#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC2A1	6513	ucsc.edu;bcgsc.ca	37	1	43394677	43394677	+	Silent	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:43394677G>T	ENST00000426263.3	-	8	1178	c.1000C>A	c.(1000-1002)Cgg>Agg	p.R334R	SLC2A1_ENST00000475162.1_Intron	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	334					carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	TGCAGGGTCCGCCGGCCTGCT	0.622																																					p.R334R													.	SLC2A1-94	0			c.C1000A						.						97.0	92.0	94.0					1																	43394677		2203	4300	6503	SO:0001819	synonymous_variant	6513	exon8			GGGTCCGCCGGCC	K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.1000C>A	1.37:g.43394677G>T		Somatic	31	0		WXS	Illumina HiSeq		41	4	NM_006516	0	0	19	19	0	A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Silent	SNP	ENST00000426263.3	37	CCDS477.1																																																																																			.		0.622	SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020358.2	NM_006516	
HIPK1	204851	broad.mit.edu	37	1	114483094	114483094	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:114483094G>T	ENST00000369558.1	+	2	321	c.89G>T	c.(88-90)gGc>gTc	p.G30V	HIPK1_ENST00000426820.2_Missense_Mutation_p.G30V|HIPK1_ENST00000369554.2_Missense_Mutation_p.G30V|HIPK1_ENST00000369561.4_Missense_Mutation_p.G30V|HIPK1_ENST00000369555.2_Missense_Mutation_p.G30V|HIPK1_ENST00000369559.4_Missense_Mutation_p.G30V			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	30					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAGCCCTCTGGCTGGGATGTT	0.507																																					p.G30V													.	HIPK1-361	0			c.G89T						.						208.0	227.0	220.0					1																	114483094		2203	4300	6503	SO:0001583	missense	204851	exon2			CCTCTGGCTGGGA	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.89G>T	1.37:g.114483094G>T	ENSP00000358571:p.Gly30Val	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	93	4	NM_152696	0	0	4	4	0	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364752	0.24684	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000514621;ENST00000503968	T;T;T;T;T;T;T;T;T	0.46063	0.89;0.9;0.93;0.88;0.88;0.93;0.89;1.0;1.0	4.92	4.92	0.64577	.	0.171901	0.39407	N	0.001364	T	0.16769	0.0403	N	0.24115	0.695	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.0;0.003	T	0.03739	-1.1008	10	0.36615	T	0.2	.	14.0344	0.64636	0.0:0.0:0.8392:0.1608	.	30;30	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	V	101;30;30;30;30;30;30;30;30	ENSP00000407442:G101V;ENSP00000358572:G30V;ENSP00000409673:G30V;ENSP00000358567:G30V;ENSP00000358568:G30V;ENSP00000358571:G30V;ENSP00000358574:G30V;ENSP00000422322:G30V;ENSP00000426695:G30V	ENSP00000358567:G30V	G	+	2	0	HIPK1	114284617	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.683000	0.37638	2.271000	0.75665	0.650000	0.86243	GGC	.		0.507	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
DENND4B	9909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153916546	153916546	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:153916546A>G	ENST00000361217.4	-	2	723	c.305T>C	c.(304-306)cTc>cCc	p.L102P		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	102	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAGCTCAACGAGGGGGGGCTT	0.632																																					p.L102P		.											.	DENND4B-69	0			c.T305C						.						28.0	32.0	31.0					1																	153916546		1905	4105	6010	SO:0001583	missense	9909	exon2			TCAACGAGGGGGG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.305T>C	1.37:g.153916546A>G	ENSP00000354597:p.Leu102Pro	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	72	17	NM_014856	0	0	0	0	0	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.314898	0.81358	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.29655	1.56;1.56	4.7	4.7	0.59300	MABP domain (1);	.	.	.	.	T	0.34164	0.0888	L	0.52126	1.63	0.80722	D	1	D	0.64830	0.994	P	0.59288	0.855	T	0.19451	-1.0305	9	0.87932	D	0	-8.3452	13.2712	0.60161	1.0:0.0:0.0:0.0	.	102	O75064	DEN4B_HUMAN	P	102;113	ENSP00000354597:L102P;ENSP00000357635:L113P	ENSP00000354597:L102P	L	-	2	0	DENND4B	152183170	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.903000	0.92573	1.964000	0.57103	0.379000	0.24179	CTC	.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
THBS3	7059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155175049	155175049	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:155175049C>T	ENST00000368378.3	-	3	365	c.345G>A	c.(343-345)gcG>gcA	p.A115A	RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000422665.1_RNA|THBS3_ENST00000457183.2_Intron|THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000430312.1_RNA|THBS3_ENST00000541990.1_5'UTR	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	115	Laminin G-like.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.A115A(1)		breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CAGCCAGGCCCGCTTGCTGTA	0.627																																					p.A115A		.											.	THBS3-222	1	Substitution - coding silent(1)	lung(1)	c.G345A						.						100.0	82.0	88.0					1																	155175049		2203	4300	6503	SO:0001819	synonymous_variant	7059	exon3			CAGGCCCGCTTGC	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.345G>A	1.37:g.155175049C>T		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	55	13	NM_007112	0	0	10	15	5	B1AVR8|B4DQ20|Q8WV34	Silent	SNP	ENST00000368378.3	37	CCDS1099.1																																																																																			.		0.627	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
CADM3	57863	broad.mit.edu	37	1	159166790	159166790	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:159166790G>T	ENST00000368125.4	+	7	1049	c.892G>T	c.(892-894)Ggc>Tgc	p.G298C	CADM3_ENST00000497636.1_3'UTR|CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Missense_Mutation_p.G332C	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	298	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					TGGCACCTACGGCTGCACAGC	0.542																																					p.G332C													.	CADM3-92	0			c.G994T						.						124.0	104.0	110.0					1																	159166790		2203	4300	6503	SO:0001583	missense	57863	exon8			ACCTACGGCTGCA	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.892G>T	1.37:g.159166790G>T	ENSP00000357107:p.Gly298Cys	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	107	4	NM_021189	0	0	1	1	0	Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	37	CCDS44251.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220537	0.58560	.	.	ENSG00000162706	ENST00000368124;ENST00000368125	T;T	0.12361	2.69;2.69	5.07	4.12	0.48240	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.542570	0.19235	N	0.119301	T	0.10208	0.0250	N	0.24115	0.695	0.34409	D	0.696165	P;D;D	0.69078	0.943;0.989;0.997	P;D;P	0.63488	0.861;0.915;0.826	T	0.02991	-1.1085	10	0.52906	T	0.07	.	6.4405	0.21847	0.099:0.1987:0.7022:0.0	.	252;298;332	Q8N126-3;Q8N126;Q8N126-2	.;CADM3_HUMAN;.	C	332;298	ENSP00000357106:G332C;ENSP00000357107:G298C	ENSP00000357106:G332C	G	+	1	0	CADM3	157433414	0.003000	0.15002	0.995000	0.50966	0.951000	0.60555	0.144000	0.16135	2.629000	0.89072	0.591000	0.81541	GGC	.		0.542	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189	
SHCBP1L	81626	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	182922005	182922005	+	Silent	SNP	C	C	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:182922005C>G	ENST00000367547.3	-	1	500	c.264G>C	c.(262-264)gcG>gcC	p.A88A	SHCBP1L_ENST00000488956.1_5'UTR|SHCBP1L_ENST00000423786.1_5'Flank	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	160										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						GCTCCTccgccgccgccgccg	0.746																																					p.A88A		.											.	SHCBP1L-91	0			c.G264C						.						5.0	6.0	6.0					1																	182922005		2140	4210	6350	SO:0001819	synonymous_variant	81626	exon1			CTCCGCCGCCGCC	AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.264G>C	1.37:g.182922005C>G		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	43	18	NM_030933	0	0	0	0	0	Q4G195|Q9BZQ3|Q9H2B6	Silent	SNP	ENST00000367547.3	37	CCDS30955.1																																																																																			.		0.746	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085956.1	NM_030933	
F13B	2165	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	197020002	197020002	+	Silent	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:197020002T>C	ENST00000367412.1	-	10	1606	c.1563A>G	c.(1561-1563)aaA>aaG	p.K521K	F13B_ENST00000490002.1_5'Flank	NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	521					blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TGCACATTCCTTTAGATTCTG	0.348																																					p.K521K		.											.	F13B-92	0			c.A1563G						.						85.0	85.0	85.0					1																	197020002		2203	4300	6503	SO:0001819	synonymous_variant	2165	exon10			CATTCCTTTAGAT	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1563A>G	1.37:g.197020002T>C		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	68	27	NM_001994	0	0	0	0	0	A8K3E5|Q5VYL5	Silent	SNP	ENST00000367412.1	37	CCDS1388.1																																																																																			.		0.348	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994	
PPP1R15B	84919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	204379052	204379052	+	Silent	SNP	A	A	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:204379052A>G	ENST00000367188.4	-	1	1867	c.1488T>C	c.(1486-1488)atT>atC	p.I496I	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	496					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			CAGCAGTCTGAATTGTTGCTG	0.458																																					p.I496I		.											.	PPP1R15B-652	0			c.T1488C						.						73.0	78.0	76.0					1																	204379052		2203	4300	6503	SO:0001819	synonymous_variant	84919	exon1			AGTCTGAATTGTT	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1488T>C	1.37:g.204379052A>G		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	72	23	NM_032833	0	0	7	16	9	Q53GQ4|Q658M2|Q6P156|Q96SN1	Silent	SNP	ENST00000367188.4	37	CCDS1445.1																																																																																			.		0.458	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
PARP1	142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	226570817	226570817	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:226570817T>A	ENST00000366794.5	-	8	1222	c.1079A>T	c.(1078-1080)gAa>gTa	p.E360V		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	360					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GGCGCTGGTTTCTGGGGGGAA	0.507								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.E360V		.											.	PARP1-727	0			c.A1079T						.						111.0	139.0	129.0					1																	226570817		2203	4300	6503	SO:0001583	missense	142	exon8			CTGGTTTCTGGGG	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1079A>T	1.37:g.226570817T>A	ENSP00000355759:p.Glu360Val	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	96	40	NM_001618	0	0	7	14	7	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	ENST00000366794.5	37	CCDS1554.1	.	.	.	.	.	.	.	.	.	.	T	11.05	1.525131	0.27299	.	.	ENSG00000143799	ENST00000366794	T	0.09723	2.95	5.26	5.26	0.73747	.	0.049169	0.85682	D	0.000000	T	0.05731	0.0150	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.38090	-0.9677	10	0.32370	T	0.25	.	9.4103	0.38487	0.0:0.0804:0.0:0.9196	.	360	P09874	PARP1_HUMAN	V	360	ENSP00000355759:E360V	ENSP00000355759:E360V	E	-	2	0	PARP1	224637440	0.994000	0.37717	0.177000	0.23020	0.267000	0.26476	3.623000	0.54224	1.977000	0.57605	0.454000	0.30748	GAA	.		0.507	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
ARID4B	51742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	235345203	235345203	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:235345203A>T	ENST00000264183.3	-	20	3528	c.3031T>A	c.(3031-3033)Ttt>Att	p.F1011I	ARID4B_ENST00000366603.2_Missense_Mutation_p.F1011I|ARID4B_ENST00000349213.3_Missense_Mutation_p.F925I|ARID4B_ENST00000494543.1_5'Flank	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	1011					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CTACTTGGAAATTCTGCTTTT	0.438																																					p.F1011I		.											.	ARID4B-228	0			c.T3031A						.						116.0	121.0	119.0					1																	235345203		2203	4300	6503	SO:0001583	missense	51742	exon20			TTGGAAATTCTGC	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.3031T>A	1.37:g.235345203A>T	ENSP00000264183:p.Phe1011Ile	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	77	24	NM_016374	0	0	3	12	9	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	ENST00000264183.3	37	CCDS31061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.17|18.17	3.563590|3.563590	0.65651|0.65651	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183|ENST00000444620	T;T;T|.	0.23552|.	1.9;1.95;1.95|.	5.18|5.18	4.03|4.03	0.46877|0.46877	.|.	0.359358|.	0.32785|.	N|.	0.005655|.	T|T	0.47303|0.47303	0.1438|0.1438	N|N	0.19112|0.19112	0.55|0.55	0.53688|0.53688	D|D	0.999971|0.999971	D;D;D;D|.	0.67145|.	0.996;0.992;0.996;0.987|.	D;D;D;D|.	0.77557|.	0.99;0.974;0.99;0.942|.	T|T	0.33085|0.33085	-0.9882|-0.9882	10|5	0.25751|.	T|.	0.34|.	-11.9576|-11.9576	12.1739|12.1739	0.54173|0.54173	0.8568:0.1432:0.0:0.0|0.8568:0.1432:0.0:0.0	.|.	692;1011;925;1011|.	Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39|.	.;.;.;ARI4B_HUMAN|.	I|K	1011;925;1011;1011|410	ENSP00000264184:F925I;ENSP00000355562:F1011I;ENSP00000264183:F1011I|.	ENSP00000264183:F1011I|.	F|N	-|-	1|3	0|2	ARID4B|ARID4B	233411826|233411826	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.991000|0.991000	0.79684|0.79684	5.361000|5.361000	0.66092|0.66092	0.956000|0.956000	0.37904|0.37904	0.477000|0.477000	0.44152|0.44152	TTT|AAT	.		0.438	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374	
FMN2	56776	hgsc.bcm.edu	37	1	240371139	240371139	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:240371139C>T	ENST00000319653.9	+	5	3257	c.3027C>T	c.(3025-3027)ccC>ccT	p.P1009P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1009	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CGGGCATACCCCCTCCTCCCC	0.731																																					p.P1009P		.											.	FMN2-145	0			c.C3027T						.																																			SO:0001819	synonymous_variant	56776	exon5			CATACCCCCTCCT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3027C>T	1.37:g.240371139C>T		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	81	5	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			.		0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
RHOBTB1	9886	broad.mit.edu;bcgsc.ca	37	10	62637691	62637691	+	Silent	SNP	G	G	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr10:62637691G>A	ENST00000337910.5	-	8	2038	c.1701C>T	c.(1699-1701)tgC>tgT	p.C567C	RHOBTB1_ENST00000490827.1_5'Flank|RHOBTB1_ENST00000357917.4_Silent_p.C567C	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	567					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					AGTGTGGCAGGCAAAATCTGT	0.403																																					p.C567C													.	RHOBTB1-228	0			c.C1701T						.						95.0	90.0	92.0					10																	62637691		2203	4300	6503	SO:0001819	synonymous_variant	9886	exon8			TGGCAGGCAAAAT	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1701C>T	10.37:g.62637691G>A		Somatic	143	0		WXS	Illumina HiSeq	Phase_I	153	6	NM_014836	0	0	53	53	0		Silent	SNP	ENST00000337910.5	37	CCDS7261.1																																																																																			.		0.403	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1		
MUC2	4583	broad.mit.edu	37	11	1093344	1093344	+	Silent	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr11:1093344G>T	ENST00000441003.2	+	30	5190	c.5163G>T	c.(5161-5163)ccG>ccT	p.P1721P	MUC2_ENST00000359061.5_Silent_p.P1688P|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.P9P	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1688P(1)|p.P1721P(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccgacacccatct	0.642																																					p.P1721P													.	MUC2-90	2	Substitution - coding silent(2)	lung(2)	c.G5163T						.						231.0	269.0	256.0					11																	1093344		1975	3757	5732	SO:0001819	synonymous_variant	4583	exon30			AACCCCGACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5163G>T	11.37:g.1093344G>T		Somatic	70	1		WXS	Illumina HiSeq	Phase_I	68	5	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
DAK	26007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	61111339	61111339	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr11:61111339A>G	ENST00000394900.3	+	12	1223	c.994A>G	c.(994-996)Act>Gct	p.T332A		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	332	DhaK. {ECO:0000255|PROSITE- ProRule:PRU00814}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						TGCTGAAACCACTGCAGCAGC	0.627																																					p.T332A		.											.	DAK-115	0			c.A994G						.						88.0	95.0	93.0					11																	61111339		2203	4299	6502	SO:0001583	missense	26007	exon12			GAAACCACTGCAG		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.994A>G	11.37:g.61111339A>G	ENSP00000378360:p.Thr332Ala	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	53	16	NM_015533	0	0	0	0	0	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Missense_Mutation	SNP	ENST00000394900.3	37	CCDS8003.1	.	.	.	.	.	.	.	.	.	.	A	9.592	1.126311	0.20959	.	.	ENSG00000149476	ENST00000394900;ENST00000529479	T;T	0.29142	1.58;1.58	5.84	3.45	0.39498	Dak kinase (2);	0.410578	0.28219	N	0.016157	T	0.18045	0.0433	N	0.25957	0.775	0.19575	N	0.999969	B;B	0.11235	0.004;0.0	B;B	0.16289	0.015;0.005	T	0.21280	-1.0250	10	0.25106	T	0.35	-6.7353	5.6557	0.17640	0.6665:0.0:0.0707:0.2628	.	332;332	Q2L9C1;Q3LXA3	.;DHAK_HUMAN	A	332;331	ENSP00000378360:T332A;ENSP00000432539:T331A	ENSP00000378360:T332A	T	+	1	0	DAK	60867915	0.984000	0.35163	0.040000	0.18447	0.922000	0.55478	3.052000	0.49893	0.443000	0.26582	0.533000	0.62120	ACT	.		0.627	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4	NM_015533	
CCDC87	55231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66359427	66359427	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr11:66359427C>T	ENST00000333861.3	-	1	1127	c.1060G>A	c.(1060-1062)Gct>Act	p.A354T	CCS_ENST00000533244.1_5'Flank|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	354					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						AGATCCTCAGCCACGATGAGC	0.587																																					p.A354T		.											.	CCDC87-92	0			c.G1060A						.						49.0	55.0	53.0					11																	66359427		2200	4295	6495	SO:0001583	missense	55231	exon1			CCTCAGCCACGAT	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.1060G>A	11.37:g.66359427C>T	ENSP00000328487:p.Ala354Thr	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	69	29	NM_018219	0	0	0	0	0	Q8NE76	Missense_Mutation	SNP	ENST00000333861.3	37	CCDS8145.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390249	0.42410	.	.	ENSG00000182791	ENST00000333861	T	0.32753	1.44	5.3	1.08	0.20341	.	0.256314	0.25159	N	0.032698	T	0.24353	0.0590	M	0.67953	2.075	0.31044	N	0.715953	B	0.27882	0.192	B	0.21151	0.033	T	0.13150	-1.0520	10	0.44086	T	0.13	.	3.6025	0.08030	0.1848:0.5359:0.0:0.2793	.	354	Q9NVE4	CCD87_HUMAN	T	354	ENSP00000328487:A354T	ENSP00000328487:A354T	A	-	1	0	CCDC87	66116003	0.993000	0.37304	0.982000	0.44146	0.282000	0.26991	0.720000	0.25896	0.395000	0.25257	-0.251000	0.11542	GCT	.		0.587	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219	
ANKRD13D	338692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	67058950	67058950	+	Missense_Mutation	SNP	C	C	A	rs373999660		TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr11:67058950C>A	ENST00000447274.2	+	4	1269	c.94C>A	c.(94-96)Ccc>Acc	p.P32T	ANKRD13D_ENST00000514166.1_Missense_Mutation_p.P32T|ANKRD13D_ENST00000511455.2_Missense_Mutation_p.P119T|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.P32T			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	32						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CTCTTAGGCCCCCGATTTCTA	0.627																																					p.P119T		.											.	ANKRD13D-91	0			c.C355A						.						58.0	61.0	60.0					11																	67058950		2200	4295	6495	SO:0001583	missense	338692	exon4			TAGGCCCCCGATT	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.94C>A	11.37:g.67058950C>A	ENSP00000402616:p.Pro32Thr	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	36	10	NM_207354	0	0	2	2	0	D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	ENST00000447274.2	37		.	.	.	.	.	.	.	.	.	.	C	14.41	2.526001	0.44969	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.35048	1.33;1.49;1.33;1.33	3.95	3.02	0.34903	.	0.093915	0.45361	D	0.000371	T	0.45538	0.1347	M	0.67397	2.05	0.45108	D	0.998126	P;D	0.59357	0.887;0.985	B;P	0.53809	0.441;0.735	T	0.44862	-0.9300	10	0.66056	D	0.02	-20.8257	8.6108	0.33801	0.0:0.7549:0.157:0.0882	.	119;32	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	T	32;119;32;32	ENSP00000402616:P32T;ENSP00000427130:P119T;ENSP00000310874:P32T;ENSP00000444404:P32T	ENSP00000310874:P32T	P	+	1	0	ANKRD13D	66815526	0.007000	0.16637	0.972000	0.41901	0.271000	0.26615	1.546000	0.36179	1.014000	0.39417	0.561000	0.74099	CCC	.		0.627	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000371067.2	NM_207354	
PITPNM1	9600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	67267651	67267651	+	Silent	SNP	G	G	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr11:67267651G>A	ENST00000534749.1	-	5	1070	c.882C>T	c.(880-882)ccC>ccT	p.P294P	PITPNM1_ENST00000436757.2_Silent_p.P294P|PITPNM1_ENST00000356404.3_Silent_p.P294P			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	294					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						CTGGGCCTGGGGGGGCCTCAG	0.692																																					p.P294P	GBM(28;144 709 4607 5525)	.											.	PITPNM1-227	0			c.C882T						.						25.0	31.0	29.0					11																	67267651		2171	4250	6421	SO:0001819	synonymous_variant	9600	exon6			GCCTGGGGGGGCC	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.882C>T	11.37:g.67267651G>A		Somatic	13	0		WXS	Illumina HiSeq	Phase_I	23	11	NM_001130848	0	0	14	23	9	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	ENST00000534749.1	37	CCDS31620.1																																																																																			.		0.692	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
LRP6	4040	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	12303827	12303827	+	Silent	SNP	G	G	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr12:12303827G>C	ENST00000261349.4	-	13	3013	c.2937C>G	c.(2935-2937)ctC>ctG	p.L979L	LRP6_ENST00000543091.1_Silent_p.L979L	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	979	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CAATCCAATAGAGTTGCTTGT	0.468																																					p.L979L													.	LRP6-661	0			c.C2937G						.						234.0	209.0	218.0					12																	12303827		2203	4300	6503	SO:0001819	synonymous_variant	4040	exon13			CCAATAGAGTTGC	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.2937C>G	12.37:g.12303827G>C		Somatic	154	2		WXS	Illumina HiSeq	Phase_I	126	35	NM_002336	0	0	0	0	0	Q17RZ2	Silent	SNP	ENST00000261349.4	37	CCDS8647.1																																																																																			.		0.468	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
CERS5	91012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	50529605	50529605	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr12:50529605T>C	ENST00000317551.6	-	8	906	c.782A>G	c.(781-783)aAt>aGt	p.N261S	CERS5_ENST00000422340.2_Missense_Mutation_p.N203S	NM_147190.2	NP_671723.1	Q8N5B7	CERS5_HUMAN	ceramide synthase 5	261	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CTTGGCATAATTGGCCAGTTT	0.428																																					p.N261S		.											.	.	0			c.A782G						.						92.0	88.0	89.0					12																	50529605		2203	4300	6503	SO:0001583	missense	91012	exon8			GCATAATTGGCCA		CCDS8801.1, CCDS61120.1	12q13.12	2014-09-04	2011-07-08	2011-07-08	ENSG00000139624			"""Homeoboxes / CERS class"""	23749	protein-coding gene	gene with protein product		615335	"""LAG1 longevity assurance homolog 5 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 5"""	LASS5			Standard	NM_147190		Approved	Trh4, MGC45411, FLJ25304	uc001rwd.4	Q8N5B7	OTTHUMG00000169819	ENST00000317551.6:c.782A>G	12.37:g.50529605T>C	ENSP00000325485:p.Asn261Ser	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	87	20	NM_147190	0	0	10	20	10	B4DV54	Missense_Mutation	SNP	ENST00000317551.6	37	CCDS8801.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.79|15.79	2.936979|2.936979	0.52972|0.52972	.|.	.|.	ENSG00000139624|ENSG00000139624	ENST00000550547;ENST00000547800|ENST00000551005;ENST00000317551;ENST00000422340	.|D;D;D	.|0.84660	.|-1.88;-1.88;-1.88	4.7|4.7	4.7|4.7	0.59300|0.59300	.|TRAM/LAG1/CLN8 homology domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.86239|0.86239	0.5885|0.5885	L|L	0.58101|0.58101	1.795|1.795	0.58432|0.58432	D|D	0.999999|0.999999	.|P;B;P	.|0.40794	.|0.688;0.198;0.729	.|P;B;P	.|0.47346	.|0.491;0.14;0.544	D|D	0.86223|0.86223	0.1632|0.1632	5|10	.|0.42905	.|T	.|0.14	-12.9936|-12.9936	14.6573|14.6573	0.68844|0.68844	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|203;261;180	.|B4DV54;Q8N5B7;F8W0U5	.|.;CERS5_HUMAN;.	V|S	63;165|180;261;203	.|ENSP00000447556:N180S;ENSP00000325485:N261S;ENSP00000389050:N203S	.|ENSP00000325485:N261S	I|N	-|-	1|2	0|0	CERS5|CERS5	48815872|48815872	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	7.868000|7.868000	0.87116|0.87116	2.099000|2.099000	0.63709|0.63709	0.533000|0.533000	0.62120|0.62120	ATT|AAT	.		0.428	CERS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406069.3	NM_147190	
PTPRR	5801	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	71139777	71139777	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr12:71139777T>A	ENST00000283228.2	-	6	1280	c.828A>T	c.(826-828)ttA>ttT	p.L276F	PTPRR_ENST00000549308.1_Missense_Mutation_p.L31F|PTPRR_ENST00000378778.1_Missense_Mutation_p.L70F|PTPRR_ENST00000342084.4_Missense_Mutation_p.L164F|PTPRR_ENST00000440835.2_Missense_Mutation_p.L31F	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	276					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GTGCTGGCTGTAATGTGATGG	0.473																																					p.L276F													.	PTPRR-652	0			c.A828T						.						207.0	168.0	181.0					12																	71139777		2203	4300	6503	SO:0001583	missense	5801	exon6			TGGCTGTAATGTG	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.828A>T	12.37:g.71139777T>A	ENSP00000283228:p.Leu276Phe	Somatic	144	1		WXS	Illumina HiSeq	Phase_I	128	36	NM_002849	0	0	0	1	1	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	37	CCDS8998.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.066317	0.36470	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308;ENST00000550661	T;T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33;1.33	5.0	2.61	0.31194	.	0.177186	0.25997	N	0.026967	T	0.23094	0.0558	L	0.44542	1.39	0.24575	N	0.993907	P;P;P;P	0.49961	0.93;0.731;0.731;0.612	B;B;B;B	0.44224	0.36;0.444;0.241;0.347	T	0.09314	-1.0680	10	0.12766	T	0.61	-2.501	0.2888	0.00255	0.2828:0.1721:0.1493:0.3959	.	125;164;70;276	B7Z998;F5GXR7;Q15256-4;Q15256	.;.;.;PTPRR_HUMAN	F	31;276;70;164;31;31	ENSP00000391750:L31F;ENSP00000283228:L276F;ENSP00000368054:L70F;ENSP00000339605:L164F;ENSP00000446943:L31F;ENSP00000449616:L31F	ENSP00000283228:L276F	L	-	3	2	PTPRR	69426044	0.939000	0.31865	0.664000	0.29753	0.391000	0.30476	0.029000	0.13666	0.247000	0.21414	0.533000	0.62120	TTA	.		0.473	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849	
SIRT4	23409	bcgsc.ca	37	12	120750518	120750518	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr12:120750518G>C	ENST00000202967.4	+	3	816	c.757G>C	c.(757-759)Gcc>Ccc	p.A253P	RNU6-1088P_ENST00000516850.1_RNA|SIRT4_ENST00000537892.1_3'UTR	NM_012240.2	NP_036372.1			sirtuin 4											haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGTAAAAGAAGCCGACTCCCT	0.527																																					p.A253P													.	SIRT4-226	0			c.G757C						.						67.0	64.0	65.0					12																	120750518		2203	4300	6503	SO:0001583	missense	23409	exon3			AAAGAAGCCGACT	AF083109	CCDS9194.1	12q24.31	2010-06-25	2010-06-25		ENSG00000089163	ENSG00000089163			14932	protein-coding gene	gene with protein product		604482	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 4"", ""sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae)"""			10381378	Standard	NM_012240		Approved	SIR2L4	uc001tyc.3	Q9Y6E7	OTTHUMG00000169028	ENST00000202967.4:c.757G>C	12.37:g.120750518G>C	ENSP00000202967:p.Ala253Pro	Somatic	146	0		WXS	Illumina HiSeq	Phase_1	104	28	NM_012240	0	0	1	1	0		Missense_Mutation	SNP	ENST00000202967.4	37	CCDS9194.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994165	0.74703	.	.	ENSG00000089163	ENST00000202967	T	0.50548	0.74	4.59	4.59	0.56863	.	0.109676	0.64402	D	0.000007	T	0.75102	0.3804	H	0.95504	3.68	0.50467	D	0.999878	D	0.57257	0.979	P	0.62649	0.905	T	0.82727	-0.0314	10	0.66056	D	0.02	-23.7192	14.265	0.66110	0.0:0.0:0.8416:0.1584	.	253	Q9Y6E7	SIRT4_HUMAN	P	253	ENSP00000202967:A253P	ENSP00000202967:A253P	A	+	1	0	SIRT4	119234901	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	3.260000	0.51523	2.490000	0.84030	0.650000	0.86243	GCC	.		0.527	SIRT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402003.1	NM_012240	
GSX1	219409	hgsc.bcm.edu	37	13	28367053	28367053	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr13:28367053C>T	ENST00000302945.2	+	1	274	c.226C>T	c.(226-228)Ctg>Ttg	p.L76L		NM_145657.1	NP_663632.1	Q9H4S2	GSX1_HUMAN	GS homeobox 1	76					adenohypophysis development (GO:0021984)|hypothalamus development (GO:0021854)|neuron fate commitment (GO:0048663)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		gccgcccgcgcTGCCTCTACT	0.741																																					p.L76L		.											.	GSX1-69	0			c.C226T						.						2.0	3.0	3.0					13																	28367053		1552	3186	4738	SO:0001819	synonymous_variant	219409	exon1			CCCGCGCTGCCTC	AB044157	CCDS9326.1	13q12.2	2012-03-09		2007-07-26	ENSG00000169840	ENSG00000169840		"""Homeoboxes / ANTP class : HOXL subclass"""	20374	protein-coding gene	gene with protein product				GSH1			Standard	NM_145657		Approved	Gsh-1	uc001urr.1	Q9H4S2	OTTHUMG00000016637	ENST00000302945.2:c.226C>T	13.37:g.28367053C>T		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	16	4	NM_145657	0	0	0	0	0	Q9UD62	Silent	SNP	ENST00000302945.2	37	CCDS9326.1																																																																																			.		0.741	GSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044309.2	NM_145657	
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	35758158	35758158	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr13:35758158T>G	ENST00000400445.3	+	30	5411	c.4877T>G	c.(4876-4878)tTc>tGc	p.F1626C	NBEA_ENST00000310336.4_Missense_Mutation_p.F1626C|NBEA_ENST00000540320.1_Missense_Mutation_p.F1626C|NBEA_ENST00000379939.2_Missense_Mutation_p.F1623C	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1626					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AACCATGGATTCCTTGCCAAG	0.413																																					p.F1626C		.											.	NBEA-144	0			c.T4877G						.						122.0	110.0	113.0					13																	35758158		1890	4124	6014	SO:0001583	missense	26960	exon30			ATGGATTCCTTGC	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4877T>G	13.37:g.35758158T>G	ENSP00000383295:p.Phe1626Cys	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	102	32	NM_015678	0	0	1	1	0	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	T	14.31	2.497854	0.44455	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.50277	0.76;0.75;0.75;0.76	5.82	5.82	0.92795	.	0.290400	0.35291	N	0.003313	T	0.31796	0.0808	N	0.08118	0	0.80722	D	1	B	0.27732	0.187	B	0.30855	0.121	T	0.19745	-1.0296	10	0.45353	T	0.12	.	14.7488	0.69508	0.0:0.0:0.0:1.0	.	1623	Q5T321	.	C	1626;1626;1623;1626	ENSP00000440951:F1626C;ENSP00000383295:F1626C;ENSP00000369271:F1623C;ENSP00000308534:F1626C	ENSP00000308534:F1626C	F	+	2	0	NBEA	34656158	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.896000	0.63222	2.222000	0.72286	0.383000	0.25322	TTC	.		0.413	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
GPR137C	283554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	53099007	53099007	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr14:53099007T>A	ENST00000321662.6	+	4	847	c.847T>A	c.(847-849)Tgg>Agg	p.W283R		NM_001099652.1	NP_001093122.1	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C	283						integral component of membrane (GO:0016021)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8	Breast(41;0.0716)					TAATTATGGCTGGGATAATCT	0.378																																					p.W283R		.											.	GPR137C-68	0			c.T847A						.						125.0	122.0	123.0					14																	53099007		1858	4099	5957	SO:0001583	missense	283554	exon4			TATGGCTGGGATA	BX647179	CCDS45106.1	14q22.1	2012-08-10				ENSG00000180998			25445	protein-coding gene	gene with protein product							Standard	NM_001099652		Approved	DKFZp762F0713, TM7SF1L2	uc001wzu.4	Q8N3F9		ENST00000321662.6:c.847T>A	14.37:g.53099007T>A	ENSP00000315106:p.Trp283Arg	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	126	24	NM_001099652	0	0	0	0	0	Q86SM2	Missense_Mutation	SNP	ENST00000321662.6	37	CCDS45106.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.1|25.1	4.606362|4.606362	0.87157|0.87157	.|.	.|.	ENSG00000180998|ENSG00000180998	ENST00000542169|ENST00000321662	.|T	.|0.62498	.|0.02	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77942|0.77942	0.4206|0.4206	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	T|T	0.80360|0.80360	-0.1415|-0.1415	5|10	.|0.87932	.|D	.|0	-12.2616|-12.2616	16.0439|16.0439	0.80704|0.80704	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|283;112	.|Q8N3F9;B3KW22	.|G137C_HUMAN;.	Q|R	252|283	.|ENSP00000315106:W283R	.|ENSP00000315106:W283R	L|W	+|+	2|1	0|0	GPR137C|GPR137C	52168757|52168757	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.499000|7.499000	0.81566|0.81566	2.250000|2.250000	0.74265|0.74265	0.482000|0.482000	0.46254|0.46254	CTG|TGG	.		0.378	GPR137C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411685.1	XM_290615	
SRP14	6727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	40331316	40331316	+	Start_Codon_SNP	SNP	A	A	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr15:40331316A>G	ENST00000267884.6	-	1	73	c.2T>C	c.(1-3)aTg>aCg	p.M1T	SRP14_ENST00000560773.1_5'UTR|SRP14_ENST00000558720.1_5'Flank|SRP14_ENST00000558527.1_5'UTR|SRP14_ENST00000559081.1_Start_Codon_SNP_p.M1T|SRP14-AS1_ENST00000504245.1_lincRNA	NM_003134.4	NP_003125.3	P37108	SRP14_HUMAN	signal recognition particle 14kDa (homologous Alu RNA binding protein)	1					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|skin(1)|upper_aerodigestive_tract(1)	3		all_cancers(109;7.56e-18)|all_epithelial(112;4.02e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.84e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0505)		CAACAACACCATCGCGGCGAC	0.652																																					p.M1T		.											.	SRP14-514	0			c.T2C						.						19.0	23.0	22.0					15																	40331316		2073	4184	6257	SO:0001582	initiator_codon_variant	6727	exon1			AACACCATCGCGG		CCDS42017.1	15q22	2008-08-15	2002-08-29		ENSG00000140319	ENSG00000140319			11299	protein-coding gene	gene with protein product		600708	"""signal recognition particle 14kD (homologous Alu RNA-binding protein)"""			8196634	Standard	NM_003134		Approved	ALURBP, MGC14326	uc001zkq.2	P37108		ENST00000267884.6:c.2T>C	15.37:g.40331316A>G	ENSP00000267884:p.Met1Thr	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	71	8	NM_003134	2	0	791	887	94	B5BUF5|Q6B0K5|Q96Q14	Missense_Mutation	SNP	ENST00000267884.6	37	CCDS42017.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.001965	0.35320	.	.	ENSG00000140319	ENST00000267884	T	0.34667	1.35	4.92	4.92	0.64577	Signal recognition particle, SRP9/SRP14 subunit (2);	0.000000	0.85682	D	0.000000	T	0.51618	0.1685	.	.	.	0.80722	D	1	P	0.40431	0.717	P	0.52189	0.692	T	0.55958	-0.8058	9	0.87932	D	0	.	13.8377	0.63419	1.0:0.0:0.0:0.0	.	1	P37108	SRP14_HUMAN	T	1	ENSP00000267884:M1T	ENSP00000267884:M1T	M	-	2	0	SRP14	38118608	1.000000	0.71417	0.990000	0.47175	0.020000	0.10135	5.373000	0.66162	1.966000	0.57179	0.460000	0.39030	ATG	.		0.652	SRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418262.2	NM_003134	Missense_Mutation
DNAJC17	55192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41099608	41099608	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr15:41099608A>G	ENST00000220496.4	-	1	67	c.37T>C	c.(37-39)Tac>Cac	p.Y13H	ZFYVE19_ENST00000564258.1_5'UTR|ZFYVE19_ENST00000299173.10_5'Flank|ZFYVE19_ENST00000336455.5_Missense_Mutation_p.Y41C|ZFYVE19_ENST00000570108.1_Missense_Mutation_p.Y41C|ZFYVE19_ENST00000355341.4_5'UTR	NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	13	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		AGCAGCGCGTACAGGTCCATC	0.577																																					p.Y41C		.											.	ZFYVE19-91	0			c.A122G						.						180.0	134.0	150.0					15																	41099608		2203	4300	6503	SO:0001583	missense	84936	exon1			GCGCGTACAGGTC	AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.37T>C	15.37:g.41099608A>G	ENSP00000220496:p.Tyr13His	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	155	43	NM_032850	0	0	14	20	6		Missense_Mutation	SNP	ENST00000220496.4	37	CCDS10065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.8|27.8	4.859778|4.859778	0.91433|0.91433	.|.	.|.	ENSG00000166140|ENSG00000104129	ENST00000336455|ENST00000220496	T|T	0.27402|0.58940	1.67|0.3	5.35|5.35	5.35|5.35	0.76521|0.76521	.|Heat shock protein DnaJ, N-terminal (5);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.81730|0.81730	0.4884|0.4884	M|M	0.94063|0.94063	3.49|3.49	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.86513|0.86513	0.1811|0.1811	8|10	0.87932|0.87932	D|D	0|0	.|.	14.7373|14.7373	0.69424|0.69424	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|13	.|Q9NVM6	.|DJC17_HUMAN	C|H	41|13	ENSP00000337824:Y41C|ENSP00000220496:Y13H	ENSP00000337824:Y41C|ENSP00000220496:Y13H	Y|Y	+|-	2|1	0|0	ZFYVE19|DNAJC17	38886900|38886900	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.383000|5.383000	0.66219|0.66219	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	TAC|TAC	.		0.577	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252356.2	NM_018163	
MFAP1	4236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	44105507	44105507	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr15:44105507C>T	ENST00000267812.3	-	5	898	c.666G>A	c.(664-666)caG>caA	p.Q222Q		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	222					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		CCAGCTCCTTCTGTTTCAATG	0.488																																					p.Q222Q		.											.	MFAP1-226	0			c.G666A						.						350.0	297.0	315.0					15																	44105507		2198	4298	6496	SO:0001819	synonymous_variant	4236	exon5			CTCCTTCTGTTTC		CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.666G>A	15.37:g.44105507C>T		Somatic	74	0		WXS	Illumina HiSeq	Phase_I	74	23	NM_005926	0	0	31	55	24	Q86TG6	Silent	SNP	ENST00000267812.3	37	CCDS10105.1																																																																																			.		0.488	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133491.2	NM_005926	
SECISBP2L	9728	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	49304926	49304926	+	Silent	SNP	A	A	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr15:49304926A>T	ENST00000559471.1	-	12	1913	c.1650T>A	c.(1648-1650)tcT>tcA	p.S550S	SECISBP2L_ENST00000261847.3_Silent_p.S505S	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	550							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						CAATGTCCACAGAATTAAAGG	0.358																																					p.S550S													.	SECISBP2L-136	0			c.T1650A						.						116.0	123.0	121.0					15																	49304926		2197	4295	6492	SO:0001819	synonymous_variant	9728	exon12			GTCCACAGAATTA	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1650T>A	15.37:g.49304926A>T		Somatic	205	1		WXS	Illumina HiSeq	Phase_I	146	34	NM_001193489	0	0	4	7	3	Q8N767	Silent	SNP	ENST00000559471.1	37	CCDS53942.1																																																																																			.		0.358	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
PIF1	80119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65114469	65114469	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr15:65114469A>T	ENST00000268043.4	-	4	907	c.813T>A	c.(811-813)ttT>ttA	p.F271L	PIF1_ENST00000333425.6_Missense_Mutation_p.F271L|PIF1_ENST00000559239.1_Missense_Mutation_p.F271L					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						ACTTACCTGCAAAGGCATGGA	0.612																																					p.F271L		.											.	PIF1-227	0			c.T813A						.						60.0	64.0	63.0					15																	65114469		2202	4299	6501	SO:0001583	missense	80119	exon4			ACCTGCAAAGGCA	AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.813T>A	15.37:g.65114469A>T	ENSP00000268043:p.Phe271Leu	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	45	10	NM_025049	0	0	0	0	0		Missense_Mutation	SNP	ENST00000268043.4	37	CCDS10195.2	.	.	.	.	.	.	.	.	.	.	A	24.6	4.553832	0.86231	.	.	ENSG00000140451	ENST00000268043;ENST00000333425	T;T	0.52295	0.67;0.67	4.98	2.66	0.31614	.	0.100402	0.64402	D	0.000001	T	0.54711	0.1875	L	0.48174	1.505	0.80722	D	1	D	0.58970	0.984	D	0.64877	0.93	T	0.50725	-0.8794	10	0.54805	T	0.06	-11.173	7.9896	0.30233	0.8322:0.0:0.1678:0.0	.	271	Q9H611	PIF1_HUMAN	L	271	ENSP00000268043:F271L;ENSP00000328174:F271L	ENSP00000268043:F271L	F	-	3	2	PIF1	62901522	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.558000	0.36309	0.336000	0.23639	0.533000	0.62120	TTT	.		0.612	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256533.1	NM_025049	
NEO1	4756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	73581573	73581573	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr15:73581573C>A	ENST00000339362.5	+	26	4183	c.3736C>A	c.(3736-3738)Ccc>Acc	p.P1246T	NEO1_ENST00000261908.6_Missense_Mutation_p.P1246T|NEO1_ENST00000558964.1_Missense_Mutation_p.P1235T|NEO1_ENST00000560262.1_Missense_Mutation_p.P1246T			Q92859	NEO1_HUMAN	neogenin 1	1246					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						CTCCCAGCCACCCCAGCGTAA	0.458																																					p.P1246T		.											.	NEO1-116	0			c.C3736A						.						154.0	102.0	119.0					15																	73581573		2198	4297	6495	SO:0001583	missense	4756	exon25			CAGCCACCCCAGC	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.3736C>A	15.37:g.73581573C>A	ENSP00000341198:p.Pro1246Thr	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	73	32	NM_001172623	0	0	0	0	0	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	37	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713733	0.89112	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.45276	0.9;0.9	5.48	5.48	0.80851	Neogenin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.61640	0.2363	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;0.999	D;D;D;D	0.75484	0.986;0.968;0.98;0.98	T	0.53627	-0.8412	10	0.17832	T	0.49	-12.2116	19.387	0.94560	0.0:1.0:0.0:0.0	.	1246;1235;957;1246	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	T	1246;957;1246	ENSP00000341198:P1246T;ENSP00000261908:P1246T	ENSP00000261908:P1246T	P	+	1	0	NEO1	71368626	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.463000	0.80869	2.572000	0.86782	0.655000	0.94253	CCC	.		0.458	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
PML	5371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	74325643	74325643	+	Silent	SNP	G	G	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr15:74325643G>A	ENST00000268058.3	+	6	1641	c.1545G>A	c.(1543-1545)aaG>aaA	p.K515K	PML_ENST00000564428.1_Silent_p.K467K|PML_ENST00000569477.1_Silent_p.K515K|PML_ENST00000435786.2_Silent_p.K515K|PML_ENST00000268059.6_Silent_p.K515K|PML_ENST00000565898.1_Silent_p.K467K|PML_ENST00000436891.3_Silent_p.K515K|PML_ENST00000567543.1_Intron|PML_ENST00000569965.1_Silent_p.K515K|PML_ENST00000395135.3_Silent_p.K515K|PML_ENST00000395132.2_Intron|PML_ENST00000354026.6_Silent_p.K467K|PML_ENST00000563500.1_Silent_p.K467K|PML_ENST00000359928.4_Intron	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	515	Interaction with PER2.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						GCACCTCCAAGGCAGTCTCAC	0.652			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.K515K		.		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML-1083	0			c.G1545A						.						62.0	58.0	60.0					15																	74325643		2198	4297	6495	SO:0001819	synonymous_variant	5371	exon6			CTCCAAGGCAGTC	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1545G>A	15.37:g.74325643G>A		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	85	21	NM_033244	0	0	28	46	18	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Silent	SNP	ENST00000268058.3	37	CCDS10255.1																																																																																			.		0.652	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
SLC28A1	9154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	85476453	85476453	+	Silent	SNP	G	G	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr15:85476453G>A	ENST00000286749.3	+	12	1251	c.1161G>A	c.(1159-1161)ccG>ccA	p.P387P	SLC28A1_ENST00000538177.1_Intron|SLC28A1_ENST00000537216.1_Silent_p.P387P|SLC28A1_ENST00000394573.1_Silent_p.P387P|SLC28A1_ENST00000537624.1_Silent_p.P387P			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	387					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	TGGTCTACCCGGAGGTGGAGG	0.572																																					p.P387P		.											.	SLC28A1-93	0			c.G1161A						.						132.0	113.0	119.0					15																	85476453		2203	4299	6502	SO:0001819	synonymous_variant	9154	exon13			CTACCCGGAGGTG	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.1161G>A	15.37:g.85476453G>A		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	56	17	NM_004213	0	0	12	19	7	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Silent	SNP	ENST00000286749.3	37	CCDS10334.1																																																																																			.		0.572	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2		
ZNF597	146434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3487293	3487293	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr16:3487293A>T	ENST00000301744.4	-	4	641	c.406T>A	c.(406-408)Tta>Ata	p.L136I		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	136					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						TTGGTTCCTAAATATTCAGAG	0.403																																					p.L136I		.											.	ZNF597-90	0			c.T406A						.						133.0	137.0	136.0					16																	3487293		2197	4300	6497	SO:0001583	missense	146434	exon4			TTCCTAAATATTC	AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.406T>A	16.37:g.3487293A>T	ENSP00000301744:p.Leu136Ile	Somatic	201	0		WXS	Illumina HiSeq	Phase_I	208	123	NM_152457	0	0	0	3	3		Missense_Mutation	SNP	ENST00000301744.4	37	CCDS10505.1	.	.	.	.	.	.	.	.	.	.	A	5.442	0.266748	0.10294	.	.	ENSG00000167981	ENST00000301744	T	0.06849	3.25	4.91	2.52	0.30459	.	0.000000	0.36101	N	0.002790	T	0.05593	0.0147	L	0.41236	1.265	0.09310	N	1	P	0.47350	0.894	B	0.39935	0.314	T	0.31251	-0.9950	10	0.22706	T	0.39	-1.0026	3.965	0.09428	0.7202:0.0:0.0973:0.1825	.	136	Q96LX8	ZN597_HUMAN	I	136	ENSP00000301744:L136I	ENSP00000301744:L136I	L	-	1	2	ZNF597	3427294	0.067000	0.21026	0.811000	0.32455	0.229000	0.25112	0.918000	0.28678	0.994000	0.38892	0.533000	0.62120	TTA	.		0.403	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251511.2	NM_152457	
ZNF646	9726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31092685	31092685	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr16:31092685C>T	ENST00000394979.2	+	1	5463	c.5040C>T	c.(5038-5040)acC>acT	p.T1680T	ZNF646_ENST00000300850.5_Silent_p.T1680T			O15015	ZN646_HUMAN	zinc finger protein 646	1680					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						TCCGCTGCACCCAGTGCGGGC	0.652																																					p.T1680T		.											.	ZNF646-153	0			c.C5040T						.						68.0	80.0	76.0					16																	31092685		2197	4300	6497	SO:0001819	synonymous_variant	9726	exon2			CTGCACCCAGTGC	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.5040C>T	16.37:g.31092685C>T		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	112	19	NM_014699	0	0	8	12	4	Q8IVD8	Silent	SNP	ENST00000394979.2	37																																																																																				.		0.652	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699	
PRSS36	146547	broad.mit.edu	37	16	31154780	31154780	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr16:31154780G>T	ENST00000268281.4	-	8	1041	c.983C>A	c.(982-984)gCc>gAc	p.A328D	PRSS36_ENST00000418068.2_Missense_Mutation_p.A328D|PRSS36_ENST00000569305.1_Missense_Mutation_p.A328D	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	328	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						TGGCCGCGGGGCCTTCCCGCA	0.667																																					p.A328D													.	PRSS36-91	0			c.C983A						.						27.0	33.0	31.0					16																	31154780		2197	4300	6497	SO:0001583	missense	146547	exon8			CGCGGGGCCTTCC	AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.983C>A	16.37:g.31154780G>T	ENSP00000268281:p.Ala328Asp	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	79	8	NM_001258291	0	0	0	0	0	A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	37	CCDS32436.1	.	.	.	.	.	.	.	.	.	.	G	8.398	0.841279	0.16891	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.88509	-2.39;-2.39	4.11	3.12	0.35913	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.85318	0.5669	N	0.13327	0.33	0.09310	N	0.999997	D;D;D	0.71674	0.986;0.998;0.998	P;D;D	0.69824	0.823;0.966;0.966	T	0.73145	-0.4075	9	0.02654	T	1	.	9.4339	0.38626	0.0:0.2171:0.7829:0.0	.	328;328;328	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	D	328	ENSP00000268281:A328D;ENSP00000407160:A328D	ENSP00000268281:A328D	A	-	2	0	PRSS36	31062281	0.181000	0.23161	0.573000	0.28510	0.893000	0.52053	1.534000	0.36051	0.901000	0.36495	0.491000	0.48974	GCC	.		0.667	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	NM_173502	
ITGAM	3684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31335987	31335987	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr16:31335987C>A	ENST00000287497.8	+	18	2248	c.2173C>A	c.(2173-2175)Cca>Aca	p.P725T	ITGAM_ENST00000544665.3_Missense_Mutation_p.P726T			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	725					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CATCGAGGACCCAGTGAGCCC	0.602																																					p.P726T		.											.	ITGAM-226	0			c.C2176A						.						49.0	51.0	50.0					16																	31335987		1980	4148	6128	SO:0001583	missense	3684	exon18			GAGGACCCAGTGA	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2173C>A	16.37:g.31335987C>A	ENSP00000287497:p.Pro725Thr	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	140	17	NM_001145808	0	0	5	5	0	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	C	5.122	0.208084	0.09704	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.42513	0.97;0.97	4.64	-0.352	0.12598	Integrin alpha-2 (1);	.	.	.	.	T	0.16599	0.0399	N	0.11427	0.14	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12156	0.007;0.004;0.004	T	0.28586	-1.0039	9	0.07030	T	0.85	.	3.2574	0.06836	0.4401:0.1772:0.0:0.3826	.	131;725;725	B3KXM6;Q4VAK1;P11215	.;.;ITAM_HUMAN	T	726;725	ENSP00000441691:P726T;ENSP00000287497:P725T	ENSP00000287497:P725T	P	+	1	0	ITGAM	31243488	0.534000	0.26362	0.001000	0.08648	0.001000	0.01503	0.014000	0.13333	-0.004000	0.14419	-1.364000	0.01208	CCA	.		0.602	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
CLEC18A	348174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	69988283	69988283	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr16:69988283T>C	ENST00000288040.6	+	3	450	c.263T>C	c.(262-264)cTc>cCc	p.L88P	CLEC18A_ENST00000393701.2_Missense_Mutation_p.L88P|CLEC18A_ENST00000568461.1_Missense_Mutation_p.L88P|CLEC18A_ENST00000449317.2_Missense_Mutation_p.L88P	NM_001136214.2	NP_001129686.1	A5D8T8	CL18A_HUMAN	C-type lectin domain family 18, member A	88	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|lung(1)|skin(1)	5						AGGGCAGCCCTCTGTGGAACC	0.662																																					p.L88P		.											.	CLEC18A-68	0			c.T263C						.						54.0	49.0	51.0					16																	69988283		2198	4300	6498	SO:0001583	missense	348174	exon4			CAGCCCTCTGTGG	AF428259	CCDS10886.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157322		"""C-type lectin domain containing"""	30388	protein-coding gene	gene with protein product	"""mannose receptor-like"""					12975309	Standard	NM_001136214		Approved	MRCL	uc010vlo.3	A5D8T8		ENST00000288040.6:c.263T>C	16.37:g.69988283T>C	ENSP00000288040:p.Leu88Pro	Somatic	309	1		WXS	Illumina HiSeq	Phase_I	396	181	NM_001271197	0	0	0	3	3	A8K1G9|Q6DCB3|Q7Z5K9|Q96HH2	Missense_Mutation	SNP	ENST00000288040.6	37	CCDS10886.1	.	.	.	.	.	.	.	.	.	.	.	9.120	1.008658	0.19199	.	.	ENSG00000157322	ENST00000393701;ENST00000539957;ENST00000449317;ENST00000288040	T;T;T	0.07908	3.15;3.15;3.15	1.97	1.97	0.26223	CAP domain (3);	0.922111	0.09270	N	0.825284	T	0.07999	0.0200	L	0.47190	1.495	0.52501	D	0.999956	B;B;B	0.19331	0.035;0.004;0.003	B;B;B	0.17098	0.017;0.007;0.006	T	0.17137	-1.0379	9	.	.	.	.	5.9927	0.19476	0.0:0.0:0.0:1.0	.	88;88;88	B4DPF2;A5D8T8;F8W692	.;CL18A_HUMAN;.	P	88	ENSP00000377304:L88P;ENSP00000413990:L88P;ENSP00000288040:L88P	.	L	+	2	0	CLEC18A	68545784	0.004000	0.15560	0.898000	0.35279	0.442000	0.32017	0.109000	0.15417	1.168000	0.42723	0.155000	0.16302	CTC	.		0.662	CLEC18A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268955.2	NM_182619	
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72984405	72984405	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr16:72984405A>C	ENST00000268489.5	-	3	3851	c.3179T>G	c.(3178-3180)gTc>gGc	p.V1060G	ZFHX3_ENST00000397992.5_Missense_Mutation_p.V146G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1060					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCTGGAGTTGACCGTGTGCAG	0.602																																					p.V1060G		.											.	ZFHX3-72	0			c.T3179G						.						70.0	59.0	63.0					16																	72984405		2198	4300	6498	SO:0001583	missense	463	exon3			GAGTTGACCGTGT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.3179T>G	16.37:g.72984405A>C	ENSP00000268489:p.Val1060Gly	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	72	37	NM_006885	0	0	0	2	2	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	A	15.80	2.939889	0.52972	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.49432	0.78;0.78	5.31	4.22	0.49857	Zinc finger, C2H2-like (1);	0.148255	0.30464	N	0.009580	T	0.42449	0.1203	N	0.19112	0.55	0.80722	D	1	P	0.48640	0.913	P	0.51918	0.684	T	0.25606	-1.0127	10	0.41790	T	0.15	.	11.0251	0.47741	0.927:0.0:0.073:0.0	.	1060	Q15911	ZFHX3_HUMAN	G	1060;146	ENSP00000268489:V1060G;ENSP00000438926:V146G	ENSP00000268489:V1060G	V	-	2	0	ZFHX3	71541906	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	5.860000	0.69546	0.859000	0.35456	0.528000	0.53228	GTC	.		0.602	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
JPH3	57338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	87678517	87678517	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr16:87678517G>A	ENST00000284262.2	+	2	1278	c.1036G>A	c.(1036-1038)Ggc>Agc	p.G346S		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	346					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		CCTCGTCGGCGGCAAGCGCAA	0.677																																					p.G346S		.											.	JPH3-92	0			c.G1036A						.						45.0	54.0	51.0					16																	87678517		2197	4300	6497	SO:0001583	missense	57338	exon2			GTCGGCGGCAAGC	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.1036G>A	16.37:g.87678517G>A	ENSP00000284262:p.Gly346Ser	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	71	29	NM_020655	0	0	0	0	0	D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Missense_Mutation	SNP	ENST00000284262.2	37	CCDS10962.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531280	0.85706	.	.	ENSG00000154118	ENST00000537256;ENST00000284262	T	0.45668	0.89	4.56	4.56	0.56223	.	0.050973	0.85682	D	0.000000	T	0.37919	0.1021	L	0.46157	1.445	0.80722	D	1	P	0.42941	0.794	B	0.38562	0.276	T	0.29088	-1.0023	10	0.37606	T	0.19	.	16.3368	0.83067	0.0:0.0:1.0:0.0	.	346	Q8WXH2	JPH3_HUMAN	S	209;346	ENSP00000284262:G346S	ENSP00000284262:G346S	G	+	1	0	JPH3	86236018	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	9.580000	0.98207	2.098000	0.63641	0.561000	0.74099	GGC	.		0.677	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2		
KIF18B	146909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	43009571	43009571	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr17:43009571C>T	ENST00000593135.1	-	10	1339	c.1242G>A	c.(1240-1242)caG>caA	p.Q414Q	KIF18B_ENST00000590129.1_Silent_p.Q435Q|KIF18B_ENST00000587309.1_Silent_p.Q426Q|KIF18B_ENST00000339151.4_Silent_p.Q426Q|KIF18B_ENST00000438933.2_Silent_p.Q426Q	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	435	Pro-rich.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				GGGTGCAGGGCTGGCTGGGAG	0.657																																					p.Q426Q		.											.	KIF18B-70	0			c.G1278A						.						18.0	21.0	20.0					17																	43009571		1898	4102	6000	SO:0001819	synonymous_variant	146909	exon10			GCAGGGCTGGCTG		CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.1242G>A	17.37:g.43009571C>T		Somatic	33	0		WXS	Illumina HiSeq	Phase_I	51	8	NM_001264573	0	0	0	0	0	A6NJI2|B7ZM49|B9EGM8|D5L6I1	Silent	SNP	ENST00000593135.1	37	CCDS45709.2																																																																																			.		0.657	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000448724.1	NM_001080443	
TLK2	11011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	60663585	60663585	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr17:60663585C>A	ENST00000326270.9	+	17	1792	c.1524C>A	c.(1522-1524)caC>caA	p.H508Q	TLK2_ENST00000582809.1_Missense_Mutation_p.H337Q|TLK2_ENST00000343388.7_Missense_Mutation_p.H454Q|TLK2_ENST00000346027.5_Missense_Mutation_p.H486Q|TLK2_ENST00000542523.1_Missense_Mutation_p.H454Q	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	508	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						AGAATTACCACAAGTAAGTGA	0.328																																					p.H486Q		.											.	TLK2-464	0			c.C1458A						.						33.0	34.0	33.0					17																	60663585		2202	4297	6499	SO:0001583	missense	11011	exon16			TTACCACAAGTAA	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.1524C>A	17.37:g.60663585C>A	ENSP00000316512:p.His508Gln	Somatic	737	1		WXS	Illumina HiSeq	Phase_I	639	311	NM_006852	0	0	0	0	0	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37		.	.	.	.	.	.	.	.	.	.	C	8.052	0.766147	0.15983	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.45	3.48	0.39840	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62841	0.2461	N	0.26042	0.785	0.80722	D	1	D;B;B;B	0.69078	0.997;0.005;0.028;0.157	D;B;B;B	0.66351	0.943;0.037;0.064;0.166	T	0.62044	-0.6937	10	0.54805	T	0.06	-0.8054	8.4022	0.32592	0.0:0.7596:0.0:0.2404	.	508;454;486;486	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	Q	486;454;508;454	ENSP00000275780:H486Q;ENSP00000340800:H454Q;ENSP00000316512:H508Q;ENSP00000442311:H454Q	ENSP00000316512:H508Q	H	+	3	2	TLK2	58017317	1.000000	0.71417	1.000000	0.80357	0.119000	0.20118	5.818000	0.69236	0.688000	0.31529	-0.251000	0.11542	CAC	.		0.328	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
LPIN2	9663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	2939488	2939488	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr18:2939488T>C	ENST00000261596.4	-	6	1050	c.812A>G	c.(811-813)gAg>gGg	p.E271G		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	271					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CTTGGTGGACTCTGGGAATCC	0.493																																					p.E271G		.											.	LPIN2-227	0			c.A812G						.						125.0	117.0	120.0					18																	2939488		2203	4300	6503	SO:0001583	missense	9663	exon6			GTGGACTCTGGGA	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.812A>G	18.37:g.2939488T>C	ENSP00000261596:p.Glu271Gly	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	42	16	NM_014646	0	0	0	0	0	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	37	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.103696	0.76983	.	.	ENSG00000101577	ENST00000261596	T	0.81247	-1.47	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.87337	0.6152	M	0.70595	2.14	0.80722	D	1	D	0.62365	0.991	P	0.60012	0.867	D	0.86664	0.1906	10	0.38643	T	0.18	-35.667	16.2194	0.82247	0.0:0.0:0.0:1.0	.	271	Q92539	LPIN2_HUMAN	G	271	ENSP00000261596:E271G	ENSP00000261596:E271G	E	-	2	0	LPIN2	2929488	1.000000	0.71417	1.000000	0.80357	0.537000	0.34900	7.649000	0.83500	2.234000	0.73211	0.528000	0.53228	GAG	.		0.493	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
CCDC178	374864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	30992013	30992013	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr18:30992013C>T	ENST00000383096.3	-	3	222	c.40G>A	c.(40-42)Gat>Aat	p.D14N	CCDC178_ENST00000406524.2_Missense_Mutation_p.D14N|CCDC178_ENST00000403303.1_Missense_Mutation_p.D14N|CCDC178_ENST00000579916.1_Missense_Mutation_p.D14N|CCDC178_ENST00000402325.1_Missense_Mutation_p.D14N|CCDC178_ENST00000300227.8_Missense_Mutation_p.D14N|CCDC178_ENST00000579947.1_Missense_Mutation_p.D14N|CCDC178_ENST00000583930.1_Missense_Mutation_p.D14N			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	14																	GTTTGATCATCTCTAGTGGAA	0.274																																					p.D14N		.											.	.	0			c.G40A						.						43.0	45.0	44.0					18																	30992013		2201	4293	6494	SO:0001583	missense	374864	exon2			GATCATCTCTAGT	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.40G>A	18.37:g.30992013C>T	ENSP00000372576:p.Asp14Asn	Somatic	552	1		WXS	Illumina HiSeq	Phase_I	432	150	NM_001105528	0	0	0	0	0	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	C	4.876	0.162801	0.09287	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.49432	2.37;2.37;2.37;2.35;2.36;0.78	3.45	1.65	0.23941	.	.	.	.	.	T	0.30262	0.0759	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.25609	0.13;0.13;0.13;0.13;0.13	B;B;B;B;B	0.24269	0.052;0.032;0.052;0.052;0.052	T	0.20605	-1.0270	9	0.48119	T	0.1	0.1645	5.6192	0.17448	0.0:0.7486:0.0:0.2514	.	14;14;14;14;14	F8W7A7;A1L4G8;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;.;CR034_HUMAN	N	14	ENSP00000385591:D14N;ENSP00000372576:D14N;ENSP00000300227:D14N;ENSP00000385867:D14N;ENSP00000385234:D14N;ENSP00000382130:D14N	ENSP00000300227:D14N	D	-	1	0	C18orf34	29246011	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.323000	0.07997	0.464000	0.27142	0.655000	0.94253	GAT	.		0.274	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
PTPRS	5802	bcgsc.ca	37	19	5214700	5214700	+	Silent	SNP	G	G	T	rs373940938		TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr19:5214700G>T	ENST00000587303.1	-	28	4465	c.4366C>A	c.(4366-4368)Cgg>Agg	p.R1456R	PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000372412.4_Silent_p.R1457R|PTPRS_ENST00000357368.4_Silent_p.R1456R|PTPRS_ENST00000262963.6_Silent_p.R1436R|PTPRS_ENST00000353284.2_Silent_p.R1009R|PTPRS_ENST00000348075.2_Silent_p.R1418R|PTPRS_ENST00000588012.1_Silent_p.R1418R|PTPRS_ENST00000592099.1_Silent_p.R1009R			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1456	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TTCTGACACCGGTAGCCGTCC	0.607																																					p.R1456R													.	PTPRS-357	0			c.C4366A						.						55.0	42.0	46.0					19																	5214700		2203	4300	6503	SO:0001819	synonymous_variant	5802	exon29			GACACCGGTAGCC	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4366C>A	19.37:g.5214700G>T		Somatic	56	0		WXS	Illumina HiSeq	Phase_1	59	4	NM_002850	0	0	0	0	0	O75255|O75870|Q15718|Q16341|Q2M3R7	Silent	SNP	ENST00000587303.1	37	CCDS45930.1																																																																																			.		0.607	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
FBN3	84467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	8183905	8183905	+	Splice_Site	SNP	G	G	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr19:8183905G>A	ENST00000600128.1	-	26	3627	c.3213C>T	c.(3211-3213)gaC>gaT	p.D1071D	FBN3_ENST00000601739.1_Splice_Site_p.D1071D|FBN3_ENST00000270509.2_Splice_Site_p.D1071D			Q75N90	FBN3_HUMAN	fibrillin 3	1071	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ACTCGTCCACGTCTGAAGGTT	0.617																																					p.D1071D		.											.	FBN3-100	0			c.C3213T						.						66.0	52.0	57.0					19																	8183905		2203	4300	6503	SO:0001630	splice_region_variant	84467	exon25			GTCCACGTCTGAA		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.3212-1C>T	19.37:g.8183905G>A		Somatic	32	0		WXS	Illumina HiSeq	Phase_I	28	12	NM_032447	0	0	0	0	0	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	37	CCDS12196.1																																																																																			.		0.617	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	Silent
PRDX2	7001	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	12911694	12911694	+	Intron	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr19:12911694T>C	ENST00000301522.2	-	3	386				CTD-2659N19.10_ENST00000585496.1_RNA|PRDX2_ENST00000435703.1_Missense_Mutation_p.K98R|PRDX2_ENST00000334482.5_Intron	NM_005809.4	NP_005800.3	P32119	PRDX2_HUMAN	peroxiredoxin 2						cellular response to oxidative stress (GO:0034599)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of apoptotic process (GO:0042981)|removal of superoxide radicals (GO:0019430)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						gggtgtgagcttagctgcaac	0.572																																					p.K98R		.											.	PRDX2-90	0			c.A293G						.						48.0	45.0	46.0					19																	12911694		2197	4296	6493	SO:0001627	intron_variant	7001	exon3			GTGAGCTTAGCTG		CCDS12281.1	19p13.2	2008-07-17			ENSG00000167815	ENSG00000167815			9353	protein-coding gene	gene with protein product	"""thioredoxin-dependent peroxide reductase 1"", ""thiol-specific antioxidant 1"", ""natural killer-enhancing factor B"", ""thioredoxin peroxidase 1"", ""torin"""	600538		TDPX1		7607688	Standard	NM_005809		Approved	PRP, NKEFB, TSA, PRXII, PRX2, MGC4104	uc002mvd.4	P32119	OTTHUMG00000134285	ENST00000301522.2:c.257+35A>G	19.37:g.12911694T>C		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	76	22	NM_181738	0	0	0	0	0	A8K0C0|P31945|P32118|P35701|Q6FHG4|Q92763|Q9UC23	Missense_Mutation	SNP	ENST00000301522.2	37	CCDS12281.1	.	.	.	.	.	.	.	.	.	.	T	11.47	1.649424	0.29336	.	.	ENSG00000167815	ENST00000435703	T	0.45668	0.89	3.3	-6.61	0.01818	.	.	.	.	.	T	0.25344	0.0616	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.30001	-0.9993	8	0.87932	D	0	.	5.1763	0.15137	0.0:0.3936:0.2769:0.3294	.	98	A8K0C0	.	R	98	ENSP00000408905:K98R	ENSP00000408905:K98R	K	-	2	0	PRDX2	12772694	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.583000	0.05807	-1.609000	0.01585	0.379000	0.24179	AAG	.		0.572	PRDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258950.2	NM_005809	
LSM14A	26065	broad.mit.edu	37	19	34710315	34710315	+	Silent	SNP	T	T	G	rs201741862		TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr19:34710315T>G	ENST00000433627.5	+	7	876	c.801T>G	c.(799-801)gcT>gcG	p.A267A	LSM14A_ENST00000544216.3_Silent_p.A267A|LSM14A_ENST00000540746.2_Silent_p.A226A	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	267					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.A267A(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					CTCCTTCAGCTCCAAGGAGAG	0.438																																					p.A267A													.	LSM14A-91	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)	c.T801G						.						64.0	74.0	71.0					19																	34710315		2203	4300	6503	SO:0001819	synonymous_variant	26065	exon7			TTCAGCTCCAAGG	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.801T>G	19.37:g.34710315T>G		Somatic	147	0		WXS	Illumina HiSeq	Phase_I	112	4	NM_001114093	0	0	20	20	0	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Silent	SNP	ENST00000433627.5	37	CCDS46040.1																																																																																			T|0.999;G|0.001		0.438	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
CLIP3	25999	broad.mit.edu	37	19	36523200	36523200	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr19:36523200C>T	ENST00000360535.4	-	2	287	c.60G>A	c.(58-60)gaG>gaA	p.E20E	AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Silent_p.E20E	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	20	Poly-Glu.				chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)			cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			cctcctcctcctcttcttcct	0.701																																					p.E20E													.	CLIP3-94	0			c.G60A						.						4.0	5.0	5.0					19																	36523200		2084	4112	6196	SO:0001819	synonymous_variant	25999	exon1			CTCCTCCTCTTCT	AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.60G>A	19.37:g.36523200C>T		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	101	3	NM_001199570	0	0	1	1	0	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Silent	SNP	ENST00000360535.4	37	CCDS12486.1																																																																																			.		0.701	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457426.1	NM_015526	
ZNF576	79177	broad.mit.edu	37	19	44103092	44103092	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr19:44103092G>T	ENST00000336564.4	+	3	349	c.195G>T	c.(193-195)aaG>aaT	p.K65N	ZNF576_ENST00000529930.1_Missense_Mutation_p.K65N|ZNF576_ENST00000391965.2_Missense_Mutation_p.K65N|ZNF576_ENST00000528387.1_Missense_Mutation_p.K65N|ZNF576_ENST00000533118.1_Missense_Mutation_p.K65N|IRGQ_ENST00000422989.1_5'Flank|SRRM5_ENST00000607544.1_Intron|SRRM5_ENST00000526798.1_Intron|ZNF576_ENST00000525771.1_Missense_Mutation_p.K65N	NM_001145347.1	NP_001138819.1	Q9H609	ZN576_HUMAN	zinc finger protein 576	65					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(1)|prostate(1)	2		Prostate(69;0.0199)				TGGCCCAGAAGCTGCAGGGGG	0.647																																					p.K65N													.	ZNF576-90	0			c.G195T						.						87.0	102.0	97.0					19																	44103092		2203	4300	6503	SO:0001583	missense	79177	exon3			CCAGAAGCTGCAG	AK026353	CCDS12625.1	19q13.31	2013-09-20			ENSG00000124444	ENSG00000124444		"""Zinc fingers, C2H2-type"""	28357	protein-coding gene	gene with protein product						12477932	Standard	NM_024327		Approved	MGC2508	uc002owz.2	Q9H609	OTTHUMG00000165479	ENST00000336564.4:c.195G>T	19.37:g.44103092G>T	ENSP00000337852:p.Lys65Asn	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	68	4	NM_001145347	0	0	10	10	0	Q9BU03	Missense_Mutation	SNP	ENST00000336564.4	37	CCDS12625.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.374618	0.61735	.	.	ENSG00000124444	ENST00000391965;ENST00000525771;ENST00000533118;ENST00000528387;ENST00000529930;ENST00000336564	T;T;T;T;T;T	0.01359	4.98;4.98;4.98;4.98;4.98;4.98	3.93	2.89	0.33648	.	0.204121	0.35772	N	0.002997	T	0.00906	0.0030	N	0.08118	0	0.80722	D	1	B	0.34290	0.447	B	0.32393	0.145	T	0.69308	-0.5179	10	0.59425	D	0.04	-16.2701	7.5611	0.27851	0.115:0.0:0.885:0.0	.	65	Q9H609	ZN576_HUMAN	N	65	ENSP00000375827:K65N;ENSP00000436182:K65N;ENSP00000435899:K65N;ENSP00000435934:K65N;ENSP00000435463:K65N;ENSP00000337852:K65N	ENSP00000337852:K65N	K	+	3	2	ZNF576	48794932	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.823000	0.27366	1.260000	0.44134	0.591000	0.81541	AAG	.		0.647	ZNF576-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384397.1	NM_024327	
PVR	5817	broad.mit.edu;bcgsc.ca	37	19	45162149	45162149	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr19:45162149C>T	ENST00000425690.3	+	6	1430	c.1131C>T	c.(1129-1131)caC>caT	p.H377H	PVR_ENST00000403059.4_Intron|PVR_ENST00000406449.4_Silent_p.H377H|CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000344956.4_Intron	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	377					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|receptor activity (GO:0004872)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		TCCTTTGGCACTGTCATCTGT	0.512																																					p.H377H													.	PVR-90	0			c.C1131T						.						150.0	139.0	143.0					19																	45162149		2203	4300	6503	SO:0001819	synonymous_variant	5817	exon6			TTGGCACTGTCAT	BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS		2170108	Standard	XM_005259120		Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.1131C>T	19.37:g.45162149C>T		Somatic	77	0		WXS	Illumina HiSeq	Phase_I	79	6	NM_006505	0	0	28	30	2	B4DTS9|P15152|Q15267|Q15268|Q96BJ1	Silent	SNP	ENST00000425690.3	37	CCDS12640.1																																																																																			.		0.512	PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323017.2	NM_006505	
FBXO46	23403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	46215777	46215777	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr19:46215777A>G	ENST00000317683.3	-	2	1110	c.977T>C	c.(976-978)cTg>cCg	p.L326P		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	326										breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		CCTGGCCAGCAGGAACTCCAC	0.697																																					p.L326P		.											.	FBXO46-159	0			c.T977C						.						24.0	27.0	26.0					19																	46215777		1982	4149	6131	SO:0001583	missense	23403	exon2			GCCAGCAGGAACT	BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.977T>C	19.37:g.46215777A>G	ENSP00000410007:p.Leu326Pro	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	96	27	NM_001080469	0	0	6	8	2		Missense_Mutation	SNP	ENST00000317683.3	37	CCDS46116.1	.	.	.	.	.	.	.	.	.	.	A	14.80	2.643535	0.47258	.	.	ENSG00000177051	ENST00000317683	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	T	0.52789	0.1756	N	0.14661	0.345	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.51204	-0.8735	8	0.30078	T	0.28	-6.761	11.5914	0.50947	1.0:0.0:0.0:0.0	.	326	Q6PJ61	FBX46_HUMAN	P	326	.	ENSP00000410007:L326P	L	-	2	0	FBXO46	50907617	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	5.008000	0.63991	1.851000	0.53745	0.460000	0.39030	CTG	.		0.697	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459661.1	XM_371179	
ARID5A	10865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	97215160	97215160	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr2:97215160C>A	ENST00000357485.3	+	3	301	c.223C>A	c.(223-225)Ccc>Acc	p.P75T	ARID5A_ENST00000454558.2_Missense_Mutation_p.P7T	NM_212481.1	NP_997646.1	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A (MRF1-like)	75	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(2)	14						GCGACACACGCCCATCGAGAG	0.697																																					p.P75T		.											.	ARID5A-226	0			c.C223A						.						97.0	90.0	92.0					2																	97215160		2203	4300	6503	SO:0001583	missense	10865	exon3			CACACGCCCATCG	M62324	CCDS33251.1	2p11.1	2013-02-07			ENSG00000196843	ENSG00000196843		"""-"""	17361	protein-coding gene	gene with protein product	"""modulator recognition factor 1"""	611583				8649988	Standard	NM_212481		Approved	MRF-1, RP11-363D14	uc002swe.3	Q03989	OTTHUMG00000155229	ENST00000357485.3:c.223C>A	2.37:g.97215160C>A	ENSP00000350078:p.Pro75Thr	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	127	72	NM_212481	0	0	4	5	1	Q6NX37	Missense_Mutation	SNP	ENST00000357485.3	37	CCDS33251.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586158	0.86851	.	.	ENSG00000196843	ENST00000357485;ENST00000359765;ENST00000454558	T;T	0.64085	-0.08;-0.08	5.07	5.07	0.68467	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.64402	D	0.000002	T	0.77274	0.4106	M	0.75777	2.31	0.51233	D	0.999918	D	0.58970	0.984	D	0.69307	0.963	T	0.79401	-0.1819	10	0.72032	D	0.01	-21.3112	13.8159	0.63292	0.0:1.0:0.0:0.0	.	75	Q03989	ARI5A_HUMAN	T	75;75;7	ENSP00000350078:P75T;ENSP00000400785:P7T	ENSP00000350078:P75T	P	+	1	0	ARID5A	96578887	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.160000	0.58164	2.653000	0.90120	0.561000	0.74099	CCC	.		0.697	ARID5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338888.2	NM_212481	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179431535	179431535	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr2:179431535T>C	ENST00000591111.1	-	276	74625	c.74401A>G	c.(74401-74403)Aca>Gca	p.T24801A	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T17569A|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T17502A|TTN_ENST00000460472.2_Missense_Mutation_p.T17377A|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T26442A|TTN_ENST00000342992.6_Missense_Mutation_p.T23874A			Q8WZ42	TITIN_HUMAN	titin	24801	Fibronectin type-III 80. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGCAAATCTGTAATGCGGCGT	0.428																																					p.T26442A		.											.	TTN-636	0			c.A79324G						.						71.0	70.0	70.0					2																	179431535		1854	4108	5962	SO:0001583	missense	7273	exon326			AATCTGTAATGCG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.74401A>G	2.37:g.179431535T>C	ENSP00000465570:p.Thr24801Ala	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	60	42	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	12.10	1.835271	0.32421	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.75	4.57	0.56435	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56543	0.1992	L	0.41415	1.275	0.58432	D	0.999992	D;D;D;D	0.56746	0.977;0.977;0.977;0.958	P;P;P;P	0.49192	0.602;0.602;0.602;0.506	T	0.60073	-0.7334	9	0.87932	D	0	.	13.2067	0.59800	0.0:0.0:0.1326:0.8674	.	17377;17502;17569;24801	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	23874;17377;17569;17502;17375	ENSP00000343764:T23874A;ENSP00000434586:T17377A;ENSP00000340554:T17569A;ENSP00000352154:T17502A	ENSP00000340554:T17569A	T	-	1	0	TTN	179139781	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	0.965000	0.38133	0.459000	0.35465	ACA	.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DEFB118	117285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	29960794	29960794	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr20:29960794G>T	ENST00000253381.2	+	2	226	c.193G>T	c.(193-195)Gtt>Ttt	p.V65F		NM_054112.2	NP_473453.1	Q96PH6	DB118_HUMAN	defensin, beta 118	65					cell-matrix adhesion (GO:0007160)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(1)|lung(7)|ovary(3)|pancreas(1)|prostate(1)	14	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			CCACAGGCGAGTTCCTGCGAC	0.443																																					p.V65F		.											.	DEFB118-94	0			c.G193T						.						155.0	137.0	143.0					20																	29960794		2203	4300	6503	SO:0001583	missense	117285	exon2			AGGCGAGTTCCTG	AF347073	CCDS13177.1	20q11.21	2008-02-01	2002-05-09	2002-05-10	ENSG00000131068	ENSG00000131068		"""Defensins, beta"""	16196	protein-coding gene	gene with protein product		607650	"""chromosome 20 open reading frame 63"""	C20orf63		11564719, 15033915	Standard	NM_054112		Approved	dJ1018D12.3, DEFB-18, ESC42	uc002wvr.3	Q96PH6	OTTHUMG00000032161	ENST00000253381.2:c.193G>T	20.37:g.29960794G>T	ENSP00000253381:p.Val65Phe	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	109	30	NM_054112	0	0	0	0	0	Q17RC4|Q8N691|Q9NUH0	Missense_Mutation	SNP	ENST00000253381.2	37	CCDS13177.1	.	.	.	.	.	.	.	.	.	.	G	2.822	-0.244584	0.05906	.	.	ENSG00000131068	ENST00000253381	T	0.07908	3.15	3.19	-6.39	0.01951	.	7.214320	0.00397	N	0.000047	T	0.04588	0.0125	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.35201	-0.9798	10	0.15066	T	0.55	-0.7743	3.7626	0.08610	0.1823:0.2329:0.4708:0.114	.	65	Q96PH6	DB118_HUMAN	F	65	ENSP00000253381:V65F	ENSP00000253381:V65F	V	+	1	0	DEFB118	29424455	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.760000	0.00786	-2.810000	0.00348	-2.435000	0.00213	GTT	.		0.443	DEFB118-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078501.2	NM_054112	
TPX2	22974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	30388879	30388879	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr20:30388879G>T	ENST00000300403.6	+	18	2768	c.2240G>T	c.(2239-2241)tGc>tTc	p.C747F	TPX2_ENST00000340513.4_Missense_Mutation_p.C783F	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	747					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			CGATTCCACTGCTAAACTCAG	0.512																																					p.C747F		.											.	TPX2-290	0			c.G2240T						.						123.0	105.0	111.0					20																	30388879		2203	4300	6503	SO:0001583	missense	22974	exon18			TCCACTGCTAAAC	AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.2240G>T	20.37:g.30388879G>T	ENSP00000300403:p.Cys747Phe	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	67	23	NM_012112	0	0	0	1	1	Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Missense_Mutation	SNP	ENST00000300403.6	37	CCDS13190.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492479	0.64074	.	.	ENSG00000088325	ENST00000300403;ENST00000340513	T	0.37058	1.22	5.28	5.28	0.74379	.	0.110708	0.64402	D	0.000005	T	0.59169	0.2174	M	0.63428	1.95	0.43021	D	0.994579	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.61307	-0.7089	10	0.87932	D	0	.	18.0758	0.89426	0.0:0.0:1.0:0.0	.	783;747	Q96RR5;Q9ULW0	.;TPX2_HUMAN	F	747;783	ENSP00000341145:C783F	ENSP00000300403:C747F	C	+	2	0	TPX2	29852540	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	3.773000	0.55333	2.745000	0.94114	0.655000	0.94253	TGC	.		0.512	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078569.2		
SUSD2	56241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24579518	24579518	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr22:24579518T>A	ENST00000358321.3	+	3	604	c.343T>A	c.(343-345)Tgt>Agt	p.C115S		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	115					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						GCAAGTGCACTGTGTGTCACC	0.632																																					p.C115S		.											.	SUSD2-91	0			c.T343A						.						130.0	114.0	119.0					22																	24579518		2203	4300	6503	SO:0001583	missense	56241	exon3			GTGCACTGTGTGT	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.343T>A	22.37:g.24579518T>A	ENSP00000351075:p.Cys115Ser	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	46	19	NM_019601	0	0	0	0	0	Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	37	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185964	0.78789	.	.	ENSG00000099994	ENST00000358321	D	0.84873	-1.91	3.5	3.5	0.40072	.	0.000000	0.85682	D	0.000000	D	0.90511	0.7027	M	0.78637	2.42	0.50467	D	0.999877	D	0.71674	0.998	D	0.78314	0.991	D	0.90662	0.4591	10	0.87932	D	0	-25.3814	8.8392	0.35131	0.0:0.0:0.0:1.0	.	115	Q9UGT4	SUSD2_HUMAN	S	115	ENSP00000351075:C115S	ENSP00000351075:C115S	C	+	1	0	SUSD2	22909518	1.000000	0.71417	0.993000	0.49108	0.923000	0.55619	6.119000	0.71590	1.859000	0.53934	0.369000	0.22263	TGT	.		0.632	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
PIM3	415116	broad.mit.edu	37	22	50355280	50355280	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr22:50355280T>C	ENST00000360612.4	+	4	872	c.437T>C	c.(436-438)cTg>cCg	p.L146P		NM_001001852.3	NP_001001852.2	Q86V86	PIM3_HUMAN	Pim-3 proto-oncogene, serine/threonine kinase	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|histone phosphorylation (GO:0016572)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)						all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)		GACGAGCCGCTGGCGCGCCGC	0.692																																					p.L146P													.	PIM3-521	0			c.T437C						.						7.0	7.0	7.0					22																	50355280		2114	4127	6241	SO:0001583	missense	415116	exon4			AGCCGCTGGCGCG	BC052239	CCDS33678.1	22q13	2014-06-25	2014-06-25		ENSG00000198355	ENSG00000198355			19310	protein-coding gene	gene with protein product		610580	"""pim-3 oncogene"""			12477932	Standard	NM_001001852		Approved		uc003bjb.3	Q86V86	OTTHUMG00000150290	ENST00000360612.4:c.437T>C	22.37:g.50355280T>C	ENSP00000353824:p.Leu146Pro	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	35	11	NM_001001852	0	0	2	3	1	A5D8X8|A8K7J0|B1B0P0|Q68BM2	Missense_Mutation	SNP	ENST00000360612.4	37	CCDS33678.1	.	.	.	.	.	.	.	.	.	.	t	12.38	1.920821	0.33908	.	.	ENSG00000198355	ENST00000360612	T	0.66280	-0.2	3.46	1.26	0.21427	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.211787	0.37623	N	0.002018	T	0.67477	0.2897	M	0.71036	2.16	0.47862	D	0.999536	D	0.57257	0.979	P	0.57425	0.82	T	0.64516	-0.6389	10	0.54805	T	0.06	.	5.5868	0.17279	0.0:0.5218:0.0:0.4782	.	146	Q86V86	PIM3_HUMAN	P	146	ENSP00000353824:L146P	ENSP00000353824:L146P	L	+	2	0	PIM3	48741284	0.994000	0.37717	0.009000	0.14445	0.001000	0.01503	2.493000	0.45320	0.251000	0.21505	-0.332000	0.08345	CTG	.		0.692	PIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317406.1	NM_001001852	
PPARG	5468	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	12447397	12447397	+	Silent	SNP	G	G	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr3:12447397G>C	ENST00000287820.6	+	5	757	c.636G>C	c.(634-636)cgG>cgC	p.R212R	PPARG_ENST00000309576.6_Silent_p.R184R|PPARG_ENST00000397015.2_Silent_p.R184R|PPARG_ENST00000539812.1_Silent_p.R182R|PPARG_ENST00000397026.2_Silent_p.R190R|PPARG_ENST00000397012.2_Silent_p.R184R|PPARG_ENST00000397010.2_Silent_p.R184R|PPARG_ENST00000397000.1_Silent_p.R184R	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	212	Interaction with FAM120B. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	GGTTTGGGCGGATGCCACAGG	0.542			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																														p.R212R		.		Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	.	PPARG-1043	0			c.G636C						.						66.0	65.0	65.0					3																	12447397		2203	4300	6503	SO:0001819	synonymous_variant	5468	exon5			TGGGCGGATGCCA	X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.636G>C	3.37:g.12447397G>C		Somatic	62	0		WXS	Illumina HiSeq	Phase_I	83	5	NM_015869	0	0	46	49	3	A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Silent	SNP	ENST00000287820.6	37	CCDS2609.1																																																																																			.		0.542	PPARG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251979.2	NM_005037	
DAG1	1605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49547996	49547996	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr3:49547996T>C	ENST00000539901.1	+	2	587	c.29T>C	c.(28-30)cTg>cCg	p.L10P	DAG1_ENST00000308775.2_Missense_Mutation_p.L10P|DAG1_ENST00000545947.1_Missense_Mutation_p.L10P|DAG1_ENST00000541308.1_Missense_Mutation_p.L10P|DAG1_ENST00000538711.1_Missense_Mutation_p.L10P|DAG1_ENST00000479935.1_3'UTR|DAG1_ENST00000515359.2_Missense_Mutation_p.L10P	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	10					basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CTCTCGCTGCTGCTGCCCCTC	0.577																																					p.L10P		.											.	DAG1-92	0			c.T29C						.						85.0	84.0	84.0					3																	49547996		2203	4300	6503	SO:0001583	missense	1605	exon3			CGCTGCTGCTGCC	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.29T>C	3.37:g.49547996T>C	ENSP00000439334:p.Leu10Pro	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	60	13	NM_001177642	0	0	0	0	0	A8K6M7|Q969J9	Missense_Mutation	SNP	ENST00000539901.1	37	CCDS2799.1	.	.	.	.	.	.	.	.	.	.	T	8.905	0.957260	0.18507	.	.	ENSG00000173402	ENST00000515359;ENST00000421560;ENST00000308775;ENST00000545947;ENST00000541308;ENST00000539901;ENST00000538711;ENST00000418588;ENST00000431960;ENST00000452317;ENST00000435508;ENST00000452060;ENST00000428779;ENST00000419218	T;T;T;T;T;T;T;T;T;T;T;T;T	0.60797	0.78;0.77;0.78;0.78;0.78;0.78;0.78;0.75;0.76;0.16;0.64;0.74;0.76	5.85	4.7	0.59300	.	0.080454	0.51477	N	0.000097	T	0.42086	0.1187	L	0.29908	0.895	0.53688	D	0.999978	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	10	0.52906	T	0.07	-6.6126	6.3137	0.21178	0.1406:0.0754:0.0:0.784	.	10	Q14118	DAG1_HUMAN	P	10	ENSP00000440705:L10P;ENSP00000412067:L10P;ENSP00000312435:L10P;ENSP00000442600:L10P;ENSP00000440590:L10P;ENSP00000439334:L10P;ENSP00000438421:L10P;ENSP00000405859:L10P;ENSP00000388833:L10P;ENSP00000387859:L10P;ENSP00000415321:L10P;ENSP00000410145:L10P;ENSP00000401382:L10P	ENSP00000312435:L10P	L	+	2	0	DAG1	49523000	0.990000	0.36364	1.000000	0.80357	0.095000	0.18619	1.145000	0.31577	1.044000	0.40200	0.455000	0.32223	CTG	.		0.577	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1		
DNAH1	25981	broad.mit.edu;bcgsc.ca	37	3	52361913	52361913	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr3:52361913G>A	ENST00000420323.2	+	6	1015	c.754G>A	c.(754-756)Gac>Aac	p.D252N		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	252	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGACAATGAGGACTTTGACTG	0.572																																					p.D252N													.	DNAH1-67	0			c.G754A						.						76.0	76.0	76.0					3																	52361913		1969	4139	6108	SO:0001583	missense	25981	exon6			AATGAGGACTTTG	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.754G>A	3.37:g.52361913G>A	ENSP00000401514:p.Asp252Asn	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	161	6	NM_015512	0	0	3	3	0	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558493	0.65538	.	.	ENSG00000114841	ENST00000420323	T	0.23552	1.9	5.55	5.55	0.83447	.	0.420477	0.19607	N	0.110248	T	0.21718	0.0523	N	0.19112	0.55	0.36079	D	0.842653	B;B	0.14805	0.011;0.01	B;B	0.25614	0.011;0.062	T	0.12451	-1.0547	10	0.38643	T	0.18	.	17.6919	0.88270	0.0:0.0:1.0:0.0	.	252;252	C9JXH6;Q9P2D7-3	.;.	N	252	ENSP00000401514:D252N	ENSP00000401514:D252N	D	+	1	0	DNAH1	52336953	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.316000	0.89985	2.620000	0.88729	0.563000	0.77884	GAC	.		0.572	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
MBNL1	4154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	152163262	152163262	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr3:152163262C>T	ENST00000463374.1	+	4	1252	c.741C>T	c.(739-741)atC>atT	p.I247I	MBNL1_ENST00000282488.7_Silent_p.I179I|MBNL1_ENST00000545754.1_Silent_p.I179I|MBNL1_ENST00000485509.1_Silent_p.I247I|MBNL1_ENST00000485910.1_Silent_p.I179I|MBNL1_ENST00000498502.1_Silent_p.I247I|MBNL1_ENST00000357472.3_Silent_p.I247I|MBNL1_ENST00000324210.5_Silent_p.I247I|MBNL1_ENST00000493459.1_Silent_p.I190I|MBNL1_ENST00000492948.1_Silent_p.I247I|MBNL1_ENST00000355460.2_Silent_p.I247I|MBNL1_ENST00000324196.5_Silent_p.I247I|MBNL1_ENST00000282486.6_Silent_p.I247I	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1	247					alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			AAGCCAAGATCAAGGCTGCCC	0.507																																					p.I247I		.											.	MBNL1-91	0			c.C741T						.						101.0	100.0	101.0					3																	152163262		2203	4300	6503	SO:0001819	synonymous_variant	4154	exon5			CAAGATCAAGGCT	Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.741C>T	3.37:g.152163262C>T		Somatic	118	0		WXS	Illumina HiSeq	Phase_I	145	37	NM_207292	0	0	3	10	7	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Silent	SNP	ENST00000463374.1	37	CCDS3165.1	.	.	.	.	.	.	.	.	.	.	C	9.846	1.192282	0.21954	.	.	ENSG00000152601	ENST00000464596	.	.	.	5.42	4.54	0.55810	.	.	.	.	.	T	0.69762	0.3147	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68727	-0.5332	4	.	.	.	-15.5766	13.8836	0.63696	0.0:0.927:0.0:0.073	.	.	.	.	L	246	.	.	S	+	2	0	MBNL1	153645952	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.700000	0.37815	1.284000	0.44531	0.655000	0.94253	TCA	.		0.507	MBNL1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353604.1	NM_021038	
USP13	8975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	179462840	179462840	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr3:179462840T>A	ENST00000263966.3	+	13	2015	c.1544T>A	c.(1543-1545)aTc>aAc	p.I515N	USP13_ENST00000482333.1_3'UTR|USP13_ENST00000496897.1_Missense_Mutation_p.I450N	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	515	USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			GATGAACTGATCGCTTATGAA	0.478																																					p.I515N		.											.	USP13-659	0			c.T1544A						.						120.0	113.0	115.0					3																	179462840		2203	4300	6503	SO:0001583	missense	8975	exon13			AACTGATCGCTTA	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1544T>A	3.37:g.179462840T>A	ENSP00000263966:p.Ile515Asn	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	158	65	NM_003940	0	0	0	0	0	A8K2S3|B4DYF3|D3DNS2|Q96B25	Missense_Mutation	SNP	ENST00000263966.3	37	CCDS3235.1	.	.	.	.	.	.	.	.	.	.	T	11.23	1.576799	0.28092	.	.	ENSG00000058056	ENST00000263966;ENST00000496897;ENST00000497155	T;T	0.13778	2.56;2.57	5.22	5.22	0.72569	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.145148	0.48286	D	0.000197	T	0.14056	0.0340	N	0.26042	0.785	0.58432	D	0.999993	P;B	0.38335	0.627;0.244	P;B	0.44422	0.449;0.281	T	0.16247	-1.0409	10	0.17832	T	0.49	-17.5512	15.1067	0.72326	0.0:0.0:0.0:1.0	.	515;515	Q92995;A8K2S3	UBP13_HUMAN;.	N	515;450;161	ENSP00000263966:I515N;ENSP00000417146:I450N	ENSP00000263966:I515N	I	+	2	0	USP13	180945534	1.000000	0.71417	0.955000	0.39395	0.938000	0.57974	6.035000	0.70940	1.966000	0.57179	0.533000	0.62120	ATC	.		0.478	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349617.1		
MUC4	4585	broad.mit.edu	37	3	195508983	195508983	+	Silent	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr3:195508983G>T	ENST00000463781.3	-	2	9927	c.9468C>A	c.(9466-9468)acC>acA	p.T3156T	MUC4_ENST00000475231.1_Silent_p.T3156T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3156T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.587																																					p.T3156T													.	MUC4-90	2	Substitution - coding silent(2)	endometrium(2)	c.C9468A						.						5.0	4.0	4.0					3																	195508983		557	1317	1874	SO:0001819	synonymous_variant	4585	exon2			AGTGTCGGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9468C>A	3.37:g.195508983G>T		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	102	3	NM_018406	1	0	1	2	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DLG1	1739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	196888577	196888577	+	Silent	SNP	A	A	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr3:196888577A>T	ENST00000419354.1	-	6	802	c.516T>A	c.(514-516)acT>acA	p.T172T	DLG1_ENST00000448528.2_Silent_p.T172T|DLG1_ENST00000357674.4_Intron|DLG1_ENST00000450955.1_Intron|DLG1_ENST00000443183.1_Intron|DLG1_ENST00000392382.2_Intron|DLG1_ENST00000314062.3_Intron|DLG1_ENST00000422288.1_Intron|DLG1_ENST00000452595.1_Intron|DLG1_ENST00000346964.2_Silent_p.T172T			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	172	Interaction with SH3 domains.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TCACAGGGACAGTGGGAGGAG	0.388																																					p.T172T		.											.	DLG1-118	0			c.T516A						.						71.0	75.0	74.0					3																	196888577		2203	4300	6503	SO:0001819	synonymous_variant	1739	exon6			AGGGACAGTGGGA	U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.516T>A	3.37:g.196888577A>T		Somatic	381	0		WXS	Illumina HiSeq	Phase_I	398	99	NM_001098424	0	0	17	20	3	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Silent	SNP	ENST00000419354.1	37	CCDS43194.1																																																																																			.		0.388	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087	
CLNK	116449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	10522421	10522421	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr4:10522421T>G	ENST00000226951.6	-	15	1005	c.766A>C	c.(766-768)Aac>Cac	p.N256H		NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	256					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						TTACCTCTGTTTTGCACACTG	0.373																																					p.N256H	GBM(87;402 1286 6949 13902 35851)	.											.	CLNK-23	0			c.A766C						.						140.0	125.0	129.0					4																	10522421		1858	4107	5965	SO:0001583	missense	116449	exon15			CTCTGTTTTGCAC	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.766A>C	4.37:g.10522421T>G	ENSP00000226951:p.Asn256His	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	104	35	NM_052964	0	0	0	0	0	Q05C27|Q9P2U9	Missense_Mutation	SNP	ENST00000226951.6	37	CCDS47024.1	.	.	.	.	.	.	.	.	.	.	T	8.569	0.879522	0.17467	.	.	ENSG00000109684	ENST00000226951;ENST00000429087	T	0.23552	1.9	3.58	2.44	0.29823	.	1.529250	0.03878	N	0.276734	T	0.19565	0.0470	N	0.24115	0.695	0.34150	D	0.667466	B	0.26876	0.162	B	0.30855	0.121	T	0.34179	-0.9839	10	0.46703	T	0.11	-4.8736	3.7403	0.08527	0.0:0.2405:0.0:0.7595	.	256	Q7Z7G1	CLNK_HUMAN	H	256;220	ENSP00000226951:N256H	ENSP00000226951:N256H	N	-	1	0	CLNK	10131519	0.030000	0.19436	0.584000	0.28653	0.521000	0.34408	0.593000	0.23999	0.761000	0.33130	0.379000	0.24179	AAC	.		0.373	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359047.1	NM_052964	
USP46	64854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	53492228	53492228	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr4:53492228T>C	ENST00000441222.3	-	4	702	c.518A>G	c.(517-519)cAg>cGg	p.Q173R	USP46_ENST00000508499.1_Missense_Mutation_p.Q166R|USP46_ENST00000451218.2_Missense_Mutation_p.Q146R	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	173	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			AAGCGTTCCCTGAAAAATCTC	0.383																																					p.Q173R		.											.	USP46-637	0			c.A518G						.						123.0	117.0	119.0					4																	53492228		1869	4137	6006	SO:0001583	missense	64854	exon4			GTTCCCTGAAAAA	AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.518A>G	4.37:g.53492228T>C	ENSP00000407818:p.Gln173Arg	Somatic	224	0		WXS	Illumina HiSeq	Phase_I	202	64	NM_022832	0	0	1	4	3	B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Missense_Mutation	SNP	ENST00000441222.3	37	CCDS47053.1	.	.	.	.	.	.	.	.	.	.	T	15.86	2.958840	0.53400	.	.	ENSG00000109189	ENST00000441222;ENST00000451218;ENST00000508499	T;T;T	0.31247	1.5;1.5;1.5	5.08	5.08	0.68730	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000018	T	0.33818	0.0876	M	0.67953	2.075	0.80722	D	1	B;B;B;B	0.18610	0.02;0.011;0.029;0.01	B;B;B;B	0.29077	0.059;0.059;0.098;0.025	T	0.13872	-1.0493	10	0.12430	T	0.62	-17.1457	14.345	0.66654	0.0:0.0:0.0:1.0	.	57;161;173;166	P62068-2;P62068-4;P62068;P62068-3	.;.;UBP46_HUMAN;.	R	173;146;166	ENSP00000407818:Q173R;ENSP00000390102:Q146R;ENSP00000423244:Q166R	ENSP00000407818:Q173R	Q	-	2	0	USP46	53186985	1.000000	0.71417	1.000000	0.80357	0.639000	0.38242	6.263000	0.72521	2.046000	0.60703	0.528000	0.53228	CAG	.		0.383	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361516.2	NM_022832	
EXOC1	55763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	56759888	56759888	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr4:56759888T>C	ENST00000381295.2	+	15	2243	c.1895T>C	c.(1894-1896)cTa>cCa	p.L632P	EXOC1_ENST00000349598.6_Missense_Mutation_p.L617P|EXOC1_ENST00000346134.7_Missense_Mutation_p.L632P	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	632					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					GCTTCTTTCCTAAGTACTACA	0.343																																					p.L632P		.											.	EXOC1-950	0			c.T1895C						.						95.0	89.0	91.0					4																	56759888		2203	4300	6503	SO:0001583	missense	55763	exon15			CTTTCCTAAGTAC	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.1895T>C	4.37:g.56759888T>C	ENSP00000370695:p.Leu632Pro	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	121	40	NM_018261	0	0	18	29	11	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	37	CCDS3502.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.097917	0.76870	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.80529	0.4640	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.952;0.997	T	0.83349	-0.0004	9	0.87932	D	0	.	16.0821	0.81012	0.0:0.0:0.0:1.0	.	617;632	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	P	632;632;617	.	ENSP00000326514:L632P	L	+	2	0	EXOC1	56454645	1.000000	0.71417	0.150000	0.22450	0.970000	0.65996	7.698000	0.84413	2.200000	0.70718	0.460000	0.39030	CTA	.		0.343	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
CDKL2	8999	bcgsc.ca	37	4	76521462	76521462	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr4:76521462G>T	ENST00000429927.2	-	10	2088	c.1385C>A	c.(1384-1386)tCa>tAa	p.S462*	CDKL2_ENST00000307465.4_Nonsense_Mutation_p.S462*	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	462					sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ATAAATGCCTGATGGGGAATG	0.328																																					p.S462X													.	CDKL2-454	0			c.C1385A						.						175.0	163.0	167.0					4																	76521462		2203	4300	6503	SO:0001587	stop_gained	8999	exon10			ATGCCTGATGGGG	U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.1385C>A	4.37:g.76521462G>T	ENSP00000412365:p.Ser462*	Somatic	132	0		WXS	Illumina HiSeq	Phase_1	101	5	NM_003948	0	0	14	14	0	B2R695	Nonsense_Mutation	SNP	ENST00000429927.2	37	CCDS3570.1	.	.	.	.	.	.	.	.	.	.	G	42	9.585214	0.99211	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.3084	11.0954	0.48141	0.0:0.0:0.8156:0.1844	.	.	.	.	X	462	.	ENSP00000306340:S462X	S	-	2	0	CDKL2	76740486	1.000000	0.71417	0.996000	0.52242	0.796000	0.44982	2.209000	0.42806	2.738000	0.93877	0.655000	0.94253	TCA	.		0.328	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252409.2	NM_003948	
FAT1	2195	broad.mit.edu	37	4	187541450	187541450	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr4:187541450C>A	ENST00000441802.2	-	10	6499	c.6290G>T	c.(6289-6291)gGc>gTc	p.G2097V		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2097	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AATGACATGGCCCACCTCAGT	0.468										HNSCC(5;0.00058)																											p.G2097V	Colon(197;1040 2055 4143 4984 49344)												.	FAT1-34	0			c.G6290T						.						172.0	164.0	167.0					4																	187541450		1989	4161	6150	SO:0001583	missense	2195	exon10			ACATGGCCCACCT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6290G>T	4.37:g.187541450C>A	ENSP00000406229:p.Gly2097Val	Somatic	131	2		WXS	Illumina HiSeq	Phase_I	134	5	NM_005245	0	0	12	12	0		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227440	0.39399	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.70399	-0.48	5.1	5.1	0.69264	Cadherin (3);Cadherin-like (1);	0.049638	0.85682	D	0.000000	D	0.89822	0.6826	H	0.96662	3.86	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93050	0.6465	10	0.87932	D	0	.	18.7073	0.91643	0.0:1.0:0.0:0.0	.	2097	Q14517	FAT1_HUMAN	V	2097;2099	ENSP00000406229:G2097V	ENSP00000260147:G2099V	G	-	2	0	FAT1	187778444	1.000000	0.71417	1.000000	0.80357	0.057000	0.15508	4.797000	0.62503	2.653000	0.90120	0.563000	0.77884	GGC	.		0.468	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
ZNF474	133923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	121487756	121487756	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr5:121487756C>A	ENST00000296600.4	+	2	454	c.71C>A	c.(70-72)aCt>aAt	p.T24N	CTC-441N14.2_ENST00000504829.1_RNA|ZNF474_ENST00000514925.1_Intron|CTC-441N14.1_ENST00000505209.1_RNA	NM_207317.1	NP_997200.1	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	24							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|stomach(1)	21		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		AAAGAACCCACTTTCCTTATC	0.378																																					p.T24N		.											.	ZNF474-90	0			c.C71A						.						84.0	89.0	88.0					5																	121487756		2203	4300	6503	SO:0001583	missense	133923	exon2			AACCCACTTTCCT	AK057483	CCDS4130.1	5q23.2	2008-02-05			ENSG00000164185	ENSG00000164185		"""Zinc fingers, C2H2-type"""	23245	protein-coding gene	gene with protein product							Standard	NM_207317		Approved	4933409D10Rik, FLJ32921	uc003ksv.3	Q6S9Z5	OTTHUMG00000128911	ENST00000296600.4:c.71C>A	5.37:g.121487756C>A	ENSP00000296600:p.Thr24Asn	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	98	25	NM_207317	0	0	0	0	0	A8K4M0|Q96M07	Missense_Mutation	SNP	ENST00000296600.4	37	CCDS4130.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091741	0.36952	.	.	ENSG00000164185	ENST00000296600;ENST00000504912;ENST00000505843	T	0.52526	0.66	5.05	5.05	0.67936	.	0.714933	0.11261	U	0.582526	T	0.47985	0.1475	L	0.32530	0.975	0.30368	N	0.783168	D	0.54601	0.967	P	0.52823	0.71	T	0.35051	-0.9804	10	0.31617	T	0.26	-19.2224	10.871	0.46883	0.0:0.9131:0.0:0.0869	.	24	Q6S9Z5	ZN474_HUMAN	N	24	ENSP00000296600:T24N	ENSP00000296600:T24N	T	+	2	0	ZNF474	121515655	0.887000	0.30362	1.000000	0.80357	0.931000	0.56810	1.121000	0.31283	2.624000	0.88883	0.655000	0.94253	ACT	.		0.378	ZNF474-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250883.2	NM_207317	
NKX2-5	1482	broad.mit.edu	37	5	172659726	172659726	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr5:172659726T>G	ENST00000329198.4	-	2	1094	c.821A>C	c.(820-822)tAc>tCc	p.Y274S		NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	274	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CCCGGCGGGGTAAGCGGCAGT	0.677																																					p.Y274S	Esophageal Squamous(72;810 1219 2387 13420 44943)												.	NKX2-5-90	0			c.A821C						.						11.0	14.0	13.0					5																	172659726		2197	4288	6485	SO:0001583	missense	1482	exon2			GCGGGGTAAGCGG	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.821A>C	5.37:g.172659726T>G	ENSP00000327758:p.Tyr274Ser	Somatic	136	21		WXS	Illumina HiSeq	Phase_I	181	40	NM_004387	0	0	0	0	0	A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	ENST00000329198.4	37	CCDS4387.1	.	.	.	.	.	.	.	.	.	.	T	11.46	1.646353	0.29246	.	.	ENSG00000183072	ENST00000329198	D	0.90620	-2.7	4.15	4.15	0.48705	.	.	.	.	.	D	0.88872	0.6555	M	0.78456	2.415	0.80722	D	1	P	0.37330	0.59	B	0.34180	0.177	D	0.87077	0.2163	9	0.23891	T	0.37	.	13.3587	0.60644	0.0:0.0:0.0:1.0	.	274	P52952	NKX25_HUMAN	S	274	ENSP00000327758:Y274S	ENSP00000327758:Y274S	Y	-	2	0	NKX2-5	172592332	1.000000	0.71417	0.988000	0.46212	0.087000	0.18053	1.799000	0.38824	1.735000	0.51646	0.443000	0.29094	TAC	.		0.677	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2		
NKX2-5	1482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	172660100	172660100	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr5:172660100C>A	ENST00000329198.4	-	2	720	c.447G>T	c.(445-447)caG>caT	p.Q149H	NKX2-5_ENST00000424406.2_3'UTR|NKX2-5_ENST00000521848.1_3'UTR	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	149					adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCTCATAGACCTGCGCCTGCG	0.687																																					p.Q149H	Esophageal Squamous(72;810 1219 2387 13420 44943)	.											.	NKX2-5-90	0			c.G447T						.						14.0	12.0	13.0					5																	172660100		2202	4297	6499	SO:0001583	missense	1482	exon2			ATAGACCTGCGCC	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.447G>T	5.37:g.172660100C>A	ENSP00000327758:p.Gln149His	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	74	22	NM_004387	0	0	0	0	0	A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	ENST00000329198.4	37	CCDS4387.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825180	0.71143	.	.	ENSG00000183072	ENST00000329198	D	0.98044	-4.68	4.21	0.675	0.17952	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.49916	D	0.000124	D	0.98950	0.9643	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98290	1.0513	10	0.87932	D	0	.	9.3001	0.37840	0.0:0.6233:0.0:0.3767	.	149	P52952	NKX25_HUMAN	H	149	ENSP00000327758:Q149H	ENSP00000327758:Q149H	Q	-	3	2	NKX2-5	172592706	0.997000	0.39634	0.999000	0.59377	0.962000	0.63368	0.536000	0.23129	0.002000	0.14630	0.462000	0.41574	CAG	.		0.687	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2		
FGFR4	2264	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	176520385	176520385	+	Intron	SNP	A	A	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr5:176520385A>G	ENST00000292408.4	+	10	1496				FGFR4_ENST00000292410.3_Silent_p.R370R|FGFR4_ENST00000393637.1_Silent_p.R370R|FGFR4_ENST00000502906.1_Intron|FGFR4_ENST00000393648.2_Intron	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4						alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	CAGCAGGCAGAACCAAGTCTC	0.642										TSP Lung(9;0.080)																											p.R370R		.											.	FGFR4-1460	0			c.A1110G						.						77.0	80.0	79.0					5																	176520385		2203	4300	6503	SO:0001627	intron_variant	2264	exon8			AGGCAGAACCAAG	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1252-22A>G	5.37:g.176520385A>G		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	87	37	NM_022963	0	0	2	11	9	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Silent	SNP	ENST00000292408.4	37	CCDS4410.1																																																																																			.		0.642	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1		
MUC21	394263	broad.mit.edu	37	6	30954813	30954813	+	Silent	SNP	T	T	C	rs9262371		TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr6:30954813T>C	ENST00000376296.3	+	2	1102	c.861T>C	c.(859-861)aaT>aaC	p.N287N	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	287	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CAGTCACCAATTCTGAGTCCA	0.602																																					p.N287N													.	MUC21-92	0			c.T861C						.						206.0	198.0	201.0					6																	30954813		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			CACCAATTCTGAG	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.861T>C	6.37:g.30954813T>C		Somatic	126	0		WXS	Illumina HiSeq	Phase_I	152	8	NM_001010909	0	0	0	0	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																			T|0.967;C|0.033		0.602	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	38863980	38863980	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr6:38863980A>C	ENST00000359357.3	+	58	8522	c.8268A>C	c.(8266-8268)gaA>gaC	p.E2756D	DNAH8_ENST00000449981.2_Missense_Mutation_p.E2973D|DNAH8_ENST00000441566.1_Missense_Mutation_p.E2720D			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2756					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CTGTGTTTGAAGTACCCAAAA	0.408																																					p.E2973D		.											.	DNAH8-615	0			c.A8919C						.						111.0	103.0	105.0					6																	38863980		2203	4300	6503	SO:0001583	missense	1769	exon60			GTTTGAAGTACCC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.8268A>C	6.37:g.38863980A>C	ENSP00000352312:p.Glu2756Asp	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	100	23	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	11.73	1.726071	0.30593	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T;T	0.29142	1.58;1.75;1.75;1.72	5.36	4.19	0.49359	.	0.050135	0.85682	D	0.000000	T	0.09730	0.0239	L	0.41710	1.295	0.53688	D	0.99997	B	0.11235	0.004	B	0.15052	0.012	T	0.07849	-1.0751	10	0.34782	T	0.22	.	4.8304	0.13437	0.7142:0.0:0.1479:0.1378	.	2756	Q96JB1	DYH8_HUMAN	D	2961;2961;2756;2720	ENSP00000415331:E2961D;ENSP00000333363:E2961D;ENSP00000352312:E2756D;ENSP00000402294:E2720D	ENSP00000333363:E2961D	E	+	3	2	DNAH8	38971958	0.986000	0.35501	0.985000	0.45067	0.950000	0.60333	0.446000	0.21694	0.975000	0.38392	0.482000	0.46254	GAA	.		0.408	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
GCLC	2729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	53380907	53380907	+	Splice_Site	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr6:53380907C>T	ENST00000229416.6	-	4	1043	c.560G>A	c.(559-561)aGt>aAt	p.S187N	GCLC_ENST00000514004.1_Splice_Site_p.S187N	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	187					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	CCATACTCACCTGAAGCGAGG	0.468																																					p.S187N		.											.	GCLC-515	0			c.G560A						.						125.0	118.0	120.0					6																	53380907		2203	4300	6503	SO:0001630	splice_region_variant	2729	exon4			ACTCACCTGAAGC	M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.560+1G>A	6.37:g.53380907C>T		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	65	15	NM_001498	0	0	0	0	0	Q14399	Missense_Mutation	SNP	ENST00000229416.6	37	CCDS4952.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532099	0.85812	.	.	ENSG00000001084	ENST00000229416;ENST00000514004;ENST00000514933	T;T;T	0.54479	0.57;0.57;0.57	5.26	5.26	0.73747	.	0.072360	0.85682	D	0.000000	T	0.43322	0.1242	M	0.68593	2.085	0.80722	D	1	P	0.45531	0.86	B	0.39503	0.301	T	0.47983	-0.9074	9	.	.	.	-14.2666	19.2221	0.93801	0.0:1.0:0.0:0.0	.	187	P48506	GSH1_HUMAN	N	187;187;134	ENSP00000229416:S187N;ENSP00000421908:S187N;ENSP00000423615:S134N	.	S	-	2	0	GCLC	53488866	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.776000	0.85560	2.622000	0.88805	0.561000	0.74099	AGT	.		0.468	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359710.2		Missense_Mutation
GCLC	2729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	53380911	53380911	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr6:53380911A>G	ENST00000229416.6	-	4	1039	c.556T>C	c.(556-558)Ttc>Ctc	p.F186L	GCLC_ENST00000514004.1_Missense_Mutation_p.F186L	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	186					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	ACTCACCTGAAGCGAGGGTGC	0.473																																					p.F186L		.											.	GCLC-515	0			c.T556C						.						125.0	118.0	121.0					6																	53380911		2203	4300	6503	SO:0001583	missense	2729	exon4			ACCTGAAGCGAGG	M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.556T>C	6.37:g.53380911A>G	ENSP00000229416:p.Phe186Leu	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	67	16	NM_001498	0	0	0	0	0	Q14399	Missense_Mutation	SNP	ENST00000229416.6	37	CCDS4952.1	.	.	.	.	.	.	.	.	.	.	A	34	5.408603	0.96051	.	.	ENSG00000001084	ENST00000229416;ENST00000514004;ENST00000514933	T;T;T	0.76578	-1.03;0.25;-1.03	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.90642	0.7065	H	0.96080	3.765	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.93595	0.6925	10	0.87932	D	0	.	15.6543	0.77121	1.0:0.0:0.0:0.0	.	186	P48506	GSH1_HUMAN	L	186;186;133	ENSP00000229416:F186L;ENSP00000421908:F186L;ENSP00000423615:F133L	ENSP00000229416:F186L	F	-	1	0	GCLC	53488870	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.287000	0.95975	2.164000	0.68074	0.459000	0.35465	TTC	.		0.473	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359710.2		
FAM135A	57579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	71236101	71236101	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr6:71236101A>G	ENST00000418814.2	+	15	3928	c.3314A>G	c.(3313-3315)tAt>tGt	p.Y1105C	FAM135A_ENST00000370479.3_Missense_Mutation_p.Y892C|FAM135A_ENST00000505769.1_Missense_Mutation_p.Y685C|FAM135A_ENST00000361499.3_Missense_Mutation_p.Y909C|FAM135A_ENST00000457062.2_Missense_Mutation_p.Y892C|FAM135A_ENST00000505868.1_Missense_Mutation_p.Y1105C	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	1105										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						GAAACAGATTATTCAGCTTTG	0.348																																					p.Y1105C		.											.	FAM135A-90	0			c.A3314G						.						84.0	91.0	88.0					6																	71236101		2203	4300	6503	SO:0001583	missense	57579	exon13			CAGATTATTCAGC	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.3314A>G	6.37:g.71236101A>G	ENSP00000410768:p.Tyr1105Cys	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	159	48	NM_001162529	0	0	4	9	5	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	ENST00000418814.2	37	CCDS55028.1	.	.	.	.	.	.	.	.	.	.	A	3.081	-0.188920	0.06299	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T;T	0.23552	2.22;2.22;1.9;2.22;2.22;2.2	5.9	2.09	0.27110	.	0.582275	0.19653	N	0.109143	T	0.06050	0.0157	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.09022	0.0;0.0;0.0;0.002	B;B;B;B	0.06405	0.002;0.001;0.001;0.002	T	0.35773	-0.9775	10	0.38643	T	0.18	.	3.5522	0.07851	0.6563:0.1354:0.0711:0.1372	.	1105;1105;909;892	Q9P2D6-4;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;F135A_HUMAN;.;.	C	1105;892;685;892;909;1105	ENSP00000410768:Y1105C;ENSP00000359510:Y892C;ENSP00000423785:Y685C;ENSP00000409201:Y892C;ENSP00000354913:Y909C;ENSP00000423307:Y1105C	ENSP00000354913:Y909C	Y	+	2	0	FAM135A	71292822	0.798000	0.28890	0.004000	0.12327	0.251000	0.25915	1.664000	0.37439	0.115000	0.18071	0.533000	0.62120	TAT	.		0.348	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819	
PSMB1	5689	broad.mit.edu	37	6	170852793	170852793	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr6:170852793G>T	ENST00000262193.6	-	4	427	c.329C>A	c.(328-330)gCc>gAc	p.A110D	PSMB1_ENST00000462957.1_5'UTR	NM_002793.3	NP_002784.1	P20618	PSB1_HUMAN	proteasome (prosome, macropain) subunit, beta type, 1	110					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)|Carfilzomib(DB08889)	CGTAGTCATGGCCTTATTATT	0.398																																					p.A110D													.	PSMB1-91	0			c.C329A						.						133.0	116.0	122.0					6																	170852793		2203	4300	6503	SO:0001583	missense	5689	exon4			GTCATGGCCTTAT	D00761	CCDS34577.1	6q27	2008-02-05			ENSG00000008018	ENSG00000008018		"""Proteasome (prosome, macropain) subunits"""	9537	protein-coding gene	gene with protein product		602017				2025653	Standard	NM_002793		Approved	PMSB1, HC5	uc011ehe.2	P20618	OTTHUMG00000016087	ENST00000262193.6:c.329C>A	6.37:g.170852793G>T	ENSP00000262193:p.Ala110Asp	Somatic	94	2		WXS	Illumina HiSeq	Phase_I	75	7	NM_002793	0	2	337	341	2	B5BU76|Q9BWA8	Missense_Mutation	SNP	ENST00000262193.6	37	CCDS34577.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073855	0.36566	.	.	ENSG00000008018	ENST00000262193;ENST00000392093	T	0.21031	2.03	5.08	4.21	0.49690	.	0.106709	0.64402	D	0.000006	T	0.04092	0.0114	N	0.12961	0.28	0.37161	D	0.9026	B	0.28713	0.22	B	0.25614	0.062	T	0.28681	-1.0036	10	0.14252	T	0.57	-16.9599	11.2538	0.49041	0.1478:0.0:0.8522:0.0	.	110	P20618	PSB1_HUMAN	D	110;115	ENSP00000262193:A110D	ENSP00000262193:A110D	A	-	2	0	PSMB1	170694718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.782000	0.62396	1.284000	0.44531	0.650000	0.86243	GCC	.		0.398	PSMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043278.2	NM_002793	
FAM20C	56975	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	193541	193541	+	Silent	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr7:193541C>T	ENST00000313766.5	+	1	573	c.342C>T	c.(340-342)gcC>gcT	p.A114A	AC093627.12_ENST00000467050.1_RNA	NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	114					dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		CGCCCGCGGCCGAGCCGGCCG	0.741																																					p.A114A		.											.	.	0			c.C342T						.						1.0	1.0	1.0					7																	193541		632	1547	2179	SO:0001819	synonymous_variant	56975	exon1			CGCGGCCGAGCCG	BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.342C>T	7.37:g.193541C>T		Somatic	21	0		WXS	Illumina HiSeq	Phase_I	40	23	NM_020223	0	0	2	3	1	A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Silent	SNP	ENST00000313766.5	37	CCDS47522.1																																																																																			.		0.741	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322476.2	NM_020223	
FAM20C	56975	hgsc.bcm.edu;broad.mit.edu	37	7	193561	193561	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr7:193561T>A	ENST00000313766.5	+	1	593	c.362T>A	c.(361-363)tTg>tAg	p.L121*	AC093627.12_ENST00000467050.1_RNA	NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	121					dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		GAGCGCGCCTTGCGGGGGCGG	0.766																																					p.L121X		.											.	.	0			c.T362A						.						1.0	1.0	1.0					7																	193561		742	1670	2412	SO:0001587	stop_gained	56975	exon1			GCGCCTTGCGGGG	BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.362T>A	7.37:g.193561T>A	ENSP00000322323:p.Leu121*	Somatic	13	0		WXS	Illumina HiSeq	Phase_I	26	14	NM_020223	0	0	2	5	3	A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Nonsense_Mutation	SNP	ENST00000313766.5	37	CCDS47522.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.498085	0.85069	.	.	ENSG00000177706	ENST00000313766	.	.	.	4.45	-5.01	0.02991	.	3.462960	0.02171	U	0.059669	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	5.991	0.19460	0.0:0.2449:0.3819:0.3732	.	.	.	.	X	121	.	ENSP00000322323:L121X	L	+	2	0	FAM20C	288644	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.083000	0.11286	-0.496000	0.06650	0.459000	0.35465	TTG	.		0.766	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322476.2	NM_020223	
ZNF853	54753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	6661545	6661545	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr7:6661545A>T	ENST00000457543.3	+	3	1481	c.923A>T	c.(922-924)cAg>cTg	p.Q308L		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	308	Gln-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						caacaactgcagcCTCCTCCC	0.617																																					p.Q308L		.											.	.	0			c.A923T						.						39.0	46.0	44.0					7																	6661545		692	1591	2283	SO:0001583	missense	54753	exon3			AACTGCAGCCTCC	AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.923A>T	7.37:g.6661545A>T	ENSP00000455585:p.Gln308Leu	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	93	23	NM_017560	0	0	3	3	0		Missense_Mutation	SNP	ENST00000457543.3	37	CCDS59048.1																																																																																			.		0.617	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324169.2	NM_017560	
THSD7A	221981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	11582721	11582721	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr7:11582721A>C	ENST00000423059.4	-	5	1728	c.1477T>G	c.(1477-1479)Tta>Gta	p.L493V		NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	493	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CCAGTGCATAATTTTAAGTCC	0.383										HNSCC(18;0.044)																											p.L493V		.											.	THSD7A-71	0			c.T1477G						.						127.0	122.0	124.0					7																	11582721		1872	4098	5970	SO:0001583	missense	221981	exon5			TGCATAATTTTAA		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1477T>G	7.37:g.11582721A>C	ENSP00000406482:p.Leu493Val	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	166	75	NM_015204	0	0	1	1	0		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	A	15.74	2.921725	0.52653	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.60920	0.15	5.78	4.61	0.57282	.	0.197404	0.43110	D	0.000620	T	0.64735	0.2625	M	0.76574	2.34	0.45307	D	0.998302	P	0.45594	0.862	P	0.52109	0.69	T	0.61613	-0.7027	10	0.21540	T	0.41	.	10.5833	0.45267	0.8816:0.0:0.1184:0.0	.	493	Q9UPZ6	THS7A_HUMAN	V	493	ENSP00000406482:L493V	ENSP00000262042:L493V	L	-	1	2	THSD7A	11549246	0.998000	0.40836	0.998000	0.56505	0.944000	0.59088	3.710000	0.54860	2.333000	0.79357	0.482000	0.46254	TTA	.		0.383	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
TMED4	222068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44621390	44621390	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr7:44621390T>G	ENST00000457408.2	-	2	245	c.193A>C	c.(193-195)Aag>Cag	p.K65Q	TMED4_ENST00000289577.5_Missense_Mutation_p.K65Q|TMED4_ENST00000444131.2_5'UTR|TMED4_ENST00000481238.1_Missense_Mutation_p.K65Q	NM_182547.2	NP_872353.2	Q7Z7H5	TMED4_HUMAN	transmembrane emp24 protein transport domain containing 4	65	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6						AAGACCTCCTTCTGCTTATCC	0.657																																					p.K65Q		.											.	TMED4-90	0			c.A193C						.						99.0	100.0	100.0					7																	44621390		2203	4300	6503	SO:0001583	missense	222068	exon2			CCTCCTTCTGCTT	BC035467	CCDS5493.1	7p13	2004-12-21			ENSG00000158604	ENSG00000158604			22301	protein-coding gene	gene with protein product		612038				12761501	Standard	NM_182547		Approved	HNLF	uc003tli.3	Q7Z7H5	OTTHUMG00000129210	ENST00000457408.2:c.193A>C	7.37:g.44621390T>G	ENSP00000404042:p.Lys65Gln	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	115	49	NM_182547	0	0	31	68	37	A4D2K8|B4DFJ4|Q56VW3|Q7Z432|Q8N2P6	Missense_Mutation	SNP	ENST00000457408.2	37	CCDS5493.1	.	.	.	.	.	.	.	.	.	.	T	15.37	2.812640	0.50527	.	.	ENSG00000158604	ENST00000457408;ENST00000289577;ENST00000481238	T;T;T	0.46819	2.22;0.86;1.46	5.36	5.36	0.76844	GOLD (2);	0.227073	0.44285	D	0.000478	T	0.24353	0.0590	N	0.04018	-0.295	0.31797	N	0.628865	B;B	0.14438	0.01;0.007	B;B	0.19666	0.022;0.026	T	0.19192	-1.0313	10	0.27785	T	0.31	-9.1229	8.6427	0.33987	0.17:0.0:0.0:0.83	.	65;65	Q7Z7H5-3;Q7Z7H5	.;TMED4_HUMAN	Q	65	ENSP00000404042:K65Q;ENSP00000289577:K65Q;ENSP00000417443:K65Q	ENSP00000289577:K65Q	K	-	1	0	TMED4	44587915	0.974000	0.33945	1.000000	0.80357	0.998000	0.95712	1.146000	0.31589	2.246000	0.74042	0.533000	0.62120	AAG	.		0.657	TMED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251290.1	NM_182547	
FLNC	2318	broad.mit.edu	37	7	128489441	128489441	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr7:128489441G>T	ENST00000325888.8	+	30	5269	c.5008G>T	c.(5008-5010)Gcc>Tcc	p.A1670S	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.A1670S	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1670					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CACGGTGGATGCCAAGGCAGC	0.627																																					p.A1670S													.	FLNC-141	0			c.G5008T						.						73.0	83.0	80.0					7																	128489441		2166	4264	6430	SO:0001583	missense	2318	exon30			GTGGATGCCAAGG	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5008G>T	7.37:g.128489441G>T	ENSP00000327145:p.Ala1670Ser	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	100	3	NM_001127487	0	0	23	23	0	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	36	5.630736	0.96682	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85484	-1.99;-1.99	5.65	5.65	0.86999	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92283	0.7552	M	0.71296	2.17	0.80722	D	1	D;D	0.76494	0.999;0.99	D;D	0.87578	0.998;0.909	D	0.92346	0.5885	10	0.66056	D	0.02	.	19.7405	0.96228	0.0:0.0:1.0:0.0	.	1670;1670	Q14315-2;Q14315	.;FLNC_HUMAN	S	1670	ENSP00000327145:A1670S;ENSP00000344002:A1670S	ENSP00000327145:A1670S	A	+	1	0	FLNC	128276677	1.000000	0.71417	0.976000	0.42696	0.993000	0.82548	9.869000	0.99810	2.655000	0.90218	0.655000	0.94253	GCC	.		0.627	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
XRCC2	7516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	152345944	152345944	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr7:152345944G>T	ENST00000359321.1	-	3	711	c.626C>A	c.(625-627)cCt>cAt	p.P209H	XRCC2_ENST00000495707.1_5'UTR	NM_005431.1	NP_005422.1	O43543	XRCC2_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 2	209					centrosome organization (GO:0051297)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of neurogenesis (GO:0050769)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|strand invasion (GO:0042148)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			NS(1)|breast(1)|large_intestine(5)|liver(1)|lung(1)|prostate(2)	11		all_hematologic(28;0.0592)|Prostate(32;0.081)	OV - Ovarian serous cystadenocarcinoma(82;0.0423)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0429)		GGCATGAGAAGGTTCTTCTGA	0.453								Homologous recombination																													p.P209H		.											.	XRCC2-1084	0			c.C626A						.						180.0	179.0	180.0					7																	152345944		2203	4300	6503	SO:0001583	missense	7516	exon3			TGAGAAGGTTCTT	Y08837	CCDS5933.1	7q36	2006-05-04			ENSG00000196584	ENSG00000196584			12829	protein-coding gene	gene with protein product	"""RAD51-like"""	600375				7607692, 10422536	Standard	NM_005431		Approved		uc003wld.3	O43543	OTTHUMG00000151470	ENST00000359321.1:c.626C>A	7.37:g.152345944G>T	ENSP00000352271:p.Pro209His	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	90	17	NM_005431	0	0	0	0	0	B2R925	Missense_Mutation	SNP	ENST00000359321.1	37	CCDS5933.1	.	.	.	.	.	.	.	.	.	.	G	3.744	-0.053028	0.07362	.	.	ENSG00000196584	ENST00000359321	T	0.59364	0.27	5.06	5.06	0.68205	.	0.796894	0.11753	N	0.532874	T	0.49098	0.1537	L	0.36672	1.1	0.09310	N	1	B	0.19331	0.035	B	0.21708	0.036	T	0.38134	-0.9675	10	0.45353	T	0.12	-11.3151	10.9302	0.47213	0.0958:0.0:0.9042:0.0	.	209	O43543	XRCC2_HUMAN	H	209	ENSP00000352271:P209H	ENSP00000352271:P209H	P	-	2	0	XRCC2	151976877	0.216000	0.23585	0.036000	0.18154	0.024000	0.10985	2.673000	0.46858	2.353000	0.79882	0.467000	0.42956	CCT	.		0.453	XRCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322783.1	NM_005431	
TBC1D31	93594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	124154514	124154514	+	Missense_Mutation	SNP	A	A	T	rs144810574	byFrequency	TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr8:124154514A>T	ENST00000287380.1	+	19	2743	c.2653A>T	c.(2653-2655)Aat>Tat	p.N885Y	TBC1D31_ENST00000521676.1_Missense_Mutation_p.N762Y|TBC1D31_ENST00000378080.2_Intron|TBC1D31_ENST00000518805.1_Missense_Mutation_p.N439Y|TBC1D31_ENST00000327098.5_Intron|TBC1D31_ENST00000309336.3_Intron|TBC1D31_ENST00000522420.1_Missense_Mutation_p.N780Y	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	885						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										GATTAAAGAAAATTTGGCAAA	0.338																																					p.N885Y		.											.	WDR67-226	0			c.A2653T						.						51.0	48.0	49.0					8																	124154514		2203	4300	6503	SO:0001583	missense	93594	exon19			AAAGAAAATTTGG	AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.2653A>T	8.37:g.124154514A>T	ENSP00000287380:p.Asn885Tyr	Somatic	405	1		WXS	Illumina HiSeq	Phase_I	349	107	NM_145647	0	0	1	1	0	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	ENST00000287380.1	37	CCDS6338.1	.	.	.	.	.	.	.	.	.	.	A	10.88	1.474411	0.26423	.	.	ENSG00000156787	ENST00000287380;ENST00000522420;ENST00000521676;ENST00000518805	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	5.36	4.15	0.48705	.	0.359706	0.32120	N	0.006559	T	0.80199	0.4579	L	0.29908	0.895	0.58432	D	0.999994	P;B	0.42785	0.79;0.0	B;B	0.41723	0.365;0.001	T	0.81892	-0.0724	10	0.72032	D	0.01	-12.8896	9.5604	0.39366	0.7375:0.0:0.0:0.2625	.	780;885	E7ERK7;Q96DN5	.;WDR67_HUMAN	Y	885;780;762;439	ENSP00000287380:N885Y;ENSP00000429334:N780Y;ENSP00000430628:N762Y;ENSP00000429494:N439Y	ENSP00000287380:N885Y	N	+	1	0	WDR67	124223695	0.899000	0.30636	0.992000	0.48379	0.716000	0.41182	1.826000	0.39092	2.046000	0.60703	0.386000	0.25728	AAT	A|0.999;C|0.001		0.338	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381721.1	NM_145647	
FAM49B	51571	broad.mit.edu;bcgsc.ca	37	8	130866576	130866576	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr8:130866576G>T	ENST00000519824.2	-	7	725	c.452C>A	c.(451-453)gCc>gAc	p.A151D	FAM49B_ENST00000401979.2_Missense_Mutation_p.A151D|FAM49B_ENST00000519110.1_Missense_Mutation_p.A151D|FAM49B_ENST00000522941.1_Missense_Mutation_p.A5D|FAM49B_ENST00000518879.1_5'Flank|FAM49B_ENST00000522250.1_Missense_Mutation_p.A5D|FAM49B_ENST00000519540.1_Missense_Mutation_p.A151D|FAM49B_ENST00000517654.1_Missense_Mutation_p.A151D|FAM49B_ENST00000522746.1_Missense_Mutation_p.A151D|FAM49B_ENST00000523509.1_Missense_Mutation_p.A151D	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	151						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)				kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			ATTCTGTATGGCAGGATTTGT	0.308																																					p.A151D													.	FAM49B-90	0			c.C452A						.						114.0	104.0	108.0					8																	130866576		2203	4299	6502	SO:0001583	missense	51571	exon7			TGTATGGCAGGAT	AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.452C>A	8.37:g.130866576G>T	ENSP00000429150:p.Ala151Asp	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	92	5	NM_016623	0	0	49	49	0	Q96AZ5|Q9NW21|Q9NZE7	Missense_Mutation	SNP	ENST00000519824.2	37	CCDS6361.1	.	.	.	.	.	.	.	.	.	.	G	33	5.252236	0.95336	.	.	ENSG00000153310	ENST00000522746;ENST00000523509;ENST00000401979;ENST00000519110;ENST00000522250;ENST00000519824;ENST00000517654;ENST00000519540;ENST00000522941;ENST00000311292	T;T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.73418	0.3584	M	0.85299	2.745	0.80722	D	1	D	0.53462	0.96	P	0.58130	0.833	T	0.76567	-0.2912	10	0.62326	D	0.03	-6.4013	18.6274	0.91346	0.0:0.0:1.0:0.0	.	151	Q9NUQ9	FA49B_HUMAN	D	151;151;151;151;5;151;151;151;5;105	ENSP00000428117:A151D;ENSP00000429802:A151D;ENSP00000384880:A151D;ENSP00000429078:A151D;ENSP00000429978:A5D;ENSP00000429150:A151D;ENSP00000430674:A151D;ENSP00000429499:A151D;ENSP00000430433:A5D	ENSP00000311651:A105D	A	-	2	0	FAM49B	130935758	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.586000	0.98226	2.745000	0.94114	0.491000	0.48974	GCC	.		0.308	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380390.2	NM_016623	
COL22A1	169044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	139707081	139707081	+	Silent	SNP	C	C	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr8:139707081C>A	ENST00000303045.6	-	33	3080	c.2634G>T	c.(2632-2634)ctG>ctT	p.L878L	COL22A1_ENST00000435777.1_Silent_p.L878L|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	878	Collagen-like 7.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTTCCCCAGGCAGGCCTGGAT	0.607										HNSCC(7;0.00092)																											p.L878L		.											.	COL22A1-103	0			c.G2634T						.						104.0	98.0	100.0					8																	139707081		2203	4300	6503	SO:0001819	synonymous_variant	169044	exon33			CCCAGGCAGGCCT	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2634G>T	8.37:g.139707081C>A		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	54	16	NM_152888	0	0	0	0	0	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																			.		0.607	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
SCRIB	23513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	144892982	144892982	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr8:144892982A>T	ENST00000320476.3	-	12	1284	c.1278T>A	c.(1276-1278)gaT>gaA	p.D426E	SCRIB_ENST00000356994.2_Missense_Mutation_p.D426E|SCRIB_ENST00000377533.3_Missense_Mutation_p.D345E|MIR937_ENST00000401271.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	426	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GCTGCCCAGCATCCTCTGCAG	0.662																																					p.D426E	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.T1278A						.						24.0	25.0	25.0					8																	144892982		2202	4298	6500	SO:0001583	missense	23513	exon12			CCCAGCATCCTCT	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1278T>A	8.37:g.144892982A>T	ENSP00000322938:p.Asp426Glu	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	21	6	NM_015356	0	0	0	0	0	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.951040	0.53186	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.76448	-1.02;-1.02;-1.02	3.91	-5.87	0.02297	.	.	.	.	.	T	0.37972	0.1023	N	0.02011	-0.69	0.19775	N	0.999951	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.40683	-0.9550	9	0.06365	T	0.9	.	0.624	0.00783	0.3145:0.12:0.3208:0.2448	.	426;426	Q14160;Q14160-3	SCRIB_HUMAN;.	E	426;426;345	ENSP00000349486:D426E;ENSP00000322938:D426E;ENSP00000366756:D345E	ENSP00000322938:D426E	D	-	3	2	SCRIB	144964970	0.000000	0.05858	0.001000	0.08648	0.733000	0.41908	-0.296000	0.08287	-1.858000	0.01158	-0.464000	0.05259	GAT	.		0.662	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
KIAA2026	158358	broad.mit.edu;bcgsc.ca	37	9	6007447	6007447	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr9:6007447T>C	ENST00000399933.3	-	1	340	c.341A>G	c.(340-342)gAg>gGg	p.E114G	KIAA2026_ENST00000381461.2_Missense_Mutation_p.E114G|MIR4665_ENST00000581132.1_RNA	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	114										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TTCCGCCACCTCCTCCTCCGC	0.716																																					p.E114G													.	KIAA2026-92	0			c.A341G						.						11.0	14.0	13.0					9																	6007447		1846	4079	5925	SO:0001583	missense	158358	exon1			GCCACCTCCTCCT	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.341A>G	9.37:g.6007447T>C	ENSP00000382815:p.Glu114Gly	Somatic	38	2		WXS	Illumina HiSeq	Phase_I	54	19	NM_001017969	0	0	0	0	0	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37		.	.	.	.	.	.	.	.	.	.	T	12.00	1.806818	0.31961	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	.	.	.	4.34	1.7	0.24286	Bromodomain (1);	.	.	.	.	T	0.17492	0.0420	N	0.08118	0	0.23994	N	0.996238	B	0.06786	0.001	B	0.09377	0.004	T	0.18085	-1.0348	8	0.62326	D	0.03	.	4.8866	0.13706	0.0:0.1904:0.2208:0.5888	.	114	Q5HYC2	K2026_HUMAN	G	114	.	ENSP00000370870:E114G	E	-	2	0	KIAA2026	5997447	0.000000	0.05858	1.000000	0.80357	0.483000	0.33249	0.084000	0.14891	0.653000	0.30826	0.402000	0.26972	GAG	.		0.716	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
PBX3	5090	ucsc.edu;bcgsc.ca	37	9	128723051	128723051	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr9:128723051C>T	ENST00000373489.5	+	6	948	c.932C>T	c.(931-933)aCg>aTg	p.T311M	PBX3_ENST00000373487.4_Missense_Mutation_p.T332M|PBX3_ENST00000538998.1_3'UTR|PBX3_ENST00000447726.2_Missense_Mutation_p.T236M|PBX3_ENST00000373483.2_Missense_Mutation_p.T130M|PBX3_ENST00000342287.5_Missense_Mutation_p.T311M	NM_006195.5	NP_006186.1	P40426	PBX3_HUMAN	pre-B-cell leukemia homeobox 3	311					adult locomotory behavior (GO:0008344)|anterior compartment pattern formation (GO:0007387)|dorsal spinal cord development (GO:0021516)|neuron development (GO:0048666)|posterior compartment specification (GO:0007388)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)	24						GCTGCAAAGACGGCCGTGACA	0.517																																					p.T311M													.	PBX3-91	0			c.C932T						.						69.0	59.0	62.0					9																	128723051		2203	4300	6503	SO:0001583	missense	5090	exon6			CAAAGACGGCCGT		CCDS6865.1, CCDS48021.1	9q33.3	2011-06-20	2007-01-30		ENSG00000167081	ENSG00000167081		"""Homeoboxes / TALE class"""	8634	protein-coding gene	gene with protein product		176312	"""pre-B-cell leukemia transcription factor 3"""			1682799	Standard	NM_006195		Approved		uc004bqb.3	P40426	OTTHUMG00000020684	ENST00000373489.5:c.932C>T	9.37:g.128723051C>T	ENSP00000362588:p.Thr311Met	Somatic	182	2		WXS	Illumina HiSeq		164	39	NM_006195	0	0	6	7	1	E9PB27|Q5JSA0|Q5JSA1|Q5VXL3|Q96PF9|Q96PG0	Missense_Mutation	SNP	ENST00000373489.5	37	CCDS6865.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.806995	0.90623	.	.	ENSG00000167081	ENST00000373492;ENST00000373489;ENST00000342287;ENST00000373487;ENST00000373483;ENST00000373482;ENST00000447726;ENST00000538998	D;D;T;D;D;D	0.89617	-2.33;-2.28;1.69;-2.5;-2.54;-2.41	5.87	5.87	0.94306	.	0.090349	0.85682	D	0.000000	D	0.94420	0.8205	M	0.76574	2.34	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	D;P;P	0.75020	0.985;0.846;0.828	D	0.93532	0.6870	10	0.49607	T	0.09	.	20.2192	0.98319	0.0:1.0:0.0:0.0	.	222;332;311	B7Z5Q0;Q5JS98;P40426	.;.;PBX3_HUMAN	M	130;311;311;332;130;130;236;222	ENSP00000362588:T311M;ENSP00000341990:T311M;ENSP00000362586:T332M;ENSP00000362582:T130M;ENSP00000387456:T236M;ENSP00000444005:T222M	ENSP00000341990:T311M	T	+	2	0	PBX3	127762872	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.487000	0.81328	2.780000	0.95670	0.655000	0.94253	ACG	.		0.517	PBX3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417765.1		
RABL6	55684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139734263	139734263	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr9:139734263G>A	ENST00000311502.7	+	13	2112	c.1876G>A	c.(1876-1878)Gac>Aac	p.D626N	RABL6_ENST00000357466.2_Intron|RABL6_ENST00000371675.3_Missense_Mutation_p.D511N|RABL6_ENST00000432842.2_3'UTR|RABL6_ENST00000371663.4_Missense_Mutation_p.D627N			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	626					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										GAATGACTCGGACCTCTTCGG	0.657																																					p.D627N		.											.	.	0			c.G1879A						.						29.0	35.0	33.0					9																	139734263		1894	4100	5994	SO:0001583	missense	55684	exon13			GACTCGGACCTCT	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1876G>A	9.37:g.139734263G>A	ENSP00000311134:p.Asp626Asn	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	49	18	NM_001173988	0	0	36	59	23	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Missense_Mutation	SNP	ENST00000311502.7	37	CCDS48058.1	.	.	.	.	.	.	.	.	.	.	.	19.33	3.807620	0.70797	.	.	ENSG00000196642	ENST00000371663;ENST00000311502;ENST00000371675;ENST00000435930	T;T;T;T	0.80909	-1.11;-1.14;-1.13;-1.43	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.88930	0.6571	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	D	0.90196	0.4253	10	0.66056	D	0.02	-24.3311	15.167	0.72837	0.0:0.0:1.0:0.0	.	420;627;626	B1AMX5;Q3YEC7-2;Q3YEC7	.;.;PARF_HUMAN	N	627;626;511;420	ENSP00000360727:D627N;ENSP00000311134:D626N;ENSP00000360740:D511N;ENSP00000408442:D420N	ENSP00000311134:D626N	D	+	1	0	C9orf86	138854084	1.000000	0.71417	0.511000	0.27724	0.034000	0.12701	7.931000	0.87625	2.162000	0.67917	0.561000	0.74099	GAC	.		0.657	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055141.4	NM_024718	
RAI2	10742	broad.mit.edu	37	X	17819166	17819166	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chrX:17819166T>G	ENST00000545871.1	-	3	1425	c.965A>C	c.(964-966)aAg>aCg	p.K322T	RAI2_ENST00000415486.3_Missense_Mutation_p.K272T|RAI2_ENST00000360011.1_Missense_Mutation_p.K322T|RAI2_ENST00000331511.1_Missense_Mutation_p.K322T|RAI2_ENST00000451717.1_Missense_Mutation_p.K322T	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	322					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					GGGCACTGACTTCATGGAGAG	0.567																																					p.K322T													.	RAI2-131	0			c.A965C						.						104.0	98.0	100.0					X																	17819166		2203	4300	6503	SO:0001583	missense	10742	exon3			ACTGACTTCATGG	Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.965A>C	X.37:g.17819166T>G	ENSP00000444210:p.Lys322Thr	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	67	4	NM_001172739	0	0	51	55	4	B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	ENST00000545871.1	37	CCDS14183.1	.	.	.	.	.	.	.	.	.	.	t	15.67	2.900999	0.52227	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.39056	1.13;1.13;1.13;1.13;1.1	5.29	5.29	0.74685	.	0.160590	0.42420	D	0.000711	T	0.58694	0.2140	L	0.55481	1.735	0.49582	D	0.999808	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.975	T	0.61554	-0.7039	10	0.66056	D	0.02	-27.0086	14.0079	0.64475	0.0:0.0:0.0:1.0	.	272;322	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	T	322;322;322;322;272	ENSP00000333456:K322T;ENSP00000353106:K322T;ENSP00000444210:K322T;ENSP00000401323:K322T;ENSP00000392578:K272T	ENSP00000333456:K322T	K	-	2	0	RAI2	17729087	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.282000	0.58971	1.963000	0.57068	0.483000	0.47432	AAG	.		0.567	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055937.1	NM_021785	
SNX12	29934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	70280928	70280928	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chrX:70280928G>T	ENST00000374274.3	-	4	543	c.427C>A	c.(427-429)Cac>Aac	p.H143N	SNX12_ENST00000465030.1_5'UTR|SNX12_ENST00000276105.3_Missense_Mutation_p.H139N	NM_001256185.1|NM_001256188.1|NM_013346.3	NP_001243114.1|NP_001243117.1|NP_037478.2	Q9UMY4	SNX12_HUMAN	sorting nexin 12	143	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of protein transport (GO:0051224)|regulation of endocytosis (GO:0030100)	early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)	p.H143Y(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	Renal(35;0.156)					AGGAACATGTGTAGGCAGCGT	0.517																																					p.H143N		.											.	SNX12-226	1	Substitution - Missense(1)	lung(1)	c.C427A						.						104.0	78.0	87.0					X																	70280928		2203	4300	6503	SO:0001583	missense	29934	exon5			ACATGTGTAGGCA	AF171229	CCDS14405.1, CCDS59169.1	Xq13.1	2008-03-11			ENSG00000147164	ENSG00000147164		"""Sorting nexins"""	14976	protein-coding gene	gene with protein product		300883					Standard	NM_013346		Approved		uc004dyr.2	Q9UMY4	OTTHUMG00000021786	ENST00000374274.3:c.427C>A	X.37:g.70280928G>T	ENSP00000363392:p.His143Asn	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	47	32	NM_001256185	0	0	7	61	54	F8W8K5|Q8WUG9	Missense_Mutation	SNP	ENST00000374274.3	37	CCDS14405.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.698895	0.48307	.	.	ENSG00000147164	ENST00000374274;ENST00000276105	T;T	0.39787	1.06;1.06	5.25	5.25	0.73442	.	0.208471	0.50627	D	0.000112	T	0.66557	0.2801	M	0.79926	2.475	0.80722	D	1	D	0.71674	0.998	D	0.83275	0.996	T	0.66964	-0.5790	10	0.38643	T	0.18	-19.7041	16.8073	0.85709	0.0:0.0:1.0:0.0	.	143	Q3SYF1	.	N	143;139	ENSP00000363392:H143N;ENSP00000276105:H139N	ENSP00000276105:H139N	H	-	1	0	SNX12	70197653	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.653000	0.98506	2.434000	0.82447	0.594000	0.82650	CAC	.		0.517	SNX12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057094.1	NM_013346	
BRWD3	254065	bcgsc.ca	37	X	79932816	79932816	+	Silent	SNP	G	G	T			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chrX:79932816G>T	ENST00000373275.4	-	41	4917	c.4701C>A	c.(4699-4701)ccC>ccA	p.P1567P	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1567					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TTCCTGTCCGGGGCTCTCTGC	0.358																																					p.P1567P													.	BRWD3-134	0			c.C4701A						.						43.0	41.0	42.0					X																	79932816		2203	4299	6502	SO:0001819	synonymous_variant	254065	exon41			TGTCCGGGGCTCT		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4701C>A	X.37:g.79932816G>T		Somatic	54	0		WXS	Illumina HiSeq	Phase_1	45	4	NM_153252	0	0	5	5	0	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Silent	SNP	ENST00000373275.4	37	CCDS14447.1																																																																																			.		0.358	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
TENM1	10178	bcgsc.ca	37	X	123515037	123515037	+	Silent	SNP	T	T	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chrX:123515037T>G	ENST00000371130.3	-	31	7590	c.7527A>C	c.(7525-7527)ggA>ggC	p.G2509G	TENM1_ENST00000422452.2_Silent_p.G2516G|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2509					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GTTGCTTCCCTCCTTCAAGGC	0.448																																					p.G2516G													.	.	0			c.A7548C						.						126.0	120.0	122.0					X																	123515037		2202	4298	6500	SO:0001819	synonymous_variant	10178	exon32			CTTCCCTCCTTCA	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7527A>C	X.37:g.123515037T>G		Somatic	31	1		WXS	Illumina HiSeq	Phase_1	27	22	NM_001163278	0	0	0	4	4	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																			.		0.448	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
SLC9A6	10479	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	135098843	135098843	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chrX:135098843T>A	ENST00000370698.3	+	10	1215	c.1180T>A	c.(1180-1182)Ttc>Atc	p.F394I	SLC9A6_ENST00000370695.4_Missense_Mutation_p.F426I|SLC9A6_ENST00000370701.1_Missense_Mutation_p.F374I	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	394					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GAATTTCATCTTCTCCTACAT	0.348																																					p.F426I													.	SLC9A6-131	0			c.T1276A						.						141.0	119.0	126.0					X																	135098843		2203	4300	6503	SO:0001583	missense	10479	exon10			TTCATCTTCTCCT	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1180T>A	X.37:g.135098843T>A	ENSP00000359732:p.Phe394Ile	Somatic	93	1		WXS	Illumina HiSeq	Phase_I	70	41	NM_001042537	0	0	0	7	7	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.035859	0.93630	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.60171	0.21;0.21;0.21	5.67	5.67	0.87782	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	D	0.84624	0.5513	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90110	0.4191	10	0.87932	D	0	.	14.0301	0.64610	0.0:0.0:0.0:1.0	.	426;394	Q92581-2;Q92581	.;SL9A6_HUMAN	I	374;394;426	ENSP00000359735:F374I;ENSP00000359732:F394I;ENSP00000359729:F426I	ENSP00000359729:F426I	F	+	1	0	SLC9A6	134926509	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	1.911000	0.55334	0.486000	0.48141	TTC	.		0.348	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
C1orf112	55732	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	169798424	169798424	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:169798424delT	ENST00000286031.6	+	13	1848	c.1148delT	c.(1147-1149)gttfs	p.V383fs	C1orf112_ENST00000359326.4_Frame_Shift_Del_p.V383fs|C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000413811.2_Frame_Shift_Del_p.F311fs	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	383										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CTCAAAGCCGTTTTCTACAGT	0.368																																					p.V383fs		.											.	C1orf112-90	0			c.1148delT						.						133.0	130.0	131.0					1																	169798424		2203	4300	6503	SO:0001589	frameshift_variant	55732	exon13			.	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.1148delT	1.37:g.169798424delT	ENSP00000286031:p.Val383fs	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	111	29	NM_018186	0	0	0	0	0	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Frame_Shift_Del	DEL	ENST00000286031.6	37	CCDS1285.1																																																																																			.		0.368	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186	
CCSAP	126731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	229461075	229461076	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr1:229461075_229461076delAG	ENST00000366687.1	-	3	770_771	c.719_720delCT	c.(718-720)tctfs	p.S240fs	CCSAP_ENST00000366686.1_Frame_Shift_Del_p.S126fs|CCSAP_ENST00000284617.2_Frame_Shift_Del_p.S240fs|RP4-803J11.2_ENST00000418348.1_RNA|CCSAP_ENST00000483092.1_5'UTR			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein	240					multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)											CCACATCCACAGAGTGAGCTCG	0.441																																					p.240_240del		.											.	.	0			c.719_720del						.																																			SO:0001589	frameshift_variant	126731	exon4			.	BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.719_720delCT	1.37:g.229461077_229461078delAG	ENSP00000355648:p.Ser240fs	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	101	28	NM_145257	0	0	0	0	0	A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	Frame_Shift_Del	DEL	ENST00000366687.1	37	CCDS1577.1																																																																																			.		0.441	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091839.1	NM_145257	
PTEN	5728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	89692845	89692845	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr10:89692845delA	ENST00000371953.3	+	5	1686	c.329delA	c.(328-330)caafs	p.Q110fs		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	110	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(5)|p.Y27fs*1(2)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GATCTTGACCAATGGCTAAGT	0.398		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.Q110fs		.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN-17735	50	Whole gene deletion(37)|Deletion - Frameshift(8)|Unknown(5)	prostate(16)|central_nervous_system(11)|skin(6)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|breast(3)|ovary(3)|soft_tissue(1)|urinary_tract(1)	c.329delA						.						127.0	117.0	121.0					10																	89692845		2203	4297	6500	SO:0001589	frameshift_variant	5728	exon5	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.329delA	10.37:g.89692845delA	ENSP00000361021:p.Gln110fs	Somatic	229	0		WXS	Illumina HiSeq	Phase_I	224	59	NM_000314	0	0	0	0	0	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	ENST00000371953.3	37	CCDS31238.1																																																																																			.		0.398	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
SIRT4	23409	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	120750516	120750517	+	Frame_Shift_Del	DEL	AA	AA	-	rs16950058|rs201277474	byFrequency	TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr12:120750516_120750517delAA	ENST00000202967.4	+	3	814_815	c.755_756delAA	c.(754-756)gaafs	p.E252fs	RNU6-1088P_ENST00000516850.1_RNA|SIRT4_ENST00000537892.1_3'UTR	NM_012240.2	NP_036372.1			sirtuin 4											haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGTGTAAAAGAAGCCGACTCCC	0.525																																					p.252_252del		.											.	SIRT4-226	0			c.755_756del						.																																			SO:0001589	frameshift_variant	23409	exon3			.	AF083109	CCDS9194.1	12q24.31	2010-06-25	2010-06-25		ENSG00000089163	ENSG00000089163			14932	protein-coding gene	gene with protein product		604482	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 4"", ""sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae)"""			10381378	Standard	NM_012240		Approved	SIR2L4	uc001tyc.3	Q9Y6E7	OTTHUMG00000169028	ENST00000202967.4:c.755_756delAA	12.37:g.120750516_120750517delAA	ENSP00000202967:p.Glu252fs	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	104	29	NM_012240	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000202967.4	37	CCDS9194.1																																																																																			.		0.525	SIRT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402003.1	NM_012240	
SIRT4	23409	hgsc.bcm.edu	37	12	120750516	120750518	+	In_Frame_Del	DEL	AAG	AAG	-	rs16950058|rs201277474	byFrequency	TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr12:120750516_120750518delAAG	ENST00000202967.4	+	3	814_816	c.755_757delAAG	c.(754-759)gaagcc>gcc	p.E252del	RNU6-1088P_ENST00000516850.1_RNA|SIRT4_ENST00000537892.1_3'UTR	NM_012240.2	NP_036372.1			sirtuin 4											haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGTGTAAAAGAAGCCGACTCCCT	0.527																																					p.252_253del		.											.	SIRT4-226	0			c.755_757del						.																																			SO:0001651	inframe_deletion	23409	exon3			.	AF083109	CCDS9194.1	12q24.31	2010-06-25	2010-06-25		ENSG00000089163	ENSG00000089163			14932	protein-coding gene	gene with protein product		604482	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 4"", ""sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae)"""			10381378	Standard	NM_012240		Approved	SIR2L4	uc001tyc.3	Q9Y6E7	OTTHUMG00000169028	ENST00000202967.4:c.755_757delAAG	12.37:g.120750516_120750518delAAG	ENSP00000202967:p.Glu252del	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	105	20	NM_012240	0	0	0	0	0		In_Frame_Del	DEL	ENST00000202967.4	37	CCDS9194.1																																																																																			.		0.527	SIRT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402003.1	NM_012240	
KLHL41	10324	broad.mit.edu;bcgsc.ca	37	2	170382094	170382096	+	Splice_Site	DEL	GGT	GGT	-	rs112795676		TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	GGT	GGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr2:170382094_170382096delGGT	ENST00000284669.1	+	6	1786_1788	c.1709_1711delGGT	c.(1708-1713)aggtat>aat	p.570_571RY>N	BBS5_ENST00000554017.1_Splice_Site_p.508_509RY>N|RP11-724O16.1_ENST00000513963.1_Splice_Site_p.508_509RY>N	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	570					myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											TCCTCCATCAGGTATGAAGATGA	0.379																																					p.570_571del													.	.	0			c.1710_1711del						.																																			SO:0001630	splice_region_variant	10324	exon6			CCATCAGGTATGA	AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.1710-1GGT>-	2.37:g.170382094_170382096delGGT		Somatic	105	0		WXS	Illumina HiSeq	Phase_I	68	8	NM_006063	0	0	0	0	0	Q53R42	Frame_Shift_Del	DEL	ENST00000284669.1	37	CCDS2234.1																																																																																			.		0.379	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255263.1	NM_006063	In_Frame_Del
KLHL41	10324	broad.mit.edu;bcgsc.ca	37	2	170382098	170382107	+	Frame_Shift_Del	DEL	TGAAGATGAT	TGAAGATGAT	-	rs144510735		TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	TGAAGATGAT	TGAAGATGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr2:170382098_170382107delTGAAGATGAT	ENST00000284669.1	+	6	1790_1799	c.1713_1722delTGAAGATGAT	c.(1711-1722)tatgaagatgatfs	p.YEDD571fs	BBS5_ENST00000554017.1_Frame_Shift_Del_p.YEDD509fs|RP11-724O16.1_ENST00000513963.1_Frame_Shift_Del_p.YEDD509fs	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	571					myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											CCATCAGGTATGAAGATGATAAAAAAGAAT	0.367																																					p.571_574del													.	.	0			c.1713_1722del						.																																			SO:0001589	frameshift_variant	10324	exon6			CAGGTATGAAGAT	AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.1713_1722delTGAAGATGAT	2.37:g.170382098_170382107delTGAAGATGAT	ENSP00000284669:p.Tyr571fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	68	8	NM_006063	0	0	0	0	0	Q53R42	Frame_Shift_Del	DEL	ENST00000284669.1	37	CCDS2234.1																																																																																			.		0.367	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255263.1	NM_006063	
LIMD1	8994	hgsc.bcm.edu;broad.mit.edu	37	3	45714309	45714327	+	Splice_Site	DEL	ACAAGTAAGAAGGGATGGG	ACAAGTAAGAAGGGATGGG	-			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	ACAAGTAAGAAGGGATGGG	ACAAGTAAGAAGGGATGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr3:45714309_45714327delACAAGTAAGAAGGGATGGG	ENST00000273317.4	+	5	1790_1793	c.1769_1772delACAAGTAAGAAGGGATGGG	c.(1768-1773)cacaag>cg	p.HK590fs	LIMD1_ENST00000440097.1_Splice_Site_p.HK590fs|LIMD1_ENST00000465039.1_3'UTR	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	590	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.|Necessary for nuclear localization.				cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		CGAGATTACCACAAGTAAGAAGGGATGGGAGCAGACAGG	0.53																																					p.590_591del		.											.	LIMD1-279	0			c.1769_1772del						.																																			SO:0001630	splice_region_variant	8994	exon5			.	AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.1772+1ACAAGTAAGAAGGGATGGG>-	3.37:g.45714309_45714327delACAAGTAAGAAGGGATGGG		Somatic	54	0		WXS	Illumina HiSeq	Phase_I	59	10	NM_014240	0	0	0	0	0	Q17RQ1|Q9BQQ9|Q9NQ47	Frame_Shift_Del	DEL	ENST00000273317.4	37	CCDS2729.1																																																																																			.		0.530	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257327.1	NM_014240	Frame_Shift_Del
ANTXR2	118429	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	80976344	80976344	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr4:80976344delC	ENST00000307333.7	-	6	517	c.515delG	c.(514-516)agtfs	p.S172fs	ANTXR2_ENST00000403729.2_Frame_Shift_Del_p.S172fs|ANTXR2_ENST00000346652.6_Frame_Shift_Del_p.S172fs|ANTXR2_ENST00000295465.4_Frame_Shift_Del_p.S172fs|ANTXR2_ENST00000404191.1_Frame_Shift_Del_p.S95fs	NM_001145794.1	NP_001139266.1	P58335	ANTR2_HUMAN	anthrax toxin receptor 2	172	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						ACAATAAACACTAGCCCCAAG	0.383									Juvenile Hyaline Fibromatosis																												p.S172fs		.											.	ANTXR2-23	0			c.515delG						.						75.0	67.0	69.0					4																	80976344		1845	4088	5933	SO:0001589	frameshift_variant	118429	exon6	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	.	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000307333.7:c.515delG	4.37:g.80976344delC	ENSP00000306185:p.Ser172fs	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	127	42	NM_001145794	0	0	0	0	0	Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	Frame_Shift_Del	DEL	ENST00000307333.7	37	CCDS47086.1																																																																																			.		0.383	ANTXR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324663.1	NM_058172	
PNPLA8	50640	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	108154603	108154603	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr7:108154603delT	ENST00000422087.1	-	5	1597	c.1191delA	c.(1189-1191)aaafs	p.K397fs	PNPLA8_ENST00000436062.1_Frame_Shift_Del_p.K397fs|PNPLA8_ENST00000426128.2_Frame_Shift_Del_p.K397fs|PNPLA8_ENST00000483879.1_Intron|PNPLA8_ENST00000453144.1_Frame_Shift_Del_p.K297fs|PNPLA8_ENST00000388728.5_Frame_Shift_Del_p.K397fs|PNPLA8_ENST00000257694.8_Frame_Shift_Del_p.K397fs	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	397					arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)			breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						CAGCCACTCCTTTTCCTTCAG	0.353																																					p.K397fs		.											.	PNPLA8-135	0			c.1191delA						.						189.0	210.0	203.0					7																	108154603		2203	4300	6503	SO:0001589	frameshift_variant	50640	exon3			.	AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.1191delA	7.37:g.108154603delT	ENSP00000410804:p.Lys397fs	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	106	23	NM_001256008	0	0	0	0	0	A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	Frame_Shift_Del	DEL	ENST00000422087.1	37	CCDS34733.1																																																																																			.		0.353	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337475.1	NM_015723	
SHB	6461	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	37919918	37919918	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr9:37919918delC	ENST00000377707.3	-	6	1995	c.1430delG	c.(1429-1431)agtfs	p.S477fs	RP11-613M10.9_ENST00000540557.1_Intron	NM_003028.2	NP_003019.2	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein B	477	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(4)|lung(1)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)	11		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		TTCCGGGACACTGTCGAACGG	0.517																																					p.S477fs		.											.	SHB-92	0			c.1430delG						.						145.0	154.0	151.0					9																	37919918		2044	4183	6227	SO:0001589	frameshift_variant	6461	exon6			.		CCDS43806.1	9p13.2	2013-09-23	2005-05-24		ENSG00000107338	ENSG00000107338		"""SH2 domain containing"""	10838	protein-coding gene	gene with protein product		600314	"""SHB adaptor protein (a Src homology 2 protein)"", ""SHB (Src homology 2 domain containing) adaptor protein B"""			7713524	Standard	NM_003028		Approved		uc004aax.3	Q15464	OTTHUMG00000019936	ENST00000377707.3:c.1430delG	9.37:g.37919918delC	ENSP00000366936:p.Ser477fs	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	140	35	NM_003028	0	0	0	0	0	B9EGM0|D3DRQ5|Q504U5|Q5VUM8	Frame_Shift_Del	DEL	ENST00000377707.3	37	CCDS43806.1																																																																																			.		0.517	SHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052490.1		
IL1R2	7850	broad.mit.edu	37	2	102638648	102638649	+	Splice_Site	INS	-	-	A			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr2:102638648_102638649insA	ENST00000332549.3	+	6	917_918		c.e6-1		IL1R2_ENST00000441002.1_Splice_Site|IL1R2_ENST00000393414.2_Splice_Site	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II						cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						ATCTTTCTCAGAAAAAAAAGAA	0.441																																					.	Pancreas(106;189 1628 2302 5133 12295)												.	IL1R2-522	0			c.689-1->A						.																																			SO:0001630	splice_region_variant	7850	exon6			TTCTCAGAAAAAA	X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.689-1->A	2.37:g.102638656_102638656dupA		Somatic	262	0		WXS	Illumina HiSeq	Phase_I	355	8	NM_004633	0	0	0	0	0	D3DVJ5|Q6LCE6|Q9UE68	Splice_Site	INS	ENST00000332549.3	37	CCDS2054.1																																																																																			.		0.441	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253191.1	NM_004633	Intron
NEFH	4744	hgsc.bcm.edu	37	22	29885593	29885594	+	In_Frame_Ins	INS	-	-	TGAGAAGGCCAAGTCCCC	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr22:29885593_29885594insTGAGAAGGCCAAGTCCCC	ENST00000310624.6	+	4	1997_1998	c.1964_1965insTGAGAAGGCCAAGTCCCC	c.(1963-1968)ccagag>ccTGAGAAGGCCAAGTCCCCagag	p.655_656PE>PEKAKSPE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GCCAAGTCCCCAGAGAAGGAAG	0.554																																					p.P655delinsPEKAKSP		.											.	NEFH-90	0			c.1964_1965insTGAGAAGGCCAAGTCCCC						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1947_1964dupTGAGAAGGCCAAGTCCCC	22.37:g.29885593_29885594insTGAGAAGGCCAAGTCCCC	ENSP00000311997:p.Glu650_Pro655dup	Somatic	263	0		WXS	Illumina HiSeq	Phase_I	307	58	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			TGAGAAGGCCAAGTCCCC|1.000;|0.000		0.554	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
DLEC1	9940	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	38101279	38101280	+	In_Frame_Ins	INS	-	-	CAT			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr3:38101279_38101280insCAT	ENST00000308059.6	+	3	630_631	c.609_610insCAT	c.(610-612)cat>CATcat	p.204_204H>HH	DLEC1_ENST00000452631.2_In_Frame_Ins_p.204_204H>HH|DLEC1_ENST00000346219.3_In_Frame_Ins_p.204_204H>HH					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TGCTACGGAAACATCATTTGAT	0.465																																					p.K203delinsKH		.											.	DLEC1-161	0			c.609_610insCAT						.																																			SO:0001652	inframe_insertion	9940	exon3			.	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.613_615dupCAT	3.37:g.38101283_38101285dupCAT	ENSP00000308597:p.His205dup	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	91	39	NM_007337	0	0	0	0	0		In_Frame_Ins	INS	ENST00000308059.6	37	CCDS2672.2																																																																																			.		0.465	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
CXCL1	2919	broad.mit.edu	37	4	74735703	74735704	+	Frame_Shift_Ins	INS	-	-	C	rs549189473		TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr4:74735703_74735704insC	ENST00000395761.3	+	3	372_373	c.305_306insC	c.(304-309)aacagtfs	p.S103fs	CXCL1_ENST00000509101.1_3'UTR	NM_001511.3	NP_001502.1	P09341	GROA_HUMAN	chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)	103					actin cytoskeleton organization (GO:0030036)|cell chemotaxis (GO:0060326)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|positive regulation of catalytic activity (GO:0043085)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|enzyme activator activity (GO:0008047)|receptor binding (GO:0005102)			lung(2)	2	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			AAGATGCTGAACAGGTGAGTTA	0.475																																					p.N102fs													.	CXCL1-204	0			c.305_306insC						.																																			SO:0001589	frameshift_variant	2919	exon3			TGCTGAACAGGTG	J03561	CCDS47074.1	4q13.3	2013-02-25	2002-08-22	2002-08-23		ENSG00000163739		"""Endogenous ligands"""	4602	protein-coding gene	gene with protein product		155730	"""GRO1 oncogene (melanoma growth stimulating activity, alpha)"", ""fibroblast secretory protein"""	MGSA, GRO1, FSP		2217207	Standard	NM_001511		Approved	SCYB1, GROa, MGSA-a, NAP-3	uc003hhh.3	P09341		ENST00000395761.3:c.306dupC	4.37:g.74735704_74735704dupC	ENSP00000379110:p.Ser103fs	Somatic	192	0		WXS	Illumina HiSeq	Phase_I	170	9	NM_001511	0	0	0	0	0	Q9UCR7	Frame_Shift_Ins	INS	ENST00000395761.3	37	CCDS47074.1																																																																																			.		0.475	CXCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362734.1		
CHCHD3	54927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	132570441	132570442	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr7:132570441_132570442insG	ENST00000262570.5	-	5	577_578	c.433_434insC	c.(433-435)ctgfs	p.L145fs	CHCHD3_ENST00000448878.1_Frame_Shift_Ins_p.L150fs|CHCHD3_ENST00000476546.1_5'UTR	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3	145					inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						CAGTCTAGCCAGCTGTTCTTTG	0.332																																					p.L145fs		.											.	CHCHD3-90	0			c.434_435insC						.																																			SO:0001589	frameshift_variant	54927	exon5			.	BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231	ENST00000262570.5:c.434dupC	7.37:g.132570442_132570442dupG	ENSP00000262570:p.Leu145fs	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	65	15	NM_017812	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000262570.5	37	CCDS5828.1																																																																																			.		0.332	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338899.1	NM_017812	
SYCE1	93426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	135372389	135372390	+	Missense_Mutation	DNP	AG	AG	TT			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr10:135372389_135372390AG>TT	ENST00000343131.5	-	4	366_367	c.262_263CT>AA	c.(262-264)CTg>AAg	p.L88K	SYCE1_ENST00000432597.2_Missense_Mutation_p.L52K|SPRN_ENST00000541506.1_Intron|SYCE1_ENST00000368517.3_Missense_Mutation_p.L52K	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	88					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ACGCGAGTCCAGTTCCTTCTGC	0.53																																					p.L88K		.											.	SYCE1-91	0			c.C262A						.																																			SO:0001583	missense	93426	exon4			AGTCCAGTTCCTT	AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.262_263delinsTT	10.37:g.135372389_135372390delinsTT	ENSP00000341282:p.Leu88Lys	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	22.0	NM_001143764	0	0	0	0	0	B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	DNP	ENST00000343131.5	37	CCDS44501.1																																																																																			.		0.530	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_201564	
KLHL11	55175	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40010765	40010766	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-B1-A657-01A-11D-A31X-10	TCGA-B1-A657-10A-01D-A31X-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c22d5cb0-397b-480a-97ae-4bf07e07c1f0	86a94d68-d695-416e-a19a-d1f1d0952902	g.chr17:40010765_40010766TG>CT	ENST00000319121.3	-	2	1413_1414	c.1353_1354CA>AG	c.(1351-1356)gtCAaa>gtAGaa	p.K452E		NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	452										NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				AGCTTCCCTTTGACTTCTGTTA	0.376																																					p.K452E													.	KLHL11-90	0			c.C1353A						.																																			SO:0001583	missense	55175	exon2			CCCTTTGACTTCT		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.1353_1354delinsCT	17.37:g.40010765_40010766delinsCT	ENSP00000314608:p.Lys452Glu	Somatic	206	1		WXS	Illumina HiSeq	Phase_I	214	97	NM_018143	0	0	0	0	0		Missense_Mutation	DNP	ENST00000319121.3	37	CCDS11411.1																																																																																			.		0.376	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143	
