#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABO	28	hgsc.bcm.edu	37	9	136131057	136131057	+	RNA	DEL	G	G	-	rs8176750|rs56392308	byFrequency	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr9:136131057delG	ENST00000453660.2	-	0	1071				RP11-430N14.4_ENST00000606717.1_RNA			P16442	BGAT_HUMAN	ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)						protein glycosylation (GO:0006486)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosylgalactoside 3-alpha-galactosyltransferase activity (GO:0004381)|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity (GO:0004380)|metal ion binding (GO:0046872)	p.P353fs?(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|prostate(1)|stomach(2)	11				OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)		AGCCGCTCACGGGTTCCGGAC	0.662													GGG|GGG|GG|deletion	242	0.0483227	0.0658	0.0432	5008	,	,		13669	0.0		0.0954	False		,,,				2504	0.0297																1	Deletion - Frameshift(1)	central_nervous_system(1)								234,3304		17,200,1552	9.0	10.0	10.0			-7.1	0.0	9	dbSNP_129	10	533,7273		35,463,3405	no	frameshift	ABO	NM_020469.2		52,663,4957	A1A1,A1R,RR		6.8281,6.6139,6.7613			136131057	767,10577	1853	4054	5907			28			AF134415		9q34.2	2014-07-19			ENSG00000175164	ENSG00000175164	2.4.1.40, 2.4.1.37	"""Blood group antigens"", ""Glycosyltransferase family 6 domain containing"""	79	protein-coding gene	gene with protein product		110300				184030	Standard	NM_020469		Approved	A3GALNT, A3GALT1	uc004cda.1	P16442	OTTHUMG00000020872		9.37:g.136131057delG		Somatic		WXS	Illumina HiSeq	Phase_I	B0JDB9|O14758|Q14490|Q53I57|Q6ISD4|Q6KFZ2|Q70V27|Q99484|Q99485|Q9NY01|Q9UQ68|Q9UQ69	Frame_Shift_Del	DEL	ENST00000453660.2	37																																																																																					0.662	ABO-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000054907.4		NM_020469	
ADAMTS12	81792	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	33576384	33576384	+	Silent	SNP	G	G	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr5:33576384G>A	ENST00000504830.1	-	19	4082	c.3747C>T	c.(3745-3747)ctC>ctT	p.L1249L	ADAMTS12_ENST00000352040.3_Silent_p.L1164L|ADAMTS12_ENST00000504582.1_5'Flank	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1249	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L1249L(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CTCCCAGAGGGAGCAGAGTGT	0.517										HNSCC(64;0.19)																																							1	Substitution - coding silent(1)	kidney(1)											152.0	152.0	152.0					5																	33576384		2203	4300	6503	SO:0001819	synonymous_variant	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3747C>T	5.37:g.33576384G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	ENST00000504830.1	37	CCDS34140.1																																																																																				0.517	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2		NM_030955	
APLF	200558	hgsc.bcm.edu	37	2	68805143	68805143	+	Frame_Shift_Del	DEL	A	A	-	rs149897324	byFrequency	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr2:68805143delA	ENST00000303795.4	+	10	1696	c.1525delA	c.(1525-1527)aaafs	p.K509fs	APLF_ENST00000471727.1_Intron	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	509					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						AAGGTTTATGAAAAGAAAATA	0.358													AAAA|AAAA|AAA|deletion	23	0.00459265	0.0008	0.0058	5008	,	,		20808	0.0		0.0119	False		,,,				2504	0.0061																0										15,4251		0,15,2118	68.0	74.0	72.0			2.8	1.0	2	dbSNP_134	73	121,8127		3,115,4006	no	frameshift	APLF	NM_173545.2		3,130,6124	A1A1,A1R,RR		1.467,0.3516,1.0868			68805143	136,12378	2203	4299	6502	SO:0001589	frameshift_variant	200558			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.1525delA	2.37:g.68805143delA	ENSP00000307004:p.Lys509fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K476|Q53P47|Q53PB9|Q53QU0	Frame_Shift_Del	DEL	ENST00000303795.4	37	CCDS1888.1																																																																																				0.358	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1		NM_173545	
BIN2	51411	broad.mit.edu;hgsc.bcm.edu	37	12	51685607	51685607	+	Missense_Mutation	SNP	G	G	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr12:51685607G>T	ENST00000267012.4	-	10	1344	c.1283C>A	c.(1282-1284)cCc>cAc	p.P428H	BIN2_ENST00000544402.1_Missense_Mutation_p.P402H|BIN2_ENST00000452142.2_Missense_Mutation_p.P396H|BIN2_ENST00000604560.1_Missense_Mutation_p.P401H	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	428	Pro-rich.				cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)	p.P428H(1)		NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						CCCTGAGGAGGGCCTGGGGCT	0.607																																																	1	Substitution - Missense(1)	kidney(1)											53.0	56.0	55.0					12																	51685607		2203	4300	6503	SO:0001583	missense	51411			AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.1283C>A	12.37:g.51685607G>T	ENSP00000267012:p.Pro428His	Somatic		WXS	Illumina HiSeq	Phase_I	Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	ENST00000267012.4	37	CCDS8811.1	.	.	.	.	.	.	.	.	.	.	G	7.498	0.652005	0.14580	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	D;T;T	0.96830	-4.14;-0.1;-0.11	4.08	-1.51	0.08664	.	2.083000	0.01674	N	0.025771	D	0.90007	0.6880	N	0.14661	0.345	0.09310	N	1	B;B;B	0.10296	0.002;0.002;0.003	B;B;B	0.08055	0.003;0.003;0.001	T	0.79921	-0.1599	10	0.54805	T	0.06	0.0504	0.7054	0.00915	0.1972:0.1514:0.3109:0.3404	.	402;396;428	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	H	396;428;402	ENSP00000410217:P396H;ENSP00000267012:P428H;ENSP00000445874:P402H	ENSP00000267012:P428H	P	-	2	0	BIN2	49971874	0.002000	0.14202	0.008000	0.14137	0.930000	0.56654	-0.342000	0.07801	-0.410000	0.07542	0.563000	0.77884	CCC		0.607	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000469800.1			
TRAPPC11	60684	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	184601356	184601356	+	Missense_Mutation	SNP	A	A	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr4:184601356A>T	ENST00000334690.6	+	10	1251	c.1049A>T	c.(1048-1050)tAc>tTc	p.Y350F	TRAPPC11_ENST00000357207.4_Missense_Mutation_p.Y350F	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	350					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.Y350F(1)									GGTTTCTATTACCAGCAGGCA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											116.0	116.0	116.0					4																	184601356		2203	4300	6503	SO:0001583	missense	0				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.1049A>T	4.37:g.184601356A>T	ENSP00000335371:p.Tyr350Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	ENST00000334690.6	37	CCDS34112.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.381553	0.82792	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.74291	0.3697	L	0.53617	1.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.69636	-0.5092	9	0.20519	T	0.43	.	16.4447	0.83919	1.0:0.0:0.0:0.0	.	350;350	Q7Z392;Q7Z392-3	TPC11_HUMAN;.	F	350	.	ENSP00000335371:Y350F	Y	+	2	0	C4orf41	184838350	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.335000	0.96500	2.284000	0.76573	0.528000	0.53228	TAC		0.393	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2		NM_021942	
GPATCH11	253635	broad.mit.edu;ucsc.edu	37	2	37315582	37315582	+	Splice_Site	SNP	C	C	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr2:37315582C>T	ENST00000608836.1	+	2	191	c.46C>T	c.(46-48)Caa>Taa	p.Q16*	GPATCH11_ENST00000281932.5_Splice_Site_p.S2S|GPATCH11_ENST00000409774.1_Splice_Site_p.Q42*	NM_174931.2	NP_777591.3	Q8N954	GPT11_HUMAN	G patch domain containing 11	16							nucleic acid binding (GO:0003676)	p.S2S(1)|p.Q16*(1)									CATTAATGTCCAGTAAGTAAA	0.274																																																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	kidney(2)											64.0	65.0	65.0					2																	37315582		2203	4300	6503	SO:0001630	splice_region_variant	253635			AK095667	CCDS1785.2, CCDS62891.1, CCDS1785.3	2p22.2	2013-11-05	2013-01-28	2013-01-28	ENSG00000152133	ENSG00000152133		"""G patch domain containing"""	26768	protein-coding gene	gene with protein product	"""centromere protein Y"""		"""coiled-coil domain containing 75"""	CCDC75			Standard	NM_001278505		Approved	FLJ38348, CENPY, CENP-Y	uc010ezz.3	Q8N954	OTTHUMG00000128469	ENST00000608836.1:c.47+1C>T	2.37:g.37315582C>T		Somatic		WXS	Illumina GAIIx	Phase_I	A8K0D9|B7Z2G4|B8ZZ44	Nonsense_Mutation	SNP	ENST00000608836.1	37	CCDS1785.2	.	.	.	.	.	.	.	.	.	.	C	37	6.098528	0.97281	.	.	ENSG00000152133	ENST00000409774	.	.	.	5.42	4.46	0.54185	.	0.382752	0.28700	N	0.014433	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-30.8317	15.1478	0.72671	0.1858:0.8141:0.0:0.0	.	.	.	.	X	16	.	ENSP00000386772:Q16X	Q	+	1	0	CCDC75	37169086	0.998000	0.40836	1.000000	0.80357	0.971000	0.66376	0.787000	0.26858	2.537000	0.85549	0.561000	0.74099	CAA		0.274	GPATCH11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_174931	Nonsense_Mutation
CHRNB4	1143	hgsc.bcm.edu;ucsc.edu	37	15	78917593	78917593	+	Missense_Mutation	SNP	C	C	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr15:78917593C>T	ENST00000261751.3	-	6	1490	c.1379G>A	c.(1378-1380)cGg>cAg	p.R460Q	RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000412074.2_Missense_Mutation_p.G134S	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	460					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	CAGGAACAGCCGGTCCACCAC	0.607																																																	0													252.0	212.0	225.0					15																	78917593		2196	4293	6489	SO:0001583	missense	1143			U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.1379G>A	15.37:g.78917593C>T	ENSP00000261751:p.Arg460Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	ENST00000261751.3	37	CCDS10306.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.792792|5.792792	0.96945|0.96945	.|.	.|.	ENSG00000117971|ENSG00000117971	ENST00000412074|ENST00000261751	T|D	0.74315|0.88818	-0.83|-2.43	5.37|5.37	5.37|5.37	0.77165|0.77165	.|Neurotransmitter-gated ion-channel transmembrane domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96880|0.96880	0.8981|0.8981	H|H	0.97983|0.97983	4.12|4.12	0.80722|0.80722	D|D	1|1	P|D	0.52316|0.89917	0.952|1.0	B|D	0.41174|0.97110	0.349|1.0	D|D	0.98192|0.98192	1.0463|1.0463	9|10	0.16420|0.87932	T|D	0.52|0	.|.	18.2372|18.2372	0.89952|0.89952	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	134|460	E9PHE8|P30926	.|ACHB4_HUMAN	S|Q	134|460	ENSP00000416386:G134S|ENSP00000261751:R460Q	ENSP00000416386:G134S|ENSP00000261751:R460Q	G|R	-|-	1|2	0|0	CHRNB4|CHRNB4	76704648|76704648	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.791000|7.791000	0.85805|0.85805	2.669000|2.669000	0.90835|0.90835	0.655000|0.655000	0.94253|0.94253	GGC|CGG		0.607	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290108.1			
CHRNB4	1143	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	78921969	78921969	+	Missense_Mutation	SNP	G	G	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr15:78921969G>T	ENST00000261751.3	-	5	789	c.678C>A	c.(676-678)ttC>ttA	p.F226L	RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000412074.2_Intron|CHRNB4_ENST00000560511.1_5'Flank	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	226					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.F226L(1)		endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	GCTTGATGATGAAGTCGTAAG	0.552																																																	1	Substitution - Missense(1)	kidney(1)											369.0	282.0	312.0					15																	78921969		2196	4293	6489	SO:0001583	missense	1143			U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.678C>A	15.37:g.78921969G>T	ENSP00000261751:p.Phe226Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	ENST00000261751.3	37	CCDS10306.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062941	0.55432	.	.	ENSG00000117971	ENST00000261751	T	0.75154	-0.91	5.26	3.0	0.34707	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.66356	0.2781	N	0.12502	0.225	0.80722	D	1	D	0.55172	0.97	P	0.59546	0.859	T	0.60193	-0.7311	10	0.15499	T	0.54	.	10.1258	0.42649	0.2434:0.0:0.7566:0.0	.	226	P30926	ACHB4_HUMAN	L	226	ENSP00000261751:F226L	ENSP00000261751:F226L	F	-	3	2	CHRNB4	76709024	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.050000	0.30404	1.214000	0.43395	0.609000	0.83330	TTC		0.552	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290108.1			
COL18A1	80781	hgsc.bcm.edu	37	21	46925141	46925149	+	In_Frame_Del	DEL	GGCCCCCCA	GGCCCCCCA	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	GGCCCCCCA	GGCCCCCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr21:46925141_46925149delGGCCCCCCA	ENST00000359759.4	+	34	4228_4236	c.4207_4215delGGCCCCCCA	c.(4207-4215)ggccccccadel	p.GPP1409del	SLC19A1_ENST00000567670.1_Intron|COL18A1_ENST00000355480.5_In_Frame_Del_p.GPP1174del|COL18A1_ENST00000400337.2_In_Frame_Del_p.GPP994del			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1409	Triple-helical region 9 (COL9).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GGGCCCTCCCGGCCCCCCAGGCCCCCCAG	0.727																																																	0									,	27,3173		11,5,1584					,	-8.5	0.1			10	28,7328		7,14,3657	no	coding,coding	COL18A1	NM_130445.2,NM_030582.3	,	18,19,5241	A1A1,A1R,RR		0.3806,0.8438,0.521	,	,		55,10501				SO:0001651	inframe_deletion	80781				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4207_4215delGGCCCCCCA	21.37:g.46925150_46925158delGGCCCCCCA	ENSP00000352798:p.Gly1409_Pro1411del	Somatic		WXS	Illumina HiSeq	Phase_I	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	In_Frame_Del	DEL	ENST00000359759.4	37																																																																																					0.727	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1			
COPB2	9276	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	139077639	139077639	+	Missense_Mutation	SNP	T	T	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr3:139077639T>G	ENST00000333188.5	-	20	2681	c.2500A>C	c.(2500-2502)Aat>Cat	p.N834H	COPB2_ENST00000507777.1_Missense_Mutation_p.N805H	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	834					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)	p.N834H(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						TCCATGACATTTCTCTCTTCA	0.383																																																	1	Substitution - Missense(1)	kidney(1)											135.0	121.0	126.0					3																	139077639		2203	4300	6503	SO:0001583	missense	9276			BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.2500A>C	3.37:g.139077639T>G	ENSP00000329419:p.Asn834His	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZI8	Missense_Mutation	SNP	ENST00000333188.5	37	CCDS3108.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.15|16.15	3.040729|3.040729	0.55003|0.55003	.|.	.|.	ENSG00000184432|ENSG00000184432	ENST00000503326|ENST00000333188;ENST00000507777	.|T;T	.|0.65916	.|-0.18;-0.07	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.60327|0.60327	0.2260|0.2260	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	.|B	.|0.14438	.|0.01	.|B	.|0.15484	.|0.013	T|T	0.58393|0.58393	-0.7644|-0.7644	5|10	.|0.49607	.|T	.|0.09	-7.5406|-7.5406	15.4192|15.4192	0.74997|0.74997	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|834	.|P35606	.|COPB2_HUMAN	T|H	47|834;805	.|ENSP00000329419:N834H;ENSP00000422295:N805H	.|ENSP00000329419:N834H	K|N	-|-	2|1	0|0	COPB2|COPB2	140560329|140560329	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.500000|7.500000	0.81588|0.81588	2.047000|2.047000	0.60756|0.60756	0.533000|0.533000	0.62120|0.62120	AAA|AAT		0.383	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2		NM_004766	
DIP2C	22982	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	329235	329235	+	Missense_Mutation	SNP	G	G	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr10:329235G>T	ENST00000280886.6	-	35	4358	c.4271C>A	c.(4270-4272)aCt>aAt	p.T1424N	RNA5SP298_ENST00000364991.1_RNA	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1424						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.T1424N(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TGTGAGCTCAGTTCTCCGCAG	0.557																																																	1	Substitution - Missense(1)	kidney(1)											101.0	99.0	99.0					10																	329235		2203	4300	6503	SO:0001583	missense	22982			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.4271C>A	10.37:g.329235G>T	ENSP00000280886:p.Thr1424Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	33	5.268748	0.95429	.	.	ENSG00000151240	ENST00000280886;ENST00000535541	T	0.26810	1.71	5.92	5.92	0.95590	AMP-dependent synthetase/ligase (1);	0.098796	0.64402	D	0.000002	T	0.52008	0.1708	M	0.66939	2.045	0.80722	D	1	D	0.63046	0.992	D	0.72625	0.978	T	0.35599	-0.9782	10	0.42905	T	0.14	-12.3002	20.3103	0.98641	0.0:0.0:1.0:0.0	.	1424	Q9Y2E4	DIP2C_HUMAN	N	1424;349	ENSP00000280886:T1424N	ENSP00000280886:T1424N	T	-	2	0	DIP2C	319235	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	9.815000	0.99349	2.805000	0.96524	0.549000	0.68633	ACT		0.557	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1		NM_014974	
DLD	1738	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	107542792	107542792	+	Missense_Mutation	SNP	A	A	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr7:107542792A>G	ENST00000205402.5	+	4	502	c.221A>G	c.(220-222)gAa>gGa	p.E74G	DLD_ENST00000440410.1_Intron|DLD_ENST00000537148.1_Intron|DLD_ENST00000437604.2_Missense_Mutation_p.E74G|DLD_ENST00000494441.1_3'UTR	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	74					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)	p.E74G(2)		NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	GAGAAAAATGAAACACTTGGT	0.353																																																	2	Substitution - Missense(2)	kidney(2)											290.0	256.0	268.0					7																	107542792		2203	4300	6503	SO:0001583	missense	1738			AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.221A>G	7.37:g.107542792A>G	ENSP00000205402:p.Glu74Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	ENST00000205402.5	37	CCDS5749.1	.	.	.	.	.	.	.	.	.	.	A	11.28	1.593593	0.28445	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000437604;ENST00000539590	T;T;T	0.49432	0.78;0.78;0.78	6.17	6.17	0.99709	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.317255	0.38111	N	0.001805	T	0.22975	0.0555	N	0.04355	-0.22	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.18272	-1.0342	10	0.02654	T	1	-4.6667	13.0728	0.59072	0.8666:0.1334:0.0:0.0	.	74;74	B4DT69;P09622	.;DLDH_HUMAN	G	74;74;74;24	ENSP00000205402:E74G;ENSP00000390667:E74G;ENSP00000387542:E74G	ENSP00000205402:E74G	E	+	2	0	DLD	107330028	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	3.032000	0.49736	2.371000	0.80710	0.533000	0.62120	GAA		0.353	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3		NM_000108	
DZIP1L	199221	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	137813726	137813726	+	Missense_Mutation	SNP	G	G	A	rs148594666		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr3:137813726G>A	ENST00000327532.2	-	4	1048	c.686C>T	c.(685-687)gCg>gTg	p.A229V	DZIP1L_ENST00000488595.1_5'Flank|DZIP1L_ENST00000469243.1_Missense_Mutation_p.A229V	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	229					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)	p.A229V(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						CTGCCTCTCCGCCTCCCTCTG	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		18688	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)						G	VAL/ALA,VAL/ALA	5,4401	11.4+/-27.6	0,5,2198	165.0	150.0	155.0		686,686	4.0	0.9	3	dbSNP_134	155	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	DZIP1L	NM_001170538.1,NM_173543.2	64,64	0,7,6496	AA,AG,GG		0.0233,0.1135,0.0538	probably-damaging,probably-damaging	229/540,229/768	137813726	7,12999	2203	4300	6503	SO:0001583	missense	199221			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.686C>T	3.37:g.137813726G>A	ENSP00000332148:p.Ala229Val	Somatic		WXS	Illumina HiSeq	Phase_I	C9JUG5|Q96M38	Missense_Mutation	SNP	ENST00000327532.2	37	CCDS3096.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	19.38	3.817106	0.70912	0.001135	2.33E-4	ENSG00000158163	ENST00000327532;ENST00000469243;ENST00000536706	T;T	0.61742	0.08;0.08	4.85	3.98	0.46160	.	0.373900	0.23975	N	0.042735	T	0.65112	0.2660	M	0.77820	2.39	0.31129	N	0.707908	D;D	0.63046	0.992;0.983	P;B	0.51866	0.682;0.403	T	0.71269	-0.4643	10	0.72032	D	0.01	-7.2301	8.6715	0.34154	0.1743:0.0:0.8257:0.0	.	229;229	Q8IYY4-2;Q8IYY4	.;DZI1L_HUMAN	V	229	ENSP00000332148:A229V;ENSP00000419486:A229V	ENSP00000332148:A229V	A	-	2	0	DZIP1L	139296416	0.936000	0.31750	0.894000	0.35097	0.944000	0.59088	1.453000	0.35167	1.266000	0.44231	-0.214000	0.12660	GCG		0.567	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357548.1		NM_173543	
HIPK3	10114	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	33308096	33308096	+	Missense_Mutation	SNP	A	A	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr11:33308096A>C	ENST00000303296.4	+	2	441	c.136A>C	c.(136-138)Aat>Cat	p.N46H	HIPK3_ENST00000379016.3_Missense_Mutation_p.N46H|HIPK3_ENST00000456517.1_Missense_Mutation_p.N46H|HIPK3_ENST00000525975.1_Missense_Mutation_p.N46H	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	46					apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N46H(1)		endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						GACCTATGTGAATGGTAGAAA	0.398																																																	1	Substitution - Missense(1)	kidney(1)											117.0	111.0	113.0					11																	33308096		2202	4298	6500	SO:0001583	missense	10114			AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.136A>C	11.37:g.33308096A>C	ENSP00000304226:p.Asn46His	Somatic		WXS	Illumina HiSeq	Phase_I	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	37	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.529900	0.27387	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000531504;ENST00000456517	T;T;T;T	0.52526	0.67;0.66;0.67;0.67	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000001	T	0.48114	0.1482	L	0.36672	1.1	0.80722	D	1	P;P	0.42556	0.696;0.783	P;P	0.49887	0.598;0.625	T	0.29971	-0.9994	10	0.13853	T	0.58	.	15.8791	0.79189	1.0:0.0:0.0:0.0	.	46;46	Q9H422-2;Q9H422	.;HIPK3_HUMAN	H	46	ENSP00000431710:N46H;ENSP00000304226:N46H;ENSP00000368301:N46H;ENSP00000398241:N46H	ENSP00000304226:N46H	N	+	1	0	HIPK3	33264672	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.144000	0.77357	2.160000	0.67779	0.477000	0.44152	AAT		0.398	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1		NM_005734	
HSP90AA1	3320	broad.mit.edu;hgsc.bcm.edu	37	14	102548486	102548486	+	Missense_Mutation	SNP	T	T	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr14:102548486T>C	ENST00000216281.8	-	10	2256	c.2051A>G	c.(2050-2052)cAt>cGt	p.H684R	HSP90AA1_ENST00000334701.7_Missense_Mutation_p.H806R	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	684	Required for homodimerization.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)	p.H806R(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	CCTGTTAGCATGTGTCTGGGG	0.418																																																	1	Substitution - Missense(1)	kidney(1)											59.0	56.0	57.0					14																	102548486		2203	4300	6503	SO:0001583	missense	3320			M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.2051A>G	14.37:g.102548486T>C	ENSP00000216281:p.His684Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	ENST00000216281.8	37	CCDS9967.1	.	.	.	.	.	.	.	.	.	.	t	20.3	3.965698	0.74131	.	.	ENSG00000080824	ENST00000216281;ENST00000334701	T;T	0.10099	2.91;2.91	4.34	4.34	0.51931	.	0.000000	0.85682	U	0.000000	T	0.46308	0.1386	H	0.97051	3.93	0.80722	D	1	P;D	0.76494	0.887;0.999	P;D	0.81914	0.749;0.995	T	0.64736	-0.6337	10	0.62326	D	0.03	-29.5884	13.8339	0.63398	0.0:0.0:0.0:1.0	.	806;684	P07900-2;P07900	.;HS90A_HUMAN	R	684;806	ENSP00000216281:H684R;ENSP00000335153:H806R	ENSP00000216281:H684R	H	-	2	0	HSP90AA1	101618239	1.000000	0.71417	0.924000	0.36721	0.897000	0.52465	7.727000	0.84838	1.739000	0.51704	0.377000	0.23210	CAT		0.418	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2		NM_005348	
HSPA1L	3305	broad.mit.edu;hgsc.bcm.edu	37	6	31779631	31779631	+	Missense_Mutation	SNP	G	G	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr6:31779631G>A	ENST00000375654.4	-	2	308	c.119C>T	c.(118-120)aCc>aTc	p.T40I	HSPA1L_ENST00000417199.3_Missense_Mutation_p.T40I	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	40					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.T40I(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						GTAGCTGGGGGTGGTGCGGTT	0.582																																																	1	Substitution - Missense(1)	kidney(1)											114.0	94.0	101.0					6																	31779631		2203	4300	6503	SO:0001583	missense	3305			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.119C>T	6.37:g.31779631G>A	ENSP00000364805:p.Thr40Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663672	0.47572	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653;ENST00000424494	T;T	0.01538	4.79;4.79	4.52	4.52	0.55395	.	.	.	.	.	T	0.12689	0.0308	H	0.97214	3.96	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.06285	-1.0835	9	0.87932	D	0	.	14.7802	0.69760	0.0:0.0:1.0:0.0	.	40	P34931	HS71L_HUMAN	I	40;40;40;37	ENSP00000364805:T40I;ENSP00000387691:T40I	ENSP00000364804:T40I	T	-	2	0	HSPA1L	31887610	1.000000	0.71417	0.997000	0.53966	0.215000	0.24574	9.590000	0.98238	2.317000	0.78254	0.460000	0.39030	ACC		0.582	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			
INPP5F	22876	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	121567483	121567483	+	Missense_Mutation	SNP	C	C	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr10:121567483C>T	ENST00000361976.2	+	13	1646	c.1480C>T	c.(1480-1482)Cct>Tct	p.P494S		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	801	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.P494S(1)		breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		ACAGCCATTACCTGTGAAATG	0.423																																																	1	Substitution - Missense(1)	kidney(1)											110.0	102.0	105.0					10																	121567483		2203	4300	6503	SO:0001583	missense	22876			AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1480C>T	10.37:g.121567483C>T	ENSP00000354519:p.Pro494Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	37	CCDS7616.1	.	.	.	.	.	.	.	.	.	.	C	32	5.126844	0.94429	.	.	ENSG00000198825	ENST00000361976	T	0.28895	1.59	5.55	5.55	0.83447	Synaptojanin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	L	0.48877	1.53	0.80722	D	1	D	0.69078	0.997	P	0.60789	0.879	T	0.12528	-1.0544	10	0.33940	T	0.23	-19.5224	19.8696	0.96845	0.0:1.0:0.0:0.0	.	494	Q9Y2H2	SAC2_HUMAN	S	494	ENSP00000354519:P494S	ENSP00000354519:P494S	P	+	1	0	INPP5F	121557473	1.000000	0.71417	0.714000	0.30535	0.996000	0.88848	7.726000	0.84824	2.773000	0.95371	0.585000	0.79938	CCT		0.423	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1		NM_014937	
KIAA2022	340533	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	73960856	73960856	+	Missense_Mutation	SNP	C	C	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chrX:73960856C>A	ENST00000055682.6	-	3	4147	c.3536G>T	c.(3535-3537)aGt>aTt	p.S1179I		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1179					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.S1179I(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GCTGGGTGAACTTTTCTTTCT	0.408																																																	1	Substitution - Missense(1)	kidney(1)											85.0	80.0	82.0					X																	73960856		2203	4300	6503	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3536G>T	X.37:g.73960856C>A	ENSP00000055682:p.Ser1179Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	c	10.11	1.260925	0.23051	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.31510	1.49;1.49	4.74	0.785	0.18584	.	0.498976	0.21919	N	0.067198	T	0.19406	0.0466	N	0.24115	0.695	0.30416	N	0.778591	P	0.42620	0.785	B	0.42422	0.387	T	0.13388	-1.0511	10	0.72032	D	0.01	-3.6427	5.6702	0.17717	0.0:0.5167:0.308:0.1754	.	1179	Q5QGS0	K2022_HUMAN	I	1179	ENSP00000362567:S1179I;ENSP00000055682:S1179I	ENSP00000055682:S1179I	S	-	2	0	KIAA2022	73877581	0.998000	0.40836	0.995000	0.50966	0.991000	0.79684	0.543000	0.23237	-0.159000	0.11021	0.597000	0.82753	AGT		0.408	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2		NM_001008537	
LCLAT1	253558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	30756119	30756119	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr2:30756119T>A	ENST00000309052.4	+	4	626	c.417T>A	c.(415-417)taT>taA	p.Y139*	LCLAT1_ENST00000319406.4_Nonsense_Mutation_p.Y139*|LCLAT1_ENST00000359433.1_Nonsense_Mutation_p.Y139*|LCLAT1_ENST00000491680.2_3'UTR|LCLAT1_ENST00000379509.3_Nonsense_Mutation_p.Y101*|LCLAT1_ENST00000540623.1_Nonsense_Mutation_p.Y101*	NM_182551.3	NP_872357.2	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1	139					cardiolipin acyl-chain remodeling (GO:0035965)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|multicellular organismal development (GO:0007275)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.Y139*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)	19						TGATGCGATATAGCTACCTCA	0.408																																																	1	Substitution - Nonsense(1)	kidney(1)											218.0	212.0	214.0					2																	30756119		2203	4300	6503	SO:0001587	stop_gained	253558			AK095284	CCDS1772.1, CCDS42670.1	2p23.1	2008-12-15	2008-12-15	2008-12-15	ENSG00000172954	ENSG00000172954			26756	protein-coding gene	gene with protein product		614241	"""lysocardiolipin acyltransferase"""	LYCAT		18931347, 15152008, 16620771, 17675553	Standard	NM_001002257		Approved	FLJ37965, ALCAT1, AGPAT8	uc002rnl.3	Q6UWP7	OTTHUMG00000099349	ENST00000309052.4:c.417T>A	2.37:g.30756119T>A	ENSP00000310551:p.Tyr139*	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8Z7|Q8N1Q7	Nonsense_Mutation	SNP	ENST00000309052.4	37	CCDS1772.1	.	.	.	.	.	.	.	.	.	.	T	10.83	1.462231	0.26248	.	.	ENSG00000172954	ENST00000466477;ENST00000465200;ENST00000379509;ENST00000444270;ENST00000319406;ENST00000488144;ENST00000465538;ENST00000309052;ENST00000359433;ENST00000540623;ENST00000476038;ENST00000497423;ENST00000476535	.	.	.	5.51	-1.79	0.07932	.	0.055575	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.5573	12.0165	0.53317	0.0:0.4954:0.0:0.5046	.	.	.	.	X	101;101;101;101;139;101;101;139;139;101;101;139;101	.	ENSP00000310551:Y139X	Y	+	3	2	LCLAT1	30609623	0.971000	0.33674	0.990000	0.47175	0.010000	0.07245	0.193000	0.17116	-0.217000	0.10033	-1.007000	0.02485	TAT		0.408	LCLAT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216780.1		NM_182551	
MAF	4094	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	79632954	79632954	+	Missense_Mutation	SNP	G	G	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr16:79632954G>T	ENST00000393350.1	-	1	1657	c.846C>A	c.(844-846)agC>agA	p.S282R	MAF_ENST00000326043.4_Missense_Mutation_p.S282R|MAF_ENST00000569649.1_Missense_Mutation_p.S282R	NM_001031804.2	NP_001026974.1	O75444	MAF_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog	282	Represses ARE-mediated transcription.				cell development (GO:0048468)|cytokine production (GO:0001816)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of chondrocyte differentiation (GO:0032330)|transcription from RNA polymerase II promoter (GO:0006366)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S282R(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)	10		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		CCTCCTCCTTGCTGACCCCGC	0.657			T	IGH@	MM																																			Dom	yes		16	16q22-q23	4094	v-maf musculoaponeurotic fibrosarcoma oncogene homolog		L	1	Substitution - Missense(1)	kidney(1)											19.0	19.0	19.0					16																	79632954		2194	4295	6489	SO:0001583	missense	4094				CCDS10928.1, CCDS42198.1	16q22-q23	2013-07-09	2013-07-09		ENSG00000178573	ENSG00000178573			6776	protein-coding gene	gene with protein product		177075				14998484	Standard	NM_005360		Approved	c-MAF	uc002ffm.3	O75444	OTTHUMG00000137621	ENST00000393350.1:c.846C>A	16.37:g.79632954G>T	ENSP00000377019:p.Ser282Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q66I47|Q9UP93	Missense_Mutation	SNP	ENST00000393350.1	37	CCDS42198.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.930687	0.73327	.	.	ENSG00000178573	ENST00000326043;ENST00000393350	D;D	0.92595	-3.07;-3.07	4.01	2.95	0.34219	Maf transcription factor (1);Eukaryotic transcription factor, Skn-1-like, DNA-binding (2);	0.099951	0.64402	D	0.000003	D	0.95570	0.8560	M	0.82716	2.605	0.46654	D	0.999148	D;D	0.76494	0.999;0.998	D;D	0.75484	0.986;0.976	D	0.95783	0.8818	10	0.72032	D	0.01	-12.0497	12.9296	0.58280	0.0:0.1646:0.8354:0.0	.	282;282	O75444;O75444-1	MAF_HUMAN;.	R	282	ENSP00000327048:S282R;ENSP00000377019:S282R	ENSP00000327048:S282R	S	-	3	2	MAF	78190455	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.474000	0.81024	1.951000	0.56629	0.442000	0.29010	AGC		0.657	MAF-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317037.1			
MBP	4155	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	74778271	74778271	+	Missense_Mutation	SNP	T	T	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr18:74778271T>A	ENST00000397860.3	-	3	336	c.122A>T	c.(121-123)gAg>gTg	p.E41V	MBP_ENST00000580402.1_Missense_Mutation_p.E41V|MBP_ENST00000579129.1_Missense_Mutation_p.E41V|MBP_ENST00000355994.2_Missense_Mutation_p.E41V|MBP_ENST00000487778.1_5'UTR|MBP_ENST00000397863.1_Missense_Mutation_p.E41V	NM_001025100.1	NP_001020271.1	P13727	PRG2_HUMAN	myelin basic protein	0					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)	p.E41V(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	Sargramostim(DB00020)	TTCGTTGTCCTCTGAGGTTGT	0.463																																					NSCLC(17;72 1131 19392)												1	Substitution - Missense(1)	kidney(1)											173.0	130.0	144.0					18																	74778271		2203	4300	6503	SO:0001583	missense	4155				CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971			6925	protein-coding gene	gene with protein product		159430				2425357	Standard	XM_005266699		Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397860.3:c.122A>T	18.37:g.74778271T>A	ENSP00000380958:p.Glu41Val	Somatic		WXS	Illumina HiSeq	Phase_I	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	ENST00000397860.3	37	CCDS42450.1	.	.	.	.	.	.	.	.	.	.	T	6.899	0.535326	0.13188	.	.	ENSG00000197971	ENST00000355994;ENST00000397863;ENST00000397860	.	.	.	3.28	2.12	0.27331	.	0.480100	0.18861	N	0.129134	T	0.36358	0.0964	L	0.44542	1.39	0.09310	N	1	P;D	0.55385	0.952;0.971	B;P	0.52343	0.404;0.696	T	0.13737	-1.0498	9	0.87932	D	0	-2.3411	5.252	0.15527	0.0:0.1314:0.0:0.8686	.	41;41	P02686;P02686-2	MBP_HUMAN;.	V	41	.	ENSP00000348273:E41V	E	-	2	0	MBP	72907259	0.029000	0.19370	0.074000	0.20217	0.018000	0.09664	0.704000	0.25661	0.654000	0.30846	0.533000	0.62120	GAG		0.463	MBP-005	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000267945.1		NM_001025081	
NEK9	91754	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	75583974	75583974	+	Missense_Mutation	SNP	T	T	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr14:75583974T>C	ENST00000238616.5	-	6	844	c.686A>G	c.(685-687)aAt>aGt	p.N229S		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	229	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.N229S(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		AGACTTGAAATTGTACTTTAC	0.403																																																	1	Substitution - Missense(1)	kidney(1)											126.0	114.0	118.0					14																	75583974		2203	4300	6503	SO:0001583	missense	91754			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.686A>G	14.37:g.75583974T>C	ENSP00000238616:p.Asn229Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	ENST00000238616.5	37	CCDS9839.1	.	.	.	.	.	.	.	.	.	.	t	15.87	2.959728	0.53400	.	.	ENSG00000119638	ENST00000238616;ENST00000540227;ENST00000557673	T;T	0.62788	2.0;0.0	5.73	4.59	0.56863	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.098987	0.64402	N	0.000002	T	0.38348	0.1037	N	0.04508	-0.205	0.36059	D	0.841315	B	0.18461	0.028	B	0.22152	0.038	T	0.38001	-0.9681	10	0.46703	T	0.11	.	8.5455	0.33419	0.0:0.1467:0.0:0.8533	.	229	Q8TD19	NEK9_HUMAN	S	229;211;111	ENSP00000238616:N229S;ENSP00000450943:N111S	ENSP00000238616:N229S	N	-	2	0	NEK9	74653727	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.917000	0.63369	1.020000	0.39573	0.529000	0.55759	AAT		0.403	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1		NM_033116	
NSD1	64324	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	176562399	176562399	+	Missense_Mutation	SNP	G	G	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr5:176562399G>A	ENST00000439151.2	+	2	340	c.295G>A	c.(295-297)Gac>Aac	p.D99N	NSD1_ENST00000347982.4_Intron|NSD1_ENST00000511258.1_Intron|NSD1_ENST00000361032.4_Missense_Mutation_p.D99N|NSD1_ENST00000354179.4_Intron	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	99					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.D99N(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ATCCTTTCAAGACCCTGAAAA	0.448			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	2	Substitution - Missense(2)	kidney(2)											83.0	81.0	82.0					5																	176562399		2203	4300	6503	SO:0001583	missense	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.295G>A	5.37:g.176562399G>A	ENSP00000395929:p.Asp99Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313060	0.40895	.	.	ENSG00000165671	ENST00000439151;ENST00000361032	D;D	0.94417	-3.28;-3.42	5.23	5.23	0.72850	.	0.220156	0.32055	N	0.006641	D	0.86883	0.6040	N	0.08118	0	0.80722	D	1	B;B;B	0.20671	0.047;0.028;0.015	B;B;B	0.18561	0.022;0.01;0.006	D	0.83371	0.0007	10	0.62326	D	0.03	.	11.1971	0.48719	0.0842:0.0:0.9158:0.0	.	99;99;99	Q96L73-3;Q96L73;Q6PJ64	.;NSD1_HUMAN;.	N	99	ENSP00000395929:D99N;ENSP00000354310:D99N	ENSP00000354310:D99N	D	+	1	0	NSD1	176495005	1.000000	0.71417	1.000000	0.80357	0.089000	0.18198	4.025000	0.57225	2.719000	0.93026	0.555000	0.69702	GAC		0.448	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2		NM_172349	
PABPC1	26986	hgsc.bcm.edu	37	8	101730036	101730037	+	Frame_Shift_Ins	INS	-	-	C	rs545344384	byFrequency	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr8:101730036_101730037insC	ENST00000318607.5	-	3	1595_1596	c.467_468insG	c.(466-468)gaafs	p.E156fs	PABPC1_ENST00000519596.1_5'Flank|PABPC1_ENST00000519004.1_Frame_Shift_Ins_p.E111fs|PABPC1_ENST00000522387.1_Frame_Shift_Ins_p.E124fs	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	156	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CATTCATTTTTTCAATAGCTCT	0.337													-|-|C|insertion	726	0.144968	0.2133	0.1124	5008	,	,		20837	0.0764		0.0825	False		,,,				2504	0.2106																0																																										SO:0001589	frameshift_variant	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.467_468insG	8.37:g.101730036_101730037insC	ENSP00000313007:p.Glu156fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q15097|Q93004	Frame_Shift_Ins	INS	ENST00000318607.5	37	CCDS6289.1																																																																																				0.337	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1		NM_002568	
PGAP2	27315	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	3846652	3846652	+	Silent	SNP	G	G	A	rs151115501		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr11:3846652G>A	ENST00000463452.2	+	6	812	c.729G>A	c.(727-729)ctG>ctA	p.L243L	PGAP2_ENST00000278243.4_Silent_p.L304L|PGAP2_ENST00000532017.1_3'UTR|PGAP2_ENST00000300730.6_Silent_p.L296L|PGAP2_ENST00000396991.2_Silent_p.L304L|PGAP2_ENST00000396993.4_3'UTR|PGAP2_ENST00000496834.2_Silent_p.L87L|PGAP2_ENST00000396986.2_Silent_p.L300L|PGAP2_ENST00000493547.2_3'UTR|PGAP2_ENST00000479072.1_Silent_p.L83L|PGAP2_ENST00000465307.2_3'UTR	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2	243					GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)	p.L296L(1)|p.L304L(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						ACAAGGAGCTGCTCATAACCT	0.522											OREG0020703	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - coding silent(2)	kidney(2)											147.0	121.0	130.0					11																	3846652		2201	4298	6499	SO:0001819	synonymous_variant	27315			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.729G>A	11.37:g.3846652G>A		Somatic	614	WXS	Illumina HiSeq	Phase_I	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Silent	SNP	ENST00000463452.2	37	CCDS58112.1	.	.	.	.	.	.	.	.	.	.	G	9.762	1.170224	0.21621	.	.	ENSG00000148985	ENST00000464906	.	.	.	5.41	3.52	0.40303	.	.	.	.	.	T	0.58524	0.2128	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53556	-0.8422	4	.	.	.	-10.4111	8.5956	0.33714	0.0799:0.0:0.7684:0.1518	.	.	.	.	Y	334	.	.	C	+	2	0	PGAP2	3803228	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.779000	0.55379	0.828000	0.34709	-0.291000	0.09656	TGC		0.522	PGAP2-049	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000383260.1			
POU3F4	5456	hgsc.bcm.edu	37	X	82764039	82764039	+	Frame_Shift_Del	DEL	A	A	-	rs111919890|rs386826000		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chrX:82764039delA	ENST00000373200.2	+	1	771	c.707delA	c.(706-708)gaafs	p.E236fs	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	236	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						TGCAGGTTCGAAGGCTTGCAG	0.562																																																	0										3721,0		1592,0,537,0	71.0	54.0	60.0			5.1	1.0	X	dbSNP_132	61	6481,1		2355,1,1770,0	no	frameshift	POU3F4	NM_000307.3		3947,1,2307,0	A1A1,A1R,A1,RR		0.0154,0.0,0.0098			82764039	10202,1	2203	4300	6503	SO:0001589	frameshift_variant	5456			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.707delA	X.37:g.82764039delA	ENSP00000362296:p.Glu236fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RC71|Q5H9G9|Q99410	Frame_Shift_Del	DEL	ENST00000373200.2	37	CCDS14450.1																																																																																				0.562	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2		NM_000307	
PTGIS	5740	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	48130813	48130813	+	Silent	SNP	C	C	T	rs140787750		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr20:48130813C>T	ENST00000244043.4	-	7	1004	c.975G>A	c.(973-975)tcG>tcA	p.S325S	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	325					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)	p.S325S(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	TGGTCGTCTGCGAGACAGGCT	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		21160	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)											102.0	91.0	95.0					20																	48130813		2203	4300	6503	SO:0001819	synonymous_variant	5740				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.975G>A	20.37:g.48130813C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Silent	SNP	ENST00000244043.4	37	CCDS13419.1																																																																																				0.567	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2			
RFTN1	23180	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	16475443	16475443	+	Missense_Mutation	SNP	G	G	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr3:16475443G>A	ENST00000334133.4	-	3	519	c.247C>T	c.(247-249)Cac>Tac	p.H83Y	RFTN1_ENST00000432519.1_Missense_Mutation_p.H47Y	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	83					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)	p.H83N(1)|p.H83Y(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						ACGAAGGGGTGCAGGGCCGCC	0.652																																																	2	Substitution - Missense(2)	prostate(1)|kidney(1)											55.0	63.0	60.0					3																	16475443		2203	4300	6503	SO:0001583	missense	23180			D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.247C>T	3.37:g.16475443G>A	ENSP00000334153:p.His83Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	ENST00000334133.4	37	CCDS33712.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571698	0.86542	.	.	ENSG00000131378	ENST00000432519;ENST00000334133;ENST00000451036;ENST00000449415;ENST00000441460;ENST00000431547	T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36	5.21	5.21	0.72293	.	0.168700	0.52532	D	0.000065	T	0.75213	0.3819	M	0.79926	2.475	0.58432	D	0.999999	D;D	0.89917	1.0;0.996	D;P	0.87578	0.998;0.892	T	0.79160	-0.1918	10	0.87932	D	0	-15.9704	18.3868	0.90469	0.0:0.0:1.0:0.0	.	47;83	G3XAJ6;Q14699	.;RFTN1_HUMAN	Y	47;83;83;83;83;83	ENSP00000403926:H47Y;ENSP00000334153:H83Y;ENSP00000403997:H83Y;ENSP00000409427:H83Y;ENSP00000388718:H83Y;ENSP00000393216:H83Y	ENSP00000334153:H83Y	H	-	1	0	RFTN1	16450447	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	8.578000	0.90777	2.433000	0.82419	0.561000	0.74099	CAC		0.652	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1		NM_015150	
RHBDF1	64285	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	109479	109479	+	Missense_Mutation	SNP	A	A	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr16:109479A>G	ENST00000262316.6	-	15	1973	c.1831T>C	c.(1831-1833)Tcc>Ccc	p.S611P		NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	611					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)		p.S611P(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				TACTCCCGGGAGGTGATCTCA	0.612																																																	1	Substitution - Missense(1)	kidney(1)											67.0	60.0	63.0					16																	109479		2203	4300	6503	SO:0001583	missense	64285			BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1831T>C	16.37:g.109479A>G	ENSP00000262316:p.Ser611Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	ENST00000262316.6	37	CCDS32344.1	.	.	.	.	.	.	.	.	.	.	.	22.2	4.257140	0.80246	.	.	ENSG00000007384	ENST00000262316	T	0.55413	0.52	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.63698	0.2533	L	0.49126	1.545	0.80722	D	1	D	0.65815	0.995	P	0.59761	0.863	T	0.67288	-0.5708	10	0.87932	D	0	-53.9443	14.5752	0.68240	1.0:0.0:0.0:0.0	.	611	Q96CC6	RHDF1_HUMAN	P	611	ENSP00000262316:S611P	ENSP00000262316:S611P	S	-	1	0	RHBDF1	49479	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	4.975000	0.63777	2.052000	0.61016	0.533000	0.62120	TCC		0.612	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134178.2		NM_022450	
SIK2	23235	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	111591208	111591208	+	Missense_Mutation	SNP	T	T	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr11:111591208T>A	ENST00000304987.3	+	11	1675	c.1502T>A	c.(1501-1503)aTt>aAt	p.I501N	SIK2_ENST00000533868.1_3'UTR	NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	501					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.I501N(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						AAAGGGAAAATTTTCTCCATG	0.438																																																	1	Substitution - Missense(1)	kidney(1)											83.0	86.0	85.0					11																	111591208		2201	4297	6498	SO:0001583	missense	23235			AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.1502T>A	11.37:g.111591208T>A	ENSP00000305976:p.Ile501Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	ENST00000304987.3	37	CCDS8347.1	.	.	.	.	.	.	.	.	.	.	T	16.17	3.047422	0.55110	.	.	ENSG00000170145	ENST00000304987	T	0.73363	-0.74	5.53	5.53	0.82687	.	0.762038	0.13065	N	0.416567	T	0.61223	0.2330	N	0.14661	0.345	0.40012	D	0.975291	B	0.26635	0.155	B	0.27608	0.081	T	0.56360	-0.7992	10	0.24483	T	0.36	.	15.4975	0.75666	0.0:0.0:0.0:1.0	.	501	Q9H0K1	SIK2_HUMAN	N	501	ENSP00000305976:I501N	ENSP00000305976:I501N	I	+	2	0	SIK2	111096418	1.000000	0.71417	0.965000	0.40720	0.981000	0.71138	5.647000	0.67923	2.324000	0.78689	0.533000	0.62120	ATT		0.438	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3		NM_015191	
SKA3	221150	hgsc.bcm.edu	37	13	21746601	21746601	+	Frame_Shift_Del	DEL	G	G	-	rs151272242	byFrequency	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr13:21746601delG	ENST00000314759.5	-	3	332	c.208delC	c.(208-210)caafs	p.Q70fs	SKA3_ENST00000400018.3_Frame_Shift_Del_p.Q70fs	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3	70					chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)				breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						ATGCCTTCTTGATTTTCCAAT	0.259													G|G|-|deletion	696	0.138978	0.0295	0.134	5008	,	,		19850	0.2391		0.1412	False		,,,				2504	0.1851																0									,	159,4085		0,159,1963	42.0	43.0	42.0		,	3.0	0.9	13	dbSNP_134	45	930,7300		2,926,3187	no	frameshift,frameshift	SKA3	NM_145061.5,NM_001166017.1	,	2,1085,5150	A1A1,A1R,RR		11.3001,3.7465,8.7302	,	,	21746601	1089,11385	2195	4287	6482	SO:0001589	frameshift_variant	221150			AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.208delC	13.37:g.21746601delG	ENSP00000319417:p.Gln70fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Frame_Shift_Del	DEL	ENST00000314759.5	37	CCDS31946.1																																																																																				0.259	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1		NM_145061	
TBC1D8B	54885	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	106117008	106117008	+	Missense_Mutation	SNP	G	G	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chrX:106117008G>T	ENST00000357242.5	+	21	3350	c.3176G>T	c.(3175-3177)gGg>gTg	p.G1059V	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.G1053V	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	1059							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.G1059V(2)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GAAAAAACAGGGAGCCACTTG	0.458																																																	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|kidney(1)											99.0	95.0	96.0					X																	106117008		2203	4300	6503	SO:0001583	missense	54885			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.3176G>T	X.37:g.106117008G>T	ENSP00000349781:p.Gly1059Val	Somatic		WXS	Illumina HiSeq	Phase_I	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	ENST00000357242.5	37	CCDS14522.1	.	.	.	.	.	.	.	.	.	.	G	0.034	-1.316364	0.01331	.	.	ENSG00000133138	ENST00000357242;ENST00000276175	T;T	0.07688	3.17;3.17	5.4	1.63	0.23807	.	1.002030	0.08043	N	0.995408	T	0.05090	0.0136	N	0.19112	0.55	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.43278	-0.9401	10	0.29301	T	0.29	-1.3192	3.0406	0.06137	0.6333:0.1392:0.0895:0.1379	.	1059	Q0IIM8	TBC8B_HUMAN	V	1059;1053	ENSP00000349781:G1059V;ENSP00000276175:G1053V	ENSP00000276175:G1053V	G	+	2	0	TBC1D8B	106003664	0.021000	0.18746	0.016000	0.15963	0.025000	0.11179	0.757000	0.26433	0.795000	0.33922	-0.351000	0.07748	GGG		0.458	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2		NM_017752	
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179614716	179614716	+	Intron	SNP	A	A	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr2:179614716A>G	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000360870.5_Silent_p.D4137D|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGTAACTTGATCTTGAGGCA	0.378																																																	0													89.0	91.0	91.0					2																	179614716		2203	4299	6502	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3134T>C	2.37:g.179614716A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
XPC	7508	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	14214467	14214467	+	Missense_Mutation	SNP	C	C	A			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr3:14214467C>A	ENST00000285021.7	-	2	413	c.199G>T	c.(199-201)Gca>Tca	p.A67S	XPC_ENST00000449060.2_Missense_Mutation_p.A67S	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	67	Glu-rich (acidic).				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)	p.A67S(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGACCATCTGCTGAACCCCCA	0.473			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	1	Substitution - Missense(1)	kidney(1)											105.0	99.0	101.0					3																	14214467		1882	4113	5995	SO:0001583	missense	7508	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.199G>T	3.37:g.14214467C>A	ENSP00000285021:p.Ala67Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Missense_Mutation	SNP	ENST00000285021.7	37	CCDS46763.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.275419	0.40294	.	.	ENSG00000154767	ENST00000285021;ENST00000449060;ENST00000511155	T;T;T	0.59083	0.29;0.29;0.29	5.13	-0.174	0.13319	.	0.538685	0.16632	N	0.206021	T	0.42585	0.1209	L	0.57536	1.79	0.09310	N	1	B;B	0.34103	0.437;0.278	B;B	0.25140	0.055;0.058	T	0.23511	-1.0186	10	0.39692	T	0.17	-2.41	4.8696	0.13625	0.0:0.4281:0.2948:0.2771	.	67;67	E9PH69;Q01831	.;XPC_HUMAN	S	67;67;61	ENSP00000285021:A67S;ENSP00000404002:A67S;ENSP00000423867:A61S	ENSP00000285021:A67S	A	-	1	0	XPC	14189471	0.000000	0.05858	0.001000	0.08648	0.120000	0.20174	-0.038000	0.12144	0.168000	0.19655	0.655000	0.94253	GCA		0.473	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340517.3		NM_004628	
CROCCP2	84809	broad.mit.edu	37	1	16946438	16946438	+	lincRNA	SNP	G	G	A	rs28392876	byFrequency	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr1:16946438G>A	ENST00000412962.1	-	0	1081				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GCCTTCCGCCGGGCCAGCAGC	0.672																																																	0																																												0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946438G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	ENST00000412962.1	37																																																																																					0.672	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000092784.1		NR_026752.1	
DUSP15	128853	broad.mit.edu	37	20	30438442	30438442	+	Missense_Mutation	SNP	T	T	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr20:30438442T>C	ENST00000278979.3	-	7	540	c.464A>G	c.(463-465)cAa>cGa	p.Q155R				Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15	155					positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.Q155R(1)		large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CGGAGGGCATTGGGCACCAGA	0.597																																																	1	Substitution - Missense(1)	kidney(1)											29.0	27.0	27.0					20																	30438442		876	1991	2867	SO:0001583	missense	128853				CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.464A>G	20.37:g.30438442T>C	ENSP00000278979:p.Gln155Arg	Somatic		WXS	Illumina GAIIx	Phase_I	A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Missense_Mutation	SNP	ENST00000278979.3	37		.	.	.	.	.	.	.	.	.	.	T	8.012	0.757753	0.15846	.	.	ENSG00000149599	ENST00000278979	T	0.04502	3.61	2.39	-4.68	0.03309	.	0.869767	0.10406	N	0.678539	T	0.02119	0.0066	.	.	.	0.09310	N	1	B	0.24186	0.099	B	0.21151	0.033	T	0.45338	-0.9268	9	0.22109	T	0.4	.	1.143	0.01769	0.1335:0.2653:0.1947:0.4065	.	155	Q9H1R2	DUS15_HUMAN	R	155	ENSP00000278979:Q155R	ENSP00000278979:Q155R	Q	-	2	0	DUSP15	29902103	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.794000	0.01753	-1.259000	0.02468	-0.415000	0.06103	CAA		0.597	DUSP15-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078555.3		NM_080611	
PLXNA1	5361	broad.mit.edu	37	3	126707544	126707544	+	Silent	SNP	T	T	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr3:126707544T>G	ENST00000393409.2	+	1	108	c.108T>G	c.(106-108)ggT>ggG	p.G36G	PLXNA1_ENST00000251772.4_Silent_p.G13G	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	36	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.G13G(4)		breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CAGGCGGGGGTTCACAGCCCC	0.682																																																	4	Substitution - coding silent(4)	lung(2)|kidney(2)											26.0	27.0	27.0					3																	126707544		2203	4300	6503	SO:0001819	synonymous_variant	5361			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.108T>G	3.37:g.126707544T>G		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																				0.682	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1		NM_032242	
RPL23AP53	644128	broad.mit.edu	37	8	163401	163401	+	RNA	SNP	G	G	C			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr8:163401G>C	ENST00000606975.1	-	0	520									ribosomal protein L23a pseudogene 53																		TCTGGTGCTTGTTGGCTTTAA	0.463																																																	0																																												644128					8p23.3	2014-06-17			ENSG00000223508	ENSG00000223508			35921	pseudogene	pseudogene						19123937	Standard	NR_003572		Approved		uc010lrb.4				8.37:g.163401G>C		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000606975.1	37																																																																																					0.463	RPL23AP53-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470409.1		NR_003572	
ST7	7982	broad.mit.edu	37	7	116869938	116869938	+	3'UTR	SNP	A	A	C	rs201022134		TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr7:116869938A>C	ENST00000393446.2	+	0	1902				ST7_ENST00000432298.1_3'UTR|ST7_ENST00000422922.1_3'UTR|ST7_ENST00000323984.3_3'UTR|ST7_ENST00000393447.4_3'UTR|ST7_ENST00000393451.3_3'UTR|ST7_ENST00000393443.1_3'UTR|ST7_ENST00000393444.3_3'UTR|ST7_ENST00000393449.1_3'UTR			Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7						endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CACTCACCTCACCCGCCGCTG	0.507																																																	0													60.0	58.0	59.0					7																	116869938		2203	4300	6503	SO:0001624	3_prime_UTR_variant	7982			AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000393446.2:c.*27A>C	7.37:g.116869938A>C		Somatic		WXS	Illumina GAIIx	Phase_I	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000393446.2	37		.	.	.	.	.	.	.	.	.	.	A	3.912	-0.019789	0.07634	.	.	ENSG00000004866	ENST00000446490;ENST00000490039	T;T	0.20069	2.1;2.1	4.85	-9.7	0.00521	.	.	.	.	.	T	0.12902	0.0313	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16988	-1.0384	8	0.87932	D	0	.	8.0486	0.30564	0.3268:0.2885:0.3847:0.0	.	489	C9JU30	.	P	487;489	ENSP00000402934:T487P;ENSP00000419516:T489P	ENSP00000402934:T487P	T	+	1	0	ST7	116657174	0.000000	0.05858	0.008000	0.14137	0.044000	0.14063	-0.532000	0.06164	-1.939000	0.01044	-1.252000	0.01501	ACC		0.507	ST7-013	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000319687.1		NM_021908	
MIR7162	102466227	broad.mit.edu	37	15	62534991	62534991	+	RNA	DEL	A	A	-			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr15:62534991delA	ENST00000570077.1	-	0	1311				AC126323.1_ENST00000408214.1_RNA																							TGAGCTCAGTAAAAAATGGGG	0.562																																																	0																																												0																															15.37:g.62534991delA		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	DEL	ENST00000570077.1	37																																																																																					0.562	hsa-mir-7162.1-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000422143.1			
Unknown	0	broad.mit.edu	37	16	16465314	16465314	+	IGR	SNP	A	A	G			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr16:16465314A>G								AC138969.4 (20867 upstream) : NPIPA7 (7597 downstream)																							CGGCGCCCAGATCCCCATCGA	0.632																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.16465314A>G		Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.632									
WHAMMP3	339005	broad.mit.edu	37	15	23205098	23205098	+	RNA	SNP	G	G	A	rs146035894	byFrequency	TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr15:23205098G>A	ENST00000400153.2	-	0	756					NR_003521.1		Q1A5X7	WHAL1_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3																		CTGGAAGAACGTGGTTGCCAC	0.373													a|||	60	0.0119808	0.0401	0.0043	5008	,	,		17673	0.002		0.001	False		,,,				2504	0.001																0																																												0			BC048987		15q11.2	2014-03-20	2011-06-24	2011-06-24	ENSG00000187667	ENSG00000276141			27892	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1 (pseudogene)"""	WHDC1L1, WHAMML1		18226259	Standard	NR_003521		Approved		uc001yvg.3	Q1A5X7	OTTHUMG00000171921		15.37:g.23205098G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q1A5X8|Q52M16|Q52M18	RNA	SNP	ENST00000400153.2	37																																																																																					0.373	WHAMMP3-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000415907.1		NR_003521	
WHAMMP3	339005	broad.mit.edu	37	15	23205108	23205108	+	RNA	SNP	C	C	T			TCGA-B8-5552-01B-11D-1669-08	TCGA-B8-5552-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	13b52e49-20df-4e39-9dc9-cf8f7c157bd7	ee08ef8a-2a71-4a48-b8f3-b363a19db60d	g.chr15:23205108C>T	ENST00000400153.2	-	0	746					NR_003521.1		Q1A5X7	WHAL1_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3																		GTGGTTGCCACGGTAACTAAT	0.393																																																	0																																												0			BC048987		15q11.2	2014-03-20	2011-06-24	2011-06-24	ENSG00000187667	ENSG00000276141			27892	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1 (pseudogene)"""	WHDC1L1, WHAMML1		18226259	Standard	NR_003521		Approved		uc001yvg.3	Q1A5X7	OTTHUMG00000171921		15.37:g.23205108C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q1A5X8|Q52M16|Q52M18	RNA	SNP	ENST00000400153.2	37																																																																																					0.393	WHAMMP3-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000415907.1		NR_003521	
