#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VCAM1	7412	hgsc.bcm.edu	37	1	101186217	101186217	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr1:101186217C>G	ENST00000294728.2	+	2	351	c.250C>G	c.(250-252)Cct>Gct	p.P84A	VCAM1_ENST00000370119.4_Intron|VCAM1_ENST00000370115.1_Missense_Mutation_p.P84A|VCAM1_ENST00000347652.2_Missense_Mutation_p.P84A	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	84	Ig-like C2-type 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	GACAATGAATCCTGTTAGTTT	0.458																																					p.P84A		.											.	VCAM1-90	0			c.C250G						.						108.0	94.0	99.0					1																	101186217		2203	4300	6503	SO:0001583	missense	7412	exon2			ATGAATCCTGTTA	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.250C>G	1.37:g.101186217C>G	ENSP00000294728:p.Pro84Ala	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	14	2	NM_001078	1	1	2720	2722	0	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	CCDS773.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.486427	0.44147	.	.	ENSG00000162692	ENST00000347652;ENST00000294728;ENST00000370115	T;T;T	0.08720	3.06;3.06;3.06	5.82	4.91	0.64330	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.156736	0.64402	D	0.000017	T	0.09069	0.0224	M	0.76002	2.32	0.45046	D	0.998063	P;P	0.45078	0.836;0.85	P;P	0.48227	0.455;0.571	T	0.02933	-1.1092	9	.	.	.	-13.1447	10.2074	0.43120	0.0:0.8461:0.0:0.1539	.	84;84	P19320-2;P19320	.;VCAM1_HUMAN	A	84	ENSP00000304611:P84A;ENSP00000294728:P84A;ENSP00000359133:P84A	.	P	+	1	0	VCAM1	100958805	0.909000	0.30893	0.809000	0.32408	0.400000	0.30750	1.327000	0.33746	1.462000	0.47948	0.655000	0.94253	CCT	.		0.458	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078	
PLA2G4A	5321	hgsc.bcm.edu	37	1	186916022	186916022	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr1:186916022C>G	ENST00000367466.3	+	12	1345	c.1193C>G	c.(1192-1194)tCc>tGc	p.S398C	PLA2G4A_ENST00000442353.2_Missense_Mutation_p.S338C	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	398	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	AGTGCCTTTTCCATATTGTTC	0.358																																					p.S398C		.											.	PLA2G4A-721	0			c.C1193G						.						152.0	148.0	150.0					1																	186916022		2203	4300	6503	SO:0001583	missense	5321	exon12			CCTTTTCCATATT	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.1193C>G	1.37:g.186916022C>G	ENSP00000356436:p.Ser398Cys	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_024420	0	0	0	0	0	B1AKG4|Q29R80	Missense_Mutation	SNP	ENST00000367466.3	37	CCDS1372.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.465195	0.84425	.	.	ENSG00000116711	ENST00000367466;ENST00000442353	T;T	0.23348	1.91;1.91	5.71	5.71	0.89125	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.43255	0.1239	L	0.37561	1.115	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.69307	0.963;0.949	T	0.26155	-1.0111	10	0.87932	D	0	-23.1063	18.8397	0.92177	0.0:1.0:0.0:0.0	.	338;398	E7EU42;P47712	.;PA24A_HUMAN	C	398;338	ENSP00000356436:S398C;ENSP00000406892:S338C	ENSP00000356436:S398C	S	+	2	0	PLA2G4A	185182645	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.518000	0.81795	2.685000	0.91497	0.585000	0.79938	TCC	.		0.358	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	
PARG	8505	broad.mit.edu	37	10	51093329	51093329	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr10:51093329C>T	ENST00000402038.3	-	4	294	c.295G>A	c.(295-297)Gca>Aca	p.A99T		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	584	A-domain.				carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)	p.A584T(1)		endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		TGAGCTTCTGCTTCTTCAAGT	0.318																																					p.A584T													.	PARG-948	1	Substitution - Missense(1)	kidney(1)	c.G1750A						.						235.0	183.0	198.0					10																	51093329		692	1589	2281	SO:0001583	missense	8505	exon8			CTTCTGCTTCTTC	AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.295G>A	10.37:g.51093329C>T	ENSP00000384408:p.Ala99Thr	Somatic	116	1		WXS	Illumina HiSeq	Phase_I	41	3	NM_003631	0	0	0	0	0	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Missense_Mutation	SNP	ENST00000402038.3	37		.	.	.	.	.	.	.	.	.	.	C	12.89	2.073258	0.36566	.	.	ENSG00000227345	ENST00000402038	.	.	.	3.88	2.96	0.34315	.	.	.	.	.	T	0.46678	0.1405	M	0.61703	1.905	.	.	.	B;B;P;P;P;B	0.41947	0.002;0.003;0.574;0.766;0.766;0.006	B;B;B;B;B;B	0.38616	0.006;0.006;0.191;0.179;0.277;0.01	T	0.56631	-0.7947	7	0.18710	T	0.47	-4.0352	11.9338	0.52862	0.0:0.9123:0.0:0.0877	.	502;584;135;99;124;584	Q86W56-2;Q86W56;A5YBK3;Q5SQP4;B4DX76;Q0MQR4	.;PARG_HUMAN;.;.;.;.	T	99	.	ENSP00000384408:A99T	A	-	1	0	PARG	50763335	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.907000	0.39897	0.952000	0.37798	0.407000	0.27541	GCA	.		0.318	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631	
ITPRIP	85450	ucsc.edu	37	10	106075205	106075205	+	Missense_Mutation	SNP	A	A	C			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr10:106075205A>C	ENST00000337478.1	-	2	776	c.605T>G	c.(604-606)gTg>gGg	p.V202G	RP11-127L20.5_ENST00000472915.2_RNA|ITPRIP_ENST00000278071.2_Missense_Mutation_p.V202G|ITPRIP_ENST00000358187.2_Missense_Mutation_p.V202G	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	202						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						TGGCCTGTCCACCTGCCAGTT	0.632																																					p.V202G													.	ITPRIP-90	0			c.T605G						.																																			SO:0001583	missense	85450	exon2			CTGTCCACCTGCC	AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.605T>G	10.37:g.106075205A>C	ENSP00000337178:p.Val202Gly	Somatic	123	27		WXS	Illumina HiSeq		269	78	NM_001272013	0	0	5	6	1	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	ENST00000337478.1	37	CCDS7557.1	.	.	.	.	.	.	.	.	.	.	A	11.71	1.721146	0.30503	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187	T;T;T	0.26067	1.76;1.76;1.76	5.37	1.76	0.24704	.	0.251839	0.38837	N	0.001552	T	0.27967	0.0689	M	0.74881	2.28	0.58432	D	0.999997	P	0.48589	0.912	B	0.41412	0.356	T	0.07712	-1.0758	10	0.87932	D	0	-16.2086	8.9471	0.35764	0.7067:0.0:0.2933:0.0	.	202	Q8IWB1	IPRI_HUMAN	G	202	ENSP00000337178:V202G;ENSP00000278071:V202G;ENSP00000350915:V202G	ENSP00000278071:V202G	V	-	2	0	ITPRIP	106065195	0.997000	0.39634	0.993000	0.49108	0.899000	0.52679	2.937000	0.48979	0.111000	0.17947	-0.385000	0.06624	GTG	.		0.632	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050204.1	NM_033397	
MRGPRX4	117196	ucsc.edu;bcgsc.ca	37	11	18195248	18195248	+	Silent	SNP	C	C	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr11:18195248C>T	ENST00000314254.3	+	1	865	c.445C>T	c.(445-447)Ctg>Ttg	p.L149L	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GCTCTGGGGCCTGTCCCTGCT	0.577																																					p.L149L													.	MRGPRX4-91	0			c.C445T						.						240.0	229.0	233.0					11																	18195248		2199	4293	6492	SO:0001819	synonymous_variant	117196	exon1			TGGGGCCTGTCCC	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.445C>T	11.37:g.18195248C>T		Somatic	483	4		WXS	Illumina HiSeq		767	131	NM_054032	0	0	0	0	0	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Silent	SNP	ENST00000314254.3	37	CCDS7831.1																																																																																			.		0.577	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389788.1	NM_054032	
C1QTNF4	114900	hgsc.bcm.edu	37	11	47611940	47611940	+	Missense_Mutation	SNP	C	C	G	rs142453721	byFrequency	TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr11:47611940C>G	ENST00000302514.3	-	2	939	c.423G>C	c.(421-423)caG>caC	p.Q141H		NM_031909.2	NP_114115.2	Q9BXJ3	C1QT4_HUMAN	C1q and tumor necrosis factor related protein 4	141	C1q 1. {ECO:0000255|PROSITE- ProRule:PRU00368}.			Q -> H (in Ref. 1; AAK17962). {ECO:0000305}.		extracellular space (GO:0005615)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						CTAGCGCGTACTGCGGGGCGC	0.771													C|||	86	0.0171725	0.0023	0.0303	5008	,	,		2805	0.002		0.0537	False		,,,				2504	0.0061				p.Q141H		.											.	C1QTNF4-90	0			c.G423C						.						1.0	1.0	1.0					11																	47611940		1018	2050	3068	SO:0001583	missense	114900	exon2			CGCGTACTGCGGG	AF329838	CCDS7942.1	11q11	2008-07-18				ENSG00000172247			14346	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 4"""	614911				16094384	Standard	NM_031909		Approved	CTRP4, ZACRP4	uc001ngc.2	Q9BXJ3		ENST00000302514.3:c.423G>C	11.37:g.47611940C>G	ENSP00000302274:p.Gln141His	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	4	2	NM_031909	0	0	0	0	0	Q8IV25	Missense_Mutation	SNP	ENST00000302514.3	37	CCDS7942.1	41	0.018772893772893772	2	0.0040650406504065045	9	0.024861878453038673	3	0.005244755244755245	27	0.03562005277044855	C	16.01	3.000217	0.54147	.	.	ENSG00000172247	ENST00000302514	T	0.74947	-0.89	4.5	3.57	0.40892	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.708561	0.13520	U	0.381762	T	0.37571	0.1008	L	0.29908	0.895	0.37167	D	0.902841	P	0.48998	0.918	P	0.52267	0.694	T	0.54296	-0.8315	10	0.22706	T	0.39	.	8.4836	0.33059	0.0:0.7611:0.1559:0.0829	.	141	Q9BXJ3	C1QT4_HUMAN	H	141	ENSP00000302274:Q141H	ENSP00000302274:Q141H	Q	-	3	2	C1QTNF4	47568516	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	0.739000	0.26173	0.981000	0.38548	0.462000	0.41574	CAG	C|0.981;G|0.019		0.771	C1QTNF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391772.1	NM_031909	
NAALAD2	10003	broad.mit.edu	37	11	89911214	89911214	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr11:89911214A>T	ENST00000534061.1	+	16	2017	c.1787A>T	c.(1786-1788)aAc>aTc	p.N596I	NAALAD2_ENST00000321955.4_Missense_Mutation_p.N563I|NAALAD2_ENST00000375944.3_Intron	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	596					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GCTTTGAAAAACTATGCAGCA	0.343																																					p.N596I													.	NAALAD2-92	0			c.A1787T						.						76.0	81.0	79.0					11																	89911214		2201	4299	6500	SO:0001583	missense	10003	exon16			TGAAAAACTATGC	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.1787A>T	11.37:g.89911214A>T	ENSP00000432481:p.Asn596Ile	Somatic	218	0		WXS	Illumina HiSeq	Phase_I	234	5	NM_005467	0	0	0	0	0	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	a	10.98	1.504470	0.26949	.	.	ENSG00000077616	ENST00000534061;ENST00000321955	T;T	0.31510	1.49;1.49	5.63	3.29	0.37713	Transferrin receptor-like, dimerisation domain (2);	0.216956	0.40640	N	0.001045	T	0.16385	0.0394	L	0.28458	0.855	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13469	-1.0508	9	.	.	.	-7.9053	1.5294	0.02532	0.4262:0.301:0.1284:0.1444	.	596	Q9Y3Q0	NALD2_HUMAN	I	596;563	ENSP00000432481:N596I;ENSP00000320083:N563I	.	N	+	2	0	NAALAD2	89550862	0.543000	0.26434	1.000000	0.80357	0.813000	0.45954	0.092000	0.15066	0.415000	0.25817	-0.270000	0.10280	AAC	.		0.343	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
KMT2D	8085	broad.mit.edu	37	12	49445198	49445198	+	Silent	SNP	A	A	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr12:49445198A>G	ENST00000301067.7	-	10	2267	c.2268T>C	c.(2266-2268)ccT>ccC	p.P756P		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	756	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GTGGCTCCTCAGGCCGGGGGG	0.692																																					p.P756P													.	MLL2-612	0			c.T2268C						.						20.0	23.0	22.0					12																	49445198		1725	3776	5501	SO:0001819	synonymous_variant	8085	exon10			CTCCTCAGGCCGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2268T>C	12.37:g.49445198A>G		Somatic	94	0		WXS	Illumina HiSeq	Phase_I	137	3	NM_003482	0	0	1	1	0	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.692	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
SLC46A3	283537	hgsc.bcm.edu	37	13	29278214	29278214	+	Silent	SNP	A	A	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr13:29278214A>G	ENST00000266943.6	-	5	1536	c.1167T>C	c.(1165-1167)gcT>gcC	p.A389A	SLC46A3_ENST00000380814.4_Silent_p.A389A|RNU6-53P_ENST00000365367.1_RNA|SLC46A3_ENST00000475385.1_5'UTR	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3	389					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		TTTCTAAGAAAGCAATACAAG	0.408																																					p.A389A		.											.	SLC46A3-69	0			c.T1167C						.						69.0	74.0	72.0					13																	29278214		2203	4300	6503	SO:0001819	synonymous_variant	283537	exon5			TAAGAAAGCAATA		CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.1167T>C	13.37:g.29278214A>G		Somatic	114	0		WXS	Illumina HiSeq	Phase_I	26	2	NM_181785	0	0	39	39	0	Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	Silent	SNP	ENST00000266943.6	37	CCDS9332.1																																																																																			.		0.408	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276111.1	NM_181785	
IPO4	79711	ucsc.edu;bcgsc.ca	37	14	24646579	24646579	+	IGR	SNP	G	G	C			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr14:24646579G>C	ENST00000354464.6	-	0	3646				REC8_ENST00000311457.3_Missense_Mutation_p.A242P|REC8_ENST00000559919.1_Missense_Mutation_p.A242P	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4						DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		CCCACCTCCAGCTCCTGCAGA	0.567																																					p.A242P													.	REC8-90	0			c.G724C						.						81.0	84.0	83.0					14																	24646579		1932	4124	6056	SO:0001628	intergenic_variant	9985	exon9			CCTCCAGCTCCTG	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801		14.37:g.24646579G>C		Somatic	173	3		WXS	Illumina HiSeq		158	80	NM_001048205	0	0	0	2	2	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	ENST00000354464.6	37	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298998	0.40694	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	T	0.24151	1.87	5.04	4.11	0.48088	.	0.320873	0.29389	N	0.012292	T	0.22975	0.0555	L	0.51422	1.61	0.09310	N	1	B;B	0.19073	0.033;0.02	B;B	0.17433	0.018;0.008	T	0.06972	-1.0797	10	0.29301	T	0.29	-0.117	11.5558	0.50748	0.0:0.1793:0.8207:0.0	.	243;243	O95072-2;O95072	.;REC8_HUMAN	P	242	ENSP00000308699:A242P	ENSP00000308699:A242P	A	+	1	0	REC8	23716419	0.449000	0.25689	0.573000	0.28510	0.428000	0.31595	1.284000	0.33249	2.630000	0.89119	0.561000	0.74099	GCT	.		0.567	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
DTD2	112487	hgsc.bcm.edu	37	14	31926584	31926584	+	Missense_Mutation	SNP	G	G	A	rs17097904	byFrequency	TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr14:31926584G>A	ENST00000310850.4	-	1	132	c.16C>T	c.(16-18)Cgg>Tgg	p.R6W	DTD2_ENST00000356180.4_Missense_Mutation_p.R6W|RP11-176H8.1_ENST00000547378.1_Missense_Mutation_p.R6W	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	6			R -> W (in dbSNP:rs17097904).		D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)	p.R6W(1)									TGAGGAATCCGGCTACCCTCA	0.697																																					p.R6W		.											.	.	1	Substitution - Missense(1)	skin(1)	c.C16T						.						12.0	12.0	12.0					14																	31926584		2183	4278	6461	SO:0001583	missense	112487	exon1			GAATCCGGCTACC	BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.16C>T	14.37:g.31926584G>A	ENSP00000312224:p.Arg6Trp	Somatic	11	1		WXS	Illumina HiSeq	Phase_I	17	7	NM_080664	0	0	21	30	9	D3DS87	Missense_Mutation	SNP	ENST00000310850.4	37	CCDS9643.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758136	0.69763	.	.	ENSG00000203546;ENSG00000129480;ENSG00000129480	ENST00000547378;ENST00000310850;ENST00000356180	T;T;T	0.55052	0.54;0.71;0.71	4.84	2.97	0.34412	D-Tyr tRNAtyr deacylase-like domain (1);	0.302778	0.30901	N	0.008651	T	0.52419	0.1733	M	0.69823	2.125	0.36855	D	0.888115	D	0.67145	0.996	B	0.43623	0.425	T	0.65220	-0.6221	10	0.87932	D	0	.	11.9711	0.53063	0.0:0.0:0.5428:0.4572	rs17097904	6	Q96FN9	DTD2_HUMAN	W	6	ENSP00000447056:R6W;ENSP00000312224:R6W;ENSP00000348503:R6W	ENSP00000312224:R6W	R	-	1	2	C14orf126;RP11-176H8.1	30996335	0.001000	0.12720	0.005000	0.12908	0.004000	0.04260	0.080000	0.14802	0.618000	0.30179	0.561000	0.74099	CGG	.		0.697	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276614.2	NM_080664	
CBFA2T3	863	hgsc.bcm.edu	37	16	88943542	88943542	+	Missense_Mutation	SNP	C	C	T	rs200760802	byFrequency	TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr16:88943542C>T	ENST00000268679.4	-	12	2200	c.1804G>A	c.(1804-1806)Gtg>Atg	p.V602M	CBFA2T3_ENST00000436887.2_Missense_Mutation_p.V564M|CBFA2T3_ENST00000360302.2_Missense_Mutation_p.V516M|CBFA2T3_ENST00000327483.5_Missense_Mutation_p.V516M|CBFA2T3_ENST00000448839.1_Missense_Mutation_p.V526M	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	602					cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		TCGGCCACCACGGCTGTGGGG	0.726			T	RUNX1	AML								c|||	11	0.00219649	0.0015	0.0	5008	,	,		14091	0.0		0.004	False		,,,				2504	0.0051				p.V602M		.		Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	.	CBFA2T3-722	0			c.G1804A						.	C	MET/VAL,MET/VAL	8,4120		0,8,2056	7.0	7.0	7.0		1804,1546	1.4	0.0	16		7	49,7995		0,49,3973	yes	missense,missense	CBFA2T3	NM_005187.5,NM_175931.2	21,21	0,57,6029	TT,TC,CC		0.6091,0.1938,0.4683	benign,benign	602/654,516/568	88943542	57,12115	2064	4022	6086	SO:0001583	missense	863	exon12			CCACCACGGCTGT	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.1804G>A	16.37:g.88943542C>T	ENSP00000268679:p.Val602Met	Somatic	4	0		WXS	Illumina HiSeq	Phase_I	7	6	NM_005187	0	0	0	0	0	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	ENST00000268679.4	37	CCDS10972.1	.	.	.	.	.	.	.	.	.	.	C	8.769	0.925438	0.18056	0.001938	0.006091	ENSG00000129993	ENST00000327483;ENST00000268679;ENST00000436887;ENST00000448839;ENST00000360302	T;T;T;T;T	0.45668	1.47;0.89;0.89;1.48;1.47	4.07	1.36	0.22044	.	2.039650	0.03219	U	0.177234	T	0.20251	0.0487	N	0.22421	0.69	0.09310	N	1	B;B	0.26318	0.146;0.03	B;B	0.19946	0.012;0.027	T	0.15723	-1.0427	10	0.42905	T	0.14	0.553	1.7885	0.03046	0.176:0.4794:0.2008:0.1438	.	602;516	O75081;O75081-2	MTG16_HUMAN;.	M	516;602;564;526;516	ENSP00000332122:V516M;ENSP00000268679:V602M;ENSP00000395739:V564M;ENSP00000401254:V526M;ENSP00000353449:V516M	ENSP00000268679:V602M	V	-	1	0	CBFA2T3	87471043	0.163000	0.22920	0.000000	0.03702	0.006000	0.05464	1.796000	0.38794	0.254000	0.21573	0.485000	0.47835	GTG	.		0.726	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187	
VPS53	55275	broad.mit.edu	37	17	465803	465803	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr17:465803G>A	ENST00000571805.1	-	14	1632	c.1496C>T	c.(1495-1497)aCc>aTc	p.T499I	VPS53_ENST00000291074.5_Missense_Mutation_p.T470I|VPS53_ENST00000437048.2_Missense_Mutation_p.T499I|VPS53_ENST00000576149.1_5'UTR|VPS53_ENST00000401468.3_Missense_Mutation_p.T222I|VPS53_ENST00000446250.2_Missense_Mutation_p.T301I|VPS53_ENST00000574029.1_Intron			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	499					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		CTGGAAAATGGTGGTCAGGGC	0.537																																					p.T499I													.	VPS53-90	0			c.C1496T						.						85.0	78.0	80.0					17																	465803		2203	4300	6503	SO:0001583	missense	55275	exon14			AAAATGGTGGTCA		CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.1496C>T	17.37:g.465803G>A	ENSP00000459312:p.Thr499Ile	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	149	4	NM_001128159	0	0	20	20	0	A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	ENST00000571805.1	37		.	.	.	.	.	.	.	.	.	.	G	15.51	2.854197	0.51270	.	.	ENSG00000141252	ENST00000437048;ENST00000446250;ENST00000291074;ENST00000401468;ENST00000389040	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	6.07	5.1	0.69264	.	0.042101	0.85682	D	0.000000	T	0.22975	0.0555	N	0.24115	0.695	0.80722	D	1	B;B;B;B;B	0.15141	0.012;0.001;0.0;0.0;0.001	B;B;B;B;B	0.21546	0.035;0.002;0.005;0.002;0.005	T	0.02781	-1.1111	10	0.36615	T	0.2	-26.6231	13.8962	0.63773	0.0721:0.0:0.9279:0.0	.	222;499;301;499;470	E7EVT8;Q5VIR6-4;G3V0H8;Q5VIR6;Q5VIR6-2	.;.;.;VPS53_HUMAN;.	I	499;301;470;222;451	ENSP00000401435:T499I;ENSP00000394386:T301I;ENSP00000291074:T470I;ENSP00000384294:T222I;ENSP00000373692:T451I	ENSP00000291074:T470I	T	-	2	0	VPS53	412553	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.575000	0.82447	2.884000	0.98904	0.655000	0.94253	ACC	.		0.537	VPS53-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000436940.2	NM_018289	
KRTAP1-5	83895	hgsc.bcm.edu	37	17	39183062	39183062	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr17:39183062T>C	ENST00000361883.5	-	1	392	c.346A>G	c.(346-348)Atc>Gtc	p.I116V		NM_031957.1	NP_114163.1	Q9BYS1	KRA15_HUMAN	keratin associated protein 1-5	116	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(2)|kidney(1)|lung(9)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	17		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)			CACCACCTGATACGGGTGCTC	0.642																																					p.I116V		.											.	.	0			c.A346G						.						24.0	30.0	28.0					17																	39183062		2127	4246	6373	SO:0001583	missense	83895	exon1			ACCTGATACGGGT	AJ406928	CCDS42321.1	17q21.2	2013-06-25			ENSG00000221852	ENSG00000221852		"""Keratin associated proteins"""	16777	protein-coding gene	gene with protein product		608822				11279113	Standard	NM_031957		Approved	KAP1.5	uc002hvu.3	Q9BYS1	OTTHUMG00000133587	ENST00000361883.5:c.346A>G	17.37:g.39183062T>C	ENSP00000355302:p.Ile116Val	Somatic	46	2		WXS	Illumina HiSeq	Phase_I	98	5	NM_031957	0	0	0	0	0	A6NJW6|A6NLZ6|B6ZDR1|Q52LP6	Missense_Mutation	SNP	ENST00000361883.5	37	CCDS42321.1	.	.	.	.	.	.	.	.	.	.	T	6.541	0.468074	0.12461	.	.	ENSG00000221852	ENST00000361883;ENST00000543389	T	0.29655	1.56	5.49	-0.0728	0.13738	.	.	.	.	.	T	0.14399	0.0348	N	0.04768	-0.165	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.26360	-1.0105	9	0.36615	T	0.2	.	8.8456	0.35168	0.0:0.5303:0.0:0.4697	.	116	Q9BYS1	KRA15_HUMAN	V	116;106	ENSP00000355302:I116V	ENSP00000355302:I116V	I	-	1	0	KRTAP1-5	36436588	0.006000	0.16342	0.012000	0.15200	0.491000	0.33493	-0.214000	0.09292	-0.197000	0.10350	0.459000	0.35465	ATC	.		0.642	KRTAP1-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257691.1		
MRC2	9902	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	60766323	60766323	+	Splice_Site	SNP	T	T	C			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr17:60766323T>C	ENST00000303375.5	+	23	3736		c.e23+2		MRC2_ENST00000446119.2_Splice_Site|MRC2_ENST00000580916.1_Splice_Site	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2						collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						AGGGCACGGGTATGTGTCACC	0.642																																					.		.											.	MRC2-117	0			c.3334+2T>C						.						42.0	35.0	37.0					17																	60766323		2203	4300	6503	SO:0001630	splice_region_variant	9902	exon23			CACGGGTATGTGT	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3334+2T>C	17.37:g.60766323T>C		Somatic	54	0		WXS	Illumina HiSeq	Phase_I	81	14	NM_006039	0	0	0	0	0	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Splice_Site	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.155893	0.78114	.	.	ENSG00000011028	ENST00000303375;ENST00000446119	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3771	0.66886	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRC2	58120055	1.000000	0.71417	0.863000	0.33907	0.565000	0.35776	5.032000	0.64140	1.978000	0.57642	0.459000	0.35465	.	.		0.642	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		Intron
NOL4	8715	hgsc.bcm.edu	37	18	31709939	31709939	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr18:31709939C>G	ENST00000261592.5	-	2	607	c.310G>C	c.(310-312)Gtg>Ctg	p.V104L	NOL4_ENST00000269185.4_5'UTR|NOL4_ENST00000538587.1_Missense_Mutation_p.V30L|NOL4_ENST00000589544.1_Missense_Mutation_p.V104L|NOL4_ENST00000535475.1_5'UTR	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	104						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TCTTCAACCACAGCTACCCGT	0.388																																					p.V104L		.											.	NOL4-93	0			c.G310C						.						109.0	97.0	101.0					18																	31709939		2203	4300	6503	SO:0001583	missense	8715	exon2			CAACCACAGCTAC	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.310G>C	18.37:g.31709939C>G	ENSP00000261592:p.Val104Leu	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	34	2	NM_003787	0	0	0	0	0	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	C	30	5.049814	0.93740	.	.	ENSG00000101746	ENST00000261592;ENST00000538587	D	0.83755	-1.76	5.61	5.61	0.85477	.	.	.	.	.	D	0.89708	0.6793	L	0.58810	1.83	0.80722	D	1	P;P;D	0.61697	0.902;0.902;0.99	D;P;D	0.70935	0.927;0.893;0.971	D	0.90122	0.4200	9	0.72032	D	0.01	-8.97	18.6148	0.91299	0.0:1.0:0.0:0.0	.	30;104;104	B4DSQ0;O94818;O94818-2	.;NOL4_HUMAN;.	L	104;30	ENSP00000261592:V104L	ENSP00000261592:V104L	V	-	1	0	NOL4	29963937	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.329000	0.79170	2.639000	0.89480	0.585000	0.79938	GTG	.		0.388	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
AMH	268	hgsc.bcm.edu	37	19	2251512	2251512	+	Silent	SNP	T	T	A	rs7252789	byFrequency	TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr19:2251512T>A	ENST00000221496.4	+	5	1261	c.1239T>A	c.(1237-1239)ggT>ggA	p.G413G	MIR4321_ENST00000592276.1_RNA	NM_000479.3	NP_000470	P03971	MIS_HUMAN	anti-Mullerian hormone	413					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			lung(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTGCCCAGGTGGCCCCGGCG	0.776									Persistant Mullerian Duct Syndrome (type I and II)				T|||	4602	0.91893	0.9259	0.951	5008	,	,		7149	0.9683		0.9354	False		,,,				2504	0.819				p.G413G		.											.	AMH-130	0			c.T1239A						.						1.0	1.0	1.0					19																	2251512		452	789	1241	SO:0001819	synonymous_variant	268	exon5	Familial Cancer Database	PMDS, Persistent Oviduct Syndrome	CCCAGGTGGCCCC	K03474	CCDS12085.1	19p13.3	2014-01-30				ENSG00000104899		"""Endogenous ligands"""	464	protein-coding gene	gene with protein product		600957				3754790, 18784351	Standard	NM_000479		Approved	MIS	uc002lvh.2	P03971		ENST00000221496.4:c.1239T>A	19.37:g.2251512T>A		Somatic	1	1		WXS	Illumina HiSeq	Phase_I	4	4	NM_000479	0	0	0	0	0	O75246|Q6GTN3	Silent	SNP	ENST00000221496.4	37	CCDS12085.1																																																																																			T|0.069;A|0.931		0.776	AMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451276.3	NM_000479	
ACSBG2	81616	hgsc.bcm.edu	37	19	6177251	6177251	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr19:6177251T>G	ENST00000586696.1	+	8	1026	c.750T>G	c.(748-750)atT>atG	p.I250M	ACSBG2_ENST00000252669.5_Missense_Mutation_p.I250M|ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000588304.1_Missense_Mutation_p.I200M|ACSBG2_ENST00000591403.1_Missense_Mutation_p.I250M|ACSBG2_ENST00000588485.1_Missense_Mutation_p.I63M			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	250					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.I250M(3)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCACGTGGATTGCAGGAGCAG	0.433																																					p.I250M		.											.	ACSBG2-23	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.T750G						.						97.0	69.0	78.0					19																	6177251		2203	4300	6503	SO:0001583	missense	81616	exon8			GTGGATTGCAGGA		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.750T>G	19.37:g.6177251T>G	ENSP00000465589:p.Ile250Met	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	64	4	NM_030924	0	0	0	0	0	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	37	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	T	8.593	0.885063	0.17540	.	.	ENSG00000130377	ENST00000252669	T	0.10477	2.87	4.48	-8.78	0.00824	AMP-dependent synthetase/ligase (1);	1.500690	0.04439	N	0.370611	T	0.03564	0.0102	N	0.03154	-0.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.16722	0.016;0.007	T	0.41124	-0.9526	10	0.49607	T	0.09	-6.8573	2.6506	0.04998	0.499:0.0951:0.1226:0.2833	.	250;250	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	M	250	ENSP00000252669:I250M	ENSP00000252669:I250M	I	+	3	3	ACSBG2	6128251	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.884000	0.00342	-1.157000	0.02815	-0.778000	0.03378	ATT	.		0.433	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
UBA52	7311	hgsc.bcm.edu;broad.mit.edu	37	19	18685757	18685757	+	Missense_Mutation	SNP	A	A	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr19:18685757A>T	ENST00000442744.2	+	4	326	c.268A>T	c.(268-270)Aac>Tac	p.N90Y	UBA52_ENST00000595158.1_Missense_Mutation_p.N90Y|UBA52_ENST00000596273.1_Missense_Mutation_p.N90Y|UBA52_ENST00000595683.1_Missense_Mutation_p.N90Y|UBA52_ENST00000598780.1_Missense_Mutation_p.N90Y|UBA52_ENST00000597451.1_Missense_Mutation_p.N90Y|UBA52_ENST00000596304.1_Missense_Mutation_p.N90Y|UBA52_ENST00000599551.1_Missense_Mutation_p.N90Y|UBA52_ENST00000599595.1_Missense_Mutation_p.N90Y|UBA52_ENST00000430157.2_Missense_Mutation_p.N90Y|CRLF1_ENST00000594325.1_Intron	NM_001033930.1	NP_001029102.1	P62987	RL40_HUMAN	ubiquitin A-52 residue ribosomal protein fusion product 1	90					activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|viral transcription (GO:0019083)|virion assembly (GO:0019068)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(2)	3						CCAGAAATACAACTGCGACAA	0.612																																					p.N90Y		.											.	UBA52-90	0			c.A268T						.						46.0	42.0	43.0					19																	18685757		2203	4300	6503	SO:0001583	missense	7311	exon4			AAATACAACTGCG		CCDS12382.1	19p13.1-p12	2011-04-06			ENSG00000221983	ENSG00000221983		"""L ribosomal proteins"""	12458	protein-coding gene	gene with protein product	"""ribosomal protein L40"", ""ubiquitin-52 amino acid fusion protein"", ""ubiquitin carboxyl extension protein 52"", ""60S ribosomal protein L40"", ""ubiquitin-CEP52"""	191321				8188300	Standard	XM_005260051		Approved	RPL40, CEP52, HUBCEP52, MGC57125, MGC126879, MGC126881, L40	uc002njs.3	P62987		ENST00000442744.2:c.268A>T	19.37:g.18685757A>T	ENSP00000388107:p.Asn90Tyr	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	128	13	NM_001033930	0	0	756	775	19	P02248|P02249|P02250|P14793|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000442744.2	37	CCDS12382.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.273436	0.80580	.	.	ENSG00000221983	ENST00000442744;ENST00000430157	T;T	0.45668	0.89;0.89	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.67822	0.2934	M	0.93197	3.39	0.58432	D	0.99999	D	0.59767	0.986	P	0.59424	0.857	T	0.76822	-0.2817	10	0.87932	D	0	-2.438	11.7658	0.51930	1.0:0.0:0.0:0.0	.	90	P62987	RL40_HUMAN	Y	90	ENSP00000388107:N90Y;ENSP00000396910:N90Y	ENSP00000396910:N90Y	N	+	1	0	UBA52	18546757	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.564000	0.60830	1.667000	0.50832	0.379000	0.24179	AAC	.		0.612	UBA52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465117.2	NM_003333	
GRIN2D	2906	hgsc.bcm.edu	37	19	48945880	48945880	+	Silent	SNP	T	T	C	rs62130268	byFrequency	TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr19:48945880T>C	ENST00000263269.3	+	13	2785	c.2697T>C	c.(2695-2697)gcT>gcC	p.A899A		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	899					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGCAGCGCTGAGGCCGCCC	0.781													c|||	3742	0.747204	0.6188	0.8545	5008	,	,		4716	0.6548		0.8887	False		,,,				2504	0.7945				p.A899A		.											.	GRIN2D-156	0			c.T2697C						.			1689,437		638,413,12	1.0	1.0	1.0		2697	-3.3	1.0	19	dbSNP_129	1	3712,202		1757,198,2	no	coding-synonymous	GRIN2D	NM_000836.2		2395,611,14	CC,CT,TT		5.161,20.555,10.5795		899/1337	48945880	5401,639	1063	1957	3020	SO:0001819	synonymous_variant	2906	exon13			CAGCGCTGAGGCC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2697T>C	19.37:g.48945880T>C		Somatic	1	1		WXS	Illumina HiSeq	Phase_I	4	4	NM_000836	0	0	0	1	1		Silent	SNP	ENST00000263269.3	37	CCDS12719.1																																																																																			T|0.245;C|0.755		0.781	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
ALK	238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	29432730	29432730	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr2:29432730C>G	ENST00000389048.3	-	25	4664	c.3758G>C	c.(3757-3759)aGa>aCa	p.R1253T	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1253	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GAGGCAGTTTCTGGCAGCAAT	0.493			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.R1253T		.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK-3833	0			c.G3758C						.						105.0	107.0	106.0					2																	29432730		2203	4300	6503	SO:0001583	missense	238	exon25	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CAGTTTCTGGCAG	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.3758G>C	2.37:g.29432730C>G	ENSP00000373700:p.Arg1253Thr	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	105	16	NM_004304	0	0	0	0	0	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983743	0.93044	.	.	ENSG00000171094	ENST00000389048	D	0.87571	-2.27	5.2	5.2	0.72013	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000057	D	0.95468	0.8528	H	0.94385	3.53	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96698	0.9516	9	.	.	.	.	17.5154	0.87771	0.0:1.0:0.0:0.0	.	1253	Q9UM73	ALK_HUMAN	T	1253	ENSP00000373700:R1253T	.	R	-	2	0	ALK	29286234	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.462000	0.80851	2.418000	0.82041	0.655000	0.94253	AGA	.		0.493	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
LRP1B	53353	hgsc.bcm.edu	37	2	141032014	141032014	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr2:141032014T>C	ENST00000389484.3	-	85	14092	c.13121A>G	c.(13120-13122)gAc>gGc	p.D4374G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4374	EGF-like 21. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATCTTCACTGTCTTTATTTAT	0.393										TSP Lung(27;0.18)																											p.D4374G	Colon(99;50 2074 2507 20106)	.											.	LRP1B-311	0			c.A13121G						.						116.0	106.0	110.0					2																	141032014		2203	4300	6503	SO:0001583	missense	53353	exon85			TCACTGTCTTTAT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13121A>G	2.37:g.141032014T>C	ENSP00000374135:p.Asp4374Gly	Somatic	214	1		WXS	Illumina HiSeq	Phase_I	36	2	NM_018557	0	0	0	0	0	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.22|16.22	3.061483|3.061483	0.55432|0.55432	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977;ENST00000442974	D|.	0.90069|.	-2.61|.	5.32|5.32	2.95|2.95	0.34219|0.34219	.|.	0.076891|.	0.53938|.	U|.	0.000043|.	T|T	0.18383|0.18383	0.0441|0.0441	N|N	0.01522|0.01522	-0.82|-0.82	0.40380|0.40380	D|D	0.979439|0.979439	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.05451|0.05451	-1.0884|-1.0884	10|5	0.25751|.	T|.	0.34|.	.|.	7.8801|7.8801	0.29616|0.29616	0.0:0.163:0.0:0.837|0.0:0.163:0.0:0.837	.|.	4374|.	Q9NZR2|.	LRP1B_HUMAN|.	G|A	4374;4312|606;106	ENSP00000374135:D4374G|.	ENSP00000374135:D4374G|.	D|T	-|-	2|1	0|0	LRP1B|LRP1B	140748484|140748484	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.990000|0.990000	0.78478|0.78478	2.892000|2.892000	0.48625|0.48625	0.853000|0.853000	0.35312|0.35312	0.533000|0.533000	0.62120|0.62120	GAC|ACA	.		0.393	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
TTN	7273	ucsc.edu;bcgsc.ca	37	2	179476553	179476553	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr2:179476553G>T	ENST00000591111.1	-	218	45784	c.45560C>A	c.(45559-45561)gCt>gAt	p.A15187D	TTN_ENST00000589042.1_Missense_Mutation_p.A16828D|TTN_ENST00000359218.5_Missense_Mutation_p.A7888D|TTN_ENST00000460472.2_Missense_Mutation_p.A7763D|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A7955D|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A14260D|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15187	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCATTTTCAGCCCGAACCTG	0.458																																					p.A16828D													.	TTN-636	0			c.C50483A						.						134.0	128.0	130.0					2																	179476553		1927	4145	6072	SO:0001583	missense	7273	exon268			TTTTCAGCCCGAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45560C>A	2.37:g.179476553G>T	ENSP00000465570:p.Ala15187Asp	Somatic	311	3		WXS	Illumina HiSeq		42	14	NM_001267550	0	0	6	9	3	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	12.70	2.015567	0.35511	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	5.97	5.08	0.68730	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87637	0.6227	H	0.97940	4.11	0.80722	D	1	D;D;D;D	0.62365	0.991;0.991;0.991;0.991	D;D;D;D	0.64776	0.929;0.929;0.929;0.929	D	0.91566	0.5268	9	0.87932	D	0	.	15.4698	0.75432	0.0673:0.0:0.9327:0.0	.	7763;7888;7955;15187	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	14260;7763;7955;7888;7763	ENSP00000343764:A14260D;ENSP00000434586:A7763D;ENSP00000340554:A7955D;ENSP00000352154:A7888D	ENSP00000340554:A7955D	A	-	2	0	TTN	179184798	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	7.952000	0.87827	2.828000	0.97474	0.650000	0.86243	GCT	.		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
THBD	7056	broad.mit.edu	37	20	23029807	23029807	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr20:23029807G>A	ENST00000377103.2	-	1	571	c.335C>T	c.(334-336)aCg>aTg	p.T112M		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	112	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	GTTGTCTCCCGTAACCCACTG	0.716																																					p.T112M													.	THBD-90	0			c.C335T						.						15.0	10.0	12.0					20																	23029807		2174	4264	6438	SO:0001583	missense	7056	exon1			TCTCCCGTAACCC		CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.335C>T	20.37:g.23029807G>A	ENSP00000366307:p.Thr112Met	Somatic	10	0		WXS	Illumina HiSeq	Phase_I	16	5	NM_000361	0	0	0	0	0	Q8IV29|Q9UC32	Missense_Mutation	SNP	ENST00000377103.2	37	CCDS13148.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095410	0.56075	.	.	ENSG00000178726	ENST00000377103;ENST00000503590	T	0.56611	0.45	5.71	5.71	0.89125	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.162218	0.40640	U	0.001050	T	0.74604	0.3738	M	0.79258	2.445	0.30209	N	0.797945	D	0.89917	1.0	D	0.76071	0.987	T	0.74383	-0.3683	10	0.87932	D	0	-19.0767	18.836	0.92162	0.0:0.0:1.0:0.0	.	112	P07204	TRBM_HUMAN	M	112;94	ENSP00000366307:T112M	ENSP00000366307:T112M	T	-	2	0	THBD	22977807	1.000000	0.71417	0.309000	0.25155	0.229000	0.25112	6.436000	0.73417	2.703000	0.92315	0.549000	0.68633	ACG	.		0.716	THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078307.2		
CDC42EP1	11135	broad.mit.edu	37	22	37962631	37962631	+	Missense_Mutation	SNP	T	T	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr22:37962631T>G	ENST00000249014.4	+	2	695	c.275T>G	c.(274-276)gTg>gGg	p.V92G		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	92					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					GTGCGGAGGGTGGGGGCGCCC	0.697																																					p.V92G													.	CDC42EP1-90	0			c.T275G						.						27.0	29.0	28.0					22																	37962631		2201	4293	6494	SO:0001583	missense	11135	exon2			GGAGGGTGGGGGC	M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.275T>G	22.37:g.37962631T>G	ENSP00000249014:p.Val92Gly	Somatic	71	15		WXS	Illumina HiSeq	Phase_I	66	28	NM_152243	0	0	11	12	1	A8K825|Q96GN1	Missense_Mutation	SNP	ENST00000249014.4	37	CCDS13949.1	.	.	.	.	.	.	.	.	.	.	T	8.072	0.770536	0.15983	.	.	ENSG00000128283	ENST00000249014	T	0.31247	1.5	5.22	3.03	0.35002	.	0.247549	0.30036	N	0.010569	T	0.20495	0.0493	L	0.39898	1.24	0.22728	N	0.99881	B	0.12630	0.006	B	0.13407	0.009	T	0.18023	-1.0350	10	0.20046	T	0.44	-20.0019	6.2589	0.20889	0.0:0.1809:0.2291:0.59	.	92	Q00587	BORG5_HUMAN	G	92	ENSP00000249014:V92G	ENSP00000249014:V92G	V	+	2	0	CDC42EP1	36292577	0.001000	0.12720	0.742000	0.31022	0.794000	0.44872	-0.110000	0.10824	0.841000	0.35020	0.460000	0.39030	GTG	.		0.697	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318993.1	NM_152243	
SLC9C1	285335	broad.mit.edu	37	3	111958847	111958847	+	Missense_Mutation	SNP	C	C	G	rs374694708		TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr3:111958847C>G	ENST00000305815.5	-	12	1538	c.1286G>C	c.(1285-1287)cGt>cCt	p.R429P	SLC9C1_ENST00000487372.1_Missense_Mutation_p.R381P	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	429					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TGTGGCATCACGAAGACCTTT	0.338																																					p.R429P													.	.	0			c.G1286C						.						97.0	86.0	90.0					3																	111958847		2203	4300	6503	SO:0001583	missense	285335	exon12			GCATCACGAAGAC	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.1286G>C	3.37:g.111958847C>G	ENSP00000306627:p.Arg429Pro	Somatic	163	0		WXS	Illumina HiSeq	Phase_I	111	3	NM_183061	0	0	0	0	0	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.185129	0.38609	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.78364	-1.17;-1.15	5.48	0.43	0.16515	.	0.206543	0.34853	N	0.003623	T	0.74619	0.3740	L	0.32530	0.975	0.31989	N	0.604902	D;D	0.76494	0.993;0.999	D;D	0.65773	0.938;0.937	T	0.71708	-0.4511	10	0.30854	T	0.27	-7.2332	4.8798	0.13674	0.1386:0.5768:0.0:0.2846	.	381;429	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	P	429;381	ENSP00000306627:R429P;ENSP00000420688:R381P	ENSP00000306627:R429P	R	-	2	0	SLC9A10	113441537	0.480000	0.25933	0.845000	0.33349	0.751000	0.42716	-0.612000	0.05616	-0.225000	0.09913	0.511000	0.50034	CGT	.		0.338	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
PLXND1	23129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	129284750	129284750	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr3:129284750C>A	ENST00000324093.4	-	24	4480	c.4302G>T	c.(4300-4302)aaG>aaT	p.K1434N	PLXND1_ENST00000393239.1_Missense_Mutation_p.K1434N	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1434					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CCGCAAAGTCCTTCTGCTGCT	0.587																																					p.K1434N	Ovarian(97;366 1484 3738 22084 39045)	.											.	PLXND1-90	0			c.G4302T						.						107.0	90.0	96.0					3																	129284750		2203	4300	6503	SO:0001583	missense	23129	exon24			AAAGTCCTTCTGC	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.4302G>T	3.37:g.129284750C>A	ENSP00000317128:p.Lys1434Asn	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	117	15	NM_015103	0	0	18	18	0	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069256	0.55539	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.12879	2.64;2.64	4.86	2.99	0.34606	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.106561	0.64402	D	0.000006	T	0.28400	0.0702	L	0.59436	1.845	0.53005	D	0.999968	P;D	0.76494	0.643;0.999	B;D	0.71184	0.315;0.972	T	0.01448	-1.1352	10	0.87932	D	0	.	8.6019	0.33749	0.0:0.7443:0.0:0.2557	.	29;1434	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	N	1434	ENSP00000317128:K1434N;ENSP00000376931:K1434N	ENSP00000317128:K1434N	K	-	3	2	PLXND1	130767440	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.849000	0.27723	0.973000	0.38340	0.563000	0.77884	AAG	.		0.587	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
SLC2A2	6514	broad.mit.edu	37	3	170727776	170727776	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr3:170727776G>T	ENST00000314251.3	-	4	546	c.467C>A	c.(466-468)gCt>gAt	p.A156D	SLC2A2_ENST00000382808.4_Missense_Mutation_p.A37D	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	156					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	GCTTCTTCCAGCAATTATAAG	0.393																																					p.A156D													.	SLC2A2-515	0			c.C467A						.						68.0	67.0	67.0					3																	170727776		2202	4300	6502	SO:0001583	missense	6514	exon4			CTTCCAGCAATTA	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.467C>A	3.37:g.170727776G>T	ENSP00000323568:p.Ala156Asp	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	19	3	NM_000340	0	1	24	44	19	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	ENST00000314251.3	37	CCDS3215.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.299157	0.60195	.	.	ENSG00000163581	ENST00000314251;ENST00000382808	D;D	0.82526	-1.62;-1.62	5.52	4.65	0.58169	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.571600	0.18420	N	0.141799	D	0.85915	0.5808	M	0.89353	3.025	0.18873	N	0.999986	P	0.36144	0.539	B	0.38921	0.285	T	0.80870	-0.1189	10	0.87932	D	0	.	11.222	0.48860	0.1495:0.0:0.8505:0.0	.	156	P11168	GTR2_HUMAN	D	156;37	ENSP00000323568:A156D;ENSP00000372258:A37D	ENSP00000323568:A156D	A	-	2	0	SLC2A2	172210470	0.812000	0.29077	0.981000	0.43875	0.466000	0.32739	4.427000	0.59888	1.334000	0.45468	-0.140000	0.14226	GCT	.		0.393	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
ELF2	1998	hgsc.bcm.edu	37	4	139980523	139980523	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr4:139980523G>C	ENST00000394235.2	-	10	1862	c.1360C>G	c.(1360-1362)Cag>Gag	p.Q454E	ELF2_ENST00000510408.1_Missense_Mutation_p.Q394E|ELF2_ENST00000515489.1_Intron|ELF2_ENST00000358635.3_Missense_Mutation_p.Q406E|ELF2_ENST00000379549.2_Missense_Mutation_p.Q377E|ELF2_ENST00000265495.4_Missense_Mutation_p.Q454E|ELF2_ENST00000379550.1_Missense_Mutation_p.Q466E	NM_001276458.1	NP_001263387.1			E74-like factor 2 (ets domain transcription factor)											endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	19	all_hematologic(180;0.162)					TGTGCAAGCTGTGTAGCTGGG	0.458																																					p.T454A		.											.	ELF2-228	0			c.A1360G						.						81.0	74.0	77.0					4																	139980523		2203	4300	6503	SO:0001583	missense	1998	exon9			CAAGCTGTGTAGC	AF256222	CCDS3744.1, CCDS3745.1, CCDS64062.1, CCDS64063.1	4q28	2008-02-05			ENSG00000109381	ENSG00000109381			3317	protein-coding gene	gene with protein product						8756667	Standard	NM_201999		Approved	EU32, NERF, NERF-2, NERF-1A, NERF-1B	uc003ihm.2	Q15723	OTTHUMG00000133383	ENST00000394235.2:c.1360C>G	4.37:g.139980523G>C	ENSP00000377782:p.Gln454Glu	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_201999	0	0	14	14	0		Missense_Mutation	SNP	ENST00000394235.2	37	CCDS3744.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951130	0.53186	.	.	ENSG00000109381	ENST00000358635;ENST00000394235;ENST00000379550;ENST00000265495;ENST00000379549;ENST00000540754;ENST00000510408	T;T;T;T;T;T	0.12774	2.65;2.86;2.84;2.86;2.85;2.65	5.8	4.95	0.65309	.	0.048024	0.85682	N	0.000000	T	0.26919	0.0659	L	0.34521	1.04	0.51767	D	0.999939	D;D;D;B;D	0.69078	0.997;0.99;0.997;0.006;0.99	P;D;P;B;P	0.72982	0.81;0.979;0.779;0.007;0.848	T	0.01814	-1.1268	9	.	.	.	.	16.8692	0.86037	0.0:0.1284:0.8716:0.0	.	269;454;377;394;406	B7Z8R4;Q15723-1;E9PCX3;B7Z720;Q15723-3	.;.;.;.;.	E	406;454;466;454;377;269;394	ENSP00000351458:Q406E;ENSP00000377782:Q454E;ENSP00000368868:Q466E;ENSP00000265495:Q454E;ENSP00000368867:Q377E;ENSP00000426997:Q394E	.	Q	-	1	0	ELF2	140199973	1.000000	0.71417	0.483000	0.27378	0.992000	0.81027	9.206000	0.95056	1.441000	0.47550	0.650000	0.86243	CAG	.		0.458	ELF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257233.2	NM_006874	
POU4F3	5459	broad.mit.edu	37	5	145719656	145719656	+	Silent	SNP	G	G	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr5:145719656G>T	ENST00000230732.4	+	2	755	c.666G>T	c.(664-666)tcG>tcT	p.S222S	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	222	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCGTGGGCTCGCTGAGCCAAA	0.642																																					p.S222S													.	POU4F3-90	0			c.G666T						.						47.0	50.0	49.0					5																	145719656		2203	4300	6503	SO:0001819	synonymous_variant	5459	exon2			GGGCTCGCTGAGC	U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.666G>T	5.37:g.145719656G>T		Somatic	141	1		WXS	Illumina HiSeq	Phase_I	225	6	NM_002700	0	0	0	0	0	O60557|Q2M3F8	Silent	SNP	ENST00000230732.4	37	CCDS4281.1																																																																																			.		0.642	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251887.2	NM_002700	
OR2Y1	134083	broad.mit.edu	37	5	180166493	180166493	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr5:180166493G>A	ENST00000307832.2	-	1	606	c.566C>T	c.(565-567)gCg>gTg	p.A189V		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCTGTGTCCGCACAAGCCAA	0.507																																					p.A189V													.	OR2Y1-68	0			c.C566T						.						82.0	70.0	74.0					5																	180166493		2203	4300	6503	SO:0001583	missense	134083	exon1			GTGTCCGCACAAG	AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.566C>T	5.37:g.180166493G>A	ENSP00000312403:p.Ala189Val	Somatic	144	1		WXS	Illumina HiSeq	Phase_I	198	5	NM_001001657	0	0	0	0	0	B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	ENST00000307832.2	37	CCDS34323.1	.	.	.	.	.	.	.	.	.	.	g	0.125	-1.120816	0.01785	.	.	ENSG00000174339	ENST00000307832	T	0.00137	8.68	4.41	-8.81	0.00813	GPCR, rhodopsin-like superfamily (1);	2.447600	0.01860	N	0.036546	T	0.00039	0.0001	N	0.02685	-0.53	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.45891	-0.9230	10	0.02654	T	1	.	1.5139	0.02502	0.3935:0.1488:0.3068:0.1509	.	189	Q8NGV0	OR2Y1_HUMAN	V	189	ENSP00000312403:A189V	ENSP00000312403:A189V	A	-	2	0	OR2Y1	180099099	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.460000	0.06720	-1.715000	0.01389	-1.294000	0.01345	GCG	.		0.507	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368059.2	XM_068682	
PBX2	5089	broad.mit.edu	37	6	32155509	32155509	+	Missense_Mutation	SNP	T	T	A	rs202223627		TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr6:32155509T>A	ENST00000375050.4	-	5	1055	c.785A>T	c.(784-786)tAt>tTt	p.Y262F	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	262					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Y262F(3)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						GGAGTAGAAATACTCATTTAG	0.517																																					p.Y262F													.	PBX2-91	3	Substitution - Missense(3)	lung(3)	c.A785T						.																																			SO:0001583	missense	5089	exon5			TAGAAATACTCAT		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.785A>T	6.37:g.32155509T>A	ENSP00000364190:p.Tyr262Phe	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	25	4	NM_002586	0	0	46	46	0	A2BFJ2	Missense_Mutation	SNP	ENST00000375050.4	37	CCDS4748.1	.	.	.	.	.	.	.	.	.	.	T	19.51	3.841111	0.71488	.	.	ENSG00000204304	ENST00000375050	D	0.83673	-1.75	4.63	4.63	0.57726	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.201957	0.34435	N	0.003969	T	0.61837	0.2379	N	0.10629	0.01	0.80722	D	1	P;P	0.42337	0.776;0.502	P;P	0.45232	0.474;0.458	T	0.71314	-0.4630	10	0.49607	T	0.09	-0.8351	12.0363	0.53427	0.0:0.0:0.0:1.0	.	262;262	Q7KZE5;P40425	.;PBX2_HUMAN	F	262	ENSP00000364190:Y262F	ENSP00000364190:Y262F	Y	-	2	0	PBX2	32263487	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.505000	0.81655	1.943000	0.56356	0.459000	0.35465	TAT	T|0.999;A|0.001		0.517	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4		
RBAK	57786	hgsc.bcm.edu;ucsc.edu	37	7	5105227	5105227	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr7:5105227C>T	ENST00000353796.3	+	6	2464	c.2140C>T	c.(2140-2142)Ctc>Ttc	p.L714F	RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.L714F|RBAK-RBAKDN_ENST00000407184.1_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	714	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.L714I(1)		NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TGTGGAAAATCTCTGAAGTCA	0.373																																					p.L714F		.											.	RBAK-653	1	Substitution - Missense(1)	large_intestine(1)	c.C2140T						.						38.0	41.0	40.0					7																	5105227		2116	4249	6365	SO:0001583	missense	57786	exon6			GAAAATCTCTGAA	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.2140C>T	7.37:g.5105227C>T	ENSP00000275423:p.Leu714Phe	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	56	15	NM_001204456	0	0	8	10	2	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	37	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.428124	0.25726	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.07688	3.17;3.17	3.63	2.74	0.32292	.	0.328508	0.22348	N	0.061256	T	0.06188	0.0160	N	0.08118	0	0.30907	N	0.729093	P	0.51240	0.943	P	0.49799	0.622	T	0.35076	-0.9803	8	.	.	.	.	9.2279	0.37418	0.0:0.8873:0.0:0.1127	.	714	Q9NYW8	RBAK_HUMAN	F	714	ENSP00000275423:L714F;ENSP00000380120:L714F	.	L	+	1	0	RBAK	5071753	0.000000	0.05858	0.637000	0.29366	0.480000	0.33159	0.225000	0.17757	1.089000	0.41292	0.455000	0.32223	CTC	.		0.373	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
EPDR1	54749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	37960767	37960767	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr7:37960767G>T	ENST00000199448.4	+	1	605	c.226G>T	c.(226-228)Gtg>Ttg	p.V76L	EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000559325.1_Missense_Mutation_p.V196L|EPDR1_ENST00000423717.1_Missense_Mutation_p.V76L|EPDR1_ENST00000476620.1_Intron	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1	76					cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						CAACCAGCGCGTGCGGGTGCT	0.706																																					p.V76L		.											.	EPDR1-91	0			c.G226T						.						15.0	16.0	16.0					7																	37960767		2107	4126	6233	SO:0001583	missense	54749	exon1			CAGCGCGTGCGGG	BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.226G>T	7.37:g.37960767G>T	ENSP00000199448:p.Val76Leu	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	135	18	NM_001242946	0	0	29	32	3	A8K4C0|C9JYS3|Q06BL0|Q99M77	Missense_Mutation	SNP	ENST00000199448.4	37	CCDS5454.2	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733873	0.30684	.	.	ENSG00000086289	ENST00000199448;ENST00000423717	.	.	.	4.04	1.93	0.25924	.	0.478080	0.21214	N	0.078255	T	0.40473	0.1118	L	0.42686	1.345	0.80722	D	1	B	0.16603	0.018	B	0.09377	0.004	T	0.14392	-1.0474	9	0.21014	T	0.42	-17.3655	3.9195	0.09237	0.2427:0.1958:0.5615:0.0	.	196	A4D1W8	.	L	196;170	.	ENSP00000199448:V196L	V	+	1	0	EPDR1	37927292	0.988000	0.35896	1.000000	0.80357	0.959000	0.62525	0.596000	0.24044	0.866000	0.35629	0.313000	0.20887	GTG	.		0.706	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549	
SRRT	51593	broad.mit.edu	37	7	100485034	100485034	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr7:100485034G>A	ENST00000347433.4	+	16	2227	c.2069G>A	c.(2068-2070)cGc>cAc	p.R690H	SRRT_ENST00000388793.4_Missense_Mutation_p.R689H|SRRT_ENST00000432932.1_Missense_Mutation_p.R689H|SRRT_ENST00000457580.2_Missense_Mutation_p.R690H			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	690					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						AAGATGGGGCGCAAAGACCCA	0.552																																					p.R690H													.	SRRT-92	0			c.G2069A						.						111.0	106.0	108.0					7																	100485034		2203	4300	6503	SO:0001583	missense	51593	exon16			TGGGGCGCAAAGA		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2069G>A	7.37:g.100485034G>A	ENSP00000314491:p.Arg690His	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	343	6	NM_001128853	0	0	31	31	0	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	ENST00000347433.4	37	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647866	0.67358	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000342198;ENST00000432932;ENST00000347433;ENST00000448764	.	.	.	4.83	4.83	0.62350	Arsenite-resistance protein 2 (1);	0.057795	0.64402	D	0.000004	T	0.67078	0.2855	L	0.59436	1.845	0.51767	D	0.999938	D;D;D;D	0.89917	0.994;0.999;0.999;1.0	P;P;D;D	0.70935	0.579;0.871;0.95;0.971	T	0.63765	-0.6563	9	0.30078	T	0.28	.	8.9298	0.35663	0.1002:0.0:0.8998:0.0	.	689;689;690;690	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	H	690;689;55;689;690;320	.	ENSP00000344670:R55H	R	+	2	0	SRRT	100322970	0.410000	0.25376	0.915000	0.36163	0.575000	0.36095	3.229000	0.51278	2.500000	0.84329	0.297000	0.19635	CGC	.		0.552	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
UBAP2	55833	hgsc.bcm.edu	37	9	33960823	33960823	+	Splice_Site	SNP	C	C	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr9:33960823C>G	ENST00000379238.1	-	10	916		c.e10+1		UBAP2_ENST00000418786.2_Splice_Site|UBAP2_ENST00000379239.4_Splice_Site|UBAP2_ENST00000449054.1_Splice_Site|UBAP2_ENST00000539807.1_Intron|UBAP2_ENST00000360802.1_Splice_Site					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		CAAACACTTACATCTTCAGTC	0.398																																					.		.											.	UBAP2-94	0			c.798+1G>C						.						124.0	118.0	120.0					9																	33960823		2203	4300	6503	SO:0001630	splice_region_variant	55833	exon11			CACTTACATCTTC	AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.798+1G>C	9.37:g.33960823C>G		Somatic	109	0		WXS	Illumina HiSeq	Phase_I	32	2	NM_018449	0	0	0	0	0		Splice_Site	SNP	ENST00000379238.1	37	CCDS6547.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061796	0.76187	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379260;ENST00000379239;ENST00000418786;ENST00000412543;ENST00000421278	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.786	0.96437	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UBAP2	33950823	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.966000	0.70395	2.676000	0.91093	0.563000	0.77884	.	.		0.398	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449	Intron
EGFL6	25975	broad.mit.edu	37	X	13635856	13635856	+	Silent	SNP	T	T	C			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chrX:13635856T>C	ENST00000361306.1	+	8	1043	c.786T>C	c.(784-786)ccT>ccC	p.P262P	EGFL6_ENST00000380602.3_Silent_p.P262P	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	262					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						TAGCTATCCCTGAAAATTCTG	0.343																																					p.P262P													.	EGFL6-193	0			c.T786C						.						108.0	112.0	110.0					X																	13635856		2203	4300	6503	SO:0001819	synonymous_variant	25975	exon8			TATCCCTGAAAAT	AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.786T>C	X.37:g.13635856T>C		Somatic	399	0		WXS	Illumina HiSeq	Phase_I	529	4	NM_001167890	0	0	0	0	0	B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Silent	SNP	ENST00000361306.1	37	CCDS14155.1																																																																																			.		0.343	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055800.1	NM_015507	
PLS3	5358	broad.mit.edu	37	X	114874764	114874764	+	Silent	SNP	A	A	G			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chrX:114874764A>G	ENST00000420625.2	+	9	1070	c.936A>G	c.(934-936)aaA>aaG	p.K312K	PLS3_ENST00000539310.1_Silent_p.K267K|PLS3_ENST00000543070.1_5'UTR|PLS3_ENST00000537301.1_Silent_p.K299K|PLS3_ENST00000355899.3_Silent_p.K312K|PLS3_ENST00000289290.3_Silent_p.K276K	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	312	Actin-binding 1.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						TCGCACCAAAAGGACAAAAGG	0.348																																					p.K312K	Colon(160;1047 1864 8490 12969 29601)												.	PLS3-193	0			c.A936G						.						172.0	148.0	156.0					X																	114874764		2203	4300	6503	SO:0001819	synonymous_variant	5358	exon9			ACCAAAAGGACAA	L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.936A>G	X.37:g.114874764A>G		Somatic	120	0		WXS	Illumina HiSeq	Phase_I	154	3	NM_005032	0	0	133	133	0	A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Silent	SNP	ENST00000420625.2	37	CCDS14568.1	.	.	.	.	.	.	.	.	.	.	A	10.27	1.303651	0.23736	.	.	ENSG00000102024	ENST00000497870	.	.	.	5.67	3.33	0.38152	.	.	.	.	.	T	0.57475	0.2056	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52079	-0.8623	4	.	.	.	-23.4399	7.8255	0.29313	0.8273:0.0:0.1727:0.0	.	.	.	.	G	33	.	.	R	+	1	2	PLS3	114781020	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.820000	0.55693	0.797000	0.33971	0.486000	0.48141	AGG	.		0.348	PLS3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057976.2		
NLGN4Y	22829	hgsc.bcm.edu	37	Y	16952767	16952767	+	3'UTR	SNP	C	C	T	rs373089425		TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chrY:16952767C>T	ENST00000476359.1	+	0	2621							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.A692A(1)		large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						ACATCTTAGCCTTTGCGGCGC	0.502																																					p.A692A		.											.	.	1	Substitution - coding silent(1)	prostate(1)	c.C2076T						.	C	,	0,571		0,571	53.0	72.0	66.0		1572,2076	-3.8	0.0	Y		66	1,1871		1,1871	no	coding-synonymous,coding-synonymous	NLGN4Y	NM_001206850.1,NM_014893.4	,	1,2442	T,C		0.0534,0.0,0.0409	,	524/649,692/817	16952767	1,2442	974	2291	3265	SO:0001624	3_prime_UTR_variant	22829	exon6			CTTAGCCTTTGCG		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*2618C>T	Y.37:g.16952767C>T		Somatic	1	0		WXS	Illumina HiSeq	Phase_I	4	4	NM_014893	0	0	0	2	2	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Silent	SNP	ENST00000476359.1	37																																																																																				.		0.502	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893	
SAV1	60485	hgsc.bcm.edu;broad.mit.edu	37	14	51132122	51132129	+	Frame_Shift_Del	DEL	CTAGACTT	CTAGACTT	-			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	CTAGACTT	CTAGACTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr14:51132122_51132129delCTAGACTT	ENST00000324679.4	-	2	666_673	c.303_310delAAGTCTAG	c.(301-312)agaagtctagcafs	p.RSLA101fs	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	101					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					GGGACATCTGCTAGACTTCTGGCAAGAT	0.385																																					p.101_104del		.											.	SAV1-658	0			c.303_310del						.																																			SO:0001589	frameshift_variant	60485	exon2			.	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.303_310delAAGTCTAG	14.37:g.51132122_51132129delCTAGACTT	ENSP00000324729:p.Arg101fs	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	50	13	NM_021818	0	0	0	0	0	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Frame_Shift_Del	DEL	ENST00000324679.4	37	CCDS9701.1																																																																																			.		0.385	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
BRSK1	84446	broad.mit.edu	37	19	55815036	55815036	+	Splice_Site	DEL	C	C	-			TCGA-B3-3926-01A-01D-1252-08	TCGA-B3-3926-11A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	814dbddd-9703-4c92-b179-428d00b907bf	cc643b5f-d509-4216-928c-5f6ec8b526e2	g.chr19:55815036delC	ENST00000309383.1	+	12	1405	c.1128delC	c.(1126-1128)gac>ga	p.D376fs	BRSK1_ENST00000326848.7_Splice_Site_p.D71fs|BRSK1_ENST00000590333.1_Splice_Site_p.D392fs	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	376					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.R379fs*9(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		GTCCCTCAGACCCCCCCCGGA	0.582																																					p.D376fs													.	BRSK1-759	2	Deletion - Frameshift(2)	large_intestine(2)	c.1128delC						.						54.0	63.0	60.0					19																	55815036		2203	4300	6503	SO:0001630	splice_region_variant	84446	exon12			CTCAGACCCCCCC	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1127-1C>-	19.37:g.55815036delC		Somatic	176	0		WXS	Illumina HiSeq	Phase_I	339	9	NM_032430	0	0	0	0	0	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Frame_Shift_Del	DEL	ENST00000309383.1	37	CCDS12921.1																																																																																			.		0.582	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	Frame_Shift_Del
