#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACTR5	79913	broad.mit.edu;hgsc.bcm.edu	37	20	37383750	37383750	+	Missense_Mutation	SNP	A	A	G	rs368018075		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr20:37383750A>G	ENST00000243903.4	+	4	963	c.926A>G	c.(925-927)aAt>aGt	p.N309S		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	309					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)		p.N309S(1)		kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CAGGAGCTCAATGCCCGGCGG	0.607																																																	1	Substitution - Missense(1)	kidney(1)						A	SER/ASN	0,4406		0,0,2203	27.0	30.0	29.0		926	5.9	1.0	20		29	1,8599	1.2+/-3.3	0,1,4299	no	missense	ACTR5	NM_024855.3	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	possibly-damaging	309/608	37383750	1,13005	2203	4300	6503	SO:0001583	missense	79913			AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.926A>G	20.37:g.37383750A>G	ENSP00000243903:p.Asn309Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	ENST00000243903.4	37	CCDS13308.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.798063	0.90538	0.0	1.16E-4	ENSG00000101442	ENST00000243903	D	0.96104	-3.91	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.97498	0.9181	M	0.80183	2.485	0.58432	D	0.999997	D	0.76494	0.999	D	0.83275	0.996	D	0.96962	0.9702	10	0.27082	T	0.32	-27.0862	16.24	0.82402	1.0:0.0:0.0:0.0	.	309	Q9H9F9	ARP5_HUMAN	S	309	ENSP00000243903:N309S	ENSP00000243903:N309S	N	+	2	0	ACTR5	36817164	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	8.472000	0.90407	2.241000	0.73720	0.533000	0.62120	AAT		0.607	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2		NM_024855	
ATF6B	1388	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	32084267	32084267	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr6:32084267C>T	ENST00000375203.3	-	17	1904	c.1872G>A	c.(1870-1872)atG>atA	p.M624I	ATF6B_ENST00000375201.4_Missense_Mutation_p.M621I	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta	624					response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M624I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22						CATTGGGGGCCATGGCAGGCA	0.632																																																	1	Substitution - Missense(1)	kidney(1)											114.0	92.0	100.0					6																	32084267		2203	4300	6503	SO:0001583	missense	1388				CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676		"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1		11256944, 14973138	Standard	NM_004381		Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.1872G>A	6.37:g.32084267C>T	ENSP00000364349:p.Met624Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	Missense_Mutation	SNP	ENST00000375203.3	37	CCDS4737.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898994	0.52227	.	.	ENSG00000213676	ENST00000375203;ENST00000375201	T;T	0.56611	0.45;1.2	5.45	5.45	0.79879	.	0.000000	0.85682	U	0.000000	T	0.46983	0.1421	N	0.25485	0.75	0.51482	D	0.999929	D;P;D	0.58268	0.982;0.533;0.969	D;B;D	0.68943	0.961;0.186;0.914	T	0.32052	-0.9921	10	0.13853	T	0.58	-14.2841	16.7853	0.85573	0.0:1.0:0.0:0.0	.	621;624;624	Q99941-2;Q99941;Q6AZW6	.;ATF6B_HUMAN;.	I	624;621	ENSP00000364349:M624I;ENSP00000364347:M621I	ENSP00000364347:M621I	M	-	3	0	ATF6B	32192245	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.646000	0.46630	2.574000	0.86865	0.467000	0.42956	ATG		0.632	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076638.2			
TBATA	219793	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	72541707	72541707	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr10:72541707T>C	ENST00000299290.1	-	4	516	c.127A>G	c.(127-129)Atc>Gtc	p.I43V	TBATA_ENST00000456372.2_Missense_Mutation_p.I43V|TBATA_ENST00000545575.1_Missense_Mutation_p.I33V	NM_152710.2	NP_689923	Q96M53	TBATA_HUMAN	thymus, brain and testes associated	43					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.I43V(1)									ATCCCTGGGATCACCAGTTCT	0.592																																																	1	Substitution - Missense(1)	kidney(1)											121.0	120.0	120.0					10																	72541707		2203	4300	6503	SO:0001583	missense	0			AK057382	CCDS7308.1	10q22.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166220	ENSG00000166220			23511	protein-coding gene	gene with protein product		612640	"""chromosome 10 open reading frame 27"""	C10orf27		20937703	Standard	NM_152710		Approved	FLJ32820, spatial	uc001jrj.1	Q96M53	OTTHUMG00000018413	ENST00000299290.1:c.127A>G	10.37:g.72541707T>C	ENSP00000299290:p.Ile43Val	Somatic		WXS	Illumina HiSeq	Phase_I	A4QPA8|B2RPQ2|Q5T4G2	Missense_Mutation	SNP	ENST00000299290.1	37	CCDS7308.1	.	.	.	.	.	.	.	.	.	.	T	4.919	0.170766	0.09391	.	.	ENSG00000166220	ENST00000299290;ENST00000536955;ENST00000456372;ENST00000545575	T	0.38240	1.15	4.86	-0.297	0.12820	.	0.780907	0.11588	N	0.549078	T	0.36771	0.0979	L	0.28400	0.85	0.09310	N	1	P;P;B;B;B;B	0.51791	0.948;0.644;0.097;0.037;0.1;0.1	D;B;B;B;B;B	0.67103	0.949;0.116;0.021;0.028;0.047;0.028	T	0.26573	-1.0099	10	0.07482	T	0.82	-4.9109	7.6266	0.28216	0.0:0.4639:0.0:0.5361	.	32;32;43;43;33;43	B7Z8D7;B7Z8G0;B7ZMN4;B7ZMN5;B7Z8I8;Q96M53	.;.;.;.;.;SPATL_HUMAN	V	43;30;43;33	ENSP00000299290:I43V	ENSP00000299290:I43V	I	-	1	0	C10orf27	72211713	0.241000	0.23857	0.045000	0.18777	0.568000	0.35870	-0.028000	0.12350	-0.123000	0.11745	0.482000	0.46254	ATC		0.592	TBATA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048519.1		NM_152710	
C5orf47	133491	hgsc.bcm.edu;ucsc.edu	37	5	173426713	173426713	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr5:173426713delG	ENST00000340147.6	+	3	527	c.422delG	c.(421-423)tggfs	p.W141fs	C5orf47_ENST00000522195.1_Intron	NM_001144954.1	NP_001138426.1	Q569G3	CE047_HUMAN	chromosome 5 open reading frame 47	141										kidney(1)|prostate(1)	2						GTTTTAGTATGGAATAGAGTA	0.343																																																	0													143.0	116.0	124.0					5																	173426713		692	1588	2280	SO:0001589	frameshift_variant	133491				CCDS47343.1	5q35.2	2012-02-24			ENSG00000185056	ENSG00000185056			27026	protein-coding gene	gene with protein product						12477932	Standard	NM_001144954		Approved	LOC133491	uc003mcw.4	Q569G3	OTTHUMG00000163349	ENST00000340147.6:c.422delG	5.37:g.173426713delG	ENSP00000340887:p.Trp141fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IYU7	Frame_Shift_Del	DEL	ENST00000340147.6	37	CCDS47343.1																																																																																				0.343	C5orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372926.1		NM_001144954	
CTTNBP2	83992	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	117417736	117417736	+	Silent	SNP	A	A	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr7:117417736A>T	ENST00000160373.3	-	8	2698	c.2607T>A	c.(2605-2607)gcT>gcA	p.A869A		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	869					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.A869A(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AATTTCCATGAGCTGGTATTC	0.468																																																	1	Substitution - coding silent(1)	kidney(1)											74.0	75.0	74.0					7																	117417736		2203	4300	6503	SO:0001819	synonymous_variant	83992				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.2607T>A	7.37:g.117417736A>T		Somatic		WXS	Illumina HiSeq	Phase_I	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	37	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	A	0.343	-0.949096	0.02304	.	.	ENSG00000077063	ENST00000446636	.	.	.	5.46	0.154	0.14901	.	.	.	.	.	T	0.21022	0.0506	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.22977	-1.0201	4	.	.	.	2.2837	2.0373	0.03542	0.4548:0.126:0.2968:0.1224	.	.	.	.	T	357	.	.	S	-	1	0	CTTNBP2	117204972	0.000000	0.05858	0.017000	0.16124	0.027000	0.11550	0.067000	0.14510	0.137000	0.18759	0.528000	0.53228	TCA		0.468	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4		NM_033427	
DCHS2	54798	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	155156296	155156296	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr4:155156296C>G	ENST00000357232.4	-	25	8142	c.8143G>C	c.(8143-8145)Ggg>Cgg	p.G2715R		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2715					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G2715R(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CAGCCTTCCCCTTGATCTCCT	0.512																																																	1	Substitution - Missense(1)	kidney(1)											99.0	80.0	87.0					4																	155156296		2203	4300	6503	SO:0001583	missense	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8143G>C	4.37:g.155156296C>G	ENSP00000349768:p.Gly2715Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.873449	0.51695	.	.	ENSG00000197410	ENST00000357232	T	0.55588	0.51	5.54	2.92	0.33932	.	0.842069	0.10435	N	0.674999	T	0.36690	0.0976	N	0.17082	0.46	0.09310	N	0.999997	B	0.18461	0.028	B	0.15870	0.014	T	0.29882	-0.9997	10	0.66056	D	0.02	.	8.8245	0.35047	0.0:0.7153:0.0:0.2846	.	2715	Q6V1P9	PCD23_HUMAN	R	2715	ENSP00000349768:G2715R	ENSP00000349768:G2715R	G	-	1	0	DCHS2	155375746	0.024000	0.19004	0.000000	0.03702	0.808000	0.45660	2.542000	0.45744	0.311000	0.23014	0.460000	0.39030	GGG		0.512	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2		NM_001142552	
DGKH	160851	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	42773767	42773767	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr13:42773767C>T	ENST00000337343.4	+	19	2372	c.2351C>T	c.(2350-2352)tCa>tTa	p.S784L	DGKH_ENST00000536612.1_Missense_Mutation_p.S648L|DGKH_ENST00000540693.1_Missense_Mutation_p.S784L|DGKH_ENST00000538674.1_Missense_Mutation_p.S539L|DGKH_ENST00000261491.5_Missense_Mutation_p.S784L|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000379274.2_Missense_Mutation_p.S648L	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	784					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.S784L(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		GCAAAAATTTCATTAGAATTT	0.284																																																	1	Substitution - Missense(1)	kidney(1)											26.0	29.0	28.0					13																	42773767		2195	4274	6469	SO:0001583	missense	160851			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2351C>T	13.37:g.42773767C>T	ENSP00000337572:p.Ser784Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	C	30	5.057531	0.93846	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	5.79	5.79	0.91817	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.57315	0.2045	M	0.67953	2.075	0.80722	D	1	D;D;D;D	0.71674	0.998;0.997;0.995;0.998	D;D;D;D	0.78314	0.991;0.962;0.961;0.986	T	0.57499	-0.7801	10	0.87932	D	0	.	20.0368	0.97565	0.0:1.0:0.0:0.0	.	539;648;784;784	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	L	784;784;784;648;648;539	ENSP00000440823:S784L;ENSP00000337572:S784L;ENSP00000261491:S784L;ENSP00000368576:S648L;ENSP00000445114:S648L;ENSP00000441308:S539L	ENSP00000261491:S784L	S	+	2	0	DGKH	41671767	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.703000	0.84585	2.727000	0.93392	0.591000	0.81541	TCA		0.284	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2		NM_178009	
DKKL1	27120	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	49869088	49869088	+	Missense_Mutation	SNP	G	G	T	rs527385357		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr19:49869088G>T	ENST00000221498.2	+	4	768	c.363G>T	c.(361-363)gaG>gaT	p.E121D	DKKL1_ENST00000594268.1_Intron|AC010524.2_ENST00000599433.1_RNA	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	121					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)	p.E121D(1)		large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		TGATCTCCGAGAATGTGGTGG	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		17716	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)											107.0	94.0	99.0					19																	49869088		2203	4300	6503	SO:0001583	missense	27120			AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.363G>T	19.37:g.49869088G>T	ENSP00000221498:p.Glu121Asp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000221498.2	37	CCDS12762.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365584	0.61513	.	.	ENSG00000104901	ENST00000221498	T	0.29397	1.57	4.5	3.46	0.39613	.	0.422207	0.20367	N	0.093722	T	0.35364	0.0929	M	0.72894	2.215	0.30885	N	0.73097	P	0.44139	0.827	B	0.44133	0.442	T	0.47235	-0.9133	10	0.72032	D	0.01	-22.7849	8.6097	0.33795	0.1048:0.0:0.8952:0.0	.	121	Q9UK85	DKKL1_HUMAN	D	121	ENSP00000221498:E121D	ENSP00000221498:E121D	E	+	3	2	DKKL1	54560900	1.000000	0.71417	0.981000	0.43875	0.668000	0.39293	2.036000	0.41165	1.281000	0.44480	0.561000	0.74099	GAG		0.557	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465454.2		NM_014419	
DNAJC10	54431	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	183623959	183623959	+	Silent	SNP	T	T	C	rs140227116		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr2:183623959T>C	ENST00000264065.7	+	21	2485	c.2070T>C	c.(2068-2070)caT>caC	p.H690H		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	690	Thioredoxin 4. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)	p.H690H(1)		breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			GGAAAAATCATTGGGTGATTG	0.383													T|||	1	0.000199681	0.0	0.0014	5008	,	,		15205	0.0		0.0	False		,,,				2504	0.0				Pancreas(56;860 1183 25669 35822 48585)												1	Substitution - coding silent(1)	kidney(1)						T		0,4406		0,0,2203	94.0	93.0	93.0		2070	-10.9	0.2	2	dbSNP_134	93	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DNAJC10	NM_018981.1		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		690/794	183623959	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54431				CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.2070T>C	2.37:g.183623959T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Silent	SNP	ENST00000264065.7	37	CCDS33345.1																																																																																				0.383	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2		NM_018981	
FBXO22	26263	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	76222396	76222396	+	Intron	SNP	T	T	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr15:76222396T>A	ENST00000308275.3	+	6	899				FBXO22_ENST00000453211.2_Missense_Mutation_p.V267D|FBXO22_ENST00000540507.1_Intron	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22						cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)	p.V267D(1)|p.?(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GAAAAGTATGTCTTGTGTGCT	0.383																																																	2	Substitution - Missense(1)|Unknown(1)	kidney(2)											142.0	133.0	136.0					15																	76222396		2197	4294	6491	SO:0001627	intron_variant	26263			AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.794+6T>A	15.37:g.76222396T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Missense_Mutation	SNP	ENST00000308275.3	37	CCDS10287.1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.650697	0.47362	.	.	ENSG00000167196	ENST00000453211	.	.	.	4.56	2.28	0.28536	.	.	.	.	.	T	0.42404	0.1201	.	.	.	0.80722	D	1	P	0.39883	0.693	B	0.41332	0.354	T	0.10989	-1.0606	6	.	.	.	.	6.832	0.23915	0.0:0.1665:0.0:0.8335	.	267	Q8NEZ5-3	.	D	267	.	.	V	+	2	0	FBXO22	74009451	0.988000	0.35896	0.011000	0.14972	0.797000	0.45037	2.020000	0.41010	0.311000	0.23014	0.460000	0.39030	GTC		0.383	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286477.2		NM_147188	
FMNL2	114793	hgsc.bcm.edu	37	2	153476066	153476066	+	Silent	SNP	G	G	A	rs5835439|rs3080632	byFrequency	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr2:153476066G>A	ENST00000288670.9	+	15	2038	c.1671G>A	c.(1669-1671)ccG>ccA	p.P557P	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	557	Pro-rich.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CGCCGCCGCCGccccctcctc	0.597																																																	0													4.0	5.0	4.0					2																	153476066		1422	3295	4717	SO:0001819	synonymous_variant	114793			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1671G>A	2.37:g.153476066G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	ENST00000288670.9	37	CCDS46429.1																																																																																				0.597	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2		NM_052905	
FMNL2	114793	hgsc.bcm.edu	37	2	153476069	153476069	+	Silent	SNP	C	C	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr2:153476069C>A	ENST00000288670.9	+	15	2041	c.1674C>A	c.(1672-1674)ccC>ccA	p.P558P	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	558	Pro-rich.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)		p.P558P(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CGCCGCCGccccctcctccac	0.592																																																	1	Substitution - coding silent(1)	ovary(1)											4.0	4.0	4.0					2																	153476069		1457	3387	4844	SO:0001819	synonymous_variant	114793			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1674C>A	2.37:g.153476069C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	ENST00000288670.9	37	CCDS46429.1																																																																																				0.592	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2		NM_052905	
FZR1	51343	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	3533336	3533336	+	Silent	SNP	G	G	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr19:3533336G>A	ENST00000395095.3	+	11	1287	c.1287G>A	c.(1285-1287)aaG>aaA	p.K429K	FZR1_ENST00000313639.8_Silent_p.K340K|FZR1_ENST00000441788.2_Silent_p.K429K	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	429					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.K429K(1)		endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGTCTGGAAGTACCCCTCCC	0.652																																																	1	Substitution - coding silent(1)	kidney(1)											138.0	96.0	110.0					19																	3533336		2203	4300	6503	SO:0001819	synonymous_variant	51343			AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.1287G>A	19.37:g.3533336G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Silent	SNP	ENST00000395095.3	37	CCDS45916.1																																																																																				0.652	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2		NM_016263	
GAL3ST2	64090	broad.mit.edu;hgsc.bcm.edu	37	2	242741353	242741353	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr2:242741353G>T	ENST00000192314.6	+	3	408	c.277G>T	c.(277-279)Ggc>Tgc	p.G93C	AC114730.5_ENST00000437438.1_RNA	NM_022134.2	NP_071417.2	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	93					biosynthetic process (GO:0009058)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)	p.G93C(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|skin(1)	14		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CGTCCACCTGGGCTACCCCTG	0.652																																																	1	Substitution - Missense(1)	kidney(1)											52.0	48.0	50.0					2																	242741353		2203	4299	6502	SO:0001583	missense	64090			AB040610	CCDS33427.1	2q37.2	2014-05-19			ENSG00000154252	ENSG00000154252		"""Sulfotransferases, membrane-bound"""	24869	protein-coding gene	gene with protein product		608237				11029462	Standard	NM_022134		Approved	GP3ST	uc002wcj.1	Q9H3Q3	OTTHUMG00000151473	ENST00000192314.6:c.277G>T	2.37:g.242741353G>T	ENSP00000192314:p.Gly93Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q17RK0|Q57Z52	Missense_Mutation	SNP	ENST00000192314.6	37	CCDS33427.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.104033	0.37145	.	.	ENSG00000154252	ENST00000192314	T	0.14022	2.54	3.8	2.89	0.33648	.	0.000000	0.64402	D	0.000006	T	0.31136	0.0787	M	0.73962	2.25	0.34199	D	0.672966	D	0.89917	1.0	D	0.79108	0.992	T	0.40720	-0.9548	10	0.52906	T	0.07	-47.7868	6.7483	0.23474	0.0915:0.0:0.7309:0.1776	.	93	Q9H3Q3	G3ST2_HUMAN	C	93	ENSP00000192314:G93C	ENSP00000192314:G93C	G	+	1	0	GAL3ST2	242390026	1.000000	0.71417	0.988000	0.46212	0.030000	0.12068	3.504000	0.53347	0.908000	0.36671	0.306000	0.20318	GGC		0.652	GAL3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322792.1		NM_022134	
GBF1	8729	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	104111129	104111129	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr10:104111129C>T	ENST00000369983.3	+	5	672	c.412C>T	c.(412-414)Cag>Tag	p.Q138*		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	138					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.Q138*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GAAAATCCTTCAGGTAAGCGA	0.517																																																	1	Substitution - Nonsense(1)	kidney(1)											87.0	75.0	79.0					10																	104111129		2203	4300	6503	SO:0001587	stop_gained	8729			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.412C>T	10.37:g.104111129C>T	ENSP00000359000:p.Gln138*	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Nonsense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	C	37	6.398571	0.97533	.	.	ENSG00000107862	ENST00000369983	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-13.8328	20.4561	0.99145	0.0:1.0:0.0:0.0	.	.	.	.	X	138	.	ENSP00000359000:Q138X	Q	+	1	0	GBF1	104101119	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.624000	0.83124	2.847000	0.97988	0.591000	0.81541	CAG		0.517	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1			
GPCPD1	56261	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	5559074	5559074	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr20:5559074T>C	ENST00000379019.4	-	8	869	c.657A>G	c.(655-657)atA>atG	p.I219M	GPCPD1_ENST00000481038.1_5'UTR	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	219					glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)	p.I219M(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						CCATCGTCTGTATGCTGTACT	0.448																																																	1	Substitution - Missense(1)	kidney(1)											119.0	109.0	112.0					20																	5559074		2203	4300	6503	SO:0001583	missense	56261				CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.657A>G	20.37:g.5559074T>C	ENSP00000368305:p.Ile219Met	Somatic		WXS	Illumina HiSeq	Phase_I	D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	ENST00000379019.4	37	CCDS13090.1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.452653	0.63290	.	.	ENSG00000125772	ENST00000379019	T	0.47869	0.83	5.26	0.188	0.15114	.	0.000000	0.85682	D	0.000000	T	0.47820	0.1466	L	0.29908	0.895	0.51233	D	0.999917	D	0.76494	0.999	D	0.66196	0.942	T	0.40098	-0.9581	10	0.62326	D	0.03	-21.8395	7.1072	0.25370	0.2286:0.0:0.2663:0.5051	.	219	Q9NPB8	GPCP1_HUMAN	M	219	ENSP00000368305:I219M	ENSP00000368305:I219M	I	-	3	3	GPCPD1	5507074	1.000000	0.71417	0.997000	0.53966	0.951000	0.60555	1.277000	0.33167	-0.167000	0.10871	-0.468000	0.05107	ATA		0.448	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1		NM_019593	
MROH2B	133558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	41012760	41012760	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr5:41012760G>C	ENST00000399564.4	-	30	3510	c.3060C>G	c.(3058-3060)aaC>aaG	p.N1020K	MROH2B_ENST00000506092.2_Missense_Mutation_p.N575K	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1020								p.N1020K(1)									TACAAGTGGGGTTGAGGCTCT	0.458																																																	1	Substitution - Missense(1)	kidney(1)											123.0	120.0	121.0					5																	41012760		1925	4140	6065	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3060C>G	5.37:g.41012760G>C	ENSP00000382476:p.Asn1020Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	G	6.857	0.527366	0.13066	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.05139	3.49;3.49	6.04	2.37	0.29283	Armadillo-like helical (1);Armadillo-type fold (1);	0.392235	0.24657	N	0.036666	T	0.05273	0.0140	L	0.53249	1.67	0.09310	N	1	P	0.42692	0.787	B	0.36666	0.23	T	0.32214	-0.9915	10	0.08381	T	0.77	.	7.8296	0.29334	0.3233:0.0:0.6767:0.0	.	1020	Q7Z745	HTRB2_HUMAN	K	575;725;1020	ENSP00000441504:N575K;ENSP00000382476:N1020K	ENSP00000296803:N725K	N	-	3	2	HEATR7B2	41048517	0.862000	0.29867	0.010000	0.14722	0.046000	0.14306	0.774000	0.26675	0.163000	0.19507	-0.254000	0.11334	AAC		0.458	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2		NM_173489	
HOXC8	3224	hgsc.bcm.edu;ucsc.edu	37	12	54403321	54403328	+	Frame_Shift_Del	DEL	GCCTCCAA	GCCTCCAA	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	GCCTCCAA	GCCTCCAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr12:54403321_54403328delGCCTCCAA	ENST00000040584.4	+	1	490_497	c.253_260delGCCTCCAA	c.(253-261)gcctccaaafs	p.ASK85fs	RP11-834C11.12_ENST00000513209.1_Intron	NM_022658.3	NP_073149.1	P31273	HXC8_HUMAN	homeobox C8	85					anterior/posterior pattern specification (GO:0009952)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	8						CCACGGAGACGCCTCCAAATTCTATGGC	0.587																																					GBM(197;701 2226 7002 18822 41696)												0																																										SO:0001589	frameshift_variant	3224			X99680	CCDS8870.1	12q13.13	2011-06-20	2005-12-22			ENSG00000037965		"""Homeoboxes / ANTP class : HOXL subclass"""	5129	protein-coding gene	gene with protein product		142970	"""homeo box C8"""	HOX3, HOX3A		1973146, 1358459	Standard	NM_022658		Approved		uc001ser.3	P31273		ENST00000040584.4:c.253_260delGCCTCCAA	12.37:g.54403321_54403328delGCCTCCAA	ENSP00000040584:p.Ala85fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4J4|O15221|O15362	Frame_Shift_Del	DEL	ENST00000040584.4	37	CCDS8870.1																																																																																				0.587	HOXC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358957.2			
IQGAP2	10788	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	75866461	75866461	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr5:75866461G>T	ENST00000274364.6	+	4	657	c.360G>T	c.(358-360)atG>atT	p.M120I	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	120	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.M120I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TAAGAGCGATGGAGTCTATTG	0.448																																																	1	Substitution - Missense(1)	kidney(1)											167.0	158.0	161.0					5																	75866461		2203	4300	6503	SO:0001583	missense	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.360G>T	5.37:g.75866461G>T	ENSP00000274364:p.Met120Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929442	0.73327	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	T;T;T	0.39406	1.08;1.08;1.08	5.52	5.52	0.82312	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.51415	0.1673	L	0.42245	1.32	0.80722	D	1	B	0.31026	0.304	P	0.45881	0.496	T	0.42699	-0.9436	10	0.33141	T	0.24	-33.1508	19.4372	0.94801	0.0:0.0:1.0:0.0	.	120	Q13576	IQGA2_HUMAN	I	120;93;70	ENSP00000274364:M120I;ENSP00000423672:M93I;ENSP00000421097:M70I	ENSP00000274364:M120I	M	+	3	0	IQGAP2	75902217	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.657000	0.98554	2.601000	0.87937	0.655000	0.94253	ATG		0.448	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1		NM_006633	
KIAA1279	26128	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	70748679	70748679	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr10:70748679G>A	ENST00000361983.4	+	1	193	c.91G>A	c.(91-93)Gaa>Aaa	p.E31K		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	31					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)	p.E31K(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						TCCGGAGAAGGAACCATACAA	0.622											OREG0020215	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											66.0	74.0	71.0					10																	70748679		2203	4300	6503	SO:0001583	missense	26128			BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.91G>A	10.37:g.70748679G>A	ENSP00000354848:p.Glu31Lys	Somatic	1124	WXS	Illumina HiSeq	Phase_I	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Missense_Mutation	SNP	ENST00000361983.4	37	CCDS7284.1	.	.	.	.	.	.	.	.	.	.	G	34	5.326873	0.95708	.	.	ENSG00000198954	ENST00000361983	T	0.53640	0.61	5.88	4.97	0.65823	.	0.259655	0.44285	D	0.000469	T	0.44307	0.1287	M	0.63843	1.955	0.58432	D	0.999991	P	0.43094	0.799	B	0.35931	0.214	T	0.50021	-0.8876	10	0.46703	T	0.11	-12.8144	15.4334	0.75121	0.0675:0.0:0.9325:0.0	.	31	Q96EK5	KBP_HUMAN	K	31	ENSP00000354848:E31K	ENSP00000354848:E31K	E	+	1	0	KIAA1279	70418685	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.220000	0.72237	2.779000	0.95612	0.650000	0.86243	GAA		0.622	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048370.1		NM_015634	
KLK10	5655	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	51518692	51518692	+	Missense_Mutation	SNP	C	C	T	rs142960865		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr19:51518692C>T	ENST00000309958.3	-	5	877	c.659G>A	c.(658-660)cGg>cAg	p.R220Q	KLK10_ENST00000391805.1_Missense_Mutation_p.R220Q|CTC-518B2.12_ENST00000596286.1_RNA|KLK10_ENST00000358789.3_Missense_Mutation_p.R220Q	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	220	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R220Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		GTCCTGGCCCCGGTCCAGTCC	0.587																																																	1	Substitution - Missense(1)	kidney(1)						C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	172.0	158.0	163.0		659,659,659	-0.5	0.0	19	dbSNP_134	163	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	KLK10	NM_001077500.1,NM_002776.4,NM_145888.2	43,43,43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign	220/277,220/277,220/277	51518692	2,13004	2203	4300	6503	SO:0001583	missense	5655			AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.659G>A	19.37:g.51518692C>T	ENSP00000311746:p.Arg220Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	ENST00000309958.3	37	CCDS12817.1	.	.	.	.	.	.	.	.	.	.	c	6.841	0.524481	0.13066	0.0	2.33E-4	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.88431	-2.38;-2.38;-2.38	4.45	-0.516	0.11950	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.989793	0.08180	N	0.985681	T	0.78298	0.4261	N	0.14661	0.345	0.20703	N	0.999863	B	0.06786	0.001	B	0.04013	0.001	T	0.62656	-0.6808	10	0.37606	T	0.19	.	8.6976	0.34305	0.0:0.5362:0.0:0.4638	.	220	O43240	KLK10_HUMAN	Q	220	ENSP00000375681:R220Q;ENSP00000311746:R220Q;ENSP00000351640:R220Q	ENSP00000311746:R220Q	R	-	2	0	KLK10	56210504	0.019000	0.18553	0.010000	0.14722	0.871000	0.50021	0.842000	0.27627	-0.074000	0.12820	-0.459000	0.05422	CGG		0.587	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2		NM_002776	
LCN12	286256	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	139849846	139849846	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr9:139849846T>C	ENST00000371633.3	+	6	574	c.574T>C	c.(574-576)Tgt>Cgt	p.C192R	LCN12_ENST00000466277.1_3'UTR	NM_178536.3	NP_848631.2	Q6JVE5	LCN12_HUMAN	lipocalin 12	192					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.C192R(1)		endometrium(1)|kidney(1)|lung(1)|prostate(2)	5	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GGCCAGCGTCTGTTGAAGGAT	0.632																																																	1	Substitution - Missense(1)	kidney(1)											53.0	61.0	58.0					9																	139849846		2082	4223	6305	SO:0001583	missense	286256			BC041168	CCDS7018.2	9q34	2011-10-24	2007-12-18		ENSG00000184925	ENSG00000184925		"""Lipocalins"""	28733	protein-coding gene	gene with protein product		612905				15363845	Standard	XM_005266068		Approved	MGC48935	uc004ckb.3	Q6JVE5	OTTHUMG00000020968	ENST00000371633.3:c.574T>C	9.37:g.139849846T>C	ENSP00000360696:p.Cys192Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A2AMJ7	Missense_Mutation	SNP	ENST00000371633.3	37	CCDS7018.2	.	.	.	.	.	.	.	.	.	.	T	11.22	1.574711	0.28092	.	.	ENSG00000184925	ENST00000371633	T	0.50277	0.75	1.85	0.656	0.17844	.	.	.	.	.	T	0.32704	0.0838	L	0.34521	1.04	0.22127	N	0.999342	B	0.25719	0.132	B	0.21546	0.035	T	0.29027	-1.0025	9	0.87932	D	0	.	5.272	0.15630	0.0:0.1676:0.0:0.8324	.	192	Q6JVE5	LCN12_HUMAN	R	192	ENSP00000360696:C192R	ENSP00000360696:C192R	C	+	1	0	LCN12	138969667	0.107000	0.21998	0.015000	0.15790	0.028000	0.11728	0.293000	0.19029	0.186000	0.20125	0.391000	0.25812	TGT		0.632	LCN12-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257990.1		NM_178536	
LRP1	4035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57554852	57554852	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr12:57554852T>C	ENST00000243077.3	+	13	2622	c.2156T>C	c.(2155-2157)tTc>tCc	p.F719S		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	719					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.F719S(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GTGGATGCCTTCTACGACCGC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											136.0	130.0	132.0					12																	57554852		2203	4300	6503	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.2156T>C	12.37:g.57554852T>C	ENSP00000243077:p.Phe719Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562194	0.45590	.	.	ENSG00000123384	ENST00000243077	T	0.25579	1.79	5.32	5.32	0.75619	Six-bladed beta-propeller, TolB-like (1);	0.079738	0.52532	D	0.000067	T	0.14313	0.0346	N	0.17723	0.515	0.80722	D	1	P	0.37466	0.596	B	0.29785	0.107	T	0.11916	-1.0568	10	0.17832	T	0.49	.	13.5753	0.61870	0.0:0.0:0.0:1.0	.	719	Q07954	LRP1_HUMAN	S	719	ENSP00000243077:F719S	ENSP00000243077:F719S	F	+	2	0	LRP1	55841119	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.094000	0.41719	2.371000	0.80710	0.533000	0.62120	TTC		0.582	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2		NM_002332	
MAGEB4	4115	broad.mit.edu;hgsc.bcm.edu	37	X	30260747	30260747	+	Silent	SNP	C	C	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chrX:30260747C>G	ENST00000378982.2	+	1	691	c.495C>G	c.(493-495)gcC>gcG	p.A165A	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	165	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.A165A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						TTGGCCTTGCCTTGAAGGAGG	0.532																																																	1	Substitution - coding silent(1)	kidney(1)											68.0	48.0	54.0					X																	30260747		2202	4300	6502	SO:0001819	synonymous_variant	4115				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.495C>G	X.37:g.30260747C>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2R9G0|Q6FHH4|Q8IZ00	Silent	SNP	ENST00000378982.2	37	CCDS14221.1																																																																																				0.532	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1		NM_002367	
MKI67	4288	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	129911780	129911780	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr10:129911780G>C	ENST00000368654.3	-	8	1942	c.1567C>G	c.(1567-1569)Cct>Gct	p.P523A	MKI67_ENST00000484853.1_5'Flank|MKI67_ENST00000368653.3_Missense_Mutation_p.P163A	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	523					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.P523A(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGCGTATTAGGAGGCAAGTTT	0.448																																																	1	Substitution - Missense(1)	kidney(1)											171.0	156.0	161.0					10																	129911780		2203	4300	6503	SO:0001583	missense	4288			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1567C>G	10.37:g.129911780G>C	ENSP00000357643:p.Pro523Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734688	0.69189	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609;ENST00000368652	T;T	0.03413	3.94;4.56	4.84	3.94	0.45596	.	0.067674	0.64402	D	0.000013	T	0.09686	0.0238	L	0.38175	1.15	0.43988	D	0.996688	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.71870	0.975;0.975;0.961	T	0.14671	-1.0464	10	0.42905	T	0.14	.	11.3735	0.49713	0.083:0.0:0.917:0.0	.	523;163;523	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	A	523;163;523;98	ENSP00000357643:P523A;ENSP00000357642:P163A	ENSP00000357641:P98A	P	-	1	0	MKI67	129801770	1.000000	0.71417	0.995000	0.50966	0.535000	0.34838	6.445000	0.73456	1.274000	0.44362	0.655000	0.94253	CCT		0.448	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1		NM_002417	
MRPS5	64969	broad.mit.edu;hgsc.bcm.edu	37	2	95773989	95773989	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr2:95773989C>A	ENST00000272418.2	-	5	776	c.568G>T	c.(568-570)Gag>Tag	p.E190*		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	190					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.E190*(1)		central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						CATCCTCGCTCCCGTTTAACC	0.532																																																	1	Substitution - Nonsense(1)	kidney(1)											210.0	172.0	185.0					2																	95773989		2203	4300	6503	SO:0001587	stop_gained	64969			AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.568G>T	2.37:g.95773989C>A	ENSP00000272418:p.Glu190*	Somatic		WXS	Illumina HiSeq	Phase_I	Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Nonsense_Mutation	SNP	ENST00000272418.2	37	CCDS2010.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396195	0.42512	.	.	ENSG00000144029	ENST00000272418	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.6684	16.3231	0.82958	0.0:1.0:0.0:0.0	.	.	.	.	X	190	.	ENSP00000272418:E190X	E	-	1	0	MRPS5	95137716	1.000000	0.71417	0.999000	0.59377	0.045000	0.14185	5.504000	0.66968	2.526000	0.85167	0.462000	0.41574	GAG		0.532	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252772.1		NM_031902	
MUC16	94025	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	9089041	9089041	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr19:9089041C>A	ENST00000397910.4	-	1	2977	c.2774G>T	c.(2773-2775)aGt>aTt	p.S925I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	925	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S925I(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACTGAGGTACTGCTCGTAGC	0.493																																																	2	Substitution - Missense(2)	kidney(2)											98.0	99.0	99.0					19																	9089041		1972	4171	6143	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2774G>T	19.37:g.9089041C>A	ENSP00000381008:p.Ser925Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	2.888	-0.230305	0.05983	.	.	ENSG00000181143	ENST00000397910	T	0.02682	4.2	1.55	0.485	0.16830	.	.	.	.	.	T	0.02727	0.0082	N	0.14661	0.345	.	.	.	D	0.62365	0.991	P	0.50231	0.635	T	0.44937	-0.9295	8	0.87932	D	0	.	3.902	0.09166	0.0:0.7622:0.0:0.2378	.	925	B5ME49	.	I	925	ENSP00000381008:S925I	ENSP00000381008:S925I	S	-	2	0	MUC16	8950041	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-1.498000	0.02287	0.223000	0.20920	0.205000	0.17691	AGT		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
MUC4	4585	hgsc.bcm.edu	37	3	195508415	195508462	+	In_Frame_Del	DEL	GCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACAT	GCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACAT	-	rs552027036|rs568124972|rs374252082|rs200683272|rs199756970|rs201319965|rs560125103|rs71187746|rs537438050|rs529417345|rs150749980|rs527497274|rs549411987|rs548345415|rs113897465|rs201933946|rs201140402	byFrequency	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	GCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACAT	GCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr3:195508415_195508462delGCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACAT	ENST00000463781.3	-	2	10448_10495	c.9989_10036delATGTCACCAGCCCTTCCTCAGCATCCACAGGTGACACCACCCCTGTGC	c.(9988-10038)catgtcaccagcccttcctcagcatccacaggtgacaccacccctgtgcct>cct	p.HVTSPSSASTGDTTPV3330del	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_In_Frame_Del_p.HVTSPSSASTGDTTPV3330del	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3305_S3336delVSTGHATPLLVTDASSASTGHATPLHVTSPSS(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TCGGTGACAGGCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACATGAAGAGGGGT	0.585																																																	1	Deletion - In frame(1)	stomach(1)																																								SO:0001651	inframe_deletion	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9989_10036delATGTCACCAGCCCTTCCTCAGCATCCACAGGTGACACCACCCCTGTGC	3.37:g.195508415_195508462delGCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACAT	ENSP00000417498:p.His3330_Val3345del	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Del	DEL	ENST00000463781.3	37	CCDS54700.1																																																																																				0.585	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
NCAPG	64151	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	17826669	17826670	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr4:17826669_17826670delAA	ENST00000251496.2	+	10	1638_1639	c.1462_1463delAA	c.(1462-1464)aaafs	p.K488fs		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	488					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		TGTAAGAAAGAAAGAACTCAAG	0.391																																																	0																																										SO:0001589	frameshift_variant	64151			AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.1462_1463delAA	4.37:g.17826669_17826670delAA	ENSP00000251496:p.Lys488fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Frame_Shift_Del	DEL	ENST00000251496.2	37	CCDS3424.1																																																																																				0.391	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1		NM_022346	
NEFH	4744	hgsc.bcm.edu	37	22	29885575	29885576	+	In_Frame_Ins	INS	-	-	TGAGAAGGCCAAGTCCCC	rs149950279		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr22:29885575_29885576insTGAGAAGGCCAAGTCCCC	ENST00000310624.6	+	4	1979_1980	c.1946_1947insTGAGAAGGCCAAGTCCCC	c.(1945-1950)cctgag>ccTGAGAAGGCCAAGTCCCCtgag	p.649_650PE>PEKAKSPE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	655	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GCAAAGTCCCCTGAGAAGGCCA	0.569																																																	0																																										SO:0001652	inframe_insertion	4744				CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1947_1964dupTGAGAAGGCCAAGTCCCC	22.37:g.29885575_29885576insTGAGAAGGCCAAGTCCCC	ENSP00000311997:p.Glu644_Pro649dup	Somatic		WXS	Illumina HiSeq	Phase_I	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																				0.569	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2		NM_021076	
NPNT	255743	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	106863727	106863727	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr4:106863727C>A	ENST00000379987.2	+	8	1243	c.1027C>A	c.(1027-1029)Cca>Aca	p.P343T	NPNT_ENST00000453617.2_Missense_Mutation_p.P360T|NPNT_ENST00000305572.8_Missense_Mutation_p.P343T|NPNT_ENST00000506666.1_Missense_Mutation_p.P373T|NPNT_ENST00000514622.1_Missense_Mutation_p.P343T|NPNT_ENST00000427316.2_Missense_Mutation_p.P373T	NM_001033047.2	NP_001028219.1	Q6UXI9	NPNT_HUMAN	nephronectin	343	Pro-rich.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to tumor necrosis factor (GO:0071356)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|pilomotor reflex (GO:0097195)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|ureteric bud development (GO:0001657)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integrin alpha8-beta1 complex (GO:0034678)|proteinaceous extracellular matrix (GO:0005578)|smooth muscle contractile fiber (GO:0030485)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.P343T(1)		kidney(5)|large_intestine(2)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	21		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		AACACCTCTACCACCTACAAC	0.532																																																	1	Substitution - Missense(1)	kidney(1)											125.0	114.0	118.0					4																	106863727		2203	4300	6503	SO:0001583	missense	255743				CCDS34046.1, CCDS54784.1, CCDS54785.1, CCDS54786.1, CCDS54787.1	4q25	2005-10-07							27405	protein-coding gene	gene with protein product		610306				15754038	Standard	NM_001033047		Approved	EGFL6L, POEM	uc011cfd.2	Q6UXI9		ENST00000379987.2:c.1027C>A	4.37:g.106863727C>A	ENSP00000369323:p.Pro343Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NFT9|A8K1W4|B4DIT4|B4DYK3|B4E2H7|B4E3H2|D6RCA1|E9PCK8|E9PCQ1|E9PE64|E9PF04	Missense_Mutation	SNP	ENST00000379987.2	37	CCDS34046.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.868|9.868	1.198248|1.198248	0.22037|0.22037	.|.	.|.	ENSG00000168743|ENSG00000168743	ENST00000379987;ENST00000453617;ENST00000427316;ENST00000514622;ENST00000305572;ENST00000506666;ENST00000503451|ENST00000514837	T;T;T;T;T;T;T|.	0.78816|.	-0.78;-1.13;-0.87;-1.21;-0.88;-0.88;-0.02|.	5.31|5.31	4.44|4.44	0.53790|0.53790	.|.	0.144445|.	0.64402|.	D|.	0.000005|.	T|T	0.28928|0.28928	0.0718|0.0718	N|N	0.08118|0.08118	0|0	0.27386|0.27386	N|N	0.95529|0.95529	P;P;P;P;P;P;P|.	0.49783|.	0.883;0.546;0.546;0.546;0.546;0.928;0.546|.	B;B;B;B;B;P;B|.	0.49226|.	0.399;0.202;0.202;0.202;0.202;0.603;0.202|.	T|T	0.15093|0.15093	-1.0449|-1.0449	10|5	0.18710|.	T|.	0.47|.	.|.	16.0103|16.0103	0.80399|0.80399	0.0:0.8658:0.1342:0.0|0.0:0.8658:0.1342:0.0	.|.	343;373;373;360;390;343;343|.	E9PF04;E9PE64;E9PCQ1;E9PCK8;D6RH31;Q6UXI9-2;Q6UXI9|.	.;.;.;.;.;.;NPNT_HUMAN|.	T|N	343;360;373;343;343;373;390|319	ENSP00000369323:P343T;ENSP00000402884:P360T;ENSP00000389252:P373T;ENSP00000422044:P343T;ENSP00000302557:P343T;ENSP00000422474:P373T;ENSP00000426146:P390T|.	ENSP00000302557:P343T|.	P|T	+|+	1|2	0|0	NPNT|NPNT	107083176|107083176	0.021000|0.021000	0.18746|0.18746	0.044000|0.044000	0.18714|0.18714	0.001000|0.001000	0.01503|0.01503	0.765000|0.765000	0.26546|0.26546	2.477000|2.477000	0.83638|0.83638	0.555000|0.555000	0.69702|0.69702	CCA|ACC		0.532	NPNT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364083.1		NM_198278	
NUMA1	4926	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	71735322	71735322	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr11:71735322T>C	ENST00000393695.3	-	5	537	c.206A>G	c.(205-207)cAg>cGg	p.Q69R	NUMA1_ENST00000358965.6_Missense_Mutation_p.Q69R|NUMA1_ENST00000351960.6_Missense_Mutation_p.Q69R	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.Q69R(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						GTGCTTACTCTGCAGAAAACT	0.483			T	RARA	APL																																			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	1	Substitution - Missense(1)	kidney(1)											103.0	93.0	96.0					11																	71735322		2200	4293	6493	SO:0001583	missense	4926			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.206A>G	11.37:g.71735322T>C	ENSP00000377298:p.Gln69Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000393695.3	37	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.237936	0.58886	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000542977;ENST00000537217;ENST00000544238;ENST00000543937;ENST00000543009;ENST00000537930;ENST00000544129;ENST00000535947;ENST00000535087;ENST00000368959;ENST00000541719;ENST00000366394;ENST00000541641	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;1.0;1.0;1.0;1.0	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000001	T	0.59514	0.2199	M	0.64997	1.995	0.38456	D	0.947094	D;D;D;D;D;D	0.67145	0.996;0.981;0.981;0.969;0.992;0.969	D;D;D;P;D;P	0.75484	0.986;0.969;0.969;0.766;0.979;0.654	T	0.62737	-0.6791	10	0.44086	T	0.13	.	12.5396	0.56161	0.0:0.0:0.0:1.0	.	69;69;69;69;69;69	F5H6Y5;F5H4J1;A8K394;Q14980-2;Q14980;Q9BTE9	.;.;.;.;NUMA1_HUMAN;.	R	69	ENSP00000260051:Q69R;ENSP00000351851:Q69R;ENSP00000377298:Q69R;ENSP00000444880:Q69R;ENSP00000442936:Q69R;ENSP00000442761:Q69R;ENSP00000439759:Q69R;ENSP00000438821:Q69R;ENSP00000438589:Q69R;ENSP00000439092:Q69R;ENSP00000444175:Q69R;ENSP00000439576:Q69R;ENSP00000357955:Q69R;ENSP00000438331:Q69R;ENSP00000438318:Q69R;ENSP00000441598:Q69R	ENSP00000260051:Q69R	Q	-	2	0	NUMA1	71412970	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.404000	0.59735	2.138000	0.66242	0.533000	0.62120	CAG		0.483	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1			
PBRM1	55193	hgsc.bcm.edu;ucsc.edu	37	3	52598097	52598102	+	In_Frame_Del	DEL	TAGCAG	TAGCAG	-	rs150890583		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	TAGCAG	TAGCAG	TAGCAG	-	TAGCAG	TAGCAG	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr3:52598097_52598102delTAGCAG	ENST00000296302.7	-	23	3840_3845	c.3839_3844delCTGCTA	c.(3838-3846)tctgctaaa>taa	p.1280_1282SAK>*	SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000394830.3_In_Frame_Del_p.1255_1257SAK>*|PBRM1_ENST00000409057.1_In_Frame_Del_p.1280_1282SAK>*|PBRM1_ENST00000337303.4_In_Frame_Del_p.1280_1282SAK>*|PBRM1_ENST00000410007.1_In_Frame_Del_p.1255_1257SAK>*|PBRM1_ENST00000409767.1_In_Frame_Del_p.1295_1297SAK>*|PBRM1_ENST00000356770.4_In_Frame_Del_p.1248_1250SAK>*|PBRM1_ENST00000409114.3_In_Frame_Del_p.1295_1297SAK>*			Q86U86	PB1_HUMAN	polybromo 1	1280					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCTACCACTTTAGCAGAGAGTGAAAA	0.374			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0																																										SO:0001651	inframe_deletion	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3839_3844delCTGCTA	3.37:g.52598097_52598102delTAGCAG	ENSP00000296302:p.Ser1280_Lys1282delins*	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	In_Frame_Del	DEL	ENST00000296302.7	37																																																																																					0.374	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PKD1L3	342372	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	72033601	72033601	+	RNA	SNP	G	G	C	rs368433753		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr16:72033601G>C	ENST00000534738.1	-	0	276							Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)	p.Q93E(1)		autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						TTGTTGTCTTGATGCTTTTTC	0.368																																																	1	Substitution - Missense(1)	kidney(1)											150.0	115.0	126.0					16																	72033601		692	1591	2283			342372			AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.72033601G>C		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000534738.1	37																																																																																					0.368	PKD1L3-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000387876.1		NM_181536	
PKP2	5318	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	32975511	32975511	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr12:32975511C>T	ENST00000070846.6	-	9	1885	c.1861G>A	c.(1861-1863)Gag>Aag	p.E621K	PKP2_ENST00000340811.4_Missense_Mutation_p.E577K	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	621					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)	p.E621K(1)		NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TCTGGGAGCTCTGCCTCCAGC	0.413																																																	1	Substitution - Missense(1)	kidney(1)											96.0	94.0	95.0					12																	32975511		2203	4300	6503	SO:0001583	missense	5318			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1861G>A	12.37:g.32975511C>T	ENSP00000070846:p.Glu621Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	37	CCDS8731.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318096	0.81469	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.83914	-1.78;-1.78	5.05	5.05	0.67936	Armadillo-like helical (1);Armadillo-type fold (1);	0.057793	0.64402	D	0.000002	D	0.88526	0.6460	M	0.84683	2.71	0.49130	D	0.99975	P;P;P	0.50528	0.867;0.791;0.936	P;B;P	0.49683	0.616;0.411;0.619	D	0.90883	0.4755	10	0.87932	D	0	0.2032	16.6153	0.84909	0.0:1.0:0.0:0.0	.	577;577;621	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	K	577;621;621	ENSP00000342800:E577K;ENSP00000070846:E621K	ENSP00000070846:E621K	E	-	1	0	PKP2	32866778	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.669000	0.61575	2.328000	0.79073	0.563000	0.77884	GAG		0.413	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1		NM_004572	
SCAPER	49855	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	77059317	77059317	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr15:77059317A>G	ENST00000563290.1	-	11	1456	c.1361T>C	c.(1360-1362)aTt>aCt	p.I454T	SCAPER_ENST00000538941.2_Missense_Mutation_p.I208T|SCAPER_ENST00000324767.7_Missense_Mutation_p.I454T			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	454	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.I454T(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TTCAGCTTCAATTTCTCTAGT	0.333																																																	1	Substitution - Missense(1)	kidney(1)											170.0	152.0	158.0					15																	77059317		1826	4074	5900	SO:0001583	missense	49855			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1361T>C	15.37:g.77059317A>G	ENSP00000454973:p.Ile454Thr	Somatic		WXS	Illumina HiSeq	Phase_I	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.120113	0.77323	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.35048	1.36;1.33	5.55	5.55	0.83447	.	0.187851	0.56097	D	0.000034	T	0.47395	0.1443	N	0.24115	0.695	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	T	0.51434	-0.8706	10	0.66056	D	0.02	.	15.698	0.77515	1.0:0.0:0.0:0.0	.	454;475;208	Q6NSF1;Q9BY12-2;F5H7X8	.;.;.	T	454;208;476	ENSP00000326924:I454T;ENSP00000442190:I208T	ENSP00000303560:I476T	I	-	2	0	SCAPER	74846372	1.000000	0.71417	0.996000	0.52242	0.723000	0.41478	8.759000	0.91667	2.116000	0.64780	0.254000	0.18369	ATT		0.333	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1		NM_020843	
SEMA3E	9723	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	83021907	83021907	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr7:83021907C>A	ENST00000307792.3	-	14	2098	c.1631G>T	c.(1630-1632)tGc>tTc	p.C544F	SEMA3E_ENST00000427262.1_Missense_Mutation_p.C484F	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	544					axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.C544F(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				ATACCGGGAGCAGGATATGCC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											113.0	97.0	102.0					7																	83021907		2203	4300	6503	SO:0001583	missense	9723			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1631G>T	7.37:g.83021907C>A	ENSP00000303212:p.Cys544Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	37	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527139	0.85706	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.22945	1.93;1.93	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.65059	0.2655	H	0.94658	3.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75761	-0.3204	10	0.87932	D	0	.	19.3565	0.94416	0.0:1.0:0.0:0.0	.	544	O15041	SEM3E_HUMAN	F	544;484;544	ENSP00000303212:C544F;ENSP00000405052:C484F	ENSP00000303212:C544F	C	-	2	0	SEMA3E	82859843	1.000000	0.71417	0.987000	0.45799	0.933000	0.57130	7.750000	0.85110	2.652000	0.90054	0.585000	0.79938	TGC		0.473	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1		NM_012431	
SETD2	29072	hgsc.bcm.edu;ucsc.edu	37	3	47108557	47108557	+	Intron	SNP	T	T	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr3:47108557T>A	ENST00000409792.3	-	13	6152				SETD2_ENST00000492397.1_Intron	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCTGAATACCTACTTGTGTTT	0.353			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													210.0	210.0	210.0					3																	47108557		2203	4300	6503	SO:0001627	intron_variant	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6109+2A>T	3.37:g.47108557T>A		Somatic		WXS	Illumina HiSeq	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Intron	SNP	ENST00000409792.3	37	CCDS2749.2																																																																																				0.353	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	
SETD3	84193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	99932102	99932102	+	Missense_Mutation	SNP	G	G	A	rs186182372		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr14:99932102G>A	ENST00000331768.5	-	2	200	c.41C>T	c.(40-42)aCt>aTt	p.T14I	SETD3_ENST00000329331.3_Missense_Mutation_p.T14I|SETD3_ENST00000436070.2_Missense_Mutation_p.T14I|SETD3_ENST00000453938.1_5'UTR	NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	14					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)	p.T14I(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				TGTAGCACCAGTGCCAGATTT	0.428																																																	1	Substitution - Missense(1)	kidney(1)											173.0	159.0	164.0					14																	99932102		2203	4300	6503	SO:0001583	missense	84193			AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.41C>T	14.37:g.99932102G>A	ENSP00000327436:p.Thr14Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Missense_Mutation	SNP	ENST00000331768.5	37	CCDS9951.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022199	0.54683	.	.	ENSG00000183576	ENST00000331768;ENST00000329331;ENST00000436070	T;T;T	0.24350	2.61;1.86;1.87	5.8	3.97	0.46021	.	0.270733	0.34932	N	0.003569	T	0.21841	0.0526	L	0.54323	1.7	0.38535	D	0.949062	B;B;P	0.44195	0.165;0.026;0.828	B;B;B	0.37650	0.102;0.057;0.255	T	0.06570	-1.0819	10	0.26408	T	0.33	-1.9403	10.2928	0.43605	0.067:0.2541:0.6789:0.0	.	14;14;14	Q6NXR6;A0PJU3;Q86TU7	.;.;SETD3_HUMAN	I	14	ENSP00000327436:T14I;ENSP00000327910:T14I;ENSP00000408602:T14I	ENSP00000327910:T14I	T	-	2	0	SETD3	99001855	1.000000	0.71417	0.987000	0.45799	0.980000	0.70556	3.634000	0.54302	0.790000	0.33803	-0.126000	0.14955	ACT		0.428	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3		NM_032233	
SNX14	57231	hgsc.bcm.edu	37	6	86303401	86303401	+	Silent	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr6:86303401C>T	ENST00000314673.3	-	1	212	c.36G>A	c.(34-36)ctG>ctA	p.L12L	SNX14_ENST00000505648.1_Intron|SNX14_ENST00000369627.2_Silent_p.L12L|SNX14_ENST00000513865.1_Silent_p.L12L|RP11-321N4.5_ENST00000503906.1_Intron|SNX14_ENST00000346348.3_Silent_p.L12L	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	12					protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		GCCGCTGCTTCAGCTTCTGCC	0.657																																																	0													43.0	37.0	39.0					6																	86303401		2198	4298	6496	SO:0001819	synonymous_variant	57231			AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.36G>A	6.37:g.86303401C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Silent	SNP	ENST00000314673.3	37	CCDS5004.1																																																																																				0.657	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041393.2		NM_153816	
SPTBN1	6711	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	54871514	54871514	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr2:54871514delA	ENST00000356805.4	+	20	4341	c.4060delA	c.(4060-4062)aaafs	p.K1354fs	SPTBN1_ENST00000333896.5_Frame_Shift_Del_p.K1341fs	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1354					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GGTGAAGGAGAAACTCACTGG	0.443																																																	0													84.0	87.0	86.0					2																	54871514		2203	4300	6503	SO:0001589	frameshift_variant	6711				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.4060delA	2.37:g.54871514delA	ENSP00000349259:p.Lys1354fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Frame_Shift_Del	DEL	ENST00000356805.4	37	CCDS33198.1																																																																																				0.443	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			
TCF20	6942	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	42607162	42607162	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr22:42607162C>T	ENST00000359486.3	-	1	4286	c.4150G>A	c.(4150-4152)Gat>Aat	p.D1384N	TCF20_ENST00000335626.4_Missense_Mutation_p.D1384N|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1384					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.D1384N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GACAGTATATCATCAAGCGTA	0.483																																																	1	Substitution - Missense(1)	kidney(1)											117.0	111.0	113.0					22																	42607162		2203	4300	6503	SO:0001583	missense	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.4150G>A	22.37:g.42607162C>T	ENSP00000352463:p.Asp1384Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239103	0.58995	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.61510	0.1;0.1	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000001	T	0.67767	0.2928	L	0.29908	0.895	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.81914	0.995;0.989	T	0.65207	-0.6224	10	0.39692	T	0.17	-24.0244	20.0609	0.97674	0.0:1.0:0.0:0.0	.	1384;1384	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	N	1384	ENSP00000352463:D1384N;ENSP00000335561:D1384N	ENSP00000335561:D1384N	D	-	1	0	TCF20	40937106	0.996000	0.38824	0.996000	0.52242	0.795000	0.44927	2.747000	0.47475	2.755000	0.94549	0.655000	0.94253	GAT		0.483	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1		NM_181492	
TPRG1L	127262	broad.mit.edu;hgsc.bcm.edu	37	1	3545080	3545080	+	Silent	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr1:3545080C>T	ENST00000378344.2	+	5	803	c.732C>T	c.(730-732)ctC>ctT	p.L244L	TPRG1L_ENST00000344579.5_Silent_p.L185L	NM_182752.3	NP_877429.2	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like	244						cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|synaptic vesicle (GO:0008021)		p.L244L(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(1)	8	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		GCCCCCTGCTCATCGAGACCT	0.532																																																	1	Substitution - coding silent(1)	kidney(1)											74.0	68.0	70.0					1																	3545080		2202	4300	6502	SO:0001819	synonymous_variant	127262			BC019034	CCDS47.1	1p36.32	2008-02-05	2008-01-16	2008-01-16	ENSG00000158109	ENSG00000158109			27007	protein-coding gene	gene with protein product		611460	"""family with sequence similarity 79, member A"""	FAM79A		12477932	Standard	NM_182752		Approved	RP11-46F15.3, FLJ21811	uc001akm.3	Q5T0D9	OTTHUMG00000000609	ENST00000378344.2:c.732C>T	1.37:g.3545080C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1K4|Q8WV04	Silent	SNP	ENST00000378344.2	37	CCDS47.1																																																																																				0.532	TPRG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001466.1		NM_182752	
TYRP1	7306	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	12698513	12698513	+	Silent	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr9:12698513C>T	ENST00000388918.5	+	4	900	c.771C>T	c.(769-771)gtC>gtT	p.V257V	TYRP1_ENST00000381136.2_Intron|TYRP1_ENST00000381137.2_Intron|RP11-3L8.3_ENST00000417638.1_RNA	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	257					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V257V(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GGAAAAATGTCTGTGATATCT	0.433									Oculocutaneous Albinism																																								1	Substitution - coding silent(1)	kidney(1)											120.0	115.0	117.0					9																	12698513		2203	4300	6503	SO:0001819	synonymous_variant	7306	Familial Cancer Database		L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.771C>T	9.37:g.12698513C>T		Somatic		WXS	Illumina HiSeq	Phase_I	P78468|P78469|Q13721|Q15679	Silent	SNP	ENST00000388918.5	37	CCDS34990.1																																																																																				0.433	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3		NM_000550	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10191501	10191501	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr3:10191501T>A	ENST00000256474.2	+	3	1334	c.494T>A	c.(493-495)gTt>gAt	p.V165D	VHL_ENST00000345392.2_Missense_Mutation_p.V124D|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	165	Interaction with Elongin BC complex.				cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.V165D(2)|p.V165_V166insV(1)|p.V166fs*8(1)|p.V166fs*5(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TGCCTCCAGGTTGTCCGGAGC	0.502		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	5	Substitution - Missense(2)|Insertion - Frameshift(2)|Insertion - In frame(1)	kidney(5)	GRCh37	HM971603	VHL	M							92.0	84.0	86.0					3																	10191501		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.494T>A	3.37:g.10191501T>A	ENSP00000256474:p.Val165Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517790	0.85495	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99832	-7.02;-7.02	4.86	4.86	0.63082	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.000000	0.85682	D	0.000000	D	0.99684	0.9881	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97130	0.9817	10	0.72032	D	0.01	-4.1006	12.7224	0.57149	0.0:0.0:0.0:1.0	.	124;165	P40337-2;P40337	.;VHL_HUMAN	D	165;124;83	ENSP00000256474:V165D;ENSP00000344757:V124D	ENSP00000256474:V165D	V	+	2	0	VHL	10166501	1.000000	0.71417	0.996000	0.52242	0.958000	0.62258	5.790000	0.69038	2.162000	0.67917	0.533000	0.62120	GTT		0.502	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
ZFY	7544	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	Y	2829144	2829144	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chrY:2829144C>T	ENST00000155093.3	+	3	412	c.91C>T	c.(91-93)Cag>Tag	p.Q31*	ZFY_ENST00000431102.1_Intron|ZFY_ENST00000383052.1_Nonsense_Mutation_p.Q31*|ZFY_ENST00000449237.1_Nonsense_Mutation_p.Q5*	NM_003411.3	NP_003402.2	P08048	ZFY_HUMAN	zinc finger protein, Y-linked	31					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q31*(1)		biliary_tract(1)|kidney(3)|large_intestine(1)|lung(3)	8						GGATGGTGATCAGATTGTTGT	0.318																																																	1	Substitution - Nonsense(1)	kidney(1)											111.0	98.0	101.0					Y																	2829144		632	1990	2622	SO:0001587	stop_gained	7544			L10393	CCDS14774.1, CCDS48200.1, CCDS48201.1	Yp11.3	2013-01-08			ENSG00000067646	ENSG00000067646		"""Zinc fingers, C2H2-type"""	12870	protein-coding gene	gene with protein product		490000				2497060	Standard	NM_001145275		Approved	ZNF911	uc004fqj.3	P08048	OTTHUMG00000036159	ENST00000155093.3:c.91C>T	Y.37:g.2829144C>T	ENSP00000155093:p.Gln31*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DVF7|Q14021|Q15558|Q1RME9|Q24JR0|Q96TF3	Nonsense_Mutation	SNP	ENST00000155093.3	37	CCDS14774.1																																																																																				0.318	ZFY-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088063.1		NM_003411	
ZMYM1	79830	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	35580687	35580688	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr1:35580687_35580688TC>AT	ENST00000373330.1	+	11	3430_3431	c.3256_3257TC>AT	c.(3256-3258)TCa>ATa	p.S1086I	ZMYM1_ENST00000359858.4_Missense_Mutation_p.S1086I|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	1086						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S1086L(1)|p.S1086T(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TACTGAGAACTCATTTTCTACC	0.401																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	79830			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	Exception_encountered	1.37:g.35580687_35580688delinsAT	ENSP00000362427:p.Ser1086Ile	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	CCDS41302.1																																																																																				0.401	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1		NM_024772	
ZSCAN29	146050	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	43653850	43653850	+	Silent	SNP	A	A	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr15:43653850A>G	ENST00000396976.2	-	5	2114	c.1980T>C	c.(1978-1980)ttT>ttC	p.F660F	ZSCAN29_ENST00000568898.1_Silent_p.F270F|ZSCAN29_ENST00000396972.1_Silent_p.F271F|ZSCAN29_ENST00000562072.1_3'UTR	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	660					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.F660F(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		AGTTTGGACCAAAGCTTTTGC	0.453																																																	1	Substitution - coding silent(1)	kidney(1)											146.0	144.0	145.0					15																	43653850		2201	4299	6500	SO:0001819	synonymous_variant	146050			AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.1980T>C	15.37:g.43653850A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B3KVB9|Q32M75|Q32M76|Q8NA40	Silent	SNP	ENST00000396976.2	37	CCDS10095.2																																																																																				0.453	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253278.1		NM_152455	
AIFM2	84883	broad.mit.edu	37	10	71874016	71874016	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr10:71874016C>A	ENST00000307864.1	-	9	1253	c.1040G>T	c.(1039-1041)gGc>gTc	p.G347V	AIFM2_ENST00000373248.1_Missense_Mutation_p.G347V|AIFM2_ENST00000482166.1_5'Flank	NM_001198696.1|NM_032797.5	NP_001185625.1|NP_116186.1	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 2	347					apoptotic mitochondrial changes (GO:0008637)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.G347V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|urinary_tract(2)	16						CATGAGCCGGCCCACATAGAA	0.572																																																	1	Substitution - Missense(1)	kidney(1)											67.0	63.0	64.0					10																	71874016		2203	4300	6503	SO:0001583	missense	84883			AK027403	CCDS7297.1	10q22.2	2006-11-16	2006-11-16	2006-11-16	ENSG00000042286	ENSG00000042286			21411	protein-coding gene	gene with protein product		605159	"""apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death"""	AMID		12135761, 11980907, 15958387	Standard	NM_001198696		Approved	FLJ14497, PRG3	uc001jqp.2	Q9BRQ8	OTTHUMG00000018398	ENST00000307864.1:c.1040G>T	10.37:g.71874016C>A	ENSP00000312370:p.Gly347Val	Somatic		WXS	Illumina GAIIx	Phase_I	B3KXI0|Q63Z39	Missense_Mutation	SNP	ENST00000307864.1	37	CCDS7297.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.247856	0.80024	.	.	ENSG00000042286	ENST00000373248;ENST00000307864;ENST00000395039	T;T	0.35236	1.32;1.32	5.59	5.59	0.84812	.	0.317119	0.35805	N	0.002978	T	0.54334	0.1852	L	0.48642	1.525	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.50074	-0.8870	10	0.48119	T	0.1	-12.1798	17.3794	0.87400	0.0:1.0:0.0:0.0	.	347	Q9BRQ8	AIFM2_HUMAN	V	347;347;310	ENSP00000362345:G347V;ENSP00000312370:G347V	ENSP00000312370:G347V	G	-	2	0	AIFM2	71544022	1.000000	0.71417	0.992000	0.48379	0.958000	0.62258	5.496000	0.66918	2.643000	0.89663	0.650000	0.86243	GGC		0.572	AIFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048487.1		NM_032797	
ALKBH7	84266	broad.mit.edu	37	19	6374925	6374925	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr19:6374925C>A	ENST00000245812.3	+	4	995	c.607C>A	c.(607-609)Cgc>Agc	p.R203S	ALKBH7_ENST00000599849.1_Missense_Mutation_p.R142S|ALKBH7_ENST00000596657.1_Missense_Mutation_p.R61S	NM_032306.3	NP_115682.1	Q9BT30	ALKB7_HUMAN	alkB, alkylation repair homolog 7 (E. coli)	203					cellular response to DNA damage stimulus (GO:0006974)|fatty acid metabolic process (GO:0006631)|regulation of lipid storage (GO:0010883)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)	mitochondrial matrix (GO:0005759)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.R203S(1)		breast(2)|kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						CGTGATCTGCCGCTCCCTCCC	0.607																																																	1	Substitution - Missense(1)	kidney(1)											40.0	43.0	42.0					19																	6374925		2203	4300	6503	SO:0001583	missense	84266			AY427650	CCDS12163.1	19p13.3	2008-02-05	2006-02-09	2006-02-09		ENSG00000125652		"""Alkylation repair homologs"""	21306	protein-coding gene	gene with protein product		613305	"""spermatogenesis associated 11"""	SPATA11		12477932	Standard	NM_032306		Approved	MGC10974	uc002meo.2	Q9BT30		ENST00000245812.3:c.607C>A	19.37:g.6374925C>A	ENSP00000245812:p.Arg203Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B2R4U9|Q53FF3	Missense_Mutation	SNP	ENST00000245812.3	37	CCDS12163.1	.	.	.	.	.	.	.	.	.	.	C	33	5.237760	0.95240	.	.	ENSG00000125652	ENST00000245812	T	0.55413	0.52	4.63	4.63	0.57726	.	0.060003	0.64402	D	0.000002	T	0.80237	0.4586	H	0.94734	3.575	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86136	0.1578	10	0.87932	D	0	-12.177	16.7751	0.85549	0.0:1.0:0.0:0.0	.	203	Q9BT30	ALKB7_HUMAN	S	203	ENSP00000245812:R203S	ENSP00000245812:R203S	R	+	1	0	ALKBH7	6325925	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.637000	0.46553	2.577000	0.86979	0.455000	0.32223	CGC		0.607	ALKBH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453036.1		NM_032306	
NELFB	25920	broad.mit.edu	37	9	140147247	140147247	+	5'Flank	SNP	G	G	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr9:140147247G>A	ENST00000343053.4	+	0	0				C9orf173_ENST00000388931.3_Missense_Mutation_p.G209D|C9orf173_ENST00000412566.1_Missense_Mutation_p.G209D	NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B						gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G209D(1)									AGGGGGCTGGGCCTCAGGGTG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											11.0	12.0	12.0					9																	140147247		1875	4050	5925	SO:0001631	upstream_gene_variant	441476			AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778		9.37:g.140147247G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_I	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	G	6.920	0.539476	0.13250	.	.	ENSG00000197768	ENST00000388931;ENST00000412566	T;T	0.49139	0.89;0.79	3.07	2.16	0.27623	.	3.081050	0.01996	N	0.045883	T	0.48554	0.1506	L	0.43152	1.355	0.09310	N	1	D;P	0.58268	0.982;0.95	P;P	0.51866	0.682;0.469	T	0.37033	-0.9723	10	0.11485	T	0.65	.	6.1948	0.20544	0.1469:0.0:0.8531:0.0	.	209;209	Q8N7X2-2;Q8N7X2-4	.;.	D	209	ENSP00000373583:G209D;ENSP00000391218:G209D	ENSP00000373583:G209D	G	+	2	0	C9orf173	139267068	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.241000	0.18065	0.628000	0.30357	0.561000	0.74099	GGC		0.662	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1		NM_015456	
AMER3	205147	broad.mit.edu	37	2	131520998	131520998	+	Silent	SNP	G	G	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr2:131520998G>A	ENST00000423981.1	+	2	1463	c.1353G>A	c.(1351-1353)ccG>ccA	p.P451P	AMER3_ENST00000321420.4_Silent_p.P451P	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	451					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.P451P(2)									TGTCAGGGCCGGCCCTGGGGA	0.662																																																	2	Substitution - coding silent(2)	prostate(1)|kidney(1)											33.0	36.0	35.0					2																	131520998		2203	4300	6503	SO:0001819	synonymous_variant	0			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.1353G>A	2.37:g.131520998G>A		Somatic		WXS	Illumina GAIIx	Phase_I	B7ZLH6	Silent	SNP	ENST00000423981.1	37	CCDS2164.1																																																																																				0.662	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3		NM_152698	
KRTAP10-6	386674	broad.mit.edu	37	21	46011526	46011526	+	Silent	SNP	T	T	A	rs371768583	byFrequency	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr21:46011526T>A	ENST00000400368.1	-	1	860	c.840A>T	c.(838-840)acA>acT	p.T280T	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	280	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.T280T(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GGCAGCATGATGTGGAAGCCC	0.652													.|||	5	0.000998403	0.0008	0.0	5008	,	,		22429	0.001		0.0	False		,,,				2504	0.0031																1	Substitution - coding silent(1)	kidney(1)											106.0	110.0	109.0					21																	46011526		2203	4300	6503	SO:0001819	synonymous_variant	386674			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.840A>T	21.37:g.46011526T>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000400368.1	37	CCDS42959.1																																																																																				0.652	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1		NM_198688	
Unknown	0	broad.mit.edu	37	12	88906	88906	+	IGR	SNP	A	A	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr12:88906A>T								AC215219.1 (15584 upstream) : AC026369.1 (58145 downstream)																							ccccaccaccacccccaGCTC	0.642																																																	0																																										SO:0001628	intergenic_variant	100288778																															12.37:g.88906A>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP		37																																																																																				0	0.642									
RP11-252A24.2	0	broad.mit.edu	37	16	74372644	74372644	+	RNA	SNP	A	A	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr16:74372644A>G	ENST00000429810.2	-	0	1552																											TACCCTTGTCAGGGGGAACAA	0.443																																																	0																																												283922																															16.37:g.74372644A>G		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000429810.2	37																																																																																					0.443	RP11-252A24.2-003	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000434683.1			
BMS1P20	96610	broad.mit.edu	37	22	22664115	22664115	+	RNA	SNP	A	A	T	rs376271028		TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr22:22664115A>T	ENST00000426066.1	+	0	638					NR_027293.1				BMS1 pseudogene 20																		TGTTTAATTCAGCCTTGGAAG	0.413																																																	0																																												96610					22q11.22	2013-09-20			ENSG00000236850	ENSG00000236850			49153	pseudogene	pseudogene							Standard	XR_430414		Approved				OTTHUMG00000151046		22.37:g.22664115A>T		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000426066.1	37																																																																																					0.413	BMS1P20-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000473090.1			
MAN2A2	4122	broad.mit.edu	37	15	91454153	91454153	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr15:91454153A>C	ENST00000559717.1	+	12	2296	c.1837A>C	c.(1837-1839)Acc>Ccc	p.T613P	MAN2A2_ENST00000431652.2_Missense_Mutation_p.T121P|MAN2A2_ENST00000360468.3_Missense_Mutation_p.T613P|MAN2A2_ENST00000430376.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	613					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.T613P(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GGACAAGGAGACCTACCACTT	0.607																																																	1	Substitution - Missense(1)	kidney(1)											62.0	60.0	60.0					15																	91454153		2198	4298	6496	SO:0001583	missense	4122			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.1837A>C	15.37:g.91454153A>C	ENSP00000452948:p.Thr613Pro	Somatic		WXS	Illumina GAIIx	Phase_I	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	A	16.82	3.228688	0.58777	.	.	ENSG00000196547	ENST00000360468;ENST00000431652	T;T	0.74947	-0.89;-0.89	4.96	1.32	0.21799	Glycosyl hydrolase, family 13, all-beta (1);	0.364494	0.34362	N	0.004034	T	0.71508	0.3348	L	0.58101	1.795	0.33169	D	0.548082	P;P;P;P	0.51147	0.819;0.904;0.942;0.612	P;P;P;B	0.49085	0.514;0.514;0.6;0.284	T	0.73347	-0.4011	10	0.30078	T	0.28	-14.3743	8.8555	0.35225	0.7831:0.0:0.2169:0.0	.	121;241;613;613	B4DEU9;B4DIK4;P49641-1;P49641	.;.;.;MA2A2_HUMAN	P	613;121	ENSP00000353655:T613P;ENSP00000388221:T121P	ENSP00000353655:T613P	T	+	1	0	MAN2A2	89255157	0.000000	0.05858	0.828000	0.32881	0.954000	0.61252	-0.192000	0.09587	0.040000	0.15660	0.254000	0.18369	ACC		0.607	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5		NM_006122	
NBPF12	149013	broad.mit.edu	37	1	146398425	146398425	+	Missense_Mutation	SNP	C	C	A	rs587641665	byFrequency	TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr1:146398425C>A	ENST00000442909.2	+	7	1247	c.411C>A	c.(409-411)gaC>gaA	p.D137E	NBPF12_ENST00000309471.8_Missense_Mutation_p.D62E|NBPF12_ENST00000446760.2_Missense_Mutation_p.D137E			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	0	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.D137E(6)		ovary(2)	2						ATGAGCCGGACAAGTCCCAGG	0.587													.|||	15	0.00299521	0.0045	0.0014	5008	,	,		19569	0.0		0.0	False		,,,				2504	0.0082																6	Substitution - Missense(6)	kidney(6)																																								SO:0001583	missense	100132406			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.411C>A	1.37:g.146398425C>A	ENSP00000391116:p.Asp137Glu	Somatic		WXS	Illumina GAIIx	Phase_I	O95877	Missense_Mutation	SNP	ENST00000442909.2	37		.	.	.	.	.	.	.	.	.	.	N	10.15	1.271473	0.23221	.	.	ENSG00000186275	ENST00000446760;ENST00000442909;ENST00000309471	T;T;T	0.38722	2.65;3.4;1.12	1.12	1.12	0.20585	.	.	.	.	.	T	0.21145	0.0509	M	0.73598	2.24	0.09310	N	1	B	0.26845	0.161	B	0.18263	0.021	T	0.30031	-0.9992	9	0.72032	D	0.01	.	5.9887	0.19448	0.0:1.0:0.0:0.0	.	137	Q86T75-2	.	E	137;137;62	ENSP00000396525:D137E;ENSP00000391116:D137E;ENSP00000311131:D62E	ENSP00000311131:D62E	D	+	3	2	NBPF12	144765738	0.000000	0.05858	0.004000	0.12327	0.015000	0.08874	0.437000	0.21543	1.012000	0.39366	0.361000	0.22055	GAC		0.587	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000102086.3		XM_003119146	
NTRK1	4914	broad.mit.edu	37	1	156843581	156843581	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr1:156843581C>A	ENST00000524377.1	+	8	1048	c.1007C>A	c.(1006-1008)gCa>gAa	p.A336E	NTRK1_ENST00000368196.3_Missense_Mutation_p.A336E|NTRK1_ENST00000358660.3_Missense_Mutation_p.A336E|NTRK1_ENST00000392302.2_Missense_Mutation_p.A306E	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	336	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A336E(3)|p.A306E(3)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CTGGAGCCGGCAGCCAATGAG	0.622			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																														Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	6	Substitution - Missense(6)	endometrium(4)|kidney(2)											46.0	35.0	39.0					1																	156843581		2203	4299	6502	SO:0001583	missense	4914			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1007C>A	1.37:g.156843581C>A	ENSP00000431418:p.Ala336Glu	Somatic		WXS	Illumina GAIIx	Phase_I	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	C	8.154	0.788039	0.16258	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	6.17	2.08	0.27032	Immunoglobulin-like fold (1);	0.558200	0.17457	N	0.173565	T	0.05318	0.0141	N	0.25647	0.755	0.09310	N	1	B;B;B;B	0.12630	0.006;0.003;0.001;0.005	B;B;B;B	0.12837	0.004;0.004;0.002;0.008	T	0.36529	-0.9744	10	0.21540	T	0.41	.	2.0518	0.03572	0.1195:0.4548:0.2106:0.2151	.	336;336;336;306	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	E	306;336;336;336	ENSP00000376120:A306E;ENSP00000357179:A336E;ENSP00000431418:A336E;ENSP00000351486:A336E	ENSP00000351486:A336E	A	+	2	0	NTRK1	155110205	0.000000	0.05858	0.004000	0.12327	0.742000	0.42306	0.343000	0.19944	0.490000	0.27771	0.655000	0.94253	GCA		0.622	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1		NM_002529	
KRT16P6	353194	broad.mit.edu	37	17	16721400	16721400	+	RNA	SNP	A	A	G			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chr17:16721400A>G	ENST00000602730.1	+	0	6486				AC022596.6_ENST00000417510.1_RNA																							GGGATCTTCTAGTGGGATCCG	0.602																																																	0																																												0																															17.37:g.16721400A>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000602730.1	37																																																																																					0.602	RP11-219A15.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000468034.1			
WASH6P	653440	broad.mit.edu	37	X	155254961	155254961	+	RNA	SNP	C	C	T			TCGA-B0-4706-01A-01D-1501-10	TCGA-B0-4706-11A-02D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	040fdd9b-db76-4357-9aed-77a8cbde058d	c9228cb8-9a17-422d-b984-881a1cd1c4e8	g.chrX:155254961C>T	ENST00000461007.1	+	0	3877				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.R453R(1)									CCTTTGCCCGCGTGTCAGACT	0.642																																																	1	Substitution - coding silent(1)	kidney(1)																																										0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254961C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A6NGF1|Q8N305	Silent	SNP	ENST00000461007.1	37																																																																																					0.642	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1		NG_008380	
