#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF11	440560	broad.mit.edu	37	1	12887606	12887606	+	Missense_Mutation	SNP	C	C	G	rs58074988	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:12887606C>G	ENST00000535591.1	-	3	446	c.251G>C	c.(250-252)tGc>tCc	p.C84S		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	84					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.C84S(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						ATTGAGGAAGCACCCATGGGC	0.483																																					p.C84S													.	.	1	Substitution - Missense(1)	endometrium(1)	c.G251C						.																																			SO:0001583	missense	440560	exon3			AGGAAGCACCCAT	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.251G>C	1.37:g.12887606C>G	ENSP00000439551:p.Cys84Ser	Somatic	582	1		WXS	Illumina HiSeq	Phase_I	717	10	NM_001146344	0	0	0	0	0		Missense_Mutation	SNP	ENST00000535591.1	37	CCDS53268.1	.	.	.	.	.	.	.	.	.	.	.	8.676	0.903882	0.17760	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.18016	2.24;2.24	1.48	-0.635	0.11512	.	1.371720	0.04624	N	0.402516	T	0.15825	0.0381	L	0.54908	1.71	0.09310	N	1	P	0.44816	0.844	B	0.41764	0.366	T	0.23904	-1.0175	10	0.16896	T	0.51	.	3.692	0.08350	0.2835:0.4381:0.2784:0.0	rs58074988	84	O60813	PRA11_HUMAN	S	84;125;84	ENSP00000439551:C84S;ENSP00000391839:C84S	ENSP00000328783:C125S	C	-	2	0	PRAMEF11	12810193	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.358000	0.07641	-0.176000	0.10707	-1.934000	0.00508	TGC	C|0.500;G|0.500		0.483	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
EPHA8	2046	hgsc.bcm.edu;broad.mit.edu	37	1	22903356	22903356	+	Missense_Mutation	SNP	G	G	C	rs139777546		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:22903356G>C	ENST00000166244.3	+	3	878	c.806G>C	c.(805-807)cGg>cCg	p.R269P	EPHA8_ENST00000374644.4_Missense_Mutation_p.R269P|EPHA8_ENST00000538803.1_Missense_Mutation_p.R269P	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	269	Cys-rich.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TACGAGGAGCGGCGGGATGCC	0.677																																					p.R269P		.											.	EPHA8-1380	0			c.G806C						.						25.0	26.0	26.0					1																	22903356		2201	4296	6497	SO:0001583	missense	2046	exon3			AGGAGCGGCGGGA	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.806G>C	1.37:g.22903356G>C	ENSP00000166244:p.Arg269Pro	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	82	25	NM_020526	0	0	0	0	0	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	37	CCDS225.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330463	0.41297	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.29397	1.57;5.07;5.07	4.09	2.01	0.26516	.	0.231542	0.36893	N	0.002360	T	0.22975	0.0555	L	0.32530	0.975	0.28846	N	0.896308	B;P	0.42010	0.337;0.768	B;P	0.44477	0.147;0.451	T	0.06092	-1.0846	10	0.48119	T	0.1	.	4.9743	0.14133	0.2072:0.0:0.6108:0.1819	.	269;269	P29322;P29322-2	EPHA8_HUMAN;.	P	269	ENSP00000166244:R269P;ENSP00000363775:R269P;ENSP00000440274:R269P	ENSP00000166244:R269P	R	+	2	0	EPHA8	22775943	0.991000	0.36638	1.000000	0.80357	0.979000	0.70002	0.794000	0.26958	0.926000	0.37118	0.442000	0.29010	CGG	G|0.999;A|0.001		0.677	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
PIGV	55650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27121059	27121059	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:27121059C>T	ENST00000374145.1	+	3	1216	c.534C>T	c.(532-534)ttC>ttT	p.F178F	PIGV_ENST00000449950.2_Intron|PIGV_ENST00000078527.4_Silent_p.F178F	NM_001202554.1	NP_001189483.1	Q9NUD9	PIGV_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class V	178					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	14		all_cancers(24;3.93e-26)|all_epithelial(13;3.96e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.26e-54)|Epithelial(14;2.85e-53)|OV - Ovarian serous cystadenocarcinoma(117;1.91e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000504)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.0222)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		TCCTGACATTCAGTGCCATGG	0.562																																					p.F178F		.											.	PIGV-91	0			c.C534T						.						79.0	78.0	78.0					1																	27121059		2203	4300	6503	SO:0001819	synonymous_variant	55650	exon3			GACATTCAGTGCC	AK000484	CCDS287.1	1p36.11	2013-02-26	2006-06-28		ENSG00000060642	ENSG00000060642		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	26031	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 2"", ""dol-P-Man dependent GPI mannosyltransferase"""	610274	"""phosphatidylinositol glycan, class V"""			15623507	Standard	NM_017837		Approved	FLJ20477	uc001bmz.3	Q9NUD9	OTTHUMG00000004005	ENST00000374145.1:c.534C>T	1.37:g.27121059C>T		Somatic	116	0		WXS	Illumina HiSeq	Phase_I	180	57	NM_001202554	0	0	8	32	24	D3DPL2|Q5JYG7|Q5JYG8|Q5JYG9|Q9NX26	Silent	SNP	ENST00000374145.1	37	CCDS287.1																																																																																			.		0.562	PIGV-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011441.1	NM_017837	
SLC9A1	6548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27428600	27428600	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:27428600C>T	ENST00000263980.3	-	9	2417	c.1842G>A	c.(1840-1842)ctG>ctA	p.L614L	SLC9A1_ENST00000545949.1_Silent_p.L275L|SLC9A1_ENST00000490329.1_5'Flank	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	614					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	GCTCGGAAGGCAGGGACTTGG	0.582																																					p.L614L		.											.	SLC9A1-91	0			c.G1842A						.						136.0	126.0	129.0					1																	27428600		2203	4300	6503	SO:0001819	synonymous_variant	6548	exon9			GGAAGGCAGGGAC	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.1842G>A	1.37:g.27428600C>T		Somatic	166	0		WXS	Illumina HiSeq	Phase_I	270	74	NM_003047	0	0	13	20	7	B1ALD6|D3DPL4|Q96EM2	Silent	SNP	ENST00000263980.3	37	CCDS295.1																																																																																			.		0.582	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
AGO1	26523	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	36359988	36359988	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:36359988C>T	ENST00000373204.4	+	7	1070	c.857C>T	c.(856-858)cCt>cTt	p.P286L	AGO1_ENST00000373206.1_Missense_Mutation_p.P211L	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	286	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										ACCCGTCGCCCTGCTAGCCAT	0.532																																					p.P286L		.											.	.	0			c.C857T						.						159.0	117.0	131.0					1																	36359988		2203	4300	6503	SO:0001583	missense	26523	exon7			GTCGCCCTGCTAG	AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.857C>T	1.37:g.36359988C>T	ENSP00000362300:p.Pro286Leu	Somatic	84	1		WXS	Illumina HiSeq	Phase_I	78	26	NM_012199	0	0	0	0	0	Q5TA57|Q6P4S0	Missense_Mutation	SNP	ENST00000373204.4	37	CCDS398.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485123	0.63962	.	.	ENSG00000092847	ENST00000373206;ENST00000373204	T;T	0.14022	2.54;2.54	5.24	5.24	0.73138	Argonaute/Dicer protein, PAZ (4);	0.000000	0.85682	D	0.000000	T	0.38532	0.1044	H	0.95679	3.705	0.80722	D	1	B	0.13145	0.007	B	0.33121	0.158	T	0.50171	-0.8859	10	0.72032	D	0.01	-19.9943	19.0006	0.92832	0.0:1.0:0.0:0.0	.	286	Q9UL18	AGO1_HUMAN	L	211;286	ENSP00000362302:P211L;ENSP00000362300:P286L	ENSP00000362300:P286L	P	+	2	0	EIF2C1	36132575	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.651000	0.83577	2.721000	0.93114	0.591000	0.81541	CCT	.		0.532	AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019337.3		
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	39907695	39907695	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:39907695T>G	ENST00000372915.3	+	74	18528	c.18441T>G	c.(18439-18441)aaT>aaG	p.N6147K	MACF1_ENST00000564288.1_Missense_Mutation_p.N6248K|MACF1_ENST00000317713.7_Missense_Mutation_p.N4189K|MACF1_ENST00000361689.2_Missense_Mutation_p.N4189K|MACF1_ENST00000289893.4_Missense_Mutation_p.N4691K|MACF1_ENST00000545844.1_Missense_Mutation_p.N4189K|MACF1_ENST00000539005.1_Missense_Mutation_p.N4059K|MACF1_ENST00000567887.1_Missense_Mutation_p.N6285K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6147					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTGACCTCAATACTGTTAAAG	0.353																																					p.N4189K		.											.	MACF1-165	0			c.T12567G						.						118.0	110.0	113.0					1																	39907695		2203	4300	6503	SO:0001583	missense	23499	exon72			CCTCAATACTGTT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18441T>G	1.37:g.39907695T>G	ENSP00000362006:p.Asn6147Lys	Somatic	217	0		WXS	Illumina HiSeq	Phase_I	45	12	NM_012090	0	0	1	3	2	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.72|16.72	3.201648|3.201648	0.58234|0.58234	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.48836|.	0.8;0.8;0.8;0.8;0.8;0.8|.	5.62|5.62	4.71|4.71	0.59529|0.59529	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.33990|0.33990	0.0882|0.0882	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	D;P|.	0.55605|.	0.972;0.843|.	P;P|.	0.55455|.	0.776;0.62|.	T|T	0.14727|0.14727	-1.0462|-1.0462	10|5	0.32370|.	T|.	0.25|.	.|.	9.9927|9.9927	0.41881|0.41881	0.0:0.8446:0.0:0.1554|0.0:0.8446:0.0:0.1554	.|.	6147;4189|.	Q9UPN3;F8W8Q1|.	MACF1_HUMAN;.|.	K|D	4189;6147;4189;4189;4059;4691|3193	ENSP00000439537:N4189K;ENSP00000362006:N6147K;ENSP00000354573:N4189K;ENSP00000313438:N4189K;ENSP00000444364:N4059K;ENSP00000289893:N4691K|.	ENSP00000289893:N4691K|.	N|Y	+|+	3|1	2|0	MACF1|MACF1	39680282|39680282	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	2.512000|2.512000	0.45485|0.45485	1.352000|1.352000	0.45808|0.45808	-0.366000|-0.366000	0.07423|0.07423	AAT|TAC	.		0.353	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
MCOLN3	55283	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	85491700	85491700	+	Silent	SNP	A	A	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:85491700A>G	ENST00000370589.2	-	9	1069	c.1017T>C	c.(1015-1017)aaT>aaC	p.N339N	MCOLN3_ENST00000474447.1_5'Flank|MCOLN3_ENST00000341115.4_Silent_p.N283N|MCOLN3_ENST00000370587.1_3'UTR|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	339					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		TGTACCATCCATTGACAAATT	0.333																																					p.N339N		.											.	MCOLN3-91	0			c.T1017C						.						57.0	56.0	56.0					1																	85491700		2203	4300	6503	SO:0001819	synonymous_variant	55283	exon9			CCATCCATTGACA	AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.1017T>C	1.37:g.85491700A>G		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	40	13	NM_018298	0	0	0	0	0	Q5T4H5|Q5T4H6|Q9NV09	Silent	SNP	ENST00000370589.2	37	CCDS701.1																																																																																			.		0.333	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298	
ATP1A2	477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	160105304	160105304	+	Silent	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:160105304C>A	ENST00000361216.3	+	16	2285	c.2196C>A	c.(2194-2196)ggC>ggA	p.G732G	ATP1A2_ENST00000392233.3_Silent_p.G732G	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	732					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TTGCCATGGGCATCTCTGGCT	0.602																																					p.G732G		.											.	ATP1A2-518	0			c.C2196A						.						169.0	125.0	140.0					1																	160105304		2203	4300	6503	SO:0001819	synonymous_variant	477	exon16			CATGGGCATCTCT	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2196C>A	1.37:g.160105304C>A		Somatic	142	0		WXS	Illumina HiSeq	Phase_I	246	97	NM_000702	0	0	0	0	0	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Silent	SNP	ENST00000361216.3	37	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	C	5.352	0.250270	0.10130	.	.	ENSG00000018625	ENST00000447527	.	.	.	4.31	2.27	0.28462	.	.	.	.	.	T	0.32406	0.0828	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19844	-1.0293	4	.	.	.	.	4.575	0.12228	0.1513:0.6098:0.1479:0.091	.	.	.	.	E	443	.	.	A	+	2	0	ATP1A2	158371928	0.489000	0.26004	1.000000	0.80357	0.433000	0.31745	-0.303000	0.08210	1.154000	0.42482	0.561000	0.74099	GCA	.		0.602	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
ATF6	22926	hgsc.bcm.edu	37	1	161748090	161748090	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:161748090G>C	ENST00000367942.3	+	2	206	c.139G>C	c.(139-141)Gaa>Caa	p.E47Q		NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	47	Transcription activation.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	GCTGCAATTGGAAGCAGCAAA	0.348																																					p.E47Q		.											.	ATF6-93	0			c.G139C						.						107.0	102.0	104.0					1																	161748090		2203	4300	6503	SO:0001583	missense	22926	exon2			CAATTGGAAGCAG	AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.139G>C	1.37:g.161748090G>C	ENSP00000356919:p.Glu47Gln	Somatic	167	0		WXS	Illumina HiSeq	Phase_I	21	2	NM_007348	0	0	2	2	0	O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	ENST00000367942.3	37	CCDS1235.1	.	.	.	.	.	.	.	.	.	.	G	9.469	1.095154	0.20471	.	.	ENSG00000118217	ENST00000367942	T	0.14266	2.52	4.97	4.06	0.47325	.	0.206931	0.40554	N	0.001061	T	0.02649	0.0080	N	0.14661	0.345	0.22710	N	0.998823	B;B	0.19583	0.01;0.037	B;B	0.20955	0.012;0.032	T	0.40739	-0.9547	9	0.24483	T	0.36	-9.7527	9.4424	0.38677	0.0959:0.0:0.9041:0.0	.	47;48	P18850;Q59H30	ATF6A_HUMAN;.	Q	47	ENSP00000356919:E47Q	ENSP00000356919:E47Q	E	+	1	0	ATF6	160014714	1.000000	0.71417	0.449000	0.26957	0.456000	0.32438	4.229000	0.58625	1.471000	0.48121	-0.147000	0.13772	GAA	.		0.348	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2	NM_007348	
IRF6	3664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	209964089	209964089	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:209964089G>C	ENST00000367021.3	-	7	983	c.811C>G	c.(811-813)Ctg>Gtg	p.L271V	IRF6_ENST00000542854.1_Missense_Mutation_p.L176V	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	271					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		ACCTGCTCCAGGCTGACGGGA	0.572										HNSCC(57;0.16)																											p.L271V		.											.	IRF6-92	0			c.C811G						.						80.0	76.0	77.0					1																	209964089		2203	4300	6503	SO:0001583	missense	3664	exon7			GCTCCAGGCTGAC	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.811C>G	1.37:g.209964089G>C	ENSP00000355988:p.Leu271Val	Somatic	229	0		WXS	Illumina HiSeq	Phase_I	167	71	NM_006147	0	0	4	12	8	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Missense_Mutation	SNP	ENST00000367021.3	37	CCDS1492.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139845	0.77775	.	.	ENSG00000117595	ENST00000367021;ENST00000542854;ENST00000456314	D;D;D	0.95788	-3.57;-3.57;-3.81	6.17	5.26	0.73747	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.000000	0.85682	D	0.000000	D	0.95557	0.8556	L	0.39397	1.21	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	D	0.93440	0.6793	9	.	.	.	.	9.4637	0.38800	0.1513:0.0:0.8487:0.0	.	271	O14896	IRF6_HUMAN	V	271;176;271	ENSP00000355988:L271V;ENSP00000440532:L176V;ENSP00000403855:L271V	.	L	-	1	2	IRF6	208030712	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.122000	0.57910	2.941000	0.99782	0.655000	0.94253	CTG	.		0.572	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147	
PTEN	5728	broad.mit.edu	37	10	89624275	89624275	+	Nonsense_Mutation	SNP	C	C	T	rs587781912		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr10:89624275C>T	ENST00000371953.3	+	1	1406	c.49C>T	c.(49-51)Caa>Taa	p.Q17*	KLLN_ENST00000445946.3_5'Flank	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	17	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(13)|p.Q17*(5)|p.Q17del(2)|p.R15fs*23(1)|p.R14fs*26(1)|p.Y16fs*21(1)|p.N12fs*6(1)|p.R14_D22del(1)|p.Y16fs*1(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAGGAGATATCAAGAGGATGG	0.478		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.Q17X			yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN-17735	63	Whole gene deletion(37)|Unknown(13)|Substitution - Nonsense(5)|Deletion - Frameshift(5)|Deletion - In frame(3)	prostate(14)|central_nervous_system(13)|endometrium(7)|skin(7)|lung(6)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|breast(3)|bone(2)|biliary_tract(1)|stomach(1)|soft_tissue(1)|urinary_tract(1)|kidney(1)	c.C49T						.						183.0	175.0	178.0					10																	89624275		2203	4300	6503	SO:0001587	stop_gained	5728	exon1	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	AGATATCAAGAGG	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.49C>T	10.37:g.89624275C>T	ENSP00000361021:p.Gln17*	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	205	6	NM_000314	0	0	13	14	1	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Nonsense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	C	49	15.443228	0.99834	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.05	5.05	0.67936	.	0.062767	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.7659	17.1609	0.86803	0.0:1.0:0.0:0.0	.	.	.	.	X	17	.	.	Q	+	1	0	PTEN	89614255	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.015000	0.76387	2.335000	0.79485	0.561000	0.74099	CAA	.		0.478	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
METTL10	399818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	126477651	126477651	+	Silent	SNP	A	A	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr10:126477651A>G	ENST00000368836.2	-	3	288	c.252T>C	c.(250-252)ctT>ctC	p.L84L	RP11-12J10.3_ENST00000494792.1_Missense_Mutation_p.L49S	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	84							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		TTCCAATATCAAGCACTGAAG	0.348																																					p.L84L		.											.	METTL10-22	0			c.T252C						.						172.0	152.0	159.0					10																	126477651		2203	4300	6503	SO:0001819	synonymous_variant	399818	exon3			AATATCAAGCACT		CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.252T>C	10.37:g.126477651A>G		Somatic	182	0		WXS	Illumina HiSeq	Phase_I	110	39	NM_212554	0	0	3	6	3	A8MPY7	Silent	SNP	ENST00000368836.2	37	CCDS31307.1																																																																																			.		0.348	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050884.1	NM_212554	
TRIM3	10612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6486812	6486812	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:6486812C>T	ENST00000525074.1	-	2	508	c.114G>A	c.(112-114)ctG>ctA	p.L38L	TRIM3_ENST00000359518.3_Silent_p.L38L|TRIM3_ENST00000536344.1_Intron|TRIM3_ENST00000537602.1_Silent_p.L38L|TRIM3_ENST00000345851.3_Silent_p.L38L	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	38					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAAGGTGTGCAGGCAAGGAA	0.607																																					p.L38L	Melanoma(6;5 510 1540 25169 29084)	.											.	TRIM3-714	0			c.G114A						.						209.0	157.0	174.0					11																	6486812		2201	4296	6497	SO:0001819	synonymous_variant	10612	exon2			GGTGTGCAGGCAA	AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.114G>A	11.37:g.6486812C>T		Somatic	230	1		WXS	Illumina HiSeq	Phase_I	318	107	NM_001248006	0	0	0	1	1	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Silent	SNP	ENST00000525074.1	37	CCDS7764.1																																																																																			.		0.607	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2	NM_006458	
FJX1	24147	hgsc.bcm.edu	37	11	35641295	35641295	+	Missense_Mutation	SNP	A	A	G	rs202089278	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:35641295A>G	ENST00000317811.4	+	1	1561	c.1111A>G	c.(1111-1113)Acc>Gcc	p.T371A	FJX1_ENST00000532914.1_3'UTR	NM_014344.3	NP_055159.2	Q86VR8	FJX1_HUMAN	four jointed box 1 (Drosophila)	371					retina layer formation (GO:0010842)	extracellular space (GO:0005615)				lung(1)|urinary_tract(1)	2	all_cancers(35;0.177)|all_lung(20;0.0238)|Lung NSC(22;0.0494)|all_epithelial(35;0.0739)	all_hematologic(20;0.107)				CCGCGAGCGGACCGCGCGGCG	0.706													A|||	14	0.00279553	0.0106	0.0	5008	,	,		12543	0.0		0.0	False		,,,				2504	0.0				p.T371A	Melanoma(161;10 2587 27165 47356)	.											.	.	0			c.A1111G						.	A	ALA/THR	14,3808		0,14,1897	6.0	8.0	7.0		1111	5.2	1.0	11		7	0,8144		0,0,4072	yes	missense	FJX1	NM_014344.3	58	0,14,5969	GG,GA,AA		0.0,0.3663,0.117	possibly-damaging	371/438	35641295	14,11952	1911	4072	5983	SO:0001583	missense	24147	exon1			GAGCGGACCGCGC	AJ245599	CCDS44570.1	11p13	2012-05-18				ENSG00000179431			17166	protein-coding gene	gene with protein product	"""putative secreted ligand homologous to fjx1"""	612206				7647465, 10072791	Standard	NM_014344		Approved	FLJ22416, FLJ25593	uc001mwh.3	Q86VR8		ENST00000317811.4:c.1111A>G	11.37:g.35641295A>G	ENSP00000400223:p.Thr371Ala	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	15	5	NM_014344	0	0	0	1	1	B2RCA9|Q9UGK6	Missense_Mutation	SNP	ENST00000317811.4	37	CCDS44570.1	10	0.004578754578754579	10	0.02032520325203252	0	0.0	0	0.0	0	0.0	A	20.6	4.011909	0.75046	0.003663	0.0	ENSG00000179431	ENST00000317811	D	0.81659	-1.52	5.21	5.21	0.72293	.	.	.	.	.	T	0.78470	0.4288	M	0.73217	2.22	0.38748	D	0.954037	D	0.67145	0.996	D	0.65573	0.936	D	0.85203	0.1016	9	0.72032	D	0.01	-4.633	9.3359	0.38049	0.9184:0.0:0.0816:0.0	.	371	Q86VR8	FJX1_HUMAN	A	371	ENSP00000400223:T371A	ENSP00000400223:T371A	T	+	1	0	FJX1	35597871	1.000000	0.71417	0.994000	0.49952	0.946000	0.59487	5.310000	0.65780	1.968000	0.57251	0.454000	0.30748	ACC	A|0.995;G|0.005		0.706	FJX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389078.1	NM_014344	
TTC17	55761	hgsc.bcm.edu	37	11	43436151	43436151	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:43436151T>G	ENST00000039989.4	+	16	2090	c.2076T>G	c.(2074-2076)ttT>ttG	p.F692L	TTC17_ENST00000299240.6_Missense_Mutation_p.F692L|TTC17_ENST00000526774.1_3'UTR	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	692					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CTCTGACCTTTTTGAGCCTGG	0.398																																					p.F692L		.											.	TTC17-95	0			c.T2076G						.						102.0	114.0	110.0					11																	43436151		2203	4300	6503	SO:0001583	missense	55761	exon16			GACCTTTTTGAGC	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2076T>G	11.37:g.43436151T>G	ENSP00000039989:p.Phe692Leu	Somatic	413	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_018259	0	0	0	0	0	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	T	9.464	1.093955	0.20471	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.55588	0.51;0.51	5.6	3.3	0.37823	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.056859	0.64402	D	0.000001	T	0.18341	0.0440	N	0.00750	-1.22	0.31176	N	0.702654	B;B;B	0.12013	0.0;0.005;0.0	B;B;B	0.14023	0.002;0.01;0.001	T	0.09862	-1.0655	10	0.25106	T	0.35	-14.3037	5.3147	0.15849	0.0:0.214:0.138:0.648	.	692;692;692	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	L	692	ENSP00000299240:F692L;ENSP00000039989:F692L	ENSP00000039989:F692L	F	+	3	2	TTC17	43392727	0.972000	0.33761	0.999000	0.59377	0.979000	0.70002	0.393000	0.20817	0.419000	0.25927	-0.400000	0.06385	TTT	.		0.398	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
ZBTB3	79842	broad.mit.edu	37	11	62519739	62519739	+	Silent	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:62519739G>A	ENST00000394807.3	-	2	1673	c.1548C>T	c.(1546-1548)taC>taT	p.Y516Y		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	516					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						GGATGTGGCGGTAGAGGTCCC	0.617																																					p.Y516Y													.	ZBTB3-585	0			c.C1548T						.						95.0	90.0	91.0					11																	62519739		2202	4299	6501	SO:0001819	synonymous_variant	79842	exon2			GTGGCGGTAGAGG	AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.1548C>T	11.37:g.62519739G>A		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	160	4	NM_024784	0	0	3	3	0		Silent	SNP	ENST00000394807.3	37	CCDS8034.1																																																																																			.		0.617	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395342.1	NM_024784	
OTUB1	55611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	63756155	63756155	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:63756155G>T	ENST00000538426.1	+	3	194	c.150G>T	c.(148-150)gaG>gaT	p.E50D	OTUB1_ENST00000543988.1_Missense_Mutation_p.E20D|OTUB1_ENST00000541478.1_Intron|OTUB1_ENST00000535715.1_Missense_Mutation_p.E50D|OTUB1_ENST00000422031.2_Missense_Mutation_p.E87D|OTUB1_ENST00000536443.1_3'UTR|OTUB1_ENST00000428192.2_Missense_Mutation_p.E50D|OTUB1_ENST00000543004.1_Missense_Mutation_p.E59D	NM_017670.2	NP_060140.2	Q96FW1	OTUB1_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 1	50					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|immune system process (GO:0002376)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein K48-linked deubiquitination (GO:0071108)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	NEDD8-specific protease activity (GO:0019784)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	6						TGGTGTCAGAGCGGCTGGAGC	0.537																																					p.E50D		.											.	OTUB1-501	0			c.G150T						.						114.0	116.0	115.0					11																	63756155		2201	4297	6498	SO:0001583	missense	55611	exon3			GTCAGAGCGGCTG	AY177200	CCDS8055.1	11q13.1	2014-02-24	2014-02-24			ENSG00000167770		"""OTU domain containing"""	23077	protein-coding gene	gene with protein product		608337	"""OTU domain, ubiquitin aldehyde binding 1"""			12704427, 19383985	Standard	NM_017670		Approved	FLJ20113, FLJ40710	uc001nyf.1	Q96FW1		ENST00000538426.1:c.150G>T	11.37:g.63756155G>T	ENSP00000444357:p.Glu50Asp	Somatic	346	0		WXS	Illumina HiSeq	Phase_I	515	141	NM_017670	0	0	70	118	48	Q32Q78|Q96II3|Q9NXQ4|Q9P0B8	Missense_Mutation	SNP	ENST00000538426.1	37	CCDS8055.1	.	.	.	.	.	.	.	.	.	.	G	8.534	0.871741	0.17322	.	.	ENSG00000167770	ENST00000535715;ENST00000428192;ENST00000422031;ENST00000538426;ENST00000543004;ENST00000543988	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	5.49	5.49	0.81192	.	.	.	.	.	T	0.29491	0.0735	N	0.17248	0.465	0.35424	D	0.793481	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.29971	-0.9994	9	0.15952	T	0.53	.	10.7288	0.46085	0.0876:0.0:0.9124:0.0	.	87;50	B4DPD5;Q96FW1	.;OTUB1_HUMAN	D	50;50;87;50;59;20	ENSP00000440211:E50D;ENSP00000402551:E50D;ENSP00000416973:E87D;ENSP00000444357:E50D;ENSP00000437453:E59D;ENSP00000441328:E20D	ENSP00000416973:E87D	E	+	3	2	OTUB1	63512731	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	1.546000	0.36179	2.753000	0.94483	0.591000	0.81541	GAG	.		0.537	OTUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396277.1	NM_017670	
IGSF9B	22997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	133814179	133814179	+	Silent	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:133814179C>A	ENST00000321016.8	-	3	575	c.345G>T	c.(343-345)gtG>gtT	p.V115V	IGSF9B_ENST00000533871.2_Silent_p.V115V			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	115	Ig-like 1.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CCAGCATGAGCACTTTGCACT	0.577																																					p.V115V		.											.	IGSF9B-68	0			c.G345T						.						108.0	116.0	113.0					11																	133814179		2103	4231	6334	SO:0001819	synonymous_variant	22997	exon3			CATGAGCACTTTG	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.345G>T	11.37:g.133814179C>A		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	67	32	NM_014987	0	0	0	0	0	G5EA26	Silent	SNP	ENST00000321016.8	37																																																																																				.		0.577	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
ITGB7	3695	broad.mit.edu	37	12	53587039	53587039	+	Silent	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr12:53587039G>A	ENST00000267082.5	-	12	1842	c.1611C>T	c.(1609-1611)tgC>tgT	p.C537C	ITGB7_ENST00000550743.2_Intron|ITGB7_ENST00000338737.4_Intron|ITGB7_ENST00000422257.3_Silent_p.C537C	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	537	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCTTTCCACTGCACAGGGGCC	0.627																																					p.C537C													.	ITGB7-231	0			c.C1611T						.						51.0	48.0	49.0					12																	53587039		2203	4300	6503	SO:0001819	synonymous_variant	3695	exon12			TCCACTGCACAGG		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.1611C>T	12.37:g.53587039G>A		Somatic	81	1		WXS	Illumina HiSeq	Phase_I	129	5	NM_000889	0	0	24	24	0	Q9UCP7|Q9UCS7	Silent	SNP	ENST00000267082.5	37	CCDS8849.1																																																																																			.		0.627	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2		
CEP290	80184	broad.mit.edu	37	12	88524957	88524957	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr12:88524957G>T	ENST00000552810.1	-	7	823	c.480C>A	c.(478-480)agC>agA	p.S160R	CEP290_ENST00000309041.7_Missense_Mutation_p.S160R|CEP290_ENST00000397838.3_5'Flank	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	160					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTCTTAATTTGCTGTTTTCAT	0.249																																					p.S160R													.	CEP290-96	0			c.C480A						.						114.0	102.0	105.0					12																	88524957		1765	4036	5801	SO:0001583	missense	80184	exon7			TAATTTGCTGTTT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.480C>A	12.37:g.88524957G>T	ENSP00000448012:p.Ser160Arg	Somatic	13	0		WXS	Illumina HiSeq	Phase_I	4	2	NM_025114	0	0	0	0	0	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.746016	0.30955	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139	T;T	0.64991	-0.13;-0.13	5.48	5.48	0.80851	.	0.213875	0.48767	D	0.000171	T	0.47210	0.1433	N	0.12182	0.205	0.80722	D	1	B	0.15473	0.013	B	0.16289	0.015	T	0.33111	-0.9881	10	0.25751	T	0.34	.	19.3369	0.94322	0.0:0.0:1.0:0.0	.	160	O15078	CE290_HUMAN	R	160;160;160;62	ENSP00000448012:S160R;ENSP00000308021:S160R	ENSP00000308021:S160R	S	-	3	2	CEP290	87049088	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.396000	0.59684	2.575000	0.86900	0.563000	0.77884	AGC	.		0.249	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
DGKH	160851	hgsc.bcm.edu	37	13	42740683	42740683	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr13:42740683A>C	ENST00000337343.4	+	9	1012	c.991A>C	c.(991-993)Agt>Cgt	p.S331R	DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000540693.1_Missense_Mutation_p.S331R|DGKH_ENST00000261491.5_Missense_Mutation_p.S331R|DGKH_ENST00000538674.1_Missense_Mutation_p.S86R|DGKH_ENST00000379274.2_Missense_Mutation_p.S195R|DGKH_ENST00000536612.1_Missense_Mutation_p.S195R	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	331	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		GTTCTGTGTTAGTCCTCTATT	0.363																																					p.S331R		.											.	DGKH-652	0			c.A991C						.						160.0	154.0	156.0					13																	42740683		2203	4300	6503	SO:0001583	missense	160851	exon10			TGTGTTAGTCCTC	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.991A>C	13.37:g.42740683A>C	ENSP00000337572:p.Ser331Arg	Somatic	325	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_001204504	0	0	0	0	0	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.642151	0.87859	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.80994	-1.44;-1.26;-1.44;-1.42;-1.42;1.81	5.81	5.81	0.92471	Diacylglycerol kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85111	0.5622	L	0.33293	1	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;0.999;0.998	D;D;D;D	0.83275	0.986;0.981;0.996;0.98	D	0.86762	0.1967	10	0.72032	D	0.01	.	16.1677	0.81782	1.0:0.0:0.0:0.0	.	86;195;331;331	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	R	331;331;331;195;195;86	ENSP00000440823:S331R;ENSP00000337572:S331R;ENSP00000261491:S331R;ENSP00000368576:S195R;ENSP00000445114:S195R;ENSP00000441308:S86R	ENSP00000261491:S331R	S	+	1	0	DGKH	41638683	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	7.333000	0.79214	2.218000	0.71995	0.528000	0.53228	AGT	.		0.363	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
DOCK9	23348	broad.mit.edu	37	13	99481713	99481713	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr13:99481713T>C	ENST00000376460.1	-	43	4824	c.4744A>G	c.(4744-4746)Acc>Gcc	p.T1582A	DOCK9_ENST00000339416.2_Missense_Mutation_p.T1583A|DOCK9_ENST00000448493.2_3'UTR|DOCK9-AS1_ENST00000439367.1_RNA	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1583					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ATCTGGGCGGTGGCCATTAGC	0.542																																					.													.	DOCK9-90	0			.						.						84.0	82.0	82.0					13																	99481713		2098	4229	6327	SO:0001583	missense	23348	.			GGGCGGTGGCCAT	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.4744A>G	13.37:g.99481713T>C	ENSP00000365643:p.Thr1582Ala	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	64	13	.	0	0	2	2	0	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	CCDS45062.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.7|28.7	4.945479|4.945479	0.92593|0.92593	.|.	.|.	ENSG00000088387|ENSG00000088387	ENST00000400228|ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000400220;ENST00000339416;ENST00000376453;ENST00000340449	.|T;T;T	.|0.64991	.|2.05;2.14;-0.13	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84552|0.84552	0.5497|0.5497	M|M	0.93763|0.93763	3.455|3.455	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D	.|0.89917	.|0.998;0.998;1.0;1.0;1.0;0.981;1.0;1.0	.|D;D;D;D;D;D;D;D	.|0.91635	.|0.986;0.987;0.983;0.999;0.994;0.909;0.987;0.992	D|D	0.88614|0.88614	0.3158|0.3158	5|10	.|0.87932	.|D	.|0	.|.	16.3948|16.3948	0.83586|0.83586	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1583;302;226;1582;226;1583;275;225	.|A8MWZ5;B7Z6H5;B7Z2J2;Q9BZ29-5;Q5JUD8;Q9BZ29;B7Z6G9;F5H1Q4	.|.;.;.;.;.;DOCK9_HUMAN;.;.	R|A	169|1582;1583;1575;1583;1582;513;1583;225;226	.|ENSP00000365643:T1582A;ENSP00000341086:T1583A;ENSP00000344702:T226A	.|ENSP00000341086:T1583A	H|T	-|-	2|1	0|0	DOCK9|DOCK9	98279714|98279714	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	5.854000|5.854000	0.69503|0.69503	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	CAC|ACC	.		0.542	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
PPM1A	5494	broad.mit.edu	37	14	60749544	60749544	+	Silent	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr14:60749544G>T	ENST00000395076.4	+	2	553	c.123G>T	c.(121-123)acG>acT	p.T41T	PPM1A_ENST00000325658.3_Silent_p.T41T|PPM1A_ENST00000325642.3_Silent_p.T114T|PPM1A_ENST00000529574.1_Silent_p.T41T	NM_021003.4	NP_066283.1	P35813	PPM1A_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1A	41					cell cycle arrest (GO:0007050)|dephosphorylation (GO:0016311)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|N-terminal protein myristoylation (GO:0006499)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|protein dephosphorylation (GO:0006470)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|voltage-gated calcium channel complex (GO:0005891)	calmodulin-dependent protein phosphatase activity (GO:0033192)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)|R-SMAD binding (GO:0070412)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(1)|large_intestine(8)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.046)		ATGCACATACGGCTGTGATCG	0.498																																					p.T114T													.	PPM1A-227	0			c.G342T						.						431.0	385.0	401.0					14																	60749544		2203	4300	6503	SO:0001819	synonymous_variant	5494	exon2			ACATACGGCTGTG	S87759	CCDS9744.1, CCDS9745.1, CCDS45120.1	14q23.1	2013-01-24	2010-03-05		ENSG00000100614	ENSG00000100614	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9275	protein-coding gene	gene with protein product	"""phosphatase 2C alpha"", ""protein phosphatase 2C, alpha isoform"""	606108	"""protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform"""			1311954	Standard	NM_177952		Approved	MGC9201, PP2Calpha, PP2CA	uc001xew.4	P35813	OTTHUMG00000140333	ENST00000395076.4:c.123G>T	14.37:g.60749544G>T		Somatic	613	0		WXS	Illumina HiSeq	Phase_I	245	4	NM_177952	0	0	7	8	1	B5BU11|J3KNM0|O75551	Silent	SNP	ENST00000395076.4	37	CCDS9744.1																																																																																			.		0.498	PPM1A-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276949.2	NM_021003	
ZFYVE26	23503	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	68282659	68282659	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr14:68282659C>A	ENST00000347230.4	-	2	160	c.22G>T	c.(22-24)Gag>Tag	p.E8*	ZFYVE26_ENST00000555452.1_Nonsense_Mutation_p.E8*	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	8					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCAGCTTCCTCTTTTCCAAAT	0.478																																					p.E8X		.											.	ZFYVE26-162	0			c.G22T						.						30.0	30.0	30.0					14																	68282659		2203	4300	6503	SO:0001587	stop_gained	23503	exon2			CTTCCTCTTTTCC	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.22G>T	14.37:g.68282659C>A	ENSP00000251119:p.Glu8*	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	64	24	NM_015346	0	0	0	0	0	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Nonsense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	37	6.195059	0.97367	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-20.4213	20.2576	0.98430	0.0:1.0:0.0:0.0	.	.	.	.	X	8	.	ENSP00000251119:E8X	E	-	1	0	ZFYVE26	67352412	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.200000	0.72118	2.783000	0.95769	0.655000	0.94253	GAG	.		0.478	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
DICER1	23405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	95556880	95556880	+	Silent	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr14:95556880G>T	ENST00000526495.1	-	29	6015	c.5724C>A	c.(5722-5724)gcC>gcA	p.A1908A	DICER1_ENST00000527414.1_Silent_p.A1908A|DICER1_ENST00000541352.1_3'UTR|DICER1_ENST00000527416.2_5'UTR|DICER1_ENST00000393063.1_Silent_p.A1908A|DICER1_ENST00000343455.3_Silent_p.A1908A|DICER1_ENST00000556045.1_Silent_p.A806A			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1908	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		GGCTTCGGAGGGCTCTTCTTG	0.413			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.A1908A		.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1-961	0			c.C5724A						.						187.0	186.0	187.0					14																	95556880		2203	4300	6503	SO:0001819	synonymous_variant	23405	exon28	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	TCGGAGGGCTCTT	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.5724C>A	14.37:g.95556880G>T		Somatic	468	0		WXS	Illumina HiSeq	Phase_I	95	36	NM_030621	0	0	1	1	0	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Silent	SNP	ENST00000526495.1	37	CCDS9931.1																																																																																			.		0.413	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
SIVA1	10572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	105222013	105222013	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr14:105222013C>T	ENST00000329967.6	+	2	267	c.165C>T	c.(163-165)gaC>gaT	p.D55D	SIVA1_ENST00000347067.5_Intron	NM_006427.3	NP_006418.2	O15304	SIVA_HUMAN	SIVA1, apoptosis-inducing factor	55	Interaction with BCL2L1 isoform Bcl-x(L) and inhibition of BCL2L1 anti-apoptotic activity.				activation-induced cell death of T cells (GO:0006924)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	CD27 receptor binding (GO:0005175)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|prostate(1)	3		all_cancers(154;0.14)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.173)		CCTACCTGGACCACGTGTGGG	0.607																																					p.D55D		.											.	SIVA1-514	0			c.C165T						.						92.0	88.0	89.0					14																	105222013		2203	4300	6503	SO:0001819	synonymous_variant	10572	exon2			CCTGGACCACGTG	U82938	CCDS9992.1, CCDS9993.1	14q32.33	2007-03-19							17712	protein-coding gene	gene with protein product		605567				9177220	Standard	NM_006427		Approved	SIVA, Siva-1, Siva-2, CD27BP	uc001yph.3	O15304		ENST00000329967.6:c.165C>T	14.37:g.105222013C>T		Somatic	228	0		WXS	Illumina HiSeq	Phase_I	314	98	NM_006427	0	0	58	131	73	Q96P98|Q9UPD6	Silent	SNP	ENST00000329967.6	37	CCDS9992.1	.	.	.	.	.	.	.	.	.	.	C	3.241	-0.155408	0.06544	.	.	ENSG00000184990	ENST00000556195	.	.	.	4.89	3.01	0.34805	.	.	.	.	.	T	0.55641	0.1933	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50499	-0.8821	4	.	.	.	-28.3879	7.3185	0.26513	0.0:0.783:0.0:0.217	.	.	.	.	I	73	.	.	T	+	2	0	SIVA1	104293058	0.105000	0.21958	0.720000	0.30636	0.302000	0.27658	0.003000	0.13083	1.027000	0.39758	0.462000	0.41574	ACC	.		0.607	SIVA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410541.1	NM_006427	
TP53BP1	7158	broad.mit.edu	37	15	43733777	43733777	+	Silent	SNP	A	A	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr15:43733777A>G	ENST00000263801.3	-	15	3282	c.3030T>C	c.(3028-3030)ccT>ccC	p.P1010P	TP53BP1_ENST00000382044.4_Silent_p.P1015P|TP53BP1_ENST00000450115.2_Silent_p.P1015P|TP53BP1_ENST00000382039.3_Silent_p.P1015P	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1010					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CACCAGTTGCAGGCTCTGAAT	0.388								Other conserved DNA damage response genes																													p.P1015P													.	TP53BP1-294	0			c.T3045C						.						102.0	102.0	102.0					15																	43733777		2201	4298	6499	SO:0001819	synonymous_variant	7158	exon15			AGTTGCAGGCTCT	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.3030T>C	15.37:g.43733777A>G		Somatic	250	0		WXS	Illumina HiSeq	Phase_I	244	4	NM_001141980	0	0	2	2	0	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Silent	SNP	ENST00000263801.3	37	CCDS10096.1																																																																																			.		0.388	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
ACAN	176	hgsc.bcm.edu	37	15	89399908	89399908	+	Silent	SNP	T	T	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr15:89399908T>C	ENST00000561243.1	+	11	4092	c.4092T>C	c.(4090-4092)acT>acC	p.T1364T	ACAN_ENST00000352105.7_Silent_p.T1364T|ACAN_ENST00000559004.1_Silent_p.T1364T|ACAN_ENST00000439576.2_Silent_p.T1364T			P16112	PGCA_HUMAN	aggrecan	1364	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TTCTAGAGACTGCTGCCCCTG	0.562																																					p.T1364T		.											.	ACAN-25	0			c.T4092C						.						4.0	6.0	6.0					15																	89399908		687	1791	2478	SO:0001819	synonymous_variant	176	exon12			AGAGACTGCTGCC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4092T>C	15.37:g.89399908T>C		Somatic	434	0		WXS	Illumina HiSeq	Phase_I	312	20	NM_001135	0	0	0	0	0	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																			.		0.562	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
CACNA1H	8912	hgsc.bcm.edu	37	16	1251875	1251875	+	Silent	SNP	C	C	T	rs60537026	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr16:1251875C>T	ENST00000348261.5	+	9	1673	c.1425C>T	c.(1423-1425)agC>agT	p.S475S	CACNA1H_ENST00000565831.1_Silent_p.S475S|CACNA1H_ENST00000358590.4_Silent_p.S475S	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	475					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	AGCGGCGCAGCTTGCGCCTCT	0.677													C|||	4	0.000798722	0.003	0.0	5008	,	,		16056	0.0		0.0	False		,,,				2504	0.0				p.S475S		.											.	CACNA1H-67	0			c.C1425T						.	C	,	5,4079		0,5,2037	11.0	13.0	13.0		1425,1425	3.9	0.9	16	dbSNP_129	13	0,8256		0,0,4128	no	coding-synonymous,coding-synonymous	CACNA1H	NM_001005407.1,NM_021098.2	,	0,5,6165	TT,TC,CC		0.0,0.1224,0.0405	,	475/2348,475/2354	1251875	5,12335	2042	4128	6170	SO:0001819	synonymous_variant	8912	exon9			GCGCAGCTTGCGC	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.1425C>T	16.37:g.1251875C>T		Somatic	1	1		WXS	Illumina HiSeq	Phase_I	7	4	NM_021098	0	0	0	0	0	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	ENST00000348261.5	37	CCDS45375.1																																																																																			C|0.985;T|0.015		0.677	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
TMC5	79838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	19498328	19498328	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr16:19498328T>G	ENST00000396229.2	+	16	3174	c.2425T>G	c.(2425-2427)Ttc>Gtc	p.F809V	TMC5_ENST00000561503.1_Missense_Mutation_p.F450V|TMC5_ENST00000564959.1_Missense_Mutation_p.F492V|TMC5_ENST00000381414.4_Missense_Mutation_p.F809V|TMC5_ENST00000541464.1_Missense_Mutation_p.F757V|CTA-363E6.6_ENST00000561762.1_RNA|TMC5_ENST00000542583.2_Missense_Mutation_p.F809V|TMC5_ENST00000219821.5_Missense_Mutation_p.F563V	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	809					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TTTCATCATGTTCTACTCCAA	0.517																																					p.F809V		.											.	TMC5-91	0			c.T2425G						.						128.0	104.0	112.0					16																	19498328		2197	4300	6497	SO:0001583	missense	79838	exon16			ATCATGTTCTACT	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2425T>G	16.37:g.19498328T>G	ENSP00000379531:p.Phe809Val	Somatic	118	1		WXS	Illumina HiSeq	Phase_I	116	37	NM_001105249	0	0	0	0	0	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	37	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	T	17.82	3.484037	0.63962	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39	5.61	5.61	0.85477	.	0.118609	0.64402	D	0.000006	D	0.84275	0.5436	M	0.89414	3.03	0.58432	D	0.999998	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;1.0;0.999	D	0.87427	0.2386	10	0.87932	D	0	-21.956	14.7798	0.69756	0.0:0.0:0.0:1.0	.	757;492;563;563;809;809	F5GYU8;E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2	.;.;.;.;TMC5_HUMAN;.	V	757;809;809;809;563;492	ENSP00000441227:F757V;ENSP00000370822:F809V;ENSP00000379531:F809V;ENSP00000446274:F809V;ENSP00000219821:F563V	ENSP00000219821:F563V	F	+	1	0	TMC5	19405829	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	6.761000	0.74945	2.130000	0.65690	0.533000	0.62120	TTC	.		0.517	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
CCDC102A	92922	hgsc.bcm.edu;broad.mit.edu	37	16	57562850	57562850	+	Silent	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr16:57562850C>A	ENST00000258214.2	-	2	486	c.240G>T	c.(238-240)ctG>ctT	p.L80L		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	80										endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						GCGCCTCCTCCAGCTCCCGCA	0.761																																					p.L80L		.											.	CCDC102A-91	0			c.G240T						.						6.0	8.0	8.0					16																	57562850		1458	3193	4651	SO:0001819	synonymous_variant	92922	exon2			CTCCTCCAGCTCC	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.240G>T	16.37:g.57562850C>A		Somatic	24	1		WXS	Illumina HiSeq	Phase_I	38	13	NM_033212	0	0	0	0	0	Q9BT74	Silent	SNP	ENST00000258214.2	37	CCDS10784.1																																																																																			.		0.761	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
CES4A	283848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67038037	67038037	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr16:67038037C>A	ENST00000326686.5	+	9	990	c.990C>A	c.(988-990)gaC>gaA	p.D330E	CES4A_ENST00000540947.2_Missense_Mutation_p.D330E|CES4A_ENST00000540579.1_Missense_Mutation_p.D232E|CES4A_ENST00000541479.1_Missense_Mutation_p.D353E|CES4A_ENST00000398354.1_Missense_Mutation_p.D330E|CES4A_ENST00000338718.4_Missense_Mutation_p.D353E|CES4A_ENST00000535696.1_Missense_Mutation_p.D236E			Q5XG92	EST4A_HUMAN	carboxylesterase 4A	330						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			large_intestine(2)|liver(2)|lung(4)|ovary(1)	9						TCCCAGATGACCCTTTGGTGC	0.512																																					p.D330E		.											.	CES4A-91	0			c.C990A						.						232.0	229.0	230.0					16																	67038037		2041	4186	6227	SO:0001583	missense	283848	exon9			AGATGACCCTTTG	AK094783	CCDS42174.1, CCDS42174.2, CCDS54024.1, CCDS54025.1, CCDS42174.3	16q22.1	2011-10-25	2010-10-12	2010-10-12	ENSG00000172824	ENSG00000172824		"""Carboxylesterases"""	26741	protein-coding gene	gene with protein product			"""carboxylesterase 8 (putative)"""	CES8		12975309, 17364878, 20931200	Standard	NM_001190201		Approved	FLJ37464	uc010vix.2	Q5XG92		ENST00000326686.5:c.990C>A	16.37:g.67038037C>A	ENSP00000314145:p.Asp330Glu	Somatic	284	0		WXS	Illumina HiSeq	Phase_I	399	143	NM_173815	0	0	0	0	0	A8KAJ6|B7Z349|B7Z3L2|B7Z6R3|Q6UX55|Q8N9F4	Missense_Mutation	SNP	ENST00000326686.5	37		.	.	.	.	.	.	.	.	.	.	c	1.498	-0.552834	0.03996	.	.	ENSG00000172824	ENST00000540947;ENST00000541479;ENST00000338718;ENST00000398354;ENST00000326686;ENST00000538199;ENST00000540579;ENST00000535696	T;T;T;T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24	4.63	0.0898	0.14460	Carboxylesterase, type B (1);	0.569501	0.15610	N	0.253409	T	0.52773	0.1755	L	0.41415	1.275	0.09310	N	1	B;B;B;B	0.19331	0.023;0.004;0.02;0.035	B;B;B;B	0.28305	0.022;0.004;0.088;0.021	T	0.45977	-0.9224	10	0.49607	T	0.09	.	4.644	0.12563	0.0:0.4819:0.153:0.3651	.	236;353;330;353	Q5XG92-7;F8WEE9;Q5XG92;F5H5S4	.;.;EST4A_HUMAN;.	E	330;353;353;330;330;293;232;236	ENSP00000444052:D330E;ENSP00000443175:D353E;ENSP00000340714:D353E;ENSP00000381397:D330E;ENSP00000314145:D330E;ENSP00000441103:D293E;ENSP00000441907:D232E;ENSP00000441644:D236E	ENSP00000314145:D330E	D	+	3	2	CES4A	65595538	0.000000	0.05858	0.009000	0.14445	0.083000	0.17756	-0.546000	0.06062	-0.221000	0.09973	0.486000	0.48141	GAC	.		0.512	CES4A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173815	
TNFSF13	8741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7464141	7464141	+	Silent	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr17:7464141G>A	ENST00000338784.4	+	6	1187	c.744G>A	c.(742-744)gtG>gtA	p.V248V	TNFSF12_ENST00000557233.1_Silent_p.V328V|SENP3_ENST00000429205.2_5'Flank|SENP3-EIF4A1_ENST00000579777.1_RNA|TNFSF13_ENST00000396545.4_Intron|SENP3_ENST00000321337.7_5'Flank|TNFSF12-TNFSF13_ENST00000293826.4_Silent_p.V328V|TNFSF13_ENST00000380535.4_Silent_p.V220V|TNFSF13_ENST00000483039.1_Silent_p.V112V|TNFSF13_ENST00000396542.1_Silent_p.V203V|TNFSF13_ENST00000349228.4_Silent_p.V232V	NM_003808.3	NP_003799.1	O75888	TNF13_HUMAN	tumor necrosis factor (ligand) superfamily, member 13	248					gene expression (GO:0010467)|immunoglobulin production in mucosal tissue (GO:0002426)|mRNA metabolic process (GO:0016071)|positive regulation of cell proliferation (GO:0008284)|positive regulation of germinal center formation (GO:0002636)|positive regulation of isotype switching to IgA isotypes (GO:0048298)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	receptor binding (GO:0005102)			large_intestine(2)|lung(2)|skin(1)	5		Prostate(122;0.157)				TGGGGTTTGTGAAACTGTGAT	0.473											OREG0024138	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V328V		.											.	TNFSF12-TNFSF13-44	0			c.G984A						.						108.0	102.0	104.0					17																	7464141		2203	4300	6503	SO:0001819	synonymous_variant	407977	exon11			GTTTGTGAAACTG	AF046888	CCDS11111.1, CCDS11112.1, CCDS42256.1, CCDS56019.1, CCDS73957.1	17p13.1	2007-07-23			ENSG00000161955	ENSG00000161955		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11928	protein-coding gene	gene with protein product		604472				9743536	Standard	NM_172088		Approved	APRIL, CD256		O75888	OTTHUMG00000108145	ENST00000338784.4:c.744G>A	17.37:g.7464141G>A		Somatic	244	1	641	WXS	Illumina HiSeq	Phase_I	503	135	NM_172089	0	0	552	731	179	A8MYD5|B4DVT2|Q541E1|Q5U0G8|Q96HV6|Q9P1M8|Q9P1M9	Silent	SNP	ENST00000338784.4	37	CCDS11111.1																																																																																			.		0.473	TNFSF13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226948.2	NM_003808	
CNTNAP1	8506	hgsc.bcm.edu;broad.mit.edu	37	17	40843435	40843435	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr17:40843435C>A	ENST00000264638.4	+	15	2467	c.2250C>A	c.(2248-2250)gaC>gaA	p.D750E	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	750	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CCTTTGTGGACCATCTGCCTG	0.582																																					p.D750E		.											.	CNTNAP1-525	0			c.C2250A						.						99.0	82.0	87.0					17																	40843435		2203	4300	6503	SO:0001583	missense	8506	exon15			TGTGGACCATCTG	U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.2250C>A	17.37:g.40843435C>A	ENSP00000264638:p.Asp750Glu	Somatic	125	1		WXS	Illumina HiSeq	Phase_I	326	19	NM_003632	0	0	0	0	0		Missense_Mutation	SNP	ENST00000264638.4	37	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710971	0.30322	.	.	ENSG00000108797	ENST00000264638	T	0.08984	3.03	5.31	1.06	0.20224	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.000000	0.85682	D	0.000000	T	0.04092	0.0114	N	0.20357	0.565	0.42527	D	0.993023	B	0.19935	0.04	B	0.21546	0.035	T	0.41070	-0.9529	10	0.05959	T	0.93	.	7.4711	0.27349	0.0:0.6791:0.1198:0.2011	.	750	P78357	CNTP1_HUMAN	E	750	ENSP00000264638:D750E	ENSP00000264638:D750E	D	+	3	2	CNTNAP1	38096961	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.314000	0.33597	0.095000	0.17434	0.561000	0.74099	GAC	.		0.582	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632	
KAT7	11143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	47869250	47869250	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr17:47869250G>T	ENST00000259021.4	+	2	298	c.18G>T	c.(16-18)agG>agT	p.R6S	KAT7_ENST00000435742.2_5'UTR|KAT7_ENST00000454930.2_Missense_Mutation_p.R6S|KAT7_ENST00000424009.2_Missense_Mutation_p.R6S|FAM117A_ENST00000514018.1_5'Flank|KAT7_ENST00000503935.2_5'UTR|KAT7_ENST00000510819.1_Missense_Mutation_p.R6S|KAT7_ENST00000509773.1_Missense_Mutation_p.R6S	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	6					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TATTACAGAGGAATGCAGGCA	0.423																																					p.R6S		.											.	.	0			c.G18T						.						148.0	136.0	140.0					17																	47869250		2203	4300	6503	SO:0001583	missense	11143	exon2			ACAGAGGAATGCA	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.18G>T	17.37:g.47869250G>T	ENSP00000259021:p.Arg6Ser	Somatic	322	0		WXS	Illumina HiSeq	Phase_I	434	102	NM_001199158	0	0	0	0	0	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	37	CCDS11554.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.848691	0.51164	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009	.	.	.	5.6	2.52	0.30459	.	0.093201	0.64402	D	0.000001	T	0.63189	0.2490	L	0.48642	1.525	0.80722	D	1	D;D;D;B;P	0.54601	0.967;0.967;0.967;0.421;0.557	P;P;P;B;B	0.60789	0.879;0.879;0.879;0.058;0.124	T	0.62144	-0.6916	9	0.87932	D	0	-16.1716	9.2677	0.37652	0.3015:0.0:0.6985:0.0	.	6;6;6;6;6	B4DFE0;B4DFB4;E7ER15;O95251;G5E9K7	.;.;.;KAT7_HUMAN;.	S	6	.	ENSP00000259021:R6S	R	+	3	2	KAT7	45224249	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	1.877000	0.39598	0.295000	0.22570	-0.137000	0.14449	AGG	.		0.423	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	
QRICH2	84074	hgsc.bcm.edu	37	17	74288976	74288976	+	Missense_Mutation	SNP	G	G	A	rs75054966		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr17:74288976G>A	ENST00000262765.5	-	4	1513	c.1334C>T	c.(1333-1335)gCc>gTc	p.A445V		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	445	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						accaggttgggccaaaccaga	0.572																																					p.A445V		.											.	QRICH2-94	0			c.C1334T						.						95.0	94.0	94.0					17																	74288976		2203	4300	6503	SO:0001583	missense	84074	exon4			GGTTGGGCCAAAC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1334C>T	17.37:g.74288976G>A	ENSP00000262765:p.Ala445Val	Somatic	17	1		WXS	Illumina HiSeq	Phase_I	22	4	NM_032134	0	0	0	0	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689770	0.29962	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.08370	3.1	5.51	-11.0	0.00169	.	.	.	.	.	T	0.01695	0.0054	N	0.01505	-0.83	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.0;0.003	T	0.40079	-0.9582	9	0.18710	T	0.47	-3.6749	1.0591	0.01596	0.2559:0.2896:0.2648:0.1898	.	445;445	B5MD94;Q9H0J4	.;QRIC2_HUMAN	V	445	ENSP00000262765:A445V	ENSP00000262765:A445V	A	-	2	0	QRICH2	71800571	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-1.871000	0.01640	-1.417000	0.02017	-0.423000	0.05987	GCC	A|1.000;|0.000		0.572	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
ACSBG2	81616	broad.mit.edu	37	19	6177251	6177251	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:6177251T>G	ENST00000586696.1	+	8	1026	c.750T>G	c.(748-750)atT>atG	p.I250M	ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000588304.1_Missense_Mutation_p.I200M|ACSBG2_ENST00000591403.1_Missense_Mutation_p.I250M|ACSBG2_ENST00000588485.1_Missense_Mutation_p.I63M|ACSBG2_ENST00000252669.5_Missense_Mutation_p.I250M			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	250					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.I250M(3)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCACGTGGATTGCAGGAGCAG	0.433																																					p.I250M													.	ACSBG2-23	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.T750G						.						97.0	69.0	78.0					19																	6177251		2203	4300	6503	SO:0001583	missense	81616	exon8			GTGGATTGCAGGA		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.750T>G	19.37:g.6177251T>G	ENSP00000465589:p.Ile250Met	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	82	4	NM_030924	0	0	0	0	0	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	37	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	T	8.593	0.885063	0.17540	.	.	ENSG00000130377	ENST00000252669	T	0.10477	2.87	4.48	-8.78	0.00824	AMP-dependent synthetase/ligase (1);	1.500690	0.04439	N	0.370611	T	0.03564	0.0102	N	0.03154	-0.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.16722	0.016;0.007	T	0.41124	-0.9526	10	0.49607	T	0.09	-6.8573	2.6506	0.04998	0.499:0.0951:0.1226:0.2833	.	250;250	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	M	250	ENSP00000252669:I250M	ENSP00000252669:I250M	I	+	3	3	ACSBG2	6128251	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.884000	0.00342	-1.157000	0.02815	-0.778000	0.03378	ATT	.		0.433	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
ITPKC	80271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	41223385	41223385	+	Silent	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:41223385A>T	ENST00000263370.2	+	1	378	c.345A>T	c.(343-345)ccA>ccT	p.P115P	ADCK4_ENST00000324464.3_5'Flank|ADCK4_ENST00000450541.1_5'Flank|ADCK4_ENST00000243583.6_5'Flank	NM_025194.2	NP_079470.1	Q96DU7	IP3KC_HUMAN	inositol-trisphosphate 3-kinase C	115					inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	14			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AGACGGAGCCAGACAGGTCCA	0.597																																					p.P115P		.											.	ITPKC-115	0			c.A345T						.						51.0	58.0	56.0					19																	41223385		2202	4300	6502	SO:0001819	synonymous_variant	80271	exon1			GGAGCCAGACAGG	Y11999	CCDS12563.1	19q13.1	2011-04-28	2011-04-28		ENSG00000086544	ENSG00000086544	2.7.1.127		14897	protein-coding gene	gene with protein product		606476	"""inositol 1,4,5-trisphosphate 3-kinase C"""			11085927	Standard	NM_025194		Approved	IP3KC, IP3-3KC	uc002oot.3	Q96DU7		ENST00000263370.2:c.345A>T	19.37:g.41223385A>T		Somatic	139	0		WXS	Illumina HiSeq	Phase_I	201	65	NM_025194	0	0	4	7	3	Q9UE25|Q9Y475	Silent	SNP	ENST00000263370.2	37	CCDS12563.1																																																																																			.		0.597	ITPKC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463104.1	NM_025194	
GRIN2D	2906	hgsc.bcm.edu	37	19	48945880	48945880	+	Silent	SNP	T	T	C	rs62130268	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:48945880T>C	ENST00000263269.3	+	13	2785	c.2697T>C	c.(2695-2697)gcT>gcC	p.A899A		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	899					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGCAGCGCTGAGGCCGCCC	0.781													c|||	3742	0.747204	0.6188	0.8545	5008	,	,		4716	0.6548		0.8887	False		,,,				2504	0.7945				p.A899A		.											.	GRIN2D-156	0			c.T2697C						.			1689,437		638,413,12	1.0	1.0	1.0		2697	-3.3	1.0	19	dbSNP_129	1	3712,202		1757,198,2	no	coding-synonymous	GRIN2D	NM_000836.2		2395,611,14	CC,CT,TT		5.161,20.555,10.5795		899/1337	48945880	5401,639	1063	1957	3020	SO:0001819	synonymous_variant	2906	exon13			CAGCGCTGAGGCC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2697T>C	19.37:g.48945880T>C		Somatic	1	1		WXS	Illumina HiSeq	Phase_I	4	4	NM_000836	0	0	0	0	0		Silent	SNP	ENST00000263269.3	37	CCDS12719.1																																																																																			T|0.245;C|0.755		0.781	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
NTN5	126147	broad.mit.edu	37	19	49167945	49167945	+	Silent	SNP	A	A	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:49167945A>C	ENST00000270235.4	-	3	806	c.711T>G	c.(709-711)ggT>ggG	p.G237G	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	237	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.					extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						GCTCACAAACACCCCCACTCC	0.652																																					p.G237G													.	NTN5-136	0			c.T711G						.						18.0	19.0	19.0					19																	49167945		2199	4296	6495	SO:0001819	synonymous_variant	126147	exon3			ACAAACACCCCCA		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.711T>G	19.37:g.49167945A>C		Somatic	21	2		WXS	Illumina HiSeq	Phase_I	42	9	NM_145807	0	0	1	1	0	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			.		0.652	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
ALDH16A1	126133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49971767	49971767	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:49971767A>T	ENST00000293350.4	+	15	2231	c.2068A>T	c.(2068-2070)Act>Tct	p.T690S	ALDH16A1_ENST00000540132.1_Missense_Mutation_p.T527S|CTD-3148I10.9_ENST00000599536.1_Intron|ALDH16A1_ENST00000433981.2_Missense_Mutation_p.T525S|ALDH16A1_ENST00000455361.2_Missense_Mutation_p.T639S	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	690						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CTACGGCAACACTGTGGTCAT	0.687																																					p.T690S		.											.	ALDH16A1-91	0			c.A2068T						.						123.0	129.0	127.0					19																	49971767		2203	4300	6503	SO:0001583	missense	126133	exon15			GGCAACACTGTGG	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.2068A>T	19.37:g.49971767A>T	ENSP00000293350:p.Thr690Ser	Somatic	345	0		WXS	Illumina HiSeq	Phase_I	542	197	NM_153329	0	0	17	26	9	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	ENST00000293350.4	37	CCDS12766.1	.	.	.	.	.	.	.	.	.	.	A	3.550	-0.091783	0.07053	.	.	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.37	-5.8	0.02347	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.561034	0.18181	N	0.149153	T	0.53899	0.1825	N	0.20845	0.615	0.09310	N	1	B;B;B	0.13145	0.003;0.007;0.004	B;B;B	0.17098	0.007;0.012;0.017	T	0.46748	-0.9169	10	0.13108	T	0.6	-7.5334	9.9685	0.41738	0.1664:0.0:0.7061:0.1275	.	527;639;690	F5H4B6;B4DLQ1;Q8IZ83	.;.;A16A1_HUMAN	S	690;639;527;525	ENSP00000293350:T690S;ENSP00000410142:T639S;ENSP00000445088:T527S;ENSP00000398675:T525S	ENSP00000293350:T690S	T	+	1	0	ALDH16A1	54663579	0.000000	0.05858	0.003000	0.11579	0.071000	0.16799	-0.795000	0.04580	-0.972000	0.03559	0.397000	0.26171	ACT	.		0.687	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465358.1	NM_153329	
ZNF134	7693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58131703	58131703	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:58131703C>A	ENST00000396161.5	+	3	526	c.216C>A	c.(214-216)caC>caA	p.H72Q	ZNF134_ENST00000597975.1_3'UTR	NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	72					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		AGGGTACACACCATGGACTGA	0.493																																					p.H72Q		.											.	ZNF134-226	0			c.C216A						.						108.0	104.0	105.0					19																	58131703		2041	4225	6266	SO:0001583	missense	7693	exon3			TACACACCATGGA	U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.216C>A	19.37:g.58131703C>A	ENSP00000379464:p.His72Gln	Somatic	293	1		WXS	Illumina HiSeq	Phase_I	82	29	NM_003435	0	0	2	5	3	Q9Y4B2	Missense_Mutation	SNP	ENST00000396161.5	37	CCDS42638.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322492	0.41096	.	.	ENSG00000213762	ENST00000418193;ENST00000396161	T	0.66995	-0.24	4.05	0.456	0.16655	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.63153	0.2487	M	0.81682	2.555	0.09310	N	1	B	0.30211	0.273	B	0.28638	0.092	T	0.58719	-0.7587	9	0.87932	D	0	.	5.1641	0.15077	0.163:0.6473:0.0:0.1897	.	72	P52741	ZN134_HUMAN	Q	139;72	ENSP00000379464:H72Q	ENSP00000379464:H72Q	H	+	3	2	ZNF134	62823515	0.000000	0.05858	0.000000	0.03702	0.967000	0.64934	0.316000	0.19469	0.092000	0.17331	0.655000	0.94253	CAC	.		0.493	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466808.1	NM_003435	
PRKCE	5581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	45879507	45879507	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr2:45879507G>C	ENST00000306156.3	+	1	595	c.268G>C	c.(268-270)Ggc>Cgc	p.G90R		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	90	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	TGCCCCCATAGGCTACGACGA	0.622																																					p.G90R		.											.	PRKCE-1019	0			c.G268C						.						64.0	54.0	57.0					2																	45879507		2203	4300	6503	SO:0001583	missense	5581	exon1			CCCATAGGCTACG		CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.268G>C	2.37:g.45879507G>C	ENSP00000306124:p.Gly90Arg	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	98	43	NM_005400	0	0	0	0	0	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	ENST00000306156.3	37	CCDS1824.1	.	.	.	.	.	.	.	.	.	.	G	34	5.307076	0.95629	.	.	ENSG00000171132	ENST00000421201;ENST00000306156	T;T	0.71461	-0.57;-0.57	4.95	4.95	0.65309	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.062205	0.64402	D	0.000006	D	0.84629	0.5514	M	0.86651	2.83	0.80722	D	1	D	0.67145	0.996	D	0.68943	0.961	T	0.83162	-0.0098	10	0.16896	T	0.51	.	18.1985	0.89830	0.0:0.0:1.0:0.0	.	90	Q02156	KPCE_HUMAN	R	90	ENSP00000394574:G90R;ENSP00000306124:G90R	ENSP00000306124:G90R	G	+	1	0	PRKCE	45733011	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.802000	0.99131	2.270000	0.75569	0.561000	0.74099	GGC	.		0.622	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2		
REV1	51455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	100019166	100019166	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr2:100019166C>T	ENST00000258428.3	-	21	3710	c.3482G>A	c.(3481-3483)gGa>gAa	p.G1161E	REV1_ENST00000393445.3_Missense_Mutation_p.G1160E|REV1_ENST00000465835.1_5'Flank|RP11-527J8.1_ENST00000608144.1_RNA	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1161	Protein interaction domain; mediates interaction with DNA polymerase zeta.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTCAACAGCTCCAGCTAGATT	0.493								Direct reversal of damage																													p.G1161E		.											.	REV1-92	0			c.G3482A						.						99.0	97.0	98.0					2																	100019166		2203	4300	6503	SO:0001583	missense	51455	exon21			ACAGCTCCAGCTA	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3482G>A	2.37:g.100019166C>T	ENSP00000258428:p.Gly1161Glu	Somatic	198	0		WXS	Illumina HiSeq	Phase_I	123	51	NM_016316	0	0	38	68	30	O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	ENST00000258428.3	37	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	C	33	5.204692	0.95033	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.38077	1.16;1.16	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.64046	0.2563	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.63906	-0.6531	10	0.66056	D	0.02	.	20.3854	0.98941	0.0:1.0:0.0:0.0	.	1161;1160	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	E	1160;1161	ENSP00000377091:G1160E;ENSP00000258428:G1161E	ENSP00000258428:G1161E	G	-	2	0	REV1	99385598	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.844000	0.75390	2.825000	0.97269	0.655000	0.94253	GGA	.		0.493	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
LCT	3938	broad.mit.edu	37	2	136575050	136575050	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr2:136575050G>A	ENST00000264162.2	-	6	1578	c.1568C>T	c.(1567-1569)gCg>gTg	p.A523V	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	523	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GCAGAAGGCCGCATAGTCCAG	0.612																																					p.A523V													.	LCT-101	0			c.C1568T						.						118.0	102.0	108.0					2																	136575050		2203	4300	6503	SO:0001583	missense	3938	exon6			AAGGCCGCATAGT	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1568C>T	2.37:g.136575050G>A	ENSP00000264162:p.Ala523Val	Somatic	127	1		WXS	Illumina HiSeq	Phase_I	187	7	NM_002299	0	0	0	0	0	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	G	33	5.246918	0.95305	.	.	ENSG00000115850	ENST00000264162	T	0.51817	0.69	5.49	5.49	0.81192	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.178976	0.48767	D	0.000163	T	0.72692	0.3492	M	0.86097	2.795	0.58432	D	0.999998	D	0.76494	0.999	D	0.66351	0.943	T	0.76801	-0.2825	10	0.87932	D	0	-8.1849	19.7399	0.96223	0.0:0.0:1.0:0.0	.	523	P09848	LPH_HUMAN	V	523	ENSP00000264162:A523V	ENSP00000264162:A523V	A	-	2	0	LCT	136291520	1.000000	0.71417	0.452000	0.26994	0.949000	0.60115	7.885000	0.87282	2.736000	0.93811	0.561000	0.74099	GCG	.		0.612	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
RIN2	54453	broad.mit.edu	37	20	19956190	19956190	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr20:19956190C>T	ENST00000255006.6	+	8	1817	c.1668C>T	c.(1666-1668)ttC>ttT	p.F556F	RIN2_ENST00000440354.2_Intron|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	507					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						TCAGCTCCTTCATGACCCCGG	0.592																																					p.F556F													.	RIN2-660	0			c.C1668T						.						93.0	102.0	99.0					20																	19956190		2025	4181	6206	SO:0001819	synonymous_variant	54453	exon8			CTCCTTCATGACC	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1668C>T	20.37:g.19956190C>T		Somatic	249	0		WXS	Illumina HiSeq	Phase_I	343	10	NM_001242581	0	0	9	9	0	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000255006.6	37	CCDS56182.1																																																																																			.		0.592	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1		
CBFA2T2	9139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	32199022	32199022	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr20:32199022A>G	ENST00000346541.3	+	4	865	c.328A>G	c.(328-330)Act>Gct	p.T110A	CBFA2T2_ENST00000397798.2_Missense_Mutation_p.T81A|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.T81A|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.T110A|CBFA2T2_ENST00000344201.3_Missense_Mutation_p.T81A|CBFA2T2_ENST00000397800.1_Missense_Mutation_p.T81A|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.T101A|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.T120A	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	110					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						ATTGCCAGCCACTTGTGGTGC	0.527																																					p.T110A	Esophageal Squamous(174;142 1955 14837 21276 28041)	.											.	CBFA2T2-92	0			c.A328G						.						186.0	158.0	168.0					20																	32199022		2203	4300	6503	SO:0001583	missense	9139	exon4			CCAGCCACTTGTG	AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.328A>G	20.37:g.32199022A>G	ENSP00000262653:p.Thr110Ala	Somatic	240	1		WXS	Illumina HiSeq	Phase_I	97	29	NM_005093	0	0	2	4	2	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	ENST00000346541.3	37	CCDS13221.1	.	.	.	.	.	.	.	.	.	.	A	5.376	0.254600	0.10185	.	.	ENSG00000078699	ENST00000375279;ENST00000342704;ENST00000417366;ENST00000344201;ENST00000346541;ENST00000397800;ENST00000397798;ENST00000359606	T;T;T;T;T	0.39229	1.1;1.1;1.1;1.09;1.69	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.40670	0.1126	N	0.11201	0.11	0.80722	D	1	D;D	0.67145	0.994;0.996	D;D	0.76071	0.97;0.987	T	0.24657	-1.0154	10	0.02654	T	1	-18.4621	15.6678	0.77247	1.0:0.0:0.0:0.0	.	110;101	O43439;F8W6D7	MTG8R_HUMAN;.	A	110;101;101;81;110;81;81;120	ENSP00000364428:T110A;ENSP00000345810:T101A;ENSP00000262653:T110A;ENSP00000380902:T81A;ENSP00000352622:T120A	ENSP00000345810:T101A	T	+	1	0	CBFA2T2	31662683	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	4.571000	0.60879	2.103000	0.63969	0.533000	0.62120	ACT	.		0.527	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2	NM_001032999	
SLC32A1	140679	broad.mit.edu	37	20	37356313	37356313	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr20:37356313C>T	ENST00000217420.1	+	2	872	c.609C>T	c.(607-609)ggC>ggT	p.G203G		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	203					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CGCTGGGCGGCCGAGTGGTGA	0.632																																					p.G203G													.	SLC32A1-90	0			c.C609T						.						80.0	66.0	71.0					20																	37356313		2203	4300	6503	SO:0001819	synonymous_variant	140679	exon2			GGGCGGCCGAGTG	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.609C>T	20.37:g.37356313C>T		Somatic	77	0		WXS	Illumina HiSeq	Phase_I	125	4	NM_080552	0	0	0	0	0	Q8N489	Silent	SNP	ENST00000217420.1	37	CCDS13307.1																																																																																			.		0.632	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
HELZ2	85441	hgsc.bcm.edu	37	20	62191642	62191642	+	Silent	SNP	T	T	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr20:62191642T>C	ENST00000467148.1	-	17	7608	c.7539A>G	c.(7537-7539)gtA>gtG	p.V2513V	HELZ2_ENST00000427522.2_Silent_p.V1944V	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2513	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CCTGGGGCTCTACGGTCCTCC	0.677																																					p.V2513V		.											.	.	0			c.A7539G						.						45.0	33.0	37.0					20																	62191642		2191	4295	6486	SO:0001819	synonymous_variant	85441	exon18			GGGCTCTACGGTC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7539A>G	20.37:g.62191642T>C		Somatic	12	0		WXS	Illumina HiSeq	Phase_I	34	2	NM_001037335	0	0	9	9	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			.		0.677	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
RFPL3	10738	broad.mit.edu	37	22	32756482	32756482	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr22:32756482A>G	ENST00000249007.4	+	2	822	c.617A>G	c.(616-618)aAg>aGg	p.K206R	RFPL3_ENST00000382088.3_Missense_Mutation_p.K177R|RFPL3S_ENST00000400234.1_3'UTR|RFPL3S_ENST00000461833.1_5'Flank|RFPL3_ENST00000397468.1_Missense_Mutation_p.K177R|RFPL3S_ENST00000382084.4_3'UTR	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	206	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						TGCAAAGGGAAGATCCAGCTG	0.562																																					p.K206R													.	RFPL3-91	0			c.A617G						.						120.0	116.0	117.0					22																	32756482		2203	4300	6503	SO:0001583	missense	10738	exon2			AAGGGAAGATCCA	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.617A>G	22.37:g.32756482A>G	ENSP00000249007:p.Lys206Arg	Somatic	219	0		WXS	Illumina HiSeq	Phase_I	253	9	NM_001098535	0	0	1	1	0	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Missense_Mutation	SNP	ENST00000249007.4	37	CCDS43011.1	.	.	.	.	.	.	.	.	.	.	a	0.121	-1.125578	0.01770	.	.	ENSG00000128276	ENST00000397468;ENST00000249007;ENST00000382088	T;T;T	0.69306	-0.39;-0.39;-0.39	1.36	-2.73	0.05950	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.46560	0.1399	L	0.33137	0.985	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10222	-1.0639	9	0.18276	T	0.48	.	4.5817	0.12262	0.3421:0.1932:0.4647:0.0	.	206	O75679	RFPL3_HUMAN	R	177;206;177	ENSP00000380609:K177R;ENSP00000249007:K206R;ENSP00000371520:K177R	ENSP00000249007:K206R	K	+	2	0	RFPL3	31086482	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.869000	0.04232	-3.519000	0.00148	-3.015000	0.00074	AAG	.		0.562	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
CACNA1I	8911	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	40061912	40061912	+	Missense_Mutation	SNP	T	T	G	rs370356955		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr22:40061912T>G	ENST00000402142.3	+	23	4005	c.4005T>G	c.(4003-4005)tgT>tgG	p.C1335W	CACNA1I_ENST00000400164.3_Missense_Mutation_p.C1300W|CACNA1I_ENST00000404898.1_Missense_Mutation_p.C1300W|CACNA1I_ENST00000407673.1_Missense_Mutation_p.C1300W|CACNA1I_ENST00000401624.1_Missense_Mutation_p.C1335W|CACNA1I_ENST00000336649.4_Missense_Mutation_p.C1341W	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1335					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	TCTACCACTGTCTGGGCGTGG	0.587																																					p.C1335W		.											.	CACNA1I-135	0			c.T4005G						.						124.0	132.0	129.0					22																	40061912		2111	4223	6334	SO:0001583	missense	8911	exon23			CCACTGTCTGGGC	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4005T>G	22.37:g.40061912T>G	ENSP00000385019:p.Cys1335Trp	Somatic	171	2		WXS	Illumina HiSeq	Phase_I	231	79	NM_021096	0	0	0	0	0	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	37	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	T	18.47	3.630186	0.67015	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01;-5.01;-5.01	4.3	-3.89	0.04193	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99199	0.9722	H	0.98333	4.205	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.998;0.998	D	0.98871	1.0766	10	0.87932	D	0	.	13.8835	0.63696	0.0:0.6656:0.0:0.3344	.	1300;1335;1300;1335	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	W	1335;1300;1335;1300;1341;1300	ENSP00000385019:C1335W;ENSP00000384093:C1300W;ENSP00000383887:C1335W;ENSP00000385680:C1300W;ENSP00000337829:C1341W;ENSP00000383028:C1300W	ENSP00000337829:C1341W	C	+	3	2	CACNA1I	38391858	0.613000	0.27009	0.940000	0.37924	0.966000	0.64601	-0.015000	0.12634	-0.931000	0.03746	-0.609000	0.04063	TGT	.		0.587	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
NUP210	23225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	13415370	13415370	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr3:13415370G>A	ENST00000254508.5	-	12	1517	c.1435C>T	c.(1435-1437)Cac>Tac	p.H479Y		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	479					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					CTGCCACCGTGGGCCTGCGGA	0.592																																					p.H479Y		.											.	NUP210-256	0			c.C1435T						.						87.0	65.0	72.0					3																	13415370		2203	4300	6503	SO:0001583	missense	23225	exon12			CACCGTGGGCCTG	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.1435C>T	3.37:g.13415370G>A	ENSP00000254508:p.His479Tyr	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	65	25	NM_024923	0	0	1	1	0	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647580	0.29246	.	.	ENSG00000132182	ENST00000254508	T	0.41400	1.0	5.8	3.99	0.46301	Invasin/intimin cell-adhesion (1);	0.386148	0.30003	N	0.010650	T	0.31918	0.0812	L	0.57536	1.79	0.37940	D	0.932281	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.21999	-1.0229	10	0.02654	T	1	.	8.5233	0.33289	0.1373:0.1281:0.7346:0.0	.	479;479	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	Y	479	ENSP00000254508:H479Y	ENSP00000254508:H479Y	H	-	1	0	NUP210	13390370	0.997000	0.39634	0.794000	0.32065	0.780000	0.44128	2.395000	0.44459	0.784000	0.33661	0.655000	0.94253	CAC	.		0.592	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
PLCL2	23228	hgsc.bcm.edu	37	3	17053310	17053310	+	Silent	SNP	G	G	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr3:17053310G>C	ENST00000418129.2	+	2	2559	c.2094G>C	c.(2092-2094)ctG>ctC	p.L698L	PLCL2_ENST00000432376.1_Silent_p.L698L|PLCL2_ENST00000396755.2_Silent_p.L698L	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	824	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						TGCCTGAACTGGCCATGGTGC	0.463																																					p.L698L		.											.	PLCL2-229	0			c.G2094C						.						83.0	84.0	84.0					3																	17053310		2203	4300	6503	SO:0001819	synonymous_variant	23228	exon2			TGAACTGGCCATG	AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.2094G>C	3.37:g.17053310G>C		Somatic	178	0		WXS	Illumina HiSeq	Phase_I	59	3	NM_015184	0	0	3	3	0	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Silent	SNP	ENST00000418129.2	37	CCDS33713.1	.	.	.	.	.	.	.	.	.	.	G	5.312	0.243004	0.10077	.	.	ENSG00000154822	ENST00000419842	.	.	.	5.44	3.5	0.40072	.	.	.	.	.	T	0.43612	0.1255	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42548	-0.9445	4	.	.	.	.	0.9473	0.01368	0.2527:0.1661:0.41:0.1711	.	.	.	.	S	442	.	.	W	+	2	0	PLCL2	17028314	1.000000	0.71417	0.999000	0.59377	0.720000	0.41350	1.063000	0.30567	1.409000	0.46915	0.491000	0.48974	TGG	.		0.463	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3		
TRANK1	9881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	36873055	36873055	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr3:36873055C>T	ENST00000429976.2	-	21	8134	c.7887G>A	c.(7885-7887)ctG>ctA	p.L2629L	TRANK1_ENST00000301807.6_Silent_p.L2079L|TRANK1_ENST00000428977.2_Silent_p.L2079L	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2629							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CCAAACAGAGCAGGCGGTTTA	0.532																																					p.L2629L		.											.	TRANK1-24	0			c.G7887A						.						60.0	62.0	61.0					3																	36873055		2004	4167	6171	SO:0001819	synonymous_variant	9881	exon21			ACAGAGCAGGCGG	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.7887G>A	3.37:g.36873055C>T		Somatic	49	0		WXS	Illumina HiSeq	Phase_I	85	32	NM_014831	0	0	3	3	0	Q8N8K0	Silent	SNP	ENST00000429976.2	37	CCDS46789.2																																																																																			.		0.532	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
ACAA1	30	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38178134	38178134	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr3:38178134C>G	ENST00000333167.8	-	2	386	c.214G>C	c.(214-216)Gtt>Ctt	p.V72L	MYD88_ENST00000417037.2_5'Flank|MYD88_ENST00000443433.2_5'Flank|MYD88_ENST00000424893.1_5'Flank|ACAA1_ENST00000544624.1_5'UTR|ACAA1_ENST00000450296.1_Missense_Mutation_p.V72L|MYD88_ENST00000396334.3_5'Flank|ACAA1_ENST00000301810.7_Missense_Mutation_p.V72L|ACAA1_ENST00000444607.2_Missense_Mutation_p.V72L|MYD88_ENST00000495303.1_5'Flank	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1	72					alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		TCCTTGAGAACCGCGGTCATG	0.642																																					p.V72L		.											.	ACAA1-91	0			c.G214C						.						53.0	47.0	49.0					3																	38178134		2203	4300	6503	SO:0001583	missense	30	exon2			TGAGAACCGCGGT	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087	ENST00000333167.8:c.214G>C	3.37:g.38178134C>G	ENSP00000333664:p.Val72Leu	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	94	28	NM_001130410	0	0	16	36	20	G5E935|Q96CA6	Missense_Mutation	SNP	ENST00000333167.8	37	CCDS2673.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442786	0.63067	.	.	ENSG00000060971	ENST00000333167;ENST00000301810;ENST00000450296;ENST00000358122;ENST00000444607	D;D;D;D	0.93604	-2.13;-2.13;-3.25;-2.13	4.85	4.85	0.62838	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.212850	0.38605	N	0.001627	D	0.87164	0.6109	N	0.17278	0.47	0.80722	D	1	B;B;B;B	0.18863	0.001;0.003;0.031;0.0	B;B;B;B	0.17979	0.003;0.02;0.019;0.004	T	0.82806	-0.0275	10	0.14656	T	0.56	-17.5296	17.9617	0.89087	0.0:1.0:0.0:0.0	.	4;72;72;72	F5GXL8;C9JDE9;G5E935;P09110	.;.;.;THIK_HUMAN	L	72;72;72;4;72	ENSP00000333664:V72L;ENSP00000301810:V72L;ENSP00000395183:V72L;ENSP00000391918:V72L	ENSP00000301810:V72L	V	-	1	0	ACAA1	38153138	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.483000	0.60264	2.230000	0.72887	0.655000	0.94253	GTT	.		0.642	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
HTT	3064	broad.mit.edu	37	4	3201562	3201562	+	Silent	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr4:3201562C>T	ENST00000355072.5	+	41	5617	c.5472C>T	c.(5470-5472)tcC>tcT	p.S1824S		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1824					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GGGCTCGTTCCATGATCACCA	0.597																																					p.S1824S													.	HTT-281	0			c.C5472T						.						78.0	82.0	81.0					4																	3201562		2062	4198	6260	SO:0001819	synonymous_variant	3064	exon41			TCGTTCCATGATC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.5472C>T	4.37:g.3201562C>T		Somatic	129	0		WXS	Illumina HiSeq	Phase_I	227	10	NM_002111	0	0	3	3	0	Q9UQB7	Silent	SNP	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.597	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
HPSE	10855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	84243394	84243394	+	Silent	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr4:84243394G>A	ENST00000405413.2	-	3	487	c.351C>T	c.(349-351)taC>taT	p.Y117Y	HPSE_ENST00000512196.1_Silent_p.Y117Y|HPSE_ENST00000513463.1_Silent_p.Y117Y|HPSE_ENST00000311412.5_Silent_p.Y117Y	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	117					carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	GAGATTGCCAGTAACTTCTCT	0.403																																					p.Y117Y		.											.	HPSE-227	0			c.C351T						.						85.0	87.0	86.0					4																	84243394		2203	4300	6503	SO:0001819	synonymous_variant	10855	exon2			TTGCCAGTAACTT	AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.351C>T	4.37:g.84243394G>A		Somatic	166	0		WXS	Illumina HiSeq	Phase_I	56	24	NM_001199830	0	0	4	4	0	A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Silent	SNP	ENST00000405413.2	37	CCDS3602.1																																																																																			.		0.403	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252812.2	NM_006665	
FAM198B	51313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	159092402	159092402	+	Silent	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr4:159092402A>T	ENST00000296530.8	-	2	747	c.126T>A	c.(124-126)acT>acA	p.T42T	RP11-597D13.9_ENST00000514381.1_RNA|FAM198B_ENST00000585682.1_Silent_p.T42T|RP11-597D13.9_ENST00000503611.1_RNA|FAM198B_ENST00000589306.1_Intron|RP11-597D13.9_ENST00000509463.1_RNA|FAM198B_ENST00000592057.1_Silent_p.T42T|FAM198B_ENST00000393807.5_Silent_p.T42T|RP11-597D13.9_ENST00000505532.1_RNA	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	42						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						TGGCACACGCAGTGCCCAGCA	0.637																																					p.T42T		.											.	FAM198B-90	0			c.T126A						.						42.0	44.0	43.0					4																	159092402		2202	4299	6501	SO:0001819	synonymous_variant	51313	exon2			ACACGCAGTGCCC		CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.126T>A	4.37:g.159092402A>T		Somatic	172	0		WXS	Illumina HiSeq	Phase_I	301	115	NM_016613	0	0	0	0	0	Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Silent	SNP	ENST00000296530.8	37	CCDS3798.1																																																																																			.		0.637	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365230.1	NM_001031700, NM_016613	
WDR17	116966	hgsc.bcm.edu	37	4	177081146	177081146	+	Splice_Site	SNP	A	A	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr4:177081146A>G	ENST00000280190.4	+	20	2755	c.2599A>G	c.(2599-2601)Aga>Gga	p.R867G	WDR17_ENST00000507824.2_Splice_Site_p.R850G|WDR17_ENST00000393643.2_Splice_Site_p.R843G|WDR17_ENST00000508596.1_Splice_Site_p.R843G			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	867										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TTTTATTAGGAGAGCTGACCA	0.323																																					p.R867G		.											.	WDR17-95	0			c.A2599G						.						63.0	61.0	62.0					4																	177081146		2203	4300	6503	SO:0001630	splice_region_variant	116966	exon20			ATTAGGAGAGCTG	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2598-1A>G	4.37:g.177081146A>G		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	30	2	NM_170710	0	0	0	0	0	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.70|16.70	3.195060|3.195060	0.58017|0.58017	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000443118|ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	.|T;T;T	.|0.60040	.|0.24;0.28;0.22	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75236|0.75236	0.3822|0.3822	M|M	0.74881|0.74881	2.28|2.28	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.69078	.|0.985;0.997;0.997	.|P;D;D	.|0.77004	.|0.661;0.989;0.989	T|T	0.76184|0.76184	-0.3052|-0.3052	5|10	.|0.44086	.|T	.|0.13	-32.4926|-32.4926	15.6261|15.6261	0.76859|0.76859	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|843;843;867	.|E7EP77;E7EQX0;Q8IZU2	.|.;.;WDR17_HUMAN	G|G	109|843;843;867;850	.|ENSP00000422763:R843G;ENSP00000377258:R843G;ENSP00000280190:R867G	.|ENSP00000280190:R867G	E|R	+|+	2|1	0|2	WDR17|WDR17	177318140|177318140	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	4.614000|4.614000	0.61183|0.61183	2.084000|2.084000	0.62774|0.62774	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.		0.323	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		Missense_Mutation
FAM173B	134145	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	10249973	10249973	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:10249973C>T	ENST00000511437.1	-	1	25	c.13G>A	c.(13-15)Gga>Aga	p.G5R	CCT5_ENST00000503026.1_5'Flank|FAM173B_ENST00000510047.1_Missense_Mutation_p.G5R|FAM173B_ENST00000510052.1_5'UTR|FAM173B_ENST00000280330.8_5'UTR|CTD-2256P15.1_ENST00000509915.1_RNA|CCT5_ENST00000515390.1_5'Flank|CCT5_ENST00000280326.4_5'Flank|CCT5_ENST00000515676.1_5'Flank|CCT5_ENST00000506600.1_5'Flank	NM_199133.3	NP_954584.2	Q6P4H8	F173B_HUMAN	family with sequence similarity 173, member B	5						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	16						GCCTCACCTCCTCCTCCCTCC	0.532																																					p.G5R		.											.	FAM173B-91	0			c.G13A						.						21.0	28.0	26.0					5																	10249973		1815	4066	5881	SO:0001583	missense	134145	exon1			CACCTCCTCCTCC		CCDS43301.1, CCDS58942.1	5p15.2	2008-08-08			ENSG00000150756	ENSG00000150756			27029	protein-coding gene	gene with protein product						12477932	Standard	NM_199133		Approved		uc003jeo.3	Q6P4H8	OTTHUMG00000161771	ENST00000511437.1:c.13G>A	5.37:g.10249973C>T	ENSP00000422338:p.Gly5Arg	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	122	45	NM_199133	0	0	0	0	0	B4DT41|B4DXK2|E9PBZ4	Missense_Mutation	SNP	ENST00000511437.1	37	CCDS43301.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707244	0.48412	.	.	ENSG00000150756	ENST00000511437;ENST00000510047	T;T	0.19250	2.16;2.23	4.76	4.76	0.60689	.	2.684740	0.03150	N	0.167810	T	0.32823	0.0842	L	0.34521	1.04	0.30467	N	0.773718	P;P	0.50943	0.94;0.901	P;P	0.51615	0.675;0.476	T	0.30001	-0.9993	10	0.87932	D	0	.	13.2821	0.60222	0.0:1.0:0.0:0.0	.	5;5	E9PBZ4;Q6P4H8	.;F173B_HUMAN	R	5	ENSP00000422338:G5R;ENSP00000420876:G5R	ENSP00000424210:G5R	G	-	1	0	FAM173B	10302973	0.990000	0.36364	0.880000	0.34516	0.780000	0.44128	0.276000	0.18716	2.166000	0.68216	0.561000	0.74099	GGA	.		0.532	FAM173B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000366048.2	NM_199133	
ARHGEF28	64283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	73163796	73163796	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:73163796G>C	ENST00000426542.2	+	18	2268	c.2248G>C	c.(2248-2250)Gga>Cga	p.G750R	ARHGEF28_ENST00000437974.1_Missense_Mutation_p.G750R|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.G750R|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.G437R|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.G750R|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.G750R|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.G750R			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	750					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)	p.G750R(4)									GGAGACTGTGGGACAGGTCCA	0.522																																					p.G750R		.											.	.	4	Substitution - Missense(4)	lung(4)	c.G2248C						.						104.0	99.0	101.0					5																	73163796		1962	4159	6121	SO:0001583	missense	64283	exon19			ACTGTGGGACAGG		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2248G>C	5.37:g.73163796G>C	ENSP00000412175:p.Gly750Arg	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	33	12	NM_001080479	0	0	2	5	3	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	G	2.497	-0.316052	0.05422	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.10192	3.16;3.16;3.15;2.9;3.16;3.15;3.0	5.67	4.72	0.59763	.	.	.	.	.	T	0.10208	0.0250	L	0.44542	1.39	0.09310	N	1	B;B;B;P	0.36282	0.014;0.027;0.015;0.546	B;B;B;B	0.36244	0.005;0.005;0.019;0.22	T	0.18209	-1.0344	9	0.20519	T	0.43	.	10.1606	0.42849	0.0:0.175:0.6902:0.1348	.	437;750;750;750	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	R	750;750;750;750;750;750;437	ENSP00000296794:G750R;ENSP00000441913:G750R;ENSP00000441436:G750R;ENSP00000287898:G750R;ENSP00000411459:G750R;ENSP00000412175:G750R;ENSP00000296799:G437R	ENSP00000287898:G750R	G	+	1	0	RP11-428C6.1	73199552	0.004000	0.15560	0.021000	0.16686	0.002000	0.02628	1.469000	0.35343	2.671000	0.90904	0.585000	0.79938	GGA	.		0.522	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
SHROOM1	134549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	132160478	132160478	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:132160478G>T	ENST00000378679.3	-	6	1874	c.1070C>A	c.(1069-1071)cCt>cAt	p.P357H	SHROOM1_ENST00000319854.3_Missense_Mutation_p.P357H|SHROOM1_ENST00000378676.1_Intron|SHROOM1_ENST00000488072.1_5'Flank	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	357					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TAACTCTGCAGGATACATCAC	0.567																																					p.P357H		.											.	SHROOM1-91	0			c.C1070A						.						60.0	62.0	61.0					5																	132160478		2203	4300	6503	SO:0001583	missense	134549	exon3			TCTGCAGGATACA	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.1070C>A	5.37:g.132160478G>T	ENSP00000367950:p.Pro357His	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	204	78	NM_133456	0	0	0	4	4	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Missense_Mutation	SNP	ENST00000378679.3	37	CCDS54902.1	.	.	.	.	.	.	.	.	.	.	G	9.923	1.212785	0.22289	.	.	ENSG00000164403	ENST00000378679;ENST00000319854	T;T	0.24350	1.86;1.86	3.93	3.06	0.35304	.	0.509864	0.20038	N	0.100569	T	0.18130	0.0435	L	0.27053	0.805	0.19300	N	0.999977	B;B	0.27498	0.18;0.113	B;B	0.29176	0.099;0.046	T	0.19976	-1.0289	10	0.72032	D	0.01	-3.8793	9.1379	0.36886	0.0:0.0:0.7829:0.2171	.	357;357	Q2M3G4-2;Q2M3G4	.;SHRM1_HUMAN	H	357	ENSP00000367950:P357H;ENSP00000324245:P357H	ENSP00000324245:P357H	P	-	2	0	SHROOM1	132188377	0.141000	0.22595	0.029000	0.17559	0.002000	0.02628	1.458000	0.35223	1.222000	0.43521	-0.268000	0.10319	CCT	.		0.567	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
SEC24A	10802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	134002687	134002687	+	Splice_Site	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:134002687G>A	ENST00000398844.2	+	3	1027		c.e3+1		SEC24A_ENST00000322887.4_Splice_Site	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AACCAAGAAGGTAAGTGAACC	0.438																																					.		.											.	SEC24A-68	0			c.739+1G>A						.						40.0	39.0	39.0					5																	134002687		1833	4087	5920	SO:0001630	splice_region_variant	10802	exon3			AAGAAGGTAAGTG	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.739+1G>A	5.37:g.134002687G>A		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	137	50	NM_001252231	0	0	0	0	0	A8MVW3|Q8WUV2|Q96GP7	Splice_Site	SNP	ENST00000398844.2	37	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297202	0.60086	.	.	ENSG00000113615	ENST00000398844;ENST00000322887	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7049	0.85369	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC24A	134030586	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	5.912000	0.69948	2.428000	0.82296	0.603000	0.83216	.	.		0.438	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		Intron
SPOCK1	6695	hgsc.bcm.edu;broad.mit.edu	37	5	136834142	136834142	+	Missense_Mutation	SNP	C	C	A	rs200001053		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:136834142C>A	ENST00000394945.1	-	2	275	c.106G>T	c.(106-108)Ggc>Tgc	p.G36C	SPOCK1_ENST00000282223.7_Missense_Mutation_p.G36C	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	36					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGGAAATTGCCGTGGTTGGGG	0.682																																					p.G36C		.											.	SPOCK1-91	0			c.G106T						.						22.0	21.0	21.0					5																	136834142		2203	4299	6502	SO:0001583	missense	6695	exon2			AATTGCCGTGGTT	AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.106G>T	5.37:g.136834142C>A	ENSP00000378401:p.Gly36Cys	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	56	17	NM_004598	0	0	1	1	0	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	ENST00000394945.1	37	CCDS4191.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179946	0.78564	.	.	ENSG00000152377	ENST00000394945;ENST00000282223;ENST00000505690	T;T;T	0.55588	0.54;0.54;0.51	3.66	2.77	0.32553	.	0.371240	0.21081	N	0.080484	T	0.58509	0.2127	L	0.56199	1.76	0.25077	N	0.990954	D	0.62365	0.991	P	0.55965	0.788	T	0.51576	-0.8688	10	0.66056	D	0.02	.	9.9319	0.41528	0.204:0.796:0.0:0.0	.	36	Q08629	TICN1_HUMAN	C	36	ENSP00000378401:G36C;ENSP00000282223:G36C;ENSP00000424517:G36C	ENSP00000282223:G36C	G	-	1	0	SPOCK1	136862041	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.898000	0.63238	0.626000	0.30322	0.462000	0.41574	GGC	C|0.999;G|0.000		0.682	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1	NM_004598	
KCNK17	89822	hgsc.bcm.edu	37	6	39282083	39282083	+	Missense_Mutation	SNP	C	C	T	rs139959421	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:39282083C>T	ENST00000373231.4	-	1	246	c.14G>A	c.(13-15)cGa>cAa	p.R5Q	KCNK17_ENST00000453413.2_Missense_Mutation_p.R5Q	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	5					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						CGCCCGGGCTCGCGGTCGGTA	0.746													C|||	53	0.0105831	0.0401	0.0	5008	,	,		12502	0.0		0.0	False		,,,				2504	0.0				p.R5Q		.											.	KCNK17-227	0			c.G14A						.	C	GLN/ARG,GLN/ARG	62,2676		0,62,1307	2.0	2.0	2.0		14,14	4.6	0.2	6	dbSNP_134	2	1,5981		0,1,2990	no	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	43,43	0,63,4297	TT,TC,CC		0.0167,2.2644,0.7225	possibly-damaging,possibly-damaging	5/272,5/333	39282083	63,8657	1369	2991	4360	SO:0001583	missense	89822	exon1			CGGGCTCGCGGTC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.14G>A	6.37:g.39282083C>T	ENSP00000362328:p.Arg5Gln	Somatic	2	2		WXS	Illumina HiSeq	Phase_I	10	10	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	23	0.010531135531135532	23	0.046747967479674794	0	0.0	0	0.0	0	0.0	C	17.55	3.417886	0.62622	0.022644	1.67E-4	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56275	0.47;0.47	4.59	4.59	0.56863	.	0.875659	0.09342	N	0.815355	T	0.38532	0.1044	L	0.47716	1.5	0.19300	N	0.999975	P;P	0.51933	0.82;0.949	B;P	0.44561	0.186;0.453	T	0.31806	-0.9930	10	0.59425	D	0.04	.	14.691	0.69085	0.0:1.0:0.0:0.0	.	5;5	E9PB46;Q96T54	.;KCNKH_HUMAN	Q	5	ENSP00000362328:R5Q;ENSP00000401271:R5Q	ENSP00000362328:R5Q	R	-	2	0	KCNK17	39390061	0.000000	0.05858	0.150000	0.22450	0.047000	0.14425	-0.137000	0.10389	2.260000	0.74910	0.561000	0.74099	CGA	C|0.989;T|0.011		0.746	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
KIF6	221458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	39313488	39313488	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:39313488G>T	ENST00000287152.7	-	21	2403	c.2309C>A	c.(2308-2310)cCa>cAa	p.P770Q	KIF6_ENST00000541946.1_Missense_Mutation_p.P221Q|KIF6_ENST00000373213.4_Missense_Mutation_p.P609Q|KIF6_ENST00000538893.1_Missense_Mutation_p.P714Q|KIF6_ENST00000394362.1_Missense_Mutation_p.P204Q|KIF6_ENST00000229913.5_Missense_Mutation_p.P221Q|KIF6_ENST00000373215.3_Missense_Mutation_p.P753Q|KIF6_ENST00000373216.3_Missense_Mutation_p.P753Q	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	770					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GTCTTCCAGTGGGGTGCTGGT	0.557																																					p.P770Q		.											.	KIF6-713	0			c.C2309A						.						124.0	107.0	113.0					6																	39313488		2203	4300	6503	SO:0001583	missense	221458	exon21			TCCAGTGGGGTGC	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.2309C>A	6.37:g.39313488G>T	ENSP00000287152:p.Pro770Gln	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	67	29	NM_145027	0	0	0	0	0	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	37	CCDS4844.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.700|6.700	0.497738|0.497738	0.12762|0.12762	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000458470|ENST00000287152;ENST00000394362;ENST00000373216;ENST00000373213;ENST00000229913;ENST00000373215;ENST00000538893;ENST00000541946	.|T;T;T;T;T;T;T;T	.|0.71222	.|-0.49;1.51;-0.53;-0.31;1.53;-0.49;-0.55;1.49	4.12|4.12	-1.35|-1.35	0.09114|0.09114	.|.	.|.	.|.	.|.	.|.	T|T	0.11665|0.11665	0.0284|0.0284	N|N	0.01352|0.01352	-0.895|-0.895	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.26195	.|0.09;0.09;0.144;0.054	.|B;B;B;B	.|0.29440	.|0.048;0.03;0.102;0.022	T|T	0.20940|0.20940	-1.0260|-1.0260	5|9	.|0.09084	.|T	.|0.74	.|.	1.384|1.384	0.02236|0.02236	0.1966:0.3047:0.3385:0.1602|0.1966:0.3047:0.3385:0.1602	.|.	.|753;714;753;770	.|E7EUN7;F6VGH2;Q6ZMV9-3;Q6ZMV9	.|.;.;.;KIF6_HUMAN	N|Q	645|770;204;753;609;221;753;714;221	.|ENSP00000287152:P770Q;ENSP00000377889:P204Q;ENSP00000362312:P753Q;ENSP00000362309:P609Q;ENSP00000229913:P221Q;ENSP00000362311:P753Q;ENSP00000441435:P714Q;ENSP00000439064:P221Q	.|ENSP00000229913:P221Q	H|P	-|-	1|2	0|0	KIF6|KIF6	39421466|39421466	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.191000|0.191000	0.23601|0.23601	-1.263000|-1.263000	0.02850|0.02850	-0.421000|-0.421000	0.07416|0.07416	0.563000|0.563000	0.77884|0.77884	CAC|CCA	.		0.557	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027	
NR2E1	7101	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	108499383	108499383	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:108499383T>G	ENST00000368986.4	+	5	1288	c.580T>G	c.(580-582)Ttc>Gtc	p.F194V	NR2E1_ENST00000368983.3_Missense_Mutation_p.F231V	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	194	Ligand-binding. {ECO:0000250}.				aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		CAGACTTCTCTTCATGAGCAT	0.527																																					p.F194V		.											.	NR2E1-187	0			c.T580G						.						123.0	104.0	110.0					6																	108499383		2203	4300	6503	SO:0001583	missense	7101	exon5			CTTCTCTTCATGA	Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.580T>G	6.37:g.108499383T>G	ENSP00000357982:p.Phe194Val	Somatic	181	0		WXS	Illumina HiSeq	Phase_I	79	29	NM_003269	0	0	0	0	0	Q6ZMP8	Missense_Mutation	SNP	ENST00000368986.4	37	CCDS5063.1	.	.	.	.	.	.	.	.	.	.	T	31	5.077084	0.94000	.	.	ENSG00000112333	ENST00000368986;ENST00000368983	T;T	0.50813	0.73;0.73	5.6	5.6	0.85130	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.043698	0.85682	D	0.000000	T	0.30070	0.0753	N	0.26092	0.79	0.80722	D	1	P	0.46621	0.881	P	0.48089	0.566	T	0.07009	-1.0795	10	0.30854	T	0.27	.	14.0221	0.64563	0.0:0.0:0.0:1.0	.	194	Q9Y466	NR2E1_HUMAN	V	194;231	ENSP00000357982:F194V;ENSP00000357979:F231V	ENSP00000357979:F231V	F	+	1	0	NR2E1	108606076	1.000000	0.71417	0.970000	0.41538	0.957000	0.61999	7.698000	0.84413	2.134000	0.65973	0.528000	0.53228	TTC	.		0.527	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041712.2		
FOXO3	2309	broad.mit.edu	37	6	108985136	108985136	+	Missense_Mutation	SNP	C	C	T	rs34223850		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:108985136C>T	ENST00000343882.6	+	3	1404	c.1100C>T	c.(1099-1101)cCa>cTa	p.P367L	FOXO3_ENST00000540898.1_Missense_Mutation_p.P147L|FOXO3_ENST00000406360.1_Missense_Mutation_p.P367L	NM_201559.2	NP_963853.1	O43524	FOXO3_HUMAN	forkhead box O3	367				P -> R (in Ref. 6; CAA04860). {ECO:0000305}.	antral ovarian follicle growth (GO:0001547)|cellular response to oxidative stress (GO:0034599)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|initiation of primordial ovarian follicle growth (GO:0001544)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|ovulation from ovarian follicle (GO:0001542)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		GTGGAACTGCCACGGCTGACT	0.567																																					p.P367L													.	FOXO3-1295	0			c.C1100T						.						53.0	49.0	50.0					6																	108985136		2203	4300	6503	SO:0001583	missense	2309	exon2			AACTGCCACGGCT	AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689		"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A		9479491	Standard	NM_001455		Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.1100C>T	6.37:g.108985136C>T	ENSP00000339527:p.Pro367Leu	Somatic	110	1		WXS	Illumina HiSeq	Phase_I	210	10	NM_001455	0	0	1	1	0	B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	Missense_Mutation	SNP	ENST00000343882.6	37	CCDS5068.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.786340	0.70337	.	.	ENSG00000118689	ENST00000343882;ENST00000406360;ENST00000540258;ENST00000540898	D;D	0.93366	-3.21;-3.21	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.96904	0.8989	M	0.85462	2.755	0.09310	P	0.999999999663215	D	0.89917	1.0	D	0.76071	0.987	D	0.96301	0.9221	9	0.52906	T	0.07	-29.4118	19.8586	0.96775	0.0:1.0:0.0:0.0	rs34223850	367	O43524	FOXO3_HUMAN	L	367;367;147;147	ENSP00000339527:P367L;ENSP00000385824:P367L	ENSP00000339527:P367L	P	+	2	0	FOXO3	109091829	1.000000	0.71417	0.989000	0.46669	0.788000	0.44548	7.456000	0.80751	2.701000	0.92244	0.462000	0.41574	CCA	C|1.000;|0.000		0.567	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041722.2		
TNRC18	84629	hgsc.bcm.edu	37	7	5415788	5415788	+	Silent	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr7:5415788G>A	ENST00000430969.1	-	9	3024	c.2676C>T	c.(2674-2676)ccC>ccT	p.P892P	TNRC18_ENST00000399537.4_Silent_p.P892P	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	892							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CGTGGTGCAGGGGGCTGCGGC	0.701																																					p.P892P		.											.	TNRC18-46	0			c.C2676T						.						8.0	11.0	10.0					7																	5415788		2005	4157	6162	SO:0001819	synonymous_variant	84629	exon9			GTGCAGGGGGCTG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.2676C>T	7.37:g.5415788G>A		Somatic	12	2		WXS	Illumina HiSeq	Phase_I	40	22	NM_001080495	0	0	0	2	2	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			.		0.701	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
DNAH11	8701	broad.mit.edu	37	7	21730436	21730436	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr7:21730436T>C	ENST00000409508.3	+	35	6009	c.5978T>C	c.(5977-5979)aTt>aCt	p.I1993T	DNAH11_ENST00000328843.6_Missense_Mutation_p.I2000T	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2000	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GGAATATTTATTACTATGAAC	0.378									Kartagener syndrome																												.													.	DNAH11-146	0			.						.						185.0	176.0	179.0					7																	21730436		1825	4085	5910	SO:0001583	missense	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TATTTATTACTAT	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.5978T>C	7.37:g.21730436T>C	ENSP00000475939:p.Ile1993Thr	Somatic	467	0		WXS	Illumina HiSeq	Phase_I	675	6	.	0	0	0	0	0	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	T	24.7	4.564708	0.86439	.	.	ENSG00000105877	ENST00000328843	T	0.14144	2.53	6.17	6.17	0.99709	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.39835	0.1093	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.69142	0.962	T	0.22382	-1.0218	9	0.87932	D	0	.	16.4957	0.84242	0.0:0.0:0.0:1.0	.	2000	Q96DT5	DYH11_HUMAN	T	2000	ENSP00000330671:I2000T	ENSP00000330671:I2000T	I	+	2	0	DNAH11	21696961	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.013000	0.88655	2.371000	0.80710	0.533000	0.62120	ATT	.		0.378	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
TRIM73	375593	hgsc.bcm.edu	37	7	75028469	75028469	+	Silent	SNP	A	A	G	rs142958137	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr7:75028469A>G	ENST00000437796.1	+	1	271	c.252A>G	c.(250-252)ccA>ccG	p.P84P	TRIM73_ENST00000323819.3_Silent_p.P84P|TRIM73_ENST00000447409.2_Silent_p.P84P|TRIM73_ENST00000430211.1_Silent_p.P84P|TRIM73_ENST00000450434.1_5'UTR			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	84						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						CTGGGGACCCAGAGCCCAAGG	0.667													G|||	3571	0.713059	0.7163	0.6974	5008	,	,		6749	0.874		0.5527	False		,,,				2504	0.7188				p.P84P		.											.	TRIM74-40	0			c.A252G						.						9.0	28.0	23.0					7																	75028469		810	2167	2977	SO:0001819	synonymous_variant	378108	exon2			GGACCCAGAGCCC	AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		ENST00000437796.1:c.252A>G	7.37:g.75028469A>G		Somatic	7	2		WXS	Illumina HiSeq	Phase_I	22	14	NM_198853	0	0	0	11	11	Q8N0S3	Silent	SNP	ENST00000437796.1	37	CCDS34665.1																																																																																			.		0.667	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342950.1		
TFR2	7036	hgsc.bcm.edu	37	7	100224941	100224941	+	Silent	SNP	C	C	A	rs111760099	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr7:100224941C>A	ENST00000462107.1	-	17	2228	c.1941G>T	c.(1939-1941)ggG>ggT	p.G647G	TFR2_ENST00000223051.3_Silent_p.G647G|TFR2_ENST00000431692.1_3'UTR|TFR2_ENST00000544242.1_Silent_p.G188G			Q9UP52	TFR2_HUMAN	transferrin receptor 2	647					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	GGACGACGTCCCCGTAGCGGC	0.687													C|||	26	0.00519169	0.0182	0.0029	5008	,	,		14728	0.0		0.0	False		,,,				2504	0.0				p.G647G		.											.	TFR2-92	0			c.G1941T						.	C	,	35,4107		1,33,2037	11.0	12.0	12.0		1428,1941	-1.7	1.0	7	dbSNP_132	12	7,8063		0,7,4028	no	coding-synonymous,coding-synonymous	TFR2	NM_001206855.1,NM_003227.3	,	1,40,6065	AA,AC,CC		0.0867,0.845,0.3439	,	476/631,647/802	100224941	42,12170	2071	4035	6106	SO:0001819	synonymous_variant	7036	exon16			GACGTCCCCGTAG	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.1941G>T	7.37:g.100224941C>A		Somatic	7	2		WXS	Illumina HiSeq	Phase_I	20	9	NM_003227	0	0	0	0	0	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Silent	SNP	ENST00000462107.1	37	CCDS34707.1																																																																																			C|0.997;A|0.003		0.687	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356392.3	NM_003227	
PODXL	5420	hgsc.bcm.edu	37	7	131241055	131241055	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr7:131241055A>G	ENST00000378555.3	-	1	311	c.64T>C	c.(64-66)Tcg>Ccg	p.S22P	PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_Missense_Mutation_p.S22P|PODXL_ENST00000537928.1_Missense_Mutation_p.S22P|PODXL_ENST00000322985.9_Missense_Mutation_p.S22P			O00592	PODXL_HUMAN	podocalyxin-like	22					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					gacggcgacgacggcagcagc	0.741																																					p.S22P		.											.	PODXL-136	0			c.T64C						.						5.0	8.0	7.0					7																	131241055		1914	3836	5750	SO:0001583	missense	5420	exon1			GCGACGACGGCAG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.64T>C	7.37:g.131241055A>G	ENSP00000367817:p.Ser22Pro	Somatic	12	1		WXS	Illumina HiSeq	Phase_I	22	5	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	ENST00000378555.3	37	CCDS34755.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488975	0.26686	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000378555;ENST00000322985	T;T;T;T	0.12774	2.82;2.65;2.82;2.85	.	.	.	.	7739.210000	0.00166	U	0.000000	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	0.999994	.	.	.	.	.	.	T	0.24728	-1.0152	6	0.29301	T	0.29	.	.	.	.	.	22;22	O00592-2;O00592	.;PODXL_HUMAN	P	22	ENSP00000440518:S22P;ENSP00000442655:S22P;ENSP00000367817:S22P;ENSP00000319782:S22P	ENSP00000319782:S22P	S	-	1	0	PODXL	130891595	0.001000	0.12720	0.027000	0.17364	0.027000	0.11550	0.743000	0.26231	0.056000	0.16144	0.055000	0.15244	TCG	.		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
HIPK2	28996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	139299101	139299101	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr7:139299101T>C	ENST00000406875.3	-	8	2015	c.1921A>G	c.(1921-1923)Aca>Gca	p.T641A	HIPK2_ENST00000342645.6_Missense_Mutation_p.T641A|HIPK2_ENST00000428878.2_Missense_Mutation_p.T614A	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	641	Interaction with SKI and SMAD1.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					ATCTGGGCTGTTCCTGTCTGC	0.597																																					p.T641A		.											.	HIPK2-785	0			c.A1921G						.						47.0	54.0	52.0					7																	139299101		1956	4149	6105	SO:0001583	missense	28996	exon8			GGGCTGTTCCTGT	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.1921A>G	7.37:g.139299101T>C	ENSP00000385571:p.Thr641Ala	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	107	46	NM_022740	0	0	0	3	3	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37		.	.	.	.	.	.	.	.	.	.	T	12.91	2.079694	0.36662	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.50277	0.75;0.8;0.78	5.39	2.9	0.33743	.	.	.	.	.	T	0.33847	0.0877	.	.	.	0.43667	D	0.996098	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.06481	-1.0824	8	0.27785	T	0.31	.	9.7368	0.40392	0.0:0.1461:0.0:0.8539	.	641;614	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	A	641;614;641	ENSP00000385571:T641A;ENSP00000413724:T614A;ENSP00000343108:T641A	ENSP00000343108:T641A	T	-	1	0	HIPK2	138949641	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	0.813000	0.27225	0.383000	0.24910	0.460000	0.39030	ACA	.		0.597	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
WDR86	349136	hgsc.bcm.edu	37	7	151078735	151078735	+	Missense_Mutation	SNP	A	A	G	rs4141455	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr7:151078735A>G	ENST00000334493.6	-	6	1494	c.1064T>C	c.(1063-1065)aTg>aCg	p.M355T	WDR86_ENST00000469830.2_Silent_p.H376H|WDR86_ENST00000463000.1_Intron|WDR86_ENST00000477459.1_Missense_Mutation_p.C182R	NM_001284262.1|NM_198285.2	NP_001271191.1|NP_938026.2	Q86TI4	WDR86_HUMAN	WD repeat domain 86	355			M -> T (in dbSNP:rs4141455). {ECO:0000269|PubMed:15489334}.							breast(1)|endometrium(2)|kidney(1)|lung(6)	10			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAGGCTGCGCATGGGCGGAGG	0.766													G|||	4189	0.836462	0.8691	0.8689	5008	,	,		10617	0.9851		0.7823	False		,,,				2504	0.6718				p.M355T		.											.	.	0			c.T1064C						.						1.0	1.0	1.0					7																	151078735		635	1338	1973	SO:0001583	missense	349136	exon6			CTGCGCATGGGCG	AK125347	CCDS5925.2, CCDS64805.1, CCDS64806.1, CCDS75680.1	7q36.1	2013-01-09			ENSG00000187260	ENSG00000187260		"""WD repeat domain containing"""	28020	protein-coding gene	gene with protein product						12477932	Standard	NM_198285		Approved		uc003wkb.2	Q86TI4	OTTHUMG00000150764	ENST00000334493.6:c.1064T>C	7.37:g.151078735A>G	ENSP00000335522:p.Met355Thr	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	3	3	NM_198285	0	0	0	0	0	B4DJF1|C9JAJ5|C9JXE3|Q3KNT1|Q6ZUS8	Missense_Mutation	SNP	ENST00000334493.6	37	CCDS5925.2	1852|1852	0.847985347985348|0.847985347985348	414|414	0.8414634146341463|0.8414634146341463	300|300	0.8287292817679558|0.8287292817679558	568|568	0.993006993006993|0.993006993006993	570|570	0.7519788918205804|0.7519788918205804	G|G	7.749|7.749	0.702921|0.702921	0.15172|0.15172	.|.	.|.	ENSG00000187260|ENSG00000187260	ENST00000477459|ENST00000334493	T|T	0.56444|0.54479	0.46|0.57	4.39|4.39	-2.72|-2.72	0.05968|0.05968	.|Quinoprotein amine dehydrogenase, beta chain-like (1);	0.855198|.	0.09836|.	N|.	0.749514|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.03608|0.03608	-0.345|-0.345	0.58432|0.58432	P|P	5.000000000032756E-6|5.000000000032756E-6	B|B;B	0.02656|0.02656	0.0|0.0;0.0	B|B;B	0.01281|0.01281	0.0|0.0;0.0	T|T	0.25641|0.25641	-1.0126|-1.0126	9|8	0.35671|0.11182	T|T	0.21|0.66	-0.0107|-0.0107	2.2812|2.2812	0.04114|0.04114	0.1224:0.1641:0.4024:0.3111|0.1224:0.1641:0.4024:0.3111	rs4141455;rs10385476;rs13246084|rs4141455;rs10385476;rs13246084	182|355;313	C9JAJ5|Q86TI4;D3DX12	.|WDR86_HUMAN;.	R|T	182|355	ENSP00000417512:C182R|ENSP00000335522:M355T	ENSP00000417512:C182R|ENSP00000335522:M355T	C|M	-|-	1|2	0|0	WDR86|WDR86	150709668|150709668	0.215000|0.215000	0.23574|0.23574	0.012000|0.012000	0.15200|0.15200	0.459000|0.459000	0.32528|0.32528	0.077000|0.077000	0.14738|0.14738	-1.008000|-1.008000	0.03404|0.03404	-1.507000|-1.507000	0.00952|0.00952	TGC|ATG	T|0.151;G|0.004		0.766	WDR86-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319999.3	NM_198285	
SLC35G5	83650	hgsc.bcm.edu;broad.mit.edu	37	8	11188719	11188719	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr8:11188719G>A	ENST00000382435.4	+	1	323	c.104G>A	c.(103-105)gGt>gAt	p.G35D		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	35						integral component of membrane (GO:0016021)		p.G35D(1)									CAGCCCTCTGGTGCCACCAAT	0.682																																					p.G35D		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.G104A						.																																			SO:0001583	missense	83650	exon1			CCTCTGGTGCCAC	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.104G>A	8.37:g.11188719G>A	ENSP00000371872:p.Gly35Asp	Somatic	118	1		WXS	Illumina HiSeq	Phase_I	273	14	NM_054028	0	0	1	1	0	A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.973298	0.00452	.	.	ENSG00000177710	ENST00000382435	T	0.23348	1.91	0.34	0.34	0.15985	.	0.293668	0.23411	N	0.048476	T	0.06280	0.0162	N	0.02539	-0.55	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.28267	-1.0049	9	0.09084	T	0.74	0.0032	.	.	.	.	35	Q96KT7	S35G5_HUMAN	D	35	ENSP00000371872:G35D	ENSP00000371872:G35D	G	+	2	0	SLC35G5	11226129	0.973000	0.33851	0.352000	0.25734	0.047000	0.14425	0.142000	0.16096	-1.532000	0.01747	-2.047000	0.00414	GGT	.		0.682	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
KCNU1	157855	broad.mit.edu	37	8	36698474	36698474	+	Silent	SNP	C	C	A	rs375978830		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr8:36698474C>A	ENST00000399881.3	+	16	1693	c.1656C>A	c.(1654-1656)ctC>ctA	p.L552L		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	552	Segment S8.				multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AGATGCACCTCCTGTTGATAG	0.413																																					p.L552L													.	KCNU1-23	0			c.C1656A						.						130.0	124.0	126.0					8																	36698474		1997	4172	6169	SO:0001819	synonymous_variant	157855	exon16			GCACCTCCTGTTG	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1656C>A	8.37:g.36698474C>A		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	29	5	NM_001031836	0	0	0	0	0		Silent	SNP	ENST00000399881.3	37	CCDS55220.1																																																																																			.		0.413	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
ERMP1	79956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	5801231	5801231	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr9:5801231A>T	ENST00000339450.5	-	11	2101	c.2012T>A	c.(2011-2013)tTt>tAt	p.F671Y	ERMP1_ENST00000381506.3_3'UTR|ERMP1_ENST00000543230.1_Missense_Mutation_p.F249Y|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	671						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		ATATGGAAAAAATGTTCCACT	0.403																																					p.F671Y		.											.	ERMP1-69	0			c.T2012A						.						143.0	142.0	142.0					9																	5801231		2203	4300	6503	SO:0001583	missense	79956	exon11			GGAAAAAATGTTC	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.2012T>A	9.37:g.5801231A>T	ENSP00000340427:p.Phe671Tyr	Somatic	171	1		WXS	Illumina HiSeq	Phase_I	64	18	NM_024896	0	0	4	9	5	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	ENST00000339450.5	37	CCDS34983.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.273899	0.80580	.	.	ENSG00000099219	ENST00000339450;ENST00000543230	T;T	0.25085	1.82;1.82	5.66	5.66	0.87406	.	0.090086	0.85682	D	0.000000	T	0.24084	0.0583	L	0.36672	1.1	0.80722	D	1	D	0.56521	0.976	P	0.47827	0.558	T	0.03278	-1.1053	10	0.02654	T	1	-21.0967	15.8854	0.79244	1.0:0.0:0.0:0.0	.	671	Q7Z2K6	ERMP1_HUMAN	Y	671;249	ENSP00000340427:F671Y;ENSP00000439368:F249Y	ENSP00000340427:F671Y	F	-	2	0	ERMP1	5791231	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	8.243000	0.89821	2.156000	0.67533	0.533000	0.62120	TTT	.		0.403	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
TYRP1	7306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	12694339	12694339	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr9:12694339C>G	ENST00000388918.5	+	2	472	c.343C>G	c.(343-345)Cct>Gct	p.P115A	TYRP1_ENST00000381136.2_5'Flank|TYRP1_ENST00000381137.2_5'UTR	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	115					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GACGTGCCGTCCTGGCTGGAG	0.507									Oculocutaneous Albinism																												p.P115A		.											.	TYRP1-226	0			c.C343G						.						35.0	33.0	34.0					9																	12694339		2203	4300	6503	SO:0001583	missense	7306	exon2	Familial Cancer Database		TGCCGTCCTGGCT	L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.343C>G	9.37:g.12694339C>G	ENSP00000373570:p.Pro115Ala	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	48	14	NM_000550	0	0	0	0	0	P78468|P78469|Q13721|Q15679	Missense_Mutation	SNP	ENST00000388918.5	37	CCDS34990.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937217	0.52972	.	.	ENSG00000107165	ENST00000388918	D	0.98926	-5.24	5.5	5.5	0.81552	Uncharacterised domain, di-copper centre (2);	0.097920	0.64402	D	0.000001	D	0.97324	0.9125	L	0.55834	1.745	0.80722	D	1	B	0.10296	0.003	B	0.14578	0.011	D	0.95286	0.8390	9	.	.	.	-1.287	19.7727	0.96373	0.0:1.0:0.0:0.0	.	115	P17643	TYRP1_HUMAN	A	115	ENSP00000373570:P115A	.	P	+	1	0	TYRP1	12684339	0.998000	0.40836	1.000000	0.80357	0.744000	0.42396	3.774000	0.55341	2.758000	0.94735	0.563000	0.77884	CCT	.		0.507	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3	NM_000550	
UNC13B	10497	hgsc.bcm.edu	37	9	35243362	35243362	+	Splice_Site	SNP	G	G	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr9:35243362G>C	ENST00000378495.3	+	6	690		c.e6+1		UNC13B_ENST00000378496.4_Splice_Site|UNC13B_ENST00000396787.1_Splice_Site	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)						apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TGACAATGAGGTAGGAGCAGC	0.453																																					.		.											.	UNC13B-157	0			c.468+1G>C						.						107.0	106.0	107.0					9																	35243362		2203	4300	6503	SO:0001630	splice_region_variant	10497	exon6			AATGAGGTAGGAG	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.468+1G>C	9.37:g.35243362G>C		Somatic	217	0		WXS	Illumina HiSeq	Phase_I	22	2	NM_006377	0	0	0	0	0	Q5VYM8	Splice_Site	SNP	ENST00000378495.3	37	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806342	0.70682	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2568	0.82522	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC13B	35233362	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.638000	0.91019	2.307000	0.77673	0.655000	0.94253	.	.		0.453	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	Intron
KIF12	113220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	116859620	116859620	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr9:116859620A>T	ENST00000374118.3	-	4	430	c.193T>A	c.(193-195)Ttt>Att	p.F65I	KIF12_ENST00000473174.1_Intron	NM_138424.1	NP_612433.1	Q96FN5	KIF12_HUMAN	kinesin family member 12	198	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	17						AGACTCCCAAATTCCACCACC	0.602																																					p.F65I		.											.	KIF12-90	0			c.T193A						.						41.0	43.0	43.0					9																	116859620		2203	4300	6503	SO:0001583	missense	113220	exon4			TCCCAAATTCCAC	BC010626	CCDS6801.1	9q33.1	2008-02-05			ENSG00000136883	ENSG00000136883		"""Kinesins"""	21495	protein-coding gene	gene with protein product		611278					Standard	NM_138424		Approved		uc004bif.3	Q96FN5	OTTHUMG00000020533	ENST00000374118.3:c.193T>A	9.37:g.116859620A>T	ENSP00000363232:p.Phe65Ile	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	92	32	NM_138424	0	0	17	47	30	Q5TBE0	Missense_Mutation	SNP	ENST00000374118.3	37	CCDS6801.1	.	.	.	.	.	.	.	.	.	.	A	6.945	0.544191	0.13312	.	.	ENSG00000136883	ENST00000374118;ENST00000259410	T	0.70045	-0.45	5.5	0.00987	0.14080	Kinesin, motor domain (4);	0.463632	0.22239	N	0.062709	T	0.33000	0.0848	N	0.01817	-0.705	0.23906	N	0.996504	B	0.10296	0.003	B	0.15484	0.013	T	0.21245	-1.0251	10	0.52906	T	0.07	.	4.5522	0.12117	0.4767:0.0:0.0832:0.4401	.	198	Q96FN5	KIF12_HUMAN	I	65;198	ENSP00000363232:F65I	ENSP00000259410:F198I	F	-	1	0	KIF12	115899441	0.889000	0.30405	0.842000	0.33263	0.054000	0.15201	1.421000	0.34815	-0.251000	0.09542	-0.451000	0.05528	TTT	.		0.602	KIF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053751.1	NM_138424	
COL27A1	85301	hgsc.bcm.edu	37	9	117052533	117052533	+	Silent	SNP	C	C	G	rs575474490	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr9:117052533C>G	ENST00000356083.3	+	47	4681	c.4290C>G	c.(4288-4290)ggC>ggG	p.G1430G		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1430	Collagen-like 13.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGCCCCGGGGCGTGGTGGGGA	0.677																																					p.G1430G		.											.	COL27A1-94	0			c.C4290G						.						15.0	14.0	14.0					9																	117052533		2181	4265	6446	SO:0001819	synonymous_variant	85301	exon47			CCGGGGCGTGGTG	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4290C>G	9.37:g.117052533C>G		Somatic	7	0		WXS	Illumina HiSeq	Phase_I	17	2	NM_032888	0	0	1	1	0	Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	37	CCDS6802.1																																																																																			.		0.677	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
CEL	1056	hgsc.bcm.edu	37	9	135947023	135947023	+	Missense_Mutation	SNP	G	G	C	rs374263839|rs75294797	byFrequency	TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr9:135947023G>C	ENST00000372080.4	+	11	2159	c.2143G>C	c.(2143-2145)Gcc>Ccc	p.A715P	CEL_ENST00000351304.7_Missense_Mutation_p.A646P	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	712	17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CTCCGAGACCGCCCCCGTGCC	0.781																																					p.A715P		.											.	CEL-91	0			c.G2143C						.						5.0	7.0	6.0					9																	135947023		1628	3758	5386	SO:0001583	missense	1056	exon11			GAGACCGCCCCCG	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.2143G>C	9.37:g.135947023G>C	ENSP00000361151:p.Ala715Pro	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	29	4	NM_001807	0	0	0	0	0	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	ENST00000372080.4	37	CCDS43896.1	.	.	.	.	.	.	.	.	.	.	g	7.404	0.633289	0.14322	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.70986	-0.34;-0.53	2.27	-2.27	0.06846	.	.	.	.	.	T	0.43678	0.1258	N	0.16368	0.405	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18085	-1.0348	9	0.20519	T	0.43	.	0.5426	0.00648	0.3832:0.178:0.2587:0.1801	.	712	P19835	CEL_HUMAN	P	715;646;681	ENSP00000361151:A715P;ENSP00000342217:A646P	ENSP00000304021:A681P	A	+	1	0	CEL	134936844	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.308000	0.00255	-0.627000	0.05589	-0.698000	0.03680	GCC	.		0.781	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1		
GPR112	139378	hgsc.bcm.edu	37	X	135431434	135431434	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chrX:135431434A>C	ENST00000394143.1	+	6	5860	c.5569A>C	c.(5569-5571)Aca>Cca	p.T1857P	GPR112_ENST00000287534.4_Missense_Mutation_p.T1794P|GPR112_ENST00000370652.1_Missense_Mutation_p.T1857P|GPR112_ENST00000412101.1_Missense_Mutation_p.T1652P|GPR112_ENST00000394141.1_Missense_Mutation_p.T1652P	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1857					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCCTCCTCCCACATCCCAAAT	0.453																																					p.T1857P		.											.	GPR112-183	0			c.A5569C						.						113.0	103.0	106.0					X																	135431434		2203	4300	6503	SO:0001583	missense	139378	exon6			CCTCCCACATCCC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5569A>C	X.37:g.135431434A>C	ENSP00000377699:p.Thr1857Pro	Somatic	157	0		WXS	Illumina HiSeq	Phase_I	18	2	NM_153834	0	0	0	0	0	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	a	11.27	1.589464	0.28357	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.34072	1.41;1.41;1.38;1.51;1.38	3.84	1.39	0.22231	.	.	.	.	.	T	0.33644	0.0870	N	0.24115	0.695	0.09310	N	1	D;D;D	0.64830	0.994;0.982;0.983	P;P;P	0.56960	0.81;0.682;0.637	T	0.12578	-1.0542	9	0.46703	T	0.11	.	5.0436	0.14471	0.7128:0.0:0.2872:0.0	.	1794;1652;1857	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	P	1857;1857;1652;1794;1652	ENSP00000377699:T1857P;ENSP00000359686:T1857P;ENSP00000416526:T1652P;ENSP00000287534:T1794P;ENSP00000377697:T1652P	ENSP00000287534:T1794P	T	+	1	0	GPR112	135259100	0.001000	0.12720	0.000000	0.03702	0.241000	0.25554	1.371000	0.34250	0.002000	0.14630	0.430000	0.28490	ACA	.		0.453	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
HTATSF1	27336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	135594033	135594033	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chrX:135594033A>T	ENST00000218364.4	+	9	2303	c.2129A>T	c.(2128-2130)gAg>gTg	p.E710V	HTATSF1_ENST00000535601.1_Missense_Mutation_p.E710V	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	710	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					TTTGATGAGGAGGAAGATTCC	0.458																																					p.E710V		.											.	HTATSF1-132	0			c.A2129T						.						221.0	193.0	203.0					X																	135594033		2203	4300	6503	SO:0001583	missense	27336	exon10			ATGAGGAGGAAGA	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.2129A>T	X.37:g.135594033A>T	ENSP00000218364:p.Glu710Val	Somatic	131	1		WXS	Illumina HiSeq	Phase_I	17	14	NM_001163280	0	1	3	85	81	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	A	9.409	1.080079	0.20309	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.34667	1.35;1.35	2.64	2.64	0.31445	.	.	.	.	.	T	0.21227	0.0511	N	0.14661	0.345	0.09310	N	1	P	0.42757	0.789	B	0.38655	0.278	T	0.08006	-1.0743	9	0.87932	D	0	-2.0207	8.2917	0.31960	1.0:0.0:0.0:0.0	.	710	O43719	HTSF1_HUMAN	V	710;710;676	ENSP00000442699:E710V;ENSP00000218364:E710V	ENSP00000218364:E710V	E	+	2	0	HTATSF1	135421699	0.836000	0.29430	0.004000	0.12327	0.938000	0.57974	2.165000	0.42396	1.296000	0.44742	0.235000	0.17854	GAG	.		0.458	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
F13B	2165	broad.mit.edu	37	1	197021793	197021794	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr1:197021793_197021794delTC	ENST00000367412.1	-	9	1568_1569	c.1525_1526delGA	c.(1525-1527)gaafs	p.E509fs	F13B_ENST00000490002.1_5'Flank	NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	509	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						ATATTTCACTTCTCCTCTGTTG	0.327																																					p.509_509del													.	F13B-92	0			c.1525_1526del						.																																			SO:0001589	frameshift_variant	2165	exon9			TTCACTTCTCCTC	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1525_1526delGA	1.37:g.197021795_197021796delTC	ENSP00000356382:p.Glu509fs	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_001994	0	0	0	0	0	A8K3E5|Q5VYL5	Frame_Shift_Del	DEL	ENST00000367412.1	37	CCDS1388.1																																																																																			.		0.327	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994	
OSBPL5	114879	hgsc.bcm.edu;broad.mit.edu	37	11	3143300	3143300	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr11:3143300delT	ENST00000263650.7	-	5	488	c.329delA	c.(328-330)aagfs	p.K111fs	OSBPL5_ENST00000542243.1_Frame_Shift_Del_p.E26fs|OSBPL5_ENST00000348039.5_Frame_Shift_Del_p.K111fs|OSBPL5_ENST00000389989.3_Frame_Shift_Del_p.K111fs|OSBPL5_ENST00000525498.1_Frame_Shift_Del_p.K63fs	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	111					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GGCGCGCTTCTTCTCCTGCCG	0.687																																					p.K110fs		.											.	OSBPL5-113	0			c.329delA						.						43.0	34.0	37.0					11																	3143300		2191	4291	6482	SO:0001589	frameshift_variant	114879	exon5			.	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.329delA	11.37:g.3143300delT	ENSP00000263650:p.Lys111fs	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	25	11	NM_145638	0	0	0	0	0	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Frame_Shift_Del	DEL	ENST00000263650.7	37	CCDS31344.1																																																																																			.		0.687	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2		
FSD2	123722	broad.mit.edu	37	15	83437762	83437764	+	In_Frame_Del	DEL	TAA	TAA	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	TAA	TAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr15:83437762_83437764delTAA	ENST00000334574.8	-	9	1602_1604	c.1421_1423delTTA	c.(1420-1425)attaaa>aaa	p.I474del	FSD2_ENST00000541889.1_In_Frame_Del_p.I429del			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	474	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.									breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						TCTTTGGTTTTAATAATGGGGGG	0.483																																					p.474_475del													.	FSD2-90	0			c.1421_1423del						.																																			SO:0001651	inframe_deletion	123722	exon9			TGGTTTTAATAAT	AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.1421_1423delTTA	15.37:g.83437765_83437767delTAA	ENSP00000335651:p.Ile474del	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	22	9	NM_001007122	0	0	0	0	0	B3KVG1|B7ZM02	In_Frame_Del	DEL	ENST00000334574.8	37	CCDS45332.1																																																																																			.		0.483	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418385.1	NM_001007122	
KIAA0430	9665	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	15716936	15716936	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr16:15716936delA	ENST00000396368.3	-	11	2521	c.2315delT	c.(2314-2316)ttcfs	p.F772fs	KIAA0430_ENST00000344181.3_Frame_Shift_Del_p.F441fs|KIAA0430_ENST00000602337.1_Frame_Shift_Del_p.F769fs|KIAA0430_ENST00000551742.1_Frame_Shift_Del_p.F772fs|KIAA0430_ENST00000548025.1_Frame_Shift_Del_p.F769fs|KIAA0430_ENST00000540441.2_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	772					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TGCAATGTTGAAAGCAAGCGG	0.408																																					p.F772fs		.											.	KIAA0430-90	0			c.2315delT						.						91.0	88.0	89.0					16																	15716936		1865	4105	5970	SO:0001589	frameshift_variant	9665	exon11			.	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.2315delT	16.37:g.15716936delA	ENSP00000379654:p.Phe772fs	Somatic	253	0		WXS	Illumina HiSeq	Phase_I	195	63	NM_014647	0	0	0	0	0	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Del	DEL	ENST00000396368.3	37	CCDS10562.2																																																																																			.		0.408	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647	
CEP192	55125	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	13049324	13049324	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr18:13049324delT	ENST00000325971.8	+	14	2339	c.746delT	c.(745-747)gttfs	p.V249fs	CEP192_ENST00000430049.2_Frame_Shift_Del_p.V370fs|CEP192_ENST00000506447.1_Frame_Shift_Del_p.V845fs			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	249					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GCAGCTATTGTTTATGTTGAA	0.383																																					p.V845fs		.											.	CEP192-27	0			c.2534delT						.						100.0	95.0	97.0					18																	13049324		2203	4300	6503	SO:0001589	frameshift_variant	55125	exon16			.	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.746delT	18.37:g.13049324delT	ENSP00000317156:p.Val249fs	Somatic	249	0		WXS	Illumina HiSeq	Phase_I	61	19	NM_032142	0	0	0	0	0	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Frame_Shift_Del	DEL	ENST00000325971.8	37																																																																																				.		0.383	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
COX7A1	1346	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	36642400	36642402	+	In_Frame_Del	DEL	TGT	TGT	-	rs375983153		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:36642400_36642402delTGT	ENST00000292907.3	-	3	610_612	c.149_151delACA	c.(148-153)aacatc>atc	p.N50del	COX7A1_ENST00000437291.2_5'UTR	NM_001864.2	NP_001855.1	P24310	CX7A1_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)	50					generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)	integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			endometrium(2)|large_intestine(1)	3	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CGGTACAGGATGTTGTCAACGAT	0.626																																					p.50_51del		.											.	COX7A1-226	0			c.149_151del						.																																			SO:0001651	inframe_deletion	1346	exon3			.	BC002757	CCDS12490.1	19q13.1	2011-07-04			ENSG00000161281	ENSG00000161281	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2287	protein-coding gene	gene with protein product		123995		COX7A		1327965, 2550906	Standard	NM_001864		Approved	COX7AH	uc002odm.1	P24310	OTTHUMG00000048144	ENST00000292907.3:c.149_151delACA	19.37:g.36642403_36642405delTGT	ENSP00000292907:p.Asn50del	Somatic	194	0		WXS	Illumina HiSeq	Phase_I	242	64	NM_001864	0	0	0	0	0		In_Frame_Del	DEL	ENST00000292907.3	37	CCDS12490.1																																																																																			.		0.626	COX7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109545.2	NM_001864	
CTBP1	1487	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	1232016	1232016	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr4:1232016delA	ENST00000290921.6	-	2	331	c.150delT	c.(148-150)actfs	p.T50fs	CTBP1_ENST00000382952.3_Frame_Shift_Del_p.T39fs|CTBP1_ENST00000515690.1_5'UTR|CTBP1_ENST00000510568.1_Frame_Shift_Del_p.T39fs	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1	50	Interaction with GLIS2 1. {ECO:0000250}.				Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		AGAAGGCCACAGTGGCCACGT	0.657																																					p.T50fs		.											.	CTBP1-91	0			c.150delT						.						69.0	66.0	67.0					4																	1232016		2202	4298	6500	SO:0001589	frameshift_variant	1487	exon2			.	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259	ENST00000290921.6:c.150delT	4.37:g.1232016delA	ENSP00000290921:p.Thr50fs	Somatic	164	0		WXS	Illumina HiSeq	Phase_I	275	80	NM_001328	0	0	0	0	0	Q4W5N3|Q7Z2Q5	Frame_Shift_Del	DEL	ENST00000290921.6	37	CCDS3348.1																																																																																			.		0.657	CTBP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000202938.1	NM_001328	
MAST4	375449	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	66438012	66438022	+	Frame_Shift_Del	DEL	AGGCAGAATTT	AGGCAGAATTT	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	AGGCAGAATTT	AGGCAGAATTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr5:66438012_66438022delAGGCAGAATTT	ENST00000403625.2	+	20	2859_2869	c.2564_2574delAGGCAGAATTT	c.(2563-2574)aaggcagaatttfs	p.KAEF855fs	MAST4_ENST00000261569.7_Frame_Shift_Del_p.KAEF661fs|MAST4_ENST00000403666.1_Frame_Shift_Del_p.KAEF666fs|MAST4_ENST00000404260.3_Frame_Shift_Del_p.KAEF858fs|MAST4_ENST00000405643.1_Frame_Shift_Del_p.KAEF676fs	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	858	AGC-kinase C-terminal.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CTGAGACAGAAGGCAGAATTTATTCCCCAAC	0.403																																					p.855_858del		.											.	MAST4-647	0			c.2564_2574del						.																																			SO:0001589	frameshift_variant	375449	exon20			.	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2564_2574delAGGCAGAATTT	5.37:g.66438012_66438022delAGGCAGAATTT	ENSP00000385727:p.Lys855fs	Somatic	271	0		WXS	Illumina HiSeq	Phase_I	41	16	NM_001164664	0	0	0	0	0	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Frame_Shift_Del	DEL	ENST00000403625.2	37	CCDS54861.1																																																																																			.		0.403	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
HIST1H2AD	3013	broad.mit.edu	37	6	26199108	26199109	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:26199108_26199109delCA	ENST00000341023.1	-	1	362_363	c.363_364delTG	c.(361-366)actgagfs	p.E122fs	HIST1H3D_ENST00000377831.5_5'UTR|HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	122						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				TGGTGACTCTCAGTCTTCTTGG	0.485																																					p.121_122del													.	HIST1H2AD-90	0			c.363_364del						.																																			SO:0001589	frameshift_variant	3013	exon1			GACTCTCAGTCTT	Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.363_364delTG	6.37:g.26199108_26199109delCA	ENSP00000341094:p.Glu122fs	Somatic	188	0		WXS	Illumina HiSeq	Phase_I	281	26	NM_021065	0	0	0	0	0	A0PK91|P57754|Q6FGY6	Frame_Shift_Del	DEL	ENST00000341023.1	37	CCDS4591.1																																																																																			.		0.485	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040100.1	NM_021065	
BTN3A2	11118	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	26370805	26370805	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr6:26370805delA	ENST00000356386.2	+	5	877	c.689delA	c.(688-690)gaafs	p.E230fs	BTN3A2_ENST00000396948.1_Frame_Shift_Del_p.E230fs|BTN3A2_ENST00000508906.2_Frame_Shift_Del_p.E188fs|BTN3A2_ENST00000527422.1_Frame_Shift_Del_p.E230fs|BTN3A2_ENST00000532994.1_3'UTR|BTN3A2_ENST00000377708.2_Frame_Shift_Del_p.E230fs|BTN3A2_ENST00000396934.3_Frame_Shift_Del_p.E207fs	NM_001197246.2|NM_001197247.1|NM_007047.3	NP_001184175.1|NP_001184176.1|NP_008978.2	P78410	BT3A2_HUMAN	butyrophilin, subfamily 3, member A2	230					interferon-gamma secretion (GO:0072643)|T cell mediated immunity (GO:0002456)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)	10						CTCGGCCTGGAAAAGACAGCC	0.522																																					p.E230fs		.											.	BTN3A2-90	0			c.689delA						.						105.0	103.0	103.0					6																	26370805		2203	4300	6503	SO:0001589	frameshift_variant	11118	exon3			.	U90546	CCDS4605.1, CCDS56399.1, CCDS56400.1	6p22.1	2014-01-14			ENSG00000186470	ENSG00000186470		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1139	protein-coding gene	gene with protein product		613594				9149941	Standard	NM_007047		Approved	BTN3.2	uc010jqi.2	P78410	OTTHUMG00000014450	ENST00000356386.2:c.689delA	6.37:g.26370805delA	ENSP00000348751:p.Glu230fs	Somatic	253	0		WXS	Illumina HiSeq	Phase_I	196	70	NM_001197246	0	0	0	0	0	B4DRT7|B4E103|F5H791|F8W6E0|O00477|O15338|O75658|Q76PA0|Q9BU81|Q9NR44	Frame_Shift_Del	DEL	ENST00000356386.2	37	CCDS4605.1																																																																																			.		0.522	BTN3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040113.2		
PRB2	653247	broad.mit.edu	37	12	11546691	11546692	+	In_Frame_Ins	INS	-	-	TTG			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr12:11546691_11546692insTTG	ENST00000389362.4	-	3	355_356	c.320_321insCAA	c.(319-321)aag>aaCAAg	p.106_107insN	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	106	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GACTTCGGGACTTGTCTCCTTG	0.604																																					p.K107delinsNK													.	PRB2-22	0			c.321_322insCAA						.																																			SO:0001652	inframe_insertion	653247	exon3			TCGGGACTTGTCT	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.318_320dupCAA	12.37:g.11546692_11546694dupTTG	ENSP00000374013:p.Asp106_Lys107insAsn	Somatic	1175	0		WXS	Illumina HiSeq	Phase_I	2149	7	NM_006248	0	0	0	0	0	O00599|P02811|P04281	In_Frame_Ins	INS	ENST00000389362.4	37	CCDS41757.2																																																																																			.		0.604	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
ERF	2077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	42752789	42752790	+	In_Frame_Ins	INS	-	-	AAA			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr19:42752789_42752790insAAA	ENST00000222329.4	-	4	1631_1632	c.1474_1475insTTT	c.(1474-1476)tgt>tTTTgt	p.491_492insF	ERF_ENST00000595941.1_5'Flank|ERF_ENST00000440177.2_In_Frame_Ins_p.416_417insF|AC006486.9_ENST00000594664.1_Intron	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	491					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				TTCGAGGCGACAGTCTTCACTC	0.698																																					p.C492delinsFC		.											.	ERF-658	0			c.1475_1476insTTT						.																																			SO:0001652	inframe_insertion	2077	exon4			.	U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.1474_1475insTTT	19.37:g.42752789_42752790insAAA	ENSP00000222329:p.Asp491_Cys492insPhe	Somatic	190	0		WXS	Illumina HiSeq	Phase_I	249	60	NM_006494	0	0	0	0	0	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	In_Frame_Ins	INS	ENST00000222329.4	37	CCDS12600.1																																																																																			.		0.698	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463684.1	NM_006494	
MAGI2	9863	broad.mit.edu	37	7	79082570	79082571	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr7:79082570_79082571insC	ENST00000354212.4	-	1	319_320	c.66_67insG	c.(64-69)aggaacfs	p.N23fs	MAGI2-AS3_ENST00000446159.1_RNA|MAGI2-AS3_ENST00000422093.1_RNA|MAGI2_ENST00000522391.1_Frame_Shift_Ins_p.N23fs|MAGI2-AS3_ENST00000426835.1_RNA|MAGI2-AS3_ENST00000451809.1_RNA|MAGI2-AS3_ENST00000414797.1_RNA|MAGI2_ENST00000419488.1_Frame_Shift_Ins_p.N23fs|MAGI2-AS3_ENST00000429408.1_RNA|MAGI2-AS3_ENST00000424477.1_RNA|MAGI2-AS3_ENST00000448195.1_RNA	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	23	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CCCTCCGGGTTCCTGCCAATGA	0.589																																					p.N23fs													.	MAGI2-461	0			c.67_68insG						.																																			SO:0001589	frameshift_variant	9863	exon1			CCGGGTTCCTGCC	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.67dupG	7.37:g.79082572_79082572dupC	ENSP00000346151:p.Asn23fs	Somatic	347	0		WXS	Illumina HiSeq	Phase_I	916	7	NM_012301	0	0	0	0	0	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Frame_Shift_Ins	INS	ENST00000354212.4	37	CCDS5594.1																																																																																			.		0.589	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
ATP11A	23250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	113516824	113516825	+	Missense_Mutation	DNP	GC	GC	AG	rs140812688		TCGA-B9-4115-01A-01D-1252-08	TCGA-B9-4115-10A-01D-1252-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1c21a098-a845-4933-9153-f44ea58bb752	50da5c23-8dd6-49bd-8316-9d1438d89ee8	g.chr13:113516824_113516825GC>AG	ENST00000487903.1	+	25	3014_3015	c.2926_2927GC>AG	c.(2926-2928)GCa>AGa	p.A976R	ATP11A_ENST00000375630.2_Missense_Mutation_p.A976R|ATP11A_ENST00000283558.8_Missense_Mutation_p.A976R|ATP11A_ENST00000375645.3_Missense_Mutation_p.A976R			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	976					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				ACTGTTTGACGCACTGGTGTTC	0.535																																					p.A976R		.											.	ATP11A	0			c.C2927G						.																																			SO:0001583	missense	23250	exon25			TTGACGCACTGGT	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	Exception_encountered	13.37:g.113516824_113516825delinsAG	ENSP00000420387:p.Ala976Arg	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	38.0		0	0	0	0	0	Q5VXT2	Missense_Mutation	DNP	ENST00000487903.1	37	CCDS32011.1																																																																																			.		0.535	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	
