#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SNIP1	79753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	38005993	38005993	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:38005993C>G	ENST00000296215.6	-	3	763	c.691G>C	c.(691-693)Gca>Cca	p.A231P	SNIP1_ENST00000468040.1_5'Flank	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1	231					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				TCAAGAAGTGCCCCAGAAAGT	0.502																																					p.A231P		.											.	SNIP1-227	0			c.G691C						.						66.0	69.0	68.0					1																	38005993		2203	4300	6503	SO:0001583	missense	79753	exon3			GAAGTGCCCCAGA		CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225	ENST00000296215.6:c.691G>C	1.37:g.38005993C>G	ENSP00000296215:p.Ala231Pro	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	118	63	NM_024700	0	0	1	2	1	Q96SP9|Q9H9T7	Missense_Mutation	SNP	ENST00000296215.6	37	CCDS419.1	.	.	.	.	.	.	.	.	.	.	C	32	5.162524	0.94727	.	.	ENSG00000163877	ENST00000296215;ENST00000436196	T	0.51071	0.72	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.73094	0.3543	M	0.87682	2.9	0.80722	D	1	D	0.69078	0.997	D	0.66602	0.945	T	0.72931	-0.4142	10	0.39692	T	0.17	-4.7851	20.1865	0.98220	0.0:1.0:0.0:0.0	.	231	Q8TAD8	SNIP1_HUMAN	P	231;215	ENSP00000296215:A231P	ENSP00000296215:A231P	A	-	1	0	SNIP1	37778580	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.440000	0.80464	2.775000	0.95449	0.655000	0.94253	GCA	.		0.502	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012169.2	NM_024700	
DBT	1629	ucsc.edu;bcgsc.ca	37	1	100676255	100676255	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:100676255A>G	ENST00000370132.4	-	8	1025	c.1012T>C	c.(1012-1014)Tat>Cat	p.Y338H	DBT_ENST00000370131.3_3'UTR	NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	338					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		CCAACCTTATATGTTATATTC	0.348																																					p.Y338H													.	DBT-91	0			c.T1012C						.						100.0	101.0	101.0					1																	100676255		2203	4300	6503	SO:0001583	missense	1629	exon8			CCTTATATGTTAT	BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.1012T>C	1.37:g.100676255A>G	ENSP00000359151:p.Tyr338His	Somatic	353	3		WXS	Illumina HiSeq		351	166	NM_001918	0	0	0	0	0	B2R811|Q5VVL8	Missense_Mutation	SNP	ENST00000370132.4	37	CCDS767.1	.	.	.	.	.	.	.	.	.	.	A	17.58	3.425349	0.62733	.	.	ENSG00000137992	ENST00000543138;ENST00000370132	T	0.46063	0.88	5.53	5.53	0.82687	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.44993	0.1320	M	0.79011	2.435	0.80722	D	1	B;P	0.41393	0.109;0.748	B;P	0.47827	0.206;0.558	T	0.43572	-0.9383	10	0.38643	T	0.18	-15.2965	15.9566	0.79891	1.0:0.0:0.0:0.0	.	157;338	F5H1F9;P11182	.;ODB2_HUMAN	H	157;338	ENSP00000359151:Y338H	ENSP00000359151:Y338H	Y	-	1	0	DBT	100448843	1.000000	0.71417	0.508000	0.27688	0.948000	0.59901	8.678000	0.91211	2.231000	0.72958	0.459000	0.35465	TAT	.		0.348	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030101.2	NM_001918	
CRTC2	200186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153926765	153926765	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:153926765A>G	ENST00000368633.1	-	4	527	c.400T>C	c.(400-402)Tac>Cac	p.Y134H	CRTC2_ENST00000476883.1_5'UTR|CRTC2_ENST00000368630.3_Intron	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	134					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGAGATAAGTAGGCAGGACTA	0.512																																					p.Y134H		.											.	CRTC2-228	0			c.T400C						.						61.0	54.0	56.0					1																	153926765		2203	4300	6503	SO:0001583	missense	200186	exon4			ATAAGTAGGCAGG	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.400T>C	1.37:g.153926765A>G	ENSP00000357622:p.Tyr134His	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	46	16	NM_181715	0	0	4	4	0	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	37	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.253357	0.80135	.	.	ENSG00000160741	ENST00000368633	T	0.38240	1.15	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000001	T	0.26702	0.0653	M	0.66297	2.02	0.40914	D	0.984258	P	0.38020	0.615	B	0.40134	0.32	T	0.16453	-1.0402	10	0.54805	T	0.06	-12.6013	10.82	0.46599	1.0:0.0:0.0:0.0	.	134	Q53ET0	CRTC2_HUMAN	H	134	ENSP00000357622:Y134H	ENSP00000357622:Y134H	Y	-	1	0	CRTC2	152193389	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.516000	0.73755	2.065000	0.61736	0.397000	0.26171	TAC	.		0.512	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
C1orf27	54953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	186355194	186355194	+	Silent	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:186355194T>C	ENST00000287859.6	+	4	434	c.309T>C	c.(307-309)gaT>gaC	p.D103D	C1orf27_ENST00000419367.3_Intron|C1orf27_ENST00000432021.3_Silent_p.D103D|C1orf27_ENST00000367470.3_Silent_p.D103D	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	103						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						TGGCAAATGATTTTCAAAATG	0.289																																					p.D103D		.											.	C1orf27-23	0			c.T309C						.						46.0	44.0	44.0					1																	186355194		1786	4058	5844	SO:0001819	synonymous_variant	54953	exon4			AAATGATTTTCAA	BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.309T>C	1.37:g.186355194T>C		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	84	37	NM_001164245	0	0	0	0	0	B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Silent	SNP	ENST00000287859.6	37	CCDS53448.1																																																																																			.		0.289	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086352.2	NM_017847	
PHYHIPL	84457	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	60936661	60936661	+	Silent	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr10:60936661C>A	ENST00000373880.4	+	1	312	c.48C>A	c.(46-48)ccC>ccA	p.P16P	PHYHIPL_ENST00000373878.3_5'Flank|PHYHIPL_ENST00000433653.1_Silent_p.P16P	NM_032439.3	NP_115815.2	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein-like	16						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(3)|skin(1)|urinary_tract(1)	18						CCACCAGCCCCTGTGAGGAGG	0.627																																					p.P16P		.											.	PHYHIPL-90	0			c.C48A						.						64.0	58.0	60.0					10																	60936661		2203	4300	6503	SO:0001819	synonymous_variant	84457	exon1			CAGCCCCTGTGAG	AL834339	CCDS7254.1, CCDS44405.1	10q21.1	2013-02-11	2006-01-09		ENSG00000165443	ENSG00000165443		"""Fibronectin type III domain containing"""	29378	protein-coding gene	gene with protein product			"""phytanoyl-CoA hydroxylase interacting protein-like"""			11347906	Standard	NM_032439		Approved	KIAA1796, Em:AC025038.1	uc001jkk.4	Q96FC7	OTTHUMG00000018276	ENST00000373880.4:c.48C>A	10.37:g.60936661C>A		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	46	17	NM_032439	0	0	2	3	1	B7WP61|Q68DF3|Q6UXY3|Q8N3W3|Q96JM9|Q96NP7	Silent	SNP	ENST00000373880.4	37	CCDS7254.1																																																																																			.		0.627	PHYHIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048156.1	NM_032439	
PALD1	27143	ucsc.edu	37	10	72289809	72289809	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr10:72289809G>T	ENST00000263563.6	+	4	721	c.453G>T	c.(451-453)caG>caT	p.Q151H		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	151						cytosol (GO:0005829)											AGAAACTCCAGAAGGACGGAC	0.637																																					p.Q151H													.	.	0			c.G453T						.						45.0	44.0	44.0					10																	72289809		2203	4300	6503	SO:0001583	missense	27143	exon4			ACTCCAGAAGGAC	AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.453G>T	10.37:g.72289809G>T	ENSP00000263563:p.Gln151His	Somatic	35	0		WXS	Illumina HiSeq		38	4	NM_014431	0	0	0	0	0	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	ENST00000263563.6	37	CCDS31215.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073514	0.76415	.	.	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.29917	1.55	5.34	5.34	0.76211	.	0.055071	0.85682	D	0.000000	T	0.55940	0.1952	M	0.81239	2.535	0.58432	D	0.999997	D	0.56521	0.976	P	0.59012	0.85	T	0.58645	-0.7600	10	0.52906	T	0.07	-20.0085	19.0411	0.92999	0.0:0.0:1.0:0.0	.	151	Q9ULE6	PALD_HUMAN	H	151	ENSP00000263563:Q151H	ENSP00000263563:Q151H	Q	+	3	2	KIAA1274	71959815	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.250000	0.65432	2.673000	0.90976	0.557000	0.71058	CAG	.		0.637	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048515.2	NM_014431	
PIPSL	266971	ucsc.edu	37	10	95718760	95718760	+	RNA	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr10:95718760G>A	ENST00000480546.1	-	0	2537					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										ATGTGTCCATGGCTGAGCTGG	0.527																																					.													.	.	0			.						.																																					266971	.			GTCCATGGCTGAG	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95718760G>A		Somatic	109	0		WXS	Illumina HiSeq		100	2	.	0	0	0	411	411	Q6NUK8	RNA	SNP	ENST00000480546.1	37																																																																																				.		0.527	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000351483.1	NR_002319	
MCMBP	79892	broad.mit.edu	37	10	121591063	121591063	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr10:121591063G>T	ENST00000360003.3	-	16	2021	c.1852C>A	c.(1852-1854)Ctg>Atg	p.L618M	MCMBP_ENST00000466047.1_5'UTR|MCMBP_ENST00000369077.3_Missense_Mutation_p.L616M	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein	618					DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						TTTGCTCTCAGCCATCGTTCT	0.408																																					p.L618M													.	MCMBP-93	0			c.C1852A						.						87.0	80.0	83.0					10																	121591063		2203	4300	6503	SO:0001583	missense	79892	exon16			CTCTCAGCCATCG	BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159	ENST00000360003.3:c.1852C>A	10.37:g.121591063G>T	ENSP00000353098:p.Leu618Met	Somatic	81	1		WXS	Illumina HiSeq	Phase_I	81	4	NM_024834	0	0	27	27	0	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Missense_Mutation	SNP	ENST00000360003.3	37	CCDS7617.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505668	0.44558	.	.	ENSG00000197771	ENST00000360003;ENST00000369077	.	.	.	5.72	5.72	0.89469	.	0.064488	0.64402	D	0.000004	T	0.51466	0.1676	N	0.20685	0.6	0.53005	D	0.999961	B	0.20780	0.048	B	0.14023	0.01	T	0.43507	-0.9387	9	0.46703	T	0.11	-7.219	19.8722	0.96854	0.0:0.0:1.0:0.0	.	618	Q9BTE3	MCMBP_HUMAN	M	618;616	.	ENSP00000353098:L618M	L	-	1	2	MCMBP	121581053	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.215000	0.58534	2.700000	0.92200	0.585000	0.79938	CTG	.		0.408	MCMBP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050684.1	NM_024834	
INSC	387755	broad.mit.edu;bcgsc.ca	37	11	15197495	15197495	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr11:15197495C>A	ENST00000379554.3	+	3	452	c.406C>A	c.(406-408)Cgc>Agc	p.R136S	INSC_ENST00000528567.1_Missense_Mutation_p.R89S|INSC_ENST00000424273.1_Missense_Mutation_p.R89S|INSC_ENST00000525218.1_Missense_Mutation_p.R89S|INSC_ENST00000379556.3_Missense_Mutation_p.R89S|INSC_ENST00000530161.1_Missense_Mutation_p.R89S	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	136					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						CACAGAGCTGCGCAGGATCGG	0.652																																					p.R136S													.	INSC-94	0			c.C406A						.						28.0	31.0	30.0					11																	15197495		2047	4179	6226	SO:0001583	missense	387755	exon3			GAGCTGCGCAGGA	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.406C>A	11.37:g.15197495C>A	ENSP00000368872:p.Arg136Ser	Somatic	53	2		WXS	Illumina HiSeq	Phase_I	47	22	NM_001031853	0	0	0	0	0	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	C	8.695	0.908328	0.17833	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000416761;ENST00000528567;ENST00000530161;ENST00000525218	T;T;T;T;T;T	0.28895	1.59;1.62;1.6;1.6;1.62;1.6	5.2	3.23	0.37069	.	0.249802	0.34628	N	0.003801	T	0.09818	0.0241	N	0.03608	-0.345	0.29192	N	0.875806	B;B;B;B	0.29531	0.188;0.017;0.077;0.247	B;B;B;B	0.28784	0.052;0.012;0.025;0.094	T	0.32428	-0.9907	10	0.02654	T	1	-21.7187	7.1996	0.25873	0.3943:0.4709:0.1348:0.0	.	89;89;89;136	Q1MX18-5;Q1MX18-4;A0PJX5;Q1MX18	.;.;.;INSC_HUMAN	S	136;89;89;89;89;89;89	ENSP00000368872:R136S;ENSP00000368874:R89S;ENSP00000389161:R89S;ENSP00000435022:R89S;ENSP00000436194:R89S;ENSP00000436113:R89S	ENSP00000368872:R136S	R	+	1	0	INSC	15154071	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.217000	0.58547	2.420000	0.82092	0.462000	0.41574	CGC	.		0.652	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853	
MRPL11	65003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66204727	66204727	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr11:66204727C>G	ENST00000310999.7	-	4	414	c.321G>C	c.(319-321)gaG>gaC	p.E107D	MRPL11_ENST00000430466.2_Missense_Mutation_p.E81D|MRPL11_ENST00000329819.4_Missense_Mutation_p.E107D|MRPL11_ENST00000524576.1_5'UTR	NM_016050.3	NP_057134.1	Q9Y3B7	RM11_HUMAN	mitochondrial ribosomal protein L11	107					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|prostate(1)	7						GGCCTGCCACCTCTTTCCCTG	0.547																																					p.E107D		.											.	MRPL11-90	0			c.G321C						.						82.0	76.0	78.0					11																	66204727		2200	4295	6495	SO:0001583	missense	65003	exon4			TGCCACCTCTTTC	AB051338	CCDS8139.1, CCDS8140.1, CCDS44655.1	11q13.2	2012-11-14			ENSG00000174547	ENSG00000174547		"""Mitochondrial ribosomal proteins / large subunits"""	14042	protein-coding gene	gene with protein product		611826					Standard	XR_247672		Approved		uc001ohz.4	Q9Y3B7	OTTHUMG00000167097	ENST00000310999.7:c.321G>C	11.37:g.66204727C>G	ENSP00000308897:p.Glu107Asp	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	41	22	NM_170739	0	0	0	0	0	A6NLT0|A8K219|Q32P46|Q96Q73	Missense_Mutation	SNP	ENST00000310999.7	37	CCDS8139.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399495	0.62177	.	.	ENSG00000174547	ENST00000310999;ENST00000430466;ENST00000329819	.	.	.	5.79	1.92	0.25849	Ribosomal protein L11, C-terminal (3);	0.099158	0.64402	D	0.000002	T	0.61123	0.2322	L	0.45352	1.415	0.58432	D	0.999993	D;D;D	0.71674	0.993;0.995;0.998	D;D;D	0.71184	0.953;0.962;0.972	T	0.54649	-0.8262	9	0.27785	T	0.31	-33.3697	7.3258	0.26555	0.0:0.5948:0.0:0.4052	.	81;107;107	Q9Y3B7-2;Q9Y3B7;A6NLT0	.;RM11_HUMAN;.	D	107;81;107	.	ENSP00000308897:E107D	E	-	3	2	MRPL11	65961303	0.998000	0.40836	1.000000	0.80357	0.858000	0.48976	0.534000	0.23098	0.384000	0.24942	-0.123000	0.14984	GAG	.		0.547	MRPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393098.2	NM_016050	
MTL5	9633	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	68518126	68518126	+	Start_Codon_SNP	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr11:68518126C>A	ENST00000255087.5	-	2	186	c.3G>T	c.(1-3)atG>atT	p.M1I	MTL5_ENST00000540869.1_5'Flank|MTL5_ENST00000544963.1_Start_Codon_SNP_p.M1I|MTL5_ENST00000443940.2_Start_Codon_SNP_p.M1I	NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	1					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			GGCCCTCCTCCATGGCGCAGG	0.736																																					p.M1I		.											.	MTL5-155	0			c.G3T						.						5.0	6.0	6.0					11																	68518126		2027	3960	5987	SO:0001582	initiator_codon_variant	9633	exon2			CTCCTCCATGGCG	U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.3G>T	11.37:g.68518126C>A	ENSP00000255087:p.Met1Ile	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	33	18	NM_001039656	0	0	0	0	0	A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	ENST00000255087.5	37	CCDS8184.1	.	.	.	.	.	.	.	.	.	.	c	16.50	3.140663	0.56936	.	.	ENSG00000132749	ENST00000255087;ENST00000443940;ENST00000544963	T;T;T	0.46063	1.53;0.88;1.47	3.48	3.48	0.39840	.	0.175065	0.27258	U	0.020187	T	0.59280	0.2182	.	.	.	0.80722	D	1	P;P	0.52577	0.954;0.851	D;P	0.63597	0.916;0.775	T	0.63422	-0.6641	9	0.72032	D	0.01	-17.219	10.3557	0.43962	0.0:1.0:0.0:0.0	.	1;1	Q9Y4I5-3;Q9Y4I5	.;MTL5_HUMAN	I	1	ENSP00000255087:M1I;ENSP00000403086:M1I;ENSP00000440968:M1I	ENSP00000255087:M1I	M	-	3	0	MTL5	68274702	1.000000	0.71417	0.976000	0.42696	0.112000	0.19704	1.942000	0.40243	1.792000	0.52537	0.298000	0.19748	ATG	.		0.736	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396844.1	NM_004923	Missense_Mutation
P2RY6	5031	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	73007583	73007583	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr11:73007583C>A	ENST00000393590.2	+	2	319	c.20C>A	c.(19-21)aCa>aAa	p.T7K	P2RY6_ENST00000540124.1_Missense_Mutation_p.T7K|P2RY6_ENST00000540342.1_Missense_Mutation_p.T7K|P2RY6_ENST00000542092.1_Missense_Mutation_p.T7K|P2RY6_ENST00000393591.1_Missense_Mutation_p.T7K|P2RY6_ENST00000349767.2_Missense_Mutation_p.T7K|P2RY6_ENST00000393592.2_Missense_Mutation_p.T7K|P2RY6_ENST00000538328.1_Missense_Mutation_p.T7K	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	7					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						GACAATGGCACAGGCCAGGCT	0.597																																					p.T7K													.	P2RY6-501	0			c.C20A						.						83.0	84.0	84.0					11																	73007583		2200	4293	6493	SO:0001583	missense	5031	exon4			ATGGCACAGGCCA		CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.20C>A	11.37:g.73007583C>A	ENSP00000377215:p.Thr7Lys	Somatic	80	1		WXS	Illumina HiSeq	Phase_I	60	24	NM_176796	0	0	2	2	0	Q15754	Missense_Mutation	SNP	ENST00000393590.2	37	CCDS8220.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280371	0.80692	.	.	ENSG00000171631	ENST00000540342;ENST00000542092;ENST00000349767;ENST00000393592;ENST00000544437;ENST00000393591;ENST00000540124;ENST00000393590;ENST00000536225;ENST00000535931;ENST00000538328	T;T;T;T;T;T;T;T;T;T;T	0.70986	-0.28;-0.28;-0.28;-0.28;1.3;-0.28;-0.28;-0.28;0.95;-0.53;-0.28	4.12	4.12	0.48240	.	0.795267	0.10928	N	0.618734	T	0.62696	0.2449	L	0.38175	1.15	0.19300	N	0.999978	P	0.37781	0.608	B	0.34824	0.19	T	0.59931	-0.7361	10	0.87932	D	0	.	14.2152	0.65788	0.0:1.0:0.0:0.0	.	7	Q15077	P2RY6_HUMAN	K	7	ENSP00000443427:T7K;ENSP00000445652:T7K;ENSP00000309771:T7K;ENSP00000377217:T7K;ENSP00000441079:T7K;ENSP00000377216:T7K;ENSP00000442551:T7K;ENSP00000377215:T7K;ENSP00000442509:T7K;ENSP00000440770:T7K;ENSP00000442990:T7K	ENSP00000309771:T7K	T	+	2	0	P2RY6	72685231	0.025000	0.19082	0.065000	0.19835	0.958000	0.62258	1.404000	0.34623	2.264000	0.75181	0.491000	0.48974	ACA	.		0.597	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397349.1		
MAML2	84441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	95825407	95825407	+	Silent	SNP	C	C	T	rs61901862		TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr11:95825407C>T	ENST00000524717.1	-	2	3072	c.1788G>A	c.(1786-1788)caG>caA	p.Q596Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	596					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q596Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgtt	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q596Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	1	Substitution - coding silent(1)	kidney(1)	c.G1788A						.						28.0	35.0	33.0					11																	95825407		2119	4148	6267	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1788G>A	11.37:g.95825407C>T		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	88	10	NM_032427	0	0	904	913	9	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			C|0.250;T|0.750		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
SRGAP1	57522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	64377795	64377795	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr12:64377795C>T	ENST00000355086.3	+	2	660	c.136C>T	c.(136-138)Ctc>Ttc	p.L46F	SRGAP1_ENST00000357825.3_Missense_Mutation_p.L46F|SRGAP1_ENST00000543397.1_Missense_Mutation_p.L6F	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	46	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		AGTTCAGCTTCTCCAGGATCT	0.428																																					p.L46F		.											.	SRGAP1-653	0			c.C136T						.						105.0	110.0	108.0					12																	64377795		2203	4300	6503	SO:0001583	missense	57522	exon2			CAGCTTCTCCAGG	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.136C>T	12.37:g.64377795C>T	ENSP00000347198:p.Leu46Phe	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	59	24	NM_020762	0	0	0	0	0	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	37	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872961	0.91664	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.24151	1.87;1.87;1.87	5.1	5.1	0.69264	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.31760	U	0.007120	T	0.53190	0.1781	M	0.74389	2.26	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.996;0.994;0.997	T	0.52381	-0.8583	9	.	.	.	.	18.9008	0.92442	0.0:1.0:0.0:0.0	.	46;6;46	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	F	46;46;6	ENSP00000347198:L46F;ENSP00000350480:L46F;ENSP00000437948:L6F	.	L	+	1	0	SRGAP1	62664062	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.755000	0.85180	2.548000	0.85928	0.585000	0.79938	CTC	.		0.428	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
SCYL2	55681	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	100731225	100731225	+	Silent	SNP	C	C	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr12:100731225C>T	ENST00000360820.2	+	17	2523	c.2086C>T	c.(2086-2088)Ctg>Ttg	p.L696L		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	696					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						GGCACAGAAGCTGAAAAGCCA	0.373																																					p.L696L													.	SCYL2-336	0			c.C2086T						.						125.0	124.0	124.0					12																	100731225		2203	4300	6503	SO:0001819	synonymous_variant	55681	exon17			CAGAAGCTGAAAA	AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.2086C>T	12.37:g.100731225C>T		Somatic	60	1		WXS	Illumina HiSeq	Phase_I	50	26	NM_017988	0	0	0	0	0	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Silent	SNP	ENST00000360820.2	37	CCDS9076.1																																																																																			.		0.373	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988	
ARL1	400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	101799660	101799660	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr12:101799660T>C	ENST00000261636.8	-	2	278	c.104A>G	c.(103-105)tAc>tGc	p.Y35C	RP11-321F8.4_ENST00000547360.1_lincRNA|ARL1_ENST00000549302.1_5'UTR|ARL1_ENST00000536227.1_Missense_Mutation_p.Y18C|ARL1_ENST00000551828.1_Missense_Mutation_p.Y18C|ARL1_ENST00000551688.1_Intron|ARL1_ENST00000551671.1_Missense_Mutation_p.Y35C|ARL1_ENST00000539055.1_Intron	NM_001177.4	NP_001168.1	P40616	ARL1_HUMAN	ADP-ribosylation factor-like 1	35					activation of phospholipase D activity (GO:0031584)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)|toxin metabolic process (GO:0009404)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	enzyme activator activity (GO:0008047)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			central_nervous_system(1)|upper_aerodigestive_tract(1)	2		Lung NSC(355;2.1e-05)|Breast(359;0.00015)|Myeloproliferative disorder(1001;0.163)		GBM - Glioblastoma multiforme(134;1.67e-09)|BRCA - Breast invasive adenocarcinoma(302;0.0125)		TTGTAATCTGTACAAAATTGT	0.368																																					p.Y35C		.											.	ARL1-205	0			c.A104G						.						82.0	73.0	76.0					12																	101799660		1850	4074	5924	SO:0001583	missense	400	exon2			AATCTGTACAAAA	BX537387	CCDS44958.1, CCDS73510.1	12q23.3	2014-05-09						"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	692	protein-coding gene	gene with protein product		603425					Standard	XM_005268869		Approved	ARFL1	uc001tib.3	P40616	OTTHUMG00000170271	ENST00000261636.8:c.104A>G	12.37:g.101799660T>C	ENSP00000261636:p.Tyr35Cys	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	83	39	NM_001177	0	0	19	31	12	B4DWW1|P80417|Q53XB1	Missense_Mutation	SNP	ENST00000261636.8	37	CCDS44958.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.691681	0.88735	.	.	ENSG00000120805	ENST00000261636;ENST00000536227;ENST00000551828;ENST00000551671	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.79	5.79	0.91817	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95069	0.8403	H	0.98818	4.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.97048	0.9762	10	0.72032	D	0.01	-8.9448	16.1803	0.81892	0.0:0.0:0.0:1.0	.	35;35	F8VYN9;P40616	.;ARL1_HUMAN	C	35;18;18;35	ENSP00000261636:Y35C;ENSP00000441808:Y18C;ENSP00000448850:Y18C;ENSP00000448912:Y35C	ENSP00000261636:Y35C	Y	-	2	0	ARL1	100323791	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.930000	0.87610	2.229000	0.72834	0.524000	0.50904	TAC	.		0.368	ARL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408246.1	NM_001177	
USP30	84749	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	109490532	109490532	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr12:109490532A>T	ENST00000257548.5	+	1	142	c.49A>T	c.(49-51)Atc>Ttc	p.I17F	USP30-AS1_ENST00000478808.2_RNA|USP30_ENST00000392784.2_Intron	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	17					mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						CGACAGGGCCATCCAGCGCTT	0.741																																					p.I17F		.											.	USP30-658	0			c.A49T						.						6.0	7.0	7.0					12																	109490532		1633	3539	5172	SO:0001583	missense	84749	exon1			AGGGCCATCCAGC	BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.49A>T	12.37:g.109490532A>T	ENSP00000257548:p.Ile17Phe	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	55	26	NM_032663	0	0	0	0	0	Q8WTU7|Q96JX4|Q9BSS3	Missense_Mutation	SNP	ENST00000257548.5	37	CCDS9123.2	.	.	.	.	.	.	.	.	.	.	A	20.9	4.071460	0.76301	.	.	ENSG00000135093	ENST00000257548;ENST00000536393	T	0.36699	1.24	4.83	-3.67	0.04476	.	0.525534	0.20286	N	0.095347	T	0.17746	0.0426	N	0.14661	0.345	0.36723	D	0.881283	B	0.02656	0.0	B	0.01281	0.0	T	0.03394	-1.1041	10	0.62326	D	0.03	-15.0275	9.4412	0.38670	0.2273:0.6458:0.0:0.1269	.	17	Q70CQ3	UBP30_HUMAN	F	17	ENSP00000257548:I17F	ENSP00000257548:I17F	I	+	1	0	USP30	107974915	0.830000	0.29337	0.983000	0.44433	0.992000	0.81027	-0.415000	0.07106	-0.293000	0.08986	0.482000	0.46254	ATC	.		0.741	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257733.2	NM_032663	
N4BP2L1	90634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	32972588	32972588	+	IGR	SNP	A	A	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr13:32972588A>C	ENST00000380130.2	-	0	3046				BRCA2_ENST00000544455.1_Missense_Mutation_p.K3313T|BRCA2_ENST00000380152.3_Missense_Mutation_p.K3313T	NM_052818.2	NP_438169.2	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1											large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		ACACCCATAAAGAAAAAAGAA	0.393																																					p.K3313T		.											.	BRCA2-3153	0			c.A9938C						.						69.0	72.0	71.0					13																	32972588		2203	4300	6503	SO:0001628	intergenic_variant	675	exon27			CCATAAAGAAAAA	U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697		13.37:g.32972588A>C		Somatic	104	0		WXS	Illumina HiSeq	Phase_I	125	51	NM_000059	0	0	0	0	0	A4QN21|Q5TBK0	Missense_Mutation	SNP	ENST00000380130.2	37	CCDS9345.2	.	.	.	.	.	.	.	.	.	.	A	16.59	3.166079	0.57476	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00816	5.66;5.66	5.19	1.43	0.22495	.	0.585853	0.16656	N	0.205002	T	0.02688	0.0081	L	0.55834	1.745	0.29155	N	0.87815	D	0.71674	0.998	P	0.62560	0.904	T	0.30446	-0.9978	10	0.51188	T	0.08	.	8.9414	0.35731	0.7861:0.0:0.2139:0.0	.	3313	P51587	BRCA2_HUMAN	T	3313	ENSP00000369497:K3313T;ENSP00000439902:K3313T	ENSP00000369497:K3313T	K	+	2	0	BRCA2	31870588	0.216000	0.23585	0.108000	0.21378	0.601000	0.36947	2.044000	0.41241	0.111000	0.17947	0.383000	0.25322	AAG	.		0.393	N4BP2L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_052818	
SPRY2	10253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	13	80911824	80911824	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr13:80911824T>C	ENST00000377102.1	-	2	994	c.17A>G	c.(16-18)cAg>cGg	p.Q6R	SPRY2_ENST00000540649.1_Missense_Mutation_p.Q6R|SPRY2_ENST00000377104.3_Missense_Mutation_p.Q6R			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	6					bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		GTTGCCACTCTGAGCTCTGGC	0.602																																					p.Q6R		.											.	SPRY2-659	0			c.A17G						.						36.0	39.0	38.0					13																	80911824		2203	4300	6503	SO:0001583	missense	10253	exon2			CCACTCTGAGCTC	AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.17A>G	13.37:g.80911824T>C	ENSP00000366306:p.Gln6Arg	Somatic	13	0		WXS	Illumina HiSeq	Phase_I	32	17	NM_005842	0	0	0	4	4	B2R9J9|Q5T6Z7	Missense_Mutation	SNP	ENST00000377102.1	37	CCDS9463.1	.	.	.	.	.	.	.	.	.	.	T	18.75	3.690500	0.68271	.	.	ENSG00000136158	ENST00000377104;ENST00000377102;ENST00000541655;ENST00000540649	T;T;T	0.57273	0.41;0.41;0.41	5.2	5.2	0.72013	.	0.258022	0.39687	N	0.001300	T	0.58380	0.2118	M	0.70275	2.135	0.58432	D	0.999996	P	0.51791	0.948	P	0.45610	0.487	T	0.66408	-0.5931	10	0.87932	D	0	2.2461	15.1453	0.72647	0.0:0.0:0.0:1.0	.	6	O43597	SPY2_HUMAN	R	6	ENSP00000366308:Q6R;ENSP00000366306:Q6R;ENSP00000439027:Q6R	ENSP00000366306:Q6R	Q	-	2	0	SPRY2	79809825	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.437000	0.80417	1.989000	0.58080	0.529000	0.55759	CAG	.		0.602	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1		
ITPK1	3705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	93408247	93408247	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr14:93408247A>T	ENST00000267615.6	-	11	1077	c.904T>A	c.(904-906)Tac>Aac	p.Y302N	ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000556603.2_Missense_Mutation_p.Y302N|ITPK1_ENST00000555495.1_Missense_Mutation_p.Y183N			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	302	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		ACGCCCTCGTAGCCTGGGGGT	0.652																																					p.Y302N		.											.	ITPK1-115	0			c.T904A						.						19.0	15.0	17.0					14																	93408247		2087	4121	6208	SO:0001583	missense	3705	exon11			CCTCGTAGCCTGG	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.904T>A	14.37:g.93408247A>T	ENSP00000267615:p.Tyr302Asn	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	31	18	NM_001142593	0	0	0	0	0	Q9BTL6|Q9H2E7	Missense_Mutation	SNP	ENST00000267615.6	37	CCDS9907.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.272145	0.80469	.	.	ENSG00000100605	ENST00000405174;ENST00000556603;ENST00000555495;ENST00000267615;ENST00000311458	.	.	.	4.59	4.59	0.56863	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.79764	0.4502	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.83445	0.0045	9	0.87932	D	0	-1.445	13.993	0.64378	1.0:0.0:0.0:0.0	.	302	Q13572	ITPK1_HUMAN	N	332;302;183;302;302	.	ENSP00000267615:Y302N	Y	-	1	0	ITPK1	92478000	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	8.912000	0.92726	1.717000	0.51406	0.460000	0.39030	TAC	.		0.652	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216	
HSP90AA1	3320	broad.mit.edu;ucsc.edu	37	14	102548766	102548766	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr14:102548766G>A	ENST00000216281.8	-	10	1976	c.1771C>T	c.(1771-1773)Cga>Tga	p.R591*	HSP90AA1_ENST00000334701.7_Nonsense_Mutation_p.R713*	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	591					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	GTCACCAATCGGTTTGACACA	0.393																																					p.R713X													.	HSP90AA1-949	0			c.C2137T						.						54.0	50.0	51.0					14																	102548766		2203	4300	6503	SO:0001587	stop_gained	3320	exon11			CCAATCGGTTTGA	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.1771C>T	14.37:g.102548766G>A	ENSP00000216281:p.Arg591*	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	34	14	NM_001017963	0	1	110	113	2	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Nonsense_Mutation	SNP	ENST00000216281.8	37	CCDS9967.1	.	.	.	.	.	.	.	.	.	.	g	40	8.219651	0.98712	.	.	ENSG00000080824	ENST00000216281;ENST00000334701	.	.	.	4.3	2.21	0.28008	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7696	11.5269	0.50584	0.0:0.0:0.5372:0.4628	.	.	.	.	X	591;713	.	ENSP00000216281:R591X	R	-	1	2	HSP90AA1	101618519	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.830000	0.48136	0.895000	0.36342	0.585000	0.79938	CGA	.		0.393	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348	
WDR20	91833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102675840	102675840	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr14:102675840A>G	ENST00000342702.3	+	3	1364	c.1333A>G	c.(1333-1335)Agc>Ggc	p.S445G	WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000335263.5_Missense_Mutation_p.S445G|WDR20_ENST00000556807.1_Missense_Mutation_p.S384G|WDR20_ENST00000499851.2_Missense_Mutation_p.S188G|WDR20_ENST00000556511.2_Missense_Mutation_p.S384G|WDR20_ENST00000322340.5_Intron|WDR20_ENST00000454394.2_Missense_Mutation_p.S476G|WDR20_ENST00000545563.1_Missense_Mutation_p.S272G|WDR20_ENST00000424963.2_Missense_Mutation_p.S321G	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	445										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						AAATGCTGGCAGCAAAAGCAG	0.532											OREG0022939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S476G		.											.	WDR20-90	0			c.A1426G						.						101.0	103.0	102.0					14																	102675840		2203	4300	6503	SO:0001583	missense	91833	exon4			GCTGGCAGCAAAA	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.1333A>G	14.37:g.102675840A>G	ENSP00000341037:p.Ser445Gly	Somatic	78	0	1368	WXS	Illumina HiSeq	Phase_I	73	31	NM_001242417	0	0	2	6	4	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Missense_Mutation	SNP	ENST00000342702.3	37	CCDS9969.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.709|6.709	0.499566|0.499566	0.12762|0.12762	.|.	.|.	ENSG00000140153|ENSG00000140153	ENST00000556511|ENST00000335263;ENST00000299135;ENST00000424963;ENST00000342702;ENST00000556807;ENST00000499851;ENST00000454394;ENST00000401892;ENST00000545563	.|T;T;T;T;T;T;T	.|0.67698	.|-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.162599	.|0.64402	.|D	.|0.000002	T|T	0.56277|0.56277	0.1974|0.1974	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B;B;B	.|0.24882	.|0.001;0.113;0.001;0.0;0.0;0.043;0.0	.|B;B;B;B;B;B;B	.|0.24006	.|0.001;0.05;0.001;0.0;0.002;0.027;0.002	T|T	0.52087|0.52087	-0.8622|-0.8622	5|10	.|0.19590	.|T	.|0.45	.|.	16.0225|16.0225	0.80509|0.80509	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|476;457;384;445;384;321;445	.|E7EUY8;Q5JPH5;G3V2F8;Q8TBZ3-2;F8W9S4;B3KR43;Q8TBZ3	.|.;.;.;.;.;.;WDR20_HUMAN	R|G	375|445;384;321;445;384;188;476;375;272	.|ENSP00000335434:S445G;ENSP00000395793:S321G;ENSP00000341037:S445G;ENSP00000450636:S384G;ENSP00000443641:S188G;ENSP00000406084:S476G;ENSP00000437927:S272G	.|ENSP00000299135:S384G	Q|S	+|+	2|1	0|0	WDR20|WDR20	101745593|101745593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	7.099000|7.099000	0.76981|0.76981	2.198000|2.198000	0.70561|0.70561	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.		0.532	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414963.1	NM_181291	
GLCE	26035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	69548696	69548696	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr15:69548696T>C	ENST00000261858.2	+	3	779	c.551T>C	c.(550-552)gTc>gCc	p.V184A	GLCE_ENST00000559420.2_Missense_Mutation_p.V120A	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	184					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AATGTGGAAGTCCGAGACAGA	0.428																																					p.V184A		.											.	GLCE-92	0			c.T551C						.						101.0	101.0	101.0					15																	69548696		2200	4297	6497	SO:0001583	missense	26035	exon3			TGGAAGTCCGAGA	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.551T>C	15.37:g.69548696T>C	ENSP00000261858:p.Val184Ala	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	46	16	NM_015554	0	0	0	0	0	Q6GUQ2	Missense_Mutation	SNP	ENST00000261858.2	37	CCDS32277.1	.	.	.	.	.	.	.	.	.	.	T	16.89	3.246289	0.59103	.	.	ENSG00000138604	ENST00000261858	T	0.30714	1.52	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.36880	0.0983	M	0.79475	2.455	0.80722	D	1	B	0.22080	0.064	B	0.17722	0.019	T	0.20207	-1.0282	10	0.41790	T	0.15	-8.6789	14.1808	0.65574	0.0:0.0:0.0:1.0	.	184	O94923	GLCE_HUMAN	A	184	ENSP00000261858:V184A	ENSP00000261858:V184A	V	+	2	0	GLCE	67335750	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.831000	0.86748	2.084000	0.62774	0.533000	0.62120	GTC	.		0.428	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015554	
MYO9A	4649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	72190184	72190184	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr15:72190184C>G	ENST00000356056.5	-	25	5132	c.4660G>C	c.(4660-4662)Gta>Cta	p.V1554L	MYO9A_ENST00000566885.1_Missense_Mutation_p.V1174L|MYO9A_ENST00000424560.1_Missense_Mutation_p.V1554L|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000444904.1_Missense_Mutation_p.V1535L|MYO9A_ENST00000564571.1_Missense_Mutation_p.V1554L	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1554	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GGCCTCTCTACTCTTTGCTTT	0.423																																					p.V1554L		.											.	MYO9A-93	0			c.G4660C						.						76.0	66.0	70.0					15																	72190184		2199	4297	6496	SO:0001583	missense	4649	exon25			TCTCTACTCTTTG	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.4660G>C	15.37:g.72190184C>G	ENSP00000348349:p.Val1554Leu	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	93	42	NM_006901	0	0	0	1	1	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.285329	0.23478	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.83992	-1.79;-1.79;-1.79	5.92	1.58	0.23477	.	.	.	.	.	T	0.66597	0.2805	L	0.27053	0.805	0.09310	N	1	B;B;B	0.12013	0.001;0.005;0.001	B;B;B	0.08055	0.002;0.003;0.001	T	0.50583	-0.8811	9	0.30078	T	0.28	.	0.594	0.00733	0.2435:0.3197:0.1226:0.3143	.	1535;1554;1554	B2RTY4-2;B2RTY4-4;B2RTY4	.;.;MYO9A_HUMAN	L	1554;1554;1535	ENSP00000348349:V1554L;ENSP00000399162:V1554L;ENSP00000398250:V1535L	ENSP00000348349:V1554L	V	-	1	0	MYO9A	69977238	0.001000	0.12720	0.003000	0.11579	0.983000	0.72400	0.281000	0.18810	0.024000	0.15214	0.650000	0.86243	GTA	.		0.423	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	NM_006901	
TMEM202	338949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	72698982	72698982	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr15:72698982T>A	ENST00000341689.3	+	3	431	c.377T>A	c.(376-378)gTc>gAc	p.V126D	TMEM202_ENST00000567679.1_Missense_Mutation_p.S41T	NM_001080462.1	NP_001073931.1	A6NGA9	TM202_HUMAN	transmembrane protein 202	126						integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	18						CTCATCTCTGTCTTTACCATA	0.468																																					p.V126D		.											.	TMEM202-69	0			c.T377A						.						180.0	160.0	167.0					15																	72698982		2199	4297	6496	SO:0001583	missense	338949	exon3			TCTCTGTCTTTAC		CCDS32287.1	15q24.1	2007-12-18				ENSG00000187806			33733	protein-coding gene	gene with protein product							Standard	NM_001080462		Approved	FLJ27523	uc002auq.3	A6NGA9		ENST00000341689.3:c.377T>A	15.37:g.72698982T>A	ENSP00000340212:p.Val126Asp	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	115	55	NM_001080462	0	0	0	0	0		Missense_Mutation	SNP	ENST00000341689.3	37	CCDS32287.1	.	.	.	.	.	.	.	.	.	.	T	12.61	1.990387	0.35131	.	.	ENSG00000187806	ENST00000341689	T	0.66815	-0.23	5.42	1.84	0.25277	.	1.663070	0.03249	N	0.181492	T	0.71459	0.3342	L	0.53249	1.67	0.09310	N	1	P	0.47191	0.891	P	0.51355	0.667	T	0.54214	-0.8327	10	0.87932	D	0	-26.7102	6.0845	0.19960	0.0:0.3095:0.0:0.6905	.	126	A6NGA9	TM202_HUMAN	D	126	ENSP00000340212:V126D	ENSP00000340212:V126D	V	+	2	0	TMEM202	70486036	0.002000	0.14202	0.000000	0.03702	0.006000	0.05464	0.033000	0.13754	0.514000	0.28300	0.533000	0.62120	GTC	.		0.468	TMEM202-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435756.1	NM_001080462	
SCAMP5	192683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75309011	75309011	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr15:75309011G>T	ENST00000361900.6	+	5	421	c.214G>T	c.(214-216)Ggc>Tgc	p.G72C	SCAMP5_ENST00000545456.1_Intron|SCAMP5_ENST00000565923.1_3'UTR|SCAMP5_ENST00000562212.1_Missense_Mutation_p.G72C|SCAMP5_ENST00000568081.1_5'Flank|SCAMP5_ENST00000425597.3_Missense_Mutation_p.G72C	NM_001178111.1	NP_001171582.1	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	72					exocytosis (GO:0006887)|negative regulation of endocytosis (GO:0045806)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of cytokine secretion (GO:0050715)|protein transport (GO:0015031)|response to endoplasmic reticulum stress (GO:0034976)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)|trans-Golgi network membrane (GO:0032588)				large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	5						CACCAACTTTGGCCTCGCCTT	0.602																																					p.G72C		.											.	SCAMP5-23	0			c.G214T						.						138.0	140.0	139.0					15																	75309011		2150	4256	6406	SO:0001583	missense	192683	exon5			AACTTTGGCCTCG	AL833230	CCDS45306.1	15q24.2	2014-05-20			ENSG00000198794	ENSG00000198794		"""Secretory carrier membrane proteins"""	30386	protein-coding gene	gene with protein product		613766				12477932	Standard	NM_001178111		Approved	MGC24969	uc002azk.2	Q8TAC9	OTTHUMG00000172704	ENST00000361900.6:c.214G>T	15.37:g.75309011G>T	ENSP00000355387:p.Gly72Cys	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	39	17	NM_001178111	0	0	0	0	0	B3KPJ7|B7Z762|D3DW71|Q8N3M4	Missense_Mutation	SNP	ENST00000361900.6	37	CCDS45306.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.024083	0.93462	.	.	ENSG00000198794	ENST00000361900;ENST00000425597	T;T	0.20332	2.08;2.08	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.56381	0.1981	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68194	-0.5473	10	0.87932	D	0	-0.2016	17.294	0.87164	0.0:0.0:1.0:0.0	.	72;72	Q8TAC9-2;Q8TAC9	.;SCAM5_HUMAN	C	72	ENSP00000355387:G72C;ENSP00000406547:G72C	ENSP00000355387:G72C	G	+	1	0	SCAMP5	73096064	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.690000	0.98676	2.391000	0.81399	0.561000	0.74099	GGC	.		0.602	SCAMP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420015.2	NM_138967	
SMG1	23049	broad.mit.edu	37	16	18864921	18864921	+	Silent	SNP	G	G	T	rs188559863	byFrequency	TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr16:18864921G>T	ENST00000446231.2	-	31	5164	c.4752C>A	c.(4750-4752)atC>atA	p.I1584I	SMG1_ENST00000389467.3_Silent_p.I1584I			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1584	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ATTCACTCTCGATCCGAGGAT	0.328																																					p.I1584I													.	SMG1-1160	0			c.C4752A						.						78.0	68.0	71.0					16																	18864921		1820	4076	5896	SO:0001819	synonymous_variant	23049	exon31			ACTCTCGATCCGA	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.4752C>A	16.37:g.18864921G>T		Somatic	116	0		WXS	Illumina HiSeq	Phase_I	108	4	NM_015092	0	0	0	0	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	37	CCDS45430.1																																																																																			G|0.999;A|0.001		0.328	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
ITGAD	3681	broad.mit.edu;bcgsc.ca	37	16	31414858	31414858	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr16:31414858A>C	ENST00000389202.2	+	7	645	c.596A>C	c.(595-597)cAc>cCc	p.H199P	RP11-120K18.2_ENST00000567545.1_RNA	NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	199	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CTGAAGATCCACTTCACCTTC	0.542																																					p.H199P													.	ITGAD-226	0			c.A596C						.						116.0	93.0	101.0					16																	31414858		2197	4300	6497	SO:0001583	missense	3681	exon7			AGATCCACTTCAC	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.596A>C	16.37:g.31414858A>C	ENSP00000373854:p.His199Pro	Somatic	51	1		WXS	Illumina HiSeq	Phase_I	64	32	NM_005353	0	0	0	0	0	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.298332	0.60195	.	.	ENSG00000156886	ENST00000316569;ENST00000444228;ENST00000389202	D	0.83250	-1.7	4.57	3.45	0.39498	von Willebrand factor, type A (3);	.	.	.	.	D	0.91436	0.7297	M	0.91300	3.195	0.37113	D	0.900445	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	D	0.92175	0.5747	9	0.72032	D	0.01	.	8.698	0.34307	0.8297:0.0:0.0:0.1703	.	199;215;199	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	P	63;215;199	ENSP00000373854:H199P	ENSP00000323325:H63P	H	+	2	0	ITGAD	31322359	0.992000	0.36948	0.920000	0.36463	0.687000	0.40016	5.957000	0.70323	0.756000	0.33013	0.328000	0.21473	CAC	.		0.542	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
LCAT	3931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67976796	67976796	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr16:67976796G>T	ENST00000264005.5	-	3	424	c.395C>A	c.(394-396)tCt>tAt	p.S132Y	CTC-479C5.17_ENST00000590594.1_lincRNA	NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	132					cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		GTACTCCACAGAGTAGGTCTT	0.662																																					p.S132Y		.											.	LCAT-44	0			c.C395A						.						62.0	68.0	66.0					16																	67976796		2198	4300	6498	SO:0001583	missense	3931	exon3			TCCACAGAGTAGG		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.395C>A	16.37:g.67976796G>T	ENSP00000264005:p.Ser132Tyr	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	29	12	NM_000229	0	0	8	10	2	Q53XQ3	Missense_Mutation	SNP	ENST00000264005.5	37	CCDS10854.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685825	0.88639	.	.	ENSG00000213398	ENST00000264005	D	0.97161	-4.27	5.98	5.98	0.97165	.	0.138327	0.49916	U	0.000130	D	0.98573	0.9523	M	0.91920	3.255	0.46654	D	0.999148	D	0.52996	0.957	P	0.59171	0.853	D	0.99257	1.0889	10	0.87932	D	0	-13.366	18.0148	0.89236	0.0:0.0:1.0:0.0	.	132	P04180	LCAT_HUMAN	Y	132	ENSP00000264005:S132Y	ENSP00000264005:S132Y	S	-	2	0	LCAT	66534297	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.289000	0.96061	2.861000	0.98227	0.650000	0.86243	TCT	.		0.662	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3		
KRTAP4-7	100132476	broad.mit.edu	37	17	39240627	39240627	+	Missense_Mutation	SNP	T	T	C	rs189343211		TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr17:39240627T>C	ENST00000391417.4	+	1	169	c.169T>C	c.(169-171)Tct>Cct	p.S57P		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	57	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S57P(4)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						GTGCTGCCAGTCTGTGTGCTG	0.667																																					p.S57P													.	.	4	Substitution - Missense(4)	urinary_tract(2)|kidney(2)	c.T169C						.						18.0	28.0	25.0					17																	39240627		691	1590	2281	SO:0001583	missense	100132476	exon1			TGCCAGTCTGTGT	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.169T>C	17.37:g.39240627T>C	ENSP00000375236:p.Ser57Pro	Somatic	40	2		WXS	Illumina HiSeq	Phase_I	69	13	NM_033061	0	0	0	0	0	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	0.387	-0.925721	0.02377	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.01272	5.07	3.6	-0.386	0.12466	.	1.254490	0.05892	N	0.628448	T	0.00695	0.0023	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.43572	-0.9383	9	0.02654	T	1	.	4.4551	0.11639	0.0:0.4346:0.1731:0.3923	.	57	Q9BYR0	KRA47_HUMAN	P	57	ENSP00000375236:S57P	ENSP00000375236:S57P	S	+	1	0	KRTAP4-9;KRTAP4-7	36494153	0.000000	0.05858	0.033000	0.17914	0.157000	0.22087	-0.806000	0.04525	0.004000	0.14682	0.374000	0.22700	TCT	.		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
FAM134C	162427	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40734802	40734802	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr17:40734802C>A	ENST00000309428.5	-	8	892	c.833G>T	c.(832-834)aGg>aTg	p.R278M	FAM134C_ENST00000543197.1_Missense_Mutation_p.R83M|FAM134C_ENST00000585894.1_Missense_Mutation_p.R181M	NM_178126.3	NP_835227.1	Q86VR2	F134C_HUMAN	family with sequence similarity 134, member C	278						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.134)		GGCCAATTCCCTGGCAACAGT	0.468																																					p.R278M													.	FAM134C-70	0			c.G833T						.						164.0	154.0	157.0					17																	40734802		2203	4300	6503	SO:0001583	missense	162427	exon8			AATTCCCTGGCAA	BC049370	CCDS11432.1	17q21.2	2007-05-01							27258	protein-coding gene	gene with protein product						12477932	Standard	NM_178126		Approved	DKFZp686B1036, FLJ33806	uc002ial.2	Q86VR2		ENST00000309428.5:c.833G>T	17.37:g.40734802C>A	ENSP00000309432:p.Arg278Met	Somatic	84	1		WXS	Illumina HiSeq	Phase_I	101	34	NM_178126	0	0	4	7	3	B3KR75	Missense_Mutation	SNP	ENST00000309428.5	37	CCDS11432.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396383	0.83011	.	.	ENSG00000141699	ENST00000309428;ENST00000543197	T;T	0.47528	0.84;0.87	6.17	5.21	0.72293	.	0.078533	0.85682	D	0.000000	T	0.52468	0.1736	L	0.36672	1.1	0.46654	D	0.999145	D	0.65815	0.995	D	0.63192	0.912	T	0.56238	-0.8012	10	0.87932	D	0	-17.1319	7.4263	0.27100	0.0:0.7314:0.0:0.2686	.	278	Q86VR2	F134C_HUMAN	M	278;83	ENSP00000309432:R278M;ENSP00000446235:R83M	ENSP00000309432:R278M	R	-	2	0	FAM134C	37988328	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.491000	0.45303	1.632000	0.50472	-0.140000	0.14226	AGG	.		0.468	FAM134C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450536.1	NM_178126	
HEXIM1	10614	broad.mit.edu	37	17	43226748	43226748	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr17:43226748A>G	ENST00000332499.2	+	1	2065	c.191A>G	c.(190-192)gAa>gGa	p.E64G	AC002117.1_ENST00000589950.1_RNA|AC002117.1_ENST00000452741.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	64					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CCGGAGGGGGAAGGGAGCCTG	0.682											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E64G													.	HEXIM1-23	0			c.A191G						.						31.0	33.0	33.0					17																	43226748		2202	4299	6501	SO:0001583	missense	10614	exon1			AGGGGGAAGGGAG	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.191A>G	17.37:g.43226748A>G	ENSP00000328773:p.Glu64Gly	Somatic	154	0	914	WXS	Illumina HiSeq	Phase_I	182	7	NM_006460	0	0	54	54	0	B2R8Y5	Missense_Mutation	SNP	ENST00000332499.2	37	CCDS11495.1	.	.	.	.	.	.	.	.	.	.	A	11.04	1.523233	0.27299	.	.	ENSG00000186834	ENST00000332499	.	.	.	4.36	0.691	0.18045	.	0.842697	0.10137	N	0.711287	T	0.21921	0.0528	N	0.16478	0.41	0.28652	N	0.906596	B	0.02656	0.0	B	0.04013	0.001	T	0.22661	-1.0210	9	0.28530	T	0.3	-3.5906	2.9745	0.05933	0.6069:0.0:0.21:0.183	.	64	O94992	HEXI1_HUMAN	G	64	.	ENSP00000328773:E64G	E	+	2	0	HEXIM1	40582531	0.992000	0.36948	0.921000	0.36526	0.880000	0.50808	1.340000	0.33896	0.205000	0.20568	0.459000	0.35465	GAA	.		0.682	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449821.2	NM_006460	
PPP1R9B	84687	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48221032	48221032	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr17:48221032A>G	ENST00000316878.6	-	5	1552	c.1550T>C	c.(1549-1551)aTg>aCg	p.M517T	PPP1R9B_ENST00000501501.2_5'UTR|AC002401.1_ENST00000451776.1_RNA	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B	517	Interacts with RGS2. {ECO:0000250}.|PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						CTCCAGGCCCATGTCTGCCCC	0.632																																					.													.	PPP1R9B-90	0			.						.						76.0	86.0	83.0					17																	48221032		2102	4218	6320	SO:0001583	missense	84687	.			AGGCCCATGTCTG	AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.1550T>C	17.37:g.48221032A>G	ENSP00000475417:p.Met517Thr	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	58	35	.	0	0	11	18	7	Q8TCR9	Missense_Mutation	SNP	ENST00000316878.6	37																																																																																				.		0.632	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032595	
TMEM104	54868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72781730	72781730	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr17:72781730T>A	ENST00000335464.5	+	3	317	c.155T>A	c.(154-156)cTg>cAg	p.L52Q	TMEM104_ENST00000582773.1_Missense_Mutation_p.L52Q|TMEM104_ENST00000417024.2_Intron|TMEM104_ENST00000582330.1_Missense_Mutation_p.L52Q	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	52						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					CTGGTGTTCCTGGGCTTCATG	0.632																																					p.L52Q		.											.	TMEM104-90	0			c.T155A						.						76.0	56.0	63.0					17																	72781730		2203	4300	6503	SO:0001583	missense	54868	exon3			TGTTCCTGGGCTT	AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.155T>A	17.37:g.72781730T>A	ENSP00000334849:p.Leu52Gln	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	60	34	NM_017728	0	0	0	0	0	Q8TEU1|Q9NT56|Q9NXH1	Missense_Mutation	SNP	ENST00000335464.5	37	CCDS32723.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.482735	0.84747	.	.	ENSG00000109066	ENST00000335464	T	0.02498	4.27	4.98	4.98	0.66077	.	0.074254	0.53938	D	0.000043	T	0.16769	0.0403	M	0.84585	2.705	0.80722	D	1	D;D	0.76494	0.966;0.999	P;D	0.71656	0.869;0.974	T	0.00624	-1.1639	10	0.72032	D	0.01	-10.1576	14.642	0.68732	0.0:0.0:0.0:1.0	.	52;52	Q8NE00-2;Q8NE00	.;TM104_HUMAN	Q	52	ENSP00000334849:L52Q	ENSP00000334849:L52Q	L	+	2	0	TMEM104	70293325	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	7.568000	0.82369	1.872000	0.54250	0.260000	0.18958	CTG	.		0.632	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444442.1	NM_017728	
ACER1	125981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	6312214	6312214	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr19:6312214C>T	ENST00000301452.4	-	3	373	c.296G>A	c.(295-297)gGc>gAc	p.G99D		NM_133492.2	NP_597999.1	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1	99					cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|ceramide catabolic process (GO:0046514)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)|regulation of lipid metabolic process (GO:0019216)|response to alkaline pH (GO:0010446)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)	15						TATGCTATAGCCACTGCCCAG	0.607																																					p.G99D		.											.	ACER1-90	0			c.G296A						.						59.0	51.0	54.0					19																	6312214		2203	4300	6503	SO:0001583	missense	125981	exon3			CTATAGCCACTGC	AF347024	CCDS12161.1	19p13.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000167769	ENSG00000167769	3.5.1.23	"""Alkaline ceramidase"""	18356	protein-coding gene	gene with protein product		613491	"""N-acylsphingosine amidohydrolase (alkaline ceramidase) 3"""	ASAH3		12783875	Standard	NM_133492		Approved		uc002mel.2	Q8TDN7		ENST00000301452.4:c.296G>A	19.37:g.6312214C>T	ENSP00000301452:p.Gly99Asp	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	68	24	NM_133492	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301452.4	37	CCDS12161.1	.	.	.	.	.	.	.	.	.	.	C	8.699	0.909265	0.17833	.	.	ENSG00000167769	ENST00000301452	T	0.42900	0.96	5.13	0.47	0.16747	.	0.527539	0.21637	N	0.071397	T	0.37210	0.0995	M	0.73598	2.24	0.22851	N	0.998658	P	0.42518	0.782	B	0.39503	0.301	T	0.32561	-0.9902	10	0.72032	D	0.01	-15.663	4.4791	0.11759	0.278:0.5108:0.1345:0.0768	.	99	Q8TDN7	ACER1_HUMAN	D	99	ENSP00000301452:G99D	ENSP00000301452:G99D	G	-	2	0	ACER1	6263214	0.936000	0.31750	0.029000	0.17559	0.086000	0.17979	1.990000	0.40717	-0.045000	0.13468	-1.740000	0.00687	GGC	.		0.607	ACER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452982.1	NM_133492	
SNRNP70	6625	ucsc.edu	37	19	49604725	49604725	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr19:49604725C>T	ENST00000598441.1	+	7	696	c.472C>T	c.(472-474)Cac>Tac	p.H158Y	SNRNP70_ENST00000221448.5_Missense_Mutation_p.H158Y			P08621	RU17_HUMAN	small nuclear ribonucleoprotein 70kDa (U1)	158	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	12						GCGAGACATGCACTGTGAGTA	0.622																																					p.H158Y													.	SNRNP70-90	0			c.C472T						.						118.0	82.0	94.0					19																	49604725		2203	4300	6503	SO:0001583	missense	6625	exon7			GACATGCACTGTG		CCDS12756.1, CCDS74417.1	19q13.3	2013-02-12	2008-10-29	2008-10-29		ENSG00000104852		"""RNA binding motif (RRM) containing"""	11150	protein-coding gene	gene with protein product		180740	"""small nuclear ribonucleoprotein 70kDa (RNP antigen)"""	RNPU1Z, RPU1, SNRP70			Standard	XM_005259177		Approved	U1-70K, Snp1	uc021uxh.1	P08621		ENST00000598441.1:c.472C>T	19.37:g.49604725C>T	ENSP00000472998:p.His158Tyr	Somatic	46	0		WXS	Illumina HiSeq		32	4	NM_003089	0	0	0	0	0	B3KUA3|P78493|P78494|Q15364|Q15686|Q15687|Q15689|Q99377|Q9UE45|Q9UE46|Q9UE47|Q9UE48|Q9UFQ6	Missense_Mutation	SNP	ENST00000598441.1	37	CCDS12756.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.258592	0.80246	.	.	ENSG00000104852	ENST00000221448;ENST00000401730	T;T	0.16073	2.37;2.37	4.95	4.95	0.65309	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.16811	0.0404	L	0.43152	1.355	0.80722	D	1	P;P	0.42556	0.783;0.739	B;B	0.36289	0.221;0.167	T	0.02505	-1.1149	10	0.51188	T	0.08	-22.8404	17.358	0.87342	0.0:1.0:0.0:0.0	.	158;158	P08621;P08621-2	RU17_HUMAN;.	Y	158	ENSP00000221448:H158Y;ENSP00000385077:H158Y	ENSP00000221448:H158Y	H	+	1	0	SNRNP70	54296537	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.327000	0.79147	2.470000	0.83445	0.655000	0.94253	CAC	.		0.622	SNRNP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466266.1	NM_003089	
UBE2S	27338	broad.mit.edu	37	19	55913035	55913035	+	Silent	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr19:55913035A>G	ENST00000264552.9	-	4	625	c.438T>C	c.(436-438)gcT>gcC	p.A146A	UBE2S_ENST00000592570.1_5'Flank|RPL28_ENST00000560055.1_Intron|CTD-2105E13.13_ENST00000589101.1_lincRNA	NM_014501.2	NP_055316.2	Q16763	UBE2S_HUMAN	ubiquitin-conjugating enzyme E2S	146					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular protein modification process (GO:0006464)|exit from mitosis (GO:0010458)|free ubiquitin chain polymerization (GO:0010994)|protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)	anaphase-promoting complex (GO:0005680)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			lung(1)	1	Breast(117;0.155)		LUSC - Lung squamous cell carcinoma(43;0.13)|BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.11)		GACGGGCCCGAGCCGCATACT	0.677																																					p.A146A													.	UBE2S-226	0			c.T438C						.						9.0	12.0	11.0					19																	55913035		2142	4160	6302	SO:0001819	synonymous_variant	27338	exon4			GGCCCGAGCCGCA	BC004236	CCDS33114.1	19q13.43	2008-02-05				ENSG00000108106		"""Ubiquitin-conjugating enzymes E2"""	17895	protein-coding gene	gene with protein product	"""ubiquitin carrier protein"", ""ubiquitin-conjugating enzyme E2-24 kD"", ""ubiquitin-protein ligase"""	610309				1379239	Standard	NM_014501		Approved	E2-EPF	uc002qkx.1	Q16763		ENST00000264552.9:c.438T>C	19.37:g.55913035A>G		Somatic	92	3		WXS	Illumina HiSeq	Phase_I	103	17	NM_014501	0	0	85	85	0	Q9BTC1	Silent	SNP	ENST00000264552.9	37	CCDS33114.1																																																																																			.		0.677	UBE2S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453088.1	NM_014501	
ZNF71	58491	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57133380	57133380	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr19:57133380A>T	ENST00000328070.6	+	3	959	c.725A>T	c.(724-726)tAc>tTc	p.Y242F		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		GAGAAGCCCTACGCGTGCGGG	0.652																																					p.Y242F													.	ZNF71-91	0			c.A725T						.						52.0	49.0	50.0					19																	57133380		2203	4300	6503	SO:0001583	missense	58491	exon3			AGCCCTACGCGTG	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.725A>T	19.37:g.57133380A>T	ENSP00000328245:p.Tyr242Phe	Somatic	120	1		WXS	Illumina HiSeq	Phase_I	76	30	NM_021216	0	0	1	4	3	Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	ENST00000328070.6	37	CCDS12947.1	.	.	.	.	.	.	.	.	.	.	A	13.30	2.194552	0.38806	.	.	ENSG00000197951	ENST00000328070	T	0.18338	2.22	3.82	1.56	0.23342	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07999	0.0200	N	0.04132	-0.27	0.09310	N	1	B	0.11235	0.004	B	0.16289	0.015	T	0.33979	-0.9847	9	0.49607	T	0.09	.	7.6854	0.28538	0.4953:0.0:0.0:0.5047	.	242	Q9NQZ8	ZNF71_HUMAN	F	242	ENSP00000328245:Y242F	ENSP00000328245:Y242F	Y	+	2	0	ZNF71	61825192	0.000000	0.05858	0.932000	0.37286	0.985000	0.73830	-0.089000	0.11180	0.050000	0.15949	0.459000	0.35465	TAC	.		0.652	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
DNAJC27	51277	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	25180723	25180723	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr2:25180723G>T	ENST00000264711.2	-	4	550	c.361C>A	c.(361-363)Cat>Aat	p.H121N	DNAJC27_ENST00000534855.1_Missense_Mutation_p.H50N|DNAJC27_ENST00000468467.1_5'UTR	NM_001198559.1|NM_016544.2	NP_001185488.1|NP_057628.1	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	121					small GTPase mediated signal transduction (GO:0007264)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						ATGTTTCCATGAGGTCCAAGC	0.458																																					p.H121N													.	DNAJC27-228	0			c.C361A						.						121.0	116.0	118.0					2																	25180723		2203	4300	6503	SO:0001583	missense	51277	exon4			TTCCATGAGGTCC		CCDS1716.1, CCDS74493.1	2p23.3	2011-09-02	2008-08-20	2008-08-20	ENSG00000115137	ENSG00000115137		"""Heat shock proteins / DNAJ (HSP40)"""	30290	protein-coding gene	gene with protein product		613527	"""rab and DnaJ domain containing"""	RBJ		14980719	Standard	NM_016544		Approved	RabJS	uc002rft.2	Q9NZQ0	OTTHUMG00000125524	ENST00000264711.2:c.361C>A	2.37:g.25180723G>T	ENSP00000264711:p.His121Asn	Somatic	156	1		WXS	Illumina HiSeq	Phase_I	134	56	NM_016544	0	0	0	0	0	Q5JV88|Q86Y24	Missense_Mutation	SNP	ENST00000264711.2	37	CCDS1716.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169198	0.21621	.	.	ENSG00000115137	ENST00000264711;ENST00000534855	T;T	0.76186	-0.5;-1.0	5.27	5.27	0.74061	Small GTP-binding protein domain (1);	0.105620	0.64402	D	0.000002	T	0.52933	0.1765	N	0.03194	-0.395	0.52501	D	0.999957	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.50171	-0.8859	10	0.16896	T	0.51	-24.3984	17.6166	0.88069	0.0:0.0:1.0:0.0	.	121;121	Q9NZQ0-3;Q9NZQ0	.;DJC27_HUMAN	N	121;50	ENSP00000264711:H121N;ENSP00000440086:H50N	ENSP00000264711:H121N	H	-	1	0	DNAJC27	25034227	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.524000	0.98036	2.750000	0.94351	0.563000	0.77884	CAT	.		0.458	DNAJC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246855.3	NM_016544	
SLC3A1	6519	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44547379	44547379	+	Silent	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr2:44547379A>G	ENST00000260649.6	+	10	1735	c.1659A>G	c.(1657-1659)caA>caG	p.Q553Q	PREPL_ENST00000409411.1_3'UTR|SLC3A1_ENST00000409380.1_Silent_p.Q275Q|PREPL_ENST00000409936.1_3'UTR|SLC3A1_ENST00000409740.3_Silent_p.Q184Q|PREPL_ENST00000409957.1_3'UTR|PREPL_ENST00000541738.1_3'UTR	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	553					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	AGTTATATCAAGATTTAAGTC	0.378																																					p.Q553Q													.	SLC3A1-90	0			c.A1659G						.						61.0	56.0	58.0					2																	44547379		2203	4300	6503	SO:0001819	synonymous_variant	6519	exon10			ATATCAAGATTTA		CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.1659A>G	2.37:g.44547379A>G		Somatic	117	1		WXS	Illumina HiSeq	Phase_I	112	38	NM_000341	0	0	182	348	166	A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Silent	SNP	ENST00000260649.6	37	CCDS1819.1																																																																																			.		0.378	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250676.1	NM_000341	
RGPD3	653489	broad.mit.edu	37	2	107049632	107049632	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr2:107049632G>A	ENST00000409886.3	-	16	2402	c.2315C>T	c.(2314-2316)gCg>gTg	p.A772V	RGPD3_ENST00000304514.7_Missense_Mutation_p.A772V	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	772					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTCTGAATCCGCATTTCGCAA	0.373																																					p.A772V													.	RGPD3-23	0			c.C2315T						.						90.0	75.0	80.0					2																	107049632		692	1590	2282	SO:0001583	missense	653489	exon16			GAATCCGCATTTC		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2315C>T	2.37:g.107049632G>A	ENSP00000386588:p.Ala772Val	Somatic	725	1		WXS	Illumina HiSeq	Phase_I	656	7	NM_001144013	0	0	0	0	0	B8ZZM4	Missense_Mutation	SNP	ENST00000409886.3	37	CCDS46379.1	.	.	.	.	.	.	.	.	.	.	.	3.284	-0.146450	0.06627	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.23348	1.91;1.91	2.34	1.42	0.22433	.	.	.	.	.	T	0.19127	0.0459	L	0.47716	1.5	0.22947	N	0.998528	B	0.15141	0.012	B	0.06405	0.002	T	0.16778	-1.0391	9	0.37606	T	0.19	-0.1623	4.3139	0.10984	0.2042:0.0:0.7958:0.0	.	772	A6NKT7	RGPD3_HUMAN	V	772;530;772	ENSP00000386588:A772V;ENSP00000303659:A772V	ENSP00000303659:A772V	A	-	2	0	RGPD3	106416064	0.918000	0.31147	0.919000	0.36401	0.028000	0.11728	0.415000	0.21181	1.308000	0.44962	0.173000	0.16961	GCG	.		0.373	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
ERCC3	2071	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	128051097	128051097	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr2:128051097G>T	ENST00000285398.2	-	2	320	c.226C>A	c.(226-228)Ctc>Atc	p.L76I	ERCC3_ENST00000493187.2_Missense_Mutation_p.L12I	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	76					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		ACCACCCAGAGGGGCCTGGAG	0.572			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.L76I		.	yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	.	ERCC3-723	0			c.C226A						.						71.0	63.0	66.0					2																	128051097		2203	4300	6503	SO:0001583	missense	2071	exon2	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CCCAGAGGGGCCT	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.226C>A	2.37:g.128051097G>T	ENSP00000285398:p.Leu76Ile	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	51	18	NM_000122	0	0	1	1	0	Q53QM0	Missense_Mutation	SNP	ENST00000285398.2	37	CCDS2144.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575903	0.86645	.	.	ENSG00000163161	ENST00000285398;ENST00000493187	T;T	0.77877	-1.13;-1.13	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.76695	0.4023	L	0.39020	1.185	0.80722	D	1	B;P	0.36465	0.177;0.554	P;P	0.45946	0.498;0.498	T	0.75303	-0.3365	10	0.33141	T	0.24	-17.9364	17.1634	0.86809	0.0:0.0:1.0:0.0	.	76;76	A8K359;P19447	.;ERCC3_HUMAN	I	76;12	ENSP00000285398:L76I;ENSP00000444796:L12I	ENSP00000285398:L76I	L	-	1	0	ERCC3	127767567	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.997000	0.76270	2.277000	0.76020	0.563000	0.77884	CTC	.		0.572	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1	NM_000122	
WDR33	55339	ucsc.edu;bcgsc.ca	37	2	128522273	128522273	+	Intron	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr2:128522273G>A	ENST00000322313.4	-	6	785				WDR33_ENST00000393006.1_Intron|WDR33_ENST00000409658.3_Missense_Mutation_p.T252I	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33						mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		GAAAAATATTGTGTTTATAGG	0.403																																					p.T252I													.	WDR33-90	0			c.C755T						.						39.0	44.0	42.0					2																	128522273		1327	2309	3636	SO:0001627	intron_variant	55339	exon6			AATATTGTGTTTA		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.626+128C>T	2.37:g.128522273G>A		Somatic	303	2		WXS	Illumina HiSeq		248	121	NM_001006622	0	0	2	6	4	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	37	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756277	0.49362	.	.	ENSG00000136709	ENST00000409658	T	0.36699	1.24	5.7	4.82	0.62117	.	.	.	.	.	T	0.59376	0.2189	.	.	.	0.25220	N	0.989915	D	0.62365	0.991	D	0.75484	0.986	T	0.54132	-0.8339	8	0.72032	D	0.01	.	13.4885	0.61379	0.0:0.0:0.8435:0.1565	.	252	Q9C0J8-2	.	I	252	ENSP00000387186:T252I	ENSP00000387186:T252I	T	-	2	0	WDR33	128238743	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.877000	0.63086	1.399000	0.46721	-0.181000	0.13052	ACA	.		0.403	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
NEB	4703	broad.mit.edu	37	2	152359325	152359325	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr2:152359325A>T	ENST00000172853.10	-	139	18954	c.18807T>A	c.(18805-18807)aaT>aaA	p.N6269K	NEB_ENST00000603639.1_Missense_Mutation_p.N7970K|NEB_ENST00000397345.3_Missense_Mutation_p.N7970K|NEB_ENST00000498015.2_Intron|NEB_ENST00000427231.2_Missense_Mutation_p.N7970K|NEB_ENST00000509223.2_Intron|NEB_ENST00000409198.1_Missense_Mutation_p.N6269K|NEB_ENST00000604864.1_Missense_Mutation_p.N7970K|NEB_ENST00000397336.2_Missense_Mutation_p.N7K			P20929	NEBU_HUMAN	nebulin	6269					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGTTCTCTTGATTGCGTTTGA	0.338																																					p.N8005K													.	NEB-145	0			c.T24015A						.						70.0	60.0	63.0					2																	152359325		1801	4066	5867	SO:0001583	missense	4703	exon168			CTCTTGATTGCGT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.18807T>A	2.37:g.152359325A>T	ENSP00000172853:p.Asn6269Lys	Somatic	94	2		WXS	Illumina HiSeq	Phase_I	82	6	NM_001271208	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	16.57|16.57|16.57	3.158885|3.158885|3.158885	0.57368|0.57368|0.57368	.|.|.	.|.|.	ENSG00000183091|ENSG00000183091|ENSG00000183091	ENST00000397337|ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000397336;ENST00000424585|ENST00000421461	.|T;T;T;T;T;T|.	.|0.57107|.	.|0.42;0.42;0.42;0.42;4.06;0.42|.	5.57|5.57|5.57	5.57|5.57|5.57	0.84162|0.84162|0.84162	.|.|.	.|0.045524|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.73194|0.73194|0.73194	0.3556|0.3556|0.3556	M|M|M	0.91818|0.91818|0.91818	3.245|3.245|3.245	0.21652|0.21652|0.21652	N|N|N	0.999605|0.999605|0.999605	.|D;D|.	.|0.76494|.	.|0.999;0.996|.	.|D;D|.	.|0.91635|.	.|0.999;0.991|.	T|T|T	0.70142|0.70142|0.70142	-0.4953|-0.4953|-0.4953	5|10|5	.|0.42905|.	.|T|.	.|0.14|.	.|.|.	11.631|11.631|11.631	0.51175|0.51175|0.51175	0.9285:0.0:0.0715:0.0|0.9285:0.0:0.0715:0.0|0.9285:0.0:0.0715:0.0	.|.|.	.|6269;8032|.	.|P20929;F8WCL5|.	.|NEBU_HUMAN;.|.	N|K|T	166|6269;7970;7970;6269;7;197|147	.|ENSP00000386259:N6269K;ENSP00000380505:N7970K;ENSP00000416578:N7970K;ENSP00000172853:N6269K;ENSP00000380497:N7K;ENSP00000404876:N197K|.	.|ENSP00000172853:N6269K|.	I|N|S	-|-|-	2|3|1	0|2|0	NEB|NEB|NEB	152067571|152067571|152067571	0.997000|0.997000|0.997000	0.39634|0.39634|0.39634	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.999000|0.999000|0.999000	0.98932|0.98932|0.98932	0.638000|0.638000|0.638000	0.24674|0.24674|0.24674	2.113000|2.113000|2.113000	0.64589|0.64589|0.64589	0.528000|0.528000|0.528000	0.53228|0.53228|0.53228	ATC|AAT|TCA	.		0.338	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
SSFA2	6744	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	182780851	182780851	+	Silent	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr2:182780851T>C	ENST00000431877.2	+	11	2663	c.2484T>C	c.(2482-2484)acT>acC	p.T828T	SSFA2_ENST00000428267.2_Silent_p.T675T|SSFA2_ENST00000409001.1_Silent_p.T828T|SSFA2_ENST00000320370.7_Silent_p.T828T|SSFA2_ENST00000409136.1_Silent_p.T337T	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	828						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			ATGGAAGGACTCCTACCTGTT	0.522																																					p.T828T													.	SSFA2-153	0			c.T2484C						.						108.0	120.0	116.0					2																	182780851		2203	4300	6503	SO:0001819	synonymous_variant	6744	exon11			AAGGACTCCTACC	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.2484T>C	2.37:g.182780851T>C		Somatic	81	1		WXS	Illumina HiSeq	Phase_I	100	44	NM_001130445	0	0	2	2	0	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Silent	SNP	ENST00000431877.2	37	CCDS46467.1																																																																																			.		0.522	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	
C21orf2	755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	45750162	45750162	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr21:45750162C>A	ENST00000339818.4	-	7	897	c.690G>T	c.(688-690)gaG>gaT	p.E230D	C21orf2_ENST00000496321.1_5'UTR|AP001062.7_ENST00000448927.1_RNA|C21orf2_ENST00000325223.7_Missense_Mutation_p.E229D|C21orf2_ENST00000397956.3_Missense_Mutation_p.E349D|AP001062.8_ENST00000422357.1_RNA	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2	230					cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		CCTCCAGCCCCTCTGCATCCA	0.697																																					p.E349D		.											.	C21orf2-90	0			c.G1047T						.						15.0	15.0	15.0					21																	45750162		2189	4284	6473	SO:0001583	missense	755	exon7			CAGCCCCTCTGCA	Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.690G>T	21.37:g.45750162C>A	ENSP00000344566:p.Glu230Asp	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	55	23	NM_001271441	0	0	104	189	85	A8MPS9|O14993|Q8N5X6|Q99837|Q99838	Missense_Mutation	SNP	ENST00000339818.4	37	CCDS13709.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589994	0.66105	.	.	ENSG00000160226	ENST00000339818;ENST00000397956;ENST00000325223	T;T;T	0.50813	1.46;0.73;1.47	5.13	3.29	0.37713	.	0.111298	0.64402	D	0.000014	T	0.57242	0.2040	M	0.69823	2.125	0.34719	D	0.728514	D;D;D;D	0.67145	0.986;0.996;0.976;0.986	P;P;P;P	0.58266	0.737;0.836;0.551;0.737	T	0.65747	-0.6093	10	0.29301	T	0.29	-28.6583	9.0929	0.36621	0.0:0.8222:0.0:0.1778	.	229;349;230;189	G5E952;Q8N5X6;O43822;O43822-2	.;.;CU002_HUMAN;.	D	230;349;229	ENSP00000344566:E230D;ENSP00000381047:E349D;ENSP00000317302:E229D	ENSP00000317302:E229D	E	-	3	2	C21orf2	44574590	1.000000	0.71417	0.986000	0.45419	0.343000	0.28985	2.457000	0.45005	1.153000	0.42468	0.655000	0.94253	GAG	.		0.697	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195799.1	NM_004928	
MN1	4330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	28192976	28192976	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr22:28192976C>T	ENST00000302326.4	-	1	4510	c.3556G>A	c.(3556-3558)Gcc>Acc	p.A1186T		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	1186					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						GCCCCGACGGCGCACTCACCC	0.647			T	ETV6	"""AML, meningioma"""																																p.A1186T		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.G3556A						.						18.0	20.0	19.0					22																	28192976		2099	4221	6320	SO:0001583	missense	4330	exon1			CGACGGCGCACTC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.3556G>A	22.37:g.28192976C>T	ENSP00000304956:p.Ala1186Thr	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	35	16	NM_002430	0	0	0	0	0	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.233669	0.58886	.	.	ENSG00000169184	ENST00000302326	T	0.47869	0.83	5.04	1.75	0.24633	.	0.148707	0.45361	D	0.000368	T	0.22126	0.0533	N	0.08118	0	0.24692	N	0.993302	B	0.02656	0.0	B	0.06405	0.002	T	0.10132	-1.0643	10	0.37606	T	0.19	-5.5453	4.928	0.13903	0.0:0.5962:0.1578:0.2459	.	1186	Q10571	MN1_HUMAN	T	1186	ENSP00000304956:A1186T	ENSP00000304956:A1186T	A	-	1	0	MN1	26522976	0.758000	0.28405	0.850000	0.33497	0.970000	0.65996	0.490000	0.22403	0.512000	0.28257	0.456000	0.33151	GCC	.		0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
CSNK1E	1454	ucsc.edu	37	22	38690182	38690182	+	Missense_Mutation	SNP	G	G	A	rs200745813		TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr22:38690182G>A	ENST00000396832.1	-	9	1411	c.1151C>T	c.(1150-1152)gCg>gTg	p.A384V	CSNK1E_ENST00000403904.1_Missense_Mutation_p.A384V|CSNK1E_ENST00000359867.3_Missense_Mutation_p.A384V|CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000400206.2_Missense_Mutation_p.A384V	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	384					cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GTTGGCGGGCGCACCCCTGTG	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		14506	0.0		0.001	False		,,,				2504	0.0				p.A384V	Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)												.	CSNK1E-1193	0			c.C1151T						.						36.0	37.0	36.0					22																	38690182		2203	4300	6503	SO:0001583	missense	1454	exon9			GCGGGCGCACCCC		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.1151C>T	22.37:g.38690182G>A	ENSP00000380044:p.Ala384Val	Somatic	41	0		WXS	Illumina HiSeq		39	4	NM_001894	0	0	11	11	0		Missense_Mutation	SNP	ENST00000396832.1	37	CCDS13970.1	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	21.4|21.4	4.146633|4.146633	0.77888|0.77888	.|.	.|.	ENSG00000213923|ENSG00000213923	ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904|ENST00000366216	T;T;T;T|.	0.56444|.	0.46;0.46;0.46;0.46|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.047888|.	0.85682|.	D|.	0.000000|.	T|T	0.56761|0.56761	0.2007|0.2007	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	B|.	0.15930|.	0.015|.	B|.	0.09377|.	0.004|.	T|T	0.49908|0.49908	-0.8889|-0.8889	10|5	0.42905|.	T|.	0.14|.	.|.	19.8045|19.8045	0.96525|0.96525	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	384|.	P49674|.	KC1E_HUMAN|.	V|C	384|87	ENSP00000352929:A384V;ENSP00000380044:A384V;ENSP00000383067:A384V;ENSP00000384074:A384V|.	ENSP00000352929:A384V|.	A|R	-|-	2|1	0|0	CSNK1E|CSNK1E	37020128|37020128	1.000000|1.000000	0.71417|0.71417	0.265000|0.265000	0.24526|0.24526	0.113000|0.113000	0.19764|0.19764	9.460000|9.460000	0.97641|0.97641	2.676000|2.676000	0.91093|0.91093	0.655000|0.655000	0.94253|0.94253	GCG|CGC	G|1.000;A|0.000		0.657	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894	
CHL1	10752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	383612	383612	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:383612C>A	ENST00000256509.2	+	7	1168	c.526C>A	c.(526-528)Caa>Aaa	p.Q176K	CHL1_ENST00000397491.2_Missense_Mutation_p.Q176K	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	578	Glu-rich.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		ACACATCGAACAAGATGAAAG	0.378																																					p.Q176K		.											.	CHL1-583	0			c.C526A						.						70.0	64.0	66.0					3																	383612		2203	4300	6503	SO:0001583	missense	10752	exon5			ATCGAACAAGATG	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.526C>A	3.37:g.383612C>A	ENSP00000256509:p.Gln176Lys	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	190	89	NM_001253388	0	0	0	0	0	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.654162	0.88056	.	.	ENSG00000134121	ENST00000256509;ENST00000397491;ENST00000435603	T;T;T	0.60672	1.1;1.1;0.17	5.43	5.43	0.79202	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.74566	0.3733	L	0.61387	1.9	0.80722	D	1	D;D;D	0.71674	0.989;0.98;0.998	P;P;D	0.91635	0.87;0.746;0.999	T	0.76337	-0.2996	10	0.87932	D	0	.	17.7511	0.88434	0.0:1.0:0.0:0.0	.	176;176;176	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	K	176	ENSP00000256509:Q176K;ENSP00000380628:Q176K;ENSP00000397445:Q176K	ENSP00000256509:Q176K	Q	+	1	0	CHL1	358612	1.000000	0.71417	0.957000	0.39632	0.774000	0.43823	6.928000	0.75846	2.696000	0.92011	0.591000	0.81541	CAA	.		0.378	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
FYCO1	79443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	46000087	46000087	+	Nonsense_Mutation	SNP	G	G	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:46000087G>C	ENST00000296137.2	-	13	3817	c.3612C>G	c.(3610-3612)taC>taG	p.Y1204*	FYCO1_ENST00000438446.1_5'UTR|FYCO1_ENST00000535325.1_Nonsense_Mutation_p.Y1204*	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1204					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TGCAGCAGTAGTAACAGAAGA	0.547																																					p.Y1204X		.											.	FYCO1-91	0			c.C3612G						.						72.0	70.0	71.0					3																	46000087		2203	4300	6503	SO:0001587	stop_gained	79443	exon13			GCAGTAGTAACAG	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3612C>G	3.37:g.46000087G>C	ENSP00000296137:p.Tyr1204*	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	117	62	NM_024513	0	0	1	1	0	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Nonsense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	G	46	12.162409	0.99642	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	.	.	.	5.74	3.92	0.45320	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-19.7307	10.5363	0.45007	0.1343:0.0:0.8657:0.0	.	.	.	.	X	1204	.	.	Y	-	3	2	FYCO1	45975091	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.280000	0.51677	2.709000	0.92574	0.655000	0.94253	TAC	.		0.547	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
CELSR3	1951	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	48699894	48699894	+	Silent	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:48699894G>A	ENST00000164024.4	-	1	454	c.174C>T	c.(172-174)ggC>ggT	p.G58G	CELSR3_ENST00000544264.1_Silent_p.G58G|RP11-148G20.1_ENST00000421275.1_RNA	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	58					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTAAGGCTCCGCCACCGATAT	0.682																																					p.G58G		.											.	CELSR3-523	0			c.C174T						.						21.0	26.0	25.0					3																	48699894		2117	4162	6279	SO:0001819	synonymous_variant	1951	exon1			GGCTCCGCCACCG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.174C>T	3.37:g.48699894G>A		Somatic	61	0		WXS	Illumina HiSeq	Phase_I	36	17	NM_001407	0	0	0	0	0	O75092	Silent	SNP	ENST00000164024.4	37	CCDS2775.1																																																																																			.		0.682	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
FRMD4B	23150	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	69230503	69230503	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:69230503G>A	ENST00000398540.3	-	21	2481	c.2398C>T	c.(2398-2400)Ccg>Tcg	p.P800S	FRMD4B_ENST00000542259.1_Missense_Mutation_p.P746S|FRMD4B_ENST00000478263.1_Missense_Mutation_p.P452S	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	800					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CTGGAAGACGGTGGCTCCTGA	0.433																																					p.P800S		.											.	FRMD4B-72	0			c.C2398T						.						73.0	72.0	73.0					3																	69230503		1939	4143	6082	SO:0001583	missense	23150	exon21			AAGACGGTGGCTC	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2398C>T	3.37:g.69230503G>A	ENSP00000381549:p.Pro800Ser	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	102	6	NM_015123	0	0	1	1	0	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.152377	0.38021	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.86956	-2.19;-2.18	5.83	4.95	0.65309	.	0.224065	0.47455	D	0.000237	D	0.84813	0.5555	M	0.63843	1.955	0.09310	N	1	B;P	0.42203	0.058;0.773	B;B	0.35114	0.022;0.196	T	0.79351	-0.1839	10	0.72032	D	0.01	-1.8047	16.2232	0.82269	0.0:0.0:0.8659:0.1341	.	644;800	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	S	800;746;452	ENSP00000381549:P800S;ENSP00000437658:P746S	ENSP00000381549:P800S	P	-	1	0	FRMD4B	69313193	0.959000	0.32827	0.066000	0.19879	0.545000	0.35147	2.106000	0.41835	1.441000	0.47550	-0.293000	0.09583	CCG	.		0.433	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
SERPINI2	5276	bcgsc.ca	37	3	167189527	167189527	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:167189527A>T	ENST00000476257.1	-	3	394	c.96T>A	c.(94-96)gaT>gaA	p.D32E	SERPINI2_ENST00000465031.1_5'UTR|SERPINI2_ENST00000264677.4_Missense_Mutation_p.D32E|SERPINI2_ENST00000461846.1_Missense_Mutation_p.D32E|SERPINI2_ENST00000471111.1_Missense_Mutation_p.D32E			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	32					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						CTTGATAAAGATCCACTGCAA	0.383																																					p.D42E													.	SERPINI2-228	0			c.T126A						.						146.0	149.0	148.0					3																	167189527		2203	4300	6503	SO:0001583	missense	5276	exon3			ATAAAGATCCACT	AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.96T>A	3.37:g.167189527A>T	ENSP00000420621:p.Asp32Glu	Somatic	85	0		WXS	Illumina HiSeq	Phase_1	76	35	NM_001012303	0	0	0	0	0		Missense_Mutation	SNP	ENST00000476257.1	37	CCDS3200.1	.	.	.	.	.	.	.	.	.	.	A	12.07	1.826955	0.32329	.	.	ENSG00000114204	ENST00000476257;ENST00000461846;ENST00000264677;ENST00000471111;ENST00000466903;ENST00000467583	D;D;D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87;-1.87;-1.87	5.7	3.0	0.34707	Serpin domain (3);	0.128799	0.56097	D	0.000029	D	0.87881	0.6289	L	0.50333	1.59	0.28074	N	0.932455	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.79550	-0.1757	10	0.37606	T	0.19	.	8.9818	0.35970	0.8227:0.0:0.1773:0.0	.	32;32	B4DDY9;O75830	.;SPI2_HUMAN	E	32	ENSP00000420621:D32E;ENSP00000417692:D32E;ENSP00000264677:D32E;ENSP00000419407:D32E;ENSP00000417752:D32E;ENSP00000419255:D32E	ENSP00000264677:D32E	D	-	3	2	SERPINI2	168672221	0.999000	0.42202	1.000000	0.80357	0.089000	0.18198	0.501000	0.22578	1.005000	0.39183	-0.262000	0.10625	GAT	.		0.383	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217	
TP63	8626	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	189612036	189612036	+	Silent	SNP	G	G	C	rs148577576	byFrequency	TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:189612036G>C	ENST00000264731.3	+	14	1877	c.1788G>C	c.(1786-1788)gcG>gcC	p.A596A	TP63_ENST00000449992.1_Silent_p.A417A|TP63_ENST00000354600.5_Silent_p.A502A|TP63_ENST00000440651.2_Silent_p.A592A|TP63_ENST00000320472.5_3'UTR|TP63_ENST00000456148.1_Silent_p.A498A|TP63_ENST00000382063.4_Silent_p.A511A	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	596	SAM.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TTCGACATGCGATCTGGAAGG	0.532										HNSCC(45;0.13)																											p.A596A													.	TP63-421	0			c.G1788C						.						83.0	81.0	81.0					3																	189612036		2203	4300	6503	SO:0001819	synonymous_variant	8626	exon14			ACATGCGATCTGG	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1788G>C	3.37:g.189612036G>C		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	75	30	NM_003722	0	0	0	0	0	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Silent	SNP	ENST00000264731.3	37	CCDS3293.1																																																																																			G|0.998;A|0.002		0.532	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
AFAP1	60312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	7783233	7783233	+	Intron	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr4:7783233G>T	ENST00000360265.4	-	12	1765				AFAP1-AS1_ENST00000608442.1_RNA|AFAP1_ENST00000420658.1_Missense_Mutation_p.P551H|AFAP1_ENST00000382543.3_Missense_Mutation_p.P551H|AFAP1_ENST00000513842.1_5'UTR|AFAP1_ENST00000358461.2_Intron			Q8N556	AFAP1_HUMAN	actin filament associated protein 1							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						TCTGTCAGCAGGAGAGTAGCG	0.532																																					p.P551H		.											.	AFAP1-90	0			c.C1652A						.						123.0	119.0	120.0					4																	7783233		692	1591	2283	SO:0001627	intron_variant	60312	exon13			TCAGCAGGAGAGT	AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.1531-2630C>A	4.37:g.7783233G>T		Somatic	121	0		WXS	Illumina HiSeq	Phase_I	106	40	NM_001134647	0	0	0	0	0	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Missense_Mutation	SNP	ENST00000360265.4	37	CCDS3397.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848151	0.91277	.	.	ENSG00000196526	ENST00000420658;ENST00000382543	T;T	0.16597	2.33;2.33	5.8	5.8	0.92144	.	.	.	.	.	T	0.21427	0.0516	L	0.36672	1.1	0.80722	D	1	D	0.61697	0.99	P	0.45946	0.498	T	0.00287	-1.1846	9	0.45353	T	0.12	.	20.0706	0.97721	0.0:0.0:1.0:0.0	.	551	E9PDT7	.	H	551	ENSP00000410689:P551H;ENSP00000371983:P551H	ENSP00000371983:P551H	P	-	2	0	AFAP1	7834133	1.000000	0.71417	0.588000	0.28705	0.985000	0.73830	7.463000	0.80869	2.744000	0.94065	0.655000	0.94253	CCT	.		0.532	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
UGT2B17	7367	broad.mit.edu	37	4	69403575	69403575	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr4:69403575G>T	ENST00000317746.2	-	6	1403	c.1361C>A	c.(1360-1362)cCg>cAg	p.P454Q		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	454					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	GGGCTTCACCGGTTGATCATG	0.408																																					p.P454Q	Melanoma(18;649 833 28984 37818 38500)												.	UGT2B17-91	0			c.C1361A						.						96.0	95.0	96.0					4																	69403575		2092	3934	6026	SO:0001583	missense	7367	exon6			TTCACCGGTTGAT	U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.1361C>A	4.37:g.69403575G>T	ENSP00000320401:p.Pro454Gln	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	135	5	NM_001077	0	0	0	0	0		Missense_Mutation	SNP	ENST00000317746.2	37	CCDS3523.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.029242	0.35797	.	.	ENSG00000197888	ENST00000317746	T	0.76186	-1.0	2.85	2.85	0.33270	.	0.000000	0.64402	U	0.000002	D	0.85106	0.5621	M	0.90019	3.08	0.34551	D	0.711274	.	.	.	.	.	.	D	0.90969	0.4818	8	0.87932	D	0	.	11.4257	0.50009	0.0:0.0:1.0:0.0	.	.	.	.	Q	454	ENSP00000320401:P454Q	ENSP00000320401:P454Q	P	-	2	0	UGT2B17	69086170	1.000000	0.71417	0.391000	0.26233	0.028000	0.11728	4.709000	0.61867	1.580000	0.49851	0.195000	0.17529	CCG	.		0.408	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251436.1	NM_001077	
ANXA10	11199	bcgsc.ca	37	4	169108558	169108558	+	Silent	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr4:169108558C>A	ENST00000359299.3	+	12	1134	c.948C>A	c.(946-948)atC>atA	p.I316I		NM_007193.4	NP_009124.2	Q9UJ72	ANX10_HUMAN	annexin A10	316						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(2)	16		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		TGCTTGCCATCTGTGCTGGTG	0.338																																					p.I316I													.	ANXA10-90	0			c.C948A						.						109.0	103.0	105.0					4																	169108558		2203	4300	6503	SO:0001819	synonymous_variant	11199	exon12			TGCCATCTGTGCT	AJ238979	CCDS34096.1	4q32.3	2008-02-05			ENSG00000109511	ENSG00000109511		"""Annexins"""	534	protein-coding gene	gene with protein product		608008				10458909	Standard	NM_007193		Approved	ANX14	uc003irm.3	Q9UJ72	OTTHUMG00000161275	ENST00000359299.3:c.948C>A	4.37:g.169108558C>A		Somatic	435	4		WXS	Illumina HiSeq	Phase_1	360	148	NM_007193	0	0	0	0	0	Q96IQ5|Q9UJV4	Silent	SNP	ENST00000359299.3	37	CCDS34096.1																																																																																			.		0.338	ANXA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364348.2	NM_007193	
CTNND2	1501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	10992734	10992734	+	Missense_Mutation	SNP	C	C	T	rs367931998		TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr5:10992734C>T	ENST00000304623.8	-	19	3329	c.3140G>A	c.(3139-3141)cGg>cAg	p.R1047Q	CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000503622.1_Missense_Mutation_p.R710Q|CTNND2_ENST00000359640.2_Missense_Mutation_p.R989Q|CTNND2_ENST00000511377.1_Missense_Mutation_p.R956Q|CTNND2_ENST00000458100.2_Missense_Mutation_p.R614Q	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1047					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGGCCTTTGCCGGTCCCTCTC	0.587																																					p.R1047Q		.											.	CTNND2-293	0			c.G3140A						.						134.0	120.0	125.0					5																	10992734		2203	4300	6503	SO:0001583	missense	1501	exon19			CTTTGCCGGTCCC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.3140G>A	5.37:g.10992734C>T	ENSP00000307134:p.Arg1047Gln	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	49	25	NM_001332	0	0	0	1	1	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691098	0.88735	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	T;T;T;T;T	0.79554	-1.22;-1.28;-1.22;-1.25;-1.25	5.18	4.3	0.51218	.	0.063175	0.64402	D	0.000009	D	0.84497	0.5485	L	0.39245	1.2	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.993	D;D;P	0.70227	0.968;0.968;0.543	D	0.83914	0.0297	10	0.40728	T	0.16	-11.8165	14.9681	0.71210	0.1441:0.8559:0.0:0.0	.	710;639;1047	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	Q	1047;989;956;142;614;710	ENSP00000307134:R1047Q;ENSP00000352661:R989Q;ENSP00000426510:R956Q;ENSP00000391155:R614Q;ENSP00000426887:R710Q	ENSP00000307134:R1047Q	R	-	2	0	CTNND2	11045734	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.337000	0.79256	1.159000	0.42565	0.650000	0.86243	CGG	.		0.587	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
ADAMTS12	81792	broad.mit.edu	37	5	33891915	33891915	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr5:33891915G>T	ENST00000504830.1	-	1	382	c.47C>A	c.(46-48)gCt>gAt	p.A16D	ADAMTS12_ENST00000515401.1_Missense_Mutation_p.A16D|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.A16D	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	16					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						AAGGAGCTGAGCCACCACGGA	0.522										HNSCC(64;0.19)																											p.A16D													.	ADAMTS12-232	0			c.C47A						.						95.0	100.0	98.0					5																	33891915		2203	4300	6503	SO:0001583	missense	81792	exon1			AGCTGAGCCACCA	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.47C>A	5.37:g.33891915G>T	ENSP00000422554:p.Ala16Asp	Somatic	303	0		WXS	Illumina HiSeq	Phase_I	244	5	NM_030955	0	0	0	0	0	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890371	0.72524	.	.	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.60424	0.19;0.19;3.31	5.61	2.48	0.30137	.	0.266944	0.30168	N	0.010257	T	0.49864	0.1582	L	0.27053	0.805	0.19775	N	0.999954	D;D;D	0.55385	0.969;0.971;0.971	P;P;P	0.53809	0.735;0.691;0.548	T	0.37197	-0.9716	10	0.66056	D	0.02	.	5.1183	0.14847	0.4699:0.0:0.5301:0.0	.	16;16;16	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	D	16	ENSP00000422554:A16D;ENSP00000344847:A16D;ENSP00000421638:A16D	ENSP00000344847:A16D	A	-	2	0	ADAMTS12	33927672	0.951000	0.32395	0.473000	0.27253	0.977000	0.68977	1.706000	0.37878	0.735000	0.32537	0.585000	0.79938	GCT	.		0.522	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
BPHL	670	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	3137663	3137663	+	Silent	SNP	C	C	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr6:3137663C>T	ENST00000380379.5	+	5	649	c.600C>T	c.(598-600)gaC>gaT	p.D200D	RP1-40E16.11_ENST00000447644.1_RNA|BPHL_ENST00000434640.1_Silent_p.D183D|BPHL_ENST00000380368.2_Intron|BPHL_ENST00000380375.3_Silent_p.D183D	NM_004332.2	NP_004323.2	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like (serine hydrolase)	200					cellular amino acid metabolic process (GO:0006520)|response to toxic substance (GO:0009636)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)	13	Ovarian(93;0.0386)	all_hematologic(90;0.108)				ATGGGTATGACTACTTTGCCA	0.458																																					p.D200D													.	BPHL-90	0			c.C600T						.						131.0	134.0	133.0					6																	3137663		2203	4300	6503	SO:0001819	synonymous_variant	670	exon5			GTATGACTACTTT	X81372	CCDS4483.2	6p25	2008-08-29	2008-08-29		ENSG00000137274	ENSG00000137274			1094	protein-coding gene	gene with protein product	"""breast epithelial mucin-associated antigen"""	603156		MCNAA		7759552, 9721218, 15832508	Standard	NM_004332		Approved	Bph-rp	uc003mva.3	Q86WA6	OTTHUMG00000014140	ENST00000380379.5:c.600C>T	6.37:g.3137663C>T		Somatic	178	1		WXS	Illumina HiSeq	Phase_I	132	54	NM_004332	0	0	10	13	3	Q00306|Q13855|Q3KP51	Silent	SNP	ENST00000380379.5	37	CCDS4483.2																																																																																			.		0.458	BPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039670.5		
BMP6	654	broad.mit.edu;bcgsc.ca	37	6	7727541	7727541	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr6:7727541A>T	ENST00000283147.6	+	1	512	c.353A>T	c.(352-354)cAg>cTg	p.Q118L		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	118					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)	p.Q118L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					cagcagcagcagcTGCCTCGC	0.731																																					p.Q118L													.	BMP6-578	1	Substitution - Missense(1)	lung(1)	c.A353T						.																																			SO:0001583	missense	654	exon1			AGCAGCAGCTGCC	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.353A>T	6.37:g.7727541A>T	ENSP00000283147:p.Gln118Leu	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	75	5	NM_001718	0	0	0	0	0	Q5TCP3	Missense_Mutation	SNP	ENST00000283147.6	37	CCDS4503.1	.	.	.	.	.	.	.	.	.	.	A	5.648	0.304211	0.10678	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.72725	-0.68	3.64	-7.28	0.01456	Transforming growth factor-beta, N-terminal (1);	0.609742	0.13235	N	0.403351	T	0.27134	0.0665	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10382	-1.0632	10	0.41790	T	0.15	.	2.9855	0.05966	0.1788:0.4954:0.0931:0.2327	.	118	P22004	BMP6_HUMAN	L	40;118;81	ENSP00000283147:Q118L	ENSP00000283147:Q118L	Q	+	2	0	BMP6	7672540	0.177000	0.23109	0.002000	0.10522	0.071000	0.16799	-0.158000	0.10070	-1.400000	0.02061	-1.802000	0.00618	CAG	.		0.731	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718	
PHACTR1	221692	bcgsc.ca	37	6	13228185	13228185	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr6:13228185A>G	ENST00000379350.1	+	8	1253	c.1124A>G	c.(1123-1125)aAt>aGt	p.N375S	PHACTR1_ENST00000457702.2_Missense_Mutation_p.N230S|PHACTR1_ENST00000379345.2_Intron|PHACTR1_ENST00000332995.7_Missense_Mutation_p.N375S			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	375					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TGTGATGACAATAAAGAAAAT	0.483																																					p.N375S													.	.	0			c.A1124G						.						170.0	174.0	172.0					6																	13228185		1986	4159	6145	SO:0001583	missense	221692	exon9			ATGACAATAAAGA	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.1124A>G	6.37:g.13228185A>G	ENSP00000368655:p.Asn375Ser	Somatic	94	2		WXS	Illumina HiSeq	Phase_1	80	38	NM_030948	0	0	0	1	1	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	ENST00000379350.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.41|18.41	3.617678|3.617678	0.66787|0.66787	.|.	.|.	ENSG00000112137|ENSG00000112137	ENST00000415087|ENST00000379350;ENST00000332995;ENST00000432934;ENST00000457702	.|T;T;T	.|0.35789	.|1.29;1.36;1.41	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|0.142496	.|0.64402	.|D	.|0.000005	T|T	0.22475|0.22475	0.0542|0.0542	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.31817	.|0.208;0.231;0.341	.|B;B;B	.|0.33799	.|0.17;0.058;0.167	T|T	0.06588|0.06588	-1.0818|-1.0818	5|10	.|0.52906	.|T	.|0.07	-19.1766|-19.1766	15.5501|15.5501	0.76145|0.76145	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|444;375;375	.|E7ESR5;Q9C0D0;Q9C0D0-2	.|.;PHAR1_HUMAN;.	V|S	210|375;375;444;230	.|ENSP00000368655:N375S;ENSP00000329880:N375S;ENSP00000397669:N230S	.|ENSP00000329880:N375S	I|N	+|+	1|2	0|0	PHACTR1|PHACTR1	13336164|13336164	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.661000|8.661000	0.91125|0.91125	2.315000|2.315000	0.78130|0.78130	0.533000|0.533000	0.62120|0.62120	ATA|AAT	.		0.483	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1	XM_166420	
SYNE1	23345	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152453307	152453307	+	Missense_Mutation	SNP	C	C	A	rs201664645	byFrequency	TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr6:152453307C>A	ENST00000367255.5	-	144	26645	c.26044G>T	c.(26044-26046)Ggg>Tgg	p.G8682W	SYNE1_ENST00000341594.5_Missense_Mutation_p.G8294W|SYNE1_ENST00000265368.4_Missense_Mutation_p.G8682W|SYNE1_ENST00000539504.1_Missense_Mutation_p.G837W|SYNE1_ENST00000448038.1_Missense_Mutation_p.G8634W|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000423061.1_Missense_Mutation_p.G8634W|SYNE1_ENST00000356820.4_Missense_Mutation_p.G3206W|SYNE1_ENST00000354674.4_Missense_Mutation_p.G860W	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8682	Ser-rich.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCACAGACCCTGAGGTGTCC	0.512										HNSCC(10;0.0054)																											p.G8682W													.	SYNE1-607	0			c.G26044T						.						183.0	160.0	168.0					6																	152453307		2203	4300	6503	SO:0001583	missense	23345	exon144			CAGACCCTGAGGT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.26044G>T	6.37:g.152453307C>A	ENSP00000356224:p.Gly8682Trp	Somatic	121	1		WXS	Illumina HiSeq	Phase_I	111	46	NM_182961	0	0	7	18	11	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.278156	0.80692	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.58506	0.42;4.53;1.26;0.44;0.33;0.44;0.57;2.48;1.44;4.55	5.75	5.75	0.90469	.	0.000000	0.50627	D	0.000116	T	0.74114	0.3674	M	0.75264	2.295	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.999;0.998;0.99	T	0.75944	-0.3139	10	0.87932	D	0	.	19.9447	0.97177	0.0:1.0:0.0:0.0	.	8682;8682;8634;8634;884	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	W	8682;837;1328;8634;8682;8634;8294;3206;867;862;1627;860	ENSP00000356224:G8682W;ENSP00000441052:G837W;ENSP00000356226:G1328W;ENSP00000396024:G8634W;ENSP00000265368:G8682W;ENSP00000390975:G8634W;ENSP00000341887:G8294W;ENSP00000349276:G3206W;ENSP00000356220:G1627W;ENSP00000346701:G860W	ENSP00000265368:G8682W	G	-	1	0	SYNE1	152495000	1.000000	0.71417	0.860000	0.33809	0.969000	0.65631	5.584000	0.67490	2.719000	0.93026	0.655000	0.94253	GGG	C|1.000;G|0.000		0.512	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
RP3-470B24.5	0	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	168377288	168377288	+	lincRNA	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr6:168377288T>C	ENST00000538528.1	-	0	331																											TGGGGGTCATTCCCCCTGCAG	0.642																																					p.G15G		.											.	.	0			c.A45G						.						19.0	20.0	20.0					6																	168377288		692	1591	2283			0	exon1			GGTCATTCCCCCT																													6.37:g.168377288T>C		Somatic	164	0		WXS	Illumina HiSeq	Phase_I	129	34	NM_001129895	0	0	0	0	0		Silent	SNP	ENST00000538528.1	37																																																																																				.		0.642	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA			
MEOX2	4223	hgsc.bcm.edu	37	7	15725797	15725797	+	Silent	SNP	A	A	G	rs113582077	byFrequency	TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:15725797A>G	ENST00000262041.5	-	1	640	c.231T>C	c.(229-231)caT>caC	p.H77H	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	77	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		gatggtggtgatggtggtggt	0.617																																					p.H77H	Esophageal Squamous(140;197 1769 16409 18257 29929)	.											.	MEOX2-515	0			c.T231C						.						21.0	22.0	22.0					7																	15725797		2203	4300	6503	SO:0001819	synonymous_variant	4223	exon1			GTGGTGATGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.231T>C	7.37:g.15725797A>G		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	69	7	NM_005924	0	0	0	0	0	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	37	CCDS34605.1																																																																																			.		0.617	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
MEOX2	4223	hgsc.bcm.edu	37	7	15725800	15725800	+	Silent	SNP	G	G	A	rs113582077	byFrequency	TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:15725800G>A	ENST00000262041.5	-	1	637	c.228C>T	c.(226-228)caC>caT	p.H76H	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	76	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)	p.H80delH(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtggtgatggtggtggtggt	0.612																																					p.H76H	Esophageal Squamous(140;197 1769 16409 18257 29929)	.											.	MEOX2-515	1	Deletion - In frame(1)	stomach(1)	c.C228T						.						11.0	13.0	13.0					7																	15725800		2192	4293	6485	SO:0001819	synonymous_variant	4223	exon1			GTGATGGTGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.228C>T	7.37:g.15725800G>A		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	35	9	NM_005924	0	0	0	0	0	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	37	CCDS34605.1																																																																																			.		0.612	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
DFNA5	1687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	24784199	24784199	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:24784199A>T	ENST00000342947.3	-	3	811	c.386T>A	c.(385-387)aTc>aAc	p.I129N	DFNA5_ENST00000409970.1_5'UTR|DFNA5_ENST00000419307.1_5'UTR|DFNA5_ENST00000545231.1_5'UTR|DFNA5_ENST00000409775.3_Missense_Mutation_p.I129N	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	129					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						AGAGTCTCTGATGAGCTGCTG	0.507																																					p.I129N	GBM(78;184 1250 20134 20900 23600)	.											.	DFNA5-91	0			c.T386A						.						119.0	115.0	116.0					7																	24784199		2203	4300	6503	SO:0001583	missense	1687	exon3			TCTCTGATGAGCT	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.386T>A	7.37:g.24784199A>T	ENSP00000339587:p.Ile129Asn	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	66	12	NM_001127453	0	0	8	13	5	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	37	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.361849	0.61403	.	.	ENSG00000105928	ENST00000342947;ENST00000409775	T;T	0.21932	1.98;1.98	5.59	5.59	0.84812	.	0.432748	0.26662	N	0.023150	T	0.42966	0.1226	M	0.67953	2.075	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.63283	0.913;0.913	T	0.22730	-1.0208	10	0.45353	T	0.12	-8.2661	15.7667	0.78131	1.0:0.0:0.0:0.0	.	129;129	A4FTY0;O60443	.;DFNA5_HUMAN	N	129	ENSP00000339587:I129N;ENSP00000386670:I129N	ENSP00000339587:I129N	I	-	2	0	DFNA5	24750724	1.000000	0.71417	0.742000	0.31022	0.252000	0.25951	5.678000	0.68153	2.138000	0.66242	0.528000	0.53228	ATC	.		0.507	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
HOXA9	3205	broad.mit.edu;bcgsc.ca	37	7	27203455	27203455	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:27203455G>T	ENST00000343483.6	-	2	658	c.586C>A	c.(586-588)Cca>Aca	p.P196T	RP1-170O19.20_ENST00000470747.4_Missense_Mutation_p.P36T|RP1-170O19.20_ENST00000465941.1_5'UTR|HOXA9_ENST00000497089.1_5'UTR|HOXA9_ENST00000396345.1_3'UTR	NM_152739.3	NP_689952.1	P31269	HXA9_HUMAN	homeobox A9	196					endothelial cell activation (GO:0042118)|multicellular organismal development (GO:0007275)|negative regulation of myeloid cell differentiation (GO:0045638)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(1)|lung(5)|prostate(1)	8						TTGGCTGCTGGGTTATCTGCG	0.552			T	"""NUP98, MSI2"""	AML*																																p.P196T				Dom	yes		7	7p15-p14.2	3205	homeo box A9		L	.	HOXA9-1082	0			c.C586A						.						77.0	79.0	79.0					7																	27203455		2203	4300	6503	SO:0001583	missense	3205	exon2			CTGCTGGGTTATC		CCDS5409.1	7p15.2	2011-06-20	2005-12-22		ENSG00000078399	ENSG00000078399		"""Homeoboxes / ANTP class : HOXL subclass"""	5109	protein-coding gene	gene with protein product		142956	"""homeo box A9"""	HOX1G, HOX1		1973146, 1358459	Standard	NM_152739		Approved		uc003syt.3	P31269	OTTHUMG00000023220	ENST00000343483.6:c.586C>A	7.37:g.27203455G>T	ENSP00000343619:p.Pro196Thr	Somatic	43	1		WXS	Illumina HiSeq	Phase_I	76	19	NM_152739	0	0	1	1	0	O43369|O43429|Q99820	Missense_Mutation	SNP	ENST00000343483.6	37	CCDS5409.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205571	0.79127	.	.	ENSG00000078399;ENSG00000078399;ENSG00000078399;ENSG00000257184	ENST00000343483;ENST00000354032;ENST00000242050;ENST00000470747	D;D	0.95554	-3.74;-3.74	5.21	5.21	0.72293	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000011	D	0.96870	0.8978	M	0.64567	1.98	0.80722	D	1	D	0.61080	0.989	P	0.61477	0.889	D	0.97341	0.9957	10	0.87932	D	0	.	18.1322	0.89605	0.0:0.0:1.0:0.0	.	196	P31269	HXA9_HUMAN	T	196;120;187;36	ENSP00000343619:P196T;ENSP00000421799:P36T	ENSP00000242050:P187T	P	-	1	0	RP1-170O19.20;HOXA9	27169980	1.000000	0.71417	0.997000	0.53966	0.807000	0.45602	9.869000	0.99810	2.623000	0.88846	0.561000	0.74099	CCA	.		0.552	HOXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358706.2		
HECW1	23072	broad.mit.edu;bcgsc.ca	37	7	43490498	43490498	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:43490498T>C	ENST00000395891.2	+	12	3075	c.2470T>C	c.(2470-2472)Tac>Cac	p.Y824H	HECW1_ENST00000453890.1_Intron	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	824					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						ACATCATCACTACCCAACAAT	0.418																																					p.Y824H													.	HECW1-669	0			c.T2470C						.						140.0	138.0	139.0					7																	43490498		1944	4133	6077	SO:0001583	missense	23072	exon12			CATCACTACCCAA	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2470T>C	7.37:g.43490498T>C	ENSP00000379228:p.Tyr824His	Somatic	46	1		WXS	Illumina HiSeq	Phase_I	67	37	NM_015052	0	0	0	0	0	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	T	29.3	4.997488	0.93227	.	.	ENSG00000002746	ENST00000395891;ENST00000265522	T	0.32515	1.45	5.97	5.97	0.96955	WW/Rsp5/WWP (1);	0.191964	0.46758	D	0.000271	T	0.39064	0.1064	L	0.34521	1.04	0.80722	D	1	D	0.59357	0.985	P	0.55667	0.781	T	0.06215	-1.0839	10	0.36615	T	0.2	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	824	Q76N89	HECW1_HUMAN	H	824	ENSP00000379228:Y824H	ENSP00000265522:Y824H	Y	+	1	0	HECW1	43457023	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.409000	0.80053	2.288000	0.76882	0.533000	0.62120	TAC	.		0.418	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
POR	5447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	75615290	75615290	+	Silent	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:75615290T>C	ENST00000461988.1	+	14	1824	c.1719T>C	c.(1717-1719)gaT>gaC	p.D573D	POR_ENST00000545601.1_Silent_p.D381D|POR_ENST00000419840.1_Intron|POR_ENST00000394893.1_Silent_p.D573D|POR_ENST00000450476.1_Silent_p.D472D|TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA|POR_ENST00000439269.1_Silent_p.D311D	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	570					carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	GCCGCTCGGATGAGGACTACC	0.692																																					p.D573D		.											.	POR-23	0			c.T1719C						.						11.0	17.0	15.0					7																	75615290		1973	4109	6082	SO:0001819	synonymous_variant	5447	exon14			CTCGGATGAGGAC	AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000461988.1:c.1719T>C	7.37:g.75615290T>C		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	81	18	NM_000941	0	0	107	161	54	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Silent	SNP	ENST00000461988.1	37	CCDS5579.1	.	.	.	.	.	.	.	.	.	.	T	6.335	0.429939	0.11987	.	.	ENSG00000127948	ENST00000447222	.	.	.	3.59	-1.16	0.09678	.	.	.	.	.	.	.	.	.	.	.	0.41802	D	0.989923	.	.	.	.	.	.	.	.	.	.	.	.	.	-26.2896	4.2567	0.10721	0.1605:0.2767:0.0:0.5628	.	.	.	.	R	624	.	.	X	+	1	0	POR	75453226	0.000000	0.05858	0.885000	0.34714	0.753000	0.42808	-2.270000	0.01167	-0.213000	0.10094	-0.496000	0.04628	TGA	.		0.692	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7	NM_000941	
PTCD1	26024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99022430	99022430	+	Silent	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:99022430G>A	ENST00000292478.4	-	6	1975	c.1725C>T	c.(1723-1725)ctC>ctT	p.L575L	PTCD1_ENST00000555673.1_Silent_p.L624L|ATP5J2-PTCD1_ENST00000413834.1_Silent_p.L624L	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	575					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TCATGTCTGTGAGAAGCTGTA	0.612																																					p.L624L		.											.	.	0			c.C1872T						.						52.0	53.0	53.0					7																	99022430		2203	4300	6503	SO:0001819	synonymous_variant	100526740	exon7			GTCTGTGAGAAGC	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1725C>T	7.37:g.99022430G>A		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	30	9	NM_001198879	0	0	0	0	0	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	ENST00000292478.4	37	CCDS34691.1																																																																																			.		0.612	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
MET	4233	ucsc.edu;bcgsc.ca	37	7	116423413	116423413	+	Missense_Mutation	SNP	T	T	C	rs121913247		TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:116423413T>C	ENST00000318493.6	+	19	3929	c.3742T>C	c.(3742-3744)Tat>Cat	p.Y1248H	MET_ENST00000539704.1_Missense_Mutation_p.Y100H|MET_ENST00000397752.3_Missense_Mutation_p.Y1230H			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Y1248H(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CAGAGACATGTATGATAAAGA	0.388			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.Y1248H				Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	1	Substitution - Missense(1)	kidney(1)	c.T3742C	GRCh37	CM992180	MET	M	rs121913247	.						105.0	99.0	101.0					7																	116423413		1843	4095	5938	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GACATGTATGATA	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3742T>C	7.37:g.116423413T>C	ENSP00000317272:p.Tyr1248His	Somatic	117	2		WXS	Illumina HiSeq		151	89	NM_001127500	0	0	1	4	3	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	18.43	3.622544	0.66787	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	D;D;D	0.83075	-1.68;-1.68;-1.68	5.46	5.46	0.80206	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90075	0.6900	M	0.68593	2.085	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91155	0.4956	10	0.87932	D	0	.	15.824	0.78683	0.0:0.0:0.0:1.0	.	1248;1230	P08581-2;P08581	.;MET_HUMAN	H	1230;1248;100	ENSP00000380860:Y1230H;ENSP00000317272:Y1248H;ENSP00000445020:Y100H	ENSP00000317272:Y1248H	Y	+	1	0	MET	116210649	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.145000	0.71769	2.197000	0.70478	0.460000	0.39030	TAT	.		0.388	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
POT1	25913	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	124503439	124503439	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:124503439T>C	ENST00000357628.3	-	8	1109	c.511A>G	c.(511-513)Aaa>Gaa	p.K171E	POT1_ENST00000393329.1_Missense_Mutation_p.K40E	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	171					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						ACTTCTGCTTTGCCCAAGAGC	0.388																																					p.K171E	Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)												.	POT1-227	0			c.A511G						.						114.0	107.0	110.0					7																	124503439		2203	4300	6503	SO:0001583	missense	25913	exon8			CTGCTTTGCCCAA	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.511A>G	7.37:g.124503439T>C	ENSP00000350249:p.Lys171Glu	Somatic	116	1		WXS	Illumina HiSeq	Phase_I	176	49	NM_015450	0	0	0	0	0	O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	ENST00000357628.3	37	CCDS5793.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.613597	0.87359	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391	T;T	0.50548	0.8;0.74	5.47	5.47	0.80525	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.67581	0.2908	M	0.75264	2.295	0.54753	D	0.999985	D	0.89917	1.0	D	0.87578	0.998	T	0.67177	-0.5736	10	0.34782	T	0.22	-9.8043	14.7435	0.69474	0.0:0.0:0.0:1.0	.	171	Q9NUX5	POTE1_HUMAN	E	171;40;171;171;171;170	ENSP00000350249:K171E;ENSP00000377002:K40E	ENSP00000265391:K170E	K	-	1	0	POT1	124290675	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.211000	0.72182	2.069000	0.61940	0.528000	0.53228	AAA	.		0.388	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1		
KMT2C	58508	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	151884405	151884405	+	Silent	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr7:151884405A>T	ENST00000262189.6	-	33	5168	c.4950T>A	c.(4948-4950)acT>acA	p.T1650T	KMT2C_ENST00000355193.2_Silent_p.T1650T	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1650					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CTGGGGCAACAGTTGCCATTT	0.428																																					p.T1650T													.	MLL3-1398	0			c.T4950A						.						135.0	139.0	138.0					7																	151884405		2203	4300	6503	SO:0001819	synonymous_variant	58508	exon33			GGCAACAGTTGCC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.4950T>A	7.37:g.151884405A>T		Somatic	102	1		WXS	Illumina HiSeq	Phase_I	138	38	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1																																																																																			.		0.428	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
CTSB	1508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	11705226	11705226	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr8:11705226G>T	ENST00000353047.6	-	7	891	c.638C>A	c.(637-639)cCt>cAt	p.P213H	CTSB_ENST00000534510.1_Missense_Mutation_p.P213H|CTSB_ENST00000531089.1_Missense_Mutation_p.P213H|CTSB_ENST00000415599.2_3'UTR|CTSB_ENST00000345125.3_Missense_Mutation_p.P213H|CTSB_ENST00000533455.1_Missense_Mutation_p.P213H|CTSB_ENST00000525076.1_5'Flank|CTSB_ENST00000530640.2_Missense_Mutation_p.P213H|CTSB_ENST00000434271.1_Missense_Mutation_p.P213H|RP11-589N15.2_ENST00000602711.1_RNA|CTSB_ENST00000453527.2_Missense_Mutation_p.P213H	NM_001908.3	NP_001899.1	P07858	CATB_HUMAN	cathepsin B	213					cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|decidualization (GO:0046697)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of catalytic activity (GO:0050790)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|proteoglycan binding (GO:0043394)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(1)	16	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		GCTGTAGCCAGGCTCACAGAT	0.647																																					p.P213H		.											.	CTSB-90	0			c.C638A						.						109.0	104.0	105.0					8																	11705226		2203	4300	6503	SO:0001583	missense	1508	exon9			TAGCCAGGCTCAC	M14221	CCDS5986.1	8p23.1	2012-10-02			ENSG00000164733	ENSG00000164733	3.4.22.1	"""Cathepsins"""	2527	protein-coding gene	gene with protein product		116810				8112600, 3463996	Standard	XM_006716244		Approved		uc003wuq.3	P07858	OTTHUMG00000090799	ENST00000353047.6:c.638C>A	8.37:g.11705226G>T	ENSP00000345672:p.Pro213His	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	53	24	NM_147780	0	0	96	186	90	B3KQR5|B3KRR5|Q503A6|Q96D87	Missense_Mutation	SNP	ENST00000353047.6	37	CCDS5986.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493396	0.44352	.	.	ENSG00000164733	ENST00000434271;ENST00000540571;ENST00000353047;ENST00000530640;ENST00000531089;ENST00000453527;ENST00000345125;ENST00000533455;ENST00000534510;ENST00000541328	D;D;D;D;D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18	5.17	3.16	0.36331	Peptidase C1A, papain C-terminal (2);	0.662303	0.15592	N	0.254378	D	0.90765	0.7101	M	0.76838	2.35	0.45295	D	0.99829	D;P;P;D;D	0.60575	0.988;0.73;0.85;0.988;0.985	P;P;P;P;P	0.56163	0.752;0.512;0.512;0.723;0.793	D	0.90644	0.4577	10	0.52906	T	0.07	.	12.4013	0.55414	0.0:0.0:0.6427:0.3573	.	150;213;119;213;150	B3KUJ8;A8K2H4;B4DMY4;P07858;F5H2P9	.;.;.;CATB_HUMAN;.	H	213;150;213;213;213;213;213;213;213;119	ENSP00000415889:P213H;ENSP00000345672:P213H;ENSP00000435105:P213H;ENSP00000433215:P213H;ENSP00000409917:P213H;ENSP00000342070:P213H;ENSP00000432244:P213H;ENSP00000434217:P213H	ENSP00000342070:P213H	P	-	2	0	CTSB	11742635	0.137000	0.22531	0.501000	0.27601	0.244000	0.25665	2.483000	0.45233	2.397000	0.81536	0.561000	0.74099	CCT	.		0.647	CTSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207586.3	NM_147780	
TRPA1	8989	ucsc.edu	37	8	72958841	72958841	+	Silent	SNP	G	G	A	rs367626209		TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr8:72958841G>A	ENST00000262209.4	-	17	2175	c.1968C>T	c.(1966-1968)atC>atT	p.I656I	RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000537896.1_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	656					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	AATTATACTCGATCTGTAGAA	0.294																																					p.I656I													.	TRPA1-230	0			c.C1968T						.	A		1,4405	824.0+/-416.5	0,1,2202	104.0	111.0	109.0		1968	-8.9	0.6	8		109	0,8600		0,0,4300	no	coding-synonymous	TRPA1	NM_007332.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		656/1120	72958841	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8989	exon17			ATACTCGATCTGT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1968C>T	8.37:g.72958841G>A		Somatic	66	0		WXS	Illumina HiSeq		39	4	NM_007332	0	0	0	0	0	A6NIN6	Silent	SNP	ENST00000262209.4	37	CCDS34908.1																																																																																			.		0.294	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
LRRCC1	85444	ucsc.edu;bcgsc.ca	37	8	86027335	86027335	+	Splice_Site	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr8:86027335G>A	ENST00000360375.3	+	5	694	c.545G>A	c.(544-546)gGg>gAg	p.G182E	LRRCC1_ENST00000414626.2_Splice_Site_p.G162E	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	182	LRRCT.				mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						TGTTTCCAAGGGTACAGAGCA	0.318																																					p.G182E													.	LRRCC1-90	0			c.G545A						.						83.0	79.0	80.0					8																	86027335		1820	4089	5909	SO:0001630	splice_region_variant	85444	exon5			TCCAAGGGTACAG	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.545-1G>A	8.37:g.86027335G>A		Somatic	153	2		WXS	Illumina HiSeq		116	52	NM_033402	0	0	0	0	0	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451934	0.84209	.	.	ENSG00000133739	ENST00000426019;ENST00000360375;ENST00000414626	T;T	0.23552	1.9;1.9	4.98	4.98	0.66077	U2A&apos (1);/phosphoprotein 32 family A, C-terminal (1);	0.000000	0.40554	N	0.001071	T	0.56262	0.1973	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.60687	-0.7214	9	.	.	.	.	18.599	0.91240	0.0:0.0:1.0:0.0	.	162;89;182	Q9C099-2;E9PE41;Q9C099	.;.;LRCC1_HUMAN	E	89;182;162	ENSP00000353538:G182E;ENSP00000394695:G162E	.	G	+	2	0	LRRCC1	86214587	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.393000	0.90182	2.468000	0.83385	0.460000	0.39030	GGG	.		0.318	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402	Missense_Mutation
DCAF4L2	138009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	88885869	88885869	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr8:88885869C>G	ENST00000319675.3	-	1	427	c.331G>C	c.(331-333)Gag>Cag	p.E111Q		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	111										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						ACCCGGAGCTCAGGGGTCGTC	0.542																																					p.E111Q		.											.	DCAF4L2-91	0			c.G331C						.						138.0	133.0	135.0					8																	88885869		2203	4300	6503	SO:0001583	missense	138009	exon1			GGAGCTCAGGGGT	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.331G>C	8.37:g.88885869C>G	ENSP00000316496:p.Glu111Gln	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	85	32	NM_152418	0	0	0	0	0		Missense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.247732	0.22880	.	.	ENSG00000176566	ENST00000319675	T	0.61510	0.1	1.39	0.34	0.15985	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.699660	0.15847	N	0.241732	T	0.38480	0.1042	L	0.29908	0.895	0.09310	N	1	P	0.37330	0.59	B	0.33846	0.171	T	0.22452	-1.0216	10	0.72032	D	0.01	.	6.1683	0.20402	0.3004:0.6996:0.0:0.0	.	111	Q8NA75	DC4L2_HUMAN	Q	111	ENSP00000316496:E111Q	ENSP00000316496:E111Q	E	-	1	0	DCAF4L2	88954985	0.999000	0.42202	0.001000	0.08648	0.010000	0.07245	1.840000	0.39230	-0.115000	0.11915	0.467000	0.42956	GAG	.		0.542	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
PKHD1L1	93035	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	110488892	110488892	+	Nonsense_Mutation	SNP	C	C	G			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr8:110488892C>G	ENST00000378402.5	+	52	9017	c.8913C>G	c.(8911-8913)taC>taG	p.Y2971*		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2971					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTCTATATTACTTGGGTATGT	0.343										HNSCC(38;0.096)																											p.Y2971X													.	PKHD1L1-145	0			c.C8913G						.						43.0	42.0	42.0					8																	110488892		1865	4100	5965	SO:0001587	stop_gained	93035	exon52			ATATTACTTGGGT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8913C>G	8.37:g.110488892C>G	ENSP00000367655:p.Tyr2971*	Somatic	142	1		WXS	Illumina HiSeq	Phase_I	123	50	NM_177531	0	0	0	0	0	Q567P2|Q9UF27	Nonsense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	48	14.623838	0.99803	.	.	ENSG00000205038	ENST00000378402	.	.	.	5.69	-0.86	0.10680	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2209	0.54433	0.0:0.4969:0.0:0.5031	.	.	.	.	X	2971	.	ENSP00000367655:Y2971X	Y	+	3	2	PKHD1L1	110558068	0.445000	0.25657	0.710000	0.30468	0.416000	0.31233	0.485000	0.22324	-0.457000	0.07033	-1.128000	0.01989	TAC	.		0.343	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
OTC	5009	broad.mit.edu	37	X	38260574	38260574	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chrX:38260574C>A	ENST00000039007.4	+	5	585	c.433C>A	c.(433-435)Caa>Aaa	p.Q145K	TM4SF2_ENST00000465127.1_Intron|OTC_ENST00000488812.1_3'UTR	NM_000531.5	NP_000522.3	P00480	OTC_HUMAN	ornithine carbamoyltransferase	145					ammonia homeostasis (GO:0097272)|arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|liver development (GO:0001889)|midgut development (GO:0007494)|ornithine catabolic process (GO:0006593)|protein homotrimerization (GO:0070207)|response to biotin (GO:0070781)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|ornithine carbamoyltransferase activity (GO:0004585)|phosphate ion binding (GO:0042301)|phospholipid binding (GO:0005543)	p.Q145K(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22					L-Citrulline(DB00155)|L-Ornithine(DB00129)	AGTGTATAAACAATCAGATTT	0.403																																					p.Q145K													.	OTC-172	1	Substitution - Missense(1)	prostate(1)	c.C433A						.						108.0	81.0	90.0					X																	38260574		2202	4300	6502	SO:0001583	missense	5009	exon5			TATAAACAATCAG	K02100	CCDS14247.1	Xp21.1	2014-06-28			ENSG00000036473	ENSG00000036473	2.1.3.3		8512	protein-coding gene	gene with protein product		300461					Standard	NM_000531		Approved		uc004def.4	P00480	OTTHUMG00000022727	ENST00000039007.4:c.433C>A	X.37:g.38260574C>A	ENSP00000039007:p.Gln145Lys	Somatic	125	8		WXS	Illumina HiSeq	Phase_I	88	12	NM_000531	0	0	0	0	0	A8K9P2|D3DWB0|Q3KNR1|Q6B0I1|Q9NYJ5	Missense_Mutation	SNP	ENST00000039007.4	37	CCDS14247.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114759	0.77210	.	.	ENSG00000036473	ENST00000039007	D	0.98345	-4.88	5.97	5.97	0.96955	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (1);	0.187966	0.64402	D	0.000019	D	0.97244	0.9099	M	0.72576	2.205	0.58432	D	0.999997	P	0.37525	0.598	B	0.32805	0.153	D	0.97447	1.0025	10	0.87932	D	0	-0.3779	19.371	0.94484	0.0:1.0:0.0:0.0	.	145	P00480	OTC_HUMAN	K	145	ENSP00000039007:Q145K	ENSP00000039007:Q145K	Q	+	1	0	OTC	38145518	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.440000	0.80464	2.527000	0.85204	0.600000	0.82982	CAA	.		0.403	OTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059006.2		
MID1IP1	58526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	38664368	38664368	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chrX:38664368G>T	ENST00000336949.6	+	2	1114	c.169G>T	c.(169-171)Ggc>Tgc	p.G57C	MID1IP1-AS1_ENST00000436893.1_RNA|MID1IP1_ENST00000457894.1_Missense_Mutation_p.G57C|MID1IP1_ENST00000378474.3_Missense_Mutation_p.G57C	NM_021242.4	NP_067065.1	Q9NPA3	M1IP1_HUMAN	MID1 interacting protein 1	57					lipid metabolic process (GO:0006629)|negative regulation of microtubule depolymerization (GO:0007026)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of ligase activity (GO:0051351)|protein polymerization (GO:0051258)|regulation of lipid biosynthetic process (GO:0046890)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7						CGTGGAGGTAGGCGGCAGTGG	0.662																																					p.G57C		.											.	MID1IP1-130	0			c.G169T						.						42.0	33.0	37.0					X																	38664368		2202	4300	6502	SO:0001583	missense	58526	exon2			GAGGTAGGCGGCA		CCDS14249.1	Xp11.4	2012-02-23	2012-02-23		ENSG00000165175	ENSG00000165175			20715	protein-coding gene	gene with protein product	"""gastrulation specific G12 homolog (zebrafish)"""		"""MID1 interacting protein 1 (gastrulation specific G12-like (zebrafish))"""				Standard	NM_001098790		Approved	STRAIT11499, FLJ10386, MIG12, THRSPL, G12-like	uc010ngz.3	Q9NPA3	OTTHUMG00000024092	ENST00000336949.6:c.169G>T	X.37:g.38664368G>T	ENSP00000338706:p.Gly57Cys	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	151	74	NM_021242	0	0	2	53	51	D3DWB2	Missense_Mutation	SNP	ENST00000336949.6	37	CCDS14249.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964421	0.53507	.	.	ENSG00000165175	ENST00000457894;ENST00000378474;ENST00000336949	.	.	.	4.84	1.05	0.20165	.	0.159061	0.29286	N	0.012584	T	0.43277	0.1240	L	0.40543	1.245	0.33031	D	0.530214	D	0.58620	0.983	P	0.51297	0.665	T	0.54589	-0.8271	9	0.59425	D	0.04	-14.4554	6.8616	0.24069	0.4221:0.0:0.5779:0.0	.	57	Q9NPA3	M1IP1_HUMAN	C	57	.	ENSP00000338706:G57C	G	+	1	0	MID1IP1	38549312	0.735000	0.28153	0.940000	0.37924	0.993000	0.82548	0.654000	0.24918	0.136000	0.18733	0.529000	0.55759	GGC	.		0.662	MID1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060655.1		
RPA4	29935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	96139635	96139635	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chrX:96139635G>A	ENST00000373040.3	+	1	729	c.326G>A	c.(325-327)gGt>gAt	p.G109D	DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000373061.3_Intron|DIAPH2_ENST00000373054.4_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	109					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						CAGTGGTTTGGTAGAGAGAAA	0.463								Other identified genes with known or suspected DNA repair function																													p.G109D		.											.	RPA4-227	0			c.G326A						.						101.0	87.0	92.0					X																	96139635		2203	4300	6503	SO:0001583	missense	29935	exon1			GGTTTGGTAGAGA	U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.326G>A	X.37:g.96139635G>A	ENSP00000362131:p.Gly109Asp	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	61	33	NM_013347	0	0	0	0	0	Q3SY03	Missense_Mutation	SNP	ENST00000373040.3	37	CCDS35345.1	.	.	.	.	.	.	.	.	.	.	G	0.245	-1.011087	0.02095	.	.	ENSG00000204086	ENST00000373040	T	0.37235	1.21	3.66	-0.387	0.12463	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	.	.	.	.	T	0.08313	0.0207	N	0.01086	-1.025	0.09310	N	1	B	0.25904	0.137	B	0.25759	0.063	T	0.29274	-1.0017	9	0.02654	T	1	-20.9474	2.3223	0.04214	0.1176:0.3079:0.405:0.1696	.	109	Q13156	RFA4_HUMAN	D	109	ENSP00000362131:G109D	ENSP00000362131:G109D	G	+	2	0	RPA4	96026291	0.001000	0.12720	0.000000	0.03702	0.019000	0.09904	0.691000	0.25467	-0.217000	0.10033	0.600000	0.82982	GGT	.		0.463	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057464.1	NM_013347	
RBMX2	51634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	129546641	129546641	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chrX:129546641A>T	ENST00000305536.6	+	6	852	c.788A>T	c.(787-789)aAg>aTg	p.K263M		NM_016024.2	NP_057108.2	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2	263	Arg-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(2)|large_intestine(1)|liver(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	19						AGAGAAGAAAAGACCAGGATT	0.527																																					p.K263M		.											.	RBMX2-134	0			c.A788T						.						69.0	67.0	68.0					X																	129546641		1931	4135	6066	SO:0001583	missense	51634	exon6			AAGAAAAGACCAG	AF078865	CCDS43993.1	Xq26.1	2013-02-12			ENSG00000134597	ENSG00000134597		"""RNA binding motif (RRM) containing"""	24282	protein-coding gene	gene with protein product						10810093	Standard	NM_016024		Approved	CGI-79	uc004evt.3	Q9Y388	OTTHUMG00000022395	ENST00000305536.6:c.788A>T	X.37:g.129546641A>T	ENSP00000339090:p.Lys263Met	Somatic	233	1		WXS	Illumina HiSeq	Phase_I	201	91	NM_016024	0	0	53	53	0	A8K9Z0|Q5JY82|Q9Y3I8	Missense_Mutation	SNP	ENST00000305536.6	37	CCDS43993.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804392	0.31869	.	.	ENSG00000134597	ENST00000305536;ENST00000538614	T	0.14516	2.5	4.9	-0.267	0.12938	.	0.462561	0.21532	N	0.073035	T	0.12987	0.0315	L	0.29908	0.895	0.18873	N	0.999989	P	0.50943	0.94	P	0.50231	0.635	T	0.13019	-1.0525	10	0.66056	D	0.02	.	7.4457	0.27209	0.5412:0.0:0.4588:0.0	.	263	Q9Y388	RBMX2_HUMAN	M	263	ENSP00000339090:K263M	ENSP00000339090:K263M	K	+	2	0	RBMX2	129374322	0.289000	0.24334	0.029000	0.17559	0.223000	0.24884	0.054000	0.14205	-0.329000	0.08527	0.417000	0.27973	AAG	.		0.527	RBMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058265.1	NM_016024	
FCGR1B	2210	broad.mit.edu	37	1	120927211	120927212	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:120927211_120927212delGC	ENST00000369384.4	-	5	810_811	c.768_769delGC	c.(766-771)gagctgfs	p.EL256fs	RP11-439A17.9_ENST00000457996.1_RNA|FCGR1B_ENST00000472543.1_5'Flank|RP11-439A17.10_ENST00000426275.1_RNA|FCGR1B_ENST00000369383.4_Frame_Shift_Del_p.EL164fs	NM_001017986.3	NP_001017986.1	Q92637	FCGRB_HUMAN	Fc fragment of IgG, high affinity Ib, receptor (CD64)	256					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|Fc receptor signaling pathway (GO:0038093)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	immunoglobulin receptor activity (GO:0019763)			breast(1)|endometrium(1)|lung(2)	4	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)	Intravenous Immunoglobulin(DB00028)	TGACATTTCAGCTCTTCTTCTA	0.465																																					p.256_257del													.	.	0			c.768_769del						.																																			SO:0001589	frameshift_variant	2210	exon5			ATTTCAGCTCTTC		CCDS72844.1, CCDS72845.1, CCDS72846.1	1p11.2	2013-01-11	2005-02-02		ENSG00000198019	ENSG00000198019		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3614	protein-coding gene	gene with protein product		601502	"""Fc fragment of IgG, high affinity Ib, receptor for (CD64)"""			8697799, 9763663	Standard	NM_001017986		Approved	CD64b	uc001eip.3	Q92637	OTTHUMG00000040903	ENST00000369384.4:c.768_769delGC	1.37:g.120927211_120927212delGC	ENSP00000358391:p.Glu256fs	Somatic	618	0		WXS	Illumina HiSeq	Phase_I	511	66	NM_001017986	0	0	0	0	0	Q7KZ13|Q92638	Frame_Shift_Del	DEL	ENST00000369384.4	37	CCDS30821.1																																																																																			.		0.465	FCGR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098241.1		
FCGR1A	2209	broad.mit.edu	37	1	149762998	149762999	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr1:149762998_149762999delGC	ENST00000369168.4	+	6	1104_1105	c.1050_1051delGC	c.(1048-1053)gagctgfs	p.EL350fs	RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000545683.1_Intron|RP11-196G18.3_ENST00000428289.1_RNA	NM_000566.3	NP_000557.1	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor (CD64)	350					antibody-dependent cellular cytotoxicity (GO:0001788)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intracellular signal transduction (GO:0035556)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of phagocytosis (GO:0050766)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG receptor activity (GO:0019770)|receptor signaling protein activity (GO:0005057)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	10	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TAGAAGAAGAGCTGAAATGTCA	0.475																																					p.350_351del													.	FCGR1A-23	0			c.1050_1051del						.																																			SO:0001589	frameshift_variant	2209	exon6			AGAAGAGCTGAAA	BC032634	CCDS933.1	1q21.2-q21.3	2014-09-17	2005-02-02		ENSG00000150337	ENSG00000150337		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3613	protein-coding gene	gene with protein product		146760	"""Fc fragment of IgG, high affinity Ia, receptor for (CD64)"""			8697799, 9763663	Standard	NM_000566		Approved	CD64, CD64A	uc001esp.4	P12314	OTTHUMG00000012089	ENST00000369168.4:c.1050_1051delGC	1.37:g.149762998_149762999delGC	ENSP00000358165:p.Glu350fs	Somatic	433	0		WXS	Illumina HiSeq	Phase_I	420	26	NM_000566	0	0	0	0	0	P12315|Q5QNW7|Q92495|Q92663	Frame_Shift_Del	DEL	ENST00000369168.4	37	CCDS933.1																																																																																			.		0.475	FCGR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033446.1	NM_000566	
BCL6B	255877	hgsc.bcm.edu	37	17	6928020	6928031	+	In_Frame_Del	DEL	CAGCAGCAGCAG	CAGCAGCAGCAG	-	rs72254884|rs386385552		TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	CAGCAGCAGCAG	CAGCAGCAGCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr17:6928020_6928031delCAGCAGCAGCAG	ENST00000293805.5	+	4	794_805	c.702_713delCAGCAGCAGCAG	c.(700-714)tccagcagcagcagc>tcc	p.234_238SSSSS>S		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	234	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						ACGAGGCCTCcagcagcagcagcagcagcagc	0.59																																					p.234_238del		.											.	BCL6B-227	0			c.702_713del						.																																			SO:0001651	inframe_deletion	255877	exon4			.	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.702_713delCAGCAGCAGCAG	17.37:g.6928020_6928031delCAGCAGCAGCAG	ENSP00000293805:p.Ser238_Ser241del	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	67	23	NM_181844	0	0	0	0	0	Q6PCB4	In_Frame_Del	DEL	ENST00000293805.5	37	CCDS42248.1																																																																																			.		0.590	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439455.2	NM_181844	
ACSBG2	81616	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	6165945	6165945	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr19:6165945delG	ENST00000586696.1	+	7	933	c.657delG	c.(655-657)cagfs	p.Q219fs	ACSBG2_ENST00000252669.5_Frame_Shift_Del_p.Q219fs|ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000588304.1_Frame_Shift_Del_p.Q169fs|ACSBG2_ENST00000591403.1_Frame_Shift_Del_p.Q219fs|ACSBG2_ENST00000588485.1_Frame_Shift_Del_p.Q32fs			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	219					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCGAGAGCCAGAAGGCGAATC	0.517											OREG0025194	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q219fs		.											.	ACSBG2-23	0			c.657delG						.						163.0	130.0	141.0					19																	6165945		2203	4300	6503	SO:0001589	frameshift_variant	81616	exon7			.		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.657delG	19.37:g.6165945delG	ENSP00000465589:p.Gln219fs	Somatic	70	0	632	WXS	Illumina HiSeq	Phase_I	56	18	NM_030924	0	0	0	0	0	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Frame_Shift_Del	DEL	ENST00000586696.1	37	CCDS12159.1																																																																																			.		0.517	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
BARD1	580	hgsc.bcm.edu;bcgsc.ca	37	2	215610468	215610468	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr2:215610468delT	ENST00000260947.4	-	8	1922	c.1788delA	c.(1786-1788)aaafs	p.K596fs	BARD1_ENST00000449967.2_Frame_Shift_Del_p.K452fs	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	596	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ACTCAGTATATTTTTTAGCCT	0.398									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.K596fs		.											.	BARD1-415	0			c.1788delA						.						131.0	131.0	131.0					2																	215610468		2203	4300	6503	SO:0001589	frameshift_variant	580	exon8	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	.		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.1788delA	2.37:g.215610468delT	ENSP00000260947:p.Lys596fs	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	75	23	NM_000465	0	0	0	0	0	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Frame_Shift_Del	DEL	ENST00000260947.4	37	CCDS2397.1																																																																																			.		0.398	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256602.1	NM_000465	
SERPINI2	5276	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	167189524	167189526	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:167189524_167189526delAAG	ENST00000476257.1	-	3	395_397	c.97_99delCTT	c.(97-99)cttdel	p.L33del	SERPINI2_ENST00000465031.1_5'UTR|SERPINI2_ENST00000264677.4_In_Frame_Del_p.L33del|SERPINI2_ENST00000461846.1_In_Frame_Del_p.L33del|SERPINI2_ENST00000471111.1_In_Frame_Del_p.L33del			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	33					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						CCTCTTGATAAAGATCCACTGCA	0.384																																					p.43_43del		.											.	SERPINI2-228	0			c.127_129del						.																																			SO:0001651	inframe_deletion	5276	exon3			.	AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.97_99delCTT	3.37:g.167189524_167189526delAAG	ENSP00000420621:p.Leu33del	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	75	35	NM_001012303	0	0	0	0	0		In_Frame_Del	DEL	ENST00000476257.1	37	CCDS3200.1																																																																																			.		0.384	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217	
SERPINI2	5276	hgsc.bcm.edu	37	3	167189524	167189527	+	Frame_Shift_Del	DEL	AAGA	AAGA	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	AAGA	AAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr3:167189524_167189527delAAGA	ENST00000476257.1	-	3	394_397	c.96_99delTCTT	c.(94-99)gatcttfs	p.DL32fs	SERPINI2_ENST00000465031.1_5'UTR|SERPINI2_ENST00000264677.4_Frame_Shift_Del_p.DL32fs|SERPINI2_ENST00000461846.1_Frame_Shift_Del_p.DL32fs|SERPINI2_ENST00000471111.1_Frame_Shift_Del_p.DL32fs			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	32					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						CCTCTTGATAAAGATCCACTGCAA	0.382																																					p.42_43del		.											.	SERPINI2-228	0			c.126_129del						.																																			SO:0001589	frameshift_variant	5276	exon3			.	AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.96_99delTCTT	3.37:g.167189524_167189527delAAGA	ENSP00000420621:p.Asp32fs	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	79	30	NM_001012303	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000476257.1	37	CCDS3200.1																																																																																			.		0.382	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217	
ADD1	118	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	2930230	2930232	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr4:2930230_2930232delAAG	ENST00000398129.1	+	14	2214_2216	c.2194_2196delAAG	c.(2194-2196)aagdel	p.K734del	ADD1_ENST00000398125.1_3'UTR|ADD1_ENST00000503455.2_3'UTR|ADD1_ENST00000264758.7_In_Frame_Del_p.K765del|ADD1_ENST00000355842.3_3'UTR|ADD1_ENST00000446856.1_In_Frame_Del_p.K734del|ADD1_ENST00000398123.2_3'UTR|ADD1_ENST00000513328.2_3'UTR			P35611	ADDA_HUMAN	adducin 1 (alpha)	734	Interaction with calmodulin. {ECO:0000255}.				actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GAAGAAGAGCAAGAAGAAGAGTG	0.616																																					p.763_763del	Esophageal Squamous(71;505 1201 20414 34538 37449)	.											.	ADD1-92	0			c.2287_2289del						.		,,,	2,4264		0,2,2131					,,,	5.2	1.0			63	0,8254		0,0,4127	no	utr-3,utr-3,coding,coding	ADD1	NM_176801.2,NM_014190.3,NM_014189.3,NM_001119.4	,,,	0,2,6258	A1A1,A1R,RR		0.0,0.0469,0.016	,,,	,,,		2,12518				SO:0001651	inframe_deletion	118	exon15			.	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.2194_2196delAAG	4.37:g.2930236_2930238delAAG	ENSP00000381197:p.Lys734del	Somatic	157	0		WXS	Illumina HiSeq	Phase_I	117	50	NM_014189	0	0	0	0	0	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	In_Frame_Del	DEL	ENST00000398129.1	37	CCDS43205.1																																																																																			.		0.616	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189	
LARS	51520	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	145547749	145547751	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr5:145547749_145547751delTCC	ENST00000394434.2	-	5	538_540	c.372_374delGGA	c.(370-375)gaggaa>gaa	p.124_125EE>E	LARS_ENST00000545646.1_Intron|LARS_ENST00000274562.9_In_Frame_Del_p.97_98EE>E|LARS_ENST00000510191.1_In_Frame_Del_p.70_71EE>E|LARS_ENST00000511505.1_Intron	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	124					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	ACTGGTTTCTTCCTCTTCCTCTT	0.33																																					p.124_125del		.											.	LARS-90	0			c.372_374del						.																																			SO:0001651	inframe_deletion	51520	exon5			.	AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.372_374delGGA	5.37:g.145547749_145547751delTCC	ENSP00000377954:p.Glu126del	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	88	28	NM_020117	0	0	0	0	0	A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	In_Frame_Del	DEL	ENST00000394434.2	37	CCDS34265.1																																																																																			.		0.330	LARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000373367.1	NM_020117	
RPS2	6187	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	2014483	2014484	+	In_Frame_Ins	INS	-	-	CGGCCT			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr16:2014483_2014484insCGGCCT	ENST00000343262.4	-	2	199_200	c.143_144insAGGCCG	c.(142-144)cgc>cgAGGCCGc	p.48_48R>RGR	SNORA64_ENST00000384674.1_RNA|RNF151_ENST00000569714.1_5'Flank|RPS2_ENST00000529806.1_In_Frame_Ins_p.48_48R>RGR|RPS2_ENST00000526522.1_In_Frame_Ins_p.48_48R>RGR|RNF151_ENST00000569210.2_5'Flank|SNORA10_ENST00000384084.1_RNA|RNF151_ENST00000321392.3_5'Flank|RPS2_ENST00000530225.1_In_Frame_Ins_p.48_48R>RGR|SNHG9_ENST00000459373.1_lincRNA	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	48	Arg/Gly-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CGCGAGCTCCGCGGCCTCGGCC	0.757																																					p.R48delinsRGR		.											.	RPS2-90	0			c.144_145insAGGCCG						.																																			SO:0001652	inframe_insertion	6187	exon2			.	AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.138_143dupAGGCCG	16.37:g.2014484_2014489dupCGGCCT	ENSP00000341885:p.GlyArg48dup	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	59	19	NM_002952	0	0	0	0	0	B2R5G0|D3DU82|Q3MIB1	In_Frame_Ins	INS	ENST00000343262.4	37	CCDS10452.1																																																																																			.		0.757	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250613.2	NM_002952	
COIL	8161	broad.mit.edu	37	17	55028117	55028118	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr17:55028117_55028118insT	ENST00000240316.4	-	2	519_520	c.485_486insA	c.(484-486)aacfs	p.N162fs		NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin	162						Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					TTTTTCTCTTGTTTTTTTTGCT	0.366																																					p.N162fs													.	COIL-91	0			c.486_487insA						.																																			SO:0001589	frameshift_variant	8161	exon2			TCTCTTGTTTTTT	U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.486dupA	17.37:g.55028125_55028125dupT	ENSP00000240316:p.Asn162fs	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	122	7	NM_004645	0	0	0	0	0	B2R931	Frame_Shift_Ins	INS	ENST00000240316.4	37	CCDS11592.1																																																																																			.		0.366	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440618.1		
PCDHGC5	56097	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140870632	140870633	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B1-A654-01A-11D-A31X-10	TCGA-B1-A654-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de661caf-c510-4b30-860a-a6b90ce03bdb	d5f5011d-91bc-4ca2-b4ff-2b456e1e1cbb	g.chr5:140870632_140870633insT	ENST00000252087.1	+	1	1825_1826	c.1825_1826insT	c.(1825-1827)ctgfs	p.L609fs	PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	609	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCTACTCACTGTTGCCACAG	0.619																																					p.L609fs		.											.	PCDHGC5-25	0			c.1825_1826insT						.																																			SO:0001589	frameshift_variant	56097	exon1			.	AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.1826dupT	5.37:g.140870633_140870633dupT	ENSP00000252087:p.Leu609fs	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	38	19	NM_018929	0	0	0	0	0	Q9Y5C2	Frame_Shift_Ins	INS	ENST00000252087.1	37	CCDS4263.1																																																																																			.		0.619	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929	
