#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CFAP57	149465	hgsc.bcm.edu;bcgsc.ca	37	1	43685098	43685098	+	Missense_Mutation	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr1:43685098A>G	ENST00000372492.4	+	13	2461	c.2137A>G	c.(2137-2139)Atg>Gtg	p.M713V		NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		713										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGAATTAAAAATGGAGAATGA	0.418																																					p.M713V		.											.	WDR65-91	0			c.A2137G						.																																			SO:0001583	missense	149465	exon13			TTAAAAATGGAGA																												ENST00000372492.4:c.2137A>G	1.37:g.43685098A>G	ENSP00000361570:p.Met713Val	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	85	38	NM_001195831	0	0	0	0	0	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	ENST00000372492.4	37		.	.	.	.	.	.	.	.	.	.	A	12.45	1.941117	0.34283	.	.	ENSG00000243710	ENST00000372492	T	0.30182	1.54	5.74	5.74	0.90152	.	.	.	.	.	T	0.43077	0.1231	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.09640	-1.0665	6	0.27082	T	0.32	.	16.3426	0.83092	1.0:0.0:0.0:0.0	.	.	.	.	V	713	ENSP00000361570:M713V	ENSP00000361570:M713V	M	+	1	0	WDR65	43457685	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.255000	0.89846	2.317000	0.78254	0.460000	0.39030	ATG	.		0.418	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
SPATA6	54558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	48918785	48918785	+	Missense_Mutation	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr1:48918785C>T	ENST00000371847.3	-	2	234	c.70G>A	c.(70-72)Gtg>Atg	p.V24M	SPATA6_ENST00000396199.3_De_novo_Start_InFrame|SPATA6_ENST00000371843.3_Missense_Mutation_p.V24M|SPATA6_ENST00000463938.1_5'UTR	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	24					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TCTTTAAGCACGACTCCTGGG	0.373																																					p.V24M		.											.	SPATA6-91	0			c.G70A						.						124.0	118.0	120.0					1																	48918785		2203	4300	6503	SO:0001583	missense	54558	exon2			TAAGCACGACTCC	AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.70G>A	1.37:g.48918785C>T	ENSP00000360913:p.Val24Met	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	71	30	NM_019073	0	0	0	0	0	Q5T3N7|Q8WUE6	Missense_Mutation	SNP	ENST00000371847.3	37	CCDS551.1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373114	0.24857	.	.	ENSG00000132122	ENST00000371847;ENST00000371843	T;T	0.12569	2.67;2.67	5.12	1.99	0.26369	.	0.662370	0.14247	N	0.331705	T	0.04815	0.0130	N	0.08118	0	0.80722	D	1	B;B	0.33073	0.396;0.153	B;B	0.24394	0.053;0.053	T	0.41088	-0.9528	10	0.30854	T	0.27	.	3.3052	0.06997	0.1575:0.4045:0.3416:0.0963	.	24;24	Q9NWH7-2;Q9NWH7	.;SPAT6_HUMAN	M	24	ENSP00000360913:V24M;ENSP00000360909:V24M	ENSP00000360909:V24M	V	-	1	0	SPATA6	48691372	0.208000	0.23494	1.000000	0.80357	0.990000	0.78478	-0.170000	0.09897	1.163000	0.42636	0.555000	0.69702	GTG	.		0.373	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021347.1	NM_019073	
GTF2B	2959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	89352944	89352944	+	Splice_Site	SNP	C	C	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr1:89352944C>G	ENST00000370500.5	-	2	242	c.124G>C	c.(124-126)Ggt>Cgt	p.G42R	GTF2B_ENST00000494819.1_5'UTR	NM_001514.5	NP_001505.1	Q00403	TF2B_HUMAN	general transcription factor IIB	42					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)	core promoter binding (GO:0001047)|thyroid hormone receptor binding (GO:0046966)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		AACAACTCACCTACAACCAAG	0.473																																					p.G42R		.											.	GTF2B-154	0			c.G124C						.						293.0	301.0	298.0					1																	89352944		2203	4300	6503	SO:0001630	splice_region_variant	2959	exon2			ACTCACCTACAAC	M76766	CCDS715.1	1p22-p21	2010-03-23			ENSG00000137947	ENSG00000137947		"""General transcription factors"""	4648	protein-coding gene	gene with protein product		189963				1876184, 8162052	Standard	NM_001514		Approved	TFIIB	uc001dmo.4	Q00403	OTTHUMG00000010611	ENST00000370500.5:c.124+1G>C	1.37:g.89352944C>G		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	82	39	NM_001514	0	0	0	0	0	A8K1A7|Q5JS30	Missense_Mutation	SNP	ENST00000370500.5	37	CCDS715.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002123	0.74932	.	.	ENSG00000137947	ENST00000370500;ENST00000448623	T;T	0.43294	0.95;0.95	5.67	5.67	0.87782	Zinc finger, TFIIB-type (2);	0.000000	0.85682	D	0.000000	T	0.37156	0.0993	M	0.77103	2.36	0.80722	D	1	B	0.13145	0.007	B	0.23574	0.047	T	0.24977	-1.0145	9	.	.	.	-12.0703	19.7698	0.96359	0.0:1.0:0.0:0.0	.	42	Q00403	TF2B_HUMAN	R	42;41	ENSP00000359531:G42R;ENSP00000415741:G41R	.	G	-	1	0	GTF2B	89125532	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.125000	0.77193	2.659000	0.90383	0.655000	0.94253	GGT	.		0.473	GTF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029279.1	NM_001514	Missense_Mutation
C1orf146	388649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	92707844	92707844	+	Missense_Mutation	SNP	A	A	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr1:92707844A>C	ENST00000370375.3	+	3	290	c.142A>C	c.(142-144)Att>Ctt	p.I48L	C1orf146_ENST00000370373.2_5'UTR	NM_001012425.1	NP_001012425.1	Q5VVC0	CA146_HUMAN	chromosome 1 open reading frame 146	48										breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8		all_lung(203;0.00528)|Lung NSC(277;0.0193)		all cancers(265;0.00846)|Epithelial(280;0.0952)		AAATGGATCAATTATATTTTC	0.308																																					p.I48L		.											.	C1orf146-91	0			c.A142C						.						111.0	112.0	112.0					1																	92707844		2203	4298	6501	SO:0001583	missense	388649	exon3			GGATCAATTATAT		CCDS30772.1	1p22.1	2008-02-05			ENSG00000203910	ENSG00000203910			24032	protein-coding gene	gene with protein product						15496913	Standard	NM_001012425		Approved		uc001doq.3	Q5VVC0	OTTHUMG00000010285	ENST00000370375.3:c.142A>C	1.37:g.92707844A>C	ENSP00000359401:p.Ile48Leu	Somatic	13	0		WXS	Illumina HiSeq	Phase_I	20	10	NM_001012425	0	0	0	0	0	Q5VVC4	Missense_Mutation	SNP	ENST00000370375.3	37	CCDS30772.1	.	.	.	.	.	.	.	.	.	.	A	14.39	2.520239	0.44866	.	.	ENSG00000203910	ENST00000370375;ENST00000370373	.	.	.	5.15	2.85	0.33270	.	0.254660	0.34067	N	0.004296	T	0.11750	0.0286	N	0.24115	0.695	0.28249	N	0.92534	B	0.32507	0.373	B	0.30572	0.117	T	0.07986	-1.0744	9	0.59425	D	0.04	0.0214	8.2971	0.31993	0.7519:0.0:0.2481:0.0	.	48	Q5VVC0	CA146_HUMAN	L	48;27	.	ENSP00000359399:I27L	I	+	1	0	C1orf146	92480432	0.955000	0.32602	0.999000	0.59377	0.994000	0.84299	1.221000	0.32503	0.445000	0.26639	0.533000	0.62120	ATT	.		0.308	C1orf146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028364.1	NM_001012425	
AMPD2	271	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110170816	110170816	+	Missense_Mutation	SNP	C	C	G	rs570605098		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr1:110170816C>G	ENST00000256578.3	+	10	1714	c.1354C>G	c.(1354-1356)Cgt>Ggt	p.R452G	AMPD2_ENST00000393688.3_Missense_Mutation_p.R333G|AMPD2_ENST00000528454.1_Missense_Mutation_p.R334G|AMPD2_ENST00000358729.4_Missense_Mutation_p.R377G|AMPD2_ENST00000342115.4_Missense_Mutation_p.R371G|AMPD2_ENST00000528667.1_Missense_Mutation_p.R452G|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000526301.1_3'UTR	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	452					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		GGAGCAGGGCCGTGAACAGAC	0.597																																					p.R452G													.	AMPD2-292	0			c.C1354G						.						74.0	73.0	73.0					1																	110170816		2203	4300	6503	SO:0001583	missense	271	exon10			CAGGGCCGTGAAC	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.1354C>G	1.37:g.110170816C>G	ENSP00000256578:p.Arg452Gly	Somatic	167	1		WXS	Illumina HiSeq	Phase_I	104	49	NM_004037	0	0	28	40	12	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	37	CCDS805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.57|15.57	2.873478|2.873478	0.51695|0.51695	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000369840|ENST00000342115;ENST00000528667;ENST00000256578;ENST00000358729;ENST00000528454;ENST00000393688	.|D;D;D;D;D;D	.|0.83591	.|-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	5.04|5.04	4.13|4.13	0.48395|0.48395	.|Adenosine/AMP deaminase (1);	.|0.131267	.|0.50627	.|D	.|0.000110	T|T	0.61502|0.61502	0.2352|0.2352	L|L	0.32530|0.32530	0.975|0.975	0.39338|0.39338	D|D	0.965537|0.965537	.|B;B;B;B	.|0.29253	.|0.239;0.0;0.011;0.0	.|B;B;B;B	.|0.32211	.|0.142;0.004;0.026;0.002	T|T	0.66420|0.66420	-0.5928|-0.5928	5|10	.|0.72032	.|D	.|0.01	-18.7411|-18.7411	6.0763|6.0763	0.19917|0.19917	0.2887:0.6218:0.0:0.0894|0.2887:0.6218:0.0:0.0894	.|.	.|377;333;452;371	.|Q01433-4;Q01433-3;Q01433;Q01433-2	.|.;.;AMPD2_HUMAN;.	R|G	422|371;452;452;377;334;333	.|ENSP00000345498:R371G;ENSP00000436541:R452G;ENSP00000256578:R452G;ENSP00000351573:R377G;ENSP00000437164:R334G;ENSP00000377292:R333G	.|ENSP00000256578:R452G	P|R	+|+	2|1	0|0	AMPD2|AMPD2	109972339|109972339	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.962000|0.962000	0.63368|0.63368	2.423000|2.423000	0.44705|0.44705	1.367000|1.367000	0.46095|0.46095	0.561000|0.561000	0.74099|0.74099	CCG|CGT	.		0.597	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1		
ZNF697	90874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	120165395	120165395	+	Missense_Mutation	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr1:120165395G>A	ENST00000421812.2	-	3	1690	c.1571C>T	c.(1570-1572)gCg>gTg	p.A524V		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	524					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		GCCGCAGCCCGCACACTTGTG	0.637																																					p.A524V		.											.	ZNF697-23	0			c.C1571T						.						13.0	17.0	16.0					1																	120165395		2127	4266	6393	SO:0001583	missense	90874	exon3			CAGCCCGCACACT	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1571C>T	1.37:g.120165395G>A	ENSP00000396857:p.Ala524Val	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	86	36	NM_001080470	0	0	0	2	2	Q96IT2	Missense_Mutation	SNP	ENST00000421812.2	37	CCDS44202.1	.	.	.	.	.	.	.	.	.	.	G	2.237	-0.374694	0.05034	.	.	ENSG00000143067	ENST00000421812	T	0.17691	2.26	4.99	4.07	0.47477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.216152	0.23519	N	0.047302	T	0.03915	0.0110	N	0.20574	0.59	0.09310	N	1	B	0.23128	0.08	B	0.25291	0.059	T	0.32188	-0.9916	10	0.37606	T	0.19	-8.4913	8.9809	0.35964	0.0:0.1625:0.6694:0.1681	.	524	Q5TEC3	ZN697_HUMAN	V	524	ENSP00000396857:A524V	ENSP00000396857:A524V	A	-	2	0	ZNF697	119966918	0.000000	0.05858	0.026000	0.17262	0.005000	0.04900	0.294000	0.19047	1.414000	0.47017	-0.175000	0.13238	GCG	.		0.637	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036349.3	XM_371286	
CREG1	8804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	167515417	167515417	+	Missense_Mutation	SNP	T	T	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr1:167515417T>A	ENST00000370509.4	-	3	605	c.580A>T	c.(580-582)Ata>Tta	p.I194L	CREG1_ENST00000466652.1_5'UTR	NM_003851.2	NP_003842.1	O75629	CREG1_HUMAN	cellular repressor of E1A-stimulated genes 1	194					cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|transcription factor complex (GO:0005667)	FMN binding (GO:0010181)|oxidoreductase activity (GO:0016491)|transcription corepressor activity (GO:0003714)										ATATTGGTTATATTCAACTTA	0.383																																					p.I194L		.											.	CREG1-186	0			c.A580T						.						73.0	75.0	74.0					1																	167515417		2203	4300	6503	SO:0001583	missense	8804	exon3			TGGTTATATTCAA	AF084523	CCDS1262.1	1q24	2008-02-05	2004-09-22	2004-09-22	ENSG00000143162	ENSG00000143162			2351	protein-coding gene	gene with protein product			"""cellular repressor of E1A-stimulated genes"""	CREG		9710587	Standard	NM_003851		Approved		uc001gel.3	O75629	OTTHUMG00000034682	ENST00000370509.4:c.580A>T	1.37:g.167515417T>A	ENSP00000359540:p.Ile194Leu	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	105	46	NM_003851	0	0	81	143	62	B2RDD4|Q8N9A3	Missense_Mutation	SNP	ENST00000370509.4	37	CCDS1262.1	.	.	.	.	.	.	.	.	.	.	T	33	5.194241	0.94960	.	.	ENSG00000143162	ENST00000370509	.	.	.	5.86	5.86	0.93980	FMN-binding split barrel-related (1);FMN-binding split barrel (1);	0.000000	0.85682	D	0.000000	T	0.76111	0.3942	M	0.82923	2.615	0.51012	D	0.999905	D	0.58620	0.983	D	0.68192	0.956	T	0.79102	-0.1941	8	0.52906	T	0.07	0.6411	16.2453	0.82441	0.0:0.0:0.0:1.0	.	194	O75629	CREG1_HUMAN	L	194	.	ENSP00000359540:I194L	I	-	1	0	CREG1	165782041	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	7.549000	0.82163	2.241000	0.73720	0.533000	0.62120	ATA	.		0.383	CREG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083911.1	NM_003851	
MARC1	64757	hgsc.bcm.edu	37	1	220960439	220960439	+	Silent	SNP	G	G	T	rs367900610		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr1:220960439G>T	ENST00000366910.5	+	1	339	c.153G>T	c.(151-153)ctG>ctT	p.L51L		NM_022746.3	NP_073583.3	Q5VT66	MARC1_HUMAN	mitochondrial amidoxime reducing component 1	51					detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										GCCGGCGGCTGCTGCAGCAGG	0.756																																					p.L51L		.											.	.	0			c.G153T						.	G		0,3888		0,0,1944	5.0	6.0	6.0		153	0.2	0.9	1		6	2,7704		0,2,3851	no	coding-synonymous	MOSC1	NM_022746.3		0,2,5795	TT,TG,GG		0.026,0.0,0.0173		51/338	220960439	2,11592	1944	3853	5797	SO:0001819	synonymous_variant	64757	exon1			GCGGCTGCTGCAG	AK026043	CCDS1526.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000186205	ENSG00000186205			26189	protein-coding gene	gene with protein product		614126	"""MOCO sulphurase C-terminal domain containing 1"""	MOSC1		11886751	Standard	NM_022746		Approved	FLJ22390	uc001hms.3	Q5VT66	OTTHUMG00000037353	ENST00000366910.5:c.153G>T	1.37:g.220960439G>T		Somatic	3	0		WXS	Illumina HiSeq	Phase_I	25	10	NM_022746	0	0	0	0	0	A8K447|B2D078|Q5VVS9|Q5VVT0|Q5VVT1|Q8N9P5|Q96FN8|Q9H6C7	Silent	SNP	ENST00000366910.5	37	CCDS1526.1																																																																																			.		0.756	MARC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090904.1	NM_022746	
FAM178A	55719	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	102675796	102675796	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr10:102675796C>T	ENST00000238961.4	+	2	723	c.181C>T	c.(181-183)Caa>Taa	p.Q61*	FAM178A_ENST00000370271.3_Nonsense_Mutation_p.Q61*|FAM178A_ENST00000370269.3_Nonsense_Mutation_p.Q61*	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	61						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											AGCTTCAAAACAAGGTATGTA	0.333																																					p.Q61X		.											.	.	0			c.C181T						.						145.0	150.0	148.0					10																	102675796		2203	4300	6503	SO:0001587	stop_gained	55719	exon2			TCAAAACAAGGTA	AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.181C>T	10.37:g.102675796C>T	ENSP00000238961:p.Gln61*	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	55	20	NM_001136123	0	0	0	0	0	A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Nonsense_Mutation	SNP	ENST00000238961.4	37	CCDS7500.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.510828	0.85389	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	.	.	.	5.65	5.65	0.86999	.	0.136815	0.34386	N	0.004001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-7.1251	16.8133	0.85726	0.0:1.0:0.0:0.0	.	.	.	.	X	61	.	ENSP00000238961:Q61X	Q	+	1	0	FAM178A	102665786	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	4.535000	0.60629	2.819000	0.97034	0.650000	0.86243	CAA	.		0.333	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049897.3		
TDRD1	56165	broad.mit.edu;bcgsc.ca	37	10	115964520	115964520	+	Missense_Mutation	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr10:115964520G>A	ENST00000369280.1	+	10	1625	c.1165G>A	c.(1165-1167)Ggg>Agg	p.G389R	TDRD1_ENST00000369282.1_Missense_Mutation_p.G389R|TDRD1_ENST00000422662.1_Missense_Mutation_p.G50R|TDRD1_ENST00000369281.2_Missense_Mutation_p.G389R|TDRD1_ENST00000251864.2_Missense_Mutation_p.G389R			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	389					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		CCCAGCAGAAGGGAATTGGAG	0.363																																					p.G389R													.	TDRD1-90	0			c.G1165A						.						85.0	79.0	81.0					10																	115964520		2203	4300	6503	SO:0001583	missense	56165	exon10			GCAGAAGGGAATT	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.1165G>A	10.37:g.115964520G>A	ENSP00000358286:p.Gly389Arg	Somatic	87	2		WXS	Illumina HiSeq	Phase_I	79	36	NM_198795	0	0	0	0	0	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	37		.	.	.	.	.	.	.	.	.	.	G	24.8	4.573519	0.86542	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.24538	2.8;2.76;1.85;2.15;2.81	6.17	6.17	0.99709	.	0.173121	0.50627	D	0.000112	T	0.49406	0.1555	M	0.61703	1.905	0.42236	D	0.991914	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.996;0.997;0.999;0.999;0.989	T	0.14615	-1.0466	10	0.31617	T	0.26	-10.9572	17.7962	0.88572	0.0:0.0:1.0:0.0	.	50;389;389;389;389	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	R	389;389;389;50;389	ENSP00000358288:G389R;ENSP00000251864:G389R;ENSP00000358287:G389R;ENSP00000402794:G50R;ENSP00000358286:G389R	ENSP00000251864:G389R	G	+	1	0	TDRD1	115954510	1.000000	0.71417	0.977000	0.42913	0.971000	0.66376	4.264000	0.58859	2.941000	0.99782	0.655000	0.94253	GGG	.		0.363	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
WDR11	55717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	122665493	122665493	+	Missense_Mutation	SNP	T	T	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr10:122665493T>A	ENST00000263461.6	+	27	3643	c.3397T>A	c.(3397-3399)Tct>Act	p.S1133T	WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	0					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GGTTCTCCTCTCTCTGGGCTG	0.512																																					p.S1133T		.											.	WDR11-226	0			c.T3397A						.						117.0	106.0	110.0					10																	122665493		2203	4300	6503	SO:0001583	missense	55717	exon27			CTCCTCTCTCTGG	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.3397T>A	10.37:g.122665493T>A	ENSP00000263461:p.Ser1133Thr	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	122	48	NM_018117	0	0	45	111	66	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000263461.6	37	CCDS7619.1	.	.	.	.	.	.	.	.	.	.	T	16.56	3.158729	0.57368	.	.	ENSG00000120008	ENST00000263461	D	0.91843	-2.92	5.63	4.48	0.54585	.	0.000000	0.85682	D	0.000000	D	0.94069	0.8099	L	0.58669	1.825	0.52501	D	0.999954	P;P;P;P	0.52842	0.956;0.956;0.911;0.682	D;D;P;B	0.65010	0.931;0.931;0.558;0.129	D	0.93073	0.6484	10	0.48119	T	0.1	-11.2569	11.9916	0.53178	0.1299:0.0:0.0:0.8701	.	1133;1133;424;662	Q9BZH6;B2RCJ6;Q9NWV7;Q659C9	WDR11_HUMAN;.;.;.	T	1133	ENSP00000263461:S1133T	ENSP00000263461:S1133T	S	+	1	0	WDR11	122655483	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	5.888000	0.69758	0.923000	0.37045	0.455000	0.32223	TCT	.		0.512	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050707.2		
TCIRG1	10312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	67817430	67817430	+	Splice_Site	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr11:67817430A>G	ENST00000265686.3	+	17	2123	c.2015A>G	c.(2014-2016)gAg>gGg	p.E672G	RP11-802E16.3_ENST00000534517.1_RNA|TCIRG1_ENST00000532635.1_Splice_Site_p.E456G|RP11-802E16.3_ENST00000526897.1_RNA|RP11-802E16.3_ENST00000529934.1_RNA	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	672					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						ATGCCCCAGGAGGAAAACAAG	0.637																																					p.E672G		.											.	TCIRG1-227	0			c.A2015G						.						38.0	39.0	39.0					11																	67817430		2199	4292	6491	SO:0001630	splice_region_variant	10312	exon17			CCCAGGAGGAAAA	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.2014-1A>G	11.37:g.67817430A>G		Somatic	62	0		WXS	Illumina HiSeq	Phase_I	72	38	NM_006019	0	0	0	0	0	O75877|Q8WVC5	Missense_Mutation	SNP	ENST00000265686.3	37	CCDS8177.1	.	.	.	.	.	.	.	.	.	.	A	8.644	0.896745	0.17686	.	.	ENSG00000110719	ENST00000265686;ENST00000532635;ENST00000546315	D;D	0.89123	-1.95;-2.47	4.21	1.83	0.25207	.	1.186560	0.05814	N	0.614544	T	0.78666	0.4319	N	0.17082	0.46	0.45194	D	0.998206	B	0.02656	0.0	B	0.06405	0.002	T	0.64024	-0.6504	10	0.15066	T	0.55	-4.3465	6.3839	0.21550	0.7598:0.0:0.2402:0.0	.	672	Q13488	VPP3_HUMAN	G	672;456;30	ENSP00000265686:E672G;ENSP00000434407:E456G	ENSP00000265686:E672G	E	+	2	0	TCIRG1	67574006	0.009000	0.17119	0.006000	0.13384	0.156000	0.22039	0.207000	0.17395	0.671000	0.31185	0.379000	0.24179	GAG	.		0.637	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394305.1	NM_006019	Missense_Mutation
NAALAD2	10003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	89868775	89868775	+	Missense_Mutation	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr11:89868775A>G	ENST00000534061.1	+	2	361	c.131A>G	c.(130-132)cAt>cGt	p.H44R	NAALAD2_ENST00000525171.1_Missense_Mutation_p.H44R|NAALAD2_ENST00000321955.4_Missense_Mutation_p.H44R|NAALAD2_ENST00000375944.3_Missense_Mutation_p.H44R	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	44					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GTGCGCTATCATCAAAGTATA	0.343																																					p.H44R		.											.	NAALAD2-92	0			c.A131G						.						112.0	113.0	112.0					11																	89868775		2201	4299	6500	SO:0001583	missense	10003	exon2			GCTATCATCAAAG	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.131A>G	11.37:g.89868775A>G	ENSP00000432481:p.His44Arg	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	58	10	NM_005467	0	0	0	0	0	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	A	7.614	0.675410	0.14841	.	.	ENSG00000077616	ENST00000525497;ENST00000534061;ENST00000321955;ENST00000525171;ENST00000375944	T;T;T;T;T	0.42513	0.97;1.39;1.53;1.01;2.81	5.08	-0.0308	0.13912	.	0.762404	0.12673	N	0.448598	T	0.21674	0.0522	N	0.20986	0.625	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.001;0.0;0.001;0.0	B;B;B;B;B	0.08055	0.0;0.003;0.001;0.001;0.0	T	0.18241	-1.0343	9	.	.	.	-1.591	2.7544	0.05289	0.5012:0.285:0.0769:0.1368	.	44;44;44;44;44	Q4KKV4;E9PJV2;Q9Y3Q0;E9PKX5;Q8IUX3	.;.;NALD2_HUMAN;.;.	R	44	ENSP00000431989:H44R;ENSP00000432481:H44R;ENSP00000320083:H44R;ENSP00000435249:H44R;ENSP00000365111:H44R	.	H	+	2	0	NAALAD2	89508423	0.776000	0.28616	0.094000	0.20943	0.701000	0.40568	0.409000	0.21082	-0.159000	0.11021	-0.305000	0.09177	CAT	.		0.343	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
DDX12P	440081	broad.mit.edu	37	12	9583320	9583320	+	IGR	SNP	T	T	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr12:9583320T>C								RP13-735L24.1 (33107 upstream) : SNORA75 (14333 downstream)																							CAGCATCTGATAGGGCAGCAC	0.657																																					.													.	.	0			.						.						4.0	6.0	6.0					12																	9583320		625	1478	2103	SO:0001628	intergenic_variant	440081	.			ATCTGATAGGGCA																													12.37:g.9583320T>C		Somatic	68	2		WXS	Illumina HiSeq	Phase_I	135	13	.	0	0	4	4	0		RNA	SNP		37																																																																																				.	0	0.657								
MFSD5	84975	broad.mit.edu	37	12	53647798	53647798	+	Silent	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr12:53647798C>T	ENST00000329548.4	+	2	1370	c.1179C>T	c.(1177-1179)ctC>ctT	p.L393L	MFSD5_ENST00000534842.1_Silent_p.L500L	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	393					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						GCCTAGGGCTCCTTGTCCTCC	0.542																																					p.L500L													.	MFSD5-93	0			c.C1500T						.						155.0	135.0	142.0					12																	53647798		2203	4300	6503	SO:0001819	synonymous_variant	84975	exon2			AGGGCTCCTTGTC	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.1179C>T	12.37:g.53647798C>T		Somatic	191	1		WXS	Illumina HiSeq	Phase_I	138	7	NM_001170790	0	0	83	83	0	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Silent	SNP	ENST00000329548.4	37	CCDS8851.1																																																																																			.		0.542	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889	
NT5DC3	51559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	104182695	104182695	+	Missense_Mutation	SNP	G	G	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr12:104182695G>C	ENST00000392876.3	-	10	1062	c.1022C>G	c.(1021-1023)cCt>cGt	p.P341R		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	341						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						CTTTCGGAAAGGCCTAACAAC	0.423																																					p.P341R		.											.	NT5DC3-228	0			c.C1022G						.						192.0	183.0	186.0					12																	104182695		2203	4300	6503	SO:0001583	missense	51559	exon10			CGGAAAGGCCTAA	AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1022C>G	12.37:g.104182695G>C	ENSP00000376615:p.Pro341Arg	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	106	46	NM_001031701	0	0	2	2	0	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	ENST00000392876.3	37	CCDS41824.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625073	0.87560	.	.	ENSG00000111696	ENST00000392876	T	0.26223	1.75	6.07	6.07	0.98685	HAD-like domain (1);	0.000000	0.85682	D	0.000000	T	0.59473	0.2196	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.60622	-0.7227	10	0.59425	D	0.04	-12.7708	20.6593	0.99626	0.0:0.0:1.0:0.0	.	341	Q86UY8	NT5D3_HUMAN	R	341	ENSP00000376615:P341R	ENSP00000376615:P341R	P	-	2	0	NT5DC3	102706825	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	9.515000	0.98015	2.885000	0.99019	0.655000	0.94253	CCT	.		0.423	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575	
RGCC	28984	hgsc.bcm.edu	37	13	42031876	42031876	+	Silent	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr13:42031876G>A	ENST00000379359.3	+	1	182	c.33G>A	c.(31-33)gcG>gcA	p.A11A		NM_014059.2	NP_054778.2	Q9H4X1	RGCC_HUMAN	regulator of cell cycle	11	Ala-rich.				cellular response to hypoxia (GO:0071456)|complement activation (GO:0006956)|fibroblast activation (GO:0072537)|mitotic cell cycle arrest (GO:0071850)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of exit from mitosis (GO:0001100)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mitotic cell cycle phase transition (GO:1901991)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of mitosis (GO:0045840)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stress fiber assembly (GO:0051496)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)										gcagccccgcggccgccgcgg	0.741																																					p.A11A		.											.	.	0			c.G33A						.						1.0	1.0	1.0					13																	42031876		410	1255	1665	SO:0001819	synonymous_variant	28984	exon1			CCCCGCGGCCGCC	AF036549	CCDS41880.1	13q14.11	2012-02-20	2012-02-20	2012-02-20	ENSG00000102760	ENSG00000102760			20369	protein-coding gene	gene with protein product	"""response gene to complement 32"""	610077	"""chromosome 13 open reading frame 15"""	C13orf15		17146433, 19158077, 19652095	Standard	NM_014059		Approved	bA157L14.2, RGC-32, RGC32	uc001uyi.2	Q9H4X1	OTTHUMG00000016796	ENST00000379359.3:c.33G>A	13.37:g.42031876G>A		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	25	14	NM_014059	0	0	0	0	0	Q6NZ48|Q9UL69	Silent	SNP	ENST00000379359.3	37	CCDS41880.1																																																																																			.		0.741	RGCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044684.1	NM_014059	
ERICH6B	220081	hgsc.bcm.edu	37	13	46170728	46170728	+	Missense_Mutation	SNP	T	T	C	rs142875900|rs45625342|rs375947127	byFrequency	TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr13:46170728T>C	ENST00000298738.2	-	3	577	c.413A>G	c.(412-414)gAg>gGg	p.E138G		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		138	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						CCCCAGATActcttcctcctc	0.493																																					p.E138G		.											.	FAM194B-68	0			c.A413G						.						131.0	77.0	93.0					13																	46170728		692	1566	2258	SO:0001583	missense	220081	exon3			AGATACTCTTCCT																												ENST00000298738.2:c.413A>G	13.37:g.46170728T>C	ENSP00000298738:p.Glu138Gly	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	66	5	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	T	1.421	-0.572820	0.03882	.	.	ENSG00000165837	ENST00000298738	T	0.06768	3.26	1.57	-3.01	0.05463	.	.	.	.	.	T	0.03959	0.0111	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40608	-0.9554	9	0.87932	D	0	0.9224	6.4617	0.21960	0.0:0.5129:0.0:0.4871	rs45625342	138;138	A2VDI6;Q5W0A0	.;F194B_HUMAN	G	138	ENSP00000298738:E138G	ENSP00000298738:E138G	E	-	2	0	FAM194B	45068729	0.001000	0.12720	0.000000	0.03702	0.016000	0.09150	0.940000	0.28992	-0.743000	0.04784	-1.309000	0.01313	GAG	.		0.493	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
NKX2-1	7080	hgsc.bcm.edu	37	14	36988288	36988288	+	Missense_Mutation	SNP	C	C	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr14:36988288C>A	ENST00000518149.1	-	2	880	c.275G>T	c.(274-276)gGc>gTc	p.G92V	NKX2-1_ENST00000498187.2_Missense_Mutation_p.G92V|NKX2-1_ENST00000522719.2_Missense_Mutation_p.G92V|RP11-896J10.3_ENST00000521945.1_RNA|NKX2-1_ENST00000354822.5_Missense_Mutation_p.G122V|NKX2-1-AS1_ENST00000521292.2_RNA			P43699	NKX21_HUMAN	NK2 homeobox 1	92					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|brain development (GO:0007420)|cerebral cortex cell migration (GO:0021795)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|Clara cell differentiation (GO:0060486)|developmental induction (GO:0031128)|endoderm development (GO:0007492)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|forebrain development (GO:0030900)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain neuron fate commitment (GO:0021877)|globus pallidus development (GO:0021759)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|locomotory behavior (GO:0007626)|lung development (GO:0030324)|lung saccule development (GO:0060430)|menarche (GO:0042696)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron migration (GO:0001764)|oligodendrocyte differentiation (GO:0048709)|phospholipid metabolic process (GO:0006644)|pituitary gland development (GO:0021983)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|rhythmic process (GO:0048511)|thyroid gland development (GO:0030878)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G92D(1)		large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	7	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		GCTCATGTTGCCCAGGTTGCC	0.716			A		NSCLC																																p.G122V		.		Dom	yes		14	14q13	7080	NK2 homeobox 1		E	.	NKX2-1-658	1	Substitution - Missense(1)	skin(1)	c.G365T						.						10.0	14.0	13.0					14																	36988288		2088	4220	6308	SO:0001583	missense	7080	exon2			ATGTTGCCCAGGT		CCDS9659.1, CCDS41945.1	14q13.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000136352	ENSG00000136352		"""Homeoboxes / ANTP class : NKL subclass"""	11825	protein-coding gene	gene with protein product		600635	"""benign chorea"", ""thyroid transcription factor 1"""	NKX2A, BCH, TITF1		1976511	Standard	NM_001079668		Approved	TTF-1, TTF1	uc001wtu.3	P43699	OTTHUMG00000140225	ENST00000518149.1:c.275G>T	14.37:g.36988288C>A	ENSP00000428341:p.Gly92Val	Somatic	5	1		WXS	Illumina HiSeq	Phase_I	26	13	NM_001079668	0	0	0	0	0	D3DSA3|O14954|O14955|Q7KZF6|Q9BRJ8	Missense_Mutation	SNP	ENST00000518149.1	37	CCDS9659.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.357912	0.82243	.	.	ENSG00000136352	ENST00000354822;ENST00000498187;ENST00000518149;ENST00000522719	D;D;D;D	0.91521	-2.86;-2.82;-2.82;-2.82	4.7	4.7	0.59300	.	0.056339	0.64402	D	0.000001	D	0.94843	0.8334	M	0.84683	2.71	0.80722	D	1	D;P	0.57257	0.979;0.935	P;P	0.59546	0.859;0.544	D	0.94962	0.8109	10	0.49607	T	0.09	.	16.7821	0.85565	0.0:1.0:0.0:0.0	.	122;92	P43699-3;P43699	.;NKX21_HUMAN	V	122;92;92;92	ENSP00000346879:G122V;ENSP00000429607:G92V;ENSP00000428341:G92V;ENSP00000429519:G92V	ENSP00000346879:G122V	G	-	2	0	NKX2-1	36058039	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.934000	0.75880	2.442000	0.82660	0.455000	0.32223	GGC	.		0.716	NKX2-1-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376225.2	NM_003317	
ARID4A	5926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	58796735	58796735	+	Missense_Mutation	SNP	A	A	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr14:58796735A>C	ENST00000355431.3	+	11	1127	c.754A>C	c.(754-756)Agc>Cgc	p.S252R	ARID4A_ENST00000348476.3_Missense_Mutation_p.S252R|ARID4A_ENST00000395168.3_Missense_Mutation_p.S252R|ARID4A_ENST00000431317.2_Missense_Mutation_p.S252R	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	252					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TCAGAAAGCAAGCATCTTCTT	0.388																																					p.S252R		.											.	ARID4A-231	0			c.A754C						.						97.0	104.0	101.0					14																	58796735		2203	4300	6503	SO:0001583	missense	5926	exon11			AAAGCAAGCATCT	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.754A>C	14.37:g.58796735A>C	ENSP00000347602:p.Ser252Arg	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	151	66	NM_002892	0	0	1	3	2	Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	37	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	A	17.03	3.284422	0.59867	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000445108;ENST00000431317	T;T;T;T	0.14391	2.51;2.51;2.51;2.51	6.07	4.94	0.65067	RBB1NT (1);	0.208574	0.64402	D	0.000015	T	0.24851	0.0603	L	0.57536	1.79	0.39498	D	0.96815	P;B;P	0.46277	0.875;0.139;0.702	P;B;P	0.52454	0.699;0.394;0.556	T	0.01420	-1.1359	10	0.42905	T	0.14	-12.6657	12.3445	0.55114	0.9343:0.0:0.0657:0.0	.	252;252;252	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	R	252;252;252;215;252	ENSP00000347602:S252R;ENSP00000344556:S252R;ENSP00000378597:S252R;ENSP00000397368:S252R	ENSP00000344556:S252R	S	+	1	0	ARID4A	57866488	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.593000	0.54001	1.112000	0.41740	-0.274000	0.10170	AGC	.		0.388	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
TTC8	123016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	89338717	89338717	+	Missense_Mutation	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr14:89338717C>T	ENST00000345383.5	+	12	1322	c.1238C>T	c.(1237-1239)gCt>gTt	p.A413V	TTC8_ENST00000358622.5_Missense_Mutation_p.A225V|TTC8_ENST00000346301.4_Missense_Mutation_p.A383V|TTC8_ENST00000536576.1_Missense_Mutation_p.A184V|TTC8_ENST00000338104.6_Missense_Mutation_p.A439V|TTC8_ENST00000354441.6_Missense_Mutation_p.A158V|TTC8_ENST00000380656.2_Missense_Mutation_p.A423V	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	449					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TTCAGGCTGGCTCTGGTCAAC	0.532																																					p.A423V		.											.	TTC8-90	0			c.C1268T						.						123.0	105.0	111.0					14																	89338717		2203	4300	6503	SO:0001583	missense	123016	exon13			GGCTGGCTCTGGT	AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.1238C>T	14.37:g.89338717C>T	ENSP00000339486:p.Ala413Val	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	122	58	NM_144596	0	0	19	33	14	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Missense_Mutation	SNP	ENST00000345383.5	37	CCDS9885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.2|28.2	4.900692|4.900692	0.92035|0.92035	.|.	.|.	ENSG00000165533|ENSG00000165533	ENST00000345383;ENST00000536576;ENST00000346301;ENST00000338104;ENST00000354441;ENST00000380656;ENST00000358622|ENST00000554686	T;T;T;T;T;T;T|.	0.74106|.	-0.81;-0.81;-0.81;-0.81;-0.81;-0.81;-0.81|.	5.59|5.59	5.59|5.59	0.84812|0.84812	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.101143|.	0.64402|.	D|.	0.000002|.	D|D	0.85733|0.85733	0.5765|0.5765	M|M	0.89904|0.89904	3.07|3.07	0.58432|0.58432	D|D	0.999999|0.999999	P;P;P;P;P|.	0.48089|.	0.905;0.604;0.885;0.55;0.685|.	P;B;P;B;B|.	0.47346|.	0.544;0.394;0.492;0.382;0.382|.	D|D	0.87391|0.87391	0.2363|0.2363	10|5	0.41790|.	T|.	0.15|.	-15.7808|-15.7808	19.96|19.96	0.97242|0.97242	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	158;184;449;393;423|.	Q8TAM2-2;B3KSL8;Q8TAM2;Q8TAM2-3;Q8TAM2-4|.	.;.;TTC8_HUMAN;.;.|.	V|F	413;184;383;439;158;423;225|373	ENSP00000339486:A413V;ENSP00000445067:A184V;ENSP00000298324:A383V;ENSP00000337653:A439V;ENSP00000346427:A158V;ENSP00000370031:A423V;ENSP00000351439:A225V|.	ENSP00000337653:A439V|.	A|L	+|+	2|1	0|0	TTC8|TTC8	88408470|88408470	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	5.670000|5.670000	0.68088|0.68088	2.793000|2.793000	0.96121|0.96121	0.561000|0.561000	0.74099|0.74099	GCT|CTC	.		0.532	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596	
TRPM1	4308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	31342655	31342655	+	Missense_Mutation	SNP	A	A	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr15:31342655A>T	ENST00000256552.6	-	12	1541	c.1394T>A	c.(1393-1395)gTg>gAg	p.V465E	TRPM1_ENST00000397795.2_Missense_Mutation_p.V443E|TRPM1_ENST00000542188.1_Missense_Mutation_p.V482E	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		Ttcttcctccacttcctcttt	0.542																																					p.V482E		.											.	TRPM1-94	0			c.T1445A						.						208.0	217.0	214.0					15																	31342655		2000	4152	6152	SO:0001583	missense	4308	exon11			TCCTCCACTTCCT	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.1394T>A	15.37:g.31342655A>T	ENSP00000256552:p.Val465Glu	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	100	38	NM_001252020	0	0	0	0	0		Missense_Mutation	SNP	ENST00000256552.6	37	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	A	3.172	-0.169735	0.06461	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.72051	-0.62;-0.62;-0.62	4.8	-0.746	0.11095	.	0.495264	0.20727	N	0.086800	T	0.44074	0.1276	N	0.08118	0	0.09310	N	1	B;B	0.12013	0.005;0.003	B;B	0.12156	0.007;0.003	T	0.29822	-0.9999	10	0.66056	D	0.02	-6.1648	5.5491	0.17081	0.5174:0.0:0.3552:0.1273	.	437;443	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	E	443;482;465;443	ENSP00000380897:V443E;ENSP00000437849:V482E;ENSP00000256552:V465E	ENSP00000256552:V465E	V	-	2	0	TRPM1	29129947	0.010000	0.17322	0.812000	0.32479	0.123000	0.20343	0.172000	0.16704	-0.389000	0.07786	-1.843000	0.00578	GTG	.		0.542	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
AQR	9716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	35189882	35189882	+	Silent	SNP	T	T	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr15:35189882T>G	ENST00000156471.5	-	21	2493	c.2268A>C	c.(2266-2268)ggA>ggC	p.G756G		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	756					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TCTTCCCTTTTCCACTTCTTA	0.393																																					p.G756G		.											.	AQR-135	0			c.A2268C						.						111.0	102.0	105.0					15																	35189882		1844	4108	5952	SO:0001819	synonymous_variant	9716	exon21			CCCTTTTCCACTT	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.2268A>C	15.37:g.35189882T>G		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	79	30	NM_014691	0	0	10	20	10	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Silent	SNP	ENST00000156471.5	37	CCDS42013.1																																																																																			.		0.393	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
SMAD3	4088	broad.mit.edu	37	15	67473652	67473652	+	Silent	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr15:67473652C>T	ENST00000327367.4	+	6	1042	c.732C>T	c.(730-732)gtC>gtT	p.V244V	SMAD3_ENST00000439724.3_Silent_p.V200V|SMAD3_ENST00000540846.2_Silent_p.V139V|SMAD3_ENST00000537194.2_Silent_p.V49V	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	244	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		ACCAGCGCGTCGGGGAGACAT	0.607																																					p.V244V													.	SMAD3-904	0			c.C732T						.						77.0	62.0	67.0					15																	67473652		2201	4299	6500	SO:0001819	synonymous_variant	4088	exon6			GCGCGTCGGGGAG	BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.732C>T	15.37:g.67473652C>T		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	92	3	NM_005902	0	0	20	20	0	A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Silent	SNP	ENST00000327367.4	37	CCDS10222.1																																																																																			.		0.607	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256967.2	NM_005902	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000563630.1_5'UTR|ZNF598_ENST00000562103.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	6	6	NM_178167	0	0	0	4	4	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
PKD1	5310	ucsc.edu	37	16	2168072	2168072	+	Silent	SNP	G	G	A	rs554071267		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr16:2168072G>A	ENST00000262304.4	-	5	1129	c.921C>T	c.(919-921)ttC>ttT	p.F307F	PKD1_ENST00000423118.1_Silent_p.F307F|RP11-304L19.2_ENST00000562027.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	307	PKD 1. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AGCCGTCTCCGAAGTCCCAGC	0.716													g|||	1	0.000199681	0.0	0.0	5008	,	,		14557	0.0		0.0	False		,,,				2504	0.001				p.F307F													.	PKD1-91	0			c.C921T						.						5.0	7.0	7.0					16																	2168072		2005	4072	6077	SO:0001819	synonymous_variant	5310	exon5			GTCTCCGAAGTCC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.921C>T	16.37:g.2168072G>A		Somatic	18	0		WXS	Illumina HiSeq		159	2	NM_000296	0	0	5	5	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.		0.716	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
CDH11	1009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	64981793	64981793	+	Missense_Mutation	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr16:64981793A>G	ENST00000268603.4	-	13	2719	c.2104T>C	c.(2104-2106)Tac>Cac	p.Y702H	CDH11_ENST00000394156.3_3'UTR|CDH11_ENST00000566827.1_Missense_Mutation_p.Y576H	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	702					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y702H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CTAGGCATGTACTGATACTCA	0.522			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.Y702H		.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	CDH11-852	1	Substitution - Missense(1)	large_intestine(1)	c.T2104C						.						135.0	128.0	130.0					16																	64981793		2203	4300	6503	SO:0001583	missense	1009	exon13			GCATGTACTGATA	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.2104T>C	16.37:g.64981793A>G	ENSP00000268603:p.Tyr702His	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	223	117	NM_001797	0	0	15	15	0	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	37	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.715271	0.48622	.	.	ENSG00000140937	ENST00000268603;ENST00000538390	T	0.76060	-0.99	6.17	6.17	0.99709	Cadherin, cytoplasmic domain (1);	0.054697	0.85682	D	0.000000	T	0.76054	0.3934	L	0.31926	0.97	0.80722	D	1	D	0.55800	0.973	P	0.59115	0.852	T	0.71182	-0.4668	10	0.15499	T	0.54	.	16.0034	0.80327	1.0:0.0:0.0:0.0	.	702	P55287	CAD11_HUMAN	H	702;685	ENSP00000268603:Y702H	ENSP00000268603:Y702H	Y	-	1	0	CDH11	63539294	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	TAC	.		0.522	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
RLTPR	146206	ucsc.edu;bcgsc.ca	37	16	67690142	67690142	+	Missense_Mutation	SNP	G	G	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr16:67690142G>C	ENST00000334583.6	+	34	4082	c.3754G>C	c.(3754-3756)Gac>Cac	p.D1252H	RLTPR_ENST00000545661.1_Missense_Mutation_p.D1216H	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	1252					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TGACATTATGGACAGTTCCAC	0.602																																					p.D1252H													.	RLTPR-67	0			c.G3754C						.						140.0	138.0	139.0					16																	67690142		1996	4170	6166	SO:0001583	missense	146206	exon34			ATTATGGACAGTT	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.3754G>C	16.37:g.67690142G>C	ENSP00000334958:p.Asp1252His	Somatic	255	3		WXS	Illumina HiSeq		341	162	NM_001013838	0	0	0	0	0	B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	37	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403657	0.62288	.	.	ENSG00000159753	ENST00000334583;ENST00000398282;ENST00000545661	T;T	0.34275	1.37;1.67	5.23	5.23	0.72850	.	0.000000	0.56097	D	0.000037	T	0.49695	0.1572	L	0.29908	0.895	0.43191	D	0.995023	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.51576	-0.8688	10	0.72032	D	0.01	-23.1754	16.9494	0.86240	0.0:0.0:1.0:0.0	.	1216;1252	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	H	1252;349;1216	ENSP00000334958:D1252H;ENSP00000441481:D1216H	ENSP00000334958:D1252H	D	+	1	0	RLTPR	66247643	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	5.707000	0.68370	2.596000	0.87737	0.591000	0.81541	GAC	.		0.602	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838	
LCAT	3931	broad.mit.edu	37	16	67976298	67976298	+	Missense_Mutation	SNP	C	C	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr16:67976298C>A	ENST00000264005.5	-	5	745	c.716G>T	c.(715-717)gGc>gTc	p.G239V	CTC-479C5.17_ENST00000590594.1_lincRNA	NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	239					cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		CTTGATGGAGCCACCCCAGGG	0.587																																					p.G239V													.	LCAT-44	0			c.G716T						.						51.0	56.0	55.0					16																	67976298		2198	4300	6498	SO:0001583	missense	3931	exon5			ATGGAGCCACCCC		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.716G>T	16.37:g.67976298C>A	ENSP00000264005:p.Gly239Val	Somatic	138	1		WXS	Illumina HiSeq	Phase_I	231	10	NM_000229	0	0	190	190	0	Q53XQ3	Missense_Mutation	SNP	ENST00000264005.5	37	CCDS10854.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560286	0.86335	.	.	ENSG00000213398	ENST00000264005	D	0.99667	-6.34	4.99	4.99	0.66335	.	0.137403	0.47852	U	0.000220	D	0.99694	0.9884	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97487	1.0051	10	0.87932	D	0	-12.9043	15.8074	0.78524	0.0:1.0:0.0:0.0	.	239	P04180	LCAT_HUMAN	V	239	ENSP00000264005:G239V	ENSP00000264005:G239V	G	-	2	0	LCAT	66533799	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	7.651000	0.83577	2.590000	0.87494	0.561000	0.74099	GGC	.		0.587	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3		
WDR16	146845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	9501596	9501596	+	Silent	SNP	C	C	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr17:9501596C>A	ENST00000352665.5	+	5	651	c.582C>A	c.(580-582)atC>atA	p.I194I	WDR16_ENST00000396219.3_Silent_p.I126I|WDR16_ENST00000299764.5_Silent_p.I204I	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						ATAGAAAAATCTGGCCAACTG	0.328																																					p.I194I		.											.	WDR16-71	0			c.C582A						.						92.0	98.0	96.0					17																	9501596		2203	4300	6503	SO:0001819	synonymous_variant	146845	exon5			AAAAATCTGGCCA	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.582C>A	17.37:g.9501596C>A		Somatic	31	0		WXS	Illumina HiSeq	Phase_I	54	14	NM_145054	0	0	0	0	0		Silent	SNP	ENST00000352665.5	37	CCDS11149.2																																																																																			.		0.328	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054	
TMEM99	147184	broad.mit.edu	37	17	38992526	38992526	+	IGR	SNP	T	T	G	rs144713336	byFrequency	TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr17:38992526T>G	ENST00000301665.3	+	0	2058					NM_001195386.1|NM_001195387.1|NM_145274.3	NP_001182315.1|NP_001182316.1|NP_660317.2	Q8N816	TMM99_HUMAN	transmembrane protein 99							integral component of membrane (GO:0016021)				cervix(1)|large_intestine(1)|lung(5)|skin(2)|urinary_tract(1)	10		Breast(137;0.000301)				tattggttttttgtgtgtgtg	0.423																																					.													.	TMEM99-91	0			.						.																																			SO:0001628	intergenic_variant	147184	.			GGTTTTTTGTGTG	AK097454	CCDS42319.1	17q21.2	2008-11-06			ENSG00000167920	ENSG00000167920			28305	protein-coding gene	gene with protein product						12477932	Standard	NM_001195386		Approved	MGC21518	uc021txc.1	Q8N816	OTTHUMG00000133579		17.37:g.38992526T>G		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	13	5	.	0	0	0	0	0	B4DQ34|Q96BP9	Splice_Site	SNP	ENST00000301665.3	37	CCDS42319.1																																																																																			.		0.423	TMEM99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257681.1	NM_145274	
KRTAP4-7	100132476	broad.mit.edu;ucsc.edu	37	17	39240627	39240627	+	Missense_Mutation	SNP	T	T	C	rs189343211		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr17:39240627T>C	ENST00000391417.4	+	1	169	c.169T>C	c.(169-171)Tct>Cct	p.S57P		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	57	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S57P(4)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						GTGCTGCCAGTCTGTGTGCTG	0.667																																					p.S57P													.	.	4	Substitution - Missense(4)	urinary_tract(2)|kidney(2)	c.T169C						.						18.0	28.0	25.0					17																	39240627		691	1590	2281	SO:0001583	missense	100132476	exon1			TGCCAGTCTGTGT	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.169T>C	17.37:g.39240627T>C	ENSP00000375236:p.Ser57Pro	Somatic	39	1		WXS	Illumina HiSeq	Phase_I	72	7	NM_033061	0	0	0	0	0	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	0.387	-0.925721	0.02377	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.01272	5.07	3.6	-0.386	0.12466	.	1.254490	0.05892	N	0.628448	T	0.00695	0.0023	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.43572	-0.9383	9	0.02654	T	1	.	4.4551	0.11639	0.0:0.4346:0.1731:0.3923	.	57	Q9BYR0	KRA47_HUMAN	P	57	ENSP00000375236:S57P	ENSP00000375236:S57P	S	+	1	0	KRTAP4-9;KRTAP4-7	36494153	0.000000	0.05858	0.033000	0.17914	0.157000	0.22087	-0.806000	0.04525	0.004000	0.14682	0.374000	0.22700	TCT	.		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
ACE	1636	broad.mit.edu	37	17	61566074	61566074	+	Nonsense_Mutation	SNP	C	C	T	rs397514689		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr17:61566074C>T	ENST00000290866.4	+	16	2395	c.2371C>T	c.(2371-2373)Cga>Tga	p.R791*	ACE_ENST00000428043.1_Nonsense_Mutation_p.R791*|ACE_ENST00000290863.6_Nonsense_Mutation_p.R217*|ACE_ENST00000490216.2_Nonsense_Mutation_p.R217*|ACE_ENST00000577647.1_Nonsense_Mutation_p.R217*|ACE_ENST00000421982.2_Nonsense_Mutation_p.R101*|ACE_ENST00000413513.3_Nonsense_Mutation_p.R217*	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	791	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GGAGGGCTGGCGAGACAAGGC	0.562																																					p.R791X													.	ACE-94	0			c.C2371T						.						119.0	107.0	111.0					17																	61566074		2203	4300	6503	SO:0001587	stop_gained	1636	exon16			GGCTGGCGAGACA	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.2371C>T	17.37:g.61566074C>T	ENSP00000290866:p.Arg791*	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	112	4	NM_000789	0	0	6	6	0	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Nonsense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.192639	0.58017	.	.	ENSG00000159640	ENST00000290866;ENST00000428043;ENST00000290863;ENST00000413513;ENST00000421982	.	.	.	5.93	2.45	0.29901	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-33.4471	15.4296	0.75081	0.354:0.646:0.0:0.0	.	.	.	.	X	791;791;217;217;101	.	ENSP00000290863:R217X	R	+	1	2	ACE	58919806	0.999000	0.42202	1.000000	0.80357	0.160000	0.22226	0.619000	0.24388	0.795000	0.33922	0.561000	0.74099	CGA	.		0.562	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
SAP30BP	29115	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	73702116	73702116	+	Missense_Mutation	SNP	G	G	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr17:73702116G>C	ENST00000584667.1	+	10	946	c.689G>C	c.(688-690)gGc>gCc	p.G230A	SAP30BP_ENST00000355423.3_Missense_Mutation_p.G214A	NM_013260.6	NP_037392.1			SAP30 binding protein											kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)	17	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			ACCAAAAAAGGcaccacgacc	0.567																																					p.G230A													.	SAP30BP-91	0			c.G689C						.						126.0	88.0	101.0					17																	73702116		2203	4300	6503	SO:0001583	missense	29115	exon10			AAAAAGGCACCAC	AY082382	CCDS11726.1	17q25.1	2006-01-05				ENSG00000161526			30785	protein-coding gene	gene with protein product		610218				15496587	Standard	NM_013260		Approved	HCNGP, HTRG, HTRP	uc002jpe.3	Q9UHR5		ENST00000584667.1:c.689G>C	17.37:g.73702116G>C	ENSP00000462116:p.Gly230Ala	Somatic	80	1		WXS	Illumina HiSeq	Phase_I	60	24	NM_013260	0	0	166	238	72		Missense_Mutation	SNP	ENST00000584667.1	37	CCDS11726.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180200	0.78564	.	.	ENSG00000161526	ENST00000355423;ENST00000293208	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.55816	0.1944	L	0.47716	1.5	0.80722	D	1	P;P	0.41597	0.7;0.756	B;B	0.43783	0.431;0.351	T	0.49542	-0.8929	9	0.09338	T	0.73	-24.486	19.8045	0.96525	0.0:0.0:1.0:0.0	.	214;230	Q9UHR5-2;Q9UHR5	.;S30BP_HUMAN	A	230;214	.	ENSP00000293208:G214A	G	+	2	0	SAP30BP	71213711	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.925000	0.92832	2.676000	0.91093	0.655000	0.94253	GGC	.		0.567	SAP30BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448227.1	NM_013260	
MFSD11	79157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	74738356	74738356	+	Splice_Site	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr17:74738356G>A	ENST00000588460.1	+	5	2479		c.e5+1		MFSD11_ENST00000593181.1_Intron|MFSD11_ENST00000586622.1_Splice_Site|MFSD11_ENST00000355954.3_Intron|MFSD11_ENST00000590514.1_Splice_Site|MFSD11_ENST00000336509.4_Splice_Site	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11							integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						TGCAGTCTAGGTAATTATCCT	0.403																																					.		.											.	MFSD11-91	0			c.437+1G>A						.						140.0	140.0	140.0					17																	74738356		2203	4300	6503	SO:0001630	splice_region_variant	79157	exon6			GTCTAGGTAATTA	BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.437+1G>A	17.37:g.74738356G>A		Somatic	120	0		WXS	Illumina HiSeq	Phase_I	180	10	NM_001242534	0	0	0	0	0	O43442|Q9NXI5	Splice_Site	SNP	ENST00000588460.1	37	CCDS11750.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.234688	0.79800	.	.	ENSG00000092931	ENST00000336509	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9326	0.97124	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MFSD11	72249951	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	9.471000	0.97696	2.720000	0.93068	0.650000	0.86243	.	.		0.403	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451516.1	NM_024311	Intron
TXNDC2	84203	hgsc.bcm.edu	37	18	9887074	9887074	+	Missense_Mutation	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr18:9887074G>A	ENST00000306084.6	+	2	797	c.598G>A	c.(598-600)Gaa>Aaa	p.E200K	TXNDC2_ENST00000357775.5_Missense_Mutation_p.E133K|TXNDC2_ENST00000536353.2_Intron	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	200	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						GTCCTCAGAAGAAGCCATCCA	0.577																																					p.E200K		.											.	TXNDC2-92	0			c.G598A						.						152.0	154.0	153.0					18																	9887074		2203	4300	6503	SO:0001583	missense	84203	exon2			TCAGAAGAAGCCA	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.598G>A	18.37:g.9887074G>A	ENSP00000304908:p.Glu200Lys	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	114	7	NM_001098529	0	0	0	0	0	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	.	.	.	.	.	.	.	.	.	.	g	1.272	-0.612710	0.03690	.	.	ENSG00000168454	ENST00000357775;ENST00000306084;ENST00000426718	T;T	0.16457	2.34;2.34	3.48	-6.08	0.02151	.	1.613580	0.03995	N	0.295530	T	0.05456	0.0144	N	0.02539	-0.55	0.09310	N	1	B	0.18013	0.025	B	0.11329	0.006	T	0.34204	-0.9838	9	.	.	.	-1.8327	6.0796	0.19935	0.4735:0.3503:0.1761:0.0	.	200	Q86VQ3	TXND2_HUMAN	K	133;200;200	ENSP00000350419:E133K;ENSP00000304908:E200K	.	E	+	1	0	TXNDC2	9877074	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.583000	0.00904	-0.859000	0.04105	-0.300000	0.09419	GAA	.		0.577	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
CABLES1	91768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	20768825	20768825	+	Missense_Mutation	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr18:20768825C>T	ENST00000256925.7	+	2	869	c.869C>T	c.(868-870)tCt>tTt	p.S290F	CABLES1_ENST00000400473.2_5'UTR|CABLES1_ENST00000420687.2_Missense_Mutation_p.S25F|CABLES1_ENST00000585061.1_3'UTR	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	290	Interacts with CDK3. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TCCCAGAGATCTTCCTTGGAG	0.433																																					p.S290F		.											.	CABLES1-522	0			c.C869T						.						67.0	63.0	64.0					18																	20768825		1814	4069	5883	SO:0001583	missense	91768	exon2			AGAGATCTTCCTT	BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.869C>T	18.37:g.20768825C>T	ENSP00000256925:p.Ser290Phe	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	24	7	NM_001100619	0	0	4	13	9	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	Missense_Mutation	SNP	ENST00000256925.7	37	CCDS42417.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817292	0.90790	.	.	ENSG00000134508	ENST00000256925;ENST00000420687	T;T	0.50548	0.74;0.78	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	L	0.47716	1.5	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.83275	0.989;0.996	T	0.66705	-0.5856	10	0.87932	D	0	-11.7652	19.4124	0.94679	0.0:1.0:0.0:0.0	.	25;290	Q8TDN4-2;Q8TDN4	.;CABL1_HUMAN	F	290;25	ENSP00000256925:S290F;ENSP00000413851:S25F	ENSP00000256925:S290F	S	+	2	0	CABLES1	19022823	1.000000	0.71417	0.958000	0.39756	0.852000	0.48524	7.345000	0.79337	2.595000	0.87683	0.556000	0.70494	TCT	.		0.433	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445198.2	NM_138375	
ABCA7	10347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	1041554	1041554	+	Missense_Mutation	SNP	A	A	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:1041554A>T	ENST00000263094.6	+	3	343	c.112A>T	c.(112-114)Atc>Ttc	p.I38F	AC011558.5_ENST00000585757.1_RNA|ABCA7_ENST00000433129.1_Missense_Mutation_p.I38F|ABCA7_ENST00000435683.2_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	38					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCTTCTTCATCCTGGTGGC	0.637																																					p.I38F		.											.	ABCA7-98	0			c.A112T						.						103.0	107.0	106.0					19																	1041554		2203	4300	6503	SO:0001583	missense	10347	exon3			TTCTTCATCCTGG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.112A>T	19.37:g.1041554A>T	ENSP00000263094:p.Ile38Phe	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	25	9	NM_019112	0	0	3	11	8	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.986185	0.93044	.	.	ENSG00000064687	ENST00000263094;ENST00000524850;ENST00000531467;ENST00000433129	D;D;D;D	0.99194	-5.54;-5.54;-5.54;-5.54	4.78	4.78	0.61160	.	.	.	.	.	D	0.98839	0.9608	L	0.53729	1.69	0.47905	D	0.999542	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.997	D	0.99744	1.1016	9	0.87932	D	0	.	12.2354	0.54512	1.0:0.0:0.0:0.0	.	38;38	B4DVJ5;Q8IZY2	.;ABCA7_HUMAN	F	38;38;36;38	ENSP00000263094:I38F;ENSP00000431473:I38F;ENSP00000433545:I36F;ENSP00000414062:I38F	ENSP00000263094:I38F	I	+	1	0	ABCA7	992554	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	5.979000	0.70508	1.794000	0.52575	0.460000	0.39030	ATC	.		0.637	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
ADAMTSL5	339366	hgsc.bcm.edu	37	19	1506086	1506086	+	Silent	SNP	G	G	A	rs186786015		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:1506086G>A	ENST00000413997.2	-	12	1373	c.1374C>T	c.(1372-1374)gcC>gcT	p.A458A	ADAMTSL5_ENST00000395467.2_3'UTR|ADAMTSL5_ENST00000330475.4_Silent_p.A448A|CTB-25B13.9_ENST00000590252.1_RNA|ADAMTSL5_ENST00000590562.1_5'UTR			Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	458	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.					extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCGTAGCCGGCGTGGGGCA	0.721													G|||	1	0.000199681	0.0	0.0	5008	,	,		14339	0.001		0.0	False		,,,				2504	0.0				p.A448A		.											.	ADAMTSL5-90	0			c.C1344T						.	G		0,4384		0,0,2192	12.0	15.0	14.0		1344	-0.7	0.4	19		14	4,8564		0,4,4280	no	coding-synonymous	ADAMTSL5	NM_213604.2		0,4,6472	AA,AG,GG		0.0467,0.0,0.0309		448/472	1506086	4,12948	2192	4284	6476	SO:0001819	synonymous_variant	339366	exon12			GTAGCCGGCGTGG	BC040620	CCDS12071.1	19p13.3	2008-02-05	2006-02-07	2006-02-07		ENSG00000185761			27912	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain containing 6"""	THSD6			Standard	NM_213604		Approved		uc002ltd.2	Q6ZMM2		ENST00000413997.2:c.1374C>T	19.37:g.1506086G>A		Somatic	1	0		WXS	Illumina HiSeq	Phase_I	42	20	NM_213604	1	0	17	36	18	B4DXK7|Q8IW95	Silent	SNP	ENST00000413997.2	37																																																																																				G|0.999;A|0.000		0.721	ADAMTSL5-202	KNOWN	basic	protein_coding	protein_coding		XM_294919	
EVI5L	115704	hgsc.bcm.edu	37	19	7927064	7927064	+	Silent	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:7927064C>T	ENST00000270530.4	+	15	1864	c.1668C>T	c.(1666-1668)ggC>ggT	p.G556G	EVI5L_ENST00000538904.2_Silent_p.G567G	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	556					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						TGGTCGTGGGCGAGCTGCAGG	0.731																																					p.G567G		.											.	EVI5L-91	0			c.C1701T						.						5.0	6.0	6.0					19																	7927064		2077	4154	6231	SO:0001819	synonymous_variant	115704	exon15			CGTGGGCGAGCTG	BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.1668C>T	19.37:g.7927064C>T		Somatic	4	0		WXS	Illumina HiSeq	Phase_I	15	10	NM_001159944	0	0	9	21	12	B9A6I9	Silent	SNP	ENST00000270530.4	37	CCDS12188.1																																																																																			.		0.731	EVI5L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461347.1	NM_145245	
LPHN1	22859	broad.mit.edu	37	19	14262129	14262129	+	Silent	SNP	A	A	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:14262129A>C	ENST00000340736.6	-	24	4278	c.3981T>G	c.(3979-3981)ggT>ggG	p.G1327G	CTB-55O6.12_ENST00000588658.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000361434.3_Silent_p.G1322G	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1327					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCCGGTCAGCACCCCCGGGCC	0.716																																					p.G1327G													.	LPHN1-523	0			c.T3981G						.						5.0	6.0	6.0					19																	14262129		2111	4119	6230	SO:0001819	synonymous_variant	22859	exon24			GTCAGCACCCCCG	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.3981T>G	19.37:g.14262129A>C		Somatic	13	2		WXS	Illumina HiSeq	Phase_I	40	15	NM_001008701	0	0	5	6	1	Q96IE7|Q9BU07|Q9HAR3	Silent	SNP	ENST00000340736.6	37	CCDS32928.1																																																																																			.		0.716	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
TSHZ3	57616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	31768208	31768208	+	Missense_Mutation	SNP	C	C	T	rs201694059		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:31768208C>T	ENST00000240587.4	-	2	2818	c.2491G>A	c.(2491-2493)Gta>Ata	p.V831I		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	831					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					ATGAATGATACGACGGCAGAT	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		19141	0.001		0.0	False		,,,				2504	0.0				p.V831I		.											.	TSHZ3-232	0			c.G2491A						.						143.0	130.0	135.0					19																	31768208		2203	4300	6503	SO:0001583	missense	57616	exon2			ATGATACGACGGC	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2491G>A	19.37:g.31768208C>T	ENSP00000240587:p.Val831Ile	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	199	81	NM_020856	0	0	0	0	0	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465152	0.43839	.	.	ENSG00000121297	ENST00000240587	T	0.11930	2.73	5.37	4.32	0.51571	.	0.118294	0.56097	D	0.000026	T	0.07593	0.0191	N	0.08118	0	0.48040	D	0.999571	B	0.21452	0.056	B	0.16722	0.016	T	0.33420	-0.9869	10	0.23302	T	0.38	-9.1996	14.4459	0.67349	0.0:0.9276:0.0:0.0723	.	831	Q63HK5	TSH3_HUMAN	I	831	ENSP00000240587:V831I	ENSP00000240587:V831I	V	-	1	0	TSHZ3	36460048	1.000000	0.71417	0.961000	0.40146	0.937000	0.57800	5.745000	0.68672	2.501000	0.84356	0.655000	0.94253	GTA	C|0.999;A|0.001		0.527	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
ZNF181	339318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	35231657	35231657	+	Missense_Mutation	SNP	T	T	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:35231657T>C	ENST00000492450.1	+	4	460	c.371T>C	c.(370-372)aTa>aCa	p.I124T	ZNF181_ENST00000459757.2_Missense_Mutation_p.I123T|ZNF181_ENST00000392232.3_Missense_Mutation_p.I168T			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTGGAATATATAGAGAAGTTG	0.348																																					p.I124T		.											.	ZNF181-91	0			c.T371C						.						45.0	50.0	48.0					19																	35231657		2194	4294	6488	SO:0001583	missense	339318	exon4			AATATATAGAGAA	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.371T>C	19.37:g.35231657T>C	ENSP00000420727:p.Ile124Thr	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	107	29	NM_001029997	0	0	7	8	1	B7ZKX3|Q49A75	Missense_Mutation	SNP	ENST00000492450.1	37	CCDS32990.2	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.579817	0.00129	.	.	ENSG00000197841	ENST00000392232;ENST00000425140;ENST00000492450;ENST00000459757	T;T;T	0.05717	3.4;3.49;3.46	2.89	-0.737	0.11129	.	.	.	.	.	T	0.04182	0.0116	L	0.38175	1.15	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.46119	-0.9214	9	0.23302	T	0.38	.	1.2006	0.01884	0.1774:0.117:0.3517:0.3539	.	123;124	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	T	168;123;124;123	ENSP00000376065:I168T;ENSP00000420727:I124T;ENSP00000419435:I123T	ENSP00000376065:I168T	I	+	2	0	ZNF181	39923497	0.286000	0.24305	0.000000	0.03702	0.058000	0.15608	0.956000	0.29202	-0.238000	0.09724	-0.512000	0.04463	ATA	.		0.348	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	NM_001029997	
CATSPERG	57828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	38850108	38850108	+	Splice_Site	SNP	A	A	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:38850108A>T	ENST00000409235.3	+	14	1611		c.e14-1		CATSPERG_ENST00000215069.4_Intron|CATSPERG_ENST00000410018.1_Splice_Site|AC005625.1_ENST00000590304.1_RNA	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma						cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						CTGTCCCTGCAGCTCTAACAA	0.527																																					.		.											.	CATSPERG-92	0			c.1497-2A>T						.						75.0	61.0	66.0					19																	38850108		2203	4300	6503	SO:0001630	splice_region_variant	57828	exon14			CCCTGCAGCTCTA	AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.1497-1A>T	19.37:g.38850108A>T		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	69	33	NM_021185	0	0	0	0	0	A6NEG6|Q659E1	Splice_Site	SNP	ENST00000409235.3	37	CCDS12514.2	.	.	.	.	.	.	.	.	.	.	A	14.07	2.426002	0.43020	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1118	0.53844	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CATSPERG	43541948	1.000000	0.71417	0.268000	0.24571	0.124000	0.20399	5.184000	0.65070	2.172000	0.68678	0.533000	0.62120	.	.		0.527	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330204.1	NM_021185	Intron
SUPT5H	6829	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	39966780	39966780	+	Missense_Mutation	SNP	G	G	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:39966780G>C	ENST00000599117.1	+	30	3451	c.3084G>C	c.(3082-3084)gaG>gaC	p.E1028D	SUPT5H_ENST00000359191.6_Missense_Mutation_p.E1024D|SUPT5H_ENST00000432763.2_Missense_Mutation_p.E1028D|SUPT5H_ENST00000598725.1_Missense_Mutation_p.E1028D|SUPT5H_ENST00000402194.2_Missense_Mutation_p.E1024D			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	1028					7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TTTCCAGTGAGCACCTGGAGC	0.577																																					p.E1028D		.											.	SUPT5H-94	0			c.G3084C						.						90.0	72.0	79.0					19																	39966780		2203	4300	6503	SO:0001583	missense	6829	exon28			CAGTGAGCACCTG	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.3084G>C	19.37:g.39966780G>C	ENSP00000470252:p.Glu1028Asp	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	86	10	NM_003169	0	0	292	306	14	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	37	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	G	9.397	1.076981	0.20227	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	4.42	-0.361	0.12564	.	0.102463	0.64402	D	0.000003	T	0.25901	0.0631	N	0.16201	0.385	0.51233	D	0.999916	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.03202	-1.1061	8	.	.	.	-29.1312	4.6807	0.12734	0.3392:0.0:0.5198:0.1409	.	1024;1028	O00267-2;O00267	.;SPT5H_HUMAN	D	1028;1024;1006;1028	.	.	E	+	3	2	SUPT5H	44658620	0.986000	0.35501	1.000000	0.80357	0.996000	0.88848	0.154000	0.16343	0.130000	0.18549	0.462000	0.41574	GAG	.		0.577	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
PPM1N	147699	broad.mit.edu	37	19	46002036	46002036	+	Silent	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:46002036C>T	ENST00000451287.2	+	1	306	c.306C>T	c.(304-306)ctC>ctT	p.L102L	RTN2_ENST00000344680.4_5'Flank|PPM1N_ENST00000396735.2_5'Flank|PPM1N_ENST00000401593.1_5'Flank|RTN2_ENST00000245923.4_5'Flank|RTN2_ENST00000589384.1_5'Flank|PPM1N_ENST00000396736.2_5'Flank|PPM1N_ENST00000396737.2_Intron|RTN2_ENST00000590526.1_5'Flank|PPM1N_ENST00000456399.2_Intron|PPM1N_ENST00000401705.1_Intron|PPM1N_ENST00000324688.4_Silent_p.L24L	NM_001080401.1	NP_001073870.1	Q8N819	PPM1N_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative)	102	PP2C-like.						magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)	9						TTGCCGTCCTCGACGGCCACG	0.701																																					p.L102L													.	.	0			c.C306T						.						4.0	4.0	4.0					19																	46002036		1776	3705	5481	SO:0001819	synonymous_variant	147699	exon1			CGTCCTCGACGGC	AK097444	CCDS46115.1	19q13.32	2012-04-17			ENSG00000213889	ENSG00000213889		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26845	protein-coding gene	gene with protein product							Standard	NM_001080401		Approved	FLJ40125	uc002pce.3	Q8N819	OTTHUMG00000140397	ENST00000451287.2:c.306C>T	19.37:g.46002036C>T		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	64	9	NM_001080401	0	0	0	2	2	Q6P662	Silent	SNP	ENST00000451287.2	37	CCDS46115.1																																																																																			.		0.701	PPM1N-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326517.2	NM_001080401	
CCDC9	26093	hgsc.bcm.edu	37	19	47763935	47763935	+	Missense_Mutation	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:47763935G>A	ENST00000221922.6	+	5	523	c.301G>A	c.(301-303)Ggc>Agc	p.G101S		NM_015603.2	NP_056418.1	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9	101	Gly-rich.						poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	12		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		ACAGCAGGGAGGCCGGGCCGG	0.756																																					p.G101S		.											.	CCDC9-90	0			c.G301A						.						13.0	15.0	14.0					19																	47763935		1920	4024	5944	SO:0001583	missense	26093	exon5			CAGGGAGGCCGGG	AL050284	CCDS12698.1	19q13.33	2008-02-05				ENSG00000105321			24560	protein-coding gene	gene with protein product						11230166	Standard	NM_015603		Approved	DKFZP586M1019	uc010xym.2	Q9Y3X0		ENST00000221922.6:c.301G>A	19.37:g.47763935G>A	ENSP00000221922:p.Gly101Ser	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	7	6	NM_015603	0	0	8	23	15		Missense_Mutation	SNP	ENST00000221922.6	37	CCDS12698.1	.	.	.	.	.	.	.	.	.	.	-	10.73	1.433672	0.25813	.	.	ENSG00000105321	ENST00000221922;ENST00000504556	T	0.31769	1.48	3.32	2.26	0.28386	.	0.589357	0.16586	N	0.207978	T	0.26048	0.0635	L	0.54323	1.7	0.27250	N	0.958919	P	0.40180	0.705	B	0.40864	0.342	T	0.08046	-1.0741	10	0.25751	T	0.34	-10.5089	5.4967	0.16807	0.2634:0.0:0.7366:0.0	.	101	Q9Y3X0	CCDC9_HUMAN	S	101	ENSP00000221922:G101S	ENSP00000221922:G101S	G	+	1	0	CCDC9	52455775	0.926000	0.31397	0.964000	0.40570	0.633000	0.38033	1.380000	0.34351	0.731000	0.32448	0.431000	0.28591	GGC	.		0.756	CCDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466917.1	NM_015603	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48205552	48205552	+	Silent	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr19:48205552C>T	ENST00000396720.3	+	15	4757	c.4563C>T	c.(4561-4563)ccC>ccT	p.P1521P	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1521										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CGCCCGCGCCCTCGTACCCCC	0.741																																					p.P1521P		.											.	GLTSCR1-48	0			c.C4563T						.						11.0	13.0	12.0					19																	48205552		2094	4176	6270	SO:0001819	synonymous_variant	29998	exon15			CGCGCCCTCGTAC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.4563C>T	19.37:g.48205552C>T		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	13	7	NM_015711	0	0	3	6	3	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																			.		0.741	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
CEBPZ	10153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	37455042	37455042	+	Missense_Mutation	SNP	T	T	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr2:37455042T>A	ENST00000234170.5	-	2	1439	c.1294A>T	c.(1294-1296)Aat>Tat	p.N432Y		NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	432					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				GAGCTGATATTTGAGCGGAAG	0.363																																					p.N432Y		.											.	CEBPZ-91	0			c.A1294T						.						102.0	104.0	103.0					2																	37455042		2203	4300	6503	SO:0001583	missense	10153	exon2			TGATATTTGAGCG	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.1294A>T	2.37:g.37455042T>A	ENSP00000234170:p.Asn432Tyr	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	113	37	NM_005760	0	0	35	52	17	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	37	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	T	19.75	3.885601	0.72410	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	T	0.13420	2.59	5.31	5.31	0.75309	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.46814	0.1412	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59289	-0.7482	10	0.87932	D	0	.	15.3016	0.73955	0.0:0.0:0.0:1.0	.	432	Q03701	CEBPZ_HUMAN	Y	432	ENSP00000234170:N432Y	ENSP00000234170:N432Y	N	-	1	0	CEBPZ	37308546	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.525000	0.81892	2.017000	0.59298	0.528000	0.53228	AAT	.		0.363	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
CAMKMT	79823	hgsc.bcm.edu	37	2	44589184	44589184	+	Missense_Mutation	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr2:44589184C>T	ENST00000378494.3	+	1	82	c.38C>T	c.(37-39)aCc>aTc	p.T13I	PREPL_ENST00000378520.3_5'Flank|PREPL_ENST00000409936.1_5'Flank|PREPL_ENST00000409411.1_5'Flank|PREPL_ENST00000541738.1_5'Flank|PREPL_ENST00000410081.1_5'Flank|PREPL_ENST00000540817.1_5'Flank|PREPL_ENST00000409272.1_5'Flank|CAMKMT_ENST00000407131.1_Missense_Mutation_p.T13I|PREPL_ENST00000378511.3_5'Flank|CAMKMT_ENST00000402247.1_Missense_Mutation_p.T13I|PREPL_ENST00000409957.1_5'Flank|PREPL_ENST00000260648.6_5'Flank|CAMKMT_ENST00000403853.3_Missense_Mutation_p.T13I	NM_024766.4	NP_079042.1	Q7Z624	CMKMT_HUMAN	calmodulin-lysine N-methyltransferase	13						Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	calmodulin-lysine N-methyltransferase activity (GO:0018025)			breast(2)|large_intestine(3)|lung(5)	10						ACCGGCGAGACCGCGCGAGCA	0.741																																					p.T13I		.											.	CAMKMT-90	0			c.C38T						.						4.0	7.0	6.0					2																	44589184		2073	4050	6123	SO:0001583	missense	79823	exon1			GCGAGACCGCGCG		CCDS1820.1	2p21	2011-06-22	2011-03-10	2011-03-10	ENSG00000143919	ENSG00000143919	2.1.1.60		26276	protein-coding gene	gene with protein product	"""CaM KMT"""	609559	"""chromosome 2 open reading frame 34"""	C2orf34		20975703	Standard	NM_024766		Approved	CLNMT	uc002rum.3	Q7Z624	OTTHUMG00000128761	ENST00000378494.3:c.38C>T	2.37:g.44589184C>T	ENSP00000367755:p.Thr13Ile	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	62	31	NM_024766	0	0	6	10	4	Q4ZG15|Q53SS6|Q8N6P5|Q9H5G8	Missense_Mutation	SNP	ENST00000378494.3	37	CCDS1820.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846091	0.51164	.	.	ENSG00000143919	ENST00000402247;ENST00000454848;ENST00000407131;ENST00000378494;ENST00000403853	.	.	.	4.91	4.91	0.64330	.	0.320112	0.26262	N	0.025387	T	0.41419	0.1158	L	0.40543	1.245	0.09310	N	0.999994	B;P	0.47762	0.079;0.9	B;P	0.47645	0.051;0.553	T	0.30765	-0.9967	9	0.39692	T	0.17	-0.7064	13.4872	0.61373	0.0:1.0:0.0:0.0	.	13;13	Q7Z624;Q7Z624-2	CMKMT_HUMAN;.	I	13	.	ENSP00000367755:T13I	T	+	2	0	CAMKMT	44442688	0.000000	0.05858	0.278000	0.24718	0.011000	0.07611	0.616000	0.24344	2.549000	0.85964	0.655000	0.94253	ACC	.		0.741	CAMKMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250678.2	NM_024766	
GCC2	9648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	109087879	109087879	+	Missense_Mutation	SNP	T	T	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr2:109087879T>A	ENST00000309863.6	+	6	2808	c.2094T>A	c.(2092-2094)agT>agA	p.S698R		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	698					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						ATAAACTCAGTTCAGAAAAAA	0.308																																					p.S698R		.											.	GCC2-91	0			c.T2094A						.						114.0	143.0	133.0					2																	109087879		2203	4299	6502	SO:0001583	missense	9648	exon6			ACTCAGTTCAGAA	BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.2094T>A	2.37:g.109087879T>A	ENSP00000307939:p.Ser698Arg	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	172	39	NM_181453	0	0	17	32	15	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	ENST00000309863.6	37	CCDS33268.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.987|3.987	-0.005307|-0.005307	0.07773|0.07773	.|.	.|.	ENSG00000135968|ENSG00000135968	ENST00000309863;ENST00000409896|ENST00000393318	T|.	0.32023|.	1.47|.	5.5|5.5	4.27|4.27	0.50696|0.50696	.|.	0.676432|.	0.15756|.	N|.	0.246200|.	T|T	0.34019|0.34019	0.0883|0.0883	L|L	0.41236|0.41236	1.265|1.265	0.24442|0.24442	N|N	0.994523|0.994523	B|.	0.27625|.	0.183|.	B|.	0.22386|.	0.039|.	T|T	0.18840|0.18840	-1.0324|-1.0324	10|6	0.19590|0.12103	T|T	0.45|0.63	.|.	8.3633|8.3633	0.32372|0.32372	0.1299:0.0:0.1353:0.7349|0.1299:0.0:0.1353:0.7349	.|.	698|.	Q8IWJ2|.	GCC2_HUMAN|.	R|D	698;661|443	ENSP00000307939:S698R|.	ENSP00000307939:S698R|ENSP00000376993:V443D	S|V	+|+	3|2	2|0	GCC2|GCC2	108454311|108454311	0.010000|0.010000	0.17322|0.17322	0.942000|0.942000	0.38095|0.38095	0.386000|0.386000	0.30323|0.30323	0.472000|0.472000	0.22116|0.22116	2.213000|2.213000	0.71641|0.71641	0.528000|0.528000	0.53228|0.53228	AGT|GTT	.		0.308	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	NM_014635	
ORC4	5000	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	148695764	148695764	+	Missense_Mutation	SNP	T	T	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr2:148695764T>A	ENST00000392857.5	-	13	1180	c.1073A>T	c.(1072-1074)cAa>cTa	p.Q358L	AC009480.1_ENST00000584553.1_RNA|ORC4_ENST00000488761.1_5'Flank|ORC4_ENST00000535373.1_Missense_Mutation_p.Q358L|ORC4_ENST00000264169.2_Missense_Mutation_p.Q358L|ORC4_ENST00000536575.1_Missense_Mutation_p.Q274L|ORC4_ENST00000392858.1_Missense_Mutation_p.Q358L|ORC4_ENST00000540442.1_Missense_Mutation_p.Q284L|ORC4_ENST00000542387.1_Missense_Mutation_p.Q141L	NM_001190879.2|NM_001190882.2|NM_002552.4|NM_181741.3	NP_001177808.1|NP_001177811.1|NP_002543.2|NP_859525.1	O43929	ORC4_HUMAN	origin recognition complex, subunit 4	358					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	14						TGCTTTCCTTTGAACAAACTT	0.328																																					p.Q358L		.											.	ORC4-207	0			c.A1073T						.						50.0	52.0	51.0					2																	148695764		2201	4299	6500	SO:0001583	missense	5000	exon13			TTCCTTTGAACAA	AF022108	CCDS2187.1, CCDS54404.1, CCDS54405.1	2q22-q23	2010-10-12	2010-10-12	2010-10-12	ENSG00000115947	ENSG00000115947		"""ATPases / AAA-type"""	8490	protein-coding gene	gene with protein product		603056	"""origin recognition complex, subunit 4 (yeast homolog)-like"", ""origin recognition complex, subunit 4-like (yeast)"", ""origin recognition complex, subunit 4-like (S. cerevisiae)"", ""origin recognition complex, subunit 4 homolog (S. cerevisiae)"""	ORC4L		9353276, 9691185	Standard	NM_181742		Approved	HsORC4, Orc4p	uc002twk.3	O43929	OTTHUMG00000131849	ENST00000392857.5:c.1073A>T	2.37:g.148695764T>A	ENSP00000376597:p.Gln358Leu	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	156	8	NM_002552	0	0	52	58	6	B7Z3D0|B7Z5F1|D3DP86|F5H069|Q96C42	Missense_Mutation	SNP	ENST00000392857.5	37	CCDS2187.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.162605	0.57368	.	.	ENSG00000115947	ENST00000264169;ENST00000535373;ENST00000392858;ENST00000540442;ENST00000536575;ENST00000392857;ENST00000542387	T;T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.76478	0.3993	M	0.66939	2.045	0.80722	D	1	B	0.32573	0.376	B	0.30943	0.122	T	0.75445	-0.3315	10	0.41790	T	0.15	-17.6101	16.4116	0.83717	0.0:0.0:0.0:1.0	.	358	O43929	ORC4_HUMAN	L	358;358;358;284;274;358;141	ENSP00000264169:Q358L;ENSP00000441953:Q358L;ENSP00000376598:Q358L;ENSP00000438326:Q284L;ENSP00000441502:Q274L;ENSP00000376597:Q358L;ENSP00000437440:Q141L	ENSP00000264169:Q358L	Q	-	2	0	ORC4	148412234	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.684000	0.84104	2.276000	0.75962	0.528000	0.53228	CAA	.		0.328	ORC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254797.3	NM_181742	
PKP4	8502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	159459582	159459582	+	Splice_Site	SNP	C	C	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr2:159459582C>A	ENST00000389759.3	+	4	358	c.246C>A	c.(244-246)agC>agA	p.S82R	PKP4_ENST00000389757.3_Splice_Site_p.S82R	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	82					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						TTTTCTTTAGCTCAACTGAGA	0.259										HNSCC(62;0.18)																											p.S82R		.											.	PKP4-97	0			c.C246A						.						39.0	47.0	45.0					2																	159459582		2180	4267	6447	SO:0001630	splice_region_variant	8502	exon4			CTTTAGCTCAACT	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.246-1C>A	2.37:g.159459582C>A		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	104	23	NM_001005476	0	0	0	0	0	Q86W91	Missense_Mutation	SNP	ENST00000389759.3	37	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754453	0.49362	.	.	ENSG00000144283	ENST00000389757;ENST00000389759	T;T	0.79653	-1.28;-1.29	5.48	5.48	0.80851	.	0.095284	0.64402	D	0.000001	T	0.75258	0.3825	L	0.59436	1.845	0.80722	D	1	B;P	0.42456	0.339;0.78	B;B	0.34779	0.189;0.18	T	0.76046	-0.3102	9	.	.	.	.	15.2074	0.73190	0.0:1.0:0.0:0.0	.	82;82	Q99569-2;Q99569	.;PKP4_HUMAN	R	82	ENSP00000374407:S82R;ENSP00000374409:S82R	.	S	+	3	2	PKP4	159167828	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	2.706000	0.47135	2.745000	0.94114	0.484000	0.47621	AGC	.		0.259	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		Missense_Mutation
GPR155	151556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	175331330	175331330	+	Missense_Mutation	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr2:175331330A>G	ENST00000392552.2	-	6	1446	c.1208T>C	c.(1207-1209)tTg>tCg	p.L403S	GPR155_ENST00000295500.4_Missense_Mutation_p.L403S|GPR155_ENST00000392551.2_Missense_Mutation_p.L403S	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	403					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						TTTCTTACTCAAAAGAAGAAT	0.274																																					p.L403S		.											.	GPR155-91	0			c.T1208C						.						78.0	87.0	84.0					2																	175331330		2202	4287	6489	SO:0001583	missense	151556	exon7			TTACTCAAAAGAA	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.1208T>C	2.37:g.175331330A>G	ENSP00000376335:p.Leu403Ser	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	150	47	NM_001033045	0	0	4	5	1	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	ENST00000392552.2	37	CCDS2259.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.485820	0.84854	.	.	ENSG00000163328	ENST00000392552;ENST00000392551;ENST00000295500	T;T;T	0.52983	0.64;0.64;0.64	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.67496	0.2899	M	0.71581	2.175	0.58432	D	0.999998	D	0.89917	1.0	D	0.78314	0.991	T	0.66881	-0.5811	10	0.38643	T	0.18	-8.6419	16.0125	0.80411	1.0:0.0:0.0:0.0	.	403	Q7Z3F1	GP155_HUMAN	S	403	ENSP00000376335:L403S;ENSP00000376334:L403S;ENSP00000295500:L403S	ENSP00000295500:L403S	L	-	2	0	GPR155	175039576	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.737000	0.91562	2.178000	0.69098	0.528000	0.53228	TTG	.		0.274	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529	
NBEAL1	65065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	203972839	203972839	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr2:203972839G>A	ENST00000449802.1	+	13	2123	c.1790G>A	c.(1789-1791)tGg>tAg	p.W597*		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	597										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TTCAGTGCTTGGTTTTGCTTA	0.408																																					p.W597X		.											.	NBEAL1-92	0			c.G1790A						.						60.0	50.0	53.0					2																	203972839		692	1591	2283	SO:0001587	stop_gained	65065	exon13			GTGCTTGGTTTTG	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.1790G>A	2.37:g.203972839G>A	ENSP00000399903:p.Trp597*	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	121	71	NM_001114132	0	0	0	1	1	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Nonsense_Mutation	SNP	ENST00000449802.1	37	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	41	8.993174	0.99029	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.1076	0.93303	0.0:0.0:1.0:0.0	.	.	.	.	X	597	.	ENSP00000344985:W597X	W	+	2	0	NBEAL1	203681084	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.500000	0.84329	0.557000	0.71058	TGG	.		0.408	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
CATIP	375307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219222408	219222408	+	Silent	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr2:219222408C>T	ENST00000289388.3	+	3	299	c.270C>T	c.(268-270)gcC>gcT	p.A90A	AC021016.8_ENST00000411433.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		90					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCGTGCATGCCTCTAGCCGAG	0.567																																					p.A90A		.											.	C2orf62-68	0			c.C270T						.						75.0	72.0	73.0					2																	219222408		2203	4300	6503	SO:0001819	synonymous_variant	375307	exon3			GCATGCCTCTAGC																												ENST00000289388.3:c.270C>T	2.37:g.219222408C>T		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	73	37	NM_198559	0	0	11	45	34		Silent	SNP	ENST00000289388.3	37	CCDS2414.1																																																																																			.		0.567	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
OLIG1	116448	hgsc.bcm.edu	37	21	34442850	34442850	+	Missense_Mutation	SNP	G	G	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr21:34442850G>C	ENST00000382348.1	+	1	401	c.298G>C	c.(298-300)Gag>Cag	p.E100Q	AP000282.2_ENST00000454622.1_RNA|OLIG1_ENST00000333063.5_Missense_Mutation_p.E84Q|AP000282.2_ENST00000420356.1_RNA	NM_138983.2	NP_620450.2	Q8TAK6	OLIG1_HUMAN	oligodendrocyte transcription factor 1	100					neuron fate commitment (GO:0048663)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)	1						ggACGCCAAGGAGGAGCAGCA	0.746																																					p.E100Q		.											.	OLIG1-446	0			c.G298C						.						4.0	5.0	5.0					21																	34442850		1905	3895	5800	SO:0001583	missense	116448	exon1			GCCAAGGAGGAGC	AP000109	CCDS42920.1, CCDS42920.2	21q22.11	2013-05-21			ENSG00000184221	ENSG00000184221		"""Basic helix-loop-helix proteins"""	16983	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 1"", ""oligodendrocyte lineage transcription factor 1"", ""basic domain, helix-loop-helix protein, class B, 6"""	606385				11526205	Standard	NM_138983		Approved	BHLHB6, bHLHe21	uc002yqz.3	Q8TAK6	OTTHUMG00000065064	ENST00000382348.1:c.298G>C	21.37:g.34442850G>C	ENSP00000371785:p.Glu100Gln	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	22	13	NM_138983	0	0	0	0	0	Q7RTS0	Missense_Mutation	SNP	ENST00000382348.1	37	CCDS42920.2	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691676	0.48097	.	.	ENSG00000184221	ENST00000382348;ENST00000333063	D;D	0.98585	-5.01;-2.75	4.35	3.45	0.39498	.	0.466103	0.16859	U	0.196606	D	0.93802	0.8018	N	0.14661	0.345	0.29416	N	0.860923	P	0.38978	0.652	B	0.39027	0.288	D	0.90917	0.4780	10	0.33940	T	0.23	-11.8771	8.2305	0.31595	0.0932:0.1572:0.7496:0.0	.	100	Q8TAK6	OLIG1_HUMAN	Q	100;84	ENSP00000371785:E100Q;ENSP00000331066:E84Q	ENSP00000331066:E84Q	E	+	1	0	OLIG1	33364720	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	3.498000	0.53302	1.996000	0.58369	0.479000	0.44913	GAG	.		0.746	OLIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139730.1	NM_138983	
KRTAP10-1	386677	hgsc.bcm.edu	37	21	45959197	45959197	+	Silent	SNP	G	G	A	rs200623181	byFrequency	TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr21:45959197G>A	ENST00000400375.1	-	1	881	c.837C>T	c.(835-837)cgC>cgT	p.R279R	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198691.2	NP_941964.2	P60331	KR101_HUMAN	keratin associated protein 10-1	279						keratin filament (GO:0045095)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(3)|prostate(4)|skin(1)	11						AGCAGGCCGGGCGGGAGCACG	0.716													G|||	12	0.00239617	0.0045	0.0014	5008	,	,		14843	0.001		0.003	False		,,,				2504	0.001				p.R279R		.											.	KRTAP10-1-91	0			c.C837T						.	G	,	19,4277		0,19,2129	16.0	21.0	19.0		,837	-2.5	0.0	21		19	3,8445		0,3,4221	no	intron,coding-synonymous	TSPEAR,KRTAP10-1	NM_144991.2,NM_198691.2	,	0,22,6350	AA,AG,GG		0.0355,0.4423,0.1726	,	,279/283	45959197	22,12722	2148	4224	6372	SO:0001819	synonymous_variant	386677	exon1			GGCCGGGCGGGAG	AJ566380	CCDS42954.1	21q22.3	2007-10-05			ENSG00000215455	ENSG00000215455		"""Keratin associated proteins"""	22966	protein-coding gene	gene with protein product				KRTAP18-1			Standard	NM_198691		Approved	KAP10.1, KAP18.1	uc002zfh.1	P60331	OTTHUMG00000057627	ENST00000400375.1:c.837C>T	21.37:g.45959197G>A		Somatic	1	0		WXS	Illumina HiSeq	Phase_I	45	25	NM_198691	0	0	0	0	0	Q0VAR0|Q0VAR1	Silent	SNP	ENST00000400375.1	37	CCDS42954.1																																																																																			G|0.997;A|0.003		0.716	KRTAP10-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128030.1		
KRTAP10-3	386682	hgsc.bcm.edu;broad.mit.edu	37	21	45978023	45978023	+	Silent	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr21:45978023G>A	ENST00000391620.1	-	1	620	c.576C>T	c.(574-576)gcC>gcT	p.A192A	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198696.2	NP_941969.2	P60369	KR103_HUMAN	keratin associated protein 10-3	192	18 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				kidney(1)|lung(4)|prostate(1)|skin(1)	7						ACACGCAGGAGGCCGGGCGGC	0.721																																					p.A192A		.											.	KRTAP10-3-91	0			c.C576T						.						32.0	39.0	36.0					21																	45978023		2200	4298	6498	SO:0001819	synonymous_variant	386682	exon1			GCAGGAGGCCGGG	AJ566383	CCDS42956.1	21q22.3	2007-10-05			ENSG00000212935	ENSG00000212935		"""Keratin associated proteins"""	22968	protein-coding gene	gene with protein product				KRTAP18-3			Standard	NM_198696		Approved	KAP10.3, KAP18.3	uc002zfj.1	P60369	OTTHUMG00000057628	ENST00000391620.1:c.576C>T	21.37:g.45978023G>A		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	165	9	NM_198696	0	0	0	0	0	A3KN67|Q70LJ4	Silent	SNP	ENST00000391620.1	37	CCDS42956.1																																																																																			.		0.721	KRTAP10-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128031.1		
EIF3L	51386	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	38273745	38273745	+	Missense_Mutation	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr22:38273745G>A	ENST00000412331.2	+	11	1724	c.1142G>A	c.(1141-1143)cGt>cAt	p.R381H	EIF3L_ENST00000406934.1_Missense_Mutation_p.R283H|EIF3L_ENST00000381683.6_Missense_Mutation_p.R333H	NM_016091.3	NP_057175.1			eukaryotic translation initiation factor 3, subunit L											kidney(2)|large_intestine(3)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TACCCCATGCGTATTGATGAG	0.507																																					p.R381H		.											.	EIF3L-69	0			c.G1142A						.						109.0	91.0	97.0					22																	38273745		2203	4300	6503	SO:0001583	missense	51386	exon11			CCATGCGTATTGA	AF083243	CCDS13960.1, CCDS56230.1	22q	2012-12-20	2009-01-07	2009-01-07	ENSG00000100129	ENSG00000100129			18138	protein-coding gene	gene with protein product			"""eukaryotic translation initiation factor 3, subunit 6 interacting protein"", ""eukaryotic translation initiation factor 3, subunit E interacting protein"""	EIF3S6IP, EIF3EIP		11042152, 11590142	Standard	NM_016091		Approved	HSPC021, HSPC025, EIF3S11	uc003auf.3	Q9Y262	OTTHUMG00000150671	ENST00000412331.2:c.1142G>A	22.37:g.38273745G>A	ENSP00000416892:p.Arg381His	Somatic	260	1		WXS	Illumina HiSeq	Phase_I	198	77	NM_016091	0	0	1	1	0		Missense_Mutation	SNP	ENST00000412331.2	37	CCDS13960.1	.	.	.	.	.	.	.	.	.	.	g	17.83	3.484330	0.63962	.	.	ENSG00000100129	ENST00000412331;ENST00000425539;ENST00000381683;ENST00000262832;ENST00000406934	T;T;T	0.47177	0.85;0.85;0.85	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.50205	0.1602	M	0.64170	1.965	0.80722	D	1	B;B;B;B	0.33755	0.424;0.205;0.241;0.391	B;B;B;B	0.34779	0.185;0.086;0.067;0.189	T	0.54912	-0.8222	10	0.52906	T	0.07	-11.4514	18.5732	0.91144	0.0:0.0:1.0:0.0	.	333;283;381;424	B4DYB2;B0QY90;Q9Y262;B0QY89	.;.;EIF3L_HUMAN;.	H	381;424;333;348;283	ENSP00000416892:R381H;ENSP00000371099:R333H;ENSP00000384634:R283H	ENSP00000262832:R348H	R	+	2	0	EIF3L	36603691	1.000000	0.71417	0.983000	0.44433	0.982000	0.71751	9.824000	0.99380	2.436000	0.82500	0.436000	0.28706	CGT	.		0.507	EIF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319551.2	NM_016091	
ENTHD1	150350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	40283710	40283710	+	Missense_Mutation	SNP	A	A	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr22:40283710A>C	ENST00000325157.6	-	2	293	c.43T>G	c.(43-45)Tca>Gca	p.S15A		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	15	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.									breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					TCAGCATCTGAGTAATTTTTC	0.388																																					p.S15A		.											.	ENTHD1-93	0			c.T43G						.						79.0	77.0	78.0					22																	40283710		2203	4300	6503	SO:0001583	missense	150350	exon2			CATCTGAGTAATT	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.43T>G	22.37:g.40283710A>C	ENSP00000317431:p.Ser15Ala	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	22	8	NM_152512	0	0	0	0	0	B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	ENST00000325157.6	37	CCDS13998.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.238534	0.79800	.	.	ENSG00000176177	ENST00000325157	T	0.51574	0.7	5.72	5.72	0.89469	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.000000	0.56097	D	0.000026	T	0.74336	0.3703	M	0.89968	3.075	0.46336	D	0.998993	P	0.45348	0.856	D	0.64687	0.928	T	0.79598	-0.1737	10	0.87932	D	0	-12.6774	15.6751	0.77311	1.0:0.0:0.0:0.0	.	15	Q8IYW4	ENTD1_HUMAN	A	15	ENSP00000317431:S15A	ENSP00000317431:S15A	S	-	1	0	ENTHD1	38613656	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.127000	0.64727	2.183000	0.69458	0.533000	0.62120	TCA	.		0.388	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512	
CENPM	79019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	42339699	42339699	+	Missense_Mutation	SNP	C	C	T	rs138744954		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr22:42339699C>T	ENST00000215980.5	-	5	404	c.317G>A	c.(316-318)cGg>cAg	p.R106Q	CENPM_ENST00000404067.1_Intron|CENPM_ENST00000407253.3_Intron|CENPM_ENST00000402338.1_Missense_Mutation_p.R72Q|CENPM_ENST00000402420.1_Silent_p.A100A	NM_024053.3	NP_076958.1	Q9NSP4	CENPM_HUMAN	centromere protein M	106					mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|prostate(1)	3						GTGGCTCTCCCGCCCAGCTGG	0.572																																					p.R106Q		.											.	CENPM-90	0			c.G317A						.	C	,GLN/ARG	0,4406		0,0,2203	78.0	59.0	65.0		,317	-4.7	1.0	22	dbSNP_134	65	2,8598	2.2+/-6.3	0,2,4298	yes	intron,missense	CENPM	NM_001002876.1,NM_024053.3	,43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,benign	,106/181	42339699	2,13004	2203	4300	6503	SO:0001583	missense	79019	exon5			CTCTCCCGCCCAG	BC000705	CCDS14025.1, CCDS46719.1, CCDS46720.1	22q13.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000100162	ENSG00000100162			18352	protein-coding gene	gene with protein product		610152	"""chromosome 22 open reading frame 18"""	C22orf18		16622420, 16622419	Standard	NM_001110215		Approved	Pane1, CENP-M, MGC861	uc003bbn.3	Q9NSP4	OTTHUMG00000151277	ENST00000215980.5:c.317G>A	22.37:g.42339699C>T	ENSP00000215980:p.Arg106Gln	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	94	37	NM_024053	0	0	0	0	0	A7LM22|B1AHQ9|Q6I9W3	Missense_Mutation	SNP	ENST00000215980.5	37	CCDS14025.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106900	0.37145	0.0	2.33E-4	ENSG00000100162	ENST00000215980;ENST00000402338	.	.	.	5.25	-4.72	0.03269	.	0.976709	0.08428	N	0.947321	T	0.26448	0.0646	N	0.16656	0.425	0.29767	N	0.83507	B	0.15930	0.015	B	0.10450	0.005	T	0.41070	-0.9529	9	0.11182	T	0.66	-34.5962	11.9913	0.53176	0.0:0.4651:0.0:0.5349	.	106	Q9NSP4	CENPM_HUMAN	Q	106;72	.	ENSP00000215980:R106Q	R	-	2	0	CENPM	40669645	0.002000	0.14202	0.956000	0.39512	0.972000	0.66771	-0.717000	0.04986	-0.651000	0.05415	-0.218000	0.12543	CGG	C|1.000;T|0.000		0.572	CENPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322058.1	NM_024053	
MCAT	27349	hgsc.bcm.edu	37	22	43539309	43539309	+	Missense_Mutation	SNP	C	C	A	rs200527554	byFrequency	TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr22:43539309C>A	ENST00000290429.6	-	1	91	c.46G>T	c.(46-48)Gcc>Tcc	p.A16S	MCAT_ENST00000464244.1_5'Flank|MCAT_ENST00000327555.5_Missense_Mutation_p.A16S	NM_173467.4	NP_775738.3	Q8IVS2	FABD_HUMAN	malonyl CoA:ACP acyltransferase (mitochondrial)	16					fatty acid biosynthetic process (GO:0006633)|metabolic process (GO:0008152)	mitochondrion (GO:0005739)	[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			breast(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	11		Ovarian(80;0.0694)				CGGTAGCTGGCGCCCAAGCCC	0.761													C|||	44	0.00878594	0.0008	0.0014	5008	,	,		12066	0.001		0.0	False		,,,				2504	0.0419				p.A16S		.											.	MCAT-91	0			c.G46T						.	C	SER/ALA,SER/ALA	2,2788		0,2,1393	2.0	3.0	3.0		46,46	0.4	0.0	22		3	12,6196		0,12,3092	no	missense,missense	MCAT	NM_014507.3,NM_173467.4	99,99	0,14,4485	AA,AC,CC		0.1933,0.0717,0.1556	benign,benign	16/181,16/391	43539309	14,8984	1395	3104	4499	SO:0001583	missense	27349	exon1			AGCTGGCGCCCAA	AL359401	CCDS14045.1, CCDS33660.1	22q13.2	2010-04-27			ENSG00000100294	ENSG00000100294	2.3.1.39		29622	protein-coding gene	gene with protein product		614479				12882974	Standard	NM_173467		Approved	MT, MCT, fabD, FASN2C, NET62	uc003bdl.1	Q8IVS2	OTTHUMG00000150704	ENST00000290429.6:c.46G>T	22.37:g.43539309C>A	ENSP00000290429:p.Ala16Ser	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	6	6	NM_014507	0	0	2	9	7	B0QY72|O95510|O95511	Missense_Mutation	SNP	ENST00000290429.6	37	CCDS33660.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005171	0.35415	7.17E-4	0.001933	ENSG00000100294	ENST00000327555;ENST00000290429	T	0.44482	0.92	5.13	0.374	0.16183	.	1.107710	0.06871	N	0.800769	T	0.19208	0.0461	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.11329	0.006;0.006	T	0.24977	-1.0145	10	0.09590	T	0.72	-2.6285	4.8423	0.13496	0.1466:0.5099:0.2666:0.0768	.	16;16	B0QY72;Q8IVS2	.;FABD_HUMAN	S	16	ENSP00000290429:A16S	ENSP00000290429:A16S	A	-	1	0	MCAT	41869253	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.231000	0.09069	-0.090000	0.12462	-0.463000	0.05309	GCC	.		0.761	MCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319677.2	NM_173467	
LAMB2	3913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49161312	49161312	+	Missense_Mutation	SNP	G	G	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr3:49161312G>C	ENST00000418109.1	-	25	3810	c.3646C>G	c.(3646-3648)Cag>Gag	p.Q1216E	USP19_ENST00000398888.2_5'Flank|USP19_ENST00000453664.1_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.Q1216E|USP19_ENST00000398892.3_5'Flank|LAMB2_ENST00000464891.1_5'Flank|USP19_ENST00000488993.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1216	Domain II.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGCAACTCCTGCGCCCGCTGC	0.612																																					p.Q1216E		.											.	LAMB2-93	0			c.C3646G						.						42.0	43.0	42.0					3																	49161312		2203	4300	6503	SO:0001583	missense	3913	exon24			ACTCCTGCGCCCG		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.3646C>G	3.37:g.49161312G>C	ENSP00000388325:p.Gln1216Glu	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	84	57	NM_002292	0	0	102	300	198	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	G	0.910	-0.719263	0.03182	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.34072	1.38;1.38	5.84	2.97	0.34412	.	0.513188	0.21549	N	0.072764	T	0.27933	0.0688	L	0.44542	1.39	0.21675	N	0.999593	B	0.17465	0.022	B	0.14023	0.01	T	0.26087	-1.0113	10	0.07175	T	0.84	.	14.3514	0.66705	0.0:0.0:0.4875:0.5125	.	1216	P55268	LAMB2_HUMAN	E	1216	ENSP00000388325:Q1216E;ENSP00000307156:Q1216E	ENSP00000307156:Q1216E	Q	-	1	0	LAMB2	49136316	0.007000	0.16637	0.323000	0.25347	0.532000	0.34746	0.332000	0.19751	0.326000	0.23384	0.561000	0.74099	CAG	.		0.612	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
CRYBG3	131544	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	97595925	97595925	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr3:97595925A>T	ENST00000182096.4	+	1	107	c.43A>T	c.(43-45)Aaa>Taa	p.K15*		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	1963							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						AAGACTAGACAAAAGAATGTC	0.393																																					p.K1963X													.	CRYBG3-68	0			c.A5887T						.						61.0	57.0	58.0					3																	97595925		1837	4091	5928	SO:0001587	stop_gained	131544	exon4			CTAGACAAAAGAA			3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.43A>T	3.37:g.97595925A>T	ENSP00000182096:p.Lys15*	Somatic	219	2		WXS	Illumina HiSeq	Phase_I	272	154	NM_153605	0	0	0	0	0	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Nonsense_Mutation	SNP	ENST00000182096.4	37		.	.	.	.	.	.	.	.	.	.	A	20.8	4.042531	0.75732	.	.	ENSG00000080200	ENST00000182096	.	.	.	5.6	1.79	0.24919	.	4.944570	0.00465	N	0.000108	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.082	0.25237	0.6464:0.2818:0.0718:0.0	.	.	.	.	X	15	.	ENSP00000182096:K15X	K	+	1	0	CRYBG3	99078615	0.001000	0.12720	0.000000	0.03702	0.022000	0.10575	0.754000	0.26390	0.074000	0.16767	-0.321000	0.08615	AAA	.		0.393	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605	
PARP15	165631	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	122354765	122354765	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr3:122354765C>T	ENST00000464300.2	+	12	1921	c.1855C>T	c.(1855-1857)Cga>Tga	p.R619*	PARP15_ENST00000493645.1_Nonsense_Mutation_p.R316*|PARP15_ENST00000465304.1_3'UTR|PARP15_ENST00000310366.4_Nonsense_Mutation_p.R385*|PARP15_ENST00000483793.1_Nonsense_Mutation_p.R424*	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	619	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		GTACGTTGTGCGAGTACTTAC	0.478																																					p.R619X													.	PARP15-524	0			c.C1855T						.						165.0	138.0	147.0					3																	122354765		2203	4300	6503	SO:0001587	stop_gained	165631	exon12			GTTGTGCGAGTAC	AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.1855C>T	3.37:g.122354765C>T	ENSP00000417214:p.Arg619*	Somatic	135	1		WXS	Illumina HiSeq	Phase_I	176	53	NM_001113523	0	0	4	4	0	J3KR47|Q8N1K3	Nonsense_Mutation	SNP	ENST00000464300.2	37	CCDS46893.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656138	0.47467	.	.	ENSG00000173200	ENST00000464300;ENST00000483793;ENST00000542823;ENST00000310366;ENST00000493645	.	.	.	3.99	3.11	0.35812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2151	0.43164	0.0:0.9003:0.0:0.0996	.	.	.	.	X	619;424;366;385;316	.	ENSP00000308436:R385X	R	+	1	2	PARP15	123837455	0.787000	0.28750	0.005000	0.12908	0.204000	0.24138	1.301000	0.33447	0.892000	0.36259	0.650000	0.86243	CGA	.		0.478	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355964.2	NM_152615	
EHHADH	1962	ucsc.edu	37	3	184935956	184935956	+	Missense_Mutation	SNP	T	T	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr3:184935956T>A	ENST00000231887.3	-	5	611	c.536A>T	c.(535-537)gAa>gTa	p.E179V	EHHADH_ENST00000456310.1_Missense_Mutation_p.E83V|EHHADH_ENST00000475987.1_5'Flank	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	179	Enoyl-CoA hydratase / isomerase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			GATTGCTTCTTCAACCGGGTC	0.338																																					p.E179V													.	EHHADH-93	0			c.A536T						.						155.0	155.0	155.0					3																	184935956		2203	4300	6503	SO:0001583	missense	1962	exon5			GCTTCTTCAACCG	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.536A>T	3.37:g.184935956T>A	ENSP00000231887:p.Glu179Val	Somatic	28	0		WXS	Illumina HiSeq		39	4	NM_001966	0	0	25	25	0	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.293445	0.80914	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.74002	-0.8;-0.8	5.9	5.9	0.94986	.	0.367187	0.30658	N	0.009146	T	0.79323	0.4426	M	0.77820	2.39	0.80722	D	1	P	0.50369	0.934	P	0.47626	0.552	T	0.81913	-0.0715	10	0.56958	D	0.05	-26.7427	13.8388	0.63426	0.0:0.0:0.0:1.0	.	179	Q08426	ECHP_HUMAN	V	179;179;83	ENSP00000231887:E179V;ENSP00000387746:E83V	ENSP00000231887:E179V	E	-	2	0	EHHADH	186418650	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	4.409000	0.59768	2.260000	0.74910	0.528000	0.53228	GAA	.		0.338	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
MUC4	4585	bcgsc.ca	37	3	195515038	195515038	+	Missense_Mutation	SNP	G	G	A	rs201206859		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr3:195515038G>A	ENST00000463781.3	-	2	3872	c.3413C>T	c.(3412-3414)cCt>cTt	p.P1138L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P1138L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	605					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P1138L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGAGGT	0.567																																					p.P1138L													.	MUC4-90	1	Substitution - Missense(1)	endometrium(1)	c.C3413T						.																																			SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3413C>T	3.37:g.195515038G>A	ENSP00000417498:p.Pro1138Leu	Somatic	274	9		WXS	Illumina HiSeq	Phase_1	357	15	NM_018406	0	0	1	1	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.066	0.197826	0.09652	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33865	1.39;1.39	0.814	0.814	0.18756	.	.	.	.	.	T	0.38108	0.1028	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	D	0.74674	0.984	T	0.21280	-1.0250	8	.	.	.	.	7.6132	0.28142	0.0:0.0:1.0:0.0	.	1138	E7ESK3	.	L	1138	ENSP00000417498:P1138L;ENSP00000420243:P1138L	.	P	-	2	0	MUC4	196999433	0.002000	0.14202	0.001000	0.08648	0.065000	0.16274	1.050000	0.30404	0.776000	0.33473	0.064000	0.15345	CCT	.		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195515134	195515134	+	Missense_Mutation	SNP	G	G	T	rs374418206		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr3:195515134G>T	ENST00000463781.3	-	2	3776	c.3317C>A	c.(3316-3318)cCt>cAt	p.P1106H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P1106H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	538					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P1106H(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAGGAAGAGAGGT	0.572																																					p.P1106H													.	MUC4-90	2	Substitution - Missense(2)	skin(2)	c.C3317A						.						8.0	7.0	7.0					3																	195515134		649	1454	2103	SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3317C>A	3.37:g.195515134G>T	ENSP00000417498:p.Pro1106His	Somatic	340	8		WXS	Illumina HiSeq	Phase_1	467	26	NM_018406	0	0	1	1	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.963	0.178958	0.09443	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34072	1.38;1.38	0.814	0.814	0.18756	.	.	.	.	.	T	0.38427	0.1040	N	0.19112	0.55	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.21655	-1.0239	8	.	.	.	.	7.6132	0.28142	0.0:0.0:1.0:0.0	.	1106	E7ESK3	.	H	1106	ENSP00000417498:P1106H;ENSP00000420243:P1106H	.	P	-	2	0	MUC4	196999529	0.103000	0.21917	0.003000	0.11579	0.286000	0.27126	3.387000	0.52501	0.776000	0.33473	0.064000	0.15345	CCT	.		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MAEA	10296	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1316285	1316285	+	Missense_Mutation	SNP	G	G	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr4:1316285G>T	ENST00000303400.4	+	4	636	c.573G>T	c.(571-573)aaG>aaT	p.K191N	MAEA_ENST00000514708.1_Intron|MAEA_ENST00000264750.6_Intron|MAEA_ENST00000505177.2_Missense_Mutation_p.K191N|MAEA_ENST00000510794.1_Missense_Mutation_p.K190N|MAEA_ENST00000505839.1_Missense_Mutation_p.K143N|MAEA_ENST00000452175.2_Missense_Mutation_p.K112N	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	191	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	GGCTCCGGAAGATGAAGGTGC	0.662																																					p.K191N													.	MAEA-91	0			c.G573T						.						53.0	53.0	53.0					4																	1316285		2203	4300	6503	SO:0001583	missense	10296	exon4			CCGGAAGATGAAG	AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.573G>T	4.37:g.1316285G>T	ENSP00000302830:p.Lys191Asn	Somatic	105	1		WXS	Illumina HiSeq	Phase_I	105	44	NM_001017405	0	0	0	0	0	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	37	CCDS33936.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187358	0.78789	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000503653;ENST00000539495;ENST00000502558;ENST00000452175;ENST00000510794;ENST00000505839	T;T;T;T;T;T	0.70282	0.57;-0.07;-0.47;0.51;0.64;0.57	5.94	1.34	0.21922	CTLH, C-terminal LisH motif (2);	0.000000	0.85682	D	0.000000	T	0.82263	0.4999	M	0.85099	2.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.987	D;D;D	0.85130	0.997;0.996;0.95	T	0.80957	-0.1150	10	0.66056	D	0.02	-29.5845	8.5243	0.33296	0.5403:0.0:0.4597:0.0	.	190;191;191	B4DVN3;E7ESC7;Q7L5Y9	.;.;MAEA_HUMAN	N	191;191;191;170;123;112;190;143	ENSP00000302830:K191N;ENSP00000422215:K191N;ENSP00000421644:K191N;ENSP00000426903:K123N;ENSP00000411415:K112N;ENSP00000426807:K190N	ENSP00000302830:K191N	K	+	3	2	MAEA	1306285	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.400000	0.44504	0.317000	0.23160	0.655000	0.94253	AAG	.		0.662	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882	
SLIT2	9353	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	20535255	20535255	+	Silent	SNP	T	T	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr4:20535255T>A	ENST00000504154.1	+	18	2001	c.1749T>A	c.(1747-1749)ggT>ggA	p.G583G	SLIT2_ENST00000273739.5_Silent_p.G587G|SLIT2_ENST00000503823.1_Silent_p.G575G|SLIT2_ENST00000503837.1_Silent_p.G579G	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	583					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GAGCATCTGGTGTAAATGAAA	0.328																																					p.G583G													.	SLIT2-521	0			c.T1749A						.						133.0	134.0	134.0					4																	20535255		2203	4300	6503	SO:0001819	synonymous_variant	9353	exon18			ATCTGGTGTAAAT	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1749T>A	4.37:g.20535255T>A		Somatic	352	2		WXS	Illumina HiSeq	Phase_I	300	75	NM_004787	0	0	6	9	3	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	CCDS3426.1																																																																																			.		0.328	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
CCDC149	91050	broad.mit.edu	37	4	24810216	24810216	+	Missense_Mutation	SNP	A	A	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr4:24810216A>C	ENST00000389609.4	-	13	1528	c.1385T>G	c.(1384-1386)cTg>cGg	p.L462R	CCDC149_ENST00000504487.1_Missense_Mutation_p.L462R|CCDC149_ENST00000502801.1_3'UTR|CCDC149_ENST00000428116.2_3'UTR	NM_173463.4	NP_775734.2	Q6ZUS6	CC149_HUMAN	coiled-coil domain containing 149	407										cervix(1)|endometrium(1)|large_intestine(2)|lung(3)	7		Breast(46;0.173)				GACCTCTTCCAGTTCTGCAGC	0.527																																					p.L462R													.	CCDC149-68	0			c.T1385G						.						96.0	86.0	89.0					4																	24810216		692	1591	2283	SO:0001583	missense	91050	exon13			TCTTCCAGTTCTG		CCDS33967.1, CCDS47036.1, CCDS33967.2	4p15.2	2008-03-03				ENSG00000181982			25405	protein-coding gene	gene with protein product						17457313	Standard	NM_173463		Approved	DKFZp761B107	uc003grc.3	Q6ZUS6		ENST00000389609.4:c.1385T>G	4.37:g.24810216A>C	ENSP00000374260:p.Leu462Arg	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	67	3	NM_173463	0	0	11	11	0	A6NJE7|B4DK90|B4DZG3|G5EA04|Q6NW41|Q8N3K8	Missense_Mutation	SNP	ENST00000389609.4	37	CCDS33967.2	.	.	.	.	.	.	.	.	.	.	A	16.78	3.218696	0.58560	.	.	ENSG00000181982	ENST00000504487;ENST00000389609;ENST00000382116	.	.	.	5.38	-4.24	0.03777	.	1.262130	0.05375	N	0.536082	T	0.18383	0.0441	N	0.19112	0.55	0.09310	N	0.999999	P;P	0.40875	0.612;0.731	B;B	0.41764	0.143;0.366	T	0.16424	-1.0403	9	0.59425	D	0.04	3.0031	2.4486	0.04512	0.4465:0.1992:0.2548:0.0996	.	407;462	Q6ZUS6;G5EA04	CC149_HUMAN;.	R	462;462;386	.	ENSP00000371550:L386R	L	-	2	0	CCDC149	24419314	0.004000	0.15560	0.000000	0.03702	0.542000	0.35054	0.701000	0.25616	-0.755000	0.04709	-0.441000	0.05720	CTG	.		0.527	CCDC149-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360157.1	NM_173463	
DSPP	1834	bcgsc.ca	37	4	88536614	88536614	+	Missense_Mutation	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr4:88536614A>G	ENST00000282478.7	+	4	2833	c.2800A>G	c.(2800-2802)Aat>Gat	p.N934D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.N934D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	934	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacaacagcaatagcagtga	0.478																																					p.N934D													.	DSPP-90	0			c.A2800G						.																																			SO:0001583	missense	1834	exon5			AACAGCAATAGCA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2800A>G	4.37:g.88536614A>G	ENSP00000282478:p.Asn934Asp	Somatic	485	1		WXS	Illumina HiSeq	Phase_1	448	39	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	a	0.025	-1.380186	0.01204	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.87334	-2.24;-2.24	1.73	0.826	0.18829	.	.	.	.	.	T	0.72374	0.3452	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.54091	-0.8345	9	0.09843	T	0.71	.	4.3182	0.11003	0.2182:0.0:0.7818:0.0	.	934	Q9NZW4	DSPP_HUMAN	D	934	ENSP00000382213:N934D;ENSP00000282478:N934D	ENSP00000282478:N934D	N	+	1	0	DSPP	88755638	0.001000	0.12720	0.381000	0.26106	0.004000	0.04260	0.109000	0.15417	0.304000	0.22809	-1.256000	0.01477	AAT	.		0.478	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
ANAPC10	10393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	145916549	145916549	+	Missense_Mutation	SNP	G	G	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr4:145916549G>T	ENST00000507656.1	-	5	627	c.534C>A	c.(532-534)ttC>ttA	p.F178L	ANAPC10_ENST00000510270.1_5'UTR|ANAPC10_ENST00000309439.5_Missense_Mutation_p.F178L|ANAPC10_ENST00000451299.2_Missense_Mutation_p.F178L	NM_001256706.1	NP_001243635.1	Q9UM13	APC10_HUMAN	anaphase promoting complex subunit 10	178	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(3)|lung(1)|skin(1)	6	all_hematologic(180;0.151)					GATACATCATGAAATCTATAG	0.303																																					p.F189L		.											.	ANAPC10-650	0			c.C567A						.						119.0	115.0	116.0					4																	145916549		1815	4079	5894	SO:0001583	missense	10393	exon7			CATCATGAAATCT	AF132794	CCDS43273.1	4q31	2011-06-15			ENSG00000164162	ENSG00000164162		"""Anaphase promoting complex subunits"""	24077	protein-coding gene	gene with protein product		613745				10318877, 11230166	Standard	NM_001256706		Approved	APC10, DOC1, DKFZP564L0562	uc031shk.1	Q9UM13	OTTHUMG00000161477	ENST00000507656.1:c.534C>A	4.37:g.145916549G>T	ENSP00000423995:p.Phe178Leu	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	51	27	NM_001256709	0	0	6	27	21	D3DNZ7|Q2V500|Q9UG51|Q9Y5R0	Missense_Mutation	SNP	ENST00000507656.1	37	CCDS43273.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607532	0.46527	.	.	ENSG00000164162	ENST00000507656;ENST00000309439;ENST00000451299	T;T;T	0.72615	-0.67;-0.67;-0.67	5.82	3.2	0.36748	Anaphase-promoting complex, subunit 10/DOC domain (2);	0.000000	0.85682	D	0.000000	T	0.62502	0.2433	L	0.57536	1.79	0.80722	D	1	B	0.09022	0.002	B	0.20384	0.029	T	0.51687	-0.8674	10	0.19147	T	0.46	-9.7039	8.8754	0.35343	0.2784:0.0:0.7216:0.0	.	178	Q9UM13	APC10_HUMAN	L	178	ENSP00000423995:F178L;ENSP00000310071:F178L;ENSP00000403891:F178L	ENSP00000310071:F178L	F	-	3	2	ANAPC10	146135999	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.820000	0.48057	0.400000	0.25396	0.484000	0.47621	TTC	.		0.303	ANAPC10-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365090.1	NM_014885	
ADAMTS12	81792	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	33658354	33658354	+	Silent	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:33658354A>G	ENST00000504830.1	-	7	1460	c.1125T>C	c.(1123-1125)agT>agC	p.S375S	ADAMTS12_ENST00000352040.3_Silent_p.S375S|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	375	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TGATGTTACAACTGCGGTGAG	0.507										HNSCC(64;0.19)																											p.S375S		.											.	ADAMTS12-232	0			c.T1125C						.						145.0	145.0	145.0					5																	33658354		2203	4300	6503	SO:0001819	synonymous_variant	81792	exon7			GTTACAACTGCGG	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1125T>C	5.37:g.33658354A>G		Somatic	196	0		WXS	Illumina HiSeq	Phase_I	169	10	NM_030955	0	0	0	0	0	A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	CCDS34140.1																																																																																			.		0.507	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	90281309	90281309	+	Missense_Mutation	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:90281309C>T	ENST00000405460.2	+	85	18218	c.18122C>T	c.(18121-18123)tCa>tTa	p.S6041L	GPR98_ENST00000425867.2_Missense_Mutation_p.S1702L	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	6041					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CAGAGCATGTCACAGATCTAT	0.433																																					p.S6041L		.											.	GPR98-103	0			c.C18122T						.						181.0	166.0	171.0					5																	90281309		1920	4145	6065	SO:0001583	missense	84059	exon85			GCATGTCACAGAT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.18122C>T	5.37:g.90281309C>T	ENSP00000384582:p.Ser6041Leu	Somatic	193	0		WXS	Illumina HiSeq	Phase_I	157	54	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352252	0.41700	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.29917	1.61;1.55	5.7	5.7	0.88788	GPCR, family 2-like (1);	0.379457	0.28989	N	0.013487	T	0.22399	0.0540	N	0.14661	0.345	0.22835	N	0.998674	B;B;B	0.24317	0.101;0.042;0.082	B;B;B	0.25506	0.061;0.061;0.036	T	0.10042	-1.0647	9	.	.	.	.	19.8221	0.96602	0.0:1.0:0.0:0.0	.	1702;6041;1702	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	L	6041;6041;1702	ENSP00000384582:S6041L;ENSP00000392618:S1702L	.	S	+	2	0	GPR98	90317065	0.993000	0.37304	0.750000	0.31169	0.347000	0.29111	4.029000	0.57253	2.690000	0.91761	0.557000	0.71058	TCA	.		0.433	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
TMEM232	642987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	109904274	109904274	+	Missense_Mutation	SNP	T	T	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:109904274T>G	ENST00000455884.2	-	11	1379	c.1329A>C	c.(1327-1329)aaA>aaC	p.K443N	TMEM232_ENST00000515518.2_5'UTR|TMEM232_ENST00000429839.2_Missense_Mutation_p.K443N			C9JQI7	TM232_HUMAN	transmembrane protein 232	443						integral component of membrane (GO:0016021)				breast(1)|kidney(2)	3						CCCATGAAATTTTCACCAGGT	0.363																																					p.K443N		.											.	.	0			c.A1329C						.						308.0	232.0	255.0					5																	109904274		692	1591	2283	SO:0001583	missense	642987	exon11			TGAAATTTTCACC	AK125070	CCDS47253.1, CCDS47253.2	5q22.1	2014-02-12	2009-10-02		ENSG00000186952	ENSG00000186952			37270	protein-coding gene	gene with protein product							Standard	NM_001039763		Approved	FLJ43080	uc011cvh.2	C9JQI7	OTTHUMG00000163297	ENST00000455884.2:c.1329A>C	5.37:g.109904274T>G	ENSP00000401477:p.Lys443Asn	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	71	34	NM_001039763	0	0	2	4	2	B4DKF4	Missense_Mutation	SNP	ENST00000455884.2	37	CCDS47253.2	.	.	.	.	.	.	.	.	.	.	T	22.1	4.247887	0.80024	.	.	ENSG00000186952	ENST00000429839;ENST00000455884	.	.	.	5.88	1.11	0.20524	.	0.123853	0.52532	D	0.000067	T	0.53110	0.1776	M	0.68952	2.095	0.28041	N	0.933767	D;D;D	0.63046	0.992;0.979;0.992	P;D;P	0.65323	0.891;0.934;0.891	T	0.42916	-0.9423	8	.	.	.	-19.3897	7.1643	0.25681	0.0:0.3566:0.0:0.6434	.	443;443;325	C9JQI7;C9JQI7-2;E9PFK0	TM232_HUMAN;.;.	N	443	.	.	K	-	3	2	TMEM232	109932173	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	0.620000	0.24403	0.511000	0.28236	0.455000	0.32223	AAA	.		0.363	TMEM232-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372488.2	NM_001039763	
JADE2	23338	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	133895661	133895661	+	Missense_Mutation	SNP	C	C	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:133895661C>A	ENST00000402835.1	+	5	708	c.453C>A	c.(451-453)aaC>aaA	p.N151K	PHF15_ENST00000361895.2_Missense_Mutation_p.N151K|PHF15_ENST00000395003.1_Missense_Mutation_p.N151K|PHF15_ENST00000282605.4_Missense_Mutation_p.N151K																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGCTCATCAACTCGGAGCTTA	0.592																																					p.N151K													.	PHF15-90	0			c.C453A						.						77.0	67.0	70.0					5																	133895661		2203	4300	6503	SO:0001583	missense	23338	exon5			CATCAACTCGGAG																												ENST00000402835.1:c.453C>A	5.37:g.133895661C>A	ENSP00000384671:p.Asn151Lys	Somatic	202	1		WXS	Illumina HiSeq	Phase_I	130	58	NM_015288	0	0	9	16	7		Missense_Mutation	SNP	ENST00000402835.1	37		.	.	.	.	.	.	.	.	.	.	C	21.6	4.172913	0.78452	.	.	ENSG00000043143	ENST00000413974;ENST00000448712;ENST00000282605;ENST00000361895;ENST00000432594;ENST00000402835;ENST00000395003;ENST00000431355	T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31	5.67	3.89	0.44902	Enhancer of polycomb-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77391	0.4123	M	0.89095	3.005	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.80589	-0.1315	9	.	.	.	.	10.9336	0.47233	0.0:0.8496:0.0:0.1504	.	151;151;151;151;167	Q9NQC1;B5MBX1;D3DQA3;Q9NQC1-3;B3KPL2	JADE2_HUMAN;.;.;.;.	K	151;167;151;151;151;151;151;151	ENSP00000282605:N151K;ENSP00000354425:N151K;ENSP00000384671:N151K;ENSP00000378451:N151K;ENSP00000406189:N151K	.	N	+	3	2	PHF15	133923560	0.923000	0.31300	0.992000	0.48379	0.902000	0.53008	1.927000	0.40094	1.413000	0.46997	0.561000	0.74099	AAC	.		0.592	PHF15-007	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000318543.1		
TRPC7	57113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	135561911	135561911	+	Silent	SNP	T	T	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:135561911T>A	ENST00000513104.1	-	9	2355	c.2073A>T	c.(2071-2073)cgA>cgT	p.R691R	TRPC7_ENST00000426057.2_Silent_p.R575R|TRPC7_ENST00000355180.3_Silent_p.R630R	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	691					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGAGTTTTGCTCGGGCGAACT	0.443																																					p.R691R		.											.	.	0			c.A2073T						.						37.0	36.0	36.0					5																	135561911		1848	3950	5798	SO:0001819	synonymous_variant	57113	exon9			TTTTGCTCGGGCG	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.2073A>T	5.37:g.135561911T>A		Somatic	108	0		WXS	Illumina HiSeq	Phase_I	96	47	NM_020389	0	0	1	1	0	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Silent	SNP	ENST00000513104.1	37	CCDS47267.2	.	.	.	.	.	.	.	.	.	.	T	10.27	1.303877	0.23736	.	.	ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753	.	.	.	4.99	-2.08	0.07254	.	.	.	.	.	T	0.38161	0.1030	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28073	-1.0055	4	.	.	.	-6.643	0.5481	0.00657	0.2789:0.2612:0.1187:0.3412	.	.	.	.	C	575;630;636	.	.	S	-	1	0	TRPC7	135589810	0.029000	0.19370	0.942000	0.38095	0.996000	0.88848	-0.795000	0.04580	-0.526000	0.06383	0.482000	0.46254	AGC	.		0.443	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
HSPA9	3313	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	137903216	137903216	+	Missense_Mutation	SNP	T	T	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:137903216T>C	ENST00000297185.3	-	7	769	c.644A>G	c.(643-645)aAt>aGt	p.N215S	HSPA9_ENST00000501917.2_5'Flank	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	215					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCGAAGCACATTCAGTCCAGA	0.423																																					p.N215S		.											.	HSPA9-226	0			c.A644G						.						96.0	97.0	96.0					5																	137903216		2203	4300	6503	SO:0001583	missense	3313	exon7			AGCACATTCAGTC	L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.644A>G	5.37:g.137903216T>C	ENSP00000297185:p.Asn215Ser	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	69	7	NM_004134	0	0	149	154	5	B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Missense_Mutation	SNP	ENST00000297185.3	37	CCDS4208.1	.	.	.	.	.	.	.	.	.	.	T	18.79	3.699341	0.68501	.	.	ENSG00000113013	ENST00000297185;ENST00000541333;ENST00000540484	T	0.01203	5.18	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.04952	0.0133	H	0.95328	3.655	0.80722	D	1	B;B	0.24651	0.002;0.108	B;B	0.25884	0.006;0.064	T	0.01330	-1.1383	10	0.66056	D	0.02	-21.9951	15.0791	0.72099	0.0:0.0:0.0:1.0	.	146;215	B7Z1V7;P38646	.;GRP75_HUMAN	S	215;168;201	ENSP00000297185:N215S	ENSP00000297185:N215S	N	-	2	0	HSPA9	137931115	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.250000	0.72435	2.095000	0.63458	0.533000	0.62120	AAT	.		0.423	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251285.1	NM_004134	
PCDHA2	56146	hgsc.bcm.edu	37	5	140176265	140176265	+	Silent	SNP	C	C	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:140176265C>A	ENST00000526136.1	+	1	1716	c.1716C>A	c.(1714-1716)acC>acA	p.T572T	PCDHA2_ENST00000378132.1_Silent_p.T572T|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Silent_p.T572T	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	572					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCTGGCACCGCTGCTGGCG	0.682																																					p.T572T		.											.	PCDHA2-94	0			c.C1716A						.						97.0	92.0	93.0					5																	140176265		2203	4298	6501	SO:0001819	synonymous_variant	56146	exon1			TGGCACCGCTGCT	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1716C>A	5.37:g.140176265C>A		Somatic	7	0		WXS	Illumina HiSeq	Phase_I	177	13	NM_031495	0	0	2	3	1	O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	37	CCDS54914.1																																																																																			.		0.682	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
DIAPH1	1729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140953451	140953451	+	Missense_Mutation	SNP	G	G	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:140953451G>T	ENST00000398557.4	-	16	2106	c.1966C>A	c.(1966-1968)Cct>Act	p.P656T	DIAPH1_ENST00000398566.3_Missense_Mutation_p.P647T|DIAPH1_ENST00000253811.6_Missense_Mutation_p.P656T|DIAPH1_ENST00000389057.5_Missense_Mutation_p.P647T|DIAPH1_ENST00000518047.1_Missense_Mutation_p.P647T|DIAPH1_ENST00000389054.3_Missense_Mutation_p.P656T|DIAPH1_ENST00000398562.2_Missense_Mutation_p.P635T|DIAPH1_ENST00000520569.1_Missense_Mutation_p.P602T	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	656	FH1.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGGCAAAGGAGGGGGTGGA	0.592																																					p.P656T		.											.	DIAPH1-91	0			c.C1966A						.						9.0	9.0	9.0					5																	140953451		1969	4113	6082	SO:0001583	missense	1729	exon16			GCAAAGGAGGGGG	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.1966C>A	5.37:g.140953451G>T	ENSP00000381565:p.Pro656Thr	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	54	25	NM_005219	0	0	8	15	7	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	ENST00000398557.4	37	CCDS43374.1	.	.	.	.	.	.	.	.	.	.	g	13.06	2.124083	0.37533	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047;ENST00000546094	T;T;T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.13;-0.15;-0.15;-0.15;-0.15;-0.15	4.73	4.73	0.59995	Formin Homology 1 (1);	0.242758	0.33875	N	0.004470	T	0.70430	0.3223	M	0.85373	2.75	0.48511	D	0.999665	P;P;P	0.43938	0.822;0.645;0.645	P;B;B	0.44477	0.451;0.41;0.41	T	0.73780	-0.3875	10	0.36615	T	0.2	.	16.9924	0.86357	0.0:0.0:1.0:0.0	.	602;647;656	E7ERW8;E9PEZ2;O60610	.;.;DIAP1_HUMAN	T	656;602;635;647;647;656;656;647;95	ENSP00000373706:P656T;ENSP00000429282:P602T;ENSP00000381570:P635T;ENSP00000373709:P647T;ENSP00000381572:P647T;ENSP00000381565:P656T;ENSP00000253811:P656T;ENSP00000428268:P647T	ENSP00000253811:P656T	P	-	1	0	DIAPH1	140933635	0.998000	0.40836	1.000000	0.80357	0.566000	0.35808	3.542000	0.53625	2.629000	0.89072	0.472000	0.43445	CCT	.		0.592	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_005219	
PCYOX1L	78991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	148747898	148747898	+	Missense_Mutation	SNP	A	A	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:148747898A>T	ENST00000274569.4	+	6	1228	c.1166A>T	c.(1165-1167)cAg>cTg	p.Q389L	PCYOX1L_ENST00000514349.1_Missense_Mutation_p.Q299L	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	389					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGCAGCCCCAGGAGGCAGCT	0.557											OREG0016912	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q389L	Ovarian(62;1136 1477 27277 27495)	.											.	PCYOX1L-91	0			c.A1166T						.						92.0	99.0	97.0					5																	148747898		2203	4300	6503	SO:0001583	missense	78991	exon6			AGCCCCAGGAGGC		CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.1166A>T	5.37:g.148747898A>T	ENSP00000274569:p.Gln389Leu	Somatic	125	0	1719	WXS	Illumina HiSeq	Phase_I	107	42	NM_024028	0	0	15	30	15	Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Missense_Mutation	SNP	ENST00000274569.4	37	CCDS4296.1	.	.	.	.	.	.	.	.	.	.	A	16.43	3.122001	0.56613	.	.	ENSG00000145882	ENST00000274569;ENST00000514349	T;T	0.15718	2.4;2.4	5.51	5.51	0.81932	Prenylcysteine lyase (1);	0.000000	0.85682	D	0.000000	T	0.39759	0.1090	M	0.66939	2.045	0.80722	D	1	D;B;D	0.69078	0.997;0.216;0.993	D;B;P	0.80764	0.994;0.09;0.874	T	0.08994	-1.0695	10	0.32370	T	0.25	-22.8691	15.6328	0.76926	1.0:0.0:0.0:0.0	.	271;299;389	B3KXF9;E7EVZ5;Q8NBM8	.;.;PCYXL_HUMAN	L	389;299	ENSP00000274569:Q389L;ENSP00000428512:Q299L	ENSP00000274569:Q389L	Q	+	2	0	PCYOX1L	148728091	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	6.075000	0.71261	2.084000	0.62774	0.459000	0.35465	CAG	.		0.557	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252331.2	NM_024028	
RARS	5917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	167937680	167937680	+	Nonsense_Mutation	SNP	G	G	T	rs148161788		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:167937680G>T	ENST00000231572.3	+	12	1495	c.1441G>T	c.(1441-1443)Gaa>Taa	p.E481*	RARS_ENST00000538719.1_Nonsense_Mutation_p.E275*	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	481					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.E481K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		GAAGGAAAAAGAAAGAGACAA	0.373																																					p.E481X		.											.	RARS-93	1	Substitution - Missense(1)	skin(1)	c.G1441T						.						65.0	65.0	65.0					5																	167937680		2203	4300	6503	SO:0001587	stop_gained	5917	exon12			GAAAAAGAAAGAG	BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.1441G>T	5.37:g.167937680G>T	ENSP00000231572:p.Glu481*	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	128	51	NM_002887	0	0	0	0	0	B2RBS9|Q53GY4|Q9BWA1	Nonsense_Mutation	SNP	ENST00000231572.3	37	CCDS4367.1	.	.	.	.	.	.	.	.	.	.	G	38	6.721281	0.97788	.	.	ENSG00000113643	ENST00000231572;ENST00000538719	.	.	.	4.99	4.12	0.48240	.	0.150792	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-22.9725	15.7934	0.78384	0.0:0.1366:0.8634:0.0	.	.	.	.	X	481;275	.	ENSP00000231572:E481X	E	+	1	0	RARS	167870258	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.498000	0.81546	1.218000	0.43458	-0.150000	0.13652	GAA	.		0.373	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252794.2	NM_002887	
DDX41	51428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176943307	176943307	+	Missense_Mutation	SNP	G	G	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr5:176943307G>C	ENST00000507955.1	-	3	803	c.280C>G	c.(280-282)Ctt>Gtt	p.L94V	DDX41_ENST00000506965.1_5'UTR	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	94					apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TTCTCTTTAAGGTGCTGGTGC	0.582																																					p.L94V		.											.	DDX41-226	0			c.C280G						.						161.0	161.0	161.0					5																	176943307		2203	4300	6503	SO:0001583	missense	51428	exon3			CTTTAAGGTGCTG	AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.280C>G	5.37:g.176943307G>C	ENSP00000422753:p.Leu94Val	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	84	36	NM_016222	0	0	75	147	72	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	ENST00000507955.1	37	CCDS4427.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.008160	0.75046	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.29142	1.58;1.59	5.38	4.5	0.54988	.	0.000000	0.64402	D	0.000003	T	0.48150	0.1484	L	0.56340	1.77	0.58432	D	0.999999	D	0.76494	0.999	D	0.68621	0.959	T	0.37244	-0.9714	10	0.42905	T	0.14	-23.2967	14.3294	0.66545	0.0725:0.0:0.9274:0.0	.	94	Q9UJV9	DDX41_HUMAN	V	112;94	ENSP00000330349:L112V;ENSP00000422753:L94V	ENSP00000330349:L112V	L	-	1	0	DDX41	176875913	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.218000	0.72224	2.513000	0.84729	0.491000	0.48974	CTT	.		0.582	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253432.2	NM_016222	
DCDC2	51473	hgsc.bcm.edu	37	6	24357769	24357769	+	Silent	SNP	A	A	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr6:24357769A>T	ENST00000378454.3	-	1	511	c.210T>A	c.(208-210)acT>acA	p.T70T	KAAG1_ENST00000274766.1_5'UTR	NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	70	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				TTCGGTGGCCAGTCCGCGGGG	0.597																																					p.T70T		.											.	DCDC2-91	0			c.T210A						.						39.0	38.0	38.0					6																	24357769		2203	4299	6502	SO:0001819	synonymous_variant	51473	exon2			GTGGCCAGTCCGC	AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.210T>A	6.37:g.24357769A>T		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	74	4	NM_001195610	0	0	88	88	0	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Silent	SNP	ENST00000378454.3	37	CCDS4550.1	.	.	.	.	.	.	.	.	.	.	A	4.106	0.017843	0.07959	.	.	ENSG00000146038	ENST00000436313	.	.	.	5.56	-4.43	0.03568	.	.	.	.	.	T	0.19248	0.0462	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41179	-0.9523	4	.	.	.	-10.2342	0.669	0.00856	0.2741:0.2931:0.2257:0.2071	.	.	.	.	Q	38	.	.	L	-	2	0	DCDC2	24465748	0.027000	0.19231	0.078000	0.20375	0.442000	0.32017	-0.787000	0.04618	-0.539000	0.06273	-1.491000	0.00971	CTG	.		0.597	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043604.1	NM_016356	
LRFN2	57497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	40399589	40399589	+	Missense_Mutation	SNP	G	G	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr6:40399589G>T	ENST00000338305.6	-	2	1806	c.1264C>A	c.(1264-1266)Ccg>Acg	p.P422T		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	422	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCCCGTTCCGGGGGGCTTTTG	0.642																																					p.P422T		.											.	LRFN2-93	0			c.C1264A						.						44.0	48.0	47.0					6																	40399589		2203	4300	6503	SO:0001583	missense	57497	exon2			GTTCCGGGGGGCT	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1264C>A	6.37:g.40399589G>T	ENSP00000345985:p.Pro422Thr	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	56	23	NM_020737	0	0	0	0	0	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400939	0.25291	.	.	ENSG00000156564	ENST00000338305	T	0.72282	-0.64	5.38	5.38	0.77491	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.50718	0.1632	L	0.50333	1.59	0.80722	D	1	B	0.19445	0.036	B	0.20577	0.03	T	0.51309	-0.8722	10	0.13853	T	0.58	.	16.6167	0.84918	0.0:0.0:1.0:0.0	.	422	Q9ULH4	LRFN2_HUMAN	T	422	ENSP00000345985:P422T	ENSP00000345985:P422T	P	-	1	0	LRFN2	40507567	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	9.578000	0.98200	2.525000	0.85131	0.561000	0.74099	CCG	.		0.642	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
MMS22L	253714	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	97634560	97634560	+	Missense_Mutation	SNP	C	C	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr6:97634560C>T	ENST00000275053.4	-	15	2311	c.2046G>A	c.(2044-2046)atG>atA	p.M682I	MMS22L_ENST00000369251.2_Missense_Mutation_p.M642I	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	682					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						ATTGTTGATGCATACTCCTAA	0.353																																					p.M682I													.	MMS22L-92	0			c.G2046A						.						68.0	61.0	64.0					6																	97634560		2203	4300	6503	SO:0001583	missense	253714	exon15			TTGATGCATACTC		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.2046G>A	6.37:g.97634560C>T	ENSP00000275053:p.Met682Ile	Somatic	125	1		WXS	Illumina HiSeq	Phase_I	124	44	NM_198468	0	0	0	0	0	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	C	6.612	0.481341	0.12581	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.27557	1.66;1.66	5.31	2.25	0.28309	.	0.490245	0.21528	N	0.073091	T	0.04048	0.0113	N	0.11427	0.14	0.23371	N	0.997812	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41197	-0.9522	10	0.27082	T	0.32	-3.7566	3.7368	0.08514	0.1899:0.4744:0.2506:0.0851	.	642;682	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	I	682;642	ENSP00000275053:M682I;ENSP00000358254:M642I	ENSP00000275053:M682I	M	-	3	0	MMS22L	97741281	0.994000	0.37717	0.998000	0.56505	0.995000	0.86356	0.280000	0.18790	0.190000	0.20209	0.585000	0.79938	ATG	.		0.353	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	
BVES	11149	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	105563684	105563684	+	Missense_Mutation	SNP	G	G	A	rs370149373		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr6:105563684G>A	ENST00000314641.5	-	7	1051	c.835C>T	c.(835-837)Cat>Tat	p.H279Y	BVES_ENST00000336775.5_Missense_Mutation_p.H279Y|BVES_ENST00000446408.2_Missense_Mutation_p.H279Y	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	279					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)			NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				CTGAGCTGATGTTCCAGCTTT	0.443																																					p.H279Y		.											.	BVES-90	0			c.C835T						.	G	TYR/HIS,TYR/HIS,TYR/HIS	0,4406		0,0,2203	145.0	121.0	129.0		835,835,835	4.8	1.0	6		129	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	BVES	NM_001199563.1,NM_007073.4,NM_147147.3	83,83,83	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	279/361,279/361,279/361	105563684	1,13005	2203	4300	6503	SO:0001583	missense	11149	exon7			GCTGATGTTCCAG	AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.835C>T	6.37:g.105563684G>A	ENSP00000313172:p.His279Tyr	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	97	32	NM_001199563	0	0	0	3	3	A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	ENST00000314641.5	37	CCDS5051.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.317534	0.23908	0.0	1.16E-4	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.17213	2.29;2.29;2.29	5.71	4.79	0.61399	.	0.279017	0.39544	N	0.001325	T	0.02688	0.0081	N	0.22421	0.69	0.27859	N	0.940468	P	0.40398	0.716	B	0.30495	0.116	T	0.34104	-0.9842	10	0.02654	T	1	-25.5861	13.3716	0.60717	0.0:0.0:0.7242:0.2758	.	279	Q8NE79	POPD1_HUMAN	Y	279	ENSP00000313172:H279Y;ENSP00000337259:H279Y;ENSP00000397310:H279Y	ENSP00000313172:H279Y	H	-	1	0	BVES	105670377	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	4.940000	0.63533	2.706000	0.92434	0.563000	0.77884	CAT	.		0.443	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406075.1	NM_147147	
ARPC1B	10095	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	98988630	98988630	+	Silent	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr7:98988630A>G	ENST00000451682.1	+	8	924	c.615A>G	c.(613-615)gtA>gtG	p.V205V	PDAP1_ENST00000496335.1_5'Flank|ARPC1B_ENST00000252725.5_Silent_p.V205V			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	205					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GCGGCTGGGTACATGGCGTCT	0.627																																					p.V205V													.	ARPC1B-90	0			c.A615G						.						39.0	38.0	39.0					7																	98988630		2203	4300	6503	SO:0001819	synonymous_variant	10095	exon6			CTGGGTACATGGC	AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.615A>G	7.37:g.98988630A>G		Somatic	93	1		WXS	Illumina HiSeq	Phase_I	98	56	NM_005720	1	1	333	927	592	Q9BU00	Silent	SNP	ENST00000451682.1	37	CCDS5661.1																																																																																			.		0.627	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
FBXL13	222235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	102553614	102553614	+	Silent	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr7:102553614G>A	ENST00000313221.4	-	11	1353	c.927C>T	c.(925-927)ttC>ttT	p.F309F	FBXL13_ENST00000436908.1_Silent_p.F309F|FBXL13_ENST00000379306.3_Silent_p.F309F|LRRC17_ENST00000339431.4_Intron|FBXL13_ENST00000379305.3_Silent_p.F309F|FBXL13_ENST00000455112.2_Silent_p.F309F|FBXL13_ENST00000393772.2_Silent_p.F309F|FBXL13_ENST00000456695.1_Silent_p.F309F|FBXL13_ENST00000379308.3_Silent_p.F309F|LRRC17_ENST00000249377.4_Intron	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	309										NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						CTTTGTCTGTGAACCGTCTGC	0.443																																					p.F309F		.											.	FBXL13-226	0			c.C927T						.						146.0	131.0	136.0					7																	102553614		2203	4300	6503	SO:0001819	synonymous_variant	222235	exon11			GTCTGTGAACCGT	BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.927C>T	7.37:g.102553614G>A		Somatic	170	0		WXS	Illumina HiSeq	Phase_I	169	38	NM_001111038	0	0	0	3	3	C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Silent	SNP	ENST00000313221.4	37	CCDS5726.1																																																																																			.		0.443	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348001.1	NM_145032	
LAMB1	3912	broad.mit.edu;bcgsc.ca	37	7	107599767	107599767	+	Missense_Mutation	SNP	C	C	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr7:107599767C>G	ENST00000222399.6	-	20	2847	c.2617G>C	c.(2617-2619)Gcc>Ccc	p.A873P	LAMB1_ENST00000393561.1_Missense_Mutation_p.A897P	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	873	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.A873S(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CAGTCATCGGCGTGGCCATTG	0.557																																					p.A873P													.	LAMB1-97	1	Substitution - Missense(1)	lung(1)	c.G2617C						.						129.0	118.0	122.0					7																	107599767		2203	4300	6503	SO:0001583	missense	3912	exon20			CATCGGCGTGGCC	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2617G>C	7.37:g.107599767C>G	ENSP00000222399:p.Ala873Pro	Somatic	181	0		WXS	Illumina HiSeq	Phase_I	227	9	NM_002291	0	0	187	207	20	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.899179	0.72754	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.62941	-0.01;-0.01	5.55	5.55	0.83447	EGF-like, laminin (3);	.	.	.	.	T	0.80259	0.4590	M	0.76727	2.345	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.95	T	0.81191	-0.1045	9	0.87932	D	0	.	19.6941	0.96016	0.0:1.0:0.0:0.0	.	873;897	P07942;G3XAI2	LAMB1_HUMAN;.	P	897;873	ENSP00000377191:A897P;ENSP00000222399:A873P	ENSP00000222399:A873P	A	-	1	0	LAMB1	107387003	0.877000	0.30153	0.815000	0.32552	0.459000	0.32528	1.734000	0.38166	2.885000	0.99019	0.655000	0.94253	GCC	.		0.557	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
LAMB1	3912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	107605061	107605061	+	Missense_Mutation	SNP	G	G	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr7:107605061G>C	ENST00000222399.6	-	14	1864	c.1634C>G	c.(1633-1635)cCt>cGt	p.P545R	LAMB1_ENST00000393560.1_Missense_Mutation_p.P545R|LAMB1_ENST00000393561.1_Missense_Mutation_p.P569R	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	545					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GTAGTAACCAGGTTCCACTTC	0.567																																					p.P545R		.											.	LAMB1-97	0			c.C1634G						.						173.0	143.0	153.0					7																	107605061		2203	4300	6503	SO:0001583	missense	3912	exon14			TAACCAGGTTCCA	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1634C>G	7.37:g.107605061G>C	ENSP00000222399:p.Pro545Arg	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	202	73	NM_002291	0	0	196	284	88	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614445	0.66672	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.63096	-0.02;-0.02;0.91	4.64	4.64	0.57946	EGF-like, laminin (3);	.	.	.	.	T	0.72606	0.3481	M	0.69463	2.115	0.38209	D	0.940402	B;B;B	0.33777	0.213;0.425;0.321	B;P;B	0.47645	0.229;0.553;0.126	T	0.76737	-0.2849	9	0.49607	T	0.09	.	17.501	0.87732	0.0:0.0:1.0:0.0	.	545;545;569	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	R	569;545;545	ENSP00000377191:P569R;ENSP00000222399:P545R;ENSP00000377190:P545R	ENSP00000222399:P545R	P	-	2	0	LAMB1	107392297	1.000000	0.71417	0.631000	0.29282	0.798000	0.45092	9.435000	0.97529	2.129000	0.65627	0.563000	0.77884	CCT	.		0.567	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
KEL	3792	broad.mit.edu;bcgsc.ca	37	7	142640932	142640932	+	Missense_Mutation	SNP	G	G	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr7:142640932G>T	ENST00000355265.2	-	14	2004	c.1530C>A	c.(1528-1530)agC>agA	p.S510R	KEL_ENST00000479768.2_5'Flank	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	510					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					ACCGGACACAGCTCAGGACAG	0.557																																					p.S510R													.	KEL-93	0			c.C1530A						.						95.0	78.0	84.0					7																	142640932		2203	4300	6503	SO:0001583	missense	3792	exon14			GACACAGCTCAGG	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1530C>A	7.37:g.142640932G>T	ENSP00000347409:p.Ser510Arg	Somatic	207	1		WXS	Illumina HiSeq	Phase_I	201	8	NM_000420	0	0	5	5	0	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.624790	0.28889	.	.	ENSG00000197993	ENST00000355265	D	0.81499	-1.5	4.86	0.752	0.18398	.	0.373083	0.27227	N	0.020340	T	0.75664	0.3880	M	0.63843	1.955	0.28877	N	0.894608	D	0.60160	0.987	P	0.50708	0.648	T	0.69026	-0.5254	10	0.06891	T	0.86	-20.2736	6.581	0.22594	0.4159:0.0:0.5841:0.0	.	510	P23276	KELL_HUMAN	R	510	ENSP00000347409:S510R	ENSP00000347409:S510R	S	-	3	2	KEL	142351054	0.793000	0.28825	0.943000	0.38184	0.194000	0.23727	0.091000	0.15046	0.264000	0.21851	-0.122000	0.15005	AGC	.		0.557	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
CRH	1392	hgsc.bcm.edu	37	8	67089641	67089641	+	Silent	SNP	C	C	T	rs560106713	byFrequency	TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr8:67089641C>T	ENST00000276571.3	-	2	518	c.72G>A	c.(70-72)gcG>gcA	p.A24A		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	24					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	GGCTCAGGAGCGCCCTGCATG	0.726											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	7	0.00139776	0.0053	0.0	5008	,	,		11538	0.0		0.0	False		,,,				2504	0.0				p.A24A		.											.	CRH-90	0			c.G72A						.						2.0	2.0	2.0					8																	67089641		1373	3133	4506	SO:0001819	synonymous_variant	1392	exon2			CAGGAGCGCCCTG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.72G>A	8.37:g.67089641C>T		Somatic	0	0	1096	WXS	Illumina HiSeq	Phase_I	16	10	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			.		0.726	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
FAM83H	286077	broad.mit.edu	37	8	144808646	144808646	+	Silent	SNP	T	T	C			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr8:144808646T>C	ENST00000388913.3	-	5	3110	c.2985A>G	c.(2983-2985)caA>caG	p.Q995Q		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	995					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGCTCTCGGGTTGGCCGTTCT	0.697																																					p.Q995Q													.	FAM83H-92	0			c.A2985G						.						10.0	13.0	12.0					8																	144808646		1983	4126	6109	SO:0001819	synonymous_variant	286077	exon5			CTCGGGTTGGCCG	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2985A>G	8.37:g.144808646T>C		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	107	4	NM_198488	0	0	55	58	3	A0JLS2|Q8N4W0	Silent	SNP	ENST00000388913.3	37	CCDS6410.2																																																																																			.		0.697	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
FAM47A	158724	bcgsc.ca	37	X	34148842	34148842	+	Silent	SNP	G	G	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chrX:34148842G>A	ENST00000346193.3	-	1	1605	c.1554C>T	c.(1552-1554)cgC>cgT	p.R518R		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	518										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GAGGCTCCGAGCGGAGACTGG	0.657																																					p.R518R													.	FAM47A-134	0			c.C1554T						.						27.0	27.0	27.0					X																	34148842		2185	4270	6455	SO:0001819	synonymous_variant	158724	exon1			CTCCGAGCGGAGA	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1554C>T	X.37:g.34148842G>A		Somatic	26	0		WXS	Illumina HiSeq	Phase_1	28	5	NM_203408	0	0	0	0	0	A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	CCDS43926.1																																																																																			.		0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
SSX9	280660	bcgsc.ca	37	X	48161189	48161189	+	RNA	SNP	A	A	G	rs6609702		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chrX:48161189A>G	ENST00000608568.1	-	0	375					NR_073393.1		Q7RTT3	SSX9_HUMAN	synovial sarcoma, X breakpoint 9						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	8						GTCATCTGAGAACGTTCAACT	0.443													-|||	1321	0.349934	0.202	0.2522	3775	,	,		13949	0.2351		0.4195	False		,,,				2504	0.2249				.													.	SSX9-90	0			.						.	G		1208,2627		153,731,171,748,400	127.0	120.0	123.0			-0.6	0.0	X	dbSNP_116	123	3795,2932		781,1186,1047,461,824	no	intergenic				934,1917,1218,1209,1224	GG,GA,G,AA,A		43.5856,31.4993,47.3679			48161189	5003,5559	2203	4299	6502			280660	.			TCTGAGAACGTTC	BK000689		Xp11.23	2013-01-16			ENSG00000204648	ENSG00000204648			19655	other	unknown		300544				12216073	Standard	NR_073393		Approved		uc031tjk.1	Q7RTT3	OTTHUMG00000021490		X.37:g.48161189A>G		Somatic	261	4		WXS	Illumina HiSeq	Phase_1	268	8	.	0	0	0	0	0		RNA	SNP	ENST00000608568.1	37		661	0.39843279083785416	77	0.1807511737089202	74	0.2356687898089172	95	0.1962809917355372	211	0.3822463768115942	N	0.003	-2.470259	0.00169	0.314993	0.564144	ENSG00000204648	ENST00000376909;ENST00000407081	T;T	0.06768	3.26;3.26	1.21	-0.565	0.11771	.	1.369700	0.05488	N	0.555972	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43829	-0.9367	8	0.02654	T	1	.	3.2805	0.06913	0.2209:0.44:0.3391:0.0	rs6609702	97	Q7RTT3	SSX9_HUMAN	P	97	ENSP00000366107:S97P;ENSP00000385293:S97P	ENSP00000366107:S97P	S	-	1	0	SSX9	48046133	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-1.822000	0.01711	-0.934000	0.03733	-1.239000	0.01543	TCT	A|0.600;G|0.400		0.443	SSX9-002	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000472372.1	NR_073393	
HDAC6	10013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	48676773	48676773	+	Missense_Mutation	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chrX:48676773A>G	ENST00000334136.5	+	22	2319	c.2141A>G	c.(2140-2142)gAc>gGc	p.D714G	HDAC6_ENST00000376619.2_Missense_Mutation_p.D714G|HDAC6_ENST00000444343.2_Missense_Mutation_p.D728G			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	714	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	GGTGATGCTGACTACCTAGCT	0.637																																					p.D714G	Pancreas(112;205 1675 2305 8976 15959)	.											.	HDAC6-230	0			c.A2141G						.						53.0	42.0	45.0					X																	48676773		2203	4300	6503	SO:0001583	missense	10013	exon22			ATGCTGACTACCT	AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.2141A>G	X.37:g.48676773A>G	ENSP00000334061:p.Asp714Gly	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	88	77	NM_006044	0	0	0	27	27	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	ENST00000334136.5	37	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.672707	0.88445	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619;ENST00000436813	T;T;T	0.71222	-0.55;-0.55;-0.55	5.35	5.35	0.76521	Histone deacetylase domain (2);	0.237016	0.41294	D	0.000917	T	0.76786	0.4036	L	0.43923	1.385	0.80722	D	1	P;D;P	0.57571	0.931;0.98;0.931	P;D;P	0.63703	0.848;0.917;0.848	T	0.79090	-0.1946	10	0.87932	D	0	-11.0343	12.2017	0.54331	1.0:0.0:0.0:0.0	.	704;362;714	B4DZN1;B3KVK5;Q9UBN7	.;.;HDAC6_HUMAN	G	728;714;714;714	ENSP00000398566:D728G;ENSP00000334061:D714G;ENSP00000365804:D714G	ENSP00000334061:D714G	D	+	2	0	HDAC6	48561717	1.000000	0.71417	0.932000	0.37286	0.989000	0.77384	8.533000	0.90617	1.785000	0.52413	0.486000	0.48141	GAC	.		0.637	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044	
SERPINA7	6906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	105280775	105280775	+	Missense_Mutation	SNP	A	A	G			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chrX:105280775A>G	ENST00000327674.4	-	1	610	c.275T>C	c.(274-276)aTt>aCt	p.I92T	SERPINA7_ENST00000372563.1_Missense_Mutation_p.I92T|SERPINA7_ENST00000487487.1_5'Flank			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	92					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GGTCTCCACAATCTCAGTTTG	0.483																																					p.I92T		.											.	SERPINA7-226	0			c.T275C						.						82.0	75.0	78.0					X																	105280775		2203	4300	6503	SO:0001583	missense	6906	exon2			TCCACAATCTCAG	M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.275T>C	X.37:g.105280775A>G	ENSP00000329374:p.Ile92Thr	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	46	6	NM_000354	0	0	0	0	0	D3DUX1	Missense_Mutation	SNP	ENST00000327674.4	37	CCDS14518.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.760784	0.31137	.	.	ENSG00000123561	ENST00000327674;ENST00000372563	D;D	0.85773	-2.03;-2.03	4.91	4.91	0.64330	Serpin domain (3);	0.073669	0.56097	D	0.000032	D	0.94298	0.8168	H	0.96175	3.78	0.40968	D	0.984676	D	0.89917	1.0	D	0.87578	0.998	D	0.95648	0.8704	10	0.87932	D	0	.	11.5511	0.50721	1.0:0.0:0.0:0.0	.	92	P05543	THBG_HUMAN	T	92	ENSP00000329374:I92T;ENSP00000361644:I92T	ENSP00000329374:I92T	I	-	2	0	SERPINA7	105167431	1.000000	0.71417	0.055000	0.19348	0.009000	0.06853	8.589000	0.90817	1.930000	0.55929	0.486000	0.48141	ATT	.		0.483	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057790.1	NM_000354	
TENM1	10178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	123637524	123637524	+	Missense_Mutation	SNP	G	G	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chrX:123637524G>T	ENST00000371130.3	-	19	3394	c.3331C>A	c.(3331-3333)Cct>Act	p.P1111T	TENM1_ENST00000422452.2_Missense_Mutation_p.P1111T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1111					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATAAAGTCAGGGCACGTTTCA	0.363																																					p.P1111T		.											.	.	0			c.C3331A						.						165.0	160.0	162.0					X																	123637524		2203	4300	6503	SO:0001583	missense	10178	exon19			AGTCAGGGCACGT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3331C>A	X.37:g.123637524G>T	ENSP00000360171:p.Pro1111Thr	Somatic	134	1		WXS	Illumina HiSeq	Phase_I	155	132	NM_001163278	0	0	0	2	2	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302140	0.40694	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.85773	-2.03;-2.0	5.7	5.7	0.88788	.	0.060698	0.64402	D	0.000002	T	0.77955	0.4208	L	0.38953	1.18	0.51233	D	0.999913	B;B;B	0.17852	0.024;0.011;0.007	B;B;B	0.12156	0.007;0.005;0.004	T	0.71768	-0.4493	10	0.16420	T	0.52	.	13.7872	0.63117	0.0:0.0:0.8469:0.1531	.	1110;1111;1111	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	T	1111	ENSP00000360171:P1111T;ENSP00000403954:P1111T	ENSP00000360171:P1111T	P	-	1	0	ODZ1	123465205	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.633000	0.74286	2.402000	0.81655	0.600000	0.82982	CCT	.		0.363	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
TTTY14	83869	bcgsc.ca	37	Y	21154603	21154603	+	IGR	SNP	A	A	C	rs79788321		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chrY:21154603A>C								TTTY14 (114489 upstream) : RNU6-255P (26265 downstream)																							CATGTCCCCTACGTCGGTGCG	0.662																																					.													.	.	0			.						.																																			SO:0001628	intergenic_variant	100133941	.			TCCCCTACGTCGG																													Y.37:g.21154603A>C		Somatic	35	0		WXS	Illumina HiSeq	Phase_1	37	34	.	0	1	0	1844	1843		RNA	SNP		37																																																																																				.	0	0.662								
OR5T2	219464	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	56000572	56000573	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr11:56000572_56000573delAA	ENST00000313264.4	-	1	164_165	c.89_90delTT	c.(88-90)tttfs	p.F30fs		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					AGATATGCATAAAGTTACAGTT	0.351																																					p.30_30del		.											.	OR5T2-70	0			c.89_90del						.																																			SO:0001589	frameshift_variant	219464	exon1			.	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.89_90delTT	11.37:g.56000572_56000573delAA	ENSP00000323688:p.Phe30fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	106	39	NM_001004746	0	0	0	0	0	B9EGX5|Q6IFC8	Frame_Shift_Del	DEL	ENST00000313264.4	37	CCDS31523.1																																																																																			.		0.351	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
CDC42BPG	55561	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	64603951	64603963	+	Frame_Shift_Del	DEL	CCAGCTGGGGGCC	CCAGCTGGGGGCC	-			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	CCAGCTGGGGGCC	CCAGCTGGGGGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr11:64603951_64603963delCCAGCTGGGGGCC	ENST00000342711.5	-	12	1423_1435	c.1424_1436delGGCCCCCAGCTGG	c.(1423-1437)gggcccccagctggtfs	p.GPPAG475fs		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						ACCTGGGCTACCAGCTGGGGGCCCATCCGTCTG	0.653											OREG0004017	type=REGULATORY REGION|Gene=CDC42BPG|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.475_479del		.											.	CDC42BPG-528	0			c.1424_1436del						.																																			SO:0001589	frameshift_variant	55561	exon12			.	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.1424_1436delGGCCCCCAGCTGG	11.37:g.64603951_64603963delCCAGCTGGGGGCC	ENSP00000345133:p.Gly475fs	Somatic	99	0	1077	WXS	Illumina HiSeq	Phase_I	62	10	NM_017525	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000342711.5	37	CCDS31601.1																																																																																			.		0.653	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
TEKT5	146279	broad.mit.edu	37	16	10788448	10788448	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr16:10788448delC	ENST00000283025.2	-	1	354	c.283delG	c.(283-285)gacfs	p.D95fs	RP11-109M19.1_ENST00000576710.1_RNA	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	95						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						TTGGACTGGTCCCAGTCGTGG	0.677																																					p.D95fs													.	TEKT5-92	0			c.283delG						.						65.0	76.0	72.0					16																	10788448		2197	4300	6497	SO:0001589	frameshift_variant	146279	exon1			ACTGGTCCCAGTC		CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.283delG	16.37:g.10788448delC	ENSP00000283025:p.Asp95fs	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	102	7	NM_144674	0	0	0	0	0	A1L3Z3	Frame_Shift_Del	DEL	ENST00000283025.2	37	CCDS10542.1																																																																																			.		0.677	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251963.1	NM_144674	
SERPINF1	5176	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	1679947	1679953	+	Frame_Shift_Del	DEL	GAGAACT	GAGAACT	-	rs146939364	byFrequency	TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	GAGAACT	GAGAACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr17:1679947_1679953delGAGAACT	ENST00000254722.4	+	7	1071_1077	c.908_914delGAGAACT	c.(907-915)cgagaactgfs	p.REL303fs		NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	303					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L305V(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						GACATAGACCGAGAACTGAAGACCGTG	0.512																																					p.303_305del		.											.	SERPINF1-227	1	Substitution - Missense(1)	stomach(1)	c.908_914del						.																																			SO:0001589	frameshift_variant	5176	exon7			.	M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.908_914delGAGAACT	17.37:g.1679947_1679953delGAGAACT	ENSP00000254722:p.Arg303fs	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	133	60	NM_002615	0	0	0	0	0	F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Frame_Shift_Del	DEL	ENST00000254722.4	37	CCDS11012.1																																																																																			.		0.512	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207109.4	NM_002615	
APEH	327	broad.mit.edu	37	3	49723112	49723112	+	IGR	DEL	T	T	-			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr3:49723112delT	ENST00000296456.5	+	0	3220				MST1_ENST00000494828.2_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000383728.3_3'UTR|MST1_ENST00000449682.2_Frame_Shift_Del_p.N435fs	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCCATCTGGGTTCCGGCAGAA	0.587																																					p.N435fs													.	MST1-278	0			c.1304delA						.						43.0	42.0	43.0					3																	49723112		2203	4300	6503	SO:0001628	intergenic_variant	4485	exon11			TCTGGGTTCCGGC	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723112delT		Somatic	231	0		WXS	Illumina HiSeq	Phase_I	300	9	NM_020998	0	0	0	0	0	Q9BQ33|Q9P0Y2	Frame_Shift_Del	DEL	ENST00000296456.5	37	CCDS2801.1																																																																																			.		0.587	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
CITED2	10370	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	139694300	139694309	+	Frame_Shift_Del	DEL	CACACGAAGT	CACACGAAGT	-			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	CACACGAAGT	CACACGAAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr6:139694300_139694309delCACACGAAGT	ENST00000367651.2	-	2	988_997	c.773_782delACTTCGTGTG	c.(772-783)gacttcgtgtgcfs	p.DFVC258fs	CITED2_ENST00000537332.1_Frame_Shift_Del_p.DFVC258fs|CITED2_ENST00000536159.1_Frame_Shift_Del_p.DFVC258fs	NM_006079.4	NP_006070.2	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	258	Asp/Glu-rich (acidic).				adrenal cortex formation (GO:0035802)|bone morphogenesis (GO:0060349)|cardiac neural crest cell development involved in heart development (GO:0061308)|cell aging (GO:0007569)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|cranial nerve morphogenesis (GO:0021602)|decidualization (GO:0046697)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endocardial cushion development (GO:0003197)|erythrocyte development (GO:0048821)|granulocyte differentiation (GO:0030851)|heart development (GO:0007507)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|left/right axis specification (GO:0070986)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|peripheral nervous system development (GO:0007422)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of gene expression (GO:0010628)|positive regulation of male gonad development (GO:2000020)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|pulmonary artery morphogenesis (GO:0061156)|regulation of organ formation (GO:0003156)|regulation of RNA biosynthetic process (GO:2001141)|response to estrogen (GO:0043627)|response to fluid shear stress (GO:0034405)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sex determination (GO:0007530)|skeletal muscle cell differentiation (GO:0035914)|spleen development (GO:0048536)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|LBD domain binding (GO:0050693)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(4)	5	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		CTGCTGTTTGCACACGAAGTCCGTCATAAA	0.49																																					p.263_266del	NSCLC(98;1219 1550 33720 43229 49330)	.											.	CITED2-90	0			c.788_797del						.																																			SO:0001589	frameshift_variant	10370	exon2			.	U65093	CCDS5195.1, CCDS75530.1	6q23.3	2008-08-29			ENSG00000164442	ENSG00000164442			1987	protein-coding gene	gene with protein product		602937				8901575, 10552932	Standard	NM_006079		Approved	MRG1	uc021zfz.2	Q99967	OTTHUMG00000015691	ENST00000367651.2:c.773_782delACTTCGTGTG	6.37:g.139694300_139694309delCACACGAAGT	ENSP00000356623:p.Asp258fs	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	57	15	NM_001168389	0	0	0	0	0	O95426|Q5VTF4	Frame_Shift_Del	DEL	ENST00000367651.2	37	CCDS5195.1																																																																																			.		0.490	CITED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042463.1		
ASAH1	427	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	17916973	17916973	+	Splice_Site	DEL	T	T	-			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr8:17916973delT	ENST00000262097.6	-	12	1229	c.918delA	c.(916-918)gaa>ga	p.E306fs	ASAH1_ENST00000314146.10_Splice_Site_p.E300fs|ASAH1_ENST00000520781.1_Splice_Site_p.E281fs|ASAH1_ENST00000381733.4_Splice_Site_p.E322fs|ASAH1_ENST00000417108.2_Splice_Site_p.E216fs	NM_177924.3	NP_808592.2	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase (acid ceramidase) 1	306					cell death (GO:0008219)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lung development (GO:0030324)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|ceramidase activity (GO:0017040)			breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		TAGCATCGAGTCTAGATACAA	0.398																																					p.E322fs		.											.	ASAH1-90	0			c.966delA						.						185.0	167.0	173.0					8																	17916973		2203	4300	6503	SO:0001630	splice_region_variant	427	exon12			.	U70063	CCDS6005.1, CCDS6006.1, CCDS47813.1	8p22	2007-03-27	2002-09-11	2002-09-13	ENSG00000104763	ENSG00000104763			735	protein-coding gene	gene with protein product		613468	"""N-acylsphingosine amidohydrolase (acid ceramidase)"""	ASAH		8955159, 10610716	Standard	NM_004315		Approved	AC, PHP32, FLJ21558	uc003wyn.2	Q13510	OTTHUMG00000096997	ENST00000262097.6:c.918-1A>-	8.37:g.17916973delT		Somatic	77	0		WXS	Illumina HiSeq	Phase_I	66	25	NM_004315	0	0	0	0	0	E9PDS0|Q6W898|Q96AS2	Frame_Shift_Del	DEL	ENST00000262097.6	37	CCDS6006.1																																																																																			.		0.398	ASAH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214077.2	NM_004315	Frame_Shift_Del
STMN4	81551	broad.mit.edu	37	8	27097616	27097616	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr8:27097616delG	ENST00000265770.7	-	5	518	c.382delC	c.(382-384)caafs	p.Q128fs	STMN4_ENST00000519997.1_Frame_Shift_Del_p.Q119fs|STMN4_ENST00000523048.1_Frame_Shift_Del_p.Q155fs|STMN4_ENST00000350889.4_Frame_Shift_Del_p.Q155fs|STMN4_ENST00000522908.1_Frame_Shift_Del_p.Q155fs|STMN4_ENST00000519614.1_Frame_Shift_Del_p.Q128fs			Q9H169	STMN4_HUMAN	stathmin-like 4	128	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				regulation of microtubule polymerization or depolymerization (GO:0031110)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	11		Ovarian(32;0.00167)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0214)|Epithelial(17;9.82e-10)|Colorectal(74;0.142)	Lomustine(DB01206)	ATGGCCTTTTGGATCACCTCT	0.512																																					p.Q155fs													.	STMN4-154	0			c.463delC						.						220.0	205.0	210.0					8																	27097616		2203	4300	6503	SO:0001589	frameshift_variant	81551	exon6			CCTTTTGGATCAC		CCDS6055.1, CCDS64851.1, CCDS64852.1, CCDS64854.1	8p21.2	2006-12-09			ENSG00000015592	ENSG00000015592			16078	protein-coding gene	gene with protein product						11230166	Standard	NM_001283054		Approved	RB3	uc003xfj.3	Q9H169	OTTHUMG00000099461	ENST00000265770.7:c.382delC	8.37:g.27097616delG	ENSP00000265770:p.Gln128fs	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	131	10	NM_030795	0	0	0	0	0	B7Z2Z7|B7Z4I9|D3DSS8|D3DSS9|G5EA16|Q2TAB9	Frame_Shift_Del	DEL	ENST00000265770.7	37																																																																																				.		0.512	STMN4-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000375941.1	NM_030795	
OPTN	10133	hgsc.bcm.edu;bcgsc.ca	37	10	13160980	13160981	+	Frame_Shift_Ins	INS	-	-	AAGGG			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr10:13160980_13160981insAAGGG	ENST00000378748.3	+	8	1081_1082	c.719_720insAAGGG	c.(718-723)ctaaggfs	p.-242fs	OPTN_ENST00000378757.2_Frame_Shift_Ins_p.-242fs|OPTN_ENST00000378747.3_Frame_Shift_Ins_p.-242fs|OPTN_ENST00000378752.3_Frame_Shift_Ins_p.-236fs|OPTN_ENST00000482140.1_3'UTR|OPTN_ENST00000378764.2_Frame_Shift_Ins_p.-236fs|OPTN_ENST00000263036.5_Frame_Shift_Ins_p.-242fs	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin						cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						CTGCTGTGCCTAAGGGAAGGGA	0.431																																					p.L240fs		.											.	OPTN-70	0			c.719_720insAAGGG						.																																			SO:0001589	frameshift_variant	10133	exon7			.	AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.725_729dupAAGGG	10.37:g.13160986_13160990dupAAGGG	ENSP00000368022:p.Glu242fs	Somatic	206	0		WXS	Illumina HiSeq	Phase_I	172	39	NM_001008212	0	0	0	0	0	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Frame_Shift_Ins	INS	ENST00000378748.3	37	CCDS7094.1																																																																																			.		0.431	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980	
FBXL15	79176	broad.mit.edu	37	10	104182716	104182717	+	Frame_Shift_Ins	INS	-	-	G	rs145311924		TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr10:104182716_104182717insG	ENST00000224862.3	+	4	2185_2186	c.869_870insG	c.(868-873)gcgggcfs	p.AG290fs	CUEDC2_ENST00000465409.1_5'Flank|PSD_ENST00000492902.2_5'Flank|FBXL15_ENST00000369956.2_Frame_Shift_Ins_p.AG286fs	NM_024326.3	NP_077302.3	Q9H469	FXL15_HUMAN	F-box and leucine-rich repeat protein 15	290					bone mineralization (GO:0030282)|dorsal/ventral pattern formation (GO:0009953)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of BMP signaling pathway (GO:0030513)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)				kidney(1)	1		Colorectal(252;0.207)		Epithelial(162;1.19e-08)|all cancers(201;2.65e-07)		CAGGATATGGCGGGCTTCGCAC	0.649											OREG0020479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A290fs													.	FBXL15-226	0			c.869_870insG						.																																			SO:0001589	frameshift_variant	79176	exon4			ATATGGCGGGCTT	BC036120	CCDS31273.1	10q24.32	2011-06-09	2004-06-15	2004-06-16	ENSG00000107872	ENSG00000107872		"""F-boxes / Leucine-rich repeats"""	28155	protein-coding gene	gene with protein product		610287	"""F-box only protein 37"""	FBXO37			Standard	NM_024326		Approved	MGC11279, Fbl15	uc001kvk.2	Q9H469	OTTHUMG00000018957	ENST00000224862.3:c.872dupG	10.37:g.104182719_104182719dupG	ENSP00000224862:p.Ala290fs	Somatic	53	0	1379	WXS	Illumina HiSeq	Phase_I	104	9	NM_024326	0	0	0	0	0	A1L4J8|B1AKX8|B1AKX9|B1AKY0|B1AKY1|C9JWA4|Q0D2Q3|Q49AL7|Q5JWA5	Frame_Shift_Ins	INS	ENST00000224862.3	37	CCDS31273.1																																																																																			.		0.649	FBXL15-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		XM_370575	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	152579988	152579989	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr2:152579988_152579989insA	ENST00000172853.10	-	9	771_772	c.624_625insT	c.(622-627)actgaafs	p.E209fs	NEB_ENST00000409198.1_Frame_Shift_Ins_p.E209fs|NEB_ENST00000604864.1_Frame_Shift_Ins_p.E209fs|NEB_ENST00000603639.1_Frame_Shift_Ins_p.E209fs|NEB_ENST00000397345.3_Frame_Shift_Ins_p.E209fs|NEB_ENST00000427231.2_Frame_Shift_Ins_p.E209fs			P20929	NEBU_HUMAN	nebulin	209					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.E209*(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCCCAGTCTTCAGTGTACAGTT	0.391																																					p.E209_D210delinsX		.											.	NEB-145	1	Substitution - Nonsense(1)	autonomic_ganglia(1)	c.625_626insT						.																																			SO:0001589	frameshift_variant	4703	exon9			.	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.625dupT	2.37:g.152579989_152579989dupA	ENSP00000172853:p.Glu209fs	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	120	67	NM_004543	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Nonsense_Mutation	INS	ENST00000172853.10	37																																																																																				.		0.391	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
SEC14L2	23541	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	30818390	30818391	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chr22:30818390_30818391insA	ENST00000312932.9	+	12	1466_1467	c.1206_1207insA	c.(1207-1209)aaafs	p.K403fs	RNU6-564P_ENST00000410983.1_RNA|RP4-539M6.21_ENST00000608952.1_RNA|RP4-539M6.20_ENST00000608677.1_RNA|RP4-539M6.19_ENST00000439838.1_Intron|SEC14L2_ENST00000403484.1_Frame_Shift_Ins_p.K329fs|SEC14L2_ENST00000402592.3_Frame_Shift_Ins_p.K320fs	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)	403					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	CAGGCACCCCGAAATAACACCT	0.515																																					p.P402fs		.											.	SEC14L2-90	0			c.1206_1207insA						.																																			SO:0001589	frameshift_variant	23541	exon12			.	AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.1209dupA	22.37:g.30818393_30818393dupA	ENSP00000316203:p.Lys403fs	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	62	21	NM_012429	0	0	0	0	0	B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	Frame_Shift_Ins	INS	ENST00000312932.9	37	CCDS13876.1																																																																																			.		0.515	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321018.4	NM_012429	
RENBP	5973	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	153200984	153200985	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AT-A5NU-01A-11D-A28G-10	TCGA-AT-A5NU-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	573e6af3-cd69-43ac-8dbf-b2f3331d520d	f93a95f6-7503-431f-9f12-d22c659ce92b	g.chrX:153200984_153200985insT	ENST00000393700.3	-	10	1202_1203	c.1122_1123insA	c.(1120-1125)cgagagfs	p.E375fs	NAA10_ENST00000464845.1_5'Flank|NAA10_ENST00000370015.4_5'Flank|RENBP_ENST00000369997.3_Frame_Shift_Ins_p.E361fs|NAA10_ENST00000393712.3_5'Flank|RENBP_ENST00000412763.1_3'UTR|NAA10_ENST00000393710.3_5'Flank|NAA10_ENST00000370009.1_5'Flank	NM_002910.5	NP_002901.2	P51606	RENBP_HUMAN	renin binding protein	375					N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)|regulation of blood pressure (GO:0008217)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|endopeptidase inhibitor activity (GO:0004866)|N-acylglucosamine 2-epimerase activity (GO:0050121)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	ACCTTGCCCTCTCGGCTCAGGT	0.644																																					p.E375fs		.											.	RENBP-132	0			c.1123_1124insA						.																																			SO:0001589	frameshift_variant	5973	exon10			.		CCDS14738.2	Xq28	2013-09-23	2001-11-28		ENSG00000102032	ENSG00000102032			9959	protein-coding gene	gene with protein product	"""N-acylglucosamine 2-epimerase"", ""GlcNAc 2-epimerase"", ""N-acetyl-D-glucosamine 2-epimerase"""	312420	"""renin-binding protein"""			1618798	Standard	NM_002910		Approved	RNBP, RBP	uc004fjo.2	P51606	OTTHUMG00000024224	ENST00000393700.3:c.1123dupA	X.37:g.153200985_153200985dupT	ENSP00000377303:p.Glu375fs	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	171	144	NM_002910	0	0	0	0	0	B4DNZ3|Q96BI6	Frame_Shift_Ins	INS	ENST00000393700.3	37	CCDS14738.2																																																																																			.		0.644	RENBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061103.3	NM_002910	
