#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATAD3C	219293	bcgsc.ca	37	1	1392552	1392552	+	Missense_Mutation	SNP	C	C	G	rs373927712		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:1392552C>G	ENST00000378785.2	+	8	1728	c.733C>G	c.(733-735)Cga>Gga	p.R245G		NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	245							ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCTTCGGAAGCGAGCCACTGT	0.627																																					p.R245G													.	.	0			c.C733G						.						42.0	42.0	42.0					1																	1392552		692	1591	2283	SO:0001583	missense	219293	exon8			CGGAAGCGAGCCA	AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.733C>G	1.37:g.1392552C>G	ENSP00000368062:p.Arg245Gly	Somatic	97	0		WXS	Illumina HiSeq	Phase_1	142	78	NM_001039211	0	0	0	0	0	Q8N1Z5	Missense_Mutation	SNP	ENST00000378785.2	37	CCDS44039.1	.	.	.	.	.	.	.	.	.	.	.	8.578	0.881656	0.17467	.	.	ENSG00000215915	ENST00000378785	T	0.77750	-1.12	2.51	0.459	0.16678	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.90390	0.6992	H	0.97365	3.99	0.50813	D	0.999897	D	0.76494	0.999	D	0.77557	0.99	D	0.89146	0.3520	10	0.87932	D	0	.	9.7739	0.40607	0.7125:0.2875:0.0:0.0	.	245	Q5T2N8	ATD3C_HUMAN	G	245	ENSP00000368062:R245G	ENSP00000368062:R245G	R	+	1	2	ATAD3C	1382415	1.000000	0.71417	0.462000	0.27118	0.006000	0.05464	0.868000	0.27982	-0.126000	0.11682	-1.075000	0.02238	CGA	.		0.627	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001279.3	NM_001039211	
PANK4	55229	bcgsc.ca	37	1	2447128	2447128	+	Missense_Mutation	SNP	T	T	C	rs202214872		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:2447128T>C	ENST00000378466.3	-	10	1259	c.1247A>G	c.(1246-1248)gAg>gGg	p.E416G	PANK4_ENST00000435556.3_Missense_Mutation_p.E377G	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	416					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CAGTGGCCTCTCCAGCCGGTC	0.602																																					p.E416G													.	PANK4-158	0			c.A1247G						.																																			SO:0001583	missense	55229	exon10			GGCCTCTCCAGCC	AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1247A>G	1.37:g.2447128T>C	ENSP00000367727:p.Glu416Gly	Somatic	60	0		WXS	Illumina HiSeq	Phase_1	103	40	NM_018216	0	0	1	1	0	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	ENST00000378466.3	37	CCDS42.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459228	0.63401	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	T;T	0.14391	2.51;2.51	5.35	4.22	0.49857	Domain of unknown function DUF89 (1);	0.048156	0.85682	D	0.000000	T	0.19406	0.0466	M	0.74881	2.28	0.80722	D	1	B;B	0.26602	0.154;0.154	B;B	0.28638	0.092;0.092	T	0.01781	-1.1275	10	0.59425	D	0.04	-31.2138	11.5607	0.50774	0.0:0.0:0.1597:0.8403	.	377;416	E9PHT6;Q9NVE7	.;PANK4_HUMAN	G	416;377	ENSP00000367727:E416G;ENSP00000421433:E377G	ENSP00000367727:E416G	E	-	2	0	PANK4	2436988	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.724000	0.68500	0.873000	0.35799	0.459000	0.35465	GAG	.		0.602	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002082.1		
RERE	473	broad.mit.edu	37	1	8420609	8420609	+	Silent	SNP	T	T	G	rs578199349		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:8420609T>G	ENST00000337907.3	-	19	3592	c.2958A>C	c.(2956-2958)ccA>ccC	p.P986P	RERE_ENST00000400907.2_Intron|RERE_ENST00000377464.1_Silent_p.P718P|RERE_ENST00000400908.2_Silent_p.P986P|RERE_ENST00000476556.1_Silent_p.P432P	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	986	Pro-rich.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P986P(4)		central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTTGCAGGGGTGGGGGGTGAG	0.706																																					p.P986P													.	RERE-515	4	Substitution - coding silent(4)	kidney(2)|prostate(1)|lung(1)	c.A2958C						.						11.0	14.0	13.0					1																	8420609		1946	3883	5829	SO:0001819	synonymous_variant	473	exon19			CAGGGGTGGGGGG	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.2958A>C	1.37:g.8420609T>G		Somatic	18	0		WXS	Illumina HiSeq	Phase_I	123	28	NM_012102	0	0	14	15	1	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Silent	SNP	ENST00000337907.3	37	CCDS95.1																																																																																			.		0.706	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
VPS13D	55187	ucsc.edu;bcgsc.ca	37	1	12337404	12337404	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:12337404C>A	ENST00000358136.3	+	19	3889	c.3759C>A	c.(3757-3759)taC>taA	p.Y1253*	VPS13D_ENST00000356315.4_Nonsense_Mutation_p.Y1253*	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ATATTGGCTACTTTGAATCTG	0.383																																					p.Y1253X													.	VPS13D-95	0			c.C3759A						.						146.0	150.0	148.0					1																	12337404		2203	4300	6503	SO:0001587	stop_gained	55187	exon19			TGGCTACTTTGAA	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.3759C>A	1.37:g.12337404C>A	ENSP00000350854:p.Tyr1253*	Somatic	180	0		WXS	Illumina HiSeq		194	43	NM_015378	0	0	5	5	0		Nonsense_Mutation	SNP	ENST00000358136.3	37	CCDS30588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.341252|10.341252	0.99387|0.99387	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000011700|ENST00000356315;ENST00000358136	.|.	.|.	.|.	5.91|5.91	4.99|4.99	0.66335|0.66335	.|.	.|0.787241	.|0.11696	.|N	.|0.538439	T|.	0.63165|.	0.2488|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.55114|.	-0.8191|.	4|.	.|.	.|.	.|.	.|.	11.3031|11.3031	0.49318|0.49318	0.0:0.8535:0.0:0.1465|0.0:0.8535:0.0:0.1465	.|.	.|.	.|.	.|.	N|X	76|1253	.|.	.|.	T|Y	+|+	2|3	0|2	VPS13D|VPS13D	12259991|12259991	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.993000|0.993000	0.82548|0.82548	0.947000|0.947000	0.29082|0.29082	1.471000|1.471000	0.48121|0.48121	0.655000|0.655000	0.94253|0.94253	ACT|TAC	.		0.383	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
PLA2G2A	5320	bcgsc.ca	37	1	20304929	20304929	+	Silent	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:20304929G>A	ENST00000375111.3	-	4	400	c.129C>T	c.(127-129)ttC>ttT	p.F43F	PLA2G2A_ENST00000496748.1_5'UTR|PLA2G2A_ENST00000400520.3_Silent_p.F43F	NM_000300.3|NM_001161727.1	NP_000291.1|NP_001155199.1	P14555	PA2GA_HUMAN	phospholipase A2, group IIA (platelets, synovial fluid)	43					defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of epithelial cell proliferation (GO:0050680)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidic acid metabolic process (GO:0046473)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|small molecule metabolic process (GO:0044281)|somatic stem cell maintenance (GO:0035019)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|phospholipase A2 activity (GO:0004623)|phospholipid binding (GO:0005543)			central_nervous_system(1)|lung(6)|prostate(1)|stomach(1)	9		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000138)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.00032)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Diclofenac(DB00586)|Ginkgo biloba(DB01381)|Indomethacin(DB00328)|Suramin(DB04786)	GGCAGCCGTAGAAGCCATAAC	0.562																																					p.F43F													.	PLA2G2A-650	0			c.C129T						.						42.0	46.0	45.0					1																	20304929		2203	4300	6503	SO:0001819	synonymous_variant	5320	exon3			GCCGTAGAAGCCA	BC005919	CCDS201.1	1p35	2008-09-19			ENSG00000188257	ENSG00000188257	3.1.1.4		9031	protein-coding gene	gene with protein product		172411		PLA2B, PLA2L		8838795	Standard	NM_000300		Approved		uc010odb.2	P14555	OTTHUMG00000002699	ENST00000375111.3:c.129C>T	1.37:g.20304929G>A		Somatic	39	0		WXS	Illumina HiSeq	Phase_1	66	39	NM_001161729	0	0	0	0	0	A8K5I7|Q6DN24|Q6IBD9|Q9UCD2	Silent	SNP	ENST00000375111.3	37	CCDS201.1																																																																																			.		0.562	PLA2G2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007675.1	NM_000300	
PHC2	1912	bcgsc.ca	37	1	33832972	33832972	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:33832972T>G	ENST00000257118.5	-	6	774	c.721A>C	c.(721-723)Acc>Ccc	p.T241P	PHC2_ENST00000431992.1_Missense_Mutation_p.T212P|PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000419414.2_Missense_Mutation_p.T241P	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	241					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGAGTGGGGGTGGGGCCCGAG	0.632											OREG0013344	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T241P													.	PHC2-227	0			c.A721C						.						69.0	92.0	84.0					1																	33832972		2195	4292	6487	SO:0001583	missense	1912	exon6			TGGGGGTGGGGCC	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.721A>C	1.37:g.33832972T>G	ENSP00000257118:p.Thr241Pro	Somatic	220	3	843	WXS	Illumina HiSeq	Phase_1	375	80	NM_198040	0	0	3	3	0	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	37	CCDS378.1	.	.	.	.	.	.	.	.	.	.	T	11.86	1.763690	0.31228	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000419414	T;T;T	0.32272	1.86;1.46;1.87	5.74	-5.55	0.02536	.	0.703679	0.13425	N	0.388856	T	0.14442	0.0349	L	0.29908	0.895	0.38372	D	0.944898	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.11060	-1.0603	10	0.23891	T	0.37	-2.7256	4.1957	0.10441	0.2228:0.0732:0.4939:0.2101	.	241;212;241	A8KA40;B7ZLY0;Q8IXK0	.;.;PHC2_HUMAN	P	212;241;241	ENSP00000389436:T212P;ENSP00000257118:T241P;ENSP00000391440:T241P	ENSP00000257118:T241P	T	-	1	0	PHC2	33605559	0.001000	0.12720	0.470000	0.27216	0.960000	0.62799	-0.911000	0.04050	-0.880000	0.03997	-0.331000	0.08364	ACC	.		0.632	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
ZMYM4	9202	bcgsc.ca	37	1	35870649	35870649	+	Missense_Mutation	SNP	T	T	G	rs200301387		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:35870649T>G	ENST00000314607.6	+	24	3634	c.3554T>G	c.(3553-3555)gTg>gGg	p.V1185G	ZMYM4_ENST00000373297.2_Missense_Mutation_p.V1096G	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	1185					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ATAGTGGCTGTGGAGCCCAGG	0.423																																					p.V1185G													.	ZMYM4-291	0			c.T3554G						.						64.0	75.0	71.0					1																	35870649		2203	4300	6503	SO:0001583	missense	9202	exon24			TGGCTGTGGAGCC	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.3554T>G	1.37:g.35870649T>G	ENSP00000322915:p.Val1185Gly	Somatic	115	0		WXS	Illumina HiSeq	Phase_1	61	25	NM_005095	0	0	11	11	0	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.54|14.54	2.565382|2.565382	0.45694|0.45694	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000457946|ENST00000314607;ENST00000373297	.|T;T	.|0.24908	.|1.83;1.86	5.95|5.95	3.29|3.29	0.37713|0.37713	.|.	.|0.583284	.|0.17804	.|N	.|0.161469	T|T	0.15782|0.15782	0.0380|0.0380	N|N	0.24115|0.24115	0.695|0.695	0.58432|0.58432	D|D	0.999998|0.999998	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.06162|0.06162	-1.0842|-1.0842	5|10	.|0.23302	.|T	.|0.38	-2.5928|-2.5928	9.5722|9.5722	0.39436|0.39436	0.0:0.0707:0.1226:0.8067|0.0:0.0707:0.1226:0.8067	.|.	.|1185	.|Q5VZL5	.|ZMYM4_HUMAN	W|G	843|1185;1096	.|ENSP00000322915:V1185G;ENSP00000362394:V1096G	.|ENSP00000322915:V1185G	C|V	+|+	3|2	2|0	ZMYM4|ZMYM4	35643236|35643236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.443000|4.443000	0.59994|0.59994	1.059000|1.059000	0.40554|0.40554	0.533000|0.533000	0.62120|0.62120	TGT|GTG	.		0.423	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
FHL3	2275	bcgsc.ca	37	1	38463740	38463740	+	Missense_Mutation	SNP	A	A	C	rs201163097		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:38463740A>C	ENST00000373016.3	-	4	564	c.396T>G	c.(394-396)tgT>tgG	p.C132W	FHL3_ENST00000485803.1_5'UTR	NM_001243878.1|NM_004468.4	NP_001230807.1|NP_004459.2	Q13643	FHL3_HUMAN	four and a half LIM domains 3	132	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|muscle organ development (GO:0007517)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)|Z disc (GO:0030018)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GTGGCTGTTCACAGCCACTGC	0.587																																					p.C132W													.	FHL3-90	0			c.T396G						.						67.0	70.0	69.0					1																	38463740		2203	4300	6503	SO:0001583	missense	2275	exon4			CTGTTCACAGCCA	BC011697	CCDS30678.1	1p34.3	2008-02-05			ENSG00000183386	ENSG00000183386			3704	protein-coding gene	gene with protein product		602790				8753811, 10226657	Standard	NM_004468		Approved	SLIM2	uc001cck.3	Q13643	OTTHUMG00000004434	ENST00000373016.3:c.396T>G	1.37:g.38463740A>C	ENSP00000362107:p.Cys132Trp	Somatic	142	0		WXS	Illumina HiSeq	Phase_1	190	80	NM_004468	0	0	9	9	0	D3DPT6|Q6I9T0|Q9BVA2	Missense_Mutation	SNP	ENST00000373016.3	37	CCDS30678.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.539010	0.45176	.	.	ENSG00000183386	ENST00000373016	D	0.99898	-7.61	5.2	2.87	0.33458	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.99923	0.9964	H	0.99697	4.71	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.97083	0.9785	10	0.87932	D	0	.	7.1369	0.25533	0.594:0.0:0.406:0.0	.	132;24;132	Q9P100;Q96C98;Q13643	.;.;FHL3_HUMAN	W	132	ENSP00000362107:C132W	ENSP00000362107:C132W	C	-	3	2	FHL3	38236327	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	1.690000	0.37711	0.313000	0.23062	-0.609000	0.04063	TGT	.		0.587	FHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012958.1	NM_004468	
MACF1	23499	bcgsc.ca	37	1	39845028	39845028	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:39845028A>G	ENST00000372915.3	+	53	13532	c.13445A>G	c.(13444-13446)gAa>gGa	p.E4482G	MACF1_ENST00000567887.1_Missense_Mutation_p.E4514G|MACF1_ENST00000289893.4_Missense_Mutation_p.E2917G|MACF1_ENST00000317713.7_Missense_Mutation_p.E2415G|MACF1_ENST00000545844.1_Missense_Mutation_p.E2415G|MACF1_ENST00000361689.2_Missense_Mutation_p.E2415G|MACF1_ENST00000564288.1_Missense_Mutation_p.E4477G|MACF1_ENST00000539005.1_Missense_Mutation_p.E2394G			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4482					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGTGGCTGGAATCAAAAGAG	0.478																																					p.E2415G													.	MACF1-165	0			c.A7244G						.						218.0	217.0	217.0					1																	39845028		2203	4300	6503	SO:0001583	missense	23499	exon50			GGCTGGAATCAAA	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.13445A>G	1.37:g.39845028A>G	ENSP00000362006:p.Glu4482Gly	Somatic	342	0		WXS	Illumina HiSeq	Phase_1	160	61	NM_012090	0	0	6	6	0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	A	13.56	2.275133	0.40194	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000006	T	0.47710	0.1460	L	0.43152	1.355	0.80722	D	1	B;B;B	0.23650	0.089;0.019;0.043	B;B;B	0.32864	0.154;0.088;0.088	T	0.42649	-0.9439	10	0.56958	D	0.05	.	16.6244	0.84952	1.0:0.0:0.0:0.0	.	4482;2415;2359	Q9UPN3;F8W8Q1;Q9UPN3-3	MACF1_HUMAN;.;.	G	2415;4482;2415;2415;2394;2917	ENSP00000439537:E2415G;ENSP00000362006:E4482G;ENSP00000354573:E2415G;ENSP00000313438:E2415G;ENSP00000444364:E2394G;ENSP00000289893:E2917G	ENSP00000289893:E2917G	E	+	2	0	MACF1	39617615	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.140000	0.50585	2.323000	0.78572	0.529000	0.55759	GAA	.		0.478	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
NSUN4	387338	bcgsc.ca	37	1	46806506	46806506	+	Missense_Mutation	SNP	C	C	G	rs201083296		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:46806506C>G	ENST00000474844.1	+	1	658	c.8C>G	c.(7-9)gCg>gGg	p.A3G	NSUN4_ENST00000536062.1_5'UTR|NSUN4_ENST00000537428.1_5'Flank	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4	3					rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					GATATGGCTGCGCTGACACTG	0.647											OREG0013456	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A3G													.	NSUN4-90	0			c.C8G						.						19.0	19.0	19.0					1																	46806506		2201	4298	6499	SO:0001583	missense	387338	exon1			TGGCTGCGCTGAC	AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.8C>G	1.37:g.46806506C>G	ENSP00000419740:p.Ala3Gly	Somatic	25	0	942	WXS	Illumina HiSeq	Phase_1	42	24	NM_199044	0	0	5	10	5	A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	Missense_Mutation	SNP	ENST00000474844.1	37	CCDS534.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332602	0.81801	.	.	ENSG00000117481	ENST00000474844	T	0.16073	2.37	4.24	3.33	0.38152	.	0.669658	0.14376	N	0.323467	T	0.30448	0.0765	M	0.63428	1.95	0.80722	D	1	D	0.69078	0.997	P	0.55260	0.772	T	0.04915	-1.0918	10	0.87932	D	0	-5.8034	10.7377	0.46135	0.0:0.9052:0.0:0.0948	.	3	Q96CB9	NSUN4_HUMAN	G	3	ENSP00000419740:A3G	ENSP00000419740:A3G	A	+	2	0	NSUN4	46579093	0.972000	0.33761	0.988000	0.46212	0.090000	0.18270	2.382000	0.44345	1.006000	0.39211	-0.339000	0.08088	GCG	.		0.647	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021427.1	NM_199044	
DOCK7	85440	bcgsc.ca	37	1	62923219	62923219	+	Missense_Mutation	SNP	T	T	G	rs200939372		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:62923219T>G	ENST00000340370.5	-	48	6294	c.6277A>C	c.(6277-6279)Acc>Ccc	p.T2093P	DOCK7_ENST00000251157.5_Missense_Mutation_p.T2113P	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	2124	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CTGTGGCAGGTGACAGGCAAT	0.408																																					p.T2113P													.	DOCK7-92	0			c.A6337C						.																																			SO:0001583	missense	85440	exon48			GGCAGGTGACAGG		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.6277A>C	1.37:g.62923219T>G	ENSP00000340742:p.Thr2093Pro	Somatic	105	1		WXS	Illumina HiSeq	Phase_1	83	51	NM_001271999	0	0	0	0	0	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	CCDS30734.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.13|13.13	2.145093|2.145093	0.37825|0.37825	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370	.|T;T	.|0.14640	.|2.5;2.49	5.99|5.99	3.51|3.51	0.40186|0.40186	.|.	.|0.939062	.|0.09139	.|N	.|0.843193	T|T	0.06917|0.06917	0.0176|0.0176	N|N	0.04880|0.04880	-0.145|-0.145	0.42996|0.42996	D|D	0.994508|0.994508	.|B;B;B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0;0.0;0.0	.|B;B;B;B;B;B	.|0.08055	.|0.003;0.001;0.001;0.001;0.003;0.002	T|T	0.21895|0.21895	-1.0232|-1.0232	5|10	.|0.35671	.|T	.|0.21	.|.	6.1776|6.1776	0.20453|0.20453	0.252:0.0677:0.0:0.6803|0.252:0.0677:0.0:0.6803	.|.	.|2124;2113;2093;2082;2084;2115	.|Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.|DOCK7_HUMAN;.;.;.;.;.	P|P	1286|2124;2113;2093	.|ENSP00000251157:T2113P;ENSP00000340742:T2093P	.|ENSP00000251157:T2113P	H|T	-|-	2|1	0|0	DOCK7|DOCK7	62695807|62695807	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	0.530000|0.530000	0.23036|0.23036	1.049000|1.049000	0.40321|0.40321	0.533000|0.533000	0.62120|0.62120	CAC|ACC	.		0.408	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
ALG6	29929	bcgsc.ca	37	1	63877638	63877638	+	Missense_Mutation	SNP	C	C	T	rs76393703		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:63877638C>T	ENST00000371108.4	+	9	1027	c.722C>T	c.(721-723)tCc>tTc	p.S241F	ALG6_ENST00000263440.4_Missense_Mutation_p.S243F	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase	241					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)			endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						GTTGTGGCTTCCTTCGTTCTC	0.423																																					p.S241F													.	ALG6-90	0			c.C722T						.						225.0	206.0	212.0					1																	63877638		2203	4300	6503	SO:0001583	missense	29929	exon9			TGGCTTCCTTCGT	AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.722C>T	1.37:g.63877638C>T	ENSP00000360149:p.Ser241Phe	Somatic	116	0		WXS	Illumina HiSeq	Phase_1	50	17	NM_013339	0	0	4	4	0	B3KMU2|Q5SXR9|Q9H3I0	Missense_Mutation	SNP	ENST00000371108.4	37	CCDS30735.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.985448	0.93044	.	.	ENSG00000088035	ENST00000371108;ENST00000263440;ENST00000423077	D;D	0.83673	-1.75;-1.75	5.25	5.25	0.73442	.	0.106321	0.64402	D	0.000004	D	0.89681	0.6785	M	0.75615	2.305	0.80722	D	1	D;P	0.71674	0.998;0.907	D;P	0.68943	0.961;0.811	D	0.90250	0.4293	10	0.72032	D	0.01	-16.6467	19.242	0.93888	0.0:1.0:0.0:0.0	.	40;243	B4DHV8;A2A2G4	.;.	F	241;243;40	ENSP00000360149:S241F;ENSP00000263440:S243F	ENSP00000263440:S243F	S	+	2	0	ALG6	63650226	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	6.702000	0.74628	2.611000	0.88343	0.655000	0.94253	TCC	.		0.423	ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025330.2	NM_013339	
SGIP1	84251	bcgsc.ca	37	1	67154849	67154849	+	Missense_Mutation	SNP	G	G	C	rs542858072	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:67154849G>C	ENST00000371037.4	+	16	1411	c.1334G>C	c.(1333-1335)cGa>cCa	p.R445P	SGIP1_ENST00000371039.1_Missense_Mutation_p.R246P|SGIP1_ENST00000237247.6_Missense_Mutation_p.R476P|SGIP1_ENST00000371035.3_Missense_Mutation_p.R235P|SGIP1_ENST00000371036.3_Missense_Mutation_p.R245P	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	445	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						TCCCCTGCTCGACCAGCCACT	0.542													G|||	98	0.0195687	0.0129	0.0389	5008	,	,		16946	0.0218		0.0318	False		,,,				2504	0.0				p.R445P													.	SGIP1-93	0			c.G1334C						.						212.0	215.0	214.0					1																	67154849		2203	4300	6503	SO:0001583	missense	84251	exon16			CTGCTCGACCAGC	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1334G>C	1.37:g.67154849G>C	ENSP00000360076:p.Arg445Pro	Somatic	436	3		WXS	Illumina HiSeq	Phase_1	247	59	NM_032291	0	0	1	1	0	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138696	0.77775	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037	T;T;T;T;T	0.03094	4.05;4.05;4.05;4.05;4.05	6.17	6.17	0.99709	.	0.125931	0.56097	D	0.000029	T	0.13157	0.0319	M	0.70275	2.135	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.996;0.996;0.999	D;D;D;D	0.81914	0.995;0.979;0.979;0.995	T	0.00292	-1.1842	10	0.54805	T	0.06	-10.234	19.6509	0.95805	0.0:0.0:1.0:0.0	.	475;45;235;445	A6NEV3;B3KR01;B7Z5H8;Q9BQI5	.;.;.;SGIP1_HUMAN	P	476;246;235;475;448;245;445	ENSP00000237247:R476P;ENSP00000360078:R246P;ENSP00000360074:R235P;ENSP00000360075:R245P;ENSP00000360076:R445P	ENSP00000237247:R476P	R	+	2	0	SGIP1	66927437	1.000000	0.71417	1.000000	0.80357	0.353000	0.29299	8.648000	0.91062	2.941000	0.99782	0.655000	0.94253	CGA	.		0.542	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4	NM_032291	
FRRS1	391059	bcgsc.ca	37	1	100194174	100194174	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:100194174C>A	ENST00000414213.1	-	9	1482	c.881G>T	c.(880-882)tGg>tTg	p.W294L	FRRS1_ENST00000287474.5_Missense_Mutation_p.W294L			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	294	DOMON. {ECO:0000255|PROSITE- ProRule:PRU00246}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		CGCCAACCTCCAAGCCATATC	0.388																																					p.W294L													.	FRRS1-91	0			c.G881T						.						98.0	96.0	97.0					1																	100194174		2203	4300	6503	SO:0001583	missense	391059	exon9			AACCTCCAAGCCA	AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.881G>T	1.37:g.100194174C>A	ENSP00000393884:p.Trp294Leu	Somatic	135	0		WXS	Illumina HiSeq	Phase_1	94	43	NM_001013660	0	0	0	0	0	A6NLN7	Missense_Mutation	SNP	ENST00000414213.1	37		.	.	.	.	.	.	.	.	.	.	C	25.6	4.650467	0.87958	.	.	ENSG00000156869	ENST00000414213;ENST00000287474	T;T	0.75260	-0.92;-0.92	5.18	5.18	0.71444	.	0.062752	0.64402	D	0.000001	T	0.65207	0.2669	L	0.54323	1.7	0.80722	D	1	P	0.46395	0.877	P	0.47470	0.548	T	0.65664	-0.6113	10	0.09590	T	0.72	-9.2222	18.684	0.91557	0.0:1.0:0.0:0.0	.	294	Q6ZNA5-2	.	L	294	ENSP00000393884:W294L;ENSP00000287474:W294L	ENSP00000287474:W294L	W	-	2	0	FRRS1	99966762	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	5.970000	0.70431	2.411000	0.81874	0.484000	0.47621	TGG	.		0.388	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001013660	
CLCC1	23155	bcgsc.ca	37	1	109486197	109486197	+	Missense_Mutation	SNP	G	G	T	rs201600225	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:109486197G>T	ENST00000369971.2	-	6	731	c.602C>A	c.(601-603)aCt>aAt	p.T201N	CLCC1_ENST00000356970.2_Missense_Mutation_p.T201N|CLCC1_ENST00000369976.1_Missense_Mutation_p.T201N|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000348264.2_Intron|CLCC1_ENST00000369970.3_Missense_Mutation_p.T151N|CLCC1_ENST00000369969.2_Intron|CLCC1_ENST00000415331.1_Missense_Mutation_p.T151N|CLCC1_ENST00000482889.1_5'UTR|CLCC1_ENST00000369968.2_Intron|CLCC1_ENST00000302500.4_Intron	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	201						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		CCACAGCTCAGTAGCCACTAA	0.393													G|||	4	0.000798722	0.0	0.0014	5008	,	,		19132	0.002		0.001	False		,,,				2504	0.0				p.T201N													.	CLCC1-91	0			c.C602A						.						100.0	105.0	103.0					1																	109486197		2203	4300	6503	SO:0001583	missense	23155	exon6			AGCTCAGTAGCCA	AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.602C>A	1.37:g.109486197G>T	ENSP00000358988:p.Thr201Asn	Somatic	104	0		WXS	Illumina HiSeq	Phase_1	63	24	NM_001048210	0	0	2	2	0	O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	ENST00000369971.2	37	CCDS41362.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.651578	0.67472	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369976;ENST00000369970	T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.67449	0.2894	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.70861	-0.4757	10	0.66056	D	0.02	-17.6869	14.5247	0.67878	0.073:0.0:0.927:0.0	.	151;201	Q96S66-2;Q96S66	.;CLCC1_HUMAN	N	201;201;151;201;151	ENSP00000349456:T201N;ENSP00000358988:T201N;ENSP00000411591:T151N;ENSP00000358993:T201N;ENSP00000358987:T151N	ENSP00000349456:T201N	T	-	2	0	CLCC1	109287720	1.000000	0.71417	0.929000	0.37066	0.628000	0.37860	4.214000	0.58527	2.616000	0.88540	0.591000	0.81541	ACT	G|0.999;T|0.001		0.393	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032405.1	NM_015127	
FCGR2A	2212	bcgsc.ca	37	1	161480669	161480669	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:161480669T>G	ENST00000271450.6	+	5	703	c.665T>G	c.(664-666)gTg>gGg	p.V222G	RP11-25K21.6_ENST00000537821.2_RNA|FCGR2A_ENST00000367972.4_Missense_Mutation_p.V221G	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	222					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ATTGTGGCTGTGGTCATTGCG	0.512																																					p.V222G													.	FCGR2A-91	0			c.T665G						.						232.0	230.0	231.0					1																	161480669		2203	4300	6503	SO:0001583	missense	2212	exon5			TGGCTGTGGTCAT	J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.665T>G	1.37:g.161480669T>G	ENSP00000271450:p.Val222Gly	Somatic	177	0		WXS	Illumina HiSeq	Phase_1	285	161	NM_001136219	0	0	23	26	3	Q8WUN1|Q8WW64	Missense_Mutation	SNP	ENST00000271450.6	37	CCDS44264.1	.	.	.	.	.	.	.	.	.	.	.	12.98	2.101851	0.37048	.	.	ENSG00000143226	ENST00000367972;ENST00000271450	T;T	0.01998	4.51;4.51	2.27	-0.676	0.11361	.	2.881450	0.01271	N	0.009457	T	0.01695	0.0054	L	0.60455	1.87	0.25785	N	0.984687	D;P	0.54601	0.967;0.955	P;P	0.48454	0.576;0.578	T	0.35176	-0.9799	9	0.87932	D	0	.	5.0419	0.14463	0.0:0.5402:0.0:0.4598	.	222;221	P12318;P12318-2	FCG2A_HUMAN;.	G	221;222	ENSP00000356949:V221G;ENSP00000271450:V222G	ENSP00000271450:V222G	V	+	2	0	FCGR2A	159747293	0.000000	0.05858	0.006000	0.13384	0.027000	0.11550	-0.017000	0.12590	-0.155000	0.11098	0.459000	0.35465	GTG	.		0.512	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083318.3	NM_021642	
ASTN1	460	bcgsc.ca	37	1	177030344	177030344	+	Missense_Mutation	SNP	T	T	C	rs201383783		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:177030344T>C	ENST00000367654.3	-	2	552	c.341A>G	c.(340-342)gAg>gGg	p.E114G	ASTN1_ENST00000367657.3_Missense_Mutation_p.E114G|ASTN1_ENST00000361833.2_Missense_Mutation_p.E114G|ASTN1_ENST00000424564.2_Missense_Mutation_p.E114G|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	114					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AGTGCCATTCTCCAGCCACTG	0.517																																					p.E114G													.	ASTN1-319	0			c.A341G						.						181.0	174.0	176.0					1																	177030344		2203	4300	6503	SO:0001583	missense	460	exon2			CCATTCTCCAGCC	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.341A>G	1.37:g.177030344T>C	ENSP00000356626:p.Glu114Gly	Somatic	202	1		WXS	Illumina HiSeq	Phase_1	67	32	NM_004319	0	0	0	0	0	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	T	27.9	4.871764	0.91587	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.25749	1.78;2.19;2.19;1.79	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.48909	0.1526	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.994;0.994	T	0.47209	-0.9135	10	0.87932	D	0	-34.8281	16.2708	0.82618	0.0:0.0:0.0:1.0	.	114;114;114	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	G	114	ENSP00000356629:E114G;ENSP00000354536:E114G;ENSP00000356626:E114G;ENSP00000395041:E114G	ENSP00000354536:E114G	E	-	2	0	ASTN1	175296967	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.897000	0.87356	2.324000	0.78689	0.533000	0.62120	GAG	T|0.999;C|0.001		0.517	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
TOR1AIP2	163590	bcgsc.ca	37	1	179815930	179815930	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:179815930A>C	ENST00000367612.3	-	6	1076	c.689T>G	c.(688-690)gTt>gGt	p.V230G	TOR1AIP2_ENST00000609928.1_Missense_Mutation_p.V230G	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						ACTTGCCACAACAGCCACAAC	0.458																																					p.V230G													.	TOR1AIP2-69	0			c.T689G						.						49.0	56.0	54.0					1																	179815930		2193	4294	6487	SO:0001583	missense	163590	exon7			GCCACAACAGCCA		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.689T>G	1.37:g.179815930A>C	ENSP00000356584:p.Val230Gly	Somatic	116	2		WXS	Illumina HiSeq	Phase_1	60	31	NM_001199260	0	0	2	3	1	Q05BU2	Missense_Mutation	SNP	ENST00000367612.3	37	CCDS1334.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.018627	0.35606	.	.	ENSG00000169905	ENST00000367612	T	0.26223	1.75	5.11	3.99	0.46301	.	0.989056	0.08200	N	0.982513	T	0.25680	0.0625	L	0.33485	1.01	0.18873	N	0.999989	B	0.30937	0.301	B	0.35727	0.209	T	0.35325	-0.9793	10	0.87932	D	0	0.0631	10.3869	0.44145	0.9224:0.0:0.0776:0.0	.	230	Q8NFQ8	TOIP2_HUMAN	G	230	ENSP00000356584:V230G	ENSP00000356584:V230G	V	-	2	0	TOR1AIP2	178082553	0.007000	0.16637	0.001000	0.08648	0.008000	0.06430	2.038000	0.41184	0.803000	0.34113	0.533000	0.62120	GTT	.		0.458	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034	
GLUL	2752	bcgsc.ca	37	1	182354977	182354977	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:182354977T>C	ENST00000331872.6	-	5	1061	c.521A>G	c.(520-522)gAc>gGc	p.D174G	GLUL_ENST00000311223.5_Missense_Mutation_p.D174G|GLUL_ENST00000339526.4_Missense_Mutation_p.D174G|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000417584.2_Missense_Mutation_p.D174G	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	174					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	CTCCACGATGTCCCTGCCATA	0.512																																					p.D174G													.	GLUL-90	0			c.A521G						.						135.0	143.0	141.0					1																	182354977		2203	4300	6503	SO:0001583	missense	2752	exon5			ACGATGTCCCTGC	AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.521A>G	1.37:g.182354977T>C	ENSP00000356537:p.Asp174Gly	Somatic	226	2		WXS	Illumina HiSeq	Phase_1	174	81	NM_001033056	0	0	106	124	18	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	ENST00000331872.6	37	CCDS1344.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.193070|5.193070	0.94960|0.94960	.|.	.|.	ENSG00000135821|ENSG00000135821	ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526|ENST00000435013	D;D;D;D|.	0.87571|.	-2.27;-2.27;-2.27;-2.27|.	5.29|5.29	5.29|5.29	0.74685|0.74685	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);|.	0.145914|.	0.64402|.	D|.	0.000013|.	D|D	0.84120|0.84120	0.5402|0.5402	M|M	0.92412|0.92412	3.305|3.305	0.80722|0.80722	D|D	1|1	D|.	0.71674|.	0.998|.	D|.	0.72075|.	0.976|.	D|D	0.87715|0.87715	0.2569|0.2569	10|6	0.87932|0.59425	D|D	0|0.04	-25.0718|-25.0718	14.0272|14.0272	0.64592|0.64592	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	174|.	P15104|.	GLNA_HUMAN|.	G|A	174|174	ENSP00000356537:D174G;ENSP00000307900:D174G;ENSP00000398320:D174G;ENSP00000344958:D174G|.	ENSP00000307900:D174G|ENSP00000388535:T174A	D|T	-|-	2|1	0|0	GLUL|GLUL	180621600|180621600	1.000000|1.000000	0.71417|0.71417	0.898000|0.898000	0.35279|0.35279	0.981000|0.981000	0.71138|0.71138	7.662000|7.662000	0.83803|0.83803	1.982000|1.982000	0.57802|0.57802	0.528000|0.528000	0.53228|0.53228	GAC|ACA	.		0.512	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091043.1	NM_002065	
TRMT1L	81627	bcgsc.ca	37	1	185112542	185112542	+	Missense_Mutation	SNP	G	G	C	rs369669193		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:185112542G>C	ENST00000367506.5	-	7	1074	c.806C>G	c.(805-807)gCt>gGt	p.A269G	TRMT1L_ENST00000367504.3_Missense_Mutation_p.A113G	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	269	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.				adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						CTCAGCCAAAGCAGCCAATGT	0.353																																					p.A269G													.	TRMT1L-92	0			c.C806G						.						94.0	103.0	100.0					1																	185112542		2203	4300	6503	SO:0001583	missense	81627	exon7			GCCAAAGCAGCCA	AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.806C>G	1.37:g.185112542G>C	ENSP00000356476:p.Ala269Gly	Somatic	149	0		WXS	Illumina HiSeq	Phase_1	47	24	NM_030934	0	0	8	8	0	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Missense_Mutation	SNP	ENST00000367506.5	37	CCDS1366.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350465	0.82132	.	.	ENSG00000121486	ENST00000367504;ENST00000367506	.	.	.	5.34	4.32	0.51571	.	0.056271	0.64402	D	0.000001	T	0.40522	0.1120	L	0.38175	1.15	0.41055	D	0.985335	P	0.39044	0.656	B	0.41894	0.369	T	0.40869	-0.9540	9	0.51188	T	0.08	-13.8742	3.4542	0.07510	0.3709:0.0:0.6291:0.0	.	269	Q7Z2T5	TRM1L_HUMAN	G	113;269	.	ENSP00000356474:A113G	A	-	2	0	TRMT1L	183379165	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.497000	0.60367	2.495000	0.84180	0.591000	0.81541	GCT	.		0.353	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085787.1	NM_030934	
IPO9	55705	bcgsc.ca	37	1	201827623	201827623	+	Missense_Mutation	SNP	G	G	C	rs201551339		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:201827623G>C	ENST00000361565.4	+	12	1339	c.1270G>C	c.(1270-1272)Gca>Cca	p.A424P		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	424					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						CCTGGCTGCTGCAGCCACTCG	0.448																																					p.A424P													.	IPO9-228	0			c.G1270C						.						62.0	75.0	70.0					1																	201827623		2202	4300	6502	SO:0001583	missense	55705	exon12			GCTGCTGCAGCCA	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.1270G>C	1.37:g.201827623G>C	ENSP00000354742:p.Ala424Pro	Somatic	179	0		WXS	Illumina HiSeq	Phase_1	104	75	NM_018085	0	0	14	17	3	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	ENST00000361565.4	37	CCDS1415.1	.	.	.	.	.	.	.	.	.	.	G	35	5.581101	0.96565	.	.	ENSG00000198700	ENST00000361565	T	0.66460	-0.21	5.54	5.54	0.83059	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80144	0.4569	M	0.82323	2.585	0.80722	D	1	P	0.52692	0.955	P	0.56751	0.805	T	0.79797	-0.1652	10	0.36615	T	0.2	-8.4189	16.9815	0.86328	0.0:0.0:1.0:0.0	.	424	Q96P70	IPO9_HUMAN	P	424	ENSP00000354742:A424P	ENSP00000354742:A424P	A	+	1	0	IPO9	200094246	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.451000	0.80668	2.576000	0.86940	0.557000	0.71058	GCA	.		0.448	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085	
FCAMR	83953	bcgsc.ca	37	1	207135670	207135670	+	Missense_Mutation	SNP	C	C	A	rs199611731		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:207135670C>A	ENST00000324852.4	-	5	1014	c.540G>T	c.(538-540)ttG>ttT	p.L180F	FCAMR_ENST00000486178.1_5'Flank|FCAMR_ENST00000400962.3_Missense_Mutation_p.L180F|FCAMR_ENST00000450945.2_Missense_Mutation_p.L180F	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	135					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						TCACCACAAACAAGCCTCTCT	0.517																																					p.L180F	Ovarian(199;1883 2142 16966 44409 45154)												.	FCAMR-91	0			c.G540T						.						105.0	100.0	101.0					1																	207135670		1568	3582	5150	SO:0001583	missense	83953	exon5			CACAAACAAGCCT	AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.540G>T	1.37:g.207135670C>A	ENSP00000316491:p.Leu180Phe	Somatic	95	0		WXS	Illumina HiSeq	Phase_1	122	52	NM_001170631	0	0	10	10	0	Q32M82|Q8WWV5|Q96SA2	Missense_Mutation	SNP	ENST00000324852.4	37	CCDS53468.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997875	0.35226	.	.	ENSG00000162897	ENST00000400962;ENST00000324852;ENST00000450945;ENST00000367087	T;T;T	0.64991	-0.13;-0.13;-0.13	5.6	-2.7	0.06004	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.888450	0.09618	N	0.777967	T	0.71728	0.3374	M	0.63428	1.95	0.21719	N	0.999576	B;D;B;D	0.76494	0.011;0.999;0.364;0.992	B;D;B;D	0.77557	0.009;0.99;0.341;0.944	T	0.63686	-0.6581	10	0.62326	D	0.03	0.0926	8.852	0.35206	0.1144:0.2096:0.6036:0.0724	.	135;155;135;135	Q8WWV6-4;D2KTA8;Q8WWV6-2;Q8WWV6	.;.;.;FCAMR_HUMAN	F	180;180;180;156	ENSP00000383746:L180F;ENSP00000316491:L180F;ENSP00000392707:L180F	ENSP00000316491:L180F	L	-	3	2	FCAMR	205202293	0.001000	0.12720	0.228000	0.23943	0.138000	0.21146	-0.991000	0.03728	-0.452000	0.07087	-0.963000	0.02626	TTG	C|0.999;A|0.001		0.517	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088969.2	NM_032029	
PLXNA2	5362	bcgsc.ca	37	1	208252715	208252715	+	Missense_Mutation	SNP	A	A	C	rs202222167		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:208252715A>C	ENST00000367033.3	-	12	3233	c.2476T>G	c.(2476-2478)Tgc>Ggc	p.C826G		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	826					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TCGCCGCTGCACCAGCCACAC	0.627																																					p.C826G													.	PLXNA2-92	0			c.T2476G						.						33.0	34.0	34.0					1																	208252715		2203	4300	6503	SO:0001583	missense	5362	exon12			CGCTGCACCAGCC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2476T>G	1.37:g.208252715A>C	ENSP00000356000:p.Cys826Gly	Somatic	32	1		WXS	Illumina HiSeq	Phase_1	47	32	NM_025179	0	0	6	7	1	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.912439	0.92178	.	.	ENSG00000076356	ENST00000367033	T	0.31769	1.48	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.65365	0.2684	M	0.92507	3.315	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.75224	-0.3393	10	0.87932	D	0	.	15.7935	0.78388	1.0:0.0:0.0:0.0	.	826	O75051	PLXA2_HUMAN	G	826	ENSP00000356000:C826G	ENSP00000356000:C826G	C	-	1	0	PLXNA2	206319338	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.922000	0.70036	2.125000	0.65367	0.533000	0.62120	TGC	.		0.627	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
LAMB3	3914	hgsc.bcm.edu	37	1	209795956	209795956	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:209795956C>G	ENST00000356082.4	-	18	2760	c.2626G>C	c.(2626-2628)Gcc>Ccc	p.A876P	MIR4260_ENST00000583107.1_RNA|LAMB3_ENST00000391911.1_Missense_Mutation_p.A876P|LAMB3_ENST00000367030.3_Missense_Mutation_p.A876P	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	876	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GAGCGGCTGGCGCTCACCTGG	0.582																																					p.A876P		.											.	LAMB3-156	0			c.G2626C						.						176.0	177.0	177.0					1																	209795956		2203	4300	6503	SO:0001583	missense	3914	exon18			GGCTGGCGCTCAC	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.2626G>C	1.37:g.209795956C>G	ENSP00000348384:p.Ala876Pro	Somatic	319	0		WXS	Illumina HiSeq	Phase_I	865	334	NM_000228	0	0	5	5	0	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869140	0.32977	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.25085	1.82;1.82;1.82	5.56	-2.65	0.06095	.	0.911231	0.09623	N	0.777320	T	0.15998	0.0385	L	0.29908	0.895	0.20196	N	0.999927	B	0.31730	0.337	B	0.26416	0.069	T	0.15521	-1.0434	10	0.30078	T	0.28	.	11.3588	0.49632	0.0:0.363:0.0:0.637	.	876	Q13751	LAMB3_HUMAN	P	876	ENSP00000375778:A876P;ENSP00000348384:A876P;ENSP00000355997:A876P	ENSP00000348384:A876P	A	-	1	0	LAMB3	207862579	0.202000	0.23423	0.922000	0.36590	0.766000	0.43426	-0.483000	0.06536	-0.754000	0.04715	-0.518000	0.04402	GCC	.		0.582	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228	
TRAF5	7188	bcgsc.ca	37	1	211545690	211545690	+	Nonsense_Mutation	SNP	C	C	A	rs200264560		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:211545690C>A	ENST00000261464.5	+	11	1374	c.1320C>A	c.(1318-1320)taC>taA	p.Y440*	TRAF5_ENST00000427925.2_Nonsense_Mutation_p.Y334*|TRAF5_ENST00000336184.2_Nonsense_Mutation_p.Y440*|TRAF5_ENST00000367004.3_Nonsense_Mutation_p.Y440*	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	440	Interaction with EIF2AK2/PKR.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		GCTGTGGCTACCGGCTCTGTG	0.537																																					p.Y440X													.	TRAF5-661	0			c.C1320A						.						78.0	84.0	82.0					1																	211545690		2203	4300	6503	SO:0001587	stop_gained	7188	exon11			TGGCTACCGGCTC	AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.1320C>A	1.37:g.211545690C>A	ENSP00000261464:p.Tyr440*	Somatic	119	0		WXS	Illumina HiSeq	Phase_1	33	10	NM_004619	0	0	9	9	0	B4DIS9|B4E0A2|Q6FHY1	Nonsense_Mutation	SNP	ENST00000261464.5	37	CCDS1497.1	.	.	.	.	.	.	.	.	.	.	C	37	6.095248	0.97276	.	.	ENSG00000082512	ENST00000336184;ENST00000427925;ENST00000261464;ENST00000367004	.	.	.	5.16	2.29	0.28610	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.6191	10.6195	0.45472	0.0:0.791:0.0:0.209	.	.	.	.	X	440;334;440;440	.	ENSP00000261464:Y440X	Y	+	3	2	TRAF5	209612313	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.660000	0.61511	0.291000	0.22468	0.650000	0.86243	TAC	.		0.537	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619	
TP53BP2	7159	bcgsc.ca	37	1	223990474	223990474	+	Missense_Mutation	SNP	A	A	C	rs199538625		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:223990474A>C	ENST00000343537.7	-	8	1246	c.955T>G	c.(955-957)Tgg>Ggg	p.W319G	TP53BP2_ENST00000391879.2_5'Flank|TP53BP2_ENST00000391878.2_Missense_Mutation_p.W190G|TP53BP2_ENST00000498843.1_5'Flank	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	313					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		TTCTTCTTCCACAGCCGGTCC	0.473																																					p.W319G													.	TP53BP2-229	0			c.T955G						.						184.0	182.0	183.0					1																	223990474		2203	4300	6503	SO:0001583	missense	7159	exon8			TCTTCCACAGCCG	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.955T>G	1.37:g.223990474A>C	ENSP00000341957:p.Trp319Gly	Somatic	192	0		WXS	Illumina HiSeq	Phase_1	85	28	NM_001031685	0	0	23	25	2	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	37	CCDS44319.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.082375	0.76528	.	.	ENSG00000143514	ENST00000391878;ENST00000343537	T;T	0.33216	1.42;1.42	5.56	5.56	0.83823	.	0.107477	0.64402	D	0.000002	T	0.53834	0.1821	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.991	D;P	0.80764	0.994;0.874	T	0.53041	-0.8494	10	0.44086	T	0.13	.	15.7073	0.77594	1.0:0.0:0.0:0.0	.	319;313	B4DG66;Q13625	.;ASPP2_HUMAN	G	190;319	ENSP00000375750:W190G;ENSP00000341957:W319G	ENSP00000341957:W319G	W	-	1	0	TP53BP2	222057097	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.500000	0.81588	2.098000	0.63641	0.533000	0.62120	TGG	.		0.473	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
OBSCN	84033	hgsc.bcm.edu	37	1	228559225	228559225	+	Missense_Mutation	SNP	G	G	A	rs200269110	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:228559225G>A	ENST00000422127.1	+	94	20790	c.20746G>A	c.(20746-20748)Gag>Aag	p.E6916K	OBSCN_ENST00000366707.4_Missense_Mutation_p.E4550K|OBSCN_ENST00000570156.2_Missense_Mutation_p.E7873K	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6916					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGGCCTGCGCGAGCCACTGAT	0.746													G|||	34	0.00678914	0.0257	0.0	5008	,	,		12917	0.0		0.0	False		,,,				2504	0.0				p.E7873K		.											.	OBSCN-403	0			c.G23617A						.	G	LYS/GLU	70,3774		0,70,1852	5.0	9.0	8.0		20746	4.4	0.9	1		8	0,8116		0,0,4058	yes	missense	OBSCN	NM_001098623.1	56	0,70,5910	AA,AG,GG		0.0,1.821,0.5853	benign	6916/7969	228559225	70,11890	1922	4058	5980	SO:0001583	missense	84033	exon105			CTGCGCGAGCCAC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.20746G>A	1.37:g.228559225G>A	ENSP00000409493:p.Glu6916Lys	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	13	6	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.35|17.35	3.368034|3.368034	0.61513|0.61513	0.01821|0.01821	0.0|0.0	ENSG00000154358|ENSG00000154358	ENST00000422127;ENST00000366707|ENST00000441106	T;T|T	0.65549|0.72394	-0.16;-0.1|-0.65	4.41|4.41	4.41|4.41	0.53225|0.53225	.|.	.|.	.|.	.|.	.|.	T|T	0.64068|0.64068	0.2565|0.2565	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.72301|0.72301	-0.4334|-0.4334	9|7	0.40728|0.41790	T|T	0.16|0.15	.|.	17.2084|17.2084	0.86924|0.86924	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	6916|.	Q5VST9|.	OBSCN_HUMAN|.	K|Q	6916;4550|1532	ENSP00000409493:E6916K;ENSP00000355668:E4550K|ENSP00000388554:R1532Q	ENSP00000355668:E4550K|ENSP00000388554:R1532Q	E|R	+|+	1|2	0|0	OBSCN|OBSCN	226625848|226625848	0.999000|0.999000	0.42202|0.42202	0.931000|0.931000	0.37212|0.37212	0.040000|0.040000	0.13550|0.13550	2.926000|2.926000	0.48892|0.48892	2.300000|2.300000	0.77407|0.77407	0.555000|0.555000	0.69702|0.69702	GAG|CGA	.		0.746	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2T12	127064	hgsc.bcm.edu	37	1	248458346	248458346	+	Missense_Mutation	SNP	C	C	T	rs149479956	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:248458346C>T	ENST00000317996.1	-	1	534	c.535G>A	c.(535-537)Gcc>Acc	p.A179T		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			AACACGGGGGCCTCGCAGAAG	0.562																																					p.A179T		.											.	OR2T12-71	0			c.G535A						.						166.0	128.0	141.0					1																	248458346		2201	4298	6499	SO:0001583	missense	127064	exon1			CGGGGGCCTCGCA	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.535G>A	1.37:g.248458346C>T	ENSP00000324583:p.Ala179Thr	Somatic	102	1		WXS	Illumina HiSeq	Phase_I	249	18	NM_001004692	0	0	0	0	0		Missense_Mutation	SNP	ENST00000317996.1	37	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	c	11.86	1.764047	0.31228	.	.	ENSG00000177201	ENST00000317996	T	0.36878	1.23	1.55	0.228	0.15364	GPCR, rhodopsin-like superfamily (1);	0.505346	0.14676	U	0.305046	T	0.22781	0.0550	N	0.17901	0.54	0.09310	N	1	B	0.25563	0.129	B	0.35971	0.215	T	0.28522	-1.0041	10	0.72032	D	0.01	.	3.0778	0.06252	0.0:0.37:0.0:0.63	.	179	Q8NG77	O2T12_HUMAN	T	179	ENSP00000324583:A179T	ENSP00000324583:A179T	A	-	1	0	OR2T12	246524969	0.000000	0.05858	0.074000	0.20217	0.296000	0.27459	-4.436000	0.00234	0.645000	0.30675	0.175000	0.17021	GCC	C|1.000;|0.000		0.562	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
FAM208B	54906	bcgsc.ca	37	10	5788304	5788304	+	Missense_Mutation	SNP	C	C	A	rs72772328		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:5788304C>A	ENST00000328090.5	+	15	3545	c.2920C>A	c.(2920-2922)Caa>Aaa	p.Q974K	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	974																	CACTGTTACTCAAGCCACATT	0.463																																					p.Q974K													.	.	0			c.C2920A						.						72.0	76.0	75.0					10																	5788304		1996	4169	6165	SO:0001583	missense	54906	exon15			GTTACTCAAGCCA	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.2920C>A	10.37:g.5788304C>A	ENSP00000328426:p.Gln974Lys	Somatic	68	0		WXS	Illumina HiSeq	Phase_1	32	16	NM_017782	0	0	10	10	0	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.250700	0.39797	.	.	ENSG00000108021	ENST00000328090	T	0.43688	0.94	4.78	4.78	0.61160	.	0.260060	0.27504	N	0.019074	T	0.62865	0.2463	M	0.70595	2.14	0.25318	N	0.989145	D	0.69078	0.997	D	0.87578	0.998	T	0.56860	-0.7909	10	0.72032	D	0.01	.	14.0255	0.64584	0.0:1.0:0.0:0.0	.	974	Q5VWN6	F208B_HUMAN	K	974	ENSP00000328426:Q974K	ENSP00000328426:Q974K	Q	+	1	0	C10orf18	5828310	0.394000	0.25246	0.128000	0.21923	0.039000	0.13416	1.854000	0.39368	2.557000	0.86248	0.655000	0.94253	CAA	.		0.463	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
CACNB2	783	bcgsc.ca	37	10	18827274	18827274	+	Missense_Mutation	SNP	A	A	C	rs575188082		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:18827274A>C	ENST00000324631.7	+	13	1528	c.1468A>C	c.(1468-1470)Acc>Ccc	p.T490P	CACNB2_ENST00000282343.8_Missense_Mutation_p.T462P|CACNB2_ENST00000377319.3_Missense_Mutation_p.T397P|CACNB2_ENST00000377331.2_Missense_Mutation_p.T438P|CACNB2_ENST00000377328.1_Missense_Mutation_p.T240P|CACNB2_ENST00000377315.4_Missense_Mutation_p.T442P|CACNB2_ENST00000396576.2_Missense_Mutation_p.T435P|CACNB2_ENST00000352115.6_Missense_Mutation_p.T466P|CACNB2_ENST00000377329.4_Missense_Mutation_p.T436P|RP11-499P20.2_ENST00000425669.1_RNA	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	490					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TCTTAGCCCCACCCTAGCCTC	0.478																																					p.T490P													.	CACNB2-154	0			c.A1468C						.						148.0	153.0	151.0					10																	18827274		2203	4300	6503	SO:0001583	missense	783	exon13			AGCCCCACCCTAG	U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.1468A>C	10.37:g.18827274A>C	ENSP00000320025:p.Thr490Pro	Somatic	301	5		WXS	Illumina HiSeq	Phase_1	267	127	NM_201596	0	0	1	1	0	A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Missense_Mutation	SNP	ENST00000324631.7	37	CCDS7125.1	.	.	.	.	.	.	.	.	.	.	A	18.88	3.716865	0.68844	.	.	ENSG00000165995	ENST00000324631;ENST00000352115;ENST00000377328;ENST00000282343;ENST00000377331;ENST00000396576;ENST00000377319;ENST00000377329;ENST00000377315	D;D;D;D;D;D;D;D;D	0.83419	-1.72;-1.71;-1.7;-1.72;-1.69;-1.69;-1.68;-1.69;-1.69	5.6	-2.45	0.06481	.	0.440958	0.26058	N	0.026587	T	0.78362	0.4271	L	0.42245	1.32	0.29204	N	0.875039	B;B;D;B;B;P;B;B;B;B;B;P;P	0.71674	0.146;0.357;0.998;0.357;0.042;0.49;0.0;0.256;0.041;0.321;0.256;0.579;0.586	B;B;P;B;B;B;B;B;B;B;B;B;B	0.56434	0.16;0.04;0.798;0.024;0.147;0.088;0.0;0.043;0.058;0.088;0.086;0.192;0.04	T	0.71024	-0.4712	10	0.40728	T	0.16	-3.0699	3.2829	0.06921	0.2479:0.1455:0.4643:0.1422	.	404;462;240;442;412;436;446;397;438;462;452;466;490	B7Z1U5;Q5QJA0;A6PVM6;Q5VVH1;Q6TME1;Q08289-3;Q59H42;Q08289-6;A6PVM7;Q08289-4;Q08289-7;Q08289-8;Q08289	.;.;.;.;.;.;.;.;.;.;.;.;CACB2_HUMAN	P	490;466;240;462;438;435;397;436;442	ENSP00000320025:T490P;ENSP00000344474:T466P;ENSP00000366545:T240P;ENSP00000282343:T462P;ENSP00000366548:T438P;ENSP00000379821:T435P;ENSP00000366536:T397P;ENSP00000366546:T436P;ENSP00000366532:T442P	ENSP00000282343:T462P	T	+	1	0	CACNB2	18867280	0.088000	0.21588	0.273000	0.24645	0.972000	0.66771	1.209000	0.32357	-0.443000	0.07180	0.528000	0.53228	ACC	.		0.478	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724	
ANK3	288	hgsc.bcm.edu	37	10	61819138	61819138	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:61819138G>C	ENST00000280772.2	-	41	12837	c.12646C>G	c.(12646-12648)Cga>Gga	p.R4216G	ANK3_ENST00000373827.2_Missense_Mutation_p.R1700G|RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000355288.2_Missense_Mutation_p.R840G|ANK3_ENST00000503366.1_Missense_Mutation_p.R1707G	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4216					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTTACTCTTCGAGCTTGAGCG	0.408																																					p.R4216G		.											.	ANK3-107	0			c.C12646G						.						201.0	175.0	184.0					10																	61819138		2203	4300	6503	SO:0001583	missense	288	exon41			CTCTTCGAGCTTG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12646C>G	10.37:g.61819138G>C	ENSP00000280772:p.Arg4216Gly	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_020987	0	0	65	65	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315261	0.40996	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000503366;ENST00000395299;ENST00000373817	T;T;T;T;T	0.79352	-0.67;-1.26;0.38;-0.38;-1.22	5.56	4.65	0.58169	.	0.000000	0.30329	U	0.009875	T	0.73783	0.3631	L	0.29908	0.895	0.80722	D	1	P;P;P;P;B;P;D	0.58268	0.889;0.543;0.889;0.945;0.447;0.543;0.982	B;B;B;P;B;B;P	0.49752	0.301;0.162;0.394;0.597;0.307;0.162;0.621	T	0.77464	-0.2578	10	0.72032	D	0.01	.	13.835	0.63404	0.0733:0.0:0.9267:0.0	.	1707;840;1700;4216;941;840;239	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.;.;.;ANK3_HUMAN;.;.;.	G	4216;1700;298;840;1707;1686;941	ENSP00000280772:R4216G;ENSP00000362933:R1700G;ENSP00000362926:R298G;ENSP00000347436:R840G;ENSP00000425236:R1707G	ENSP00000280772:R4216G	R	-	1	2	ANK3	61489144	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.006000	0.76329	2.623000	0.88846	0.455000	0.32223	CGA	.		0.408	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
DNA2	1763	bcgsc.ca	37	10	70196869	70196869	+	Silent	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:70196869A>C	ENST00000358410.3	-	10	1595	c.1545T>G	c.(1543-1545)ggT>ggG	p.G515G	DNA2_ENST00000399180.2_Silent_p.G601G|DNA2_ENST00000399179.2_Silent_p.G515G	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	515	Nuclease activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						TAACTCTGTCACCTGCCATTA	0.353																																					p.G515G													.	.	0			c.T1545G						.						182.0	176.0	178.0					10																	70196869		1887	4114	6001	SO:0001819	synonymous_variant	1763	exon10			TCTGTCACCTGCC	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.1545T>G	10.37:g.70196869A>C		Somatic	134	5		WXS	Illumina HiSeq	Phase_1	122	69	NM_001080449	0	0	7	8	1	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Silent	SNP	ENST00000358410.3	37																																																																																				.		0.353	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
ENTPD1	953	bcgsc.ca	37	10	97604357	97604357	+	Missense_Mutation	SNP	A	A	G	rs80329743		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:97604357A>G	ENST00000371205.4	+	5	821	c.538A>G	c.(538-540)Att>Gtt	p.I180V	ENTPD1_ENST00000453258.2_Missense_Mutation_p.I187V|ENTPD1_ENST00000539125.1_Missense_Mutation_p.I42V|ENTPD1_ENST00000371203.5_Missense_Mutation_p.I42V|ENTPD1_ENST00000543964.1_Missense_Mutation_p.I72V|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000490659.1_3'UTR|RP11-429G19.3_ENST00000433113.1_RNA|ENTPD1_ENST00000371207.3_Missense_Mutation_p.I192V			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	180					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		CTATGGCTGGATTACTATCAA	0.522																																					p.I192V													.	ENTPD1-93	0			c.A574G						.						158.0	153.0	154.0					10																	97604357		2203	4300	6503	SO:0001583	missense	953	exon5			GGCTGGATTACTA	S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.538A>G	10.37:g.97604357A>G	ENSP00000360248:p.Ile180Val	Somatic	169	0		WXS	Illumina HiSeq	Phase_1	77	23	NM_001164178	0	0	25	28	3	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Missense_Mutation	SNP	ENST00000371205.4	37	CCDS7444.1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.861384	0.51482	.	.	ENSG00000138185	ENST00000453258;ENST00000371206;ENST00000371207;ENST00000543964;ENST00000539125;ENST00000371203;ENST00000371205	T;T;T;T;T;T	0.15372	2.43;2.43;2.43;2.43;2.43;2.43	5.83	5.83	0.93111	.	0.159980	0.56097	D	0.000038	T	0.19967	0.0480	L	0.39245	1.2	0.58432	D	0.999993	P;P;B;P;P	0.47034	0.889;0.865;0.153;0.889;0.568	P;B;B;P;B	0.46940	0.532;0.396;0.113;0.532;0.279	T	0.01904	-1.1250	10	0.25106	T	0.35	-25.9621	14.1648	0.65469	1.0:0.0:0.0:0.0	.	192;192;187;180;187	B4DWB9;G3XAF6;P49961-2;P49961;P49961-3	.;.;.;ENTP1_HUMAN;.	V	187;187;192;72;42;42;180	ENSP00000390955:I187V;ENSP00000360250:I192V;ENSP00000442968:I72V;ENSP00000440027:I42V;ENSP00000360246:I42V;ENSP00000360248:I180V	ENSP00000360246:I42V	I	+	1	0	ENTPD1	97594347	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.762000	0.68809	2.236000	0.73375	0.533000	0.62120	ATT	.		0.522	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049566.1	NM_001776	
ABCC2	1244	bcgsc.ca	37	10	101603581	101603581	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:101603581T>G	ENST00000370449.4	+	27	3880	c.3767T>G	c.(3766-3768)gTg>gGg	p.V1256G		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1256	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	AACTGGCTGGTGAGGATGACA	0.418																																					p.V1256G													.	ABCC2-91	0			c.T3767G						.						293.0	304.0	300.0					10																	101603581		2203	4300	6503	SO:0001583	missense	1244	exon27			GGCTGGTGAGGAT	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3767T>G	10.37:g.101603581T>G	ENSP00000359478:p.Val1256Gly	Somatic	414	1		WXS	Illumina HiSeq	Phase_1	276	60	NM_000392	0	0	5	6	1	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.552029	0.86127	.	.	ENSG00000023839	ENST00000370449	D	0.83992	-1.79	5.33	5.33	0.75918	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.94335	0.8179	H	0.97587	4.035	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96281	0.9206	10	0.87932	D	0	-15.3424	15.3291	0.74193	0.0:0.0:0.0:1.0	.	1256	Q92887	MRP2_HUMAN	G	1256	ENSP00000359478:V1256G	ENSP00000359478:V1256G	V	+	2	0	ABCC2	101593571	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.037000	0.88933	2.017000	0.59298	0.533000	0.62120	GTG	.		0.418	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
SEC31B	25956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	102255181	102255181	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:102255181C>G	ENST00000370345.3	-	19	2530	c.2433G>C	c.(2431-2433)gaG>gaC	p.E811D	SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	811					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		AAGATGATGTCTCTTTAGAGT	0.488																																					p.E811D		.											.	SEC31B-91	0			c.G2433C						.						69.0	61.0	63.0					10																	102255181		2203	4300	6503	SO:0001583	missense	25956	exon19			TGATGTCTCTTTA	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2433G>C	10.37:g.102255181C>G	ENSP00000359370:p.Glu811Asp	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	33	17	NM_015490	0	0	2	3	1	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.927568	0.34002	.	.	ENSG00000075826	ENST00000370345	T	0.51325	0.71	5.76	-1.7	0.08159	.	0.960732	0.08733	N	0.901781	T	0.18676	0.0448	N	0.08118	0	0.09310	N	0.999998	B;B	0.32893	0.017;0.389	B;B	0.25987	0.006;0.065	T	0.13308	-1.0514	10	0.33141	T	0.24	-8.994	0.6819	0.00876	0.1758:0.2806:0.2804:0.2633	.	810;811	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	D	811	ENSP00000359370:E811D	ENSP00000359370:E811D	E	-	3	2	SEC31B	102245171	.	.	0.335000	0.25508	0.480000	0.33159	.	.	-0.009000	0.14296	0.561000	0.74099	GAG	.		0.488	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
PAX2	5076	bcgsc.ca	37	10	102510625	102510625	+	Silent	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:102510625G>C	ENST00000428433.1	+	3	937	c.387G>C	c.(385-387)gtG>gtC	p.V129V	PAX2_ENST00000553492.1_Intron|PAX2_ENST00000361791.3_Silent_p.V129V|PAX2_ENST00000370296.2_Silent_p.V129V|PAX2_ENST00000355243.3_Silent_p.V129V|PAX2_ENST00000556085.1_Silent_p.V128V	NM_003987.3|NM_003990.3	NP_003978|NP_003981.2	Q02962	PAX2_HUMAN	paired box 2	129	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				aging (GO:0007568)|axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cell fate determination (GO:0001709)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucose stimulus (GO:0071333)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|glial cell differentiation (GO:0010001)|inner ear morphogenesis (GO:0042472)|mesenchymal to epithelial transition (GO:0060231)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|mesonephric duct development (GO:0072177)|mesonephric tubule formation (GO:0072172)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric nephron tubule formation (GO:0072289)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytolysis (GO:0045918)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of programmed cell death (GO:0043069)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|neural tube closure (GO:0001843)|optic chiasma development (GO:0061360)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|optic nerve development (GO:0021554)|optic nerve morphogenesis (GO:0021631)|optic nerve structural organization (GO:0021633)|pancreas development (GO:0031016)|paramesonephric duct development (GO:0061205)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of optic nerve formation (GO:2000597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|protein kinase B signaling (GO:0043491)|reactive oxygen species metabolic process (GO:0072593)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of metanephros size (GO:0035566)|response to nutrient levels (GO:0031667)|retinal pigment epithelium development (GO:0003406)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|ureter development (GO:0072189)|ureter maturation (GO:0035799)|ureter morphogenesis (GO:0072197)|urogenital system development (GO:0001655)|vestibulocochlear nerve formation (GO:0021650)|visual perception (GO:0007601)	centriolar satellite (GO:0034451)|lysosome (GO:0005764)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|superoxide-generating NADPH oxidase activity (GO:0016175)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;1.32e-08)|all cancers(201;7.32e-07)		ATGACACAGTGCCCAGCGTCT	0.592																																					p.V129V													.	PAX2-90	0			c.G387C						.						61.0	65.0	64.0					10																	102510625		2203	4300	6503	SO:0001819	synonymous_variant	5076	exon3			CACAGTGCCCAGC		CCDS7499.1, CCDS41561.1	10q24.31	2011-06-20	2007-07-12		ENSG00000075891	ENSG00000075891		"""Paired boxes"", ""Homeoboxes / PRD class"""	8616	protein-coding gene	gene with protein product		167409	"""paired box gene 2"""			8431641, 7981748	Standard	NM_003990		Approved		uc001krk.4	Q02962	OTTHUMG00000018913	ENST00000428433.1:c.387G>C	10.37:g.102510625G>C		Somatic	101	0		WXS	Illumina HiSeq	Phase_1	207	101	NM_000278	0	0	67	77	10	Q15105|Q15110|Q15837|Q5SZP2|Q5SZP3	Silent	SNP	ENST00000428433.1	37	CCDS53569.1																																																																																			.		0.592	PAX2-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
XPNPEP1	7511	bcgsc.ca	37	10	111667523	111667523	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:111667523G>T	ENST00000502935.1	-	3	291	c.172C>A	c.(172-174)Caa>Aaa	p.Q58K	XPNPEP1_ENST00000369683.1_5'UTR|XPNPEP1_ENST00000430337.1_5'UTR|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.Q58K|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.Q15K					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		CTCATGGCTTGTCTCAGCTGC	0.537																																					p.Q58K													.	XPNPEP1-94	0			c.C172A						.						222.0	191.0	201.0					10																	111667523		2203	4300	6503	SO:0001583	missense	7511	exon3			TGGCTTGTCTCAG		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.172C>A	10.37:g.111667523G>T	ENSP00000421566:p.Gln58Lys	Somatic	239	0		WXS	Illumina HiSeq	Phase_1	222	110	NM_001167604	0	0	39	41	2		Missense_Mutation	SNP	ENST00000502935.1	37	CCDS7560.2	.	.	.	.	.	.	.	.	.	.	G	14.10	2.434498	0.43224	.	.	ENSG00000108039	ENST00000502935;ENST00000322238;ENST00000369680;ENST00000403138;ENST00000423625	.	.	.	5.33	5.33	0.75918	Creatinase (1);	0.119653	0.64402	D	0.000017	T	0.40297	0.1111	N	0.11698	0.16	0.51233	D	0.999916	B;B;B	0.14012	0.009;0.007;0.009	B;B;B	0.12837	0.008;0.004;0.008	T	0.21211	-1.0252	9	0.23302	T	0.38	-6.8452	15.934	0.79688	0.0:0.0:1.0:0.0	.	58;58;15	B4E2P4;G5E9Y2;Q9NQW7	.;.;XPP1_HUMAN	K	58;58;15;15;15	.	ENSP00000324011:Q58K	Q	-	1	0	XPNPEP1	111657513	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.635000	0.67841	2.504000	0.84457	0.655000	0.94253	CAA	.		0.537	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2		
DCLRE1A	9937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	115608965	115608965	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:115608965A>G	ENST00000361384.2	-	2	2816	c.1899T>C	c.(1897-1899)cgT>cgC	p.R633R	DCLRE1A_ENST00000369305.1_Silent_p.R633R	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	633					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		TCTTTTTTTGACGCTGTGACC	0.368								Other identified genes with known or suspected DNA repair function																													p.R633R		.											.	DCLRE1A-228	0			c.T1899C						.						162.0	164.0	163.0					10																	115608965		2203	4300	6503	SO:0001819	synonymous_variant	9937	exon2			TTTTTGACGCTGT		CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.1899T>C	10.37:g.115608965A>G		Somatic	145	0		WXS	Illumina HiSeq	Phase_I	225	84	NM_014881	0	0	2	5	3	D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Silent	SNP	ENST00000361384.2	37	CCDS7584.1																																																																																			.		0.368	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1	NM_014881	
TDRD1	56165	bcgsc.ca	37	10	115985894	115985894	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:115985894A>C	ENST00000369280.1	+	22	3554	c.3094A>C	c.(3094-3096)Acc>Ccc	p.T1032P	TDRD1_ENST00000369281.2_Missense_Mutation_p.T918P|TDRD1_ENST00000251864.2_Missense_Mutation_p.T1032P|TDRD1_ENST00000369282.1_Missense_Mutation_p.T1032P|TDRD1_ENST00000422662.1_Missense_Mutation_p.T636P			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1032	Tudor 4. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		AAACATTGAAACCCTGCCTCT	0.443																																					p.T1032P													.	TDRD1-90	0			c.A3094C						.						138.0	123.0	128.0					10																	115985894		2203	4300	6503	SO:0001583	missense	56165	exon22			ATTGAAACCCTGC	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.3094A>C	10.37:g.115985894A>C	ENSP00000358286:p.Thr1032Pro	Somatic	63	0		WXS	Illumina HiSeq	Phase_1	56	23	NM_198795	0	0	1	1	0	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	37		.	.	.	.	.	.	.	.	.	.	A	17.08	3.298570	0.60195	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9	6.01	6.01	0.97437	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.236879	0.43919	D	0.000508	T	0.41166	0.1147	M	0.90542	3.125	0.48185	D	0.9996	D;D;D;D;D	0.89917	0.997;0.999;1.0;0.999;0.999	P;D;D;D;D	0.87578	0.844;0.969;0.998;0.948;0.983	T	0.44832	-0.9302	10	0.51188	T	0.08	-8.2086	15.0995	0.72262	1.0:0.0:0.0:0.0	.	636;1032;918;1032;918	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	P	1032;1032;918;636;1032	ENSP00000358288:T1032P;ENSP00000251864:T1032P;ENSP00000358287:T918P;ENSP00000402794:T636P;ENSP00000358286:T1032P	ENSP00000251864:T1032P	T	+	1	0	TDRD1	115975884	1.000000	0.71417	0.979000	0.43373	0.239000	0.25481	7.340000	0.79292	2.307000	0.77673	0.528000	0.53228	ACC	.		0.443	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
ILK	3611	bcgsc.ca	37	11	6629291	6629291	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:6629291C>T	ENST00000396751.2	+	2	561	c.105C>T	c.(103-105)ttC>ttT	p.F35F	ILK_ENST00000528995.1_Silent_p.F35F|ILK_ENST00000420936.2_Silent_p.F35F|ILK_ENST00000537806.1_Intron|RP11-732A19.2_ENST00000527398.1_RNA|ILK_ENST00000299421.4_Silent_p.F35F	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase	35	Interaction with LIMS1.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		ATCATGGCTTCTCCCCCTTGC	0.532																																					p.F35F													.	ILK-1363	0			c.C105T						.						60.0	56.0	57.0					11																	6629291		2201	4296	6497	SO:0001819	synonymous_variant	3611	exon3			TGGCTTCTCCCCC	U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.105C>T	11.37:g.6629291C>T		Somatic	39	0		WXS	Illumina HiSeq	Phase_1	67	19	NM_001014794	0	0	166	185	19	B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Silent	SNP	ENST00000396751.2	37	CCDS7768.1																																																																																			.		0.532	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384519.1	NM_004517	
MRGPRX2	117194	bcgsc.ca	37	11	19077074	19077074	+	Missense_Mutation	SNP	C	C	G	rs201365816		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:19077074C>G	ENST00000329773.2	-	2	963	c.876G>C	c.(874-876)caG>caC	p.Q292H		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	292					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						GGATCGGCTGCTGCAGCCGCC	0.537																																					p.Q292H	GBM(198;1966 2199 4849 37227 49954)												.	MRGPRX2-91	0			c.G876C						.						34.0	40.0	38.0					11																	19077074		2199	4293	6492	SO:0001583	missense	117194	exon2			CGGCTGCTGCAGC		CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.876G>C	11.37:g.19077074C>G	ENSP00000333800:p.Gln292His	Somatic	82	0		WXS	Illumina HiSeq	Phase_1	100	69	NM_054030	0	0	0	0	0	B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Missense_Mutation	SNP	ENST00000329773.2	37	CCDS7847.1	.	.	.	.	.	.	.	.	.	.	.	10.65	1.409195	0.25378	.	.	ENSG00000183695	ENST00000329773	T	0.06142	3.34	5.04	0.79	0.18613	.	4.184940	0.00357	N	0.000031	T	0.07413	0.0187	L	0.43923	1.385	0.09310	N	1	B	0.16396	0.017	B	0.17979	0.02	T	0.36089	-0.9762	10	0.44086	T	0.13	.	3.4378	0.07452	0.1753:0.5086:0.0:0.3162	.	292	Q96LB1	MRGX2_HUMAN	H	292	ENSP00000333800:Q292H	ENSP00000333800:Q292H	Q	-	3	2	MRGPRX2	19033650	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.268000	0.08607	0.056000	0.16144	0.650000	0.86243	CAG	.		0.537	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387819.1	NM_054030	
MRGPRX2	117194	bcgsc.ca	37	11	19077079	19077079	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:19077079G>C	ENST00000329773.2	-	2	958	c.871C>G	c.(871-873)Ctg>Gtg	p.L291V		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	291					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						GGCTGCTGCAGCCGCCACTGC	0.532																																					p.L291V	GBM(198;1966 2199 4849 37227 49954)												.	MRGPRX2-91	0			c.C871G						.						35.0	43.0	41.0					11																	19077079		2198	4293	6491	SO:0001583	missense	117194	exon2			GCTGCAGCCGCCA		CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.871C>G	11.37:g.19077079G>C	ENSP00000333800:p.Leu291Val	Somatic	82	2		WXS	Illumina HiSeq	Phase_1	96	47	NM_054030	0	0	0	0	0	B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Missense_Mutation	SNP	ENST00000329773.2	37	CCDS7847.1	.	.	.	.	.	.	.	.	.	.	.	8.321	0.824218	0.16678	.	.	ENSG00000183695	ENST00000329773	T	0.07114	3.22	5.25	-3.39	0.04868	.	1.848080	0.02775	N	0.120139	T	0.07954	0.0199	L	0.47016	1.485	0.09310	N	1	B	0.25441	0.126	B	0.21546	0.035	T	0.38351	-0.9665	10	0.14252	T	0.57	.	7.955	0.30038	0.1138:0.0:0.1876:0.6985	.	291	Q96LB1	MRGX2_HUMAN	V	291	ENSP00000333800:L291V	ENSP00000333800:L291V	L	-	1	2	MRGPRX2	19033655	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.070000	0.00301	-0.322000	0.08615	-0.188000	0.12872	CTG	.		0.532	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387819.1	NM_054030	
WT1	7490	bcgsc.ca	37	11	32449564	32449564	+	Missense_Mutation	SNP	G	G	C	rs200222400		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:32449564G>C	ENST00000379079.2	-	3	447	c.174C>G	c.(172-174)tgC>tgG	p.C58W	WT1_ENST00000332351.3_Missense_Mutation_p.C270W|WT1_ENST00000448076.3_Missense_Mutation_p.C270W|WT1_ENST00000530998.1_Missense_Mutation_p.C58W	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	202	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TGGGGGTGTGGCAGCCATAGA	0.672			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.C270W			yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.C810G						.						21.0	24.0	23.0					11																	32449564		2173	4242	6415	SO:0001583	missense	7490	exon3	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	GGTGTGGCAGCCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.174C>G	11.37:g.32449564G>C	ENSP00000368370:p.Cys58Trp	Somatic	37	0		WXS	Illumina HiSeq	Phase_1	56	20	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000379079.2	37	CCDS55751.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223217	0.58668	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076;ENST00000527775	D;D;D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65;-2.65;-2.65	5.11	3.24	0.37175	Wilm&apos (1);s tumour protein, N-terminal (1);	0.000000	0.85682	U	0.000000	D	0.92473	0.7610	L	0.55213	1.73	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;0.998;0.992	D;D;D;D;D	0.79108	0.984;0.992;0.992;0.978;0.963	D	0.91434	0.5168	10	0.87932	D	0	.	8.0073	0.30332	0.3304:0.0:0.6696:0.0	.	275;202;275;58;58	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	W	58;270;58;270;270;21	ENSP00000368370:C58W;ENSP00000331327:C270W;ENSP00000435307:C58W;ENSP00000415516:C270W;ENSP00000413452:C270W;ENSP00000435351:C21W	ENSP00000331327:C270W	C	-	3	2	WT1	32406140	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.427000	0.34881	0.856000	0.35383	0.561000	0.74099	TGC	.		0.672	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378	
SLC43A3	29015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57188512	57188512	+	Missense_Mutation	SNP	C	C	T	rs148055054		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:57188512C>T	ENST00000395123.2	-	7	768	c.464G>A	c.(463-465)cGt>cAt	p.R155H	SLC43A3_ENST00000395124.1_Missense_Mutation_p.R155H|SLC43A3_ENST00000533524.1_Missense_Mutation_p.R168H|SLC43A3_ENST00000528098.1_5'UTR|SLC43A3_ENST00000529554.1_Missense_Mutation_p.R155H|SLC43A3_ENST00000352187.1_Missense_Mutation_p.R155H	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	155					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						GATGGTCGAACGGTGTTGGCC	0.448																																					p.R155H		.											.	SLC43A3-90	0			c.G464A						.	C	HIS/ARG,HIS/ARG,HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	156.0	128.0	138.0		464,464,464	5.8	1.0	11	dbSNP_134	138	0,8592		0,0,4296	no	missense,missense,missense	SLC43A3	NM_014096.2,NM_017611.2,NM_199329.1	29,29,29	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	155/492,155/492,155/492	57188512	1,12993	2201	4296	6497	SO:0001583	missense	29015	exon7			GTCGAACGGTGTT	AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.464G>A	11.37:g.57188512C>T	ENSP00000378555:p.Arg155His	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	91	35	NM_017611	0	0	8	10	2	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	ENST00000395123.2	37	CCDS7956.1	.	.	.	.	.	.	.	.	.	.	C	35	5.465074	0.96257	2.27E-4	0.0	ENSG00000134802	ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524;ENST00000530005;ENST00000529113;ENST00000525474	T;T;T;T;T;T;D;D	0.84146	-0.35;-0.35;-0.35;-0.35;-0.35;-0.46;-1.81;-1.81	5.85	5.85	0.93711	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.93468	0.7916	M	0.87180	2.865	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.997;0.998	D	0.93715	0.7027	10	0.62326	D	0.03	-17.6544	17.9537	0.89062	0.0:1.0:0.0:0.0	.	155;168;155;155	B4DV87;E7EQD2;Q8NBI5;A8K2X6	.;.;S43A3_HUMAN;.	H	155;155;155;155;168;155;102;155	ENSP00000378555:R155H;ENSP00000378556:R155H;ENSP00000337561:R155H;ENSP00000436254:R155H;ENSP00000434515:R168H;ENSP00000435893:R155H;ENSP00000434293:R102H;ENSP00000436055:R155H	ENSP00000337561:R155H	R	-	2	0	SLC43A3	56945088	1.000000	0.71417	0.993000	0.49108	0.945000	0.59286	6.437000	0.73421	2.782000	0.95742	0.655000	0.94253	CGT	C|1.000;T|0.000		0.448	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
SLC22A10	387775	bcgsc.ca	37	11	63071626	63071626	+	Missense_Mutation	SNP	T	T	G	rs76578107		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:63071626T>G	ENST00000332793.6	+	8	1334	c.1332T>G	c.(1330-1332)tgT>tgG	p.C444W	SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000544661.1_Missense_Mutation_p.V243G|SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000525620.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	444						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	GAATCGGCTGTTCTGCTGCTA	0.488																																					p.C444W													.	SLC22A10-92	0			c.T1332G						.						207.0	213.0	211.0					11																	63071626		2086	4261	6347	SO:0001583	missense	387775	exon8			CGGCTGTTCTGCT	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.1332T>G	11.37:g.63071626T>G	ENSP00000327569:p.Cys444Trp	Somatic	215	1		WXS	Illumina HiSeq	Phase_1	63	26	NM_001039752	0	0	0	0	0	Q68CJ0	Missense_Mutation	SNP	ENST00000332793.6	37	CCDS41661.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.960|6.960	0.547063|0.547063	0.13312|0.13312	.|.	.|.	ENSG00000184999|ENSG00000184999	ENST00000332793|ENST00000544661	T|T	0.59224|0.69306	0.28|-0.39	3.05|3.05	1.81|1.81	0.25067|0.25067	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.427522|.	0.24630|.	U|.	0.036882|.	T|T	0.69602|0.69602	0.3129|0.3129	M|M	0.88377|0.88377	2.95|2.95	0.09310|0.09310	N|N	1|1	P|P	0.47841|0.34684	0.901|0.463	B|B	0.42386|0.37888	0.386|0.26	T|T	0.64474|0.64474	-0.6399|-0.6399	10|9	0.38643|0.72032	T|D	0.18|0.01	.|.	5.2147|5.2147	0.15336|0.15336	0.2588:0.0:0.0:0.7412|0.2588:0.0:0.0:0.7412	.|.	444|238	Q63ZE4|E9PJB1	S22AA_HUMAN|.	W|G	444|243	ENSP00000327569:C444W|ENSP00000445667:V243G	ENSP00000327569:C444W|ENSP00000433817:V238G	C|V	+|+	3|2	2|0	SLC22A10|SLC22A10	62828202|62828202	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.288000|0.288000	0.18939|0.18939	0.348000|0.348000	0.23949|0.23949	0.472000|0.472000	0.43445|0.43445	TGT|GTT	.		0.488	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
SYVN1	84447	bcgsc.ca	37	11	64898255	64898255	+	Missense_Mutation	SNP	T	T	G	rs199952384		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:64898255T>G	ENST00000377190.3	-	11	1076	c.982A>C	c.(982-984)Acc>Ccc	p.T328P	SYVN1_ENST00000294256.8_Missense_Mutation_p.T328P|SYVN1_ENST00000307289.6_Missense_Mutation_p.T277P|SYVN1_ENST00000526121.1_5'UTR|SYVN1_ENST00000526060.1_Missense_Mutation_p.T328P	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	328					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						ATACGGCAGGTGGGGCAGGTC	0.711																																					p.T328P													.	SYVN1-91	0			c.A982C						.						21.0	25.0	24.0					11																	64898255		2190	4272	6462	SO:0001583	missense	84447	exon11			GGCAGGTGGGGCA	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.982A>C	11.37:g.64898255T>G	ENSP00000366395:p.Thr328Pro	Somatic	52	3		WXS	Illumina HiSeq	Phase_1	149	101	NM_172230	0	0	4	6	2	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Missense_Mutation	SNP	ENST00000377190.3	37	CCDS31605.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.449287	0.84101	.	.	ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000434219;ENST00000307289;ENST00000526060	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.22	5.22	0.72569	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	T	0.68513	0.3009	M	0.78223	2.4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.73161	-0.4070	10	0.87932	D	0	-30.9766	13.0856	0.59138	0.0:0.0:0.0:1.0	.	277;328;328	Q86TM6-2;Q86TM6-3;Q86TM6	.;.;SYVN1_HUMAN	P	328;328;328;277;328	ENSP00000366395:T328P;ENSP00000294256:T328P;ENSP00000302035:T277P;ENSP00000436984:T328P	ENSP00000294256:T328P	T	-	1	0	SYVN1	64654831	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	6.057000	0.71119	1.966000	0.57179	0.379000	0.24179	ACC	.		0.711	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	
LTBP3	4054	hgsc.bcm.edu	37	11	65306859	65306859	+	Missense_Mutation	SNP	C	C	T	rs372367914	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:65306859C>T	ENST00000301873.5	-	27	3968	c.3700G>A	c.(3700-3702)Ggc>Agc	p.G1234S	LTBP3_ENST00000322147.4_Missense_Mutation_p.G1187S|LTBP3_ENST00000530785.1_Missense_Mutation_p.G237S|LTBP3_ENST00000532932.1_Missense_Mutation_p.G664S|LTBP3_ENST00000536982.1_Missense_Mutation_p.G813S|LTBP3_ENST00000529189.1_Missense_Mutation_p.G190S	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	1234					bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						CACACGGCGCCGCCCGGCCGC	0.721													C|||	2	0.000399361	0.0008	0.0	5008	,	,		7392	0.0		0.001	False		,,,				2504	0.0				p.G1234S		.											.	LTBP3-91	0			c.G3700A						.	C	SER/GLY,SER/GLY,SER/GLY	2,3936		0,2,1967	18.0	21.0	20.0		3700,3208,3559	4.8	0.4	11		20	0,7628		0,0,3814	no	missense,missense,missense	LTBP3	NM_001130144.2,NM_001164266.1,NM_021070.4	56,56,56	0,2,5781	TT,TC,CC		0.0,0.0508,0.0173	probably-damaging,probably-damaging,probably-damaging	1234/1304,1070/1140,1187/1257	65306859	2,11564	1969	3814	5783	SO:0001583	missense	4054	exon27			CGGCGCCGCCCGG	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.3700G>A	11.37:g.65306859C>T	ENSP00000301873:p.Gly1234Ser	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	13	9	NM_001130144	0	0	12	37	25	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	37	CCDS44647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.48|18.48	3.632392|3.632392	0.67015|0.67015	5.08E-4|5.08E-4	0.0|0.0	ENSG00000168056|ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000530785;ENST00000529189;ENST00000532932;ENST00000536982;ENST00000532661;ENST00000529371|ENST00000526927	T;T;T;T;T;T;D;T|.	0.86097|.	1.72;1.72;1.72;1.72;1.72;1.72;-2.07;1.72|.	4.79|4.79	4.79|4.79	0.61399|0.61399	Matrix fibril-associated (1);Epidermal growth factor-like (1);|.	0.057494|.	0.64402|.	D|.	0.000002|.	T|T	0.40372|0.40372	0.1114|0.1114	N|N	0.11201|0.11201	0.11|0.11	0.47778|0.47778	D|D	0.999511|0.999511	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;0.999;0.999;1.0;1.0;0.998|.	T|T	0.30534|0.30534	-0.9975|-0.9975	10|5	0.02654|.	T|.	1|.	.|.	15.3249|15.3249	0.74154|0.74154	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	813;1070;1234;1187;664;813|.	F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2;B4DQL8|.	.;.;LTBP3_HUMAN;.;.;.|.	S|Q	1187;1234;237;190;664;813;190;107|837	ENSP00000326647:G1187S;ENSP00000301873:G1234S;ENSP00000434315:G237S;ENSP00000434406:G190S;ENSP00000435530:G664S;ENSP00000441912:G813S;ENSP00000436341:G190S;ENSP00000436032:G107S|.	ENSP00000301873:G1234S|.	G|R	-|-	1|2	0|0	LTBP3|LTBP3	65063435|65063435	0.999000|0.999000	0.42202|0.42202	0.445000|0.445000	0.26908|0.26908	0.187000|0.187000	0.23431|0.23431	4.535000|4.535000	0.60629|0.60629	2.204000|2.204000	0.70986|0.70986	0.561000|0.561000	0.74099|0.74099	GGC|CGG	.		0.721	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
SF3B2	10992	hgsc.bcm.edu	37	11	65835460	65835460	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:65835460A>C	ENST00000322535.6	+	20	2423	c.2374A>C	c.(2374-2376)Aca>Cca	p.T792P	PACS1_ENST00000320580.4_5'Flank|SF3B2_ENST00000528302.1_Missense_Mutation_p.T775P|RP11-1167A19.2_ENST00000529036.1_Intron	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	792					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						AGAGAAGAGAACAGCCACTGT	0.512											OREG0021094	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T792P		.											.	SF3B2-92	0			c.A2374C						.						138.0	141.0	140.0					11																	65835460		2201	4295	6496	SO:0001583	missense	10992	exon20			AAGAGAACAGCCA	U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.2374A>C	11.37:g.65835460A>C	ENSP00000318861:p.Thr792Pro	Somatic	139	0	1087	WXS	Illumina HiSeq	Phase_I	482	138	NM_006842	0	0	179	208	29	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Missense_Mutation	SNP	ENST00000322535.6	37	CCDS31612.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.7|28.7	4.939948|4.939948	0.92526|0.92526	.|.	.|.	ENSG00000087365|ENSG00000087365	ENST00000530981|ENST00000528302;ENST00000322535;ENST00000355456	.|.	.|.	.|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|0.092804	.|0.64402	.|D	.|0.000001	T|T	0.77974|0.77974	0.4211|0.4211	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	.|D	.|0.61080	.|0.989	.|P	.|0.58331	.|0.837	T|T	0.81818|0.81818	-0.0758|-0.0758	5|9	.|0.66056	.|D	.|0.02	-9.2765|-9.2765	14.0383|14.0383	0.64658|0.64658	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|792	.|Q13435	.|SF3B2_HUMAN	D|P	211|775;792;696	.|.	.|ENSP00000318861:T792P	E|T	+|+	3|1	2|0	SF3B2|SF3B2	65592036|65592036	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.032000|7.032000	0.76498|0.76498	2.197000|2.197000	0.70478|0.70478	0.454000|0.454000	0.30748|0.30748	GAA|ACA	.		0.512	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
FOLR2	2350	hgsc.bcm.edu	37	11	71932098	71932098	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:71932098A>G	ENST00000298223.6	+	3	522	c.335A>G	c.(334-336)cAg>cGg	p.Q112R	FOLR2_ENST00000454954.2_Missense_Mutation_p.Q71R|FOLR2_ENST00000449475.2_Missense_Mutation_p.Q129R	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	112				IQ -> VR (in Ref. 6; AA sequence). {ECO:0000305}.	folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)			breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	CCCTGGATCCAGCAGGTAGGG	0.637																																					p.Q112R		.											.	FOLR2-290	0			c.A335G						.						17.0	18.0	18.0					11																	71932098		2200	4291	6491	SO:0001583	missense	2350	exon3			GGATCCAGCAGGT	AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.335A>G	11.37:g.71932098A>G	ENSP00000298223:p.Gln112Arg	Somatic	10	0		WXS	Illumina HiSeq	Phase_I	64	7	NM_001113535	0	0	1	1	0	Q05CA5|Q6GTE8	Missense_Mutation	SNP	ENST00000298223.6	37	CCDS8212.1	.	.	.	.	.	.	.	.	.	.	N	8.068	0.769589	0.15983	.	.	ENSG00000165457	ENST00000449475;ENST00000298223;ENST00000454954;ENST00000539412;ENST00000536778;ENST00000535625;ENST00000321324;ENST00000538353	T;T;T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	4.37	-0.643	0.11482	Folate receptor-like (1);	0.224016	0.38005	N	0.001858	T	0.68824	0.3043	L	0.53249	1.67	0.23023	N	0.998413	B	0.17038	0.02	B	0.25405	0.06	T	0.54450	-0.8292	10	0.25106	T	0.35	.	9.9831	0.41826	0.6851:0.0:0.3149:0.0	.	112	P14207	FOLR2_HUMAN	R	129;112;71;123;127;112;125;112	ENSP00000405638:Q129R;ENSP00000298223:Q112R;ENSP00000414094:Q71R;ENSP00000441547:Q123R;ENSP00000438568:Q127R;ENSP00000444794:Q112R;ENSP00000321957:Q125R;ENSP00000440337:Q112R	ENSP00000298223:Q112R	Q	+	2	0	FOLR2	71609746	0.010000	0.17322	0.901000	0.35422	0.462000	0.32619	0.950000	0.29122	-0.662000	0.05338	-1.815000	0.00603	CAG	.		0.637	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317923.2	NM_000803	
P2RY6	5031	bcgsc.ca	37	11	73007682	73007682	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:73007682G>C	ENST00000393590.2	+	2	418	c.119G>C	c.(118-120)gGc>gCc	p.G40A	P2RY6_ENST00000542092.1_Missense_Mutation_p.G40A|P2RY6_ENST00000538328.1_Missense_Mutation_p.G40A|P2RY6_ENST00000393591.1_Missense_Mutation_p.G40A|P2RY6_ENST00000349767.2_Missense_Mutation_p.G40A|P2RY6_ENST00000393592.2_Missense_Mutation_p.G40A|P2RY6_ENST00000540342.1_Missense_Mutation_p.G40A|P2RY6_ENST00000540124.1_Missense_Mutation_p.G40A	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	40					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)	p.G40V(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						CTGGCGGCTGGCCTGCCGCTG	0.632																																					p.G40A													.	P2RY6-501	1	Substitution - Missense(1)	lung(1)	c.G119C						.						113.0	124.0	120.0					11																	73007682		2200	4293	6493	SO:0001583	missense	5031	exon4			CGGCTGGCCTGCC		CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.119G>C	11.37:g.73007682G>C	ENSP00000377215:p.Gly40Ala	Somatic	277	0		WXS	Illumina HiSeq	Phase_1	596	132	NM_176796	0	0	12	12	0	Q15754	Missense_Mutation	SNP	ENST00000393590.2	37	CCDS8220.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.621250	0.87460	.	.	ENSG00000171631	ENST00000540342;ENST00000542092;ENST00000349767;ENST00000393592;ENST00000544437;ENST00000393591;ENST00000540124;ENST00000393590;ENST00000535931;ENST00000538328	T;T;T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	4.3	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.67785	0.2930	M	0.69523	2.12	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.72769	-0.4193	10	0.87932	D	0	.	16.265	0.82571	0.0:0.0:1.0:0.0	.	40	Q15077	P2RY6_HUMAN	A	40	ENSP00000443427:G40A;ENSP00000445652:G40A;ENSP00000309771:G40A;ENSP00000377217:G40A;ENSP00000441079:G40A;ENSP00000377216:G40A;ENSP00000442551:G40A;ENSP00000377215:G40A;ENSP00000440770:G40A;ENSP00000442990:G40A	ENSP00000309771:G40A	G	+	2	0	P2RY6	72685330	1.000000	0.71417	0.994000	0.49952	0.959000	0.62525	6.528000	0.73807	2.367000	0.80283	0.491000	0.48974	GGC	.		0.632	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397349.1		
USP35	57558	bcgsc.ca	37	11	77907381	77907381	+	Silent	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:77907381G>C	ENST00000529308.1	+	2	351	c.90G>C	c.(88-90)cgG>cgC	p.R30R	USP35_ENST00000441408.2_5'Flank|USP35_ENST00000526425.1_5'Flank|USP35_ENST00000530535.1_Intron|USP35_ENST00000530267.1_Intron	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	30					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			AGGCGGCGCGGCAGCCGCTGG	0.746																																					p.R30R													.	USP35-637	0			c.G90C						.						19.0	24.0	22.0					11																	77907381		2131	4242	6373	SO:0001819	synonymous_variant	57558	exon2			GGCGCGGCAGCCG	AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.90G>C	11.37:g.77907381G>C		Somatic	49	0		WXS	Illumina HiSeq	Phase_1	110	73	NM_020798	0	0	0	0	0		Silent	SNP	ENST00000529308.1	37	CCDS41693.1																																																																																			.		0.746	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527	
FAT3	120114	bcgsc.ca	37	11	92533292	92533292	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:92533292C>T	ENST00000298047.6	+	9	7130	c.7113C>T	c.(7111-7113)ttC>ttT	p.F2371F	FAT3_ENST00000409404.2_Silent_p.F2371F|FAT3_ENST00000525166.1_Silent_p.F2221F			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2371	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATAGTGGCTTCCCATCACTGA	0.413										TCGA Ovarian(4;0.039)																											p.F2371F													.	FAT3-73	0			c.C7113T						.						120.0	118.0	119.0					11																	92533292		1934	4134	6068	SO:0001819	synonymous_variant	120114	exon9			TGGCTTCCCATCA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7113C>T	11.37:g.92533292C>T		Somatic	134	0		WXS	Illumina HiSeq	Phase_1	62	19	NM_001008781	0	0	0	0	0	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.		0.413	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
ARHGAP20	57569	hgsc.bcm.edu;broad.mit.edu	37	11	110454361	110454361	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:110454361C>G	ENST00000260283.4	-	14	1800	c.1516G>C	c.(1516-1518)Gca>Cca	p.A506P	ARHGAP20_ENST00000533353.1_Missense_Mutation_p.A480P|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.A470P|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.A470P|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.A49P|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.A483P|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.A480P	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	506	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		AAATTAAATGCAGTCATCTGA	0.418																																					p.A506P		.											.	ARHGAP20-230	0			c.G1516C						.						138.0	119.0	125.0					11																	110454361		2201	4298	6499	SO:0001583	missense	57569	exon14			TAAATGCAGTCAT	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.1516G>C	11.37:g.110454361C>G	ENSP00000260283:p.Ala506Pro	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	10	3	NM_020809	0	0	1	1	0	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.840548	0.71488	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13;2.13	5.78	3.9	0.45041	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.059348	0.64402	D	0.000006	T	0.35307	0.0927	L	0.45051	1.395	0.47407	D	0.999418	P;P;P	0.50066	0.931;0.89;0.867	D;D;D	0.67103	0.931;0.949;0.915	T	0.03493	-1.1031	10	0.56958	D	0.05	.	11.2223	0.48862	0.1286:0.8054:0.0:0.066	.	480;506;483	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	P	506;480;49;483;470;480;470	ENSP00000260283:A506P;ENSP00000349660:A480P;ENSP00000437905:A49P;ENSP00000432076:A483P;ENSP00000436319:A470P;ENSP00000436522:A480P;ENSP00000431399:A470P	ENSP00000260283:A506P	A	-	1	0	ARHGAP20	109959571	0.996000	0.38824	0.448000	0.26945	0.922000	0.55478	3.402000	0.52608	0.889000	0.36185	0.591000	0.81541	GCA	.		0.418	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
ST3GAL4	6484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	126276866	126276866	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:126276866G>C	ENST00000526727.1	+	3	504	c.130G>C	c.(130-132)Gag>Cag	p.E44Q	ST3GAL4_ENST00000227495.6_Missense_Mutation_p.E40Q|ST3GAL4_ENST00000356132.4_Missense_Mutation_p.E44Q|ST3GAL4_ENST00000532243.1_Missense_Mutation_p.E43Q|ST3GAL4_ENST00000530591.1_Missense_Mutation_p.E40Q|ST3GAL4_ENST00000534457.1_Missense_Mutation_p.E39Q|ST3GAL4_ENST00000534083.1_Missense_Mutation_p.E44Q|ST3GAL4_ENST00000444328.2_Missense_Mutation_p.E44Q|ST3GAL4_ENST00000449406.2_Missense_Mutation_p.E33Q|ST3GAL4_ENST00000392669.2_Missense_Mutation_p.E44Q|ST3GAL4_ENST00000526756.1_3'UTR			Q11206	SIA4C_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 4	44					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|monosialoganglioside sialyltransferase activity (GO:0047288)			endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)		AGAGAAGAAGGAGCCGTGCCT	0.547																																					p.E44Q		.											.	ST3GAL4-90	0			c.G130C						.						85.0	86.0	86.0					11																	126276866		2201	4298	6499	SO:0001583	missense	6484	exon4			AAGAAGGAGCCGT	X74570	CCDS8474.1, CCDS58193.1, CCDS58194.1	11q23-q24	2013-03-01	2003-01-14	2005-02-07	ENSG00000110080	ENSG00000110080	2.4.99.4	"""Sialyltransferases"""	10864	protein-coding gene	gene with protein product	"""ST3Gal IV"""	104240	"""sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase)"""	CGS23, SIAT4, NANTA3, SIAT4C		8557707, 8288606	Standard	NM_006278		Approved	STZ, SAT3, FLJ11867	uc001qds.3	Q11206	OTTHUMG00000165830	ENST00000526727.1:c.130G>C	11.37:g.126276866G>C	ENSP00000436047:p.Glu44Gln	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	419	165	NM_001254757	0	0	14	50	36	A8K6B2|O60497|Q8N6A6|Q8NFG7|Q96QQ9	Missense_Mutation	SNP	ENST00000526727.1	37	CCDS58193.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.349790	0.41599	.	.	ENSG00000110080	ENST00000227495;ENST00000444328;ENST00000356132;ENST00000530591;ENST00000534083;ENST00000526311;ENST00000528858;ENST00000534452;ENST00000392669;ENST00000526727;ENST00000449406;ENST00000532243;ENST00000534457	T;T;T;T;T;T;T;T;T;T;T	0.43688	0.94;0.94;0.97;0.94;0.94;0.94;0.94;0.94;0.95;0.94;0.94	5.4	3.42	0.39159	.	0.741690	0.13270	N	0.400600	T	0.28234	0.0697	L	0.50333	1.59	0.09310	N	1	P;P;P	0.49559	0.925;0.454;0.454	B;B;B	0.37346	0.247;0.105;0.105	T	0.09530	-1.0670	10	0.13470	T	0.59	.	6.0778	0.19925	0.1787:0.1907:0.6306:0.0	.	25;40;44	Q9HAA9;Q6IBE6;Q11206	.;.;SIA4C_HUMAN	Q	40;44;44;40;44;44;44;44;44;44;33;43;39	ENSP00000227495:E40Q;ENSP00000394354:E44Q;ENSP00000348451:E44Q;ENSP00000433989:E40Q;ENSP00000433318:E44Q;ENSP00000432424:E44Q;ENSP00000376437:E44Q;ENSP00000436047:E44Q;ENSP00000399444:E33Q;ENSP00000434349:E43Q;ENSP00000434668:E39Q	ENSP00000227495:E40Q	E	+	1	0	ST3GAL4	125782076	0.018000	0.18449	0.992000	0.48379	0.963000	0.63663	1.290000	0.33319	2.527000	0.85204	0.561000	0.74099	GAG	.		0.547	ST3GAL4-003	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386470.1	NM_006278	
ACAD8	27034	bcgsc.ca	37	11	134127129	134127129	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:134127129A>C	ENST00000281182.4	+	3	464	c.358A>C	c.(358-360)Aca>Cca	p.T120P	ACAD8_ENST00000537423.1_Missense_Mutation_p.T43P|ACAD8_ENST00000543332.1_Intron|ACAD8_ENST00000524547.1_Intron|ACAD8_ENST00000374752.4_Intron	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	120					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	CACCAGCACCACAGCCTATAT	0.512																																					p.T120P	GBM(65;238 1125 33403 41853 48889)												.	ACAD8-90	0			c.A358C						.						69.0	63.0	65.0					11																	134127129		2201	4297	6498	SO:0001583	missense	27034	exon3			AGCACCACAGCCT	AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	ENST00000281182.4:c.358A>C	11.37:g.134127129A>C	ENSP00000281182:p.Thr120Pro	Somatic	55	0		WXS	Illumina HiSeq	Phase_1	97	39	NM_014384	0	0	26	26	0	B7Z5W4|Q6ZWP6|Q9BUS8	Missense_Mutation	SNP	ENST00000281182.4	37	CCDS8498.1	.	.	.	.	.	.	.	.	.	.	A	28.7	4.944585	0.92593	.	.	ENSG00000151498	ENST00000281182;ENST00000537423;ENST00000537915	D;D	0.99709	-6.48;-6.48	5.73	5.73	0.89815	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99674	0.9878	M	0.83692	2.655	0.80722	D	1	D;D;D	0.76494	0.983;0.998;0.999	D;D;D	0.76575	0.922;0.981;0.988	D	0.97633	1.0143	10	0.72032	D	0.01	.	16.0021	0.80301	1.0:0.0:0.0:0.0	.	61;43;120	B7Z767;B7Z5W4;Q9UKU7	.;.;ACAD8_HUMAN	P	120;43;82	ENSP00000281182:T120P;ENSP00000443763:T43P	ENSP00000281182:T120P	T	+	1	0	ACAD8	133632339	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.167000	0.94773	2.192000	0.70111	0.533000	0.62120	ACA	.		0.512	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393607.1	NM_014384	
WNK1	65125	bcgsc.ca	37	12	977305	977305	+	Intron	SNP	A	A	C	rs375911794		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:977305A>C	ENST00000315939.6	+	9	2782				WNK1_ENST00000574564.1_Missense_Mutation_p.T104P|WNK1_ENST00000537687.1_Missense_Mutation_p.T805P|WNK1_ENST00000530271.2_Missense_Mutation_p.T890P|WNK1_ENST00000340908.4_Intron|WNK1_ENST00000535572.1_Intron	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.T805P(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GTTGGGTACTACAGCCAGTAG	0.493																																					p.T890P	Colon(19;451 567 6672 12618 28860)												.	WNK1-916	1	Substitution - Missense(1)	prostate(1)	c.A2668C						.						78.0	77.0	77.0					12																	977305		1926	4131	6057	SO:0001627	intron_variant	65125	exon10			GGTACTACAGCCA	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2140-3126A>C	12.37:g.977305A>C		Somatic	67	0		WXS	Illumina HiSeq	Phase_1	114	53	NM_213655	0	0	0	0	0	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	A	4.389	0.071873	0.08436	.	.	ENSG00000060237	ENST00000537687;ENST00000530271	T;T	0.15718	2.4;2.4	5.15	-0.612	0.11597	.	.	.	.	.	T	0.05410	0.0143	.	.	.	0.80722	D	1	B	0.19583	0.037	B	0.21151	0.033	T	0.41395	-0.9511	8	0.02654	T	1	.	4.0408	0.09750	0.4731:0.0:0.2889:0.2381	.	890	F5H2M7	.	P	805;890	ENSP00000444465:T805P;ENSP00000433548:T890P	ENSP00000433548:T890P	T	+	1	0	WNK1	847566	0.661000	0.27430	0.556000	0.28293	0.869000	0.49853	1.016000	0.29976	0.047000	0.15862	0.383000	0.25322	ACA	.		0.493	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
WNK1	65125	bcgsc.ca	37	12	988849	988849	+	Silent	SNP	A	A	C	rs201077153		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:988849A>C	ENST00000315939.6	+	11	3127	c.2484A>C	c.(2482-2484)ggA>ggC	p.G828G	WNK1_ENST00000537687.1_Intron|WNK1_ENST00000530271.2_Silent_p.G1326G|WNK1_ENST00000340908.4_Silent_p.G421G|WNK1_ENST00000535572.1_Intron	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	828					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTCCAGTGGGACAGCCGCTCC	0.547																																					p.G828G	Colon(19;451 567 6672 12618 28860)												.	WNK1-916	0			c.A2484C						.						164.0	140.0	148.0					12																	988849		2203	4300	6503	SO:0001819	synonymous_variant	65125	exon11			AGTGGGACAGCCG	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2484A>C	12.37:g.988849A>C		Somatic	140	0		WXS	Illumina HiSeq	Phase_1	85	20	NM_018979	0	0	4	4	0	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	37	CCDS8506.1																																																																																			.		0.547	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
C1S	716	bcgsc.ca	37	12	7171607	7171607	+	Missense_Mutation	SNP	G	G	T	rs201505473		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:7171607G>T	ENST00000406697.1	+	8	1056	c.428G>T	c.(427-429)tGt>tTt	p.C143F	C1S_ENST00000328916.3_Missense_Mutation_p.C143F|C1S_ENST00000360817.5_Missense_Mutation_p.C143F|C1S_ENST00000402681.3_5'UTR			P09871	C1S_HUMAN	complement component 1, s subcomponent	143	EGF-like; calcium-binding.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	GATGTCCCTTGTAGCCACTTC	0.433																																					p.C143F	GBM(156;750 1943 12971 24779 31015)												.	C1S-91	0			c.G428T						.						183.0	183.0	183.0					12																	7171607		2203	4300	6503	SO:0001583	missense	716	exon5			TCCCTTGTAGCCA		CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.428G>T	12.37:g.7171607G>T	ENSP00000385035:p.Cys143Phe	Somatic	213	0		WXS	Illumina HiSeq	Phase_1	168	36	NM_201442	1	0	91	92	0	D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Missense_Mutation	SNP	ENST00000406697.1	37	CCDS31735.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428176	0.83667	.	.	ENSG00000182326	ENST00000406697;ENST00000328916;ENST00000360817;ENST00000382222;ENST00000403949	D;D;D;D	0.99818	-6.92;-6.92;-6.92;-5.91	5.96	5.96	0.96718	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);	0.000000	0.46145	D	0.000314	D	0.99921	0.9963	H	0.99368	4.535	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96217	0.9157	10	0.87932	D	0	.	19.4101	0.94667	0.0:0.0:1.0:0.0	.	143	P09871	C1S_HUMAN	F	143;143;143;132;143	ENSP00000385035:C143F;ENSP00000328173:C143F;ENSP00000354057:C143F;ENSP00000384464:C143F	ENSP00000328173:C143F	C	+	2	0	C1S	7041868	1.000000	0.71417	0.989000	0.46669	0.839000	0.47603	8.555000	0.90693	2.832000	0.97577	0.655000	0.94253	TGT	.		0.433	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317481.1	NM_001734	
CD163	9332	bcgsc.ca	37	12	7654024	7654024	+	Silent	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:7654024A>C	ENST00000359156.4	-	3	370	c.168T>G	c.(166-168)ggT>ggG	p.G56G	CD163_ENST00000432237.2_Silent_p.G56G|CD163_ENST00000396620.3_Silent_p.G56G|CD163_ENST00000541972.1_Silent_p.G44G	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	56	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	ACTTGTTTTCACCATCCACTA	0.458																																					p.G56G													.	CD163-98	0			c.T168G						.						136.0	123.0	127.0					12																	7654024		2203	4300	6503	SO:0001819	synonymous_variant	9332	exon3			GTTTTCACCATCC	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.168T>G	12.37:g.7654024A>C		Somatic	156	0		WXS	Illumina HiSeq	Phase_1	57	28	NM_203416	0	0	34	37	3	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Silent	SNP	ENST00000359156.4	37	CCDS8578.1																																																																																			.		0.458	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416	
PKP2	5318	bcgsc.ca	37	12	32974403	32974403	+	Missense_Mutation	SNP	A	A	C	rs200327989		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:32974403A>C	ENST00000070846.6	-	10	2056	c.2032T>G	c.(2032-2034)Tgg>Ggg	p.W678G	PKP2_ENST00000340811.4_Missense_Mutation_p.W634G	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	678					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					ATGGAATGCCACAGCCACTCC	0.502																																					p.W678G													.	PKP2-92	0			c.T2032G						.						95.0	80.0	85.0					12																	32974403		2203	4300	6503	SO:0001583	missense	5318	exon10			AATGCCACAGCCA	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.2032T>G	12.37:g.32974403A>C	ENSP00000070846:p.Trp678Gly	Somatic	70	1		WXS	Illumina HiSeq	Phase_1	32	14	NM_004572	0	0	1	1	0	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	ENST00000070846.6	37	CCDS8731.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.053939	0.75960	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.84223	-1.82;-1.82	4.88	4.88	0.63580	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.92708	0.7682	M	0.86420	2.815	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.93797	0.7097	10	0.87932	D	0	-20.5891	13.0643	0.59024	1.0:0.0:0.0:0.0	.	634;634;678	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	G	634;678;678	ENSP00000342800:W634G;ENSP00000070846:W678G	ENSP00000070846:W678G	W	-	1	0	PKP2	32865670	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.949000	0.87791	1.815000	0.52974	0.460000	0.39030	TGG	.		0.502	PKP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404449.1	NM_004572	
SLC11A2	4891	bcgsc.ca	37	12	51384724	51384724	+	Missense_Mutation	SNP	G	G	C	rs199589052		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:51384724G>C	ENST00000262051.7	-	15	1516	c.1429C>G	c.(1429-1431)Cgg>Ggg	p.R477G	SLC11A2_ENST00000547688.1_Missense_Mutation_p.R506G|SLC11A2_ENST00000545993.2_Missense_Mutation_p.R473G|SLC11A2_ENST00000541174.2_Missense_Mutation_p.R477G|SLC11A2_ENST00000546743.1_Missense_Mutation_p.R398G|SLC11A2_ENST00000262052.5_Missense_Mutation_p.R477G|SLC11A2_ENST00000394904.3_Missense_Mutation_p.R506G|SLC11A2_ENST00000547198.1_Missense_Mutation_p.R477G	NM_001174126.1|NM_001174127.1	NP_001167597.1|NP_001167598.1	P49281	NRAM2_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2	477					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cadmium ion transmembrane transport (GO:0070574)|cation transmembrane transport (GO:0098655)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to iron ion (GO:0071281)|cellular response to oxidative stress (GO:0034599)|cellular response to tumor necrosis factor (GO:0071356)|cobalt ion transport (GO:0006824)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detection of oxygen (GO:0003032)|erythrocyte development (GO:0048821)|ferrous iron import (GO:0070627)|ferrous iron transport (GO:0015684)|heme biosynthetic process (GO:0006783)|lead ion transport (GO:0015692)|learning or memory (GO:0007611)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organismal iron ion homeostasis (GO:0060586)|nickel cation transmembrane transport (GO:0035444)|nickel cation transport (GO:0015675)|response to cadmium ion (GO:0046686)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to lead ion (GO:0010288)|response to manganese ion (GO:0010042)|transmembrane transport (GO:0055085)|vanadium ion transport (GO:0015676)|zinc ion transmembrane transport (GO:0071577)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|brush border (GO:0005903)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|paraferritin complex (GO:0070826)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)	cadmium ion binding (GO:0046870)|cadmium ion transmembrane transporter activity (GO:0015086)|cobalt ion binding (GO:0050897)|cobalt ion transmembrane transporter activity (GO:0015087)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|ferrous iron transmembrane transporter activity (GO:0015093)|hydrogen ion transmembrane transporter activity (GO:0015078)|inorganic cation transmembrane transporter activity (GO:0022890)|iron ion binding (GO:0005506)|lead ion transmembrane transporter activity (GO:0015094)|manganese ion binding (GO:0030145)|manganese ion transmembrane transporter activity (GO:0005384)|nickel cation binding (GO:0016151)|nickel cation transmembrane transporter activity (GO:0015099)|solute:proton symporter activity (GO:0015295)|vanadium ion transmembrane transporter activity (GO:0015100)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|cervix(1)|endometrium(3)|kidney(16)|large_intestine(4)|lung(9)|upper_aerodigestive_tract(1)	36						CCTGCAATCCGCCAGCCTCTG	0.438																																					p.R506G													.	SLC11A2-153	0			c.C1516G						.						70.0	63.0	65.0					12																	51384724		2203	4300	6503	SO:0001583	missense	4891	exon15			CAATCCGCCAGCC	AB015355	CCDS8805.1, CCDS53791.1, CCDS53792.1, CCDS53793.1	12q13	2013-07-18	2013-07-18		ENSG00000110911	ENSG00000110911		"""Solute carriers"""	10908	protein-coding gene	gene with protein product		600523		NRAMP2		7613023	Standard	NM_000617		Approved	DCT1, DMT1	uc001rxk.2	P49281	OTTHUMG00000169493	ENST00000262051.7:c.1429C>G	12.37:g.51384724G>C	ENSP00000262051:p.Arg477Gly	Somatic	78	0		WXS	Illumina HiSeq	Phase_1	29	12	NM_001174125	0	0	0	0	0	B3KT08|B4DK84|F5H741|O43288|O60932|O94801|Q498Z5|Q8IUD7|Q96J35	Missense_Mutation	SNP	ENST00000262051.7	37	CCDS53792.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.811787	0.50527	.	.	ENSG00000110911	ENST00000262051;ENST00000547198;ENST00000262052;ENST00000394904;ENST00000547688;ENST00000541174;ENST00000545993;ENST00000546743	T;T;T;T;T;T;T;T	0.30714	1.92;1.92;1.92;1.91;1.91;1.92;1.92;1.52	5.91	2.1	0.27182	.	0.090350	0.85682	D	0.000000	T	0.34861	0.0912	M	0.63428	1.95	0.37707	D	0.924444	B;B;B;B;B;B	0.30033	0.105;0.169;0.266;0.169;0.005;0.001	B;B;B;B;B;B	0.36335	0.051;0.222;0.222;0.109;0.013;0.004	T	0.37911	-0.9685	10	0.72032	D	0.01	-11.6909	12.8814	0.58020	0.0:0.0:0.4077:0.5923	.	440;473;506;477;326;477	B7Z9M2;F5H741;P49281-3;P49281-2;B3KY44;P49281	.;.;.;.;.;NRAM2_HUMAN	G	477;477;477;506;506;477;473;398	ENSP00000262051:R477G;ENSP00000446769:R477G;ENSP00000262052:R477G;ENSP00000378364:R506G;ENSP00000449200:R506G;ENSP00000444542:R477G;ENSP00000442810:R473G;ENSP00000446914:R398G	ENSP00000262051:R477G	R	-	1	2	SLC11A2	49670991	1.000000	0.71417	0.999000	0.59377	0.898000	0.52572	2.789000	0.47813	0.105000	0.17753	-0.271000	0.10264	CGG	G|0.998;C|0.002		0.438	SLC11A2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404383.1		
CCDC59	29080	bcgsc.ca	37	12	82750844	82750844	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:82750844T>G	ENST00000256151.7	-	2	770	c.359A>C	c.(358-360)cAc>cCc	p.H120P	METTL25_ENST00000248306.3_5'Flank|CCDC59_ENST00000548126.1_5'UTR	NM_014167.4	NP_054886.2	Q9P031	TAP26_HUMAN	coiled-coil domain containing 59	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)	5						CAACGGCTGGTGAACTTGTTC	0.413																																					p.H120P													.	CCDC59-90	0			c.A359C						.						194.0	172.0	179.0					12																	82750844		2203	4300	6503	SO:0001583	missense	29080	exon2			GGCTGGTGAACTT	AF213377	CCDS9023.1	12q21.31	2007-10-17				ENSG00000133773			25005	protein-coding gene	gene with protein product						16630564, 12882447	Standard	NM_014167		Approved	HSPC128, TAP26, BR22	uc001szp.4	Q9P031		ENST00000256151.7:c.359A>C	12.37:g.82750844T>G	ENSP00000256151:p.His120Pro	Somatic	140	3		WXS	Illumina HiSeq	Phase_1	107	53	NM_014167	0	0	27	27	0	Q9H2V5|Q9NW62	Missense_Mutation	SNP	ENST00000256151.7	37	CCDS9023.1	.	.	.	.	.	.	.	.	.	.	T	3.450	-0.112256	0.06881	.	.	ENSG00000133773	ENST00000552377;ENST00000256151	.	.	.	4.05	0.154	0.14901	.	0.563015	0.19793	N	0.105924	T	0.20414	0.0491	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.17433	0.018	T	0.18555	-1.0333	9	0.31617	T	0.26	-37.4784	9.771	0.40589	0.0:0.0:0.5532:0.4468	.	120	Q9P031	TAP26_HUMAN	P	120	.	ENSP00000256151:H120P	H	-	2	0	CCDC59	81274975	0.000000	0.05858	0.000000	0.03702	0.151000	0.21798	0.221000	0.17680	0.024000	0.15214	-0.313000	0.08912	CAC	.		0.413	CCDC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408186.1	NM_014167	
UBE2N	7334	bcgsc.ca	37	12	93804525	93804525	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:93804525G>T	ENST00000318066.2	-	3	780	c.403C>A	c.(403-405)Caa>Aaa	p.Q135K	UBE2N_ENST00000552442.1_Intron|UBE2N_ENST00000550657.1_3'UTR|UBE2N_ENST00000549833.1_Missense_Mutation_p.Q72K	NM_003348.3	NP_003339.1	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N	135					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|DNA double-strand break processing (GO:0000729)|double-strand break repair via homologous recombination (GO:0000724)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone ubiquitination (GO:0016574)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone modification (GO:0031058)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|postreplication repair (GO:0006301)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of DNA repair (GO:0006282)|regulation of histone ubiquitination (GO:0033182)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-MMS2 complex (GO:0031372)|UBC13-UEV1A complex (GO:0035370)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|liver(2)|lung(5)	10						TCTATGGCTTGGGCTTCGTTG	0.428								Direct reversal of damage;Rad6 pathway																													p.Q135K	Pancreas(197;738 2228 30225 32034 33454)												.	UBE2N-659	0			c.C403A						.						177.0	154.0	162.0					12																	93804525		2203	4300	6503	SO:0001583	missense	7334	exon3			TGGCTTGGGCTTC	D83004	CCDS31875.1	12q22	2011-05-19	2011-05-19			ENSG00000177889		"""Ubiquitin-conjugating enzymes E2"""	12492	protein-coding gene	gene with protein product		603679	"""ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)"", ""ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)"""			8902611	Standard	NM_003348		Approved	UbcH-ben, UBC13, MGC8489	uc001tcp.3	P61088	OTTHUMG00000170156	ENST00000318066.2:c.403C>A	12.37:g.93804525G>T	ENSP00000316176:p.Gln135Lys	Somatic	206	0		WXS	Illumina HiSeq	Phase_1	110	30	NM_003348	0	0	110	116	6	Q16781|Q53Y81	Missense_Mutation	SNP	ENST00000318066.2	37	CCDS31875.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.395622	0.42512	.	.	ENSG00000177889	ENST00000318066;ENST00000549833	T;T	0.36340	1.26;1.26	5.94	5.94	0.96194	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	.	.	.	.	T	0.21468	0.0517	N	0.11341	0.13	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.15549	-1.0433	9	0.02654	T	1	.	20.3736	0.98901	0.0:0.0:1.0:0.0	.	135	P61088	UBE2N_HUMAN	K	135;72	ENSP00000316176:Q135K;ENSP00000450260:Q72K	ENSP00000316176:Q135K	Q	-	1	0	UBE2N	92328656	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.814000	0.62627	2.820000	0.97059	0.650000	0.86243	CAA	.		0.428	UBE2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407710.1	NM_003348	
MYBPC1	4604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	102038482	102038482	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:102038482A>T	ENST00000550270.1	+	10	798	c.798A>T	c.(796-798)aaA>aaT	p.K266N	MYBPC1_ENST00000452455.2_Missense_Mutation_p.K266N|MYBPC1_ENST00000547509.1_Missense_Mutation_p.K252N|MYBPC1_ENST00000541119.1_Missense_Mutation_p.K254N|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000441232.1_Missense_Mutation_p.K266N|MYBPC1_ENST00000360610.2_Missense_Mutation_p.K266N|MYBPC1_ENST00000551300.1_Missense_Mutation_p.K167N|MYBPC1_ENST00000361685.2_Missense_Mutation_p.K291N|MYBPC1_ENST00000545503.2_Missense_Mutation_p.K266N|MYBPC1_ENST00000536007.1_Missense_Mutation_p.K247N|MYBPC1_ENST00000361466.2_Missense_Mutation_p.K291N|MYBPC1_ENST00000553190.1_Missense_Mutation_p.K266N|MYBPC1_ENST00000392934.3_Missense_Mutation_p.K253N|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000547405.1_Missense_Mutation_p.K240N|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000549145.1_Missense_Mutation_p.K279N			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	266	Ig-like C2-type 2.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						AGGTTGACAAAGGAGGCAGAG	0.368																																					p.K291N		.											.	MYBPC1-94	0			c.A873T						.						86.0	82.0	83.0					12																	102038482		2203	4300	6503	SO:0001583	missense	4604	exon12			TGACAAAGGAGGC		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.798A>T	12.37:g.102038482A>T	ENSP00000449702:p.Lys266Asn	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	65	18	NM_206819	0	0	0	0	0	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	ENST00000550270.1	37	CCDS9085.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.395297	0.83011	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000540770;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.8	5.8	0.92144	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000037	T	0.69806	0.3152	M	0.87328	2.875	0.80722	D	1	P;D;D;D;D;P;D;D;P;D;D	0.89917	0.623;1.0;0.999;1.0;0.999;0.623;0.999;1.0;0.863;0.999;0.999	P;D;D;D;D;P;D;D;P;D;D	0.91635	0.499;0.999;0.993;0.999;0.998;0.627;0.998;0.999;0.614;0.998;0.999	T	0.75926	-0.3145	10	0.87932	D	0	.	15.8202	0.78633	1.0:0.0:0.0:0.0	.	247;254;266;266;253;240;266;266;291;291;279	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2;F8VZY0	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.;.	N	240;266;266;266;253;252;291;279;266;291;266;247;254;291;167;266	ENSP00000448175:K240N;ENSP00000400908:K266N;ENSP00000388989:K266N;ENSP00000353822:K266N;ENSP00000376665:K253N;ENSP00000447362:K252N;ENSP00000354845:K291N;ENSP00000447660:K279N;ENSP00000447900:K266N;ENSP00000440034:K266N;ENSP00000446128:K247N;ENSP00000442847:K254N;ENSP00000354849:K291N;ENSP00000447116:K167N;ENSP00000449702:K266N	ENSP00000353822:K266N	K	+	3	2	MYBPC1	100562613	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.038000	0.64177	2.212000	0.71576	0.533000	0.62120	AAA	.		0.368	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1		
STAB2	55576	bcgsc.ca	37	12	104030938	104030938	+	Silent	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:104030938G>C	ENST00000388887.2	+	7	837	c.633G>C	c.(631-633)tcG>tcC	p.S211S		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCAGATGTTCGCCTTCCACTG	0.433																																					p.S211S													.	STAB2-104	0			c.G633C						.						117.0	116.0	116.0					12																	104030938		2203	4300	6503	SO:0001819	synonymous_variant	55576	exon7			ATGTTCGCCTTCC	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.633G>C	12.37:g.104030938G>C		Somatic	109	0		WXS	Illumina HiSeq	Phase_1	78	35	NM_017564	0	0	0	0	0		Silent	SNP	ENST00000388887.2	37	CCDS31888.1																																																																																			.		0.433	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
ACAD10	80724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	112174685	112174685	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:112174685T>A	ENST00000313698.4	+	12	1746	c.1591T>A	c.(1591-1593)Tat>Aat	p.Y531N	ACAD10_ENST00000549590.1_Missense_Mutation_p.Y531N|ACAD10_ENST00000392636.2_Missense_Mutation_p.Y133N|ACAD10_ENST00000455480.2_Missense_Mutation_p.Y562N|ACAD10_ENST00000413681.3_3'UTR	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	531						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TGCAGAGGAGTATTTCAGGAT	0.502																																					p.Y562N		.											.	ACAD10-92	0			c.T1684A						.						124.0	112.0	116.0					12																	112174685		2203	4300	6503	SO:0001583	missense	80724	exon13			GAGGAGTATTTCA	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.1591T>A	12.37:g.112174685T>A	ENSP00000325137:p.Tyr531Asn	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	132	50	NM_001136538	0	0	13	26	13	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.801553	0.70682	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000549590;ENST00000455480;ENST00000313698	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.29	4.14	0.48551	Protein kinase-like domain (1);	0.289517	0.34133	N	0.004238	T	0.61887	0.2383	M	0.92880	3.355	0.37403	D	0.912927	D;D;D	0.89917	0.997;0.999;1.0	P;D;D	0.91635	0.879;0.957;0.999	T	0.72020	-0.4416	10	0.66056	D	0.02	.	10.4594	0.44570	0.0:0.0776:0.0:0.9224	.	562;531;531	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	N	133;531;531;562;531	ENSP00000376411:Y133N;ENSP00000446959:Y531N;ENSP00000389813:Y562N;ENSP00000325137:Y531N	ENSP00000325137:Y531N	Y	+	1	0	ACAD10	110659068	0.972000	0.33761	0.981000	0.43875	0.974000	0.67602	1.626000	0.37039	0.863000	0.35553	0.459000	0.35465	TAT	.		0.502	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247	
SPPL3	121665	bcgsc.ca	37	12	121206290	121206290	+	Splice_Site	SNP	A	A	C	rs200945160		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:121206290A>C	ENST00000353487.2	-	8	1114	c.611T>G	c.(610-612)gTa>gGa	p.V204G		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	205						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)					all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGAGAAAAATACCTGCCGAGT	0.517																																					p.V204G													.	.	0			c.T611G						.																																			SO:0001630	splice_region_variant	121665	exon8			AAAAATACCTGCC		CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.610-1T>G	12.37:g.121206290A>C		Somatic	93	3		WXS	Illumina HiSeq	Phase_1	134	62	NM_139015	0	0	0	0	0	Q3MJ04|Q8TAU4|Q96DD9	Missense_Mutation	SNP	ENST00000353487.2	37	CCDS9208.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.846716	0.91277	.	.	ENSG00000157837	ENST00000353487;ENST00000405631;ENST00000536996	T;T	0.39787	1.06;1.06	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.74268	0.3694	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82575	-0.0389	10	0.87932	D	0	-19.2687	15.6471	0.77063	1.0:0.0:0.0:0.0	.	205;204	Q8TCT6;Q3MJ04	PSL4_HUMAN;.	G	204;203;167	ENSP00000288680:V204G;ENSP00000442484:V167G	ENSP00000288680:V204G	V	-	2	0	AC069214.1	119690673	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.962000	0.93254	2.101000	0.63845	0.482000	0.46254	GTA	.		0.517	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402980.2	NM_139015	Missense_Mutation
KNTC1	9735	broad.mit.edu;ucsc.edu	37	12	123105091	123105091	+	Missense_Mutation	SNP	C	C	T	rs370269719		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:123105091C>T	ENST00000333479.7	+	60	6392	c.6215C>T	c.(6214-6216)cCg>cTg	p.P2072L	KNTC1_ENST00000450485.2_Missense_Mutation_p.P997L|HCAR1_ENST00000356987.2_3'UTR|KNTC1_ENST00000436959.3_5'UTR|KNTC1_ENST00000534995.1_5'UTR|KNTC1_ENST00000537348.1_3'UTR	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	2072					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTAGAACTTCCGGCTTTTGCA	0.458																																					p.P2072L													.	KNTC1-543	0			c.C6215T						.	C	LEU/PRO	2,3962		0,2,1980	87.0	82.0	84.0		6215	5.6	1.0	12		84	0,8364		0,0,4182	no	missense	KNTC1	NM_014708.4	98	0,2,6162	TT,TC,CC		0.0,0.0505,0.0162	probably-damaging	2072/2210	123105091	2,12326	1982	4182	6164	SO:0001583	missense	9735	exon60			AACTTCCGGCTTT		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.6215C>T	12.37:g.123105091C>T	ENSP00000328236:p.Pro2072Leu	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	51	4	NM_014708	0	0	7	7	0	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028470	0.75390	5.05E-4	0.0	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.33216	1.42;1.42	5.62	5.62	0.85841	RZZ complex, subunit KNTC1/ROD, C-terminal (1);	0.048083	0.85682	D	0.000000	T	0.55893	0.1949	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.984;0.998	T	0.49062	-0.8978	10	0.37606	T	0.19	-18.0077	19.2653	0.93983	0.0:1.0:0.0:0.0	.	997;2072	E7ES84;P50748	.;KNTC1_HUMAN	L	997;2072	ENSP00000397992:P997L;ENSP00000328236:P2072L	ENSP00000328236:P2072L	P	+	2	0	KNTC1	121671044	1.000000	0.71417	0.956000	0.39512	0.220000	0.24768	6.355000	0.73041	2.665000	0.90641	0.650000	0.86243	CCG	.		0.458	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
RIMBP2	23504	bcgsc.ca	37	12	130892349	130892349	+	Silent	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:130892349A>C	ENST00000261655.4	-	16	3010	c.2847T>G	c.(2845-2847)cgT>cgG	p.R949R		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	949					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		ATACCGAATGACGCCTGCCAC	0.532																																					p.R949R													.	RIMBP2-142	0			c.T2847G						.						210.0	166.0	181.0					12																	130892349		2203	4300	6503	SO:0001819	synonymous_variant	23504	exon16			CGAATGACGCCTG	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2847T>G	12.37:g.130892349A>C		Somatic	190	0		WXS	Illumina HiSeq	Phase_1	299	110	NM_015347	0	0	0	0	0	Q96ID2	Silent	SNP	ENST00000261655.4	37	CCDS31925.1																																																																																			.		0.532	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
EP400	57634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	132551479	132551479	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:132551479T>A	ENST00000333577.4	+	50	8931	c.8822T>A	c.(8821-8823)aTc>aAc	p.I2941N	EP400_ENST00000332482.4_Missense_Mutation_p.I2868N|EP400_ENST00000389562.2_Missense_Mutation_p.I2904N|EP400_ENST00000389561.2_Missense_Mutation_p.I2905N|EP400_ENST00000330386.6_Missense_Mutation_p.I2824N			Q96L91	EP400_HUMAN	E1A binding protein p400	2941					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GTCGCGGGGATCAGCGTGGCG	0.687																																					p.I2905N		.											.	EP400-520	0			c.T8714A						.						29.0	29.0	29.0					12																	132551479		2203	4299	6502	SO:0001583	missense	57634	exon49			CGGGGATCAGCGT	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8822T>A	12.37:g.132551479T>A	ENSP00000333602:p.Ile2941Asn	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	89	35	NM_015409	0	0	9	15	6	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	T	18.43	3.621758	0.66787	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.92545	-3.06;-3.05;-2.99;-3.01;-3.02	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.93112	0.7807	L	0.34521	1.04	0.44899	D	0.997913	D;D;D;D	0.89917	0.992;1.0;1.0;1.0	D;D;D;D	0.87578	0.976;0.998;0.998;0.998	D	0.92827	0.6277	10	0.40728	T	0.16	.	14.4084	0.67099	0.0:0.0:0.0:1.0	.	2941;2905;2824;2904	Q96L91;Q96L91-2;Q96L91-4;Q96L91-5	EP400_HUMAN;.;.;.	N	2941;2905;2904;2868;2824;2905	ENSP00000333602:I2941N;ENSP00000374212:I2905N;ENSP00000374213:I2904N;ENSP00000331737:I2868N;ENSP00000330620:I2824N	ENSP00000330620:I2824N	I	+	2	0	EP400	131117432	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	1.817000	0.53016	0.454000	0.30748	ATC	.		0.687	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
IFT88	8100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	21189985	21189985	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:21189985T>G	ENST00000319980.6	+	16	1520	c.1193T>G	c.(1192-1194)gTa>gGa	p.V398G	IFT88_ENST00000461115.1_3'UTR|IFT88_ENST00000537103.1_Missense_Mutation_p.V370G|IFT88_ENST00000382778.4_Missense_Mutation_p.V398G|IFT88_ENST00000351808.5_Missense_Mutation_p.V389G	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	398					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		ATTGCTCCTGTAATTGAAACA	0.279																																					p.V398G		.											.	IFT88-91	0			c.T1193G						.						81.0	91.0	87.0					13																	21189985		2203	4295	6498	SO:0001583	missense	8100	exon16			CTCCTGTAATTGA	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1193T>G	13.37:g.21189985T>G	ENSP00000323580:p.Val398Gly	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	181	63	NM_175605	0	0	15	15	0	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	T	19.63	3.863350	0.71949	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.35789	1.31;1.29;1.29;1.31	5.59	3.19	0.36642	.	0.122813	0.56097	D	0.000035	T	0.34978	0.0916	M	0.74647	2.275	0.80722	D	1	B;P;P;B	0.37985	0.433;0.594;0.613;0.104	B;B;B;B	0.36845	0.234;0.164;0.197;0.058	T	0.22765	-1.0207	10	0.66056	D	0.02	-16.2168	6.1242	0.20170	0.0:0.3259:0.0:0.6741	.	370;398;196;398	F5H6C2;E7EW86;Q6MZX0;Q13099	.;.;.;IFT88_HUMAN	G	398;261;389;398;370	ENSP00000372228:V398G;ENSP00000261632:V389G;ENSP00000323580:V398G;ENSP00000437719:V370G	ENSP00000323580:V398G	V	+	2	0	IFT88	20087985	0.997000	0.39634	0.988000	0.46212	0.997000	0.91878	2.622000	0.46427	0.942000	0.37525	0.528000	0.53228	GTA	.		0.279	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
IFT88	8100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	21189988	21189988	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:21189988T>A	ENST00000319980.6	+	16	1523	c.1196T>A	c.(1195-1197)aTt>aAt	p.I399N	IFT88_ENST00000461115.1_3'UTR|IFT88_ENST00000537103.1_Missense_Mutation_p.I371N|IFT88_ENST00000382778.4_Missense_Mutation_p.I399N|IFT88_ENST00000351808.5_Missense_Mutation_p.I390N	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	399					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		GCTCCTGTAATTGAAACATCT	0.279																																					p.I399N		.											.	IFT88-91	0			c.T1196A						.						81.0	90.0	87.0					13																	21189988		2203	4293	6496	SO:0001583	missense	8100	exon16			CTGTAATTGAAAC	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.1196T>A	13.37:g.21189988T>A	ENSP00000323580:p.Ile399Asn	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	180	60	NM_175605	0	0	19	19	0	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.408083	0.83340	.	.	ENSG00000032742	ENST00000382778;ENST00000389374;ENST00000351808;ENST00000319980;ENST00000537103	T;T;T;T	0.40756	1.03;1.02;1.02;1.04	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.69717	0.3142	M	0.88105	2.93	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.998	D;D;D;D	0.79784	0.986;0.979;0.993;0.991	T	0.76564	-0.2913	10	0.87932	D	0	-20.545	14.7446	0.69480	0.0:0.0:0.0:1.0	.	371;399;197;399	F5H6C2;E7EW86;Q6MZX0;Q13099	.;.;.;IFT88_HUMAN	N	399;262;390;399;371	ENSP00000372228:I399N;ENSP00000261632:I390N;ENSP00000323580:I399N;ENSP00000437719:I371N	ENSP00000323580:I399N	I	+	2	0	IFT88	20087988	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.260000	0.78391	2.121000	0.65114	0.528000	0.53228	ATT	.		0.279	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
ATP8A2	51761	ucsc.edu	37	13	26156055	26156055	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:26156055G>T	ENST00000381655.2	+	23	2248	c.2106G>T	c.(2104-2106)tgG>tgT	p.W702C	ATP8A2_ENST00000255283.8_Missense_Mutation_p.W662C|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	662					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TTAAAATATGGGTGTTGACAG	0.373																																					p.W702C													.	ATP8A2-138	0			c.G2106T						.						85.0	79.0	81.0					13																	26156055		1831	4083	5914	SO:0001583	missense	51761	exon23			AATATGGGTGTTG	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.2106G>T	13.37:g.26156055G>T	ENSP00000371070:p.Trp702Cys	Somatic	72	0		WXS	Illumina HiSeq		76	4	NM_016529	0	0	0	0	0	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.615120	0.87359	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	D;D	0.96427	-4.01;-4.01	6.17	6.17	0.99709	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.99010	0.9662	H	0.97758	4.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98844	1.0756	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	662;482;662	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	C	702;662;482	ENSP00000371070:W702C;ENSP00000255283:W662C	ENSP00000255283:W662C	W	+	3	0	ATP8A2	25054055	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.756000	0.98918	2.941000	0.99782	0.655000	0.94253	TGG	.		0.373	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
BRCA2	675	bcgsc.ca	37	13	32906983	32906983	+	Silent	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:32906983G>A	ENST00000380152.3	+	10	1601	c.1368G>A	c.(1366-1368)gaG>gaA	p.E456E	BRCA2_ENST00000544455.1_Silent_p.E456E			P51587	BRCA2_HUMAN	breast cancer 2, early onset	456					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.E456D(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CAAAATCAGAGAAGCCATTAA	0.363			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.E456E	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2-3153	2	Substitution - Missense(2)	large_intestine(2)	c.G1368A						.						62.0	71.0	68.0					13																	32906983		2201	4296	6497	SO:0001819	synonymous_variant	675	exon10	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	ATCAGAGAAGCCA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.1368G>A	13.37:g.32906983G>A		Somatic	88	0		WXS	Illumina HiSeq	Phase_1	49	22	NM_000059	0	0	1	1	0	O00183|O15008|Q13879|Q5TBJ7	Silent	SNP	ENST00000380152.3	37	CCDS9344.1																																																																																			.		0.363	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
BRCA2	675	bcgsc.ca	37	13	32913965	32913965	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:32913965G>C	ENST00000380152.3	+	11	5706	c.5473G>C	c.(5473-5475)Gca>Cca	p.A1825P	BRCA2_ENST00000544455.1_Missense_Mutation_p.A1825P			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1825					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAATAAAAATGCAGCCATTAA	0.363			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.A1825P	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2-3153	0			c.G5473C						.						61.0	69.0	66.0					13																	32913965		2203	4300	6503	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	AAAAATGCAGCCA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.5473G>C	13.37:g.32913965G>C	ENSP00000369497:p.Ala1825Pro	Somatic	89	0		WXS	Illumina HiSeq	Phase_1	58	22	NM_000059	0	0	0	0	0	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	G	5.883	0.347062	0.11126	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.71222	-0.55;-0.55	5.24	-8.48	0.00935	.	1.380380	0.04407	N	0.365374	T	0.53400	0.1794	N	0.22421	0.69	0.09310	N	1	B	0.12630	0.006	B	0.12156	0.007	T	0.44544	-0.9321	10	0.41790	T	0.15	.	11.6232	0.51130	0.4691:0.084:0.4469:0.0	.	1825	P51587	BRCA2_HUMAN	P	1825	ENSP00000369497:A1825P;ENSP00000439902:A1825P	ENSP00000369497:A1825P	A	+	1	0	BRCA2	31811965	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-0.210000	0.09345	-1.691000	0.01430	-0.345000	0.07892	GCA	.		0.363	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
ELF1	1997	bcgsc.ca	37	13	41508016	41508016	+	Missense_Mutation	SNP	G	G	T	rs79846574		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:41508016G>T	ENST00000239882.3	-	9	1719	c.1405C>A	c.(1405-1407)Caa>Aaa	p.Q469K	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.Q445K	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	469					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		GGAATGGCTTGTAAAATAAAC	0.468																																					p.Q469K													.	ELF1-227	0			c.C1405A						.																																			SO:0001583	missense	1997	exon9			TGGCTTGTAAAAT	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.1405C>A	13.37:g.41508016G>T	ENSP00000239882:p.Gln469Lys	Somatic	237	0		WXS	Illumina HiSeq	Phase_1	121	44	NM_172373	0	0	92	105	13	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	37	CCDS9374.1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827067	0.71143	.	.	ENSG00000120690	ENST00000442101;ENST00000379498;ENST00000239882	T;T	0.55052	0.54;0.54	5.44	5.44	0.79542	.	0.063340	0.64402	D	0.000004	T	0.65739	0.2720	L	0.36672	1.1	0.49915	D	0.999836	D;D	0.69078	0.994;0.997	D;D	0.72338	0.968;0.977	T	0.68375	-0.5425	10	0.87932	D	0	.	19.2715	0.94011	0.0:0.0:1.0:0.0	.	445;469	E9PDQ9;P32519	.;ELF1_HUMAN	K	445;211;469	ENSP00000405580:Q445K;ENSP00000239882:Q469K	ENSP00000239882:Q469K	Q	-	1	0	ELF1	40406016	1.000000	0.71417	0.984000	0.44739	0.900000	0.52787	7.562000	0.82300	2.539000	0.85634	0.655000	0.94253	CAA	.		0.468	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373	
VWA8	23078	bcgsc.ca	37	13	42273324	42273324	+	Silent	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:42273324G>A	ENST00000379310.3	-	29	3515	c.3447C>T	c.(3445-3447)ttC>ttT	p.F1149F		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1149						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										AGTCCACAAAGAAGCCACTTT	0.433																																					p.F1149F													.	.	0			c.C3447T						.						89.0	91.0	91.0					13																	42273324		1877	4101	5978	SO:0001819	synonymous_variant	23078	exon29			CACAAAGAAGCCA	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3447C>T	13.37:g.42273324G>A		Somatic	131	0		WXS	Illumina HiSeq	Phase_1	89	26	NM_015058	0	0	16	16	0	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	CCDS41881.1																																																																																			.		0.433	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
AKAP11	11215	hgsc.bcm.edu	37	13	42876808	42876808	+	Missense_Mutation	SNP	T	T	G	rs201995333		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:42876808T>G	ENST00000025301.2	+	8	4101	c.3926T>G	c.(3925-3927)gTa>gGa	p.V1309G		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1309					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		ATAGAGGCTGTAGTGCACCCA	0.388																																					p.V1309G		.											.	AKAP11-227	0			c.T3926G						.						78.0	79.0	78.0					13																	42876808		2203	4300	6503	SO:0001583	missense	11215	exon8			AGGCTGTAGTGCA	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3926T>G	13.37:g.42876808T>G	ENSP00000025301:p.Val1309Gly	Somatic	56	1		WXS	Illumina HiSeq	Phase_I	47	12	NM_016248	0	0	45	47	2	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	T	9.177	1.022549	0.19433	.	.	ENSG00000023516	ENST00000025301	T	0.52983	0.64	5.75	1.75	0.24633	.	1.406730	0.04625	N	0.402539	T	0.37210	0.0995	L	0.51422	1.61	0.09310	N	0.999999	B	0.30439	0.279	B	0.25140	0.058	T	0.25222	-1.0138	10	0.34782	T	0.22	.	0.6864	0.00883	0.2429:0.1806:0.1137:0.4628	.	1309	Q9UKA4	AKA11_HUMAN	G	1309	ENSP00000025301:V1309G	ENSP00000025301:V1309G	V	+	2	0	AKAP11	41774808	0.206000	0.23470	0.000000	0.03702	0.219000	0.24729	2.655000	0.46707	0.451000	0.26802	0.533000	0.62120	GTA	.		0.388	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
KIAA0226L	80183	bcgsc.ca	37	13	46942947	46942947	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:46942947G>C	ENST00000429979.1	-	4	1143	c.539C>G	c.(538-540)gCt>gGt	p.A180G	KIAA0226L_ENST00000409879.2_Missense_Mutation_p.A23G|KIAA0226L_ENST00000322896.6_Missense_Mutation_p.A23G|KIAA0226L_ENST00000534925.1_Missense_Mutation_p.A45G|KIAA0226L_ENST00000378797.2_Missense_Mutation_p.A180G|KIAA0226L_ENST00000378781.3_Missense_Mutation_p.A180G|KIAA0226L_ENST00000389908.3_Missense_Mutation_p.A180G|KIAA0226L_ENST00000378787.3_Missense_Mutation_p.A180G|KIAA0226L_ENST00000378784.4_Missense_Mutation_p.A113G	NM_025113.2	NP_079389.2	Q9H714	K226L_HUMAN	KIAA0226-like	180										NS(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|pancreas(1)	26						GACTTGAACAGCACCTGCCAA	0.338																																					p.A180G													.	.	0			c.C539G						.						82.0	89.0	87.0					13																	46942947		2203	4300	6503	SO:0001583	missense	80183	exon4			TGAACAGCACCTG	AK025215	CCDS31970.2, CCDS66543.1, CCDS66544.1, CCDS66545.1, CCDS73569.1	13q14.11	2011-08-09	2011-08-09	2011-08-09	ENSG00000102445	ENSG00000102445			20420	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 18"""	C13orf18			Standard	NM_001286766		Approved	FLJ21562	uc010acl.3	Q9H714	OTTHUMG00000016868	ENST00000429979.1:c.539C>G	13.37:g.46942947G>C	ENSP00000396935:p.Ala180Gly	Somatic	115	4		WXS	Illumina HiSeq	Phase_1	48	25	NM_025113	0	0	0	0	0	A8KAG9|A8XR19|B3KS87|Q5W051|Q5W053|Q6PJ74|Q6PK94|Q86XH7|Q8N5J6	Missense_Mutation	SNP	ENST00000429979.1	37	CCDS31970.2	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149540	0.37923	.	.	ENSG00000102445	ENST00000378781;ENST00000429979;ENST00000378797;ENST00000378784;ENST00000389908;ENST00000378787;ENST00000409879;ENST00000322896;ENST00000534925;ENST00000417405	T;T;T;T;T;T;T;T	0.48201	0.82;0.86;0.85;0.86;0.86;0.85;0.88;0.83	6.17	3.41	0.39046	.	0.417022	0.23062	N	0.052365	T	0.53238	0.1784	L	0.38175	1.15	0.22851	N	0.998653	D;P;P;P;P;P;P	0.76494	0.999;0.682;0.925;0.682;0.877;0.925;0.925	D;B;P;B;B;P;P	0.69479	0.964;0.156;0.691;0.156;0.339;0.54;0.616	T	0.41448	-0.9508	10	0.62326	D	0.03	-2.7621	7.9961	0.30269	0.0726:0.0:0.6336:0.2937	.	180;23;180;23;180;113;180	E7EMA2;B7ZBN5;Q9H714-1;B7Z6E4;Q9H714;Q9H714-3;Q9H714-4	.;.;.;.;K226L_HUMAN;.;.	G	180;180;180;113;180;180;23;23;45;45	ENSP00000368057:A180G;ENSP00000396935:A180G;ENSP00000368074:A180G;ENSP00000368061:A113G;ENSP00000374558:A180G;ENSP00000368064:A180G;ENSP00000437501:A45G;ENSP00000402357:A45G	ENSP00000315633:A23G	A	-	2	0	KIAA0226L	45840948	0.833000	0.29383	0.933000	0.37362	0.725000	0.41563	1.486000	0.35530	0.422000	0.26005	0.655000	0.94253	GCT	.		0.338	KIAA0226L-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044809.2	NM_025113	
DIS3	22894	bcgsc.ca	37	13	73349455	73349455	+	Missense_Mutation	SNP	A	A	C	rs201006124	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr13:73349455A>C	ENST00000377767.4	-	6	981	c.881T>G	c.(880-882)gTg>gGg	p.V294G	DIS3_ENST00000377780.4_Missense_Mutation_p.V264G|DIS3_ENST00000545453.1_Missense_Mutation_p.V132G	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	294					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		GAGAAGCTCCACAGCCACAAT	0.398										Multiple Myeloma(4;0.011)			A|||	71	0.0141773	0.0121	0.0173	5008	,	,		16942	0.0169		0.0258	False		,,,				2504	0.0				p.V294G													.	DIS3-90	0			c.T881G						.						129.0	133.0	132.0					13																	73349455		2203	4300	6503	SO:0001583	missense	22894	exon6			AGCTCCACAGCCA	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.881T>G	13.37:g.73349455A>C	ENSP00000366997:p.Val294Gly	Somatic	103	0		WXS	Illumina HiSeq	Phase_1	53	23	NM_014953	0	0	36	41	5	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	A	33	5.237692	0.95240	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.46451	0.87;0.87;0.87	6.06	6.06	0.98353	.	0.117437	0.64402	D	0.000019	T	0.71476	0.3344	M	0.92833	3.35	0.80722	D	1	D;P	0.53619	0.961;0.934	P;P	0.61940	0.896;0.864	T	0.79035	-0.1968	10	0.87932	D	0	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	264;294	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	G	294;264;132	ENSP00000366997:V294G;ENSP00000367011:V264G;ENSP00000440058:V132G	ENSP00000366997:V294G	V	-	2	0	DIS3	72247456	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.251000	0.95483	2.323000	0.78572	0.528000	0.53228	GTG	.		0.398	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953	
COCH	1690	bcgsc.ca	37	14	31355025	31355025	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr14:31355025C>T	ENST00000396618.3	+	11	1040	c.984C>T	c.(982-984)ttC>ttT	p.F328F	COCH_ENST00000216361.4_Silent_p.F328F|COCH_ENST00000475087.1_Silent_p.F328F|RP11-829H16.3_ENST00000555108.1_RNA|RP11-829H16.3_ENST00000555421.1_RNA|RP11-829H16.3_ENST00000556786.1_RNA|RP11-829H16.3_ENST00000468444.2_RNA|COCH_ENST00000382493.4_Silent_p.F179F|COCH_ENST00000460581.2_Silent_p.F216F	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	328	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		ATAATGGCTTCTTCTCTTACC	0.418																																					p.F328F													.	COCH-228	0			c.C984T						.						104.0	100.0	102.0					14																	31355025		2203	4300	6503	SO:0001819	synonymous_variant	1690	exon11			TGGCTTCTTCTCT		CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.984C>T	14.37:g.31355025C>T		Somatic	107	0		WXS	Illumina HiSeq	Phase_1	34	6	NM_004086	0	0	2	2	0	A8K9K9|D3DS84|Q96IU6	Silent	SNP	ENST00000396618.3	37	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.722560	0.48728	.	.	ENSG00000100473	ENST00000468826	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	T	0.77046	0.4073	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74134	-0.3763	4	.	.	.	-11.6452	20.327	0.98704	0.0:1.0:0.0:0.0	.	.	.	.	F	212	.	.	S	+	2	0	COCH	30424776	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.015000	0.70791	2.794000	0.96219	0.650000	0.86243	TCT	.		0.418	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086	
PPM1A	5494	bcgsc.ca	37	14	60749549	60749549	+	Missense_Mutation	SNP	T	T	G	rs74713917		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr14:60749549T>G	ENST00000395076.4	+	2	558	c.128T>G	c.(127-129)gTg>gGg	p.V43G	PPM1A_ENST00000529574.1_Missense_Mutation_p.V43G|PPM1A_ENST00000325642.3_Missense_Mutation_p.V116G|PPM1A_ENST00000325658.3_Missense_Mutation_p.V43G	NM_021003.4	NP_066283.1	P35813	PPM1A_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1A	43					cell cycle arrest (GO:0007050)|dephosphorylation (GO:0016311)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|N-terminal protein myristoylation (GO:0006499)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|protein dephosphorylation (GO:0006470)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|voltage-gated calcium channel complex (GO:0005891)	calmodulin-dependent protein phosphatase activity (GO:0033192)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)|R-SMAD binding (GO:0070412)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(1)|large_intestine(8)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.046)		CATACGGCTGTGATCGGTTTG	0.493																																					p.V116G													.	PPM1A-227	0			c.T347G						.						438.0	391.0	407.0					14																	60749549		2203	4300	6503	SO:0001583	missense	5494	exon2			CGGCTGTGATCGG	S87759	CCDS9744.1, CCDS9745.1, CCDS45120.1	14q23.1	2013-01-24	2010-03-05		ENSG00000100614	ENSG00000100614	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9275	protein-coding gene	gene with protein product	"""phosphatase 2C alpha"", ""protein phosphatase 2C, alpha isoform"""	606108	"""protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform"""			1311954	Standard	NM_177952		Approved	MGC9201, PP2Calpha, PP2CA	uc001xew.4	P35813	OTTHUMG00000140333	ENST00000395076.4:c.128T>G	14.37:g.60749549T>G	ENSP00000378514:p.Val43Gly	Somatic	492	0		WXS	Illumina HiSeq	Phase_1	327	121	NM_177952	0	0	49	52	3	B5BU11|J3KNM0|O75551	Missense_Mutation	SNP	ENST00000395076.4	37	CCDS9744.1	.	.	.	.	.	.	.	.	.	.	T	17.14	3.313734	0.60414	.	.	ENSG00000100614	ENST00000325642;ENST00000529574;ENST00000395076;ENST00000325658;ENST00000528241;ENST00000525399;ENST00000531937	T;T;T;T;T;T;T	0.10382	2.88;2.88;2.88;2.88;2.88;2.88;2.88	5.75	5.75	0.90469	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.24392	0.0591	M	0.86028	2.79	0.80722	D	1	B;B;B	0.24132	0.098;0.041;0.098	B;B;B	0.33750	0.169;0.16;0.169	T	0.02539	-1.1144	10	0.56958	D	0.05	-3.9804	16.0345	0.80612	0.0:0.0:0.0:1.0	.	43;43;43	P35813;P35813-2;B2R8E4	PPM1A_HUMAN;.;.	G	116;43;43;43;43;43;43	ENSP00000327255:V116G;ENSP00000432966:V43G;ENSP00000378514:V43G;ENSP00000314850:V43G;ENSP00000431453:V43G;ENSP00000435398:V43G;ENSP00000435575:V43G	ENSP00000327255:V116G	V	+	2	0	PPM1A	59819302	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.040000	0.89188	2.183000	0.69458	0.482000	0.46254	GTG	.		0.493	PPM1A-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276949.2	NM_021003	
SYT16	83851	hgsc.bcm.edu	37	14	62463094	62463094	+	Silent	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr14:62463094A>C	ENST00000430451.2	+	1	554	c.357A>C	c.(355-357)acA>acC	p.T119T	SYT16_ENST00000446982.2_Silent_p.T119T	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	119					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		CATGTTCCACAATGTCCCAGT	0.458																																					p.T119T		.											.	SYT16-23	0			c.A357C						.						131.0	125.0	127.0					14																	62463094		1910	4127	6037	SO:0001819	synonymous_variant	83851	exon1			TTCCACAATGTCC	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.357A>C	14.37:g.62463094A>C		Somatic	152	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_031914	0	0	6	6	0	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Silent	SNP	ENST00000430451.2	37	CCDS45121.1																																																																																			.		0.458	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
AKAP5	9495	bcgsc.ca	37	14	64935947	64935947	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr14:64935947G>A	ENST00000394718.4	+	2	1213	c.835G>A	c.(835-837)Gaa>Aaa	p.E279K	ZBTB25_ENST00000555424.1_Intron|ZBTB25_ENST00000555220.1_Intron|AKAP5_ENST00000320636.5_Missense_Mutation_p.E279K	NM_004857.3	NP_004848.3	P24588	AKAP5_HUMAN	A kinase (PRKA) anchor protein 5	279					energy reserve metabolic process (GO:0006112)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.E279*(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|stomach(1)	13				all cancers(60;0.00749)|OV - Ovarian serous cystadenocarcinoma(108;0.0095)|BRCA - Breast invasive adenocarcinoma(234;0.0449)		AATTGTGGAAGAAGCCAGTAA	0.413																																					p.E279K													.	AKAP5-226	1	Substitution - Nonsense(1)	large_intestine(1)	c.G835A						.						73.0	76.0	75.0					14																	64935947		2203	4300	6503	SO:0001583	missense	9495	exon2			GTGGAAGAAGCCA	M90359	CCDS9764.1	14q23.3	2012-05-16			ENSG00000179841	ENSG00000179841		"""A-kinase anchor proteins"""	375	protein-coding gene	gene with protein product		604688				1512224, 1618839	Standard	NM_004857		Approved	AKAP75, AKAP79	uc001xhd.4	P24588	OTTHUMG00000029634	ENST00000394718.4:c.835G>A	14.37:g.64935947G>A	ENSP00000378207:p.Glu279Lys	Somatic	132	0		WXS	Illumina HiSeq	Phase_1	73	20	NM_004857	0	0	2	3	1	A2RRB8	Missense_Mutation	SNP	ENST00000394718.4	37	CCDS9764.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099867	0.37048	.	.	ENSG00000179841	ENST00000394718;ENST00000320636	T;T	0.32515	1.45;1.45	5.9	5.01	0.66863	.	0.426594	0.22125	N	0.064266	T	0.32615	0.0835	M	0.61703	1.905	0.30000	N	0.816116	B	0.18461	0.028	B	0.19148	0.024	T	0.24048	-1.0171	10	0.41790	T	0.15	-2.0645	12.8171	0.57671	0.0754:0.0:0.9246:0.0	.	279	P24588	AKAP5_HUMAN	K	279	ENSP00000378207:E279K;ENSP00000315615:E279K	ENSP00000315615:E279K	E	+	1	0	AKAP5	64005700	0.883000	0.30277	0.724000	0.30704	0.166000	0.22503	2.392000	0.44433	1.500000	0.48636	0.650000	0.86243	GAA	.		0.413	AKAP5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268070.3		
CLMN	79789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	95669398	95669398	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr14:95669398T>C	ENST00000298912.4	-	9	2401	c.2288A>G	c.(2287-2289)tAt>tGt	p.Y763C		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	763					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		GTCTGGCATATAGCCCTCTGG	0.567																																					p.Y763C		.											.	CLMN-90	0			c.A2288G						.						38.0	39.0	39.0					14																	95669398		2203	4300	6503	SO:0001583	missense	79789	exon9			GGCATATAGCCCT	AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.2288A>G	14.37:g.95669398T>C	ENSP00000298912:p.Tyr763Cys	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	206	84	NM_024734	0	0	16	28	12	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	ENST00000298912.4	37	CCDS9933.1	.	.	.	.	.	.	.	.	.	.	T	9.014	0.983104	0.18889	.	.	ENSG00000165959	ENST00000298912	D	0.92647	-3.08	5.22	-4.75	0.03239	.	0.879712	0.09454	N	0.800049	D	0.83718	0.5315	L	0.39397	1.21	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.68055	-0.5510	10	0.40728	T	0.16	.	3.381	0.07255	0.1129:0.3809:0.1154:0.3907	.	763	Q96JQ2	CLMN_HUMAN	C	763	ENSP00000298912:Y763C	ENSP00000298912:Y763C	Y	-	2	0	CLMN	94739151	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.163000	0.03138	-0.982000	0.03515	-1.236000	0.01555	TAT	.		0.567	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2		
AHNAK2	113146	ucsc.edu	37	14	105415291	105415291	+	Missense_Mutation	SNP	G	G	A	rs568117634		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr14:105415291G>A	ENST00000333244.5	-	7	6616	c.6497C>T	c.(6496-6498)tCt>tTt	p.S2166F	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2166						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCTGGGGCAGACACCCCAAA	0.592													.|||	0	0.0	0.0	0.0	5008	,	,		16538	0.0		0.0	False		,,,				2504	0.0				p.S2166F													.	AHNAK2-47	0			c.C6497T						.						208.0	149.0	170.0					14																	105415291		1940	3520	5460	SO:0001583	missense	113146	exon7			GGGGCAGACACCC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6497C>T	14.37:g.105415291G>A	ENSP00000353114:p.Ser2166Phe	Somatic	485	4		WXS	Illumina HiSeq		2022	16	NM_138420	0	0	72	72	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	16.92	3.256462	0.59321	.	.	ENSG00000185567	ENST00000333244	T	0.01025	5.43	4.35	4.35	0.52113	.	.	.	.	.	T	0.08403	0.0209	M	0.91406	3.205	0.09310	N	1	D	0.71674	0.998	D	0.87578	0.998	T	0.04752	-1.0929	9	0.52906	T	0.07	.	16.9291	0.86184	0.0:0.0:1.0:0.0	.	2166	Q8IVF2	AHNK2_HUMAN	F	2166	ENSP00000353114:S2166F	ENSP00000353114:S2166F	S	-	2	0	AHNAK2	104486336	0.018000	0.18449	0.006000	0.13384	0.001000	0.01503	1.888000	0.39708	1.995000	0.58328	0.306000	0.20318	TCT	.		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
NIPA1	123606	bcgsc.ca	37	15	23060899	23060899	+	Missense_Mutation	SNP	A	A	C	rs200844669		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:23060899A>C	ENST00000337435.4	-	3	257	c.233T>G	c.(232-234)gTt>gGt	p.V78G	NIPA1_ENST00000538684.1_5'UTR|NIPA1_ENST00000437912.2_Missense_Mutation_p.V3G|NIPA1_ENST00000561183.1_Missense_Mutation_p.V3G	NM_001142275.1|NM_144599.4	NP_001135747.1|NP_653200.2	Q7RTP0	NIPA1_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 1	78					cell death (GO:0008219)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		AATCTGGCCAACAGCCACTGT	0.537																																					p.V78G													.	NIPA1-90	0			c.T233G						.						43.0	41.0	42.0					15																	23060899		2203	4300	6503	SO:0001583	missense	123606	exon3			TGGCCAACAGCCA	BK001020	CCDS73691.1, CCDS73692.1	15q11.2	2006-10-06			ENSG00000170113	ENSG00000170113			17043	protein-coding gene	gene with protein product		608145	"""spastic paraplegia 6 (autosomal dominant)"""	SPG6		14508710	Standard	NM_144599		Approved	MGC35570	uc001yvc.3	Q7RTP0	OTTHUMG00000129099	ENST00000337435.4:c.233T>G	15.37:g.23060899A>C	ENSP00000337452:p.Val78Gly	Somatic	23	0		WXS	Illumina HiSeq	Phase_1	69	53	NM_144599	0	0	0	0	0	B2RA76|Q5HYA9|Q7KZB0|Q86XW4	Missense_Mutation	SNP	ENST00000337435.4	37	CCDS10011.1	.	.	.	.	.	.	.	.	.	.	A	18.76	3.691932	0.68271	.	.	ENSG00000170113	ENST00000337435;ENST00000437912	D;D	0.92099	-2.97;-2.97	5.78	5.78	0.91487	.	0.333388	0.32093	N	0.006586	D	0.92087	0.7492	L	0.51914	1.62	0.80722	D	1	B	0.30104	0.268	B	0.41619	0.361	D	0.90395	0.4398	10	0.41790	T	0.15	-13.6329	16.3979	0.83621	1.0:0.0:0.0:0.0	.	78	Q7RTP0	NIPA1_HUMAN	G	78;3	ENSP00000337452:V78G;ENSP00000393962:V3G	ENSP00000337452:V78G	V	-	2	0	NIPA1	20612340	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.406000	0.66357	2.333000	0.79357	0.533000	0.62120	GTT	.		0.537	NIPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251135.2	NM_144599	
BMF	90427	bcgsc.ca	37	15	40396521	40396521	+	Missense_Mutation	SNP	G	G	A	rs77642791		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:40396521G>A	ENST00000354670.4	-	4	547	c.313C>T	c.(313-315)Cct>Tct	p.P105S	BMF_ENST00000561360.1_Missense_Mutation_p.P105S|BMF_ENST00000558774.1_Intron|BMF_ENST00000431415.3_Missense_Mutation_p.P105S|BMF_ENST00000559701.1_Intron|BMF_ENST00000397573.1_Missense_Mutation_p.P105S|BMF_ENST00000220446.4_Intron|BMF_ENST00000561282.1_Missense_Mutation_p.P105S	NM_001003940.1	NP_001003940.1	Q96LC9	BMF_HUMAN	Bcl2 modifying factor	105					anoikis (GO:0043276)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	6		all_cancers(109;4.18e-18)|all_epithelial(112;6.15e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0516)		GCAGGGAGAGGAAGCCGATAG	0.567																																					p.P105S													.	BMF-228	0			c.C313T						.						98.0	96.0	97.0					15																	40396521		2203	4300	6503	SO:0001583	missense	90427	exon2			GGAGAGGAAGCCG	BC060783	CCDS10052.1, CCDS32196.1, CCDS45223.1	15q14	2014-03-07			ENSG00000104081	ENSG00000104081			24132	protein-coding gene	gene with protein product		606266				11546872	Standard	NM_001003943		Approved	FLJ00065	uc001zkw.4	Q96LC9	OTTHUMG00000129875	ENST00000354670.4:c.313C>T	15.37:g.40396521G>A	ENSP00000346697:p.Pro105Ser	Somatic	148	0		WXS	Illumina HiSeq	Phase_1	267	131	NM_001003942	0	0	10	11	1	Q2M396|Q6NT30|Q6NT56|Q6P9F6|Q7Z7D4|Q7Z7D5|Q9H7K7	Missense_Mutation	SNP	ENST00000354670.4	37	CCDS10052.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553055	0.65425	.	.	ENSG00000104081	ENST00000354670;ENST00000397573;ENST00000431415	.	.	.	5.91	4.99	0.66335	.	0.186495	0.37530	N	0.002053	T	0.32255	0.0823	N	0.24115	0.695	0.80722	D	1	B;P	0.37370	0.218;0.592	B;B	0.29440	0.038;0.102	T	0.10291	-1.0636	9	0.25106	T	0.35	-9.2573	10.6792	0.45804	0.1416:0.0:0.8584:0.0	.	105;105	Q96LC9;Q96LC9-2	BMF_HUMAN;.	S	105	.	ENSP00000346697:P105S	P	-	1	0	BMF	38183813	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.773000	0.55333	2.802000	0.96397	0.655000	0.94253	CCT	.		0.567	BMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252119.1	NM_033503	
PLA2G4F	255189	bcgsc.ca	37	15	42439944	42439944	+	Missense_Mutation	SNP	A	A	C	rs79576717		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:42439944A>C	ENST00000382396.4	-	12	1162	c.1076T>G	c.(1075-1077)gTg>gGg	p.V359G	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.V361G			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	359	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		GGAACCCAACACAGCCACTAC	0.522																																					p.V359G													.	PLA2G4F-94	0			c.T1076G						.						45.0	49.0	48.0					15																	42439944		2203	4299	6502	SO:0001583	missense	255189	exon12			CCCAACACAGCCA		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.1076T>G	15.37:g.42439944A>C	ENSP00000371833:p.Val359Gly	Somatic	72	1		WXS	Illumina HiSeq	Phase_1	194	124	NM_213600	0	0	0	0	0	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	37	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.194786	0.78902	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.05382	3.45;3.45	4.67	4.67	0.58626	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.000000	0.64402	D	0.000015	T	0.24547	0.0595	M	0.75264	2.295	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.981	T	0.01078	-1.1459	10	0.87932	D	0	-13.9132	14.5918	0.68371	1.0:0.0:0.0:0.0	.	146;359	A2RRC4;Q68DD2	.;PA24F_HUMAN	G	355;361;359;359;359	ENSP00000380442:V361G;ENSP00000371833:V359G	ENSP00000290497:V355G	V	-	2	0	PLA2G4F	40227236	1.000000	0.71417	0.995000	0.50966	0.800000	0.45204	7.403000	0.79983	2.090000	0.63153	0.459000	0.35465	GTG	.		0.522	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	
TTBK2	146057	bcgsc.ca	37	15	43132600	43132600	+	Missense_Mutation	SNP	A	A	C	rs141523080		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:43132600A>C	ENST00000267890.6	-	4	357	c.249T>G	c.(247-249)tgT>tgG	p.C83W	TTBK2_ENST00000567840.1_Missense_Mutation_p.C83W|TTBK2_ENST00000567274.1_Missense_Mutation_p.C83W	NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	83	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CATTCCTCCCACAGCCAATAA	0.318																																					p.C83W													.	TTBK2-338	0			c.T249G						.						133.0	126.0	128.0					15																	43132600		1820	4084	5904	SO:0001583	missense	146057	exon4			CCTCCCACAGCCA	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.249T>G	15.37:g.43132600A>C	ENSP00000267890:p.Cys83Trp	Somatic	132	1		WXS	Illumina HiSeq	Phase_1	94	39	NM_173500	0	0	2	2	0	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	ENST00000267890.6	37	CCDS42029.1	.	.	.	.	.	.	.	.	.	.	A	11.81	1.750201	0.30955	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.64438	-0.1	5.31	4.18	0.49190	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.082061	0.85682	D	0.000000	T	0.73892	0.3645	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	T	0.75193	-0.3404	10	0.87932	D	0	.	11.2089	0.48786	0.9264:0.0:0.0736:0.0	.	63;14;83;83	Q8IWY7;Q6IQ55-2;Q6IQ55-3;Q6IQ55	.;.;.;TTBK2_HUMAN	W	83;13;63	ENSP00000267890:C83W	ENSP00000263802:C63W	C	-	3	2	TTBK2	40919892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.929000	0.48916	0.955000	0.37878	0.477000	0.44152	TGT	.		0.318	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	NM_173500	
PYGO1	26108	bcgsc.ca	37	15	55838604	55838604	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:55838604C>T	ENST00000302000.6	-	3	971	c.877G>A	c.(877-879)Gaa>Aaa	p.E293K	PYGO1_ENST00000563719.1_Missense_Mutation_p.E293K	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	293	Asn-rich.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		TTTGTGGCTTCAGTGCTACTT	0.408																																					p.E293K													.	PYGO1-228	0			c.G877A						.						301.0	299.0	300.0					15																	55838604		2193	4292	6485	SO:0001583	missense	26108	exon3			TGGCTTCAGTGCT	AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.877G>A	15.37:g.55838604C>T	ENSP00000302327:p.Glu293Lys	Somatic	348	0		WXS	Illumina HiSeq	Phase_1	117	27	NM_015617	0	0	2	2	0	A7Y2D6	Missense_Mutation	SNP	ENST00000302000.6	37	CCDS10155.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744774	0.49151	.	.	ENSG00000171016	ENST00000302000;ENST00000401688	T	0.44881	0.91	5.24	5.24	0.73138	.	0.203869	0.42420	D	0.000703	T	0.27134	0.0665	N	0.19112	0.55	0.40068	D	0.97598	B;P	0.34522	0.247;0.455	B;B	0.32211	0.091;0.142	T	0.09164	-1.0687	10	0.06625	T	0.88	-15.9589	18.1934	0.89813	0.0:1.0:0.0:0.0	.	293;293	A7Y2D6;Q9Y3Y4	.;PYGO1_HUMAN	K	293	ENSP00000302327:E293K	ENSP00000302327:E293K	E	-	1	0	PYGO1	53625896	0.997000	0.39634	1.000000	0.80357	0.982000	0.71751	3.818000	0.55678	2.605000	0.88082	0.591000	0.81541	GAA	.		0.408	PYGO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254977.2	NM_015617	
GCNT3	9245	bcgsc.ca	37	15	59911342	59911342	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:59911342C>T	ENST00000396065.1	+	3	1353	c.905C>T	c.(904-906)tCc>tTc	p.S302F	GCNT3_ENST00000560585.1_Missense_Mutation_p.S302F	NM_004751.2	NP_004742.1	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin type	302					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|immunoglobulin production in mucosal tissue (GO:0002426)|intestinal absorption (GO:0050892)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|tissue morphogenesis (GO:0048729)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0047225)|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ATTGTGGCTTCCCGAGATTTC	0.428																																					p.S302F													.	GCNT3-91	0			c.C905T						.						165.0	165.0	165.0					15																	59911342		2190	4290	6480	SO:0001583	missense	9245	exon3			TGGCTTCCCGAGA	AF102542	CCDS10172.1	15q22	2013-02-25			ENSG00000140297	ENSG00000140297	2.4.1.102, 2.4.1.150	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4205	protein-coding gene	gene with protein product		606836				9915862, 9988682	Standard	NM_004751		Approved	C2GnT-M, C2/4GnT, C2GnT2	uc002age.3	O95395	OTTHUMG00000132726	ENST00000396065.1:c.905C>T	15.37:g.59911342C>T	ENSP00000379377:p.Ser302Phe	Somatic	205	0		WXS	Illumina HiSeq	Phase_1	137	27	NM_004751	0	0	19	19	0		Missense_Mutation	SNP	ENST00000396065.1	37	CCDS10172.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962315	0.53400	.	.	ENSG00000140297	ENST00000396065	T	0.14893	2.47	5.41	4.43	0.53597	.	0.309345	0.35838	N	0.002944	T	0.44871	0.1314	M	0.85945	2.785	0.40043	D	0.975673	D	0.71674	0.998	D	0.68483	0.958	T	0.53521	-0.8427	10	0.87932	D	0	.	14.7569	0.69572	0.0:0.6617:0.3383:0.0	.	302	O95395	GCNT3_HUMAN	F	302	ENSP00000379377:S302F	ENSP00000379377:S302F	S	+	2	0	GCNT3	57698634	0.081000	0.21417	0.998000	0.56505	0.843000	0.47879	1.250000	0.32850	2.535000	0.85469	0.655000	0.94253	TCC	.		0.428	GCNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256068.1	NM_004751	
FBXO22	26263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	76196905	76196905	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:76196905G>A	ENST00000308275.3	+	2	319	c.214G>A	c.(214-216)Ggc>Agc	p.G72S	FBXO22_ENST00000565131.1_3'UTR|FBXO22_ENST00000453211.2_Missense_Mutation_p.G72S|FBXO22_ENST00000540507.1_Intron	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22	72					cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GATCTCCGCAGGCCTGGCGGA	0.602																																					p.G72S		.											.	FBXO22-658	0			c.G214A						.						108.0	101.0	103.0					15																	76196905		2197	4294	6491	SO:0001583	missense	26263	exon2			TCCGCAGGCCTGG	AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.214G>A	15.37:g.76196905G>A	ENSP00000307833:p.Gly72Ser	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	305	92	NM_012170	0	0	22	42	20	Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Missense_Mutation	SNP	ENST00000308275.3	37	CCDS10287.1	.	.	.	.	.	.	.	.	.	.	G	6.702	0.498156	0.12762	.	.	ENSG00000167196	ENST00000308275;ENST00000453211	.	.	.	3.51	0.501	0.16925	.	0.746536	0.11012	N	0.609403	T	0.13841	0.0335	N	0.03608	-0.345	0.09310	N	0.999993	B;B	0.09022	0.0;0.002	B;B	0.08055	0.001;0.003	T	0.33599	-0.9862	9	0.12103	T	0.63	-1.7367	7.3984	0.26950	0.0987:0.332:0.5694:0.0	.	72;72	Q8NEZ5;Q8NEZ5-3	FBX22_HUMAN;.	S	72	.	ENSP00000307833:G72S	G	+	1	0	FBXO22	73983960	0.001000	0.12720	0.002000	0.10522	0.591000	0.36615	0.233000	0.17911	0.106000	0.17784	0.563000	0.77884	GGC	.		0.602	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286477.2	NM_147188	
SYNM	23336	ucsc.edu	37	15	99671486	99671486	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:99671486A>G	ENST00000560674.1	+	4	2532	c.2063A>G	c.(2062-2064)gAg>gGg	p.E688G	SYNM_ENST00000328642.7_Missense_Mutation_p.E973G|SYNM_ENST00000336292.6_Missense_Mutation_p.E973G|SYNM_ENST00000561323.1_3'UTR|RP11-6O2.4_ENST00000566974.1_RNA			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	974	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						CTCACCAGAGAGGGGCAGGGT	0.642																																					.	Pancreas(125;1071 1762 21750 40003 40381)												.	SYNM-26	0			.						.						32.0	38.0	36.0					15																	99671486		2007	4151	6158	SO:0001583	missense	23336	.			CCAGAGAGGGGCA	AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.2063A>G	15.37:g.99671486A>G	ENSP00000453040:p.Glu688Gly	Somatic	17	0		WXS	Illumina HiSeq		57	1	.	0	0	3	4	1	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000560674.1	37		.	.	.	.	.	.	.	.	.	.	A	11.52	1.662170	0.29515	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	D;D	0.84944	-1.9;-1.92	5.64	4.52	0.55395	.	.	.	.	.	T	0.81725	0.4883	.	.	.	0.20074	N	0.999933	P;P	0.50272	0.933;0.933	B;B	0.40901	0.343;0.276	T	0.73078	-0.4096	8	0.87932	D	0	.	12.3478	0.55130	0.8587:0.1412:0.0:0.0	.	974;973	O15061;C9JIE4	SYNEM_HUMAN;.	G	973	ENSP00000336775:E973G;ENSP00000330469:E973G	ENSP00000330469:E973G	E	+	2	0	SYNM	97489009	0.998000	0.40836	0.017000	0.16124	0.013000	0.08279	2.672000	0.46850	0.967000	0.38186	-0.264000	0.10439	GAG	.		0.642	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000415698.2	NM_145728	
BAIAP3	8938	hgsc.bcm.edu	37	16	1394683	1394683	+	Missense_Mutation	SNP	G	G	C	rs565955956	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:1394683G>C	ENST00000324385.5	+	19	2004	c.1846G>C	c.(1846-1848)Gcc>Ccc	p.A616P	BAIAP3_ENST00000562208.1_Missense_Mutation_p.A558P|BAIAP3_ENST00000568887.1_Missense_Mutation_p.A553P|BAIAP3_ENST00000421665.2_Missense_Mutation_p.A545P|BAIAP3_ENST00000397489.1_Missense_Mutation_p.A598P|BAIAP3_ENST00000397488.2_Missense_Mutation_p.A598P|BAIAP3_ENST00000426824.3_Missense_Mutation_p.A581P	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	616					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CAGTGTGTACGCCAGCCTCTT	0.647													G|||	369	0.0736821	0.0545	0.1455	5008	,	,		18128	0.0724		0.1054	False		,,,				2504	0.0174				p.A616P		.											.	BAIAP3-91	0			c.G1846C						.						118.0	128.0	125.0					16																	1394683		2199	4300	6499	SO:0001583	missense	8938	exon19			GTGTACGCCAGCC	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1846G>C	16.37:g.1394683G>C	ENSP00000324510:p.Ala616Pro	Somatic	194	0		WXS	Illumina HiSeq	Phase_I	662	325	NM_003933	0	0	8	9	1	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	37	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.125077	0.37533	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	T;T;T;T;T	0.71934	-0.6;-0.59;-0.61;-0.59;-0.6	4.51	2.5	0.30297	.	0.373843	0.27189	N	0.020501	T	0.67192	0.2867	L	0.51422	1.61	0.35007	D	0.756553	D;P;P;P	0.61080	0.989;0.845;0.845;0.845	P;P;P;B	0.52217	0.693;0.469;0.469;0.369	T	0.69829	-0.5039	10	0.30854	T	0.27	-24.8112	6.0006	0.19519	0.3171:0.0:0.6829:0.0	.	545;558;616;598	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	P	581;598;616;598;545	ENSP00000407242:A581P;ENSP00000380625:A598P;ENSP00000324510:A616P;ENSP00000380626:A598P;ENSP00000409533:A545P	ENSP00000324510:A616P	A	+	1	0	BAIAP3	1334684	0.997000	0.39634	0.726000	0.30738	0.069000	0.16628	3.026000	0.49689	0.855000	0.35359	0.436000	0.28706	GCC	.		0.647	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109056.3		
GNPTG	84572	hgsc.bcm.edu	37	16	1401500	1401500	+	5'Flank	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:1401500C>T	ENST00000204679.4	+	0	0				TSR3_ENST00000007390.2_Missense_Mutation_p.R71Q	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit						carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				CGTGCAGCGCCGGGGGTCGCA	0.771																																					p.R71Q		.											.	.	0			c.G212A						.						3.0	4.0	4.0					16																	1401500		1707	3466	5173	SO:0001631	upstream_gene_variant	115939	exon2			CAGCGCCGGGGGT	BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835		16.37:g.1401500C>T	Exception_encountered	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	37	20	NM_001001410	0	0	2	10	8	B2R556|Q6XYD7|Q96L13	Missense_Mutation	SNP	ENST00000204679.4	37	CCDS10436.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316172	0.81469	.	.	ENSG00000007520	ENST00000007390	.	.	.	4.74	1.64	0.23874	RNase L inhibitor RLI, possible metal-binding domain (1);	0.131915	0.48767	D	0.000175	T	0.43322	0.1242	M	0.73372	2.23	0.26712	N	0.970953	P	0.52170	0.951	P	0.49276	0.605	T	0.39742	-0.9599	9	0.72032	D	0.01	-15.2852	3.4374	0.07450	0.0:0.4866:0.2002:0.3132	.	71	Q9UJK0	TSR3_HUMAN	Q	71	.	ENSP00000007390:R71Q	R	-	2	0	C16orf42	1341501	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	2.346000	0.44027	0.396000	0.25283	0.462000	0.41574	CGG	.		0.771	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109058.2	NM_032520	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3808859	3808859	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:3808859A>G	ENST00000262367.5	-	17	4174	c.3365T>C	c.(3364-3366)aTt>aCt	p.I1122T	CREBBP_ENST00000382070.3_Missense_Mutation_p.I1084T	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1122	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		ACTTACTGGAATTCCGAGGAG	0.438			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.I1122T		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP-1807	0			c.T3365C						.						69.0	68.0	68.0					16																	3808859		2197	4300	6497	SO:0001583	missense	1387	exon17			ACTGGAATTCCGA	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3365T>C	16.37:g.3808859A>G	ENSP00000262367:p.Ile1122Thr	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	62	14	NM_004380	0	0	0	0	0	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.568041	0.45798	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	T;T	0.19532	2.14;2.14	5.05	5.05	0.67936	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.54303	0.1850	M	0.89534	3.04	0.80722	D	1	D;D	0.59767	0.986;0.986	D;D	0.97110	1.0;1.0	T	0.64952	-0.6286	10	0.72032	D	0.01	-13.4551	15.0885	0.72174	1.0:0.0:0.0:0.0	.	1152;1122	Q4LE28;Q92793	.;CBP_HUMAN	T	1122;1152;1084	ENSP00000262367:I1122T;ENSP00000371502:I1084T	ENSP00000262367:I1122T	I	-	2	0	CREBBP	3748860	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.067000	0.93955	2.022000	0.59522	0.459000	0.35465	ATT	.		0.438	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
SRCAP	10847	bcgsc.ca	37	16	30731626	30731626	+	Silent	SNP	C	C	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:30731626C>A	ENST00000262518.4	+	19	3346	c.2961C>A	c.(2959-2961)ccC>ccA	p.P987P	SRCAP_ENST00000395059.2_Silent_p.P987P|SRCAP_ENST00000344771.4_Silent_p.P987P	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	987	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.P987P(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CACCCCGGCCCAAGCCAGTCA	0.582																																					p.P987P													.	SRCAP-94	1	Substitution - coding silent(1)	prostate(1)	c.C2961A						.						91.0	101.0	98.0					16																	30731626		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon19			CCGGCCCAAGCCA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2961C>A	16.37:g.30731626C>A		Somatic	220	0		WXS	Illumina HiSeq	Phase_1	548	146	NM_006662	0	0	8	8	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.582	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SETD1A	9739	broad.mit.edu	37	16	30974861	30974861	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:30974861G>C	ENST00000262519.8	+	5	1311	c.625G>C	c.(625-627)Gca>Cca	p.A209P		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	209					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						AGGCTCGGGTGCAGCCACTGA	0.577																																					p.A209P													.	SETD1A-93	0			c.G625C						.																																			SO:0001583	missense	9739	exon5			TCGGGTGCAGCCA	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.625G>C	16.37:g.30974861G>C	ENSP00000262519:p.Ala209Pro	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	236	57	NM_014712	0	0	10	12	2	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	G	6.515	0.463221	0.12402	.	.	ENSG00000099381	ENST00000262519;ENST00000452917	D	0.94280	-3.39	5.93	2.51	0.30379	.	0.628623	0.15550	N	0.256486	D	0.83667	0.5304	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.71265	-0.4644	10	0.26408	T	0.33	.	10.6274	0.45516	0.2471:0.0:0.7529:0.0	.	209	O15047	SET1A_HUMAN	P	209	ENSP00000262519:A209P	ENSP00000262519:A209P	A	+	1	0	SETD1A	30882362	0.778000	0.28640	0.992000	0.48379	0.302000	0.27658	0.180000	0.16860	0.863000	0.35553	-0.150000	0.13652	GCA	.		0.577	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
ITGAM	3684	hgsc.bcm.edu	37	16	31335785	31335785	+	Missense_Mutation	SNP	G	G	A	rs139908772	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:31335785G>A	ENST00000287497.8	+	17	2143	c.2068G>A	c.(2068-2070)Gtc>Atc	p.V690I	ITGAM_ENST00000544665.3_Missense_Mutation_p.V691I			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	690					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						TTCCCGCGCCGTCTTCAATGA	0.582													G|||	6	0.00119808	0.0038	0.0	5008	,	,		18615	0.0		0.001	False		,,,				2504	0.0				p.V691I		.											.	ITGAM-226	0			c.G2071A						.	G	ILE/VAL,ILE/VAL	14,3950		0,14,1968	22.0	23.0	23.0		2071,2068	-7.7	0.0	16	dbSNP_134	23	0,8326		0,0,4163	yes	missense,missense	ITGAM	NM_001145808.1,NM_000632.3	29,29	0,14,6131	AA,AG,GG		0.0,0.3532,0.1139	benign,benign	691/1154,690/1153	31335785	14,12276	1982	4163	6145	SO:0001583	missense	3684	exon17			CGCGCCGTCTTCA	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2068G>A	16.37:g.31335785G>A	ENSP00000287497:p.Val690Ile	Somatic	5	0		WXS	Illumina HiSeq	Phase_I	27	17	NM_001145808	0	0	10	23	13	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	CCDS45470.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	G	1.225	-0.625646	0.03610	0.003532	0.0	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.50001	0.76;0.76	4.81	-7.71	0.01254	Integrin alpha-2 (1);	.	.	.	.	T	0.17195	0.0413	N	0.04686	-0.185	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.13407	0.009;0.006;0.006	T	0.35798	-0.9774	9	0.02654	T	1	.	8.3033	0.32027	0.2458:0.0:0.6241:0.1301	.	96;690;690	B3KXM6;Q4VAK1;P11215	.;.;ITAM_HUMAN	I	691;690	ENSP00000441691:V691I;ENSP00000287497:V690I	ENSP00000287497:V690I	V	+	1	0	ITGAM	31243286	0.052000	0.20516	0.001000	0.08648	0.001000	0.01503	-0.785000	0.04628	-1.588000	0.01627	-1.008000	0.02478	GTC	G|0.999;A|0.001		0.582	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
ARMC5	79798	hgsc.bcm.edu	37	16	31474046	31474046	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:31474046C>G	ENST00000563544.1	+	4	1724	c.1178C>G	c.(1177-1179)gCc>gGc	p.A393G	ARMC5_ENST00000457010.2_Missense_Mutation_p.A393G|RP11-452L6.5_ENST00000564629.1_RNA|ARMC5_ENST00000538189.1_Missense_Mutation_p.A425G|ARMC5_ENST00000408912.3_Missense_Mutation_p.A488G|ARMC5_ENST00000268314.4_Missense_Mutation_p.A393G|ARMC5_ENST00000412665.2_Intron			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	393										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						ATTGTGGCTGCCCTTGTGGGG	0.647																																					p.A393G		.											.	ARMC5-24	0			c.C1178G						.						51.0	56.0	55.0					16																	31474046		1985	4176	6161	SO:0001583	missense	79798	exon3			TGGCTGCCCTTGT	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1178C>G	16.37:g.31474046C>G	ENSP00000456877:p.Ala393Gly	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	269	63	NM_024742	0	0	10	10	0	Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	ENST00000563544.1	37	CCDS45472.1	.	.	.	.	.	.	.	.	.	.	c	22.5	4.302423	0.81136	.	.	ENSG00000140691	ENST00000408912;ENST00000538189;ENST00000268314;ENST00000457010	T;T;T;T	0.53423	1.55;1.58;1.59;0.62	4.87	4.87	0.63330	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65291	0.2677	L	0.58101	1.795	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.68868	-0.5295	10	0.87932	D	0	-28.7614	15.5059	0.75739	0.0:1.0:0.0:0.0	.	425;488;393;393	F5H156;B4DIU9;Q96C12;Q96C12-4	.;.;ARMC5_HUMAN;.	G	488;425;393;393	ENSP00000386125:A488G;ENSP00000443995:A425G;ENSP00000268314:A393G;ENSP00000399561:A393G	ENSP00000268314:A393G	A	+	2	0	ARMC5	31381547	1.000000	0.71417	0.996000	0.52242	0.851000	0.48451	6.214000	0.72200	2.251000	0.74343	0.457000	0.33378	GCC	.		0.647	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742	
LONP2	83752	bcgsc.ca	37	16	48286156	48286156	+	Silent	SNP	G	G	A	rs202207335		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:48286156G>A	ENST00000285737.4	+	2	441	c.348G>A	c.(346-348)gaG>gaA	p.E116E	LONP2_ENST00000535754.1_Silent_p.E116E	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						TCTTAAAAGAGAAGCCATATC	0.502																																					p.E116E													.	LONP2-90	0			c.G348A						.						79.0	71.0	74.0					16																	48286156		2200	4300	6500	SO:0001819	synonymous_variant	83752	exon2			AAAAGAGAAGCCA	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.348G>A	16.37:g.48286156G>A		Somatic	39	0		WXS	Illumina HiSeq	Phase_1	29	18	NM_031490	0	0	10	13	3		Silent	SNP	ENST00000285737.4	37	CCDS10734.1																																																																																			G|0.999;A|0.001		0.502	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
HERPUD1	9709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	56970652	56970652	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:56970652G>T	ENST00000439977.2	+	4	551	c.354G>T	c.(352-354)gaG>gaT	p.E118D	HERPUD1_ENST00000570273.1_3'UTR|HERPUD1_ENST00000379792.2_Missense_Mutation_p.E93D|HERPUD1_ENST00000344114.4_Missense_Mutation_p.E117D|HERPUD1_ENST00000300302.5_Missense_Mutation_p.E117D	NM_001010989.1|NM_014685.2	NP_001010989.1|NP_055500.1	Q15011	HERP1_HUMAN	homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	118					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of protein binding (GO:0032092)|regulation of protein ubiquitination (GO:0031396)|response to unfolded protein (GO:0006986)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	11						AGTATCCTGAGGATTCCTCAA	0.443			T	ERG	prostate																																p.E118D		.		Dom	yes		16	16q12.2-q13	9709	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1"""		E	.	HERPUD1-90	0			c.G354T						.						142.0	131.0	135.0					16																	56970652		2198	4300	6498	SO:0001583	missense	9709	exon4			TCCTGAGGATTCC	AB034989	CCDS10771.1, CCDS45492.1	16q13	2008-05-14			ENSG00000051108	ENSG00000051108			13744	protein-coding gene	gene with protein product		608070				10922362, 10708769	Standard	NM_001010989		Approved	KIAA0025, Mif1, HERP, SUP	uc002eke.2	Q15011	OTTHUMG00000133276	ENST00000439977.2:c.354G>T	16.37:g.56970652G>T	ENSP00000409555:p.Glu118Asp	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	77	41	NM_014685	0	0	265	515	250	E9PGD1|O60644|Q6IAN8|Q96D92	Missense_Mutation	SNP	ENST00000439977.2	37	CCDS10771.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631353	0.28978	.	.	ENSG00000051108	ENST00000439977;ENST00000379792;ENST00000300302;ENST00000344114	T;T	0.44881	1.51;0.91	6.16	3.15	0.36227	.	0.708796	0.14867	N	0.293775	T	0.20577	0.0495	N	0.08118	0	0.26730	N	0.970611	B;B;B;B;B;B	0.20988	0.017;0.008;0.033;0.0;0.05;0.029	B;B;B;B;B;B	0.19666	0.008;0.026;0.022;0.0;0.019;0.009	T	0.21552	-1.0242	10	0.14656	T	0.56	-20.3489	8.8344	0.35104	0.2378:0.0:0.7622:0.0	.	118;117;118;93;117;118	B4E3N8;Q15011-3;A4UAE9;E9PGD1;Q15011-2;Q15011	.;.;.;.;.;HERP1_HUMAN	D	117;93;118;117	ENSP00000369118:E93D;ENSP00000340931:E117D	ENSP00000300302:E118D	E	+	3	2	HERPUD1	55528153	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	0.509000	0.22707	0.939000	0.37446	0.650000	0.86243	GAG	.		0.443	HERPUD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257056.5		
SF3B3	23450	broad.mit.edu	37	16	70569300	70569300	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:70569300C>T	ENST00000302516.5	+	6	1013	c.802C>T	c.(802-804)Cgc>Tgc	p.R268C	SNORD111_ENST00000408139.1_RNA	NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	268					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)	p.R268C(1)|p.R268S(1)		breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				GCCAGATATCCGCTGTCCAAT	0.413																																					p.R268C													.	SF3B3-91	2	Substitution - Missense(2)	lung(1)|endometrium(1)	c.C802T						.						130.0	135.0	133.0					16																	70569300		2198	4300	6498	SO:0001583	missense	23450	exon6			GATATCCGCTGTC	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.802C>T	16.37:g.70569300C>T	ENSP00000305790:p.Arg268Cys	Somatic	195	0		WXS	Illumina HiSeq	Phase_I	285	5	NM_012426	0	0	46	46	0	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863904	0.51482	.	.	ENSG00000189091	ENST00000302516	T	0.44881	0.91	4.84	3.79	0.43588	.	0.000000	0.85682	D	0.000000	T	0.58018	0.2093	M	0.78223	2.4	0.80722	D	1	D	0.54047	0.964	P	0.54889	0.763	T	0.63567	-0.6608	10	0.44086	T	0.13	.	15.9059	0.79430	0.1767:0.8233:0.0:0.0	.	268	Q15393	SF3B3_HUMAN	C	268	ENSP00000305790:R268C	ENSP00000305790:R268C	R	+	1	0	SF3B3	69126801	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.092000	0.50207	2.236000	0.73375	0.484000	0.47621	CGC	.		0.413	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
MARVELD3	91862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	71674415	71674415	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:71674415T>A	ENST00000299952.4	+	3	761	c.718T>A	c.(718-720)Tac>Aac	p.Y240N	MARVELD3_ENST00000565261.1_3'UTR|PHLPP2_ENST00000540628.1_Intron|MARVELD3_ENST00000561682.1_Intron	NM_001017967.3|NM_001271329.1	NP_001017967.2|NP_001258258.1	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	240	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				TGGGAACAACTACTACTCACC	0.572																																					p.Y240N		.											.	MARVELD3-91	0			c.T718A						.						113.0	95.0	101.0					16																	71674415		2198	4300	6498	SO:0001583	missense	91862	exon3			AACAACTACTACT	BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000299952.4:c.718T>A	16.37:g.71674415T>A	ENSP00000299952:p.Tyr240Asn	Somatic	76	1		WXS	Illumina HiSeq	Phase_I	329	87	NM_001017967	0	0	2	5	3	A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	ENST00000299952.4	37	CCDS32478.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.397934	0.62177	.	.	ENSG00000140832	ENST00000299952	D	0.85861	-2.04	5.63	5.63	0.86233	.	0.319419	0.34802	N	0.003668	D	0.90950	0.7155	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.67382	0.951	D	0.90548	0.4507	9	0.40728	T	0.16	-16.1302	13.8397	0.63430	0.0:0.0:0.0:1.0	.	240	Q96A59-2	.	N	240	ENSP00000299952:Y240N	ENSP00000299952:Y240N	Y	+	1	0	MARVELD3	70231916	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.127000	0.50484	2.154000	0.67381	0.456000	0.33151	TAC	.		0.572	MARVELD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268990.1	NM_052858	
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72984698	72984698	+	Silent	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:72984698G>A	ENST00000268489.5	-	3	3558	c.2886C>T	c.(2884-2886)ggC>ggT	p.G962G	ZFHX3_ENST00000397992.5_Silent_p.G48G	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	962					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TCATGTGCAGGCCCAGCATGT	0.607																																					p.G962G		.											.	ZFHX3-72	0			c.C2886T						.						106.0	90.0	96.0					16																	72984698		2198	4300	6498	SO:0001819	synonymous_variant	463	exon3			GTGCAGGCCCAGC	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2886C>T	16.37:g.72984698G>A		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	260	65	NM_006885	0	0	9	11	2	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.607	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
USP6	9098	hgsc.bcm.edu	37	17	5042939	5042939	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:5042939A>C	ENST00000574788.1	+	22	3698	c.1468A>C	c.(1468-1470)Acc>Ccc	p.T490P	USP6_ENST00000304328.5_Missense_Mutation_p.T173P|USP6_ENST00000250066.6_Missense_Mutation_p.T490P|USP6_ENST00000332776.4_Missense_Mutation_p.T490P			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	490					cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CCAGCTGGCCACCTGCTGGCA	0.607			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.T490P		.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	USP6-662	0			c.A1468C						.						44.0	48.0	47.0					17																	5042939		2203	4300	6503	SO:0001583	missense	9098	exon14			CTGGCCACCTGCT	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.1468A>C	17.37:g.5042939A>C	ENSP00000460380:p.Thr490Pro	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	325	20	NM_004505	0	0	0	38	38	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.512750	0.00975	.	.	ENSG00000129204	ENST00000332776;ENST00000250066;ENST00000304328	T;T;T	0.13901	2.55;3.03;2.73	0.0465	0.0465	0.14256	.	0.094876	0.64402	D	0.000001	T	0.09423	0.0232	N	0.08118	0	0.09310	N	1	P;P	0.47106	0.89;0.797	P;B	0.52554	0.702;0.321	T	0.20773	-1.0265	9	0.38643	T	0.18	.	.	.	.	.	173;490	P35125-2;P35125	.;UBP6_HUMAN	P	490;490;173	ENSP00000328010:T490P;ENSP00000250066:T490P;ENSP00000305473:T173P	ENSP00000250066:T490P	T	+	1	0	USP6	4983663	0.933000	0.31639	0.264000	0.24511	0.260000	0.26232	-0.165000	0.09968	0.115000	0.18071	0.113000	0.15668	ACC	.		0.607	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
KDM6B	23135	bcgsc.ca	37	17	7750966	7750966	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:7750966G>C	ENST00000448097.2	+	11	1691	c.1360G>C	c.(1360-1362)Gct>Cct	p.A454P	KDM6B_ENST00000254846.5_Missense_Mutation_p.A454P			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	454	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						GGGGGctcccgctgccactcc	0.682																																					p.A454P													.	KDM6B-205	0			c.G1360C						.						12.0	14.0	14.0					17																	7750966		2191	4271	6462	SO:0001583	missense	23135	exon11			GCTCCCGCTGCCA	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.1360G>C	17.37:g.7750966G>C	ENSP00000412513:p.Ala454Pro	Somatic	24	0		WXS	Illumina HiSeq	Phase_1	57	31	NM_001080424	0	0	2	2	0	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	G	12.89	2.072459	0.36566	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.10192	2.9;2.9	4.19	2.14	0.27477	.	0.443738	0.20044	N	0.100452	T	0.06005	0.0156	N	0.14661	0.345	0.30005	N	0.815706	B	0.02656	0.0	B	0.04013	0.001	T	0.13872	-1.0493	10	0.72032	D	0.01	-0.5261	6.4024	0.21646	0.1049:0.4027:0.4924:0.0	.	454	O15054-1	.	P	454	ENSP00000254846:A454P;ENSP00000412513:A454P	ENSP00000254846:A454P	A	+	1	0	KDM6B	7691691	0.388000	0.25197	0.965000	0.40720	0.996000	0.88848	0.416000	0.21198	0.506000	0.28125	0.555000	0.69702	GCT	.		0.682	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
PER1	5187	hgsc.bcm.edu	37	17	8047043	8047043	+	Silent	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:8047043T>G	ENST00000317276.4	-	19	2850	c.2613A>C	c.(2611-2613)ccA>ccC	p.P871P	PER1_ENST00000581082.1_Silent_p.P848P|PER1_ENST00000578089.1_5'UTR	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	871	Pro-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TAGTGGCTGGTGGGGTGGGCC	0.672			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.P871P		.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1-723	0			c.A2613C						.						9.0	11.0	10.0					17																	8047043		2183	4270	6453	SO:0001819	synonymous_variant	5187	exon19			GGCTGGTGGGGTG	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2613A>C	17.37:g.8047043T>G		Somatic	11	1		WXS	Illumina HiSeq	Phase_I	52	29	NM_002616	0	0	13	14	1	B2RPA8|B4DI49|D3DTR3	Silent	SNP	ENST00000317276.4	37	CCDS11131.1																																																																																			.		0.672	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
COX10	1352	hgsc.bcm.edu;bcgsc.ca	37	17	14110451	14110451	+	Missense_Mutation	SNP	A	A	C	rs200435051		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:14110451A>C	ENST00000261643.3	+	7	1330	c.1253A>C	c.(1252-1254)cAc>cCc	p.H418P	COX10_ENST00000537334.1_Missense_Mutation_p.H201P|COX10_ENST00000536205.1_Missense_Mutation_p.H226P	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	418					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		AGCCTGTGGCACCTGCCGCTG	0.672																																					p.H418P		.											.	COX10-226	0			c.A1253C						.						34.0	35.0	34.0					17																	14110451		2200	4293	6493	SO:0001583	missense	1352	exon7			TGTGGCACCTGCC	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.1253A>C	17.37:g.14110451A>C	ENSP00000261643:p.His418Pro	Somatic	81	2		WXS	Illumina HiSeq	Phase_I	161	96	NM_001303	0	0	10	10	0	B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	ENST00000261643.3	37	CCDS11166.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.623350	0.87460	.	.	ENSG00000006695	ENST00000261643;ENST00000536205;ENST00000537334	D;D;D	0.92397	-3.03;-3.03;-3.03	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.97133	0.9063	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.79784	0.981;0.993	D	0.98325	1.0530	10	0.87932	D	0	.	14.6208	0.68582	1.0:0.0:0.0:0.0	.	226;418	B4DJ50;Q12887	.;COX10_HUMAN	P	418;226;201	ENSP00000261643:H418P;ENSP00000439494:H226P;ENSP00000443354:H201P	ENSP00000261643:H418P	H	+	2	0	COX10	14051176	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.822000	0.92013	1.932000	0.55993	0.459000	0.35465	CAC	.		0.672	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303	
TVP23C	201158	bcgsc.ca	37	17	15449097	15449097	+	Splice_Site	SNP	A	A	C	rs199732389		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:15449097A>C	ENST00000225576.3	-	5	558		c.e5+1		TVP23C_ENST00000518321.1_Splice_Site|TVP23C_ENST00000428082.2_Splice_Site|TVP23C_ENST00000519970.1_Splice_Site|TVP23C-CDRT4_ENST00000522212.2_Splice_Site|TVP23C_ENST00000438826.3_Splice_Site|TVP23C_ENST00000584811.1_Splice_Site	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)							integral component of membrane (GO:0016021)											ACTGATACTCACCAGCCACTT	0.403																																					.													.	.	0			c.462+2T>G						.						151.0	145.0	147.0					17																	15449097		2203	4300	6503	SO:0001630	splice_region_variant	201158	exon6			ATACTCACCAGCC	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.462+1T>G	17.37:g.15449097A>C		Somatic	147	2		WXS	Illumina HiSeq	Phase_1	53	17	NM_145301	0	0	0	0	0	Q3LIC7	Splice_Site	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	A	15.46	2.838878	0.51057	.	.	ENSG00000259024;ENSG00000259024;ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000557349;ENST00000481756;ENST00000519970;ENST00000225576;ENST00000428082;ENST00000438826;ENST00000419890	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6393	0.68711	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RP11-726O12.1;FAM18B2	15389822	1.000000	0.71417	1.000000	0.80357	0.564000	0.35744	8.864000	0.92294	2.160000	0.67779	0.528000	0.53228	.	.		0.403	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	Intron
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	303	45		WXS	Illumina HiSeq		858	112	NM_145301	0	1	15	47	31	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
ATPAF2	91647	bcgsc.ca	37	17	17942265	17942265	+	Silent	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:17942265A>C	ENST00000474627.3	-	1	217	c.63T>G	c.(61-63)ggT>ggG	p.G21G	ATPAF2_ENST00000585101.1_Silent_p.G21G|GID4_ENST00000268719.4_5'Flank|GID4_ENST00000376345.3_5'Flank	NM_145691.3	NP_663729.1	Q8N5M1	ATPF2_HUMAN	ATP synthase mitochondrial F1 complex assembly factor 2	21					proton-transporting ATP synthase complex assembly (GO:0043461)	mitochondrion (GO:0005739)|nuclear speck (GO:0016607)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	8	all_neural(463;0.228)					CGCTGGGGCCACCCGCCGGCC	0.672																																					p.G21G													.	ATPAF2-90	0			c.T63G						.						13.0	16.0	15.0					17																	17942265		2197	4293	6490	SO:0001819	synonymous_variant	91647	exon1			GGGGCCACCCGCC	AF052185	CCDS32585.1	17p11.2	2012-10-12			ENSG00000171953	ENSG00000171953		"""Mitochondrial respiratory chain complex assembly factors"""	18802	protein-coding gene	gene with protein product		608918				11410595, 11997338	Standard	NM_145691		Approved	Atp12p, ATP12, LP3663, MGC29736	uc002gse.1	Q8N5M1	OTTHUMG00000059354	ENST00000474627.3:c.63T>G	17.37:g.17942265A>C		Somatic	35	4		WXS	Illumina HiSeq	Phase_1	87	54	NM_145691	0	0	3	4	1	A6NDE5|A8K2J2|Q6XYC7	Silent	SNP	ENST00000474627.3	37	CCDS32585.1																																																																																			.		0.672	ATPAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131934.3	NM_145691	
WSB1	26118	bcgsc.ca	37	17	25639347	25639347	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:25639347G>C	ENST00000262394.2	+	9	1534	c.1218G>C	c.(1216-1218)gaG>gaC	p.E406D	RP11-173M1.8_ENST00000578929.1_lincRNA|WSB1_ENST00000348811.2_Missense_Mutation_p.E260D	NM_015626.8	NP_056441.6	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box containing 1	406	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				lung(3)	3	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		AAGTTCAGGAGCTGCCGATTC	0.468																																					p.E406D													.	WSB1-226	0			c.G1218C						.						286.0	272.0	277.0					17																	25639347		2203	4300	6503	SO:0001583	missense	26118	exon9			TCAGGAGCTGCCG	AF069313	CCDS11220.1, CCDS11221.1	17q11.2	2013-01-09	2011-01-25		ENSG00000109046	ENSG00000109046		"""WD repeat domain containing"""	19221	protein-coding gene	gene with protein product		610091	"""WD repeat and SOCS box-containing 1"""			10354473, 12076535	Standard	XR_243778		Approved	DKFZp564A122, DKFZp564B0482, SWIP1	uc002gzd.1	Q9Y6I7	OTTHUMG00000132293	ENST00000262394.2:c.1218G>C	17.37:g.25639347G>C	ENSP00000262394:p.Glu406Asp	Somatic	450	0		WXS	Illumina HiSeq	Phase_1	403	122	NM_015626	0	0	126	140	14	Q9NRB1|Q9UBH9|Q9UG25|Q9UNN6|Q9Y656	Missense_Mutation	SNP	ENST00000262394.2	37	CCDS11220.1	.	.	.	.	.	.	.	.	.	.	G	8.222	0.802733	0.16397	.	.	ENSG00000109046	ENST00000262394;ENST00000348811	T;T	0.44083	0.93;0.93	5.91	-0.263	0.12954	SOCS protein, C-terminal (4);	0.583212	0.17272	N	0.180325	T	0.24928	0.0605	L	0.28014	0.82	0.22728	N	0.998802	B;B	0.14012	0.009;0.003	B;B	0.15870	0.014;0.014	T	0.13308	-1.0514	10	0.36615	T	0.2	-28.0638	6.7073	0.23258	0.4017:0.1213:0.477:0.0	.	260;406	Q9Y6I7-2;Q9Y6I7	.;WSB1_HUMAN	D	406;260	ENSP00000262394:E406D;ENSP00000327055:E260D	ENSP00000262394:E406D	E	+	3	2	WSB1	22663474	0.995000	0.38212	0.940000	0.37924	0.141000	0.21300	0.353000	0.20130	-0.232000	0.09811	0.655000	0.94253	GAG	.		0.468	WSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255391.4	NM_015626	
SLFN5	162394	bcgsc.ca	37	17	33586030	33586030	+	Silent	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:33586030T>G	ENST00000299977.4	+	2	469	c.321T>G	c.(319-321)ggT>ggG	p.G107G	SLFN5_ENST00000542451.1_Silent_p.G107G|SLFN5_ENST00000592325.1_Silent_p.G107G	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	107					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		CAGAGGCTGGTGTGCCACTTG	0.433																																					p.G107G													.	SLFN5-92	0			c.T321G						.						110.0	110.0	110.0					17																	33586030		2203	4300	6503	SO:0001819	synonymous_variant	162394	exon2			GGCTGGTGTGCCA	BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.321T>G	17.37:g.33586030T>G		Somatic	144	1		WXS	Illumina HiSeq	Phase_1	106	45	NM_144975	0	0	20	20	0	Q08AF2|Q8WU54|Q96A82	Silent	SNP	ENST00000299977.4	37	CCDS32619.1																																																																																			.		0.433	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448649.2	NM_144975	
ACACA	31	bcgsc.ca	37	17	35445967	35445967	+	Missense_Mutation	SNP	C	C	T	rs199660893		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:35445967C>T	ENST00000394406.2	-	55	7013	c.6823G>A	c.(6823-6825)Gag>Aag	p.E2275K	ACACA_ENST00000335166.5_Missense_Mutation_p.E2197K|ACACA_ENST00000360679.3_Missense_Mutation_p.E2217K|ACACA_ENST00000361253.5_Missense_Mutation_p.E401K|ACACA_ENST00000353139.5_Missense_Mutation_p.E2312K	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	2275					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AGCTGTTTCTCTAGCCACTCC	0.507																																					p.E2312K	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												.	ACACA-154	0			c.G6934A						.						175.0	160.0	165.0					17																	35445967		2203	4300	6503	SO:0001583	missense	31	exon55			GTTTCTCTAGCCA	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.6823G>A	17.37:g.35445967C>T	ENSP00000377928:p.Glu2275Lys	Somatic	196	0		WXS	Illumina HiSeq	Phase_1	185	72	NM_198834	0	0	25	28	3	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	37	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234586	0.95207	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330;ENST00000361253	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	5.77	4.78	0.61160	.	0.052201	0.85682	D	0.000000	T	0.69296	0.3095	M	0.81341	2.54	0.80722	D	1	D;P;P;B;B	0.54397	0.966;0.907;0.744;0.056;0.093	P;P;B;B;B	0.55055	0.484;0.767;0.402;0.009;0.02	T	0.75955	-0.3135	10	0.87932	D	0	-17.632	16.7077	0.85376	0.0:0.8704:0.1296:0.0	.	313;974;2312;2275;2217	B4DIG6;F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;.;ACACA_HUMAN;.	K	2312;2217;2275;2299;2197;974;401	ENSP00000344789:E2312K;ENSP00000353898:E2217K;ENSP00000377928:E2275K;ENSP00000335323:E2197K;ENSP00000354565:E401K	ENSP00000335323:E2197K	E	-	1	0	ACACA	32520080	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.800000	0.85949	1.398000	0.46701	0.655000	0.94253	GAG	.		0.507	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
NR1D1	9572	bcgsc.ca	37	17	38253621	38253621	+	Missense_Mutation	SNP	A	A	G	rs201066687		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:38253621A>G	ENST00000246672.3	-	2	697	c.67T>C	c.(67-69)Tcc>Ccc	p.S23P		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	23	Modulating.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					CGGCTTGGGGAGGAGCCACTG	0.592																																					p.S23P													.	NR1D1-226	0			c.T67C						.						43.0	48.0	47.0					17																	38253621		2203	4300	6503	SO:0001583	missense	9572	exon2			TTGGGGAGGAGCC	X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.67T>C	17.37:g.38253621A>G	ENSP00000246672:p.Ser23Pro	Somatic	20	0		WXS	Illumina HiSeq	Phase_1	91	56	NM_021724	0	0	6	6	0	Q0P5Z4|Q15304	Missense_Mutation	SNP	ENST00000246672.3	37	CCDS11361.1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370292	0.61624	.	.	ENSG00000126368	ENST00000246672	D	0.91686	-2.89	4.72	3.65	0.41850	.	0.229124	0.36854	N	0.002372	D	0.87696	0.6242	L	0.46157	1.445	0.58432	D	0.999994	B	0.20780	0.048	B	0.16289	0.015	D	0.83608	0.0132	10	0.72032	D	0.01	.	9.0198	0.36193	0.9115:0.0:0.0885:0.0	.	23	P20393	NR1D1_HUMAN	P	23	ENSP00000246672:S23P	ENSP00000246672:S23P	S	-	1	0	NR1D1	35507147	1.000000	0.71417	0.974000	0.42286	0.934000	0.57294	2.649000	0.46656	0.867000	0.35654	0.379000	0.24179	TCC	.		0.592	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257135.1		
KRTAP4-7	100132476	ucsc.edu	37	17	39240779	39240779	+	Silent	SNP	C	C	A	rs74195088		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:39240779C>A	ENST00000391417.4	+	1	321	c.321C>A	c.(319-321)ccC>ccA	p.P107P		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	132	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						gctgccagcccacctgctgcc	0.667																																					p.P107P													.	.	0			c.C321A						.						9.0	12.0	11.0					17																	39240779		643	1506	2149	SO:0001819	synonymous_variant	100132476	exon1			CCAGCCCACCTGC	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.321C>A	17.37:g.39240779C>A		Somatic	39	0		WXS	Illumina HiSeq		125	15	NM_033061	0	0	0	0	0	A0AVM6|A8MQ08|A8MTL4	Silent	SNP	ENST00000391417.4	37	CCDS45673.1																																																																																			C|0.956;A|0.044		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
KRTAP4-2	85291	hgsc.bcm.edu	37	17	39334233	39334233	+	Missense_Mutation	SNP	T	T	G	rs560495299	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:39334233T>G	ENST00000377726.2	-	1	227	c.184A>C	c.(184-186)Agc>Cgc	p.S62R		NM_033062.3	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	62	20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].					keratin filament (GO:0045095)				kidney(2)|lung(4)|upper_aerodigestive_tract(1)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CAGCTGGGGCTGCAGCAGGTG	0.657													T|||	17	0.00339457	0.0023	0.0014	5008	,	,		17958	0.0099		0.0	False		,,,				2504	0.0031				p.S62R		.											.	KRTAP4-2-44	0			c.A184C						.						40.0	46.0	44.0					17																	39334233		2201	4298	6499	SO:0001583	missense	85291	exon1			TGGGGCTGCAGCA	AJ406934	CCDS11384.1	17q21.2	2013-06-25			ENSG00000244537	ENSG00000244537		"""Keratin associated proteins"""	18900	protein-coding gene	gene with protein product						11279113	Standard	NM_033062		Approved	KAP4.2	uc002hwd.3	Q9BYR5	OTTHUMG00000133437	ENST00000377726.2:c.184A>C	17.37:g.39334233T>G	ENSP00000366955:p.Ser62Arg	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	477	30	NM_033062	0	0	0	0	0	A0JP64	Missense_Mutation	SNP	ENST00000377726.2	37	CCDS11384.1	.	.	.	.	.	.	.	.	.	.	.	0.738	-0.777466	0.02929	.	.	ENSG00000244537	ENST00000377726;ENST00000458321	T	0.00603	6.28	4.67	-1.59	0.08453	.	1.674050	0.04249	N	0.338307	T	0.00178	0.0005	N	0.00011	-3.005	0.09310	N	1	B	0.16802	0.019	B	0.20955	0.032	T	0.51608	-0.8684	10	0.12766	T	0.61	.	14.1242	0.65210	0.0:0.0:0.3626:0.6374	.	62	Q9BYR5	KRA42_HUMAN	R	62;179	ENSP00000366955:S62R	ENSP00000366955:S62R	S	-	1	0	KRTAP4-2	36587759	0.000000	0.05858	0.001000	0.08648	0.119000	0.20118	-2.321000	0.01119	-0.438000	0.07232	-1.986000	0.00452	AGC	.		0.657	KRTAP4-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257305.1		
KRT9	3857	broad.mit.edu	37	17	39724451	39724451	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:39724451T>G	ENST00000246662.4	-	6	1422	c.1357A>C	c.(1357-1359)Acc>Ccc	p.T453P	KRT9_ENST00000588431.1_Missense_Mutation_p.T220P	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	453	Coil 2.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				TTGTGGTAGGTCTCGATTTCC	0.557																																					p.T453P													.	KRT9-92	0			c.A1357C						.						90.0	84.0	86.0					17																	39724451		2203	4300	6503	SO:0001583	missense	3857	exon6			GGTAGGTCTCGAT		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.1357A>C	17.37:g.39724451T>G	ENSP00000246662:p.Thr453Pro	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	209	59	NM_000226	0	0	0	0	0	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	37	CCDS32654.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.798153	0.50208	.	.	ENSG00000171403	ENST00000246662	D	0.91945	-2.94	4.93	4.93	0.64822	Filament (1);Intermediate filament protein, conserved site (1);	0.000000	0.33364	N	0.004999	D	0.96522	0.8865	M	0.92367	3.3	0.19945	N	0.999942	D	0.76494	0.999	D	0.75020	0.985	D	0.91494	0.5214	10	0.87932	D	0	.	11.6733	0.51415	0.0:0.0:0.2295:0.7705	.	453	P35527	K1C9_HUMAN	P	453	ENSP00000246662:T453P	ENSP00000246662:T453P	T	-	1	0	KRT9	36977977	0.001000	0.12720	0.928000	0.36995	0.572000	0.35998	0.824000	0.27379	1.828000	0.53243	0.386000	0.25728	ACC	.		0.557	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226	
GHDC	84514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40344945	40344945	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:40344945G>T	ENST00000301671.8	-	3	807	c.366C>A	c.(364-366)gaC>gaA	p.D122E	GHDC_ENST00000436923.2_Missense_Mutation_p.D122E|GHDC_ENST00000428494.2_Intron|GHDC_ENST00000590520.1_5'Flank|GHDC_ENST00000587427.1_Missense_Mutation_p.D122E|GHDC_ENST00000414034.3_Missense_Mutation_p.D122E|GHDC_ENST00000593209.1_Missense_Mutation_p.D122E			Q8N2G8	GHDC_HUMAN	GH3 domain containing	122						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CCTCCCCAAGGTCCTGGTTTG	0.607																																					p.D122E		.											.	GHDC-90	0			c.C366A						.						105.0	118.0	113.0					17																	40344945		2203	4300	6503	SO:0001583	missense	84514	exon4			CCCAAGGTCCTGG	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.366C>A	17.37:g.40344945G>T	ENSP00000301671:p.Asp122Glu	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	674	230	NM_001142623	0	0	42	72	30	B4DQS4|E9PDB5|Q9BXM6	Missense_Mutation	SNP	ENST00000301671.8	37	CCDS11422.1	.	.	.	.	.	.	.	.	.	.	G	0.862	-0.734923	0.03111	.	.	ENSG00000167925	ENST00000393854;ENST00000414034;ENST00000301671;ENST00000436923	.	.	.	4.61	1.41	0.22369	.	1.247040	0.05644	N	0.583915	T	0.19886	0.0478	N	0.14661	0.345	0.09310	N	1	B;B	0.26400	0.148;0.009	B;B	0.24394	0.053;0.007	T	0.25082	-1.0142	9	0.18276	T	0.48	-0.018	4.8152	0.13363	0.1998:0.1781:0.6221:0.0	.	122;122	Q8N2G8-2;Q8N2G8	.;GHDC_HUMAN	E	66;122;122;122	.	ENSP00000301671:D122E	D	-	3	2	GHDC	37598471	0.000000	0.05858	0.002000	0.10522	0.094000	0.18550	0.158000	0.16422	0.544000	0.28883	0.561000	0.74099	GAC	.		0.607	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
GHDC	84514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40344972	40344972	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:40344972C>T	ENST00000301671.8	-	3	780	c.339G>A	c.(337-339)caG>caA	p.Q113Q	GHDC_ENST00000436923.2_Silent_p.Q113Q|GHDC_ENST00000428494.2_Intron|GHDC_ENST00000590520.1_5'UTR|GHDC_ENST00000587427.1_Silent_p.Q113Q|GHDC_ENST00000414034.3_Silent_p.Q113Q|GHDC_ENST00000593209.1_Silent_p.Q113Q			Q8N2G8	GHDC_HUMAN	GH3 domain containing	113						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		GGGGCAGTGGCTGCTCTCCAC	0.592																																					p.Q113Q		.											.	GHDC-90	0			c.G339A						.						118.0	133.0	128.0					17																	40344972		2203	4300	6503	SO:0001819	synonymous_variant	84514	exon4			CAGTGGCTGCTCT	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.339G>A	17.37:g.40344972C>T		Somatic	191	1		WXS	Illumina HiSeq	Phase_I	869	325	NM_001142623	0	0	40	76	36	B4DQS4|E9PDB5|Q9BXM6	Silent	SNP	ENST00000301671.8	37	CCDS11422.1																																																																																			.		0.592	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
ITGA3	3675	bcgsc.ca	37	17	48156873	48156873	+	Silent	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:48156873A>C	ENST00000320031.8	+	21	2988	c.2658A>C	c.(2656-2658)ccA>ccC	p.P886P	ITGA3_ENST00000007722.7_Silent_p.P886P	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	886					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						AGGGCCCCCCACCTGTCACTC	0.627																																					p.P886P													.	ITGA3-229	0			c.A2658C						.						30.0	32.0	32.0					17																	48156873		2203	4299	6502	SO:0001819	synonymous_variant	3675	exon21			CCCCCCACCTGTC	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.2658A>C	17.37:g.48156873A>C		Somatic	64	0		WXS	Illumina HiSeq	Phase_1	216	79	NM_005501	0	0	214	219	5	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Silent	SNP	ENST00000320031.8	37	CCDS11558.1																																																																																			.		0.627	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501	
INTS2	57508	bcgsc.ca	37	17	59946430	59946430	+	Missense_Mutation	SNP	C	C	G	rs372415686		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:59946430C>G	ENST00000444766.3	-	23	3308	c.3233G>C	c.(3232-3234)cGt>cCt	p.R1078P	INTS2_ENST00000251334.6_Missense_Mutation_p.R1070P	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	1078					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						GACAGCTAAACGAGCCACACT	0.338																																					p.R1078P													.	INTS2-206	0			c.G3233C						.						90.0	88.0	89.0					17																	59946430		1856	4098	5954	SO:0001583	missense	57508	exon23			GCTAAACGAGCCA	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.3233G>C	17.37:g.59946430C>G	ENSP00000414237:p.Arg1078Pro	Somatic	98	6		WXS	Illumina HiSeq	Phase_1	34	13	NM_020748	0	0	12	12	0	Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	37	CCDS45750.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317342	0.81469	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.47177	0.85	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.65428	0.2690	M	0.65498	2.005	0.80722	D	1	D	0.76494	0.999	D	0.66351	0.943	T	0.66268	-0.5966	9	.	.	.	-6.2183	16.8778	0.86056	0.0:1.0:0.0:0.0	.	1078	Q9H0H0	INT2_HUMAN	P	1078;1077	ENSP00000414237:R1078P	.	R	-	2	0	INTS2	57301212	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.239000	0.78182	2.220000	0.72140	0.650000	0.86243	CGT	.		0.338	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
COG1	9382	bcgsc.ca	37	17	71196858	71196858	+	Silent	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:71196858G>A	ENST00000299886.4	+	6	1304	c.1224G>A	c.(1222-1224)gaG>gaA	p.E408E		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	408					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			GGCTTCTGGAGAAGCCGCTCT	0.527																																					p.E408E													.	COG1-91	0			c.G1224A						.						55.0	58.0	57.0					17																	71196858		2203	4300	6503	SO:0001819	synonymous_variant	9382	exon6			TCTGGAGAAGCCG		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.1224G>A	17.37:g.71196858G>A		Somatic	86	0		WXS	Illumina HiSeq	Phase_1	179	59	NM_018714	0	0	59	78	19	Q9NPV9|Q9P2G6	Silent	SNP	ENST00000299886.4	37	CCDS11692.1																																																																																			.		0.527	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		
ITGB4	3691	hgsc.bcm.edu	37	17	73732406	73732406	+	Missense_Mutation	SNP	G	G	C	rs201929789		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:73732406G>C	ENST00000200181.3	+	15	1986	c.1799G>C	c.(1798-1800)cGc>cCc	p.R600P	ITGB4_ENST00000339591.3_Missense_Mutation_p.R600P|ITGB4_ENST00000450894.3_Missense_Mutation_p.R600P|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000579662.1_Missense_Mutation_p.R600P|ITGB4_ENST00000449880.2_Missense_Mutation_p.R600P	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	600	Cysteine-rich tandem repeats.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAGTGTGGCCGCTGCCACTGC	0.632																																					p.R600P		.											.	ITGB4-227	0			c.G1799C						.						65.0	69.0	67.0					17																	73732406		2203	4300	6503	SO:0001583	missense	3691	exon15			GTGGCCGCTGCCA		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.1799G>C	17.37:g.73732406G>C	ENSP00000200181:p.Arg600Pro	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	385	151	NM_001005731	0	0	19	19	0	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	37	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.314176	0.40996	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.94862	-3.54;-3.54;-3.54	4.6	4.6	0.57074	.	0.067612	0.64402	D	0.000010	D	0.97222	0.9092	M	0.83774	2.66	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0	D;D;D;D;D	0.79784	0.916;0.961;0.993;0.985;0.985	D	0.98032	1.0377	10	0.72032	D	0.01	.	16.4661	0.84079	0.0:0.0:1.0:0.0	.	560;600;600;600;600	B4E3N0;P16144-5;P16144-3;A0AVL6;P16144	.;.;.;.;ITB4_HUMAN	P	516;600;600;600	ENSP00000200181:R600P;ENSP00000344079:R600P;ENSP00000400217:R600P	ENSP00000200181:R600P	R	+	2	0	ITGB4	71244001	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.642000	0.67888	2.095000	0.63458	0.558000	0.71614	CGC	G|0.998;C|0.002		0.632	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
SEPT9	10801	hgsc.bcm.edu	37	17	75488782	75488782	+	Missense_Mutation	SNP	T	T	G	rs376712636		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:75488782T>G	ENST00000427177.1	+	9	1586	c.1460T>G	c.(1459-1461)gTg>gGg	p.V487G	SEPT9_ENST00000588690.1_Missense_Mutation_p.V323G|SEPT9_ENST00000591198.1_Missense_Mutation_p.V468G|SEPT9_ENST00000591088.1_Missense_Mutation_p.V236G|SEPT9_ENST00000592951.1_Missense_Mutation_p.V236G|SEPT9_ENST00000431235.2_Missense_Mutation_p.V323G|SEPT9_ENST00000329047.8_Missense_Mutation_p.V469G|SEPT9_ENST00000541152.2_Missense_Mutation_p.V236G|SEPT9_ENST00000427180.1_Missense_Mutation_p.V375G|SEPT9_ENST00000585930.1_Missense_Mutation_p.V263G|SEPT9_ENST00000427674.2_Missense_Mutation_p.V323G|SEPT9_ENST00000423034.2_Missense_Mutation_p.V480G|SEPT9_ENST00000592481.1_3'UTR|SEPT9_ENST00000590294.1_Missense_Mutation_p.V469G|SEPT9_ENST00000449803.2_Missense_Mutation_p.V323G	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	487	Septin-type G.			V -> E (in Ref. 5; BAB14057). {ECO:0000305}.	cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			GACCGGCTGGTGAACGAGAAG	0.582																																					p.V487G		.											.	SEPT9-659	0			c.T1460G						.						135.0	147.0	143.0					17																	75488782		1981	4158	6139	SO:0001583	missense	10801	exon9			GGCTGGTGAACGA	AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.1460T>G	17.37:g.75488782T>G	ENSP00000391249:p.Val487Gly	Somatic	206	1		WXS	Illumina HiSeq	Phase_I	873	208	NM_001113491	0	0	174	229	55	A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Missense_Mutation	SNP	ENST00000427177.1	37	CCDS45790.1	.	.	.	.	.	.	.	.	.	.	t	16.89	3.247092	0.59103	.	.	ENSG00000184640	ENST00000427177;ENST00000449803;ENST00000329047;ENST00000423034;ENST00000427674;ENST00000541152;ENST00000431235;ENST00000427180	T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71;0.71	4.99	3.9	0.45041	.	0.062830	0.64402	D	0.000005	T	0.50701	0.1631	L	0.39898	1.24	0.58432	D	0.999998	P;D;B;B;B;B	0.58620	0.716;0.983;0.275;0.354;0.354;0.407	B;P;B;B;B;B	0.54590	0.386;0.756;0.219;0.283;0.283;0.405	T	0.51371	-0.8714	10	0.66056	D	0.02	.	11.4247	0.50003	0.1353:0.0:0.0:0.8647	.	263;468;375;480;469;487	Q9UHD8-9;Q9UHD8-7;Q9UHD8-8;Q9UHD8-5;Q9UHD8-2;Q9UHD8	.;.;.;.;.;SEPT9_HUMAN	G	487;323;469;480;323;263;236;375	ENSP00000391249:V487G;ENSP00000400181:V323G;ENSP00000329161:V469G;ENSP00000405877:V480G;ENSP00000403194:V323G;ENSP00000415624:V375G	ENSP00000329161:V469G	V	+	2	0	SEPT9	73000377	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	3.186000	0.50942	0.835000	0.34877	0.359000	0.22050	GTG	.		0.582	SEPT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436304.2	NM_006640	
PIEZO2	63895	bcgsc.ca	37	18	10691291	10691291	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr18:10691291G>T	ENST00000503781.3	-	44	6941	c.6942C>A	c.(6940-6942)taC>taA	p.Y2314*	PIEZO2_ENST00000538948.1_Nonsense_Mutation_p.Y271*|PIEZO2_ENST00000302079.6_Nonsense_Mutation_p.Y2314*|PIEZO2_ENST00000285141.4_Nonsense_Mutation_p.Y169*|PIEZO2_ENST00000580640.1_Nonsense_Mutation_p.Y2339*	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2314					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.Y2314*(1)|p.Y169*(1)									CTCGCGTTGGGTAGCCACAAC	0.473																																					p.Y2314X													.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C6942A						.						114.0	99.0	104.0					18																	10691291		2203	4300	6503	SO:0001587	stop_gained	63895	exon44			CGTTGGGTAGCCA	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.6942C>A	18.37:g.10691291G>T	ENSP00000421377:p.Tyr2314*	Somatic	82	0		WXS	Illumina HiSeq	Phase_1	68	23	NM_022068	0	0	12	12	0	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Nonsense_Mutation	SNP	ENST00000503781.3	37		.	.	.	.	.	.	.	.	.	.	G	40	8.416257	0.98801	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	.	.	.	5.62	4.73	0.59995	.	0.088628	0.48767	D	0.000168	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8864	0.41264	0.193:0.0:0.807:0.0	.	.	.	.	X	271;2314;271;169	.	ENSP00000285141:Y169X	Y	-	3	2	FAM38B	10681291	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	2.490000	0.45294	2.804000	0.96469	0.655000	0.94253	TAC	.		0.473	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
PLEKHJ1	55111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	2234038	2234038	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:2234038G>T	ENST00000589097.1	-	6	1456	c.343C>A	c.(343-345)Ctc>Atc	p.L115I	PLEKHJ1_ENST00000591099.2_Silent_p.A84A|SF3A2_ENST00000221494.5_5'Flank|PLEKHJ1_ENST00000326631.2_Missense_Mutation_p.L115I|PLEKHJ1_ENST00000587962.2_Missense_Mutation_p.L115I|MIR1227_ENST00000408484.1_RNA|PLEKHJ1_ENST00000589791.1_5'UTR|PLEKHJ1_ENST00000586608.2_Missense_Mutation_p.L116I|PLEKHJ1_ENST00000587394.2_Missense_Mutation_p.L115I			Q9NW61	PKHJ1_HUMAN	pleckstrin homology domain containing, family J member 1	115										endometrium(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGAAGATGAGGCTTCTCCGC	0.642																																					p.L115I		.											.	PLEKHJ1-90	0			c.C343A						.						119.0	107.0	111.0					19																	2234038		2203	4300	6503	SO:0001583	missense	55111	exon5			AGATGAGGCTTCT	AK001159	CCDS12083.1, CCDS74251.1	19p13.3	2013-01-10				ENSG00000104886		"""Pleckstrin homology (PH) domain containing"""	18211	protein-coding gene	gene with protein product	"""guanine nucleotide releasing protein x"""					11602354	Standard	XM_006722784		Approved	FLJ10297	uc002lvf.1	Q9NW61		ENST00000589097.1:c.343C>A	19.37:g.2234038G>T	ENSP00000465391:p.Leu115Ile	Somatic	176	0		WXS	Illumina HiSeq	Phase_I	567	185	NM_018049	0	0	22	40	18	B3KUQ9|D6W604	Missense_Mutation	SNP	ENST00000589097.1	37	CCDS12083.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.836779	0.32421	.	.	ENSG00000104886	ENST00000326631	.	.	.	4.05	2.94	0.34122	.	0.176721	0.36591	N	0.002508	T	0.28234	0.0697	L	0.32530	0.975	0.42701	D	0.993613	P	0.42692	0.787	B	0.33121	0.158	T	0.06881	-1.0802	9	0.33940	T	0.23	-16.6324	7.7627	0.28961	0.0916:0.0:0.7474:0.161	.	115	Q9NW61	PKHJ1_HUMAN	I	115	.	ENSP00000318075:L115I	L	-	1	0	PLEKHJ1	2185038	1.000000	0.71417	0.983000	0.44433	0.410000	0.31052	5.117000	0.64667	1.788000	0.52465	0.561000	0.74099	CTC	.		0.642	PLEKHJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451255.1	NM_018049	
TMIGD2	126259	bcgsc.ca	37	19	4294632	4294632	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:4294632G>C	ENST00000301272.2	-	4	539	c.494C>G	c.(493-495)gCg>gGg	p.A165G	TMIGD2_ENST00000595645.1_Missense_Mutation_p.A165G|TMIGD2_ENST00000600114.1_Missense_Mutation_p.A45G|TMIGD2_ENST00000600349.1_Intron	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	165					positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACACGATCGCAGCCACACC	0.637																																					p.A165G													.	TMIGD2-90	0			c.C494G						.						129.0	151.0	144.0					19																	4294632		2203	4300	6503	SO:0001583	missense	126259	exon4			ACGATCGCAGCCA	BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.494C>G	19.37:g.4294632G>C	ENSP00000301272:p.Ala165Gly	Somatic	394	0		WXS	Illumina HiSeq	Phase_1	661	151	NM_144615	0	0	0	0	0	Q6UW59	Missense_Mutation	SNP	ENST00000301272.2	37	CCDS12126.1	.	.	.	.	.	.	.	.	.	.	G	6.658	0.489899	0.12702	.	.	ENSG00000167664	ENST00000301272	T	0.46819	0.86	2.58	-4.34	0.03666	.	.	.	.	.	T	0.25531	0.0621	N	0.24115	0.695	0.09310	N	1	B;B	0.22909	0.077;0.046	B;B	0.13407	0.009;0.004	T	0.16424	-1.0403	9	0.38643	T	0.18	.	4.069	0.09874	0.558:0.2014:0.2406:0.0	.	165;165	Q96BF3-2;Q96BF3	.;TMIG2_HUMAN	G	165	ENSP00000301272:A165G	ENSP00000301272:A165G	A	-	2	0	TMIGD2	4245632	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.887000	0.04152	-0.521000	0.06426	0.543000	0.68304	GCG	.		0.637	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458088.1	NM_144615	
KDM4B	23030	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	5131903	5131903	+	Silent	SNP	G	G	C	rs544835411		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:5131903G>C	ENST00000159111.4	+	13	2009	c.1791G>C	c.(1789-1791)ccG>ccC	p.P597P	KDM4B_ENST00000536461.1_Silent_p.P631P	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	597					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						TTCAGGCACCGTCCACATTTT	0.652																																					p.P597P		.											.	KDM4B-226	0			c.G1791C						.						36.0	39.0	38.0					19																	5131903		2201	4299	6500	SO:0001819	synonymous_variant	23030	exon13			GGCACCGTCCACA	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.1791G>C	19.37:g.5131903G>C		Somatic	31	0		WXS	Illumina HiSeq	Phase_I	89	20	NM_015015	0	0	0	0	0	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Silent	SNP	ENST00000159111.4	37	CCDS12138.1																																																																																			.		0.652	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
MUC16	94025	bcgsc.ca	37	19	9021175	9021175	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:9021175G>C	ENST00000397910.4	-	19	37351	c.37148C>G	c.(37147-37149)gCt>gGt	p.A12383G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12385					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGAGGGCCAGCAGCCATAAC	0.443																																					p.A12383G													.	MUC16-566	0			c.C37148G						.						123.0	103.0	109.0					19																	9021175		1924	4126	6050	SO:0001583	missense	94025	exon19			GGGCCAGCAGCCA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37148C>G	19.37:g.9021175G>C	ENSP00000381008:p.Ala12383Gly	Somatic	132	0		WXS	Illumina HiSeq	Phase_1	74	23	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	3.215	-0.160863	0.06502	.	.	ENSG00000181143	ENST00000397910	T	0.33438	1.41	2.92	-3.21	0.05140	.	.	.	.	.	T	0.13756	0.0333	N	0.08118	0	.	.	.	B	0.24483	0.104	B	0.29353	0.101	T	0.28870	-1.0030	8	0.87932	D	0	.	3.6223	0.08100	0.2396:0.0:0.441:0.3194	.	12383	B5ME49	.	G	12383	ENSP00000381008:A12383G	ENSP00000381008:A12383G	A	-	2	0	MUC16	8882175	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.083000	0.14871	-0.657000	0.05373	-1.644000	0.00765	GCT	.		0.443	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF559	84527	bcgsc.ca	37	19	9449897	9449897	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:9449897T>G	ENST00000393883.2	+	4	710	c.62T>G	c.(61-63)gTg>gGg	p.V21G	ZNF177_ENST00000602856.1_Intron|ZNF559_ENST00000592896.1_Missense_Mutation_p.V49G|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000538743.1_Intron|ZNF559_ENST00000603380.1_Missense_Mutation_p.V21G|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000587557.1_Missense_Mutation_p.V85G|ZNF559_ENST00000586255.1_Missense_Mutation_p.V49G|ZNF559_ENST00000317221.7_Missense_Mutation_p.V21G|ZNF559_ENST00000592504.1_Missense_Mutation_p.V21G|ZNF559_ENST00000585352.1_Missense_Mutation_p.V21G|ZNF177_ENST00000446085.4_Intron	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	21	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						GATGTGGCTGTGGACTTCACC	0.473																																					p.V85G													.	ZNF559-91	0			c.T254G						.						224.0	189.0	201.0					19																	9449897		2203	4300	6503	SO:0001583	missense	84527	exon4			TGGCTGTGGACTT	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.62T>G	19.37:g.9449897T>G	ENSP00000377461:p.Val21Gly	Somatic	169	0		WXS	Illumina HiSeq	Phase_1	170	56	NM_001202408	0	0	8	10	2	K7EMG6	Missense_Mutation	SNP	ENST00000393883.2	37	CCDS12211.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.580504	0.46006	.	.	ENSG00000188321	ENST00000317221;ENST00000393883	T;T	0.04758	3.56;3.56	2.42	2.42	0.29668	Krueppel-associated box (4);	.	.	.	.	T	0.34919	0.0914	H	0.99357	4.53	0.26138	N	0.980326	D	0.89917	1.0	D	0.85130	0.997	T	0.32188	-0.9916	9	0.87932	D	0	.	8.7135	0.34397	0.0:0.0:0.0:1.0	.	21	Q9BR84	ZN559_HUMAN	G	21	ENSP00000325393:V21G;ENSP00000377461:V21G	ENSP00000325393:V21G	V	+	2	0	ZNF559	9310897	0.040000	0.19996	0.004000	0.12327	0.946000	0.59487	0.881000	0.28173	1.363000	0.46019	0.260000	0.18958	GTG	.		0.473	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
ZNF426	79088	bcgsc.ca	37	19	9644614	9644614	+	Missense_Mutation	SNP	A	A	C	rs77003677		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:9644614A>C	ENST00000535489.1	-	3	482	c.146T>G	c.(145-147)gTg>gGg	p.V49G	ZNF426_ENST00000593003.1_Missense_Mutation_p.V11G|ZNF426_ENST00000589289.1_Missense_Mutation_p.V49G|ZNF426_ENST00000253115.2_Missense_Mutation_p.V49G			Q9BUY5	ZN426_HUMAN	zinc finger protein 426	49	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20						GGTGAAGTCCACAGCCACATC	0.517																																					p.V49G													.	ZNF426-91	0			c.T146G						.																																			SO:0001583	missense	79088	exon5			AAGTCCACAGCCA	AK095759	CCDS12215.1, CCDS74279.1	19p13.2	2013-01-08				ENSG00000130818		"""Zinc fingers, C2H2-type"", ""-"""	20725	protein-coding gene	gene with protein product							Standard	NM_024106		Approved	MGC2663	uc002mlq.3	Q9BUY5		ENST00000535489.1:c.146T>G	19.37:g.9644614A>C	ENSP00000439017:p.Val49Gly	Somatic	120	0		WXS	Illumina HiSeq	Phase_1	80	28	NM_024106	0	0	6	6	0	B3KTL2	Missense_Mutation	SNP	ENST00000535489.1	37	CCDS12215.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.127870	0.56721	.	.	ENSG00000130818	ENST00000545189;ENST00000253115;ENST00000535489	T;T	0.04758	3.56;3.56	1.41	1.41	0.22369	Krueppel-associated box (4);	.	.	.	.	T	0.29223	0.0727	H	0.99011	4.4	0.47584	D	0.999469	P;P	0.52842	0.956;0.956	P;P	0.62885	0.908;0.908	T	0.17501	-1.0367	9	0.87932	D	0	.	6.8709	0.24121	1.0:0.0:0.0:0.0	.	36;49	Q59EH4;Q9BUY5	.;ZN426_HUMAN	G	36;49;49	ENSP00000253115:V49G;ENSP00000439017:V49G	ENSP00000253115:V49G	V	-	2	0	ZNF426	9505614	0.018000	0.18449	0.211000	0.23655	0.573000	0.36030	3.550000	0.53691	0.886000	0.36113	0.260000	0.18958	GTG	.		0.517	ZNF426-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449905.1	NM_024106	
CACNA1A	773	bcgsc.ca	37	19	13335580	13335580	+	Silent	SNP	G	G	A	rs200786078		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:13335580G>A	ENST00000360228.5	-	38	5631	c.5632C>T	c.(5632-5634)Ctg>Ttg	p.L1878L	CACNA1A_ENST00000573710.2_Silent_p.L1879L	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1879					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TCCATCCGCAGAAGCCGCTAC	0.617																																					p.L1879L													.	CACNA1A-67	0			c.C5635T						.						26.0	33.0	31.0					19																	13335580		1977	4155	6132	SO:0001819	synonymous_variant	773	exon38			TCCGCAGAAGCCG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5632C>T	19.37:g.13335580G>A		Somatic	19	0		WXS	Illumina HiSeq	Phase_1	28	15	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																			.		0.617	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CCDC130	81576	hgsc.bcm.edu	37	19	13875777	13875777	+	IGR	SNP	C	C	T	rs558173579	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:13875777C>T	ENST00000586600.1	+	0	1922				MRI1_ENST00000319545.8_Silent_p.L75L|MRI1_ENST00000040663.6_Silent_p.L75L			P13994	CC130_HUMAN	coiled-coil domain containing 130						response to virus (GO:0009615)					endometrium(2)|kidney(1)|large_intestine(3)|ovary(1)|skin(2)|urinary_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(19;6.02e-23)|Epithelial(5;2.58e-18)			TCGCCGCGCTCGTGGCCTTCG	0.756													C|||	13	0.00259585	0.0098	0.0	5008	,	,		6863	0.0		0.0	False		,,,				2504	0.0				p.L75L		.											.	MRI1-91	0			c.C225T						.						4.0	5.0	4.0					19																	13875777		1806	3486	5292	SO:0001628	intergenic_variant	84245	exon2			CGCGCTCGTGGCC	AF250306	CCDS12296.1	19p13.13	2008-02-05				ENSG00000104957			28118	protein-coding gene	gene with protein product						3203696	Standard	NM_030818		Approved	MGC10471	uc002mxc.1	P13994			19.37:g.13875777C>T		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	8	6	NM_001031727	0	0	13	34	21	Q9BQ72	Silent	SNP	ENST00000586600.1	37	CCDS12296.1																																																																																			.		0.756	CCDC130-001	KNOWN	alternative_5_UTR|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453216.2	NM_030818	
OR10H2	26538	broad.mit.edu	37	19	15839311	15839311	+	Missense_Mutation	SNP	C	C	T	rs139469467		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:15839311C>T	ENST00000305899.3	+	1	478	c.458C>T	c.(457-459)tCg>tTg	p.S153L		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					GCTGGTGGCTCGGTCATGGGG	0.592																																					p.S153L													.	OR10H2-70	0			c.C458T						.						91.0	75.0	81.0					19																	15839311		2203	4300	6503	SO:0001583	missense	26538	exon1			GTGGCTCGGTCAT	AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.458C>T	19.37:g.15839311C>T	ENSP00000306095:p.Ser153Leu	Somatic	56	1		WXS	Illumina HiSeq	Phase_I	199	6	NM_013939	0	0	0	0	0	Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	37	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	0.360	-0.939686	0.02322	.	.	ENSG00000171942	ENST00000305899	T	0.00019	9.06	3.4	-2.39	0.06602	GPCR, rhodopsin-like superfamily (1);	1.096810	0.07137	N	0.846687	T	0.00039	0.0001	N	0.02973	-0.45	0.09310	N	1	B	0.12630	0.006	B	0.19946	0.027	T	0.00510	-1.1697	10	0.10902	T	0.67	.	6.8361	0.23937	0.0:0.2906:0.0:0.7094	.	153	O60403	O10H2_HUMAN	L	153	ENSP00000306095:S153L	ENSP00000306095:S153L	S	+	2	0	OR10H2	15700311	0.000000	0.05858	0.002000	0.10522	0.174000	0.22865	-0.238000	0.08977	-0.296000	0.08947	0.537000	0.68136	TCG	C|1.000;T|0.000		0.592	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
USE1	55850	bcgsc.ca	37	19	17330035	17330035	+	Missense_Mutation	SNP	T	T	C	rs201210102	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:17330035T>C	ENST00000263897.5	+	7	483	c.436T>C	c.(436-438)Tcc>Ccc	p.S146P	USE1_ENST00000445667.2_Missense_Mutation_p.S146P|USE1_ENST00000596136.1_Intron|USE1_ENST00000379776.4_Intron	NM_018467.3	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog (S. cerevisiae)	146					endoplasmic reticulum tubular network organization (GO:0071786)|lysosomal transport (GO:0007041)|protein catabolic process (GO:0030163)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|secretion by cell (GO:0032940)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|lung(3)	6						AGTGGCAGGGTCCCAGCCAGT	0.517																																					p.S146P													.	.	0			c.T436C						.						34.0	40.0	38.0					19																	17330035		2011	4194	6205	SO:0001583	missense	55850	exon7			GCAGGGTCCCAGC	AF220052	CCDS46011.1	19p13.11	2007-08-20				ENSG00000053501			30882	protein-coding gene	gene with protein product	"""Q-SNARE"", ""SNARE-like tail-anchored protein 1 homolog (S. cerevisiae)"""	610675				16354670, 15029241	Standard	NM_018467		Approved	p31, SLT1, MDS032	uc002nfo.2	Q9NZ43		ENST00000263897.5:c.436T>C	19.37:g.17330035T>C	ENSP00000263897:p.Ser146Pro	Somatic	38	0		WXS	Illumina HiSeq	Phase_1	107	41	NM_018467	0	0	1	1	0	Q8NCK1|Q9BRT4	Missense_Mutation	SNP	ENST00000263897.5	37	CCDS46011.1	.	.	.	.	.	.	.	.	.	.	T	1.143	-0.648945	0.03506	.	.	ENSG00000053501	ENST00000263897;ENST00000445667	T;T	0.43294	0.95;0.95	4.43	-2.55	0.06288	.	0.812302	0.11216	N	0.587183	T	0.15132	0.0365	N	0.02802	-0.49	0.49130	D	0.999757	B	0.02656	0.0	B	0.01281	0.0	T	0.13415	-1.0510	10	0.22706	T	0.39	-10.2664	6.5631	0.22497	0.0:0.4171:0.2073:0.3757	.	146	Q9NZ43	USE1_HUMAN	P	146	ENSP00000263897:S146P;ENSP00000390287:S146P	ENSP00000263897:S146P	S	+	1	0	USE1	17191035	0.870000	0.30015	0.005000	0.12908	0.026000	0.11368	0.046000	0.14035	-0.162000	0.10964	-0.415000	0.06103	TCC	T|0.966;G|0.034		0.517	USE1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463295.1	NM_018467	
INSL3	3640	bcgsc.ca	37	19	17927847	17927847	+	Missense_Mutation	SNP	T	T	C	rs199499462		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:17927847T>C	ENST00000317306.7	-	2	228	c.212A>G	c.(211-213)gAg>gGg	p.E71G	INSL3_ENST00000379695.5_Missense_Mutation_p.R103G	NM_005543.3	NP_005534.2	P51460	INSL3_HUMAN	insulin-like 3 (Leydig cell)	71					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|perinuclear region of cytoplasm (GO:0048471)	insulin receptor binding (GO:0005158)|protease binding (GO:0002020)|receptor binding (GO:0005102)			breast(1)|lung(1)	2						ATGTCGTCTCTCCAGCCACTG	0.597																																					p.R103G													.	INSL3-90	0			c.A307G						.						64.0	50.0	55.0					19																	17927847		2203	4300	6503	SO:0001583	missense	3640	exon3			CGTCTCTCCAGCC		CCDS12365.1, CCDS58655.1	19p13.2-p12	2013-02-26	2003-05-13			ENSG00000248099		"""Endogenous ligands"""	6086	protein-coding gene	gene with protein product	"""prepro-INSL3"""	146738	"""relaxin-like factor"""	RLNL		8020942	Standard	NM_001265587		Approved	RLF, MGC119818, MGC119819	uc010ebf.2	P51460		ENST00000317306.7:c.212A>G	19.37:g.17927847T>C	ENSP00000321724:p.Glu71Gly	Somatic	30	0		WXS	Illumina HiSeq	Phase_1	74	45	NM_001265587	0	0	0	0	0	B4DZ72|G3XAG0|Q3KPI5|Q3KPI6|Q6YNB5|Q9UEA2|Q9UPH6	Missense_Mutation	SNP	ENST00000317306.7	37	CCDS12365.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.30|12.30	1.897302|1.897302	0.33535|0.33535	.|.	.|.	ENSG00000248099|ENSG00000248099	ENST00000317306|ENST00000379695	D|T	0.89123|0.50277	-2.47|0.75	3.66|3.66	2.64|2.64	0.31445|0.31445	Insulin-like (3);|.	.|.	.|.	.|.	.|.	T|T	0.39145|0.39145	0.1067|0.1067	M|M	0.63428|0.63428	1.95|1.95	0.20307|0.20307	N|N	0.999912|0.999912	B|B	0.28291|0.28713	0.206|0.22	B|B	0.26202|0.20184	0.067|0.028	T|T	0.26052|0.26052	-1.0114|-1.0114	9|8	0.49607|.	T|.	0.09|.	.|.	5.4381|5.4381	0.16492|0.16492	0.0:0.1309:0.0:0.8691|0.0:0.1309:0.0:0.8691	.|.	71|103	P51460|G3XAG0	INSL3_HUMAN|.	G|G	71|103	ENSP00000321724:E71G|ENSP00000369017:R103G	ENSP00000321724:E71G|.	E|R	-|-	2|1	0|2	INSL3|INSL3	17788847|17788847	0.342000|0.342000	0.24809|0.24809	0.717000|0.717000	0.30585|0.30585	0.133000|0.133000	0.20885|0.20885	1.084000|1.084000	0.30828|0.30828	0.516000|0.516000	0.28340|0.28340	0.369000|0.369000	0.22263|0.22263	GAG|AGA	.		0.597	INSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466836.1	NM_005543	
LRRC25	126364	broad.mit.edu	37	19	18507298	18507298	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:18507298G>T	ENST00000339007.3	-	1	1129	c.476C>A	c.(475-477)cCt>cAt	p.P159H	LRRC25_ENST00000595840.1_Missense_Mutation_p.P159H	NM_145256.2	NP_660299.2	Q8N386	LRC25_HUMAN	leucine rich repeat containing 25	159						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|skin(1)	8						GGCCAGGCCAGGGGCGCAGCT	0.642																																					p.P159H													.	LRRC25-90	0			c.C476A						.						29.0	28.0	28.0					19																	18507298		2202	4299	6501	SO:0001583	missense	126364	exon1			AGGCCAGGGGCGC	AK095435	CCDS12377.1	19p13.11	2013-09-20			ENSG00000175489	ENSG00000175489			29806	protein-coding gene	gene with protein product		607518				12384430	Standard	NM_145256		Approved	MAPA, FLJ38116	uc002niw.3	Q8N386	OTTHUMG00000183361	ENST00000339007.3:c.476C>A	19.37:g.18507298G>T	ENSP00000340983:p.Pro159His	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	142	7	NM_145256	0	0	2	2	0	Q6IQ00|Q8N9A5	Missense_Mutation	SNP	ENST00000339007.3	37	CCDS12377.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670912	0.47781	.	.	ENSG00000175489	ENST00000339007	T	0.34275	1.37	3.76	1.43	0.22495	.	0.764210	0.11156	N	0.593588	T	0.38904	0.1058	L	0.55481	1.735	0.09310	N	1	D	0.64830	0.994	P	0.51415	0.669	T	0.18366	-1.0339	10	0.46703	T	0.11	-0.5814	4.9166	0.13849	0.118:0.0:0.6746:0.2074	.	159	Q8N386	LRC25_HUMAN	H	159	ENSP00000340983:P159H	ENSP00000340983:P159H	P	-	2	0	LRRC25	18368298	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.010000	0.12743	0.303000	0.22785	0.491000	0.48974	CCT	.		0.642	LRRC25-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466342.1	NM_145256	
UBA2	10054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	34921484	34921484	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:34921484G>C	ENST00000246548.4	+	2	212	c.142G>C	c.(142-144)Gat>Cat	p.D48H	UBA2_ENST00000439527.2_5'UTR|CTD-2588C8.8_ENST00000592220.1_RNA	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	48					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TTTGTAGATTGATCTGGATAC	0.358																																					p.D48H		.											.	UBA2-227	0			c.G142C						.						185.0	170.0	175.0					19																	34921484		2203	4300	6503	SO:0001583	missense	10054	exon2			TAGATTGATCTGG	BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.142G>C	19.37:g.34921484G>C	ENSP00000246548:p.Asp48His	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	152	52	NM_005499	0	0	0	0	0	B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Missense_Mutation	SNP	ENST00000246548.4	37	CCDS12439.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624070	0.87560	.	.	ENSG00000126261	ENST00000246548	D	0.84442	-1.85	5.22	5.22	0.72569	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.100210	0.64402	D	0.000001	D	0.96565	0.8879	H	0.99937	4.99	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.98698	1.0699	10	0.87932	D	0	-19.2256	17.8923	0.88876	0.0:0.0:1.0:0.0	.	48	Q9UBT2	SAE2_HUMAN	H	48	ENSP00000246548:D48H	ENSP00000246548:D48H	D	+	1	0	UBA2	39613324	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.953000	0.93041	2.603000	0.88011	0.563000	0.77884	GAT	.		0.358	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459257.3	NM_005499	
KIRREL2	84063	bcgsc.ca	37	19	36353426	36353426	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:36353426A>G	ENST00000360202.5	+	12	1740	c.1542A>G	c.(1540-1542)ggA>ggG	p.G514G	KIRREL2_ENST00000347900.6_Silent_p.G464G|NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000592409.1_Intron|KIRREL2_ENST00000262625.7_Silent_p.G514G	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	514					cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TAGTGGCCGGAGTGGCCGCTG	0.652																																					p.G514G													.	KIRREL2-93	0			c.A1542G						.						101.0	103.0	102.0					19																	36353426		2203	4300	6503	SO:0001819	synonymous_variant	84063	exon12			GGCCGGAGTGGCC	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1542A>G	19.37:g.36353426A>G		Somatic	210	1		WXS	Illumina HiSeq	Phase_1	344	129	NM_199180	0	0	0	0	0	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Silent	SNP	ENST00000360202.5	37	CCDS12481.1																																																																																			.		0.652	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	39039030	39039030	+	Silent	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:39039030T>C	ENST00000359596.3	+	89	12252	c.12252T>C	c.(12250-12252)cgT>cgC	p.R4084R	RYR1_ENST00000360985.3_Silent_p.R4079R|RYR1_ENST00000355481.4_Silent_p.R4079R			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4084					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CGGATCCCCGTGGCCTCATCT	0.557																																					p.R4084R		.											.	RYR1-100	0			c.T12252C						.						132.0	113.0	119.0					19																	39039030		2203	4300	6503	SO:0001819	synonymous_variant	6261	exon89			TCCCCGTGGCCTC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.12252T>C	19.37:g.39039030T>C		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	299	101	NM_000540	0	0	1	1	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																			.		0.557	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
FCGBP	8857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40366038	40366038	+	Silent	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:40366038C>G	ENST00000221347.6	-	30	14203	c.14196G>C	c.(14194-14196)ccG>ccC	p.P4732P		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4732						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GACAGAAGTCCGGCCGCCTCC	0.647																																					p.P4732P		.											.	FCGBP-98	0			c.G14196C						.																																			SO:0001819	synonymous_variant	8857	exon30			GAAGTCCGGCCGC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14196G>C	19.37:g.40366038C>G		Somatic	164	0		WXS	Illumina HiSeq	Phase_I	205	59	NM_003890	0	0	0	0	0	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																			.		0.647	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ZNF227	7770	bcgsc.ca	37	19	44732627	44732627	+	Missense_Mutation	SNP	T	T	G	rs77864769		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:44732627T>G	ENST00000313040.7	+	4	294	c.89T>G	c.(88-90)gTg>gGg	p.V30G	ZNF227_ENST00000589707.1_5'UTR|ZNF227_ENST00000391961.2_5'UTR|ZNF227_ENST00000589005.1_5'UTR|ZNF227_ENST00000586228.1_Intron|ZNF227_ENST00000589237.1_3'UTR	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	30	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				GATGTGGCTGTGGTCTTCTCC	0.488																																					p.V30G													.	ZNF227-91	0			c.T89G						.						229.0	199.0	209.0					19																	44732627		2203	4300	6503	SO:0001583	missense	7770	exon4			TGGCTGTGGTCTT	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.89T>G	19.37:g.44732627T>G	ENSP00000321049:p.Val30Gly	Somatic	130	1		WXS	Illumina HiSeq	Phase_1	103	40	NM_182490	0	0	3	4	1	B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	37	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	T	14.78	2.636184	0.47049	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000418980	T	0.04758	3.56	3.84	3.84	0.44239	Krueppel-associated box (4);	.	.	.	.	T	0.35970	0.0950	H	0.99312	4.51	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.56823	-0.7915	9	0.87932	D	0	.	10.8844	0.46957	0.0:0.0:0.0:1.0	.	16;10;30	Q658S5;Q9NS43;Q86WZ6	.;.;ZN227_HUMAN	G	30;15;16	ENSP00000321049:V30G	ENSP00000321049:V30G	V	+	2	0	ZNF227	49424467	1.000000	0.71417	0.979000	0.43373	0.361000	0.29550	4.585000	0.60977	1.743000	0.51761	0.397000	0.26171	GTG	.		0.488	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
CLASRP	11129	ucsc.edu	37	19	45572384	45572384	+	Splice_Site	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:45572384T>G	ENST00000221455.3	+	17	1925		c.e17+2		CLASRP_ENST00000391953.4_Splice_Site|CLASRP_ENST00000544944.2_Splice_Site	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						GAGCGGCAGGTGAAGTGGGAA	0.597																																					.													.	CLASRP-154	0			c.1827+2T>G						.						107.0	119.0	115.0					19																	45572384		2203	4300	6503	SO:0001630	splice_region_variant	11129	exon17			GGCAGGTGAAGTG	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1827+2T>G	19.37:g.45572384T>G		Somatic	104	11		WXS	Illumina HiSeq		302	88	NM_007056	0	0	0	0	0	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Splice_Site	SNP	ENST00000221455.3	37	CCDS12652.2	.	.	.	.	.	.	.	.	.	.	T	14.73	2.623388	0.46840	.	.	ENSG00000104859	ENST00000221455;ENST00000391953;ENST00000544944	.	.	.	4.84	3.82	0.43975	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.2182	0.25971	0.0:0.0998:0.0:0.9002	.	.	.	.	.	-1	.	.	.	+	.	.	CLASRP	50264224	1.000000	0.71417	0.781000	0.31783	0.488000	0.33401	3.750000	0.55157	0.996000	0.38943	0.454000	0.30748	.	.		0.597	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	Intron
NUCB1	4924	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49422348	49422348	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:49422348G>A	ENST00000405315.4	+	9	1212	c.878G>A	c.(877-879)cGa>cAa	p.R293Q	NUCB1_ENST00000263273.5_Missense_Mutation_p.R293Q|NUCB1_ENST00000407032.1_Missense_Mutation_p.R293Q|NUCB1_ENST00000485798.1_Intron|NUCB1-AS1_ENST00000416432.1_RNA	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	293	Binds to GNAI2 and GNAI3. {ECO:0000250}.|EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		GAGGAGGAGCGACTGCGCATG	0.612																																					p.R293Q		.											.	NUCB1-90	0			c.G878A						.						56.0	58.0	58.0					19																	49422348		2203	4300	6503	SO:0001583	missense	4924	exon9			AGGAGCGACTGCG	BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.878G>A	19.37:g.49422348G>A	ENSP00000385923:p.Arg293Gln	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	126	43	NM_006184	0	0	147	342	195	B2RD64|Q15838|Q7Z4J7|Q9BUR1	Missense_Mutation	SNP	ENST00000405315.4	37	CCDS12740.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.875643|5.875643	0.97055|0.97055	.|.	.|.	ENSG00000104805|ENSG00000104805	ENST00000424608|ENST00000405315;ENST00000407032;ENST00000263273	.|T;T;T	.|0.71698	.|-0.59;-0.59;-0.59	5.01|5.01	5.01|5.01	0.66863|0.66863	.|EF-hand-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81437|0.81437	0.4822|0.4822	M|M	0.64630|0.64630	1.985|1.985	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.72982	.|0.979;0.979	T|T	0.80596|0.80596	-0.1312|-0.1312	5|10	.|0.40728	.|T	.|0.16	.|.	16.1855|16.1855	0.81948|0.81948	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|293;293	.|Q02818;Q53GX6	.|NUCB1_HUMAN;.	N|Q	263|293	.|ENSP00000385923:R293Q;ENSP00000385211:R293Q;ENSP00000263273:R293Q	.|ENSP00000263273:R293Q	D|R	+|+	1|2	0|0	NUCB1|NUCB1	54114160|54114160	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.177000|9.177000	0.94849|0.94849	2.514000|2.514000	0.84764|0.84764	0.591000|0.591000	0.81541|0.81541	GAC|CGA	.		0.612	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326545.2	NM_006184	
VRK3	51231	bcgsc.ca	37	19	50493004	50493004	+	Missense_Mutation	SNP	C	C	G	rs200282632		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:50493004C>G	ENST00000599538.1	-	11	1652	c.988G>C	c.(988-990)Gcc>Ccc	p.A330P	VRK3_ENST00000601912.1_Missense_Mutation_p.A280P|VRK3_ENST00000593919.1_Missense_Mutation_p.A330P|VRK3_ENST00000316763.3_Missense_Mutation_p.A330P|VRK3_ENST00000594948.1_Missense_Mutation_p.A330P|VRK3_ENST00000424804.2_5'UTR|VRK3_ENST00000594092.1_Missense_Mutation_p.A330P|VRK3_ENST00000601341.1_Missense_Mutation_p.A280P|VRK3_ENST00000377011.2_Missense_Mutation_p.A280P|VRK3_ENST00000443401.2_Missense_Mutation_p.A99P			Q8IV63	VRK3_HUMAN	vaccinia related kinase 3	330	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)|stomach(2)|urinary_tract(1)	23		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		TAGCGGAAGGCGAAGCCATAG	0.547																																					p.A330P	Pancreas(6;90 181 4352 12603 17050 34726 35237 44094)												.	VRK3-359	0			c.G988C						.						63.0	51.0	55.0					19																	50493004		2203	4300	6503	SO:0001583	missense	51231	exon11			GGAAGGCGAAGCC	AB031052	CCDS12791.1, CCDS33076.1	19q13.33	2011-01-14			ENSG00000105053	ENSG00000105053			18996	protein-coding gene	gene with protein product							Standard	XM_005258971		Approved		uc002prh.1	Q8IV63		ENST00000599538.1:c.988G>C	19.37:g.50493004C>G	ENSP00000469880:p.Ala330Pro	Somatic	48	0		WXS	Illumina HiSeq	Phase_1	54	26	NM_016440	0	0	36	40	4	A6NEG5|A8KA53|Q502Y2|Q9P2V8	Missense_Mutation	SNP	ENST00000599538.1	37	CCDS12791.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171142	0.78452	.	.	ENSG00000105053	ENST00000316763;ENST00000377011;ENST00000443401	T;T;T	0.76186	-1.0;-1.0;-1.0	4.57	-7.34	0.01427	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.347807	0.32343	N	0.006231	D	0.83774	0.5327	M	0.91140	3.18	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	D	0.84263	0.0484	10	0.72032	D	0.01	-3.1814	9.4534	0.38741	0.2248:0.6043:0.0:0.1709	.	99;330;280;330	B4DGW1;Q8IV63-2;A6NEG5;Q8IV63	.;.;.;VRK3_HUMAN	P	330;280;99	ENSP00000324636:A330P;ENSP00000366210:A280P;ENSP00000414907:A99P	ENSP00000324636:A330P	A	-	1	0	VRK3	55184816	0.902000	0.30710	0.705000	0.30386	0.953000	0.61014	0.076000	0.14712	-1.586000	0.01632	-0.345000	0.07892	GCC	.		0.547	VRK3-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464815.1	NM_016440	
ZNF649	65251	bcgsc.ca	37	19	52400203	52400203	+	Missense_Mutation	SNP	A	A	C	rs149586071		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:52400203A>C	ENST00000354957.3	-	3	328	c.44T>G	c.(43-45)gTg>gGg	p.V15G	ZNF649_ENST00000600738.1_Missense_Mutation_p.V15G|CTC-429C10.2_ENST00000600329.1_RNA	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	15	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GGTGAAGTCCACAGCCACATC	0.488																																					p.V15G													.	ZNF649-92	0			c.T44G						.						173.0	167.0	169.0					19																	52400203		2203	4300	6503	SO:0001583	missense	65251	exon3			AAGTCCACAGCCA	BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.44T>G	19.37:g.52400203A>C	ENSP00000347043:p.Val15Gly	Somatic	216	0		WXS	Illumina HiSeq	Phase_1	130	48	NM_023074	0	0	12	16	4	A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	ENST00000354957.3	37	CCDS12843.1	.	.	.	.	.	.	.	.	.	.	A	13.33	2.203643	0.38905	.	.	ENSG00000198093	ENST00000354957	T	0.04758	3.56	2.51	1.39	0.22231	Krueppel-associated box (4);	.	.	.	.	T	0.31544	0.0800	H	0.99312	4.51	0.38484	D	0.947792	D	0.76494	0.999	D	0.87578	0.998	T	0.10753	-1.0616	9	0.87932	D	0	.	5.2869	0.15706	0.6995:0.3005:0.0:0.0	.	15	Q9BS31	ZN649_HUMAN	G	15	ENSP00000347043:V15G	ENSP00000347043:V15G	V	-	2	0	ZNF649	57092015	0.017000	0.18338	0.752000	0.31206	0.747000	0.42532	1.960000	0.40422	0.172000	0.19760	0.443000	0.29094	GTG	.		0.488	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074	
ZNF614	80110	bcgsc.ca	37	19	52521719	52521719	+	Missense_Mutation	SNP	A	A	C	rs76388547		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:52521719A>C	ENST00000270649.6	-	3	588	c.44T>G	c.(43-45)gTg>gGg	p.V15G	ZNF614_ENST00000356322.6_Missense_Mutation_p.V15G	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	15	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GCTGAATTCCACAGCCACATC	0.418																																					p.V15G													.	ZNF614-95	0			c.T44G						.						87.0	84.0	85.0					19																	52521719		2203	4300	6503	SO:0001583	missense	80110	exon3			AATTCCACAGCCA	BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.44T>G	19.37:g.52521719A>C	ENSP00000270649:p.Val15Gly	Somatic	111	0		WXS	Illumina HiSeq	Phase_1	80	29	NM_025040	0	0	7	8	1	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	.	.	.	.	.	.	.	.	.	.	A	17.79	3.477112	0.63849	.	.	ENSG00000142556	ENST00000356322;ENST00000270649	T;T	0.04758	3.56;3.56	3.22	3.22	0.36961	Krueppel-associated box (4);	.	.	.	.	T	0.34890	0.0913	H	0.99117	4.435	0.44492	D	0.997432	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.53085	-0.8488	9	0.87932	D	0	.	9.7872	0.40684	1.0:0.0:0.0:0.0	.	15;15	Q8N883;Q9BSN8	ZN614_HUMAN;.	G	15	ENSP00000348674:V15G;ENSP00000270649:V15G	ENSP00000270649:V15G	V	-	2	0	ZNF614	57213531	0.984000	0.35163	0.963000	0.40424	0.975000	0.68041	4.979000	0.63806	1.464000	0.47987	0.477000	0.44152	GTG	.		0.418	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040	
ZNF665	79788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53668284	53668284	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:53668284T>A	ENST00000600412.1	-	2	1379	c.1264A>T	c.(1264-1266)Aag>Tag	p.K422*	ZNF665_ENST00000396424.3_Nonsense_Mutation_p.K487*|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TCATCACACTTGTAAGGTTTC	0.413																																					p.K487X		.											.	ZNF665-70	0			c.A1459T						.						91.0	95.0	93.0					19																	53668284		2203	4300	6503	SO:0001587	stop_gained	79788	exon4			CACACTTGTAAGG		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1264A>T	19.37:g.53668284T>A	ENSP00000469154:p.Lys422*	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	217	68	NM_024733	0	0	1	1	0	A8K5T8	Nonsense_Mutation	SNP	ENST00000600412.1	37		.	.	.	.	.	.	.	.	.	.	T	17.85	3.490740	0.64074	.	.	ENSG00000197497	ENST00000396424	.	.	.	2.18	1.14	0.20703	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.3597	0.21420	0.0:0.1475:0.0:0.8525	.	.	.	.	X	487	.	ENSP00000379702:K487X	K	-	1	0	ZNF665	58360096	0.000000	0.05858	0.027000	0.17364	0.049000	0.14656	-2.447000	0.01010	1.001000	0.39076	0.358000	0.22013	AAG	.		0.413	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
LILRB2	10288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54783677	54783677	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:54783677C>T	ENST00000391749.4	-	4	595	c.324G>A	c.(322-324)gaG>gaA	p.E108E	LILRB2_ENST00000314446.5_Silent_p.E108E|LILRB2_ENST00000391746.1_Silent_p.E108E|LILRB2_ENST00000471216.1_5'Flank|MIR4752_ENST00000579672.1_RNA|LILRB2_ENST00000434421.1_5'UTR|LILRB2_ENST00000391748.1_Silent_p.E108E	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	108	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGTCACTGAGCTCAGACCACC	0.602																																					p.E108E		.											.	LILRB2-91	0			c.G324A						.						105.0	105.0	105.0					19																	54783677		2203	4300	6503	SO:0001819	synonymous_variant	10288	exon4			ACTGAGCTCAGAC	AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.324G>A	19.37:g.54783677C>T		Somatic	101	0		WXS	Illumina HiSeq	Phase_I	359	108	NM_005874	0	0	4	4	0	A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Silent	SNP	ENST00000391749.4	37	CCDS12886.1																																																																																			.		0.602	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1		
NLRP8	126205	bcgsc.ca	37	19	56490765	56490765	+	Missense_Mutation	SNP	A	A	G	rs77160817		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:56490765A>G	ENST00000291971.3	+	9	2953	c.2882A>G	c.(2881-2883)gAa>gGa	p.E961G	NLRP8_ENST00000590542.1_Missense_Mutation_p.E942G	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	961					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CACAGGCTGGAAAACTGCCTG	0.512																																					p.E961G													.	NLRP8-361	0			c.A2882G						.						106.0	101.0	103.0					19																	56490765		2203	4300	6503	SO:0001583	missense	126205	exon9			GGCTGGAAAACTG	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2882A>G	19.37:g.56490765A>G	ENSP00000291971:p.Glu961Gly	Somatic	129	0		WXS	Illumina HiSeq	Phase_1	70	25	NM_176811	0	0	0	0	0	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	A	6.389	0.439869	0.12104	.	.	ENSG00000179709	ENST00000291971	T	0.52983	0.64	2.27	-1.68	0.08212	.	.	.	.	.	T	0.38321	0.1036	L	0.44542	1.39	0.09310	N	1	P;B	0.44690	0.841;0.37	P;B	0.49708	0.62;0.41	T	0.22173	-1.0224	9	0.22109	T	0.4	.	0.2333	0.00183	0.3798:0.2347:0.1554:0.2301	.	942;961	Q86W28-2;Q86W28	.;NALP8_HUMAN	G	961	ENSP00000291971:E961G	ENSP00000291971:E961G	E	+	2	0	NLRP8	61182577	0.102000	0.21896	0.002000	0.10522	0.002000	0.02628	0.040000	0.13905	-0.500000	0.06614	-0.633000	0.03987	GAA	.		0.512	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
ZNF71	58491	hgsc.bcm.edu	37	19	57133670	57133670	+	Missense_Mutation	SNP	T	T	G	rs575219516		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:57133670T>G	ENST00000328070.6	+	3	1249	c.1015T>G	c.(1015-1017)Tcc>Gcc	p.S339A		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S339A(1)		endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		CAGCCAGAGCTCCTACCTCAT	0.632													.|||	1	0.000199681	0.0	0.0014	5008	,	,		21342	0.0		0.0	False		,,,				2504	0.0				p.S339A		.											.	ZNF71-91	1	Substitution - Missense(1)	endometrium(1)	c.T1015G						.						87.0	80.0	82.0					19																	57133670		2203	4300	6503	SO:0001583	missense	58491	exon3			CAGAGCTCCTACC	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.1015T>G	19.37:g.57133670T>G	ENSP00000328245:p.Ser339Ala	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	180	9	NM_021216	0	0	4	4	0	Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	ENST00000328070.6	37	CCDS12947.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.726062	0.30593	.	.	ENSG00000197951	ENST00000328070	T	0.35421	1.31	3.76	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34135	0.0887	M	0.69358	2.11	0.09310	N	1	B	0.21452	0.056	B	0.15052	0.012	T	0.27157	-1.0082	9	0.44086	T	0.13	.	8.5519	0.33458	0.0:0.0:0.3775:0.6225	.	339	Q9NQZ8	ZNF71_HUMAN	A	339	ENSP00000328245:S339A	ENSP00000328245:S339A	S	+	1	0	ZNF71	61825482	0.000000	0.05858	0.996000	0.52242	0.982000	0.71751	-3.336000	0.00507	0.480000	0.27534	0.459000	0.35465	TCC	.		0.632	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
HS1BP3	64342	bcgsc.ca	37	2	20818846	20818846	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:20818846C>T	ENST00000304031.3	-	7	1105	c.1080G>A	c.(1078-1080)caG>caA	p.Q360Q		NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	360							phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGCGGCTTCTGCTGCCCAG	0.612																																					p.Q360Q													.	HS1BP3-91	0			c.G1080A						.						91.0	99.0	96.0					2																	20818846		2203	4300	6503	SO:0001819	synonymous_variant	64342	exon7			CGGCTTCTGCTGC		CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.1080G>A	2.37:g.20818846C>T		Somatic	201	0		WXS	Illumina HiSeq	Phase_1	276	130	NM_022460	0	0	35	37	2	B2RAW2|D6W529|Q86VC2|Q8N367	Silent	SNP	ENST00000304031.3	37	CCDS1700.1																																																																																			.		0.612	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242863.1	NM_022460	
HS1BP3	64342	bcgsc.ca	37	2	20818851	20818851	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:20818851G>C	ENST00000304031.3	-	7	1100	c.1075C>G	c.(1075-1077)Cag>Gag	p.Q359E		NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	359							phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCTTCTGCTGCCCAGCCACA	0.622																																					p.Q359E													.	HS1BP3-91	0			c.C1075G						.						86.0	95.0	92.0					2																	20818851		2203	4300	6503	SO:0001583	missense	64342	exon7			TCTGCTGCCCAGC		CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.1075C>G	2.37:g.20818851G>C	ENSP00000305193:p.Gln359Glu	Somatic	206	0		WXS	Illumina HiSeq	Phase_1	304	159	NM_022460	0	0	43	45	2	B2RAW2|D6W529|Q86VC2|Q8N367	Missense_Mutation	SNP	ENST00000304031.3	37	CCDS1700.1	.	.	.	.	.	.	.	.	.	.	G	10.26	1.302154	0.23736	.	.	ENSG00000118960	ENST00000304031	T	0.17691	2.26	5.42	5.42	0.78866	.	1.045250	0.07668	N	0.935044	T	0.20047	0.0482	L	0.46157	1.445	0.80722	D	1	B	0.22276	0.067	B	0.17433	0.018	T	0.04930	-1.0917	10	0.26408	T	0.33	-5.6295	14.7112	0.69232	0.0:0.0:1.0:0.0	.	359	Q53T59	H1BP3_HUMAN	E	359	ENSP00000305193:Q359E	ENSP00000305193:Q359E	Q	-	1	0	HS1BP3	20682332	0.066000	0.20996	0.007000	0.13788	0.718000	0.41266	3.003000	0.49505	2.556000	0.86216	0.655000	0.94253	CAG	.		0.622	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242863.1	NM_022460	
TMEM214	54867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27259433	27259433	+	Missense_Mutation	SNP	T	T	G	rs564964647		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:27259433T>G	ENST00000238788.9	+	6	861	c.799T>G	c.(799-801)Ttt>Gtt	p.F267V	TMEM214_ENST00000404032.3_Missense_Mutation_p.F222V	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	267					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						TCAAGCAGGTTTTGCCAACCT	0.567																																					p.F267V		.											.	TMEM214-115	0			c.T799G						.						103.0	103.0	103.0					2																	27259433		1943	4141	6084	SO:0001583	missense	54867	exon6			GCAGGTTTTGCCA		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.799T>G	2.37:g.27259433T>G	ENSP00000238788:p.Phe267Val	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	611	177	NM_017727	0	0	102	142	40	A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Missense_Mutation	SNP	ENST00000238788.9	37	CCDS42664.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.873746	0.91664	.	.	ENSG00000119777	ENST00000238788;ENST00000404032;ENST00000537397	T;T	0.52295	0.67;0.67	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	M	0.74258	2.255	0.80722	D	1	D;P	0.56746	0.977;0.917	P;P	0.57679	0.794;0.825	T	0.65417	-0.6173	10	0.42905	T	0.14	-14.1771	15.3509	0.74384	0.0:0.0:0.0:1.0	.	222;267	Q6NUQ4-2;Q6NUQ4	.;TM214_HUMAN	V	267;222;9	ENSP00000238788:F267V;ENSP00000384417:F222V	ENSP00000238788:F267V	F	+	1	0	TMEM214	27112937	1.000000	0.71417	0.436000	0.26797	0.968000	0.65278	7.508000	0.81686	2.128000	0.65567	0.459000	0.35465	TTT	.		0.567	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727	
CGREF1	10669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27327221	27327221	+	Missense_Mutation	SNP	G	G	T	rs112618911		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:27327221G>T	ENST00000260595.5	-	2	306	c.14C>A	c.(13-15)aCg>aAg	p.T5K	CGREF1_ENST00000452318.2_Intron|CGREF1_ENST00000402394.1_Missense_Mutation_p.T5K|CGREF1_ENST00000312734.4_Missense_Mutation_p.T5K|CGREF1_ENST00000405600.1_Missense_Mutation_p.T5K|CGREF1_ENST00000402550.1_Missense_Mutation_p.T5K|CGREF1_ENST00000404694.3_Missense_Mutation_p.T127K			Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1	5					cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			kidney(1)|lung(4)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACTGTCATCGTCAAAGGTAA	0.567																																					p.T5K		.											.	CGREF1-91	0			c.C14A						.						67.0	59.0	62.0					2																	27327221		2203	4300	6503	SO:0001583	missense	10669	exon2			GTCATCGTCAAAG	BC034764	CCDS33162.1, CCDS33162.2, CCDS54339.1	2p23.3	2013-01-10			ENSG00000138028	ENSG00000138028		"""EF-hand domain containing"""	16962	protein-coding gene	gene with protein product		606137				8968090	Standard	NM_006569		Approved	CGR11	uc002riq.3	Q99674	OTTHUMG00000152009	ENST00000260595.5:c.14C>A	2.37:g.27327221G>T	ENSP00000260595:p.Thr5Lys	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	149	38	NM_001166239	0	0	5	5	0	A6NHV7|B4DXY8|B5MCB7|B5MCC9|B5MCP5|E7EU99|Q8N4B7	Missense_Mutation	SNP	ENST00000260595.5	37		.	.	.	.	.	.	.	.	.	.	A	13.14	2.147472	0.37923	.	.	ENSG00000138028	ENST00000402550;ENST00000402394;ENST00000405600;ENST00000389521;ENST00000312734;ENST00000404694;ENST00000260595	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	4.73	-7.65	0.01281	.	1.833840	0.02770	N	0.119586	T	0.16300	0.0392	N	0.12182	0.205	0.09310	N	1	B;B;B	0.10296	0.002;0.002;0.003	B;B;B	0.06405	0.002;0.002;0.002	T	0.20638	-1.0269	10	0.44086	T	0.13	-10.5345	8.4971	0.33134	0.1308:0.0:0.5748:0.2945	.	127;5;5	B5MCC9;B5MCP5;Q99674	.;.;CGRE1_HUMAN	K	5;5;5;5;5;127;5	ENSP00000385452:T5K;ENSP00000386113:T5K;ENSP00000324025:T5K;ENSP00000385574:T127K;ENSP00000260595:T5K	ENSP00000260595:T5K	T	-	2	0	CGREF1	27180725	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.719000	0.04974	-2.518000	0.00499	-1.007000	0.02485	ACG	G|0.998;A|0.002		0.567	CGREF1-201	KNOWN	basic	protein_coding	protein_coding		NM_006569	
ZNF512	84450	bcgsc.ca	37	2	27840357	27840357	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:27840357A>G	ENST00000355467.4	+	13	1397	c.1314A>G	c.(1312-1314)ggA>ggG	p.G438G	ZNF512_ENST00000413371.2_Silent_p.G361G|ZNF512_ENST00000416005.2_Silent_p.G409G|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000556601.1_Silent_p.G307G|ZNF512_ENST00000379717.1_Silent_p.G437G	NM_001271287.1|NM_001271288.1|NM_001271289.1|NM_001271318.1|NM_032434.3	NP_001258216.1|NP_001258217.1|NP_001258218.1|NP_001258247.1|NP_115810.2	Q96ME7	ZN512_HUMAN	zinc finger protein 512	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)					TTGTGGCTGGAAAATACAAAT	0.383																																					p.G438G													.	ZNF512-91	0			c.A1314G						.						88.0	86.0	87.0					2																	27840357		2203	4300	6503	SO:0001819	synonymous_variant	84450	exon13			GGCTGGAAAATAC	AL833748	CCDS1758.1, CCDS59428.1, CCDS59429.1	2p23	2008-02-05			ENSG00000243943	ENSG00000243943		"""Zinc fingers, C2H2-type"""	29380	protein-coding gene	gene with protein product						11347906	Standard	NM_032434		Approved	KIAA1805	uc002rla.4	Q96ME7	OTTHUMG00000097786	ENST00000355467.4:c.1314A>G	2.37:g.27840357A>G		Somatic	76	0		WXS	Illumina HiSeq	Phase_1	73	45	NM_032434	0	0	16	20	4	B4DSM5|Q53RZ7|Q86XK6|Q96JM0	Silent	SNP	ENST00000355467.4	37	CCDS1758.1																																																																																			.		0.383	ZNF512-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215029.2	NM_032434	
SPAST	6683	hgsc.bcm.edu	37	2	32289269	32289269	+	Silent	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:32289269C>G	ENST00000315285.3	+	1	494	c.369C>G	c.(367-369)gcC>gcG	p.A123A	SPAST_ENST00000345662.1_Silent_p.A123A	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ACAAACAGGCCTTCGAGTACA	0.711																																					p.A123A		.											.	SPAST-153	0			c.C369G						.						4.0	4.0	4.0					2																	32289269		1808	3894	5702	SO:0001819	synonymous_variant	6683	exon1			ACAGGCCTTCGAG	AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.369C>G	2.37:g.32289269C>G		Somatic	3	1		WXS	Illumina HiSeq	Phase_I	9	6	NM_199436	0	0	0	2	2		Silent	SNP	ENST00000315285.3	37	CCDS1778.1																																																																																			.		0.711	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250253.1	NM_199436	
FAM98A	25940	bcgsc.ca	37	2	33813450	33813450	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:33813450A>G	ENST00000238823.8	-	4	614	c.474T>C	c.(472-474)ccT>ccC	p.P158P	FAM98A_ENST00000403368.1_Silent_p.P158P|FAM98A_ENST00000498340.1_Intron|FAM98A_ENST00000441530.2_Intron			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	158							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					TATTGGCTGGAGGTTTGGACA	0.388																																					p.P158P													.	FAM98A-91	0			c.T474C						.						173.0	174.0	174.0					2																	33813450		2203	4300	6503	SO:0001819	synonymous_variant	25940	exon4			GGCTGGAGGTTTG		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.474T>C	2.37:g.33813450A>G		Somatic	169	0		WXS	Illumina HiSeq	Phase_1	55	25	NM_015475	0	0	42	48	6	B2RNA2|Q9Y3Y6	Silent	SNP	ENST00000238823.8	37	CCDS33179.1																																																																																			.		0.388	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
CEBPZ	10153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	37454852	37454852	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:37454852G>A	ENST00000234170.5	-	2	1629	c.1484C>T	c.(1483-1485)cCt>cTt	p.P495L		NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	495					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				CTGGGAATAAGGGTATGCCCT	0.368																																					p.P495L		.											.	CEBPZ-91	0			c.C1484T						.						83.0	79.0	80.0					2																	37454852		2203	4300	6503	SO:0001583	missense	10153	exon2			GAATAAGGGTATG	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.1484C>T	2.37:g.37454852G>A	ENSP00000234170:p.Pro495Leu	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	34	20	NM_005760	0	0	25	66	41	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	37	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952289	0.73787	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	T	0.24538	1.85	5.59	5.59	0.84812	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64494	0.2603	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74247	-0.3727	10	0.87932	D	0	.	19.6055	0.95580	0.0:0.0:1.0:0.0	.	495	Q03701	CEBPZ_HUMAN	L	495	ENSP00000234170:P495L	ENSP00000234170:P495L	P	-	2	0	CEBPZ	37308356	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	9.296000	0.96104	2.631000	0.89168	0.650000	0.86243	CCT	.		0.368	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
ATL2	64225	bcgsc.ca	37	2	38525498	38525498	+	Missense_Mutation	SNP	T	T	G	rs76204302		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:38525498T>G	ENST00000378954.4	-	12	1421	c.1420A>C	c.(1420-1422)Acc>Ccc	p.T474P	ATL2_ENST00000539122.1_Missense_Mutation_p.T303P|ATL2_ENST00000546051.1_Missense_Mutation_p.T303P|ATL2_ENST00000402054.1_Missense_Mutation_p.T303P|ATL2_ENST00000419554.2_Missense_Mutation_p.T474P|ATL2_ENST00000452935.2_Missense_Mutation_p.T456P|ATL2_ENST00000332337.4_Missense_Mutation_p.T456P|ATL2_ENST00000406122.1_Missense_Mutation_p.T303P	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	474					endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						GTGGCTGGGGTACGAGCAGCA	0.418																																					p.T474P													.	ATL2-228	0			c.A1420C						.						137.0	125.0	129.0					2																	38525498		2203	4300	6503	SO:0001583	missense	64225	exon12			CTGGGGTACGAGC		CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.1420A>C	2.37:g.38525498T>G	ENSP00000368237:p.Thr474Pro	Somatic	95	1		WXS	Illumina HiSeq	Phase_1	36	16	NM_001135673	0	0	33	46	13	B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	ENST00000378954.4	37	CCDS46260.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.606237	0.87157	.	.	ENSG00000119787	ENST00000378954;ENST00000406122;ENST00000402054;ENST00000539122;ENST00000332337;ENST00000419554;ENST00000452935;ENST00000546051	D;D;D;D;D;D;D;D	0.96856	-4.15;-4.15;-4.15;-4.15;-4.15;-4.15;-4.15;-4.15	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.98385	0.9463	M	0.89968	3.075	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.987;0.997;0.997;0.992	D	0.99418	1.0932	10	0.72032	D	0.01	-10.8367	15.3584	0.74448	0.0:0.0:0.0:1.0	.	303;456;456;474;474	B5MCN0;B7Z7X8;Q8NHH9-4;Q8NHH9-2;Q8NHH9	.;.;.;.;ATLA2_HUMAN	P	474;303;303;303;456;474;456;303	ENSP00000368237:T474P;ENSP00000385446:T303P;ENSP00000384062:T303P;ENSP00000446192:T303P;ENSP00000333393:T456P;ENSP00000415336:T474P;ENSP00000390743:T456P;ENSP00000438938:T303P	ENSP00000333393:T456P	T	-	1	0	ATL2	38379002	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.874000	0.87199	2.217000	0.71921	0.482000	0.46254	ACC	.		0.418	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219886.2	NM_022374	
ZNF514	84874	bcgsc.ca	37	2	95818976	95818976	+	Missense_Mutation	SNP	A	A	C	rs79400981		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:95818976A>C	ENST00000295208.2	-	3	485	c.23T>G	c.(22-24)gTg>gGg	p.V8G	ZNF514_ENST00000411425.1_Missense_Mutation_p.V8G	NM_032788.1	NP_116177.1	Q96K75	ZN514_HUMAN	zinc finger protein 514	8	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(6)|urinary_tract(1)	11						GCTGAATTCCACAGCCACATC	0.478																																					p.V8G													.	ZNF514-90	0			c.T23G						.						70.0	69.0	69.0					2																	95818976		2203	4300	6503	SO:0001583	missense	84874	exon3			AATTCCACAGCCA	AL832263	CCDS2011.1	2q11.2	2013-01-08			ENSG00000144026	ENSG00000144026		"""Zinc fingers, C2H2-type"", ""-"""	25894	protein-coding gene	gene with protein product							Standard	NM_032788		Approved	FLJ14457	uc002sue.1	Q96K75	OTTHUMG00000130391	ENST00000295208.2:c.23T>G	2.37:g.95818976A>C	ENSP00000295208:p.Val8Gly	Somatic	91	0		WXS	Illumina HiSeq	Phase_1	47	21	NM_032788	0	0	36	42	6	Q5JPJ3	Missense_Mutation	SNP	ENST00000295208.2	37	CCDS2011.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.522701	0.44866	.	.	ENSG00000144026	ENST00000295208;ENST00000411425;ENST00000447814	T;T;T	0.04758	3.56;3.56;3.56	2.96	1.69	0.24217	Krueppel-associated box (4);	.	.	.	.	T	0.23766	0.0575	H	0.95402	3.665	0.40694	D	0.982426	D	0.71674	0.998	D	0.63113	0.911	T	0.02512	-1.1148	9	0.87932	D	0	.	7.1256	0.25469	0.77:0.23:0.0:0.0	.	8	Q96K75	ZN514_HUMAN	G	8;8;24	ENSP00000295208:V8G;ENSP00000405509:V8G;ENSP00000399647:V24G	ENSP00000295208:V8G	V	-	2	0	ZNF514	95182703	0.990000	0.36364	0.996000	0.52242	0.594000	0.36715	2.815000	0.48018	0.310000	0.22990	0.533000	0.62120	GTG	.		0.478	ZNF514-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252769.1	NM_032788	
GPR45	11250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	105858582	105858582	+	Silent	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:105858582C>G	ENST00000258456.1	+	1	383	c.267C>G	c.(265-267)ccC>ccG	p.P89P		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						GCTGCATGCCCTTCACCGCCG	0.627																																					p.P89P		.											.	GPR45-154	0			c.C267G						.						125.0	115.0	118.0					2																	105858582		2203	4300	6503	SO:0001819	synonymous_variant	11250	exon1			CATGCCCTTCACC	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.267C>G	2.37:g.105858582C>G		Somatic	151	0		WXS	Illumina HiSeq	Phase_I	527	245	NM_007227	0	0	0	0	0	Q6NWS4|Q6NXU6	Silent	SNP	ENST00000258456.1	37	CCDS2066.1																																																																																			.		0.627	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	NM_007227	
CBWD2	150472	hgsc.bcm.edu	37	2	114195459	114195459	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:114195459T>G	ENST00000259199.4	+	1	192	c.14T>G	c.(13-15)gTt>gGt	p.V5G	CBWD2_ENST00000416503.2_Missense_Mutation_p.V5G|RP11-480C16.1_ENST00000608834.1_lincRNA|CBWD2_ENST00000433343.2_5'UTR	NM_172003.3	NP_742000.1	Q8IUF1	CBWD2_HUMAN	COBW domain containing 2	5							ATP binding (GO:0005524)			endometrium(1)|lung(1)	2						TTACCGGCTGTTGGATCTGCG	0.622																																					p.V5G		.											.	CBWD2-90	0			c.T14G						.						33.0	38.0	36.0					2																	114195459		2154	4227	6381	SO:0001583	missense	150472	exon1			CGGCTGTTGGATC	AF452722	CCDS2116.1	2q14.1	2005-08-22			ENSG00000136682	ENSG00000136682			17907	protein-coding gene	gene with protein product		611079				12421752, 15233989	Standard	NM_172003		Approved		uc002tju.3	Q8IUF1	OTTHUMG00000131360	ENST00000259199.4:c.14T>G	2.37:g.114195459T>G	ENSP00000259199:p.Val5Gly	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	571	268	NM_172003	0	0	24	26	2	Q0VAN3	Missense_Mutation	SNP	ENST00000259199.4	37	CCDS2116.1	.	.	.	.	.	.	.	.	.	.	.	10.67	1.415862	0.25552	.	.	ENSG00000136682	ENST00000259199;ENST00000376448;ENST00000448780;ENST00000416503	T;T	0.09538	2.97;2.98	2.85	-1.52	0.08637	.	1.998220	0.02745	N	0.116767	T	0.06872	0.0175	N	0.19112	0.55	0.20196	N	0.999927	B	0.25351	0.124	B	0.24006	0.05	T	0.37502	-0.9703	10	0.87932	D	0	-14.7404	0.3048	0.00278	0.2246:0.1479:0.2295:0.398	.	5	Q8IUF1	CBWD2_HUMAN	G	5	ENSP00000259199:V5G;ENSP00000411906:V5G	ENSP00000259199:V5G	V	+	2	0	CBWD2	113911929	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-0.562000	0.05950	-0.057000	0.13199	0.327000	0.21459	GTT	.		0.622	CBWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254149.3	NM_172003	
GLI2	2736	hgsc.bcm.edu	37	2	121746538	121746538	+	Silent	SNP	C	C	T	rs140479803	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:121746538C>T	ENST00000452319.1	+	14	3108	c.3048C>T	c.(3046-3048)gaC>gaT	p.D1016D	GLI2_ENST00000314490.11_Silent_p.D688D|GLI2_ENST00000361492.4_Silent_p.D1016D					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CGAGCACCGACGGCGGCCTGG	0.761													C|||	136	0.0271565	0.0983	0.0072	5008	,	,		7708	0.0		0.001	False		,,,				2504	0.0				p.D1016D		.											.	GLI2-954	0			c.C3048T						.	C		158,2180		0,158,1011	3.0	3.0	3.0		3048	-4.9	0.0	2	dbSNP_134	3	2,4896		0,2,2447	no	coding-synonymous	GLI2	NM_005270.4		0,160,3458	TT,TC,CC		0.0408,6.7579,2.2112		1016/1587	121746538	160,7076	1169	2449	3618	SO:0001819	synonymous_variant	2736	exon13			CACCGACGGCGGC		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.3048C>T	2.37:g.121746538C>T		Somatic	2	0		WXS	Illumina HiSeq	Phase_I	18	14	NM_005270	0	0	0	0	0		Silent	SNP	ENST00000452319.1	37	CCDS33283.1																																																																																			C|0.978;T|0.022		0.761	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
TFCP2L1	29842	hgsc.bcm.edu;broad.mit.edu	37	2	122042681	122042681	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:122042681A>T	ENST00000263707.5	-	1	102	c.5T>A	c.(4-6)cTc>cAc	p.L2H		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	2	Mediate transcriptional repression.				cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					GTGCCAGAAGAGCATGGCTGG	0.756																																					p.L2H		.											.	TFCP2L1-93	0			c.T5A						.						17.0	16.0	16.0					2																	122042681		2192	4286	6478	SO:0001583	missense	29842	exon1			CAGAAGAGCATGG	AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.5T>A	2.37:g.122042681A>T	ENSP00000263707:p.Leu2His	Somatic	14	0		WXS	Illumina HiSeq	Phase_I	31	19	NM_014553	0	0	3	10	7	Q4ZG43	Missense_Mutation	SNP	ENST00000263707.5	37	CCDS2134.1	.	.	.	.	.	.	.	.	.	.	a	17.41	3.381885	0.61845	.	.	ENSG00000115112	ENST00000263707	T	0.26373	1.74	4.1	4.1	0.47936	.	0.097761	0.43747	U	0.000539	T	0.39835	0.1093	L	0.38175	1.15	0.58432	D	0.999999	D;D	0.89917	1.0;0.988	D;P	0.87578	0.998;0.832	T	0.29518	-1.0009	10	0.87932	D	0	.	12.7432	0.57266	1.0:0.0:0.0:0.0	.	2;2	Q5JV87;Q9NZI6	.;TF2L1_HUMAN	H	2	ENSP00000263707:L2H	ENSP00000263707:L2H	L	-	2	0	TFCP2L1	121759151	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	6.622000	0.74233	1.467000	0.48044	0.398000	0.26397	CTC	.		0.756	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338539.1	NM_014553	
ZRANB3	84083	bcgsc.ca	37	2	136107601	136107601	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:136107601G>C	ENST00000264159.6	-	5	660	c.544C>G	c.(544-546)Cga>Gga	p.R182G	ZRANB3_ENST00000536680.1_Missense_Mutation_p.R182G|ZRANB3_ENST00000401392.1_Missense_Mutation_p.R182G	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	182	DNA annealing helicase activity.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		AGAATGGCTCGTCTGGCTTTC	0.423																																					p.R182G													.	ZRANB3-658	0			c.C544G						.						105.0	108.0	107.0					2																	136107601		1860	4101	5961	SO:0001583	missense	84083	exon5			TGGCTCGTCTGGC	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.544C>G	2.37:g.136107601G>C	ENSP00000264159:p.Arg182Gly	Somatic	67	0		WXS	Illumina HiSeq	Phase_1	45	25	NM_032143	0	0	2	3	1	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394680	0.62066	.	.	ENSG00000121988	ENST00000401392;ENST00000264159;ENST00000536680;ENST00000397448	D;D;D	0.93133	-3.17;-3.17;-3.17	5.57	0.888	0.19206	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.97161	0.9072	M	0.92649	3.33	0.42134	D	0.991483	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.995	D	0.97660	1.0160	10	0.62326	D	0.03	-8.5108	16.2461	0.82446	0.0:0.0:0.447:0.553	.	122;182;182	E9PBP0;Q5FWF4;Q5FWF4-3	.;ZRAB3_HUMAN;.	G	182;182;182;122	ENSP00000383979:R182G;ENSP00000264159:R182G;ENSP00000441320:R182G	ENSP00000264159:R182G	R	-	1	2	ZRANB3	135824071	0.978000	0.34361	0.993000	0.49108	0.997000	0.91878	1.686000	0.37669	0.226000	0.20979	0.591000	0.81541	CGA	.		0.423	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
PLA2R1	22925	bcgsc.ca	37	2	160898583	160898583	+	Missense_Mutation	SNP	G	G	T	rs200625381		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:160898583G>T	ENST00000283243.7	-	3	826	c.620C>A	c.(619-621)aCa>aAa	p.T207K	PLA2R1_ENST00000392771.1_Missense_Mutation_p.T207K	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	207	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						ATAACGGCTTGTCGTGGCACA	0.428																																					p.T207K													.	PLA2R1-93	0			c.C620A						.						132.0	127.0	129.0					2																	160898583		2203	4300	6503	SO:0001583	missense	22925	exon3			CGGCTTGTCGTGG	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.620C>A	2.37:g.160898583G>T	ENSP00000283243:p.Thr207Lys	Somatic	141	0		WXS	Illumina HiSeq	Phase_1	97	40	NM_001195641	0	0	7	7	0	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	37	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451136	0.84209	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.56941	0.43;0.43	5.59	5.59	0.84812	Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);	0.054970	0.64402	D	0.000001	T	0.80539	0.4642	M	0.92459	3.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.999;0.999	D	0.84142	0.0418	10	0.66056	D	0.02	.	19.9651	0.97262	0.0:0.0:1.0:0.0	.	207;207;207	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	K	207	ENSP00000283243:T207K;ENSP00000376524:T207K	ENSP00000283243:T207K	T	-	2	0	PLA2R1	160606829	1.000000	0.71417	0.344000	0.25628	0.988000	0.76386	7.442000	0.80503	2.793000	0.96121	0.655000	0.94253	ACA	G|0.999;T|0.001		0.428	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
DPP4	1803	bcgsc.ca	37	2	162879272	162879272	+	Missense_Mutation	SNP	A	A	C	rs200047090		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:162879272A>C	ENST00000360534.3	-	12	1621	c.1061T>G	c.(1060-1062)gTt>gGt	p.V354G		NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	354					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	TACTCTTCCAACCCAGCCAGT	0.403																																					p.V354G													.	DPP4-93	0			c.T1061G						.						155.0	150.0	151.0					2																	162879272		2203	4300	6503	SO:0001583	missense	1803	exon12			CTTCCAACCCAGC	M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1061T>G	2.37:g.162879272A>C	ENSP00000353731:p.Val354Gly	Somatic	169	0		WXS	Illumina HiSeq	Phase_1	47	19	NM_001935	0	0	0	0	0	Q53TN1	Missense_Mutation	SNP	ENST00000360534.3	37	CCDS2216.1	.	.	.	.	.	.	.	.	.	.	A	19.18	3.777643	0.70107	.	.	ENSG00000197635	ENST00000360534	T	0.38240	1.15	5.32	5.32	0.75619	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.178535	0.48767	D	0.000167	T	0.66470	0.2792	M	0.88906	2.99	0.80722	D	1	P	0.50369	0.934	D	0.77004	0.989	T	0.73235	-0.4047	10	0.87932	D	0	-28.2942	14.5501	0.68059	1.0:0.0:0.0:0.0	.	354	P27487	DPP4_HUMAN	G	354	ENSP00000353731:V354G	ENSP00000353731:V354G	V	-	2	0	DPP4	162587518	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	5.980000	0.70516	2.126000	0.65437	0.528000	0.53228	GTT	.		0.403	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2		
ALS2	57679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	202626257	202626257	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:202626257G>A	ENST00000264276.6	-	4	832	c.460C>T	c.(460-462)Cag>Tag	p.Q154*	ALS2_ENST00000467448.1_Nonsense_Mutation_p.Q154*|ALS2_ENST00000496244.1_5'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	154					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						CACGCCAACTGTAAAATCCTG	0.522																																					p.Q154X		.											.	ALS2-275	0			c.C460T						.						79.0	79.0	79.0					2																	202626257		2073	4196	6269	SO:0001587	stop_gained	57679	exon4			CCAACTGTAAAAT	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.460C>T	2.37:g.202626257G>A	ENSP00000264276:p.Gln154*	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	121	55	NM_001135745	0	0	8	20	12	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Nonsense_Mutation	SNP	ENST00000264276.6	37	CCDS42800.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582281	0.86748	.	.	ENSG00000003393	ENST00000264276;ENST00000467448	.	.	.	6.17	6.17	0.99709	.	0.056382	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	154	.	ENSP00000264276:Q154X	Q	-	1	0	ALS2	202334502	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.405000	0.66351	2.941000	0.99782	0.655000	0.94253	CAG	.		0.522	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
KANSL1L	151050	bcgsc.ca	37	2	210993868	210993868	+	Missense_Mutation	SNP	C	C	A	rs78236584		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:210993868C>A	ENST00000281772.9	-	3	1380	c.1117G>T	c.(1117-1119)Gta>Tta	p.V373L	KANSL1L_ENST00000457374.1_Missense_Mutation_p.V373L|KANSL1L_ENST00000418791.1_Missense_Mutation_p.V373L|KANSL1L_ENST00000452086.1_Missense_Mutation_p.V373L	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	373						histone acetyltransferase complex (GO:0000123)											GCTCTGTCTACAAGCCACTTC	0.408																																					p.V373L													.	.	0			c.G1117T						.						139.0	128.0	132.0					2																	210993868		2203	4300	6503	SO:0001583	missense	151050	exon3			TGTCTACAAGCCA	AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.1117G>T	2.37:g.210993868C>A	ENSP00000281772:p.Val373Leu	Somatic	127	0		WXS	Illumina HiSeq	Phase_1	19	14	NM_152519	0	0	38	41	3	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	ENST00000281772.9	37	CCDS33370.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	12.68|12.68|12.68	2.010138|2.010138|2.010138	0.35415|0.35415|0.35415	.|.|.	.|.|.	ENSG00000144445|ENSG00000144445|ENSG00000144445	ENST00000428655|ENST00000438563;ENST00000415553|ENST00000281772;ENST00000418791;ENST00000457374;ENST00000452086	.|.|.	.|.|.	.|.|.	5.51|5.51|5.51	3.67|3.67|3.67	0.42095|0.42095|0.42095	.|.|.	.|.|0.378184	.|.|0.22513	.|.|N	.|.|0.059077	T|T|T	0.26268|0.26268|0.26268	0.0641|0.0641|0.0641	L|L|L	0.47716|0.47716|0.47716	1.5|1.5|1.5	0.26138|0.26138|0.26138	N|N|N	0.980312|0.980312|0.980312	.|.|B;P;B;B	.|.|0.38729	.|.|0.132;0.644;0.208;0.208	.|.|B;B;B;B	.|.|0.32677	.|.|0.106;0.15;0.104;0.104	T|T|T	0.09100|0.09100|0.09100	-1.0690|-1.0690|-1.0690	5|6|9	.|0.56958|0.30078	.|D|T	.|0.05|0.28	.|.|.	8.5979|8.5979|8.5979	0.33727|0.33727|0.33727	0.2701:0.6599:0.0:0.07|0.2701:0.6599:0.0:0.07|0.2701:0.6599:0.0:0.07	.|.|.	.|.|373;373;373;373	.|.|A0AUZ9-4;A0AUZ9-3;A0AUZ9-2;A0AUZ9	.|.|.;.;.;CB067_HUMAN	F|F|L	67|46;91|373	.|.|.	.|ENSP00000388182:L91F|ENSP00000281772:V373L	C|L|V	-|-|-	2|3|1	0|2|0	C2orf67|C2orf67|C2orf67	210702113|210702113|210702113	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.995000|0.995000|0.995000	0.86356|0.86356|0.86356	1.012000|1.012000|1.012000	0.29924|0.29924|0.29924	0.641000|0.641000|0.641000	0.30601|0.30601|0.30601	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	TGT|TTG|GTA	.		0.408	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3	NM_152519	
MYL1	4632	bcgsc.ca	37	2	211179729	211179729	+	Missense_Mutation	SNP	G	G	C	rs142821726		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:211179729G>C	ENST00000352451.3	-	1	185	c.38C>G	c.(37-39)gCg>gGg	p.A13G		NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	13					cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		AGCCGCAGCCGCAGCCACAGG	0.502																																					p.A13G													.	MYL1-91	0			c.C38G						.						73.0	106.0	95.0					2																	211179729		2185	4279	6464	SO:0001583	missense	4632	exon1			GCAGCCGCAGCCA		CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.38C>G	2.37:g.211179729G>C	ENSP00000307280:p.Ala13Gly	Somatic	342	0		WXS	Illumina HiSeq	Phase_1	702	155	NM_079420	0	0	0	0	0	B2R4N6|B2R4T6|P06741|Q6IBD5	Missense_Mutation	SNP	ENST00000352451.3	37	CCDS2390.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364961	0.24684	.	.	ENSG00000168530	ENST00000352451	D	0.85556	-2.0	5.3	5.3	0.74995	.	0.358981	0.27966	N	0.017124	D	0.89504	0.6734	L	0.43923	1.385	0.35447	D	0.795389	D	0.63880	0.993	D	0.72075	0.976	D	0.92456	0.5974	10	0.62326	D	0.03	.	16.7514	0.85487	0.0:0.0:1.0:0.0	.	13	P05976	MYL1_HUMAN	G	13	ENSP00000307280:A13G	ENSP00000307280:A13G	A	-	2	0	MYL1	210887974	0.998000	0.40836	0.938000	0.37757	0.230000	0.25150	4.170000	0.58229	2.486000	0.83907	0.561000	0.74099	GCG	G|1.000;C|0.000		0.502	MYL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256566.2	NM_079420	
OBSL1	23363	hgsc.bcm.edu	37	2	220435880	220435880	+	Missense_Mutation	SNP	A	A	C	rs376818200		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:220435880A>C	ENST00000404537.1	-	1	131	c.75T>G	c.(73-75)agT>agG	p.S25R	OBSL1_ENST00000289656.3_Intron|OBSL1_ENST00000373876.1_Missense_Mutation_p.S25R|INHA_ENST00000243786.2_5'Flank|OBSL1_ENST00000491370.1_Intron|INHA_ENST00000489456.1_Intron|OBSL1_ENST00000265318.4_Missense_Mutation_p.S25R|OBSL1_ENST00000373873.4_Missense_Mutation_p.S25R|OBSL1_ENST00000603926.1_Missense_Mutation_p.S25R	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	25	Ig-like 1.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CCTCGGCGCCACTTACCACCC	0.736													A|||	1	0.000199681	0.0008	0.0	5008	,	,		6502	0.0		0.0	False		,,,				2504	0.0				p.S25R		.											.	OBSL1-71	0			c.T75G						.	A	ARG/SER,ARG/SER,ARG/SER	1,3161		0,1,1580	4.0	4.0	4.0		75,75,75	-3.3	1.0	2		4	0,7030		0,0,3515	no	missense,missense,missense	OBSL1	NM_015311.2,NM_001173431.1,NM_001173408.1	110,110,110	0,1,5095	CC,CA,AA		0.0,0.0316,0.0098	benign,benign,benign	25/1897,25/1544,25/1026	220435880	1,10191	1581	3515	5096	SO:0001583	missense	23363	exon1			GGCGCCACTTACC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.75T>G	2.37:g.220435880A>C	ENSP00000385636:p.Ser25Arg	Somatic	8	1		WXS	Illumina HiSeq	Phase_I	17	7	NM_001173431	0	0	3	7	4	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	CCDS46520.1	.	.	.	.	.	.	.	.	.	.	A	12.39	1.924651	0.34002	3.16E-4	0.0	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873	T;T;T;T	0.26810	1.71;1.71;1.71;1.71	3.63	-3.34	0.04943	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.11067	0.0270	N	0.02296	-0.605	0.80722	D	1	B;P	0.52316	0.238;0.952	B;P	0.50192	0.145;0.634	T	0.35325	-0.9793	8	.	.	.	.	6.3881	0.21572	0.4017:0.0:0.4652:0.1331	.	25;25	O75147;O75147-2	OBSL1_HUMAN;.	R	25	ENSP00000265318:S25R;ENSP00000385636:S25R;ENSP00000362983:S25R;ENSP00000362980:S25R	.	S	-	3	2	OBSL1	220144124	0.457000	0.25752	0.975000	0.42487	0.006000	0.05464	-0.406000	0.07187	-0.573000	0.05998	-0.549000	0.04216	AGT	.		0.736	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
SLC19A3	80704	bcgsc.ca	37	2	228560681	228560681	+	Missense_Mutation	SNP	T	T	G	rs201784334		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:228560681T>G	ENST00000258403.3	-	4	1167	c.1096A>C	c.(1096-1098)Aca>Cca	p.T366P	SLC19A3_ENST00000409287.1_Intron|SLC19A3_ENST00000541617.1_Missense_Mutation_p.T362P	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	366					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)			breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	ATATTGGCTGTGTAATGCATG	0.443																																					p.T366P													.	SLC19A3-92	0			c.A1096C						.						83.0	92.0	89.0					2																	228560681		2203	4300	6503	SO:0001583	missense	80704	exon4			TGGCTGTGTAATG	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.1096A>C	2.37:g.228560681T>G	ENSP00000258403:p.Thr366Pro	Somatic	102	0		WXS	Illumina HiSeq	Phase_1	47	15	NM_025243	0	0	1	1	0		Missense_Mutation	SNP	ENST00000258403.3	37	CCDS2468.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.811011	0.50421	.	.	ENSG00000135917	ENST00000258403;ENST00000541617	D;D	0.87491	-2.26;-2.26	5.03	3.85	0.44370	Major facilitator superfamily domain, general substrate transporter (1);	0.370968	0.30920	N	0.008618	D	0.93154	0.7820	M	0.91972	3.26	0.09310	N	0.999999	D;D	0.60160	0.987;0.961	P;P	0.62089	0.898;0.811	D	0.86550	0.1834	10	0.49607	T	0.09	-2.3003	10.5027	0.44815	0.2562:0.0:0.0:0.7437	.	362;366	F5H2M8;Q9BZV2	.;S19A3_HUMAN	P	366;362	ENSP00000258403:T366P;ENSP00000445519:T362P	ENSP00000258403:T366P	T	-	1	0	SLC19A3	228268925	1.000000	0.71417	0.813000	0.32504	0.680000	0.39746	1.739000	0.38217	0.902000	0.36520	0.533000	0.62120	ACA	.		0.443	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		
ESF1	51575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	13695769	13695769	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr20:13695769A>T	ENST00000202816.1	-	14	2415	c.2308T>A	c.(2308-2310)Ttg>Atg	p.L770M		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	770	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						AAATTGAACAAGTGGGAAGTG	0.348																																					p.L770M		.											.	ESF1-91	0			c.T2308A						.						96.0	100.0	98.0					20																	13695769		2203	4300	6503	SO:0001583	missense	51575	exon14			TGAACAAGTGGGA		CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.2308T>A	20.37:g.13695769A>T	ENSP00000202816:p.Leu770Met	Somatic	74	1		WXS	Illumina HiSeq	Phase_I	89	38	NM_001276380	0	0	10	17	7	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	ENST00000202816.1	37	CCDS13117.1	.	.	.	.	.	.	.	.	.	.	A	18.79	3.698422	0.68386	.	.	ENSG00000089048	ENST00000202816	T	0.23348	1.91	6.05	4.93	0.64822	NUC153 (1);	0.000000	0.56097	D	0.000024	T	0.47857	0.1468	M	0.72894	2.215	0.43588	D	0.995936	D	0.89917	1.0	D	0.97110	1.0	T	0.41840	-0.9486	10	0.45353	T	0.12	-6.0E-4	11.0101	0.47657	0.8699:0.0:0.1301:0.0	.	770	Q9H501	ESF1_HUMAN	M	770	ENSP00000202816:L770M	ENSP00000202816:L770M	L	-	1	2	ESF1	13643769	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.302000	0.59092	1.065000	0.40693	0.528000	0.53228	TTG	.		0.348	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078049.1	NM_016649	
RALGAPA2	57186	bcgsc.ca	37	20	20501647	20501647	+	Missense_Mutation	SNP	A	A	G	rs77346211		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr20:20501647A>G	ENST00000202677.7	-	31	4005	c.3998T>C	c.(3997-3999)tTc>tCc	p.F1333S		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1333					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						CAGTGGCAGGAAGGGGTCATA	0.498																																					p.F1333S													.	RALGAPA2-24	0			c.T3998C						.						105.0	107.0	106.0					20																	20501647		1969	4170	6139	SO:0001583	missense	57186	exon31			GGCAGGAAGGGGT	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.3998T>C	20.37:g.20501647A>G	ENSP00000202677:p.Phe1333Ser	Somatic	77	4		WXS	Illumina HiSeq	Phase_1	57	33	NM_020343	0	0	9	9	0	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	ENST00000202677.7	37	CCDS46584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.82|16.82	3.227385|3.227385	0.58668|0.58668	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000202677|ENST00000430436	T|.	0.30448|.	1.53|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.133079|.	0.53938|.	D|.	0.000058|.	T|T	0.75133|0.75133	0.3808|0.3808	M|M	0.72894|0.72894	2.215|2.215	0.53005|0.53005	D|D	0.99996|0.99996	B;D;B|.	0.76494|.	0.057;0.999;0.057|.	B;D;B|.	0.83275|.	0.053;0.996;0.053|.	T|T	0.74466|0.74466	-0.3656|-0.3656	10|5	0.23302|.	T|.	0.38|.	.|.	16.8222|16.8222	0.85835|0.85835	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1171;1333;1333|.	A8MSM5;Q2PPJ7-2;Q2PPJ7|.	.;.;RGPA2_HUMAN|.	S|P	1333|1150	ENSP00000202677:F1333S|.	ENSP00000202677:F1333S|.	F|S	-|-	2|1	0|0	RALGAPA2|RALGAPA2	20449647|20449647	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.996000|0.996000	0.88848|0.88848	6.366000|6.366000	0.73095|0.73095	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	TTC|TCC	A|0.996;G|0.004		0.498	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343	
ZSWIM1	90204	hgsc.bcm.edu	37	20	44512073	44512073	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr20:44512073C>T	ENST00000372523.1	+	2	937	c.842C>T	c.(841-843)tCt>tTt	p.S281F	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.S281F	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	281						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				GGTATGGCTTCTCTGTTCCGT	0.542																																					p.S281F		.											.	ZSWIM1-91	0			c.C842T						.						114.0	106.0	109.0					20																	44512073		2203	4300	6503	SO:0001583	missense	90204	exon2			TGGCTTCTCTGTT	AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.842C>T	20.37:g.44512073C>T	ENSP00000361601:p.Ser281Phe	Somatic	165	1		WXS	Illumina HiSeq	Phase_I	754	280	NM_080603	0	0	7	12	5	Q5JZH2|Q9BR12|Q9BV30	Missense_Mutation	SNP	ENST00000372523.1	37	CCDS13382.2	.	.	.	.	.	.	.	.	.	.	C	11.18	1.562391	0.27915	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.25579	1.79;1.79	5.27	3.33	0.38152	.	0.405963	0.20859	U	0.084384	T	0.19167	0.0460	L	0.27053	0.805	0.09310	N	1	B	0.30406	0.278	B	0.34385	0.181	T	0.16778	-1.0391	10	0.54805	T	0.06	-14.0609	9.3261	0.37993	0.0:0.779:0.1441:0.077	.	281	Q9BR11	ZSWM1_HUMAN	F	281	ENSP00000361601:S281F;ENSP00000361598:S281F	ENSP00000361598:S281F	S	+	2	0	ZSWIM1	43945480	0.010000	0.17322	0.018000	0.16275	0.968000	0.65278	1.435000	0.34969	0.785000	0.33685	0.655000	0.94253	TCT	.		0.542	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157064.2	NM_080603	
GRIK1	2897	hgsc.bcm.edu	37	21	30927529	30927529	+	Missense_Mutation	SNP	A	A	C	rs201323952		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr21:30927529A>C	ENST00000399907.1	-	16	2862	c.2451T>G	c.(2449-2451)aaT>aaG	p.N817K	GRIK1_ENST00000399914.1_Missense_Mutation_p.N802K|GRIK1_ENST00000399909.1_Missense_Mutation_p.N802K|GRIK1_ENST00000389125.3_Missense_Mutation_p.N802K|GRIK1_ENST00000389124.2_Missense_Mutation_p.N817K|GRIK1_ENST00000309434.7_Missense_Mutation_p.N819K|GRIK1_ENST00000535441.1_Missense_Mutation_p.N819K|GRIK1_ENST00000327783.4_Missense_Mutation_p.N817K|GRIK1_ENST00000399913.1_Missense_Mutation_p.N817K	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	817					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CGGGGCAGCCATTCCCACGCC	0.478																																					p.N817K		.											.	GRIK1-137	0			c.T2451G						.						98.0	100.0	100.0					21																	30927529		2203	4300	6503	SO:0001583	missense	2897	exon16			GCAGCCATTCCCA		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2451T>G	21.37:g.30927529A>C	ENSP00000382791:p.Asn817Lys	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	40	3	NM_000830	0	0	0	0	0	Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	37	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.413038	0.42817	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9;2.9	4.88	-2.03	0.07365	Ionotropic glutamate receptor (1);	0.043179	0.85682	N	0.000000	T	0.03871	0.0109	N	0.12746	0.255	0.58432	D	0.999993	B;B;P;B	0.36125	0.238;0.395;0.538;0.177	B;B;B;B	0.35312	0.2;0.132;0.2;0.037	T	0.44997	-0.9291	10	0.06494	T	0.89	.	7.7865	0.29095	0.3408:0.1458:0.5135:0.0	.	802;817;817;802	E7EPY9;E9PD61;P39086;P39086-2	.;.;GRIK1_HUMAN;.	K	817;802;817;802;819;678;817;817;802;819	ENSP00000327687:N817K;ENSP00000373777:N802K;ENSP00000382797:N817K;ENSP00000382798:N802K;ENSP00000446326:N819K;ENSP00000373776:N817K;ENSP00000382791:N817K;ENSP00000382793:N802K;ENSP00000311646:N819K	ENSP00000311646:N819K	N	-	3	2	GRIK1	29849400	0.081000	0.21417	0.963000	0.40424	0.988000	0.76386	-0.395000	0.07287	-0.418000	0.07450	-0.263000	0.10527	AAT	A|0.999;G|0.001		0.478	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
KRTAP22-1	337979	bcgsc.ca	37	21	31973511	31973511	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr21:31973511T>G	ENST00000334680.2	+	1	98	c.72T>G	c.(70-72)tgT>tgG	p.C24W	KRTAP6-2_ENST00000334897.3_5'Flank	NM_181620.1	NP_853651.1	Q3MIV0	KR221_HUMAN	keratin associated protein 22-1	24						intermediate filament (GO:0005882)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)|urinary_tract(1)	8						GCTATGGCTGTGGTCTTAGCG	0.478																																					p.C24W													.	KRTAP22-1-68	0			c.T72G						.																																			SO:0001583	missense	337979	exon1			TGGCTGTGGTCTT	AP001708	CCDS13601.1	21q22.1	2011-02-10			ENSG00000186924	ENSG00000186924		"""Keratin associated proteins"""	18947	protein-coding gene	gene with protein product						12359730	Standard	NM_181620		Approved	KAP22.1	uc011add.2	Q3MIV0	OTTHUMG00000057778	ENST00000334680.2:c.72T>G	21.37:g.31973511T>G	ENSP00000333887:p.Cys24Trp	Somatic	175	0		WXS	Illumina HiSeq	Phase_1	110	40	NM_181620	0	0	0	0	0		Missense_Mutation	SNP	ENST00000334680.2	37	CCDS13601.1	.	.	.	.	.	.	.	.	.	.	T	9.604	1.129475	0.21041	.	.	ENSG00000186924	ENST00000334680	T	0.20200	2.09	3.93	-1.38	0.09027	.	2.982100	0.01786	N	0.032038	T	0.36358	0.0964	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.63703	0.917	T	0.22487	-1.0215	9	0.87932	D	0	.	2.5716	0.04796	0.3438:0.1913:0.0:0.4649	.	24	Q3MIV0	KR221_HUMAN	W	24	ENSP00000333887:C24W	ENSP00000333887:C24W	C	+	3	2	KRTAP22-1	30895382	0.000000	0.05858	0.002000	0.10522	0.105000	0.19272	-0.869000	0.04232	-0.234000	0.09782	0.383000	0.25322	TGT	.		0.478	KRTAP22-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128230.2		
SLC5A3	6526	bcgsc.ca	37	21	35468406	35468406	+	Silent	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr21:35468406C>G	ENST00000381151.3	+	2	1421	c.909C>G	c.(907-909)ggC>ggG	p.G303G	AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_Silent_p.G303G|MRPS6_ENST00000399312.2_Intron			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	303					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						TTATGGCTGGCTTCTTAAAGC	0.463																																					p.G303G													.	SLC5A3-92	0			c.C909G						.						86.0	93.0	91.0					21																	35468406		2203	4300	6503	SO:0001819	synonymous_variant	6526	exon2			GGCTGGCTTCTTA		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.909C>G	21.37:g.35468406C>G		Somatic	127	0		WXS	Illumina HiSeq	Phase_1	100	53	NM_006933	0	0	1	1	0	O43489	Silent	SNP	ENST00000381151.3	37	CCDS33549.1																																																																																			.		0.463	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1		
DNMT3L	29947	bcgsc.ca	37	21	45668924	45668924	+	Missense_Mutation	SNP	A	A	G	rs200728649		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr21:45668924A>G	ENST00000418993.1	-	11	1463	c.980T>C	c.(979-981)aTc>aCc	p.I327T	DNMT3L_ENST00000270172.3_Missense_Mutation_p.I327T|AP001059.5_ENST00000442785.1_RNA	NM_175867.2	NP_787063.1	Q9UJW3	DNM3L_HUMAN	DNA (cytosine-5-)-methyltransferase 3-like	327					chorionic trophoblast cell differentiation (GO:0060718)|DNA methylation (GO:0006306)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|placenta development (GO:0001890)|positive regulation of catalytic activity (GO:0043085)|regulation of gene expression by genetic imprinting (GO:0006349)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	11				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		TATGGCTGGGATGTTGCTCCA	0.602																																					p.I327T													.	DNMT3L-228	0			c.T980C						.						61.0	49.0	53.0					21																	45668924		2203	4300	6503	SO:0001583	missense	29947	exon11			GCTGGGATGTTGC	AF194032	CCDS13705.1	21q22.3	2008-07-31			ENSG00000142182	ENSG00000142182			2980	protein-coding gene	gene with protein product	"""cytosine-5-methyltransferase 3-like protein"", ""human cytosine-5-methyltransferase 3-like protein"""	606588				10857753	Standard	NM_013369		Approved	MGC1090	uc002zeh.2	Q9UJW3	OTTHUMG00000086914	ENST00000418993.1:c.980T>C	21.37:g.45668924A>G	ENSP00000412862:p.Ile327Thr	Somatic	29	0		WXS	Illumina HiSeq	Phase_1	42	29	NM_013369	0	0	0	0	0	E9PB42|Q9BUJ4	Missense_Mutation	SNP	ENST00000418993.1	37	CCDS46650.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.32|10.32	1.318055|1.318055	0.23994|0.23994	.|.	.|.	ENSG00000142182|ENSG00000142182	ENST00000270172;ENST00000418993|ENST00000436357	T;T|.	0.31510|.	1.49;1.49|.	3.02|3.02	3.02|3.02	0.34903|0.34903	.|.	0.368026|.	0.24363|.	N|.	0.039168|.	T|T	0.59074|0.59074	0.2167|0.2167	M|M	0.72894|0.72894	2.215|2.215	0.34133|0.34133	D|D	0.665472|0.665472	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|T	0.68228|0.68228	-0.5464|-0.5464	10|5	0.87932|.	D|.	0|.	-17.3426|-17.3426	7.8344|7.8344	0.29362|0.29362	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	327;327|.	Q9UJW3-2;Q9UJW3|.	.;DNM3L_HUMAN|.	T|P	327|122	ENSP00000270172:I327T;ENSP00000412862:I327T|.	ENSP00000270172:I327T|.	I|S	-|-	2|1	0|0	DNMT3L|DNMT3L	44493352|44493352	0.996000|0.996000	0.38824|0.38824	0.824000|0.824000	0.32777|0.32777	0.003000|0.003000	0.03518|0.03518	3.875000|3.875000	0.56108|0.56108	1.629000|1.629000	0.50426|0.50426	0.455000|0.455000	0.32223|0.32223	ATC|TCC	.		0.602	DNMT3L-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000195820.1	NM_013369	
BID	637	bcgsc.ca	37	22	18226601	18226601	+	Missense_Mutation	SNP	C	C	G	rs201438109		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:18226601C>G	ENST00000399774.3	-	3	360	c.191G>C	c.(190-192)aGc>aCc	p.S64T	BID_ENST00000342111.5_Missense_Mutation_p.S64T|BID_ENST00000399765.1_Intron|BID_ENST00000551952.1_Missense_Mutation_p.S64T|BID_ENST00000317361.7_Missense_Mutation_p.S110T|BID_ENST00000399767.1_5'UTR|BID_ENST00000473439.1_5'UTR	NM_001196.3|NM_001244569.1	NP_001187.1|NP_001231498.1	P55957	BID_HUMAN	BH3 interacting domain death agonist	64					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|brain development (GO:0007420)|establishment of protein localization to membrane (GO:0090150)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|intrinsic apoptotic signaling pathway (GO:0097193)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of cell proliferation (GO:0042127)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|release of cytochrome c from mitochondria (GO:0001836)|response to estradiol (GO:0032355)|signal transduction in response to DNA damage (GO:0042770)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial membrane (GO:0032592)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	death receptor binding (GO:0005123)	p.S110T(1)		large_intestine(2)|ovary(1)	3		all_epithelial(15;0.198)		Lung(27;0.0419)		GGAGTGGCTGCTGCGGTTGCC	0.637																																					p.S110T													.	BID-1083	1	Substitution - Missense(1)	ovary(1)	c.G329C						.						24.0	27.0	26.0					22																	18226601		2202	4297	6499	SO:0001583	missense	637	exon3			TGGCTGCTGCGGT	AF042083	CCDS13747.1, CCDS13748.1, CCDS13749.1	22q11.2	2014-03-07			ENSG00000015475	ENSG00000015475		"""Endogenous ligands"""	1050	protein-coding gene	gene with protein product		601997				8918887, 9721221	Standard	NM_001244567		Approved		uc002znc.2	P55957	OTTHUMG00000150087	ENST00000399774.3:c.191G>C	22.37:g.18226601C>G	ENSP00000382674:p.Ser64Thr	Somatic	49	1		WXS	Illumina HiSeq	Phase_1	82	61	NM_197966	0	0	26	26	0	Q549M7|Q71T04|Q7Z4M9|Q8IY86	Missense_Mutation	SNP	ENST00000399774.3	37	CCDS13748.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.915522	0.33815	.	.	ENSG00000015475	ENST00000317361;ENST00000399774;ENST00000342111;ENST00000551952	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.48	-7.87	0.01183	.	1.153560	0.06208	N	0.684440	T	0.17662	0.0424	L	0.50333	1.59	0.22424	N	0.999112	B;B	0.14805	0.005;0.011	B;B	0.21708	0.026;0.036	T	0.37641	-0.9697	10	0.41790	T	0.15	.	2.5945	0.04850	0.2338:0.4568:0.1511:0.1583	.	64;110	P55957;P55957-2	BID_HUMAN;.	T	110;64;64;64	ENSP00000318822:S110T;ENSP00000382674:S64T;ENSP00000344594:S64T;ENSP00000449236:S64T	ENSP00000318822:S110T	S	-	2	0	BID	16606601	0.008000	0.16893	0.000000	0.03702	0.008000	0.06430	-0.168000	0.09925	-1.138000	0.02884	-0.311000	0.09066	AGC	.		0.637	BID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316178.1	NM_197966	
CABIN1	23523	ucsc.edu	37	22	24494089	24494089	+	Missense_Mutation	SNP	A	A	C	rs77920906		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:24494089A>C	ENST00000398319.2	+	26	4436	c.4051A>C	c.(4051-4053)Aca>Cca	p.T1351P	CABIN1_ENST00000405822.2_Intron|CABIN1_ENST00000263119.5_Missense_Mutation_p.T1351P	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1351					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CCCACCTTACACAGCCACTCC	0.622																																					p.T1351P													.	CABIN1-94	0			c.A4051C						.						89.0	82.0	84.0					22																	24494089		2203	4300	6503	SO:0001583	missense	23523	exon26			CCTTACACAGCCA	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.4051A>C	22.37:g.24494089A>C	ENSP00000381364:p.Thr1351Pro	Somatic	97	1		WXS	Illumina HiSeq		278	87	NM_001199281	0	0	7	7	0	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.966900	0.74131	.	.	ENSG00000099991	ENST00000263119;ENST00000398319	T;T	0.63417	-0.04;-0.04	4.77	4.77	0.60923	.	0.111718	0.64402	D	0.000011	T	0.52108	0.1714	L	0.43152	1.355	0.80722	D	1	B	0.30824	0.296	B	0.19946	0.027	T	0.55198	-0.8178	10	0.49607	T	0.09	.	13.83	0.63375	1.0:0.0:0.0:0.0	.	1351	Q9Y6J0	CABIN_HUMAN	P	1351	ENSP00000263119:T1351P;ENSP00000381364:T1351P	ENSP00000263119:T1351P	T	+	1	0	CABIN1	22824089	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.927000	0.63440	1.935000	0.56089	0.529000	0.55759	ACA	.		0.622	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
NF2	4771	hgsc.bcm.edu	37	22	30000103	30000103	+	Splice_Site	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:30000103T>G	ENST00000338641.4	+	1	555		c.e1+2		NF2_ENST00000403999.3_Splice_Site|NF2_ENST00000397789.3_Splice_Site|NF2_ENST00000403435.1_Splice_Site|NF2_ENST00000353887.4_Splice_Site|NF2_ENST00000334961.7_Splice_Site|NF2_ENST00000361452.4_Splice_Site|NF2_ENST00000413209.2_Splice_Site|NF2_ENST00000361166.4_Splice_Site|NF2_ENST00000347330.5_Splice_Site|NF2_ENST00000361676.4_Splice_Site	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)						actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						AATTGCGAGGTAACCGGCCGG	0.562			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												.		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	1	Unknown(1)	lung(1)	c.114+2T>G						.						35.0	25.0	29.0					22																	30000103		2202	4299	6501	SO:0001630	splice_region_variant	4771	exon1	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	GCGAGGTAACCGG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.114+2T>G	22.37:g.30000103T>G		Somatic	7	0		WXS	Illumina HiSeq	Phase_I	17	15	NM_016418	0	0	0	5	5	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Splice_Site	SNP	ENST00000338641.4	37	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.472138	0.84533	.	.	ENSG00000186575	ENST00000413209;ENST00000347330;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0321	0.71717	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF2	28330103	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	5.795000	0.69074	2.034000	0.60081	0.459000	0.35465	.	.		0.562	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	Intron
TOMM22	56993	bcgsc.ca	37	22	39077991	39077991	+	Missense_Mutation	SNP	C	C	G	rs202201801		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:39077991C>G	ENST00000216034.4	+	1	39	c.8C>G	c.(7-9)gCc>gGc	p.A3G	RP3-508I15.9_ENST00000412067.1_RNA|RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.9_ENST00000444381.1_RNA	NM_020243.4	NP_064628.1	Q9NS69	TOM22_HUMAN	translocase of outer mitochondrial membrane 22 homolog (yeast)	3					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			large_intestine(1)|lung(2)	3	Melanoma(58;0.04)					GTCATGGCTGCCGCCGTCGCT	0.687																																					p.A3G													.	TOMM22-90	0			c.C8G						.						10.0	11.0	11.0					22																	39077991		2084	4144	6228	SO:0001583	missense	56993	exon1			TGGCTGCCGCCGT	AB040119	CCDS13975.1	22q12-q13	2010-07-29			ENSG00000100216	ENSG00000100216			18002	protein-coding gene	gene with protein product		607046				10982837, 10900208	Standard	NM_020243		Approved	TOM22	uc003awe.3	Q9NS69	OTTHUMG00000150991	ENST00000216034.4:c.8C>G	22.37:g.39077991C>G	ENSP00000216034:p.Ala3Gly	Somatic	24	0		WXS	Illumina HiSeq	Phase_1	37	22	NM_020243	0	0	5	5	0		Missense_Mutation	SNP	ENST00000216034.4	37	CCDS13975.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.672939	0.67928	.	.	ENSG00000100216	ENST00000216034	.	.	.	5.45	5.45	0.79879	.	0.442965	0.23041	N	0.052601	T	0.74764	0.3759	L	0.53249	1.67	0.41960	D	0.990701	D	0.58970	0.984	D	0.65443	0.935	T	0.75051	-0.3454	9	0.51188	T	0.08	-3.4227	17.0498	0.86515	0.0:1.0:0.0:0.0	.	3	Q9NS69	TOM22_HUMAN	G	3	.	ENSP00000216034:A3G	A	+	2	0	TOMM22	37407937	0.987000	0.35691	0.985000	0.45067	0.560000	0.35617	1.717000	0.37991	2.547000	0.85894	0.655000	0.94253	GCC	C|0.998;G|0.002		0.687	TOMM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320842.1		
ADSL	158	bcgsc.ca	37	22	40750276	40750276	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:40750276G>T	ENST00000216194.7	+	4	483	c.427G>T	c.(427-429)Gcc>Tcc	p.A143S	ADSL_ENST00000342312.6_Missense_Mutation_p.A143S|ADSL_ENST00000454266.2_Missense_Mutation_p.A157S	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	143					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						CTCTCGGCTTGCCGACTTTGC	0.393																																					p.A143S	Colon(4;65 130 1097 1516)												.	ADSL-652	0			c.G427T						.						219.0	216.0	217.0					22																	40750276		2203	4300	6503	SO:0001583	missense	158	exon4			CGGCTTGCCGACT	X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.427G>T	22.37:g.40750276G>T	ENSP00000216194:p.Ala143Ser	Somatic	228	0		WXS	Illumina HiSeq	Phase_1	408	111	NM_001123378	0	0	79	81	2	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	ENST00000216194.7	37	CCDS14001.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398744	0.25205	.	.	ENSG00000239900	ENST00000216194;ENST00000425605;ENST00000454266;ENST00000342312	D;D;D	0.99329	-5.75;-5.75;-5.75	5.75	3.69	0.42338	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.096122	0.64402	D	0.000001	D	0.96269	0.8783	N	0.12920	0.275	0.80722	D	1	B;B;B;B	0.19200	0.01;0.006;0.034;0.034	B;B;B;B	0.32090	0.032;0.058;0.14;0.14	D	0.93579	0.6911	10	0.06365	T	0.9	-9.9191	11.5473	0.50700	0.1421:0.0:0.8579:0.0	.	157;143;143;143	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	S	143;157;157;143	ENSP00000216194:A143S;ENSP00000390107:A157S;ENSP00000341429:A143S	ENSP00000216194:A143S	A	+	1	0	ADSL	39080222	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	2.553000	0.45837	1.437000	0.47472	0.655000	0.94253	GCC	.		0.393	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321386.1	NM_000026	
EP300	2033	broad.mit.edu	37	22	41543893	41543893	+	Silent	SNP	G	G	A	rs187938527		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:41543893G>A	ENST00000263253.7	+	12	3403	c.2184G>A	c.(2182-2184)cgG>cgA	p.R728R		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	728					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TTGTACCCCGGCAAACCCCTC	0.478			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.R728R				Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300-2011	0			c.G2184A						.						105.0	98.0	101.0					22																	41543893		2203	4300	6503	SO:0001819	synonymous_variant	2033	exon12	Familial Cancer Database	Broad Thumb-Hallux syndrome	ACCCCGGCAAACC	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.2184G>A	22.37:g.41543893G>A		Somatic	82	1		WXS	Illumina HiSeq	Phase_I	191	7	NM_001429	0	0	26	26	0	B1AKC2	Silent	SNP	ENST00000263253.7	37	CCDS14010.1																																																																																			G|0.999;T|0.000		0.478	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
ALG12	79087	bcgsc.ca	37	22	50307356	50307356	+	Missense_Mutation	SNP	C	C	A	rs140468943		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:50307356C>A	ENST00000330817.6	-	2	331	c.58G>T	c.(58-60)Gta>Tta	p.V20L		NM_024105.3	NP_077010.1	Q9BV10	ALG12_HUMAN	ALG12, alpha-1,6-mannosyltransferase	20					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosyltransferase activity (GO:0000009)|dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity (GO:0052917)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(3)	12		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		ACAGTGGCTACGGCCACCAGC	0.602																																					p.V20L													.	ALG12-90	0			c.G58T						.						65.0	75.0	72.0					22																	50307356		2203	4300	6503	SO:0001583	missense	79087	exon2			TGGCTACGGCCAC	AJ303120	CCDS14081.1	22q13.33	2013-02-26	2013-02-26		ENSG00000182858	ENSG00000182858	2.4.1.260	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19358	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase"", ""dol-P-Man dependent alpha-1,6-mannosyltransferase"""	607144	"""asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)"", ""asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)"""			11983712	Standard	NM_024105		Approved	ECM39	uc003biy.3	Q9BV10	OTTHUMG00000150289	ENST00000330817.6:c.58G>T	22.37:g.50307356C>A	ENSP00000333813:p.Val20Leu	Somatic	113	0		WXS	Illumina HiSeq	Phase_1	209	66	NM_024105	0	0	12	12	0	A6PWM1|Q4KMH4|Q8NG10|Q96AA4	Missense_Mutation	SNP	ENST00000330817.6	37	CCDS14081.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127214	0.56721	.	.	ENSG00000182858	ENST00000330817	T	0.61742	0.08	5.43	4.41	0.53225	.	0.261145	0.38272	N	0.001746	T	0.47173	0.1431	L	0.38175	1.15	0.22851	N	0.998659	P	0.40230	0.708	B	0.40066	0.318	T	0.38286	-0.9668	10	0.21540	T	0.41	-25.6344	13.5786	0.61890	0.0:0.9253:0.0:0.0747	.	20	Q9BV10	ALG12_HUMAN	L	20	ENSP00000333813:V20L	ENSP00000333813:V20L	V	-	1	0	ALG12	48693360	0.022000	0.18835	0.009000	0.14445	0.553000	0.35397	2.480000	0.45206	2.550000	0.86006	0.655000	0.94253	GTA	C|1.000;T|0.000		0.602	ALG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317405.2	NM_024105	
TUBGCP6	85378	bcgsc.ca	37	22	50659571	50659571	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:50659571T>G	ENST00000248846.5	-	16	3321	c.3217A>C	c.(3217-3219)Acc>Ccc	p.T1073P	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.T1073P|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1073	9 X 27 AA tandem repeats.				G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.T1073P(1)		breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CGTGGCTGGGTGGGAGCCACA	0.612																																					p.T1073P													.	TUBGCP6-93	1	Substitution - Missense(1)	prostate(1)	c.A3217C						.						137.0	140.0	139.0					22																	50659571		2203	4300	6503	SO:0001583	missense	85378	exon16			GCTGGGTGGGAGC	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.3217A>C	22.37:g.50659571T>G	ENSP00000248846:p.Thr1073Pro	Somatic	183	0		WXS	Illumina HiSeq	Phase_1	427	129	NM_020461	0	0	19	21	2	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	T	3.495	-0.103133	0.06967	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.10860	3.23;2.83	4.62	-9.13	0.00704	.	0.915593	0.09290	N	0.822364	T	0.02342	0.0072	N	0.01576	-0.805	0.09310	N	1	B;B;B	0.14012	0.009;0.002;0.001	B;B;B	0.17098	0.017;0.006;0.003	T	0.39502	-0.9611	10	0.40728	T	0.16	.	1.5657	0.02604	0.1538:0.3054:0.1444:0.3964	.	1065;1073;1073	B2RWN4;Q96RT7;Q96RT7-3	.;GCP6_HUMAN;.	P	1073	ENSP00000248846:T1073P;ENSP00000397387:T1073P	ENSP00000248846:T1073P	T	-	1	0	TUBGCP6	49001698	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.000000	0.03693	-1.324000	0.02272	-1.178000	0.01721	ACC	.		0.612	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461	
CIDEC	63924	hgsc.bcm.edu	37	3	9911862	9911862	+	Missense_Mutation	SNP	G	G	C	rs201802471|rs368273807		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:9911862G>C	ENST00000336832.2	-	4	491	c.352C>G	c.(352-354)Ccc>Gcc	p.P118A	CIDEC_ENST00000443115.1_Intron|CIDEC_ENST00000383817.1_Intron|CIDEC_ENST00000455015.1_Missense_Mutation_p.P44A|CIDEC_ENST00000423850.1_Missense_Mutation_p.P44A|CIDEC_ENST00000430427.1_Missense_Mutation_p.P128A	NM_001199552.1|NM_001199623.1|NM_022094.3	NP_001186481.1|NP_001186552.1|NP_071377.2	Q96AQ7	CIDEC_HUMAN	cell death-inducing DFFA-like effector c	118	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|lipid particle organization (GO:0034389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	8	Medulloblastoma(99;0.227)					TCTGATGGGGGCTGCCATTTC	0.542																																					p.P131A		.											.	CIDEC-90	0			c.C391G						.						70.0	72.0	72.0					3																	9911862		2203	4300	6503	SO:0001583	missense	63924	exon4			ATGGGGGCTGCCA		CCDS2587.1, CCDS56239.1, CCDS74897.1	3p25	2004-07-26			ENSG00000187288	ENSG00000187288			24229	protein-coding gene	gene with protein product		612120				12429024	Standard	NM_001199623		Approved	CIDE-3, FLJ20871, Fsp27	uc021wsw.1	Q96AQ7	OTTHUMG00000128522	ENST00000336832.2:c.352C>G	3.37:g.9911862G>C	ENSP00000338642:p.Pro118Ala	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	367	90	NM_001199623	0	0	0	0	0	C9JMN7|Q67DW9|Q9GZY9	Missense_Mutation	SNP	ENST00000336832.2	37	CCDS2587.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265024	0.40095	.	.	ENSG00000187288	ENST00000336832;ENST00000455015;ENST00000423850;ENST00000430427	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.78	1.72	0.24424	Caspase-activated nuclease CIDE-N (2);	0.213000	0.49916	N	0.000130	T	0.47040	0.1424	M	0.71036	2.16	0.80722	D	1	B;B	0.33528	0.034;0.416	B;B	0.40506	0.026;0.331	T	0.33701	-0.9858	10	0.51188	T	0.08	-13.7547	5.8544	0.18712	0.2576:0.1378:0.6046:0.0	.	118;128	Q96AQ7;C9JMN7	CIDEC_HUMAN;.	A	118;44;44;128	ENSP00000338642:P118A;ENSP00000392975:P44A;ENSP00000400649:P44A;ENSP00000408631:P128A	ENSP00000338642:P118A	P	-	1	0	CIDEC	9886862	0.940000	0.31905	0.348000	0.25681	0.967000	0.64934	1.716000	0.37981	0.025000	0.15241	0.461000	0.40582	CCC	G|0.999;C|0.001		0.542	CIDEC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250334.1	NM_022094	
CTNNB1	1499	bcgsc.ca	37	3	41278119	41278119	+	Missense_Mutation	SNP	C	C	A	rs77750814		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:41278119C>A	ENST00000349496.5	+	13	2275	c.1995C>A	c.(1993-1995)gaC>gaA	p.D665E	CTNNB1_ENST00000405570.1_Missense_Mutation_p.D665E|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D658E|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D665E|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D665E	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	665					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.E632_S681>SV(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGTCTGAGGACAAGCCACAAG	0.458		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D665E	Colon(6;3 56 14213 18255)			Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	1	Complex - deletion inframe(1)	kidney(1)	c.C1995A						.						126.0	128.0	127.0					3																	41278119		2203	4300	6503	SO:0001583	missense	1499	exon13	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGAGGACAAGCCA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1995C>A	3.37:g.41278119C>A	ENSP00000344456:p.Asp665Glu	Somatic	158	1		WXS	Illumina HiSeq	Phase_1	55	26	NM_001098209	0	0	108	159	51	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977910	0.53720	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.68	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.46619	0.1402	M	0.72894	2.215	0.80722	D	1	B;B	0.29136	0.234;0.234	B;B	0.26517	0.07;0.07	T	0.45556	-0.9253	10	0.45353	T	0.12	-0.5531	11.6876	0.51497	0.0:0.8582:0.0:0.1418	.	593;665	B4DSW9;P35222	.;CTNB1_HUMAN	E	665;665;665;658;665	ENSP00000385604:D665E;ENSP00000379486:D665E;ENSP00000344456:D665E;ENSP00000411226:D658E;ENSP00000379488:D665E	ENSP00000344456:D665E	D	+	3	2	CTNNB1	41253123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.074000	0.41529	1.403000	0.46800	0.557000	0.71058	GAC	.		0.458	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
OR5H15	403274	hgsc.bcm.edu	37	3	97888448	97888448	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:97888448T>C	ENST00000356526.2	+	1	905	c.905T>C	c.(904-906)aTa>aCa	p.I302T		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						GTTTCATTCATAAAAATGTTA	0.303																																					p.I302T		.											.	OR5H15-92	0			c.T905C						.						42.0	45.0	44.0					3																	97888448		2180	4289	6469	SO:0001583	missense	403274	exon1			CATTCATAAAAAT		CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.905T>C	3.37:g.97888448T>C	ENSP00000373195:p.Ile302Thr	Somatic	39	2		WXS	Illumina HiSeq	Phase_I	11	2	NM_001005515	0	0	0	0	0		Missense_Mutation	SNP	ENST00000356526.2	37	CCDS33799.1	.	.	.	.	.	.	.	.	.	.	-	0.667	-0.803458	0.02841	.	.	ENSG00000233412	ENST00000356526;ENST00000454529	T	0.37915	1.17	2.48	-4.96	0.03038	.	1.714170	0.03383	N	0.200708	T	0.17831	0.0428	N	0.11698	0.16	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09640	-1.0665	10	0.48119	T	0.1	.	2.0532	0.03575	0.3751:0.1679:0.3455:0.1115	.	302	A6NDH6	O5H15_HUMAN	T	302	ENSP00000373195:I302T	ENSP00000373195:I302T	I	+	2	0	OR5H15	99371138	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.896000	0.04114	-1.963000	0.01013	-1.372000	0.01188	ATA	.		0.303	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1		
TMPRSS7	344805	bcgsc.ca	37	3	111780727	111780727	+	Missense_Mutation	SNP	C	C	A	rs200385589		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:111780727C>A	ENST00000452346.2	+	11	1407	c.1404C>A	c.(1402-1404)gaC>gaA	p.D468E	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.D342E			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	468	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						GGCTTTCAGACAAGCCACTTT	0.448																																					p.D342E													.	TMPRSS7-70	0			c.C1026A						.						98.0	100.0	100.0					3																	111780727		1908	4126	6034	SO:0001583	missense	344805	exon9			TTCAGACAAGCCA	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1404C>A	3.37:g.111780727C>A	ENSP00000398236:p.Asp468Glu	Somatic	100	1		WXS	Illumina HiSeq	Phase_1	28	10	NM_001042575	0	0	0	0	0	C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	ENST00000452346.2	37		.	.	.	.	.	.	.	.	.	.	C	12.86	2.064486	0.36470	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	T;T	0.34859	1.34;1.34	5.62	0.415	0.16411	CUB (1);	0.318108	0.32015	N	0.006704	T	0.14184	0.0343	N	0.04508	-0.205	0.30681	N	0.752324	B;B	0.15930	0.015;0.004	B;B	0.20767	0.031;0.006	T	0.09422	-1.0675	10	0.33141	T	0.24	.	5.4512	0.16566	0.0:0.3667:0.3826:0.2507	.	468;342	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	E	468;456;442;342	ENSP00000398236:D468E;ENSP00000411645:D342E	ENSP00000411645:D342E	D	+	3	2	TMPRSS7	113263417	1.000000	0.71417	0.978000	0.43139	0.784000	0.44337	0.723000	0.25939	0.051000	0.15978	0.557000	0.71058	GAC	.		0.448	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
DTX3L	151636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	122283388	122283388	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:122283388G>T	ENST00000296161.4	+	1	304	c.115G>T	c.(115-117)Ggg>Tgg	p.G39W	PARP9_ENST00000471785.1_5'Flank|PARP9_ENST00000492382.1_5'Flank|PARP9_ENST00000477522.2_5'UTR|PARP9_ENST00000360356.2_5'UTR|PARP9_ENST00000462315.1_5'Flank|DTX3L_ENST00000383661.3_Missense_Mutation_p.G39W	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	39					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		CTCGGGCGGCGGGGAGTGCAC	0.672																																					p.G39W		.											.	DTX3L-587	0			c.G115T						.						48.0	57.0	54.0					3																	122283388		2203	4299	6502	SO:0001583	missense	151636	exon1			GGCGGCGGGGAGT		CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.115G>T	3.37:g.122283388G>T	ENSP00000296161:p.Gly39Trp	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	365	62	NM_138287	0	0	13	19	6	B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	ENST00000296161.4	37	CCDS3015.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152626	0.57259	.	.	ENSG00000163840	ENST00000296161;ENST00000383661	T;T	0.69040	0.13;-0.37	4.59	4.59	0.56863	.	0.000000	0.47455	D	0.000228	T	0.81749	0.4888	M	0.80982	2.52	0.37919	D	0.931622	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86218	0.1629	10	0.87932	D	0	-25.6532	14.2431	0.65971	0.0:0.0:1.0:0.0	.	39;39	Q8TDB6-2;Q8TDB6	.;DTX3L_HUMAN	W	39	ENSP00000296161:G39W;ENSP00000373157:G39W	ENSP00000296161:G39W	G	+	1	0	DTX3L	123766078	1.000000	0.71417	1.000000	0.80357	0.039000	0.13416	5.884000	0.69729	2.342000	0.79632	0.655000	0.94253	GGG	.		0.672	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355966.1	NM_138287	
SLC12A8	84561	broad.mit.edu	37	3	124896700	124896700	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:124896700C>T	ENST00000393469.4	-	4	558	c.509G>A	c.(508-510)gGc>gAc	p.G170D	SLC12A8_ENST00000469902.1_Missense_Mutation_p.G170D|SLC12A8_ENST00000314584.7_5'UTR|SLC12A8_ENST00000423114.2_Missense_Mutation_p.G199D	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	170					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(12)	16						GAGGTTAATGCCCAGCAAGGC	0.542																																					p.G170D													.	SLC12A8-22	0			c.G509A						.						72.0	83.0	79.0					3																	124896700		2079	4211	6290	SO:0001583	missense	84561	exon5			TTAATGCCCAGCA		CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.509G>A	3.37:g.124896700C>T	ENSP00000377112:p.Gly170Asp	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	190	5	NM_024628	0	0	8	8	0	C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Missense_Mutation	SNP	ENST00000393469.4	37	CCDS43143.1	.	.	.	.	.	.	.	.	.	.	c	19.18	3.777697	0.70107	.	.	ENSG00000221955	ENST00000393469;ENST00000423114;ENST00000469902	D;D;D	0.98876	-5.2;-5.2;-5.2	5.64	5.64	0.86602	Amino acid permease domain (1);	.	.	.	.	D	0.99064	0.9679	M	0.77712	2.385	0.80722	D	1	D;P;D	0.89917	1.0;0.86;0.988	D;P;P	0.97110	1.0;0.661;0.863	D	0.99705	1.1005	9	0.51188	T	0.08	.	17.8866	0.88856	0.0:1.0:0.0:0.0	.	62;199;170	B5MDT1;A0AV02-2;A0AV02	.;.;S12A8_HUMAN	D	170;199;170	ENSP00000377112:G170D;ENSP00000404243:G199D;ENSP00000418783:G170D	ENSP00000377112:G170D	G	-	2	0	SLC12A8	126379390	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.467000	0.80930	2.668000	0.90789	0.551000	0.68910	GGC	.		0.542	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355711.4	NM_024628	
SEC61A1	29927	bcgsc.ca	37	3	127774579	127774579	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:127774579C>T	ENST00000243253.3	+	4	389	c.205C>T	c.(205-207)Cta>Tta	p.L69L	SEC61A1_ENST00000424880.2_Intron|SEC61A1_ENST00000464451.1_Silent_p.L75L	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	69					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						GAGAGTGATTCTAGCCTCTAA	0.433																																					p.L69L													.	SEC61A1-91	0			c.C205T						.						134.0	127.0	130.0					3																	127774579		2203	4300	6503	SO:0001819	synonymous_variant	29927	exon4			GTGATTCTAGCCT	AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.205C>T	3.37:g.127774579C>T		Somatic	150	1		WXS	Illumina HiSeq	Phase_1	116	41	NM_013336	0	0	191	206	15	P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Silent	SNP	ENST00000243253.3	37	CCDS3046.1																																																																																			.		0.433	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356541.2	NM_013336	
CDV3	55573	bcgsc.ca	37	3	133306868	133306868	+	Missense_Mutation	SNP	G	G	C	rs558085907	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:133306868G>C	ENST00000264993.3	+	5	1070	c.755G>C	c.(754-756)aGc>aCc	p.S252T	CDV3_ENST00000515421.1_Intron|CDV3_ENST00000420115.2_3'UTR|CDV3_ENST00000508481.1_Missense_Mutation_p.S150T	NM_001134422.1|NM_001282763.1|NM_017548.4	NP_001127894.1|NP_001269692.1|NP_060018.1	Q9UKY7	CDV3_HUMAN	CDV3 homolog (mouse)	252					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)				kidney(3)|lung(1)|prostate(1)	5						AATCAGAAAAGCAGCCACTCA	0.423																																					p.S252T													.	CDV3-90	0			c.G755C						.						80.0	81.0	81.0					3																	133306868		2203	4300	6503	SO:0001583	missense	55573	exon5			AGAAAAGCAGCCA	AK096865	CCDS3079.1, CCDS46917.1, CCDS46918.1, CCDS75013.1, CCDS75014.1, CCDS75015.1	3q22.1	2008-02-05			ENSG00000091527	ENSG00000091527			26928	protein-coding gene	gene with protein product						10497265	Standard	NM_017548		Approved	H41	uc003epq.3	Q9UKY7	OTTHUMG00000159764	ENST00000264993.3:c.755G>C	3.37:g.133306868G>C	ENSP00000264993:p.Ser252Thr	Somatic	84	0		WXS	Illumina HiSeq	Phase_1	43	19	NM_017548	0	0	99	102	3	B3KUC2|Q96IP9	Missense_Mutation	SNP	ENST00000264993.3	37	CCDS3079.1	.	.	.	.	.	.	.	.	.	.	G	9.924	1.212860	0.22289	.	.	ENSG00000091527	ENST00000264993;ENST00000508481	.	.	.	5.51	2.55	0.30701	.	0.753004	0.12282	N	0.482767	T	0.39091	0.1065	L	0.29908	0.895	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.10109	-1.0644	9	0.08599	T	0.76	.	7.81	0.29226	0.1491:0.1339:0.717:0.0	.	252	Q9UKY7	CDV3_HUMAN	T	252;150	.	ENSP00000264993:S252T	S	+	2	0	CDV3	134789558	1.000000	0.71417	0.905000	0.35620	0.998000	0.95712	2.344000	0.44010	0.683000	0.31428	0.650000	0.86243	AGC	.		0.423	CDV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357203.1	NM_017548	
PCOLCE2	26577	hgsc.bcm.edu	37	3	142607735	142607735	+	Silent	SNP	T	T	G	rs202134327	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:142607735T>G	ENST00000295992.3	-	1	310	c.4A>C	c.(4-6)Agg>Cgg	p.R2R	PCOLCE2_ENST00000461818.1_5'UTR|PCOLCE2_ENST00000485766.1_Silent_p.R2R	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	2					positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						TTCGCGCCCCTCATGGCAGCG	0.741													T|||	30	0.00599042	0.0227	0.0	5008	,	,		11668	0.0		0.0	False		,,,				2504	0.0				p.R2R		.											.	PCOLCE2-93	0			c.A4C						.	T		39,4315		0,39,2138	14.0	21.0	18.0		4	2.3	1.0	3		18	0,8542		0,0,4271	no	coding-synonymous	PCOLCE2	NM_013363.3		0,39,6409	GG,GT,TT		0.0,0.8957,0.3024		2/416	142607735	39,12857	2177	4271	6448	SO:0001819	synonymous_variant	26577	exon1			CGCCCCTCATGGC	AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.4A>C	3.37:g.142607735T>G		Somatic	2	1		WXS	Illumina HiSeq	Phase_I	40	18	NM_013363	0	0	1	1	0	B2RCH9|D3DNG4|Q9BRH3	Silent	SNP	ENST00000295992.3	37	CCDS3127.1																																																																																			T|0.993;G|0.007		0.741	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363	
GPR149	344758	bcgsc.ca	37	3	154055935	154055935	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:154055935A>G	ENST00000389740.2	-	4	1848	c.1749T>C	c.(1747-1749)acT>acC	p.T583T		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	583					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TAGAGGCTGGAGTTATTTTTT	0.448																																					p.T583T													.	GPR149-96	0			c.T1749C						.						140.0	141.0	141.0					3																	154055935		1849	4088	5937	SO:0001819	synonymous_variant	344758	exon4			GGCTGGAGTTATT	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1749T>C	3.37:g.154055935A>G		Somatic	206	0		WXS	Illumina HiSeq	Phase_1	90	26	NM_001038705	0	0	0	0	0		Silent	SNP	ENST00000389740.2	37	CCDS43162.1																																																																																			.		0.448	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580	
PSMD2	5708	hgsc.bcm.edu	37	3	184019770	184019770	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:184019770C>T	ENST00000310118.4	+	5	1173	c.615C>T	c.(613-615)tgC>tgT	p.C205C	PSMD2_ENST00000435761.1_Silent_p.C46C|EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000439383.1_Silent_p.C75C	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	205					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	ATGAGGCTTGCGACCTGCTTA	0.507																																					p.C205C	Colon(24;313 636 6917 9932 15554)	.											.	PSMD2-90	0			c.C615T						.						115.0	106.0	109.0					3																	184019770		2203	4300	6503	SO:0001819	synonymous_variant	5708	exon5			GGCTTGCGACCTG	AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.615C>T	3.37:g.184019770C>T		Somatic	114	2		WXS	Illumina HiSeq	Phase_I	184	11	NM_002808	0	1	149	150	0	B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Silent	SNP	ENST00000310118.4	37	CCDS3258.1																																																																																			.		0.507	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345843.1	NM_002808	
FAM43A	131583	hgsc.bcm.edu	37	3	194408136	194408136	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:194408136A>G	ENST00000329759.4	+	1	1515	c.581A>G	c.(580-582)aAc>aGc	p.N194S		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	194										breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		ACGTCGGCCAACGCGCTGGCG	0.672																																					p.N194S		.											.	FAM43A-90	0			c.A581G						.						5.0	4.0	4.0					3																	194408136		2020	3974	5994	SO:0001583	missense	131583	exon1			CGGCCAACGCGCT	AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.581A>G	3.37:g.194408136A>G	ENSP00000371397:p.Asn194Ser	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	24	5	NM_153690	0	0	5	13	8	A3KME2|Q8IXP4|Q8WZ07	Missense_Mutation	SNP	ENST00000329759.4	37	CCDS33923.1	.	.	.	.	.	.	.	.	.	.	A	8.875	0.950325	0.18431	.	.	ENSG00000185112	ENST00000329759	T	0.62364	0.03	5.07	3.85	0.44370	Pleckstrin homology-type (1);	0.222998	0.44688	D	0.000422	T	0.40119	0.1104	N	0.13098	0.295	0.31328	N	0.685214	B	0.33171	0.4	B	0.33960	0.173	T	0.40403	-0.9565	10	0.07644	T	0.81	-38.1095	12.0384	0.53438	0.8111:0.1889:0.0:0.0	.	194	Q8N2R8	FA43A_HUMAN	S	194	ENSP00000371397:N194S	ENSP00000371397:N194S	N	+	2	0	FAM43A	195889425	0.999000	0.42202	1.000000	0.80357	0.903000	0.53119	3.528000	0.53524	1.913000	0.55393	0.379000	0.24179	AAC	.		0.672	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342734.1	NM_153690	
FAM193A	8603	bcgsc.ca	37	4	2674038	2674038	+	Missense_Mutation	SNP	A	A	C	rs201152034		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:2674038A>C	ENST00000324666.5	+	11	1748	c.1397A>C	c.(1396-1398)cAc>cCc	p.H466P	FAM193A_ENST00000545951.1_Missense_Mutation_p.H466P|FAM193A_ENST00000505311.1_Missense_Mutation_p.H466P|FAM193A_ENST00000382839.3_Missense_Mutation_p.H466P|FAM193A_ENST00000502458.1_Missense_Mutation_p.H488P	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	466										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						ACTGTTCCACACCTGCCACGC	0.552																																					p.H488P													.	FAM193A-93	0			c.A1463C						.						144.0	100.0	115.0					4																	2674038		2203	4300	6503	SO:0001583	missense	8603	exon12			TTCCACACCTGCC	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.1397A>C	4.37:g.2674038A>C	ENSP00000324587:p.His466Pro	Somatic	63	4		WXS	Illumina HiSeq	Phase_1	69	37	NM_001256667	0	0	7	8	1	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.048080	0.75846	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	4.82	4.82	0.62117	.	0.061911	0.64402	D	0.000004	T	0.44850	0.1313	L	0.54323	1.7	0.58432	D	0.999998	D;D;D;D;D	0.69078	0.997;0.995;0.997;0.997;0.997	D;D;D;D;D	0.80764	0.994;0.984;0.994;0.994;0.994	T	0.30416	-0.9979	10	0.42905	T	0.14	-25.7798	13.8593	0.63550	1.0:0.0:0.0:0.0	.	466;488;466;488;466	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	P	466;466;466;488;320	ENSP00000372290:H466P;ENSP00000324587:H466P;ENSP00000443617:H466P;ENSP00000427505:H488P;ENSP00000427260:H320P	ENSP00000324587:H466P	H	+	2	0	FAM193A	2643836	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.875000	0.87205	1.920000	0.55613	0.528000	0.53228	CAC	.		0.552	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704	
OTOP1	133060	hgsc.bcm.edu	37	4	4228479	4228479	+	Missense_Mutation	SNP	G	G	C	rs199890951		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:4228479G>C	ENST00000296358.4	-	1	137	c.113C>G	c.(112-114)tCc>tGc	p.S38C		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	38					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ggATTCCGGGGACCTCGGGGC	0.746																																					p.S38C		.											.	OTOP1-92	0			c.C113G						.						3.0	3.0	3.0					4																	4228479		1773	3481	5254	SO:0001583	missense	133060	exon1			TCCGGGGACCTCG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.113C>G	4.37:g.4228479G>C	ENSP00000296358:p.Ser38Cys	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	11	3	NM_177998	0	0	0	0	0	A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	G	7.656	0.683978	0.14907	.	.	ENSG00000163982	ENST00000296358	T	0.08896	3.04	2.01	0.00709	0.14069	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	P	0.52463	0.953	B	0.31390	0.129	T	0.44559	-0.9320	9	0.49607	T	0.09	-0.0197	7.5462	0.27768	0.0:0.5332:0.4668:0.0	.	38	Q7RTM1	OTOP1_HUMAN	C	38	ENSP00000296358:S38C	ENSP00000296358:S38C	S	-	2	0	OTOP1	4279380	0.001000	0.12720	0.002000	0.10522	0.057000	0.15508	0.411000	0.21115	-0.016000	0.14127	-0.472000	0.04984	TCC	.		0.746	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
ACOX3	8310	bcgsc.ca	37	4	8383307	8383307	+	Missense_Mutation	SNP	A	A	C	rs200650508		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:8383307A>C	ENST00000356406.5	-	14	1642	c.1565T>G	c.(1564-1566)gTt>gGt	p.V522G	ACOX3_ENST00000503233.1_Missense_Mutation_p.V522G|ACOX3_ENST00000413009.2_Missense_Mutation_p.V522G	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	522					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						CAGGTAGCAAACCAGCCACTT	0.438																																					p.V522G													.	ACOX3-90	0			c.T1565G						.						86.0	95.0	92.0					4																	8383307		2203	4300	6503	SO:0001583	missense	8310	exon14			TAGCAAACCAGCC	Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.1565T>G	4.37:g.8383307A>C	ENSP00000348775:p.Val522Gly	Somatic	66	0		WXS	Illumina HiSeq	Phase_1	235	187	NM_001101667	0	0	14	15	1	Q96AJ8	Missense_Mutation	SNP	ENST00000356406.5	37	CCDS3401.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.366704	0.82463	.	.	ENSG00000087008	ENST00000413009;ENST00000356406;ENST00000503233	T;T;T	0.46819	0.86;0.86;0.86	4.96	4.96	0.65561	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.72550	0.3474	M	0.89904	3.07	0.80722	D	1	D;D;D	0.63880	0.993;0.991;0.993	D;D;D	0.69142	0.962;0.949;0.962	T	0.79325	-0.1850	10	0.87932	D	0	-39.6665	13.7232	0.62740	1.0:0.0:0.0:0.0	.	522;522;522	B2R856;O15254-2;O15254	.;.;ACOX3_HUMAN	G	522	ENSP00000413994:V522G;ENSP00000348775:V522G;ENSP00000421625:V522G	ENSP00000348775:V522G	V	-	2	0	ACOX3	8434207	1.000000	0.71417	0.984000	0.44739	0.980000	0.70556	7.111000	0.77077	2.083000	0.62718	0.533000	0.62120	GTT	A|0.999;C|0.001		0.438	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206997.4		
LGI2	55203	bcgsc.ca	37	4	25005443	25005443	+	Missense_Mutation	SNP	A	A	C	rs77736957		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:25005443A>C	ENST00000382114.4	-	8	1453	c.1268T>G	c.(1267-1269)gTg>gGg	p.V423G		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	423						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				GAAGCTCTTCACAGCCAGTAC	0.532																																					p.V423G													.	LGI2-90	0			c.T1268G						.						217.0	225.0	222.0					4																	25005443		2203	4300	6503	SO:0001583	missense	55203	exon8			CTCTTCACAGCCA	AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.1268T>G	4.37:g.25005443A>C	ENSP00000371548:p.Val423Gly	Somatic	405	0		WXS	Illumina HiSeq	Phase_1	298	73	NM_018176	0	0	0	0	0	Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Missense_Mutation	SNP	ENST00000382114.4	37	CCDS3431.1	.	.	.	.	.	.	.	.	.	.	A	19.30	3.801055	0.70567	.	.	ENSG00000153012	ENST00000382114;ENST00000282970	D	0.83914	-1.78	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.89791	0.6817	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90847	0.4728	10	0.87932	D	0	-25.8133	15.7705	0.78164	1.0:0.0:0.0:0.0	.	423	Q8N0V4	LGI2_HUMAN	G	423;71	ENSP00000371548:V423G	ENSP00000282970:V71G	V	-	2	0	LGI2	24614541	1.000000	0.71417	0.997000	0.53966	0.716000	0.41182	9.339000	0.96797	2.116000	0.64780	0.455000	0.32223	GTG	.		0.532	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214978.1		
SLAIN2	57606	broad.mit.edu	37	4	48422364	48422364	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:48422364G>A	ENST00000264313.6	+	7	2001	c.1583G>A	c.(1582-1584)gGg>gAg	p.G528E	SLAIN2_ENST00000512093.1_Missense_Mutation_p.G361E	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	528					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						AGACCTGCAGGGACAACTGCA	0.557																																					p.G528E													.	.	0			c.G1583A						.						133.0	134.0	134.0					4																	48422364		2038	4203	6241	SO:0001583	missense	57606	exon7			CTGCAGGGACAAC	BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.1583G>A	4.37:g.48422364G>A	ENSP00000264313:p.Gly528Glu	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	160	4	NM_020846	0	0	41	41	0	A8K4P1|Q8N5R3	Missense_Mutation	SNP	ENST00000264313.6	37	CCDS47051.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592341	0.46214	.	.	ENSG00000109171	ENST00000264313;ENST00000512093	.	.	.	4.87	4.87	0.63330	.	0.182928	0.47455	D	0.000235	T	0.65026	0.2652	L	0.49778	1.585	0.43313	D	0.995324	D	0.65815	0.995	P	0.58721	0.844	T	0.65207	-0.6224	9	0.45353	T	0.12	-8.1445	12.6914	0.56976	0.0:0.0:0.8349:0.1651	.	528	Q9P270	SLAI2_HUMAN	E	528;361	.	ENSP00000264313:G528E	G	+	2	0	SLAIN2	48117121	1.000000	0.71417	1.000000	0.80357	0.126000	0.20510	6.329000	0.72920	2.275000	0.75901	0.557000	0.71058	GGG	.		0.557	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365807.4	NM_020846	
LPHN3	23284	bcgsc.ca	37	4	62542580	62542580	+	Silent	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:62542580T>G	ENST00000514591.1	+	5	635	c.306T>G	c.(304-306)ggT>ggG	p.G102G	LPHN3_ENST00000504896.1_Silent_p.G102G|LPHN3_ENST00000506746.1_Silent_p.G170G|LPHN3_ENST00000508946.1_Silent_p.G102G|LPHN3_ENST00000508693.1_Silent_p.G170G|LPHN3_ENST00000506700.1_Silent_p.G102G|LPHN3_ENST00000512091.2_Silent_p.G102G|LPHN3_ENST00000506720.1_Silent_p.G170G|LPHN3_ENST00000514157.1_Silent_p.G102G|LPHN3_ENST00000509896.1_Silent_p.G170G|LPHN3_ENST00000545650.1_Silent_p.G102G|LPHN3_ENST00000507625.1_Silent_p.G170G|LPHN3_ENST00000507164.1_Silent_p.G170G|LPHN3_ENST00000514996.1_Silent_p.G102G|LPHN3_ENST00000511324.1_Silent_p.G170G			Q9HAR2	LPHN3_HUMAN	latrophilin 3	102	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TGGTGGCAGGTCCTGATGTTT	0.383																																					p.G102G													.	LPHN3-508	0			c.T306G						.						229.0	229.0	229.0					4																	62542580		1975	4191	6166	SO:0001819	synonymous_variant	23284	exon3			GGCAGGTCCTGAT	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.306T>G	4.37:g.62542580T>G		Somatic	238	1		WXS	Illumina HiSeq	Phase_1	36	19	NM_015236	0	0	1	1	0	E9PE04|O94867|Q9NWK5	Silent	SNP	ENST00000514591.1	37	CCDS54768.1																																																																																			.		0.383	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
CFI	3426	bcgsc.ca	37	4	110670458	110670458	+	Missense_Mutation	SNP	A	A	C	rs199838992		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:110670458A>C	ENST00000394634.2	-	10	1271	c.1064T>G	c.(1063-1065)gTg>gGg	p.V355G	CFI_ENST00000512148.1_Missense_Mutation_p.V348G|CFI_ENST00000394635.3_Missense_Mutation_p.V363G	NM_000204.3	NP_000195	P05156	CFAI_HUMAN	complement factor I	355	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|skin(2)|stomach(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		CTTAATTGCCACCTGCCATGG	0.453																																					p.V355G													.	CFI-90	0			c.T1064G						.						146.0	152.0	150.0					4																	110670458		2203	4300	6503	SO:0001583	missense	3426	exon10			ATTGCCACCTGCC	J02770	CCDS34049.1	4q25	2014-09-17	2006-02-10	2006-02-10		ENSG00000205403	3.4.21.45	"""Complement system"""	5394	protein-coding gene	gene with protein product	"""Konglutinogen-activating factor"", ""C3b-inactivator"""	217030	"""I factor (complement)"""	IF		2956252	Standard	NM_000204		Approved	FI, C3b-INA, KAF	uc003hzr.4	P05156		ENST00000394634.2:c.1064T>G	4.37:g.110670458A>C	ENSP00000378130:p.Val355Gly	Somatic	280	5		WXS	Illumina HiSeq	Phase_1	221	103	NM_000204	0	0	266	343	77	O60442	Missense_Mutation	SNP	ENST00000394634.2	37	CCDS34049.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.081198	0.76528	.	.	ENSG00000205403	ENST00000394635;ENST00000394634;ENST00000512148	D;D;D	0.95853	-3.83;-3.83;-3.83	5.71	5.71	0.89125	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.182235	0.47093	D	0.000259	D	0.97679	0.9239	M	0.85197	2.74	0.80722	D	1	D;P;D	0.76494	0.997;0.521;0.999	D;P;D	0.69824	0.955;0.508;0.966	D	0.98427	1.0580	10	0.87932	D	0	-6.8988	14.5977	0.68419	1.0:0.0:0.0:0.0	.	363;348;355	E7ETH0;G3XAM2;P05156	.;.;CFAI_HUMAN	G	363;355;348	ENSP00000378131:V363G;ENSP00000378130:V355G;ENSP00000427438:V348G	ENSP00000378130:V355G	V	-	2	0	CFI	110889907	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.606000	0.82863	2.178000	0.69098	0.524000	0.50904	GTG	A|0.999;C|0.001		0.453	CFI-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_000204	
NEUROG2	63973	hgsc.bcm.edu	37	4	113436466	113436466	+	Missense_Mutation	SNP	C	C	G	rs200923931	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:113436466C>G	ENST00000313341.3	-	2	492	c.166G>C	c.(166-168)Ggg>Cgg	p.G56R	RP11-402J6.1_ENST00000506057.1_RNA|RP11-402J6.1_ENST00000504009.1_RNA	NM_024019.3	NP_076924.1	Q9H2A3	NGN2_HUMAN	neurogenin 2	56					axon guidance (GO:0007411)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(6)|skin(2)	12		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00168)		gcctcagccccgcgctgccga	0.776													C|||	25	0.00499201	0.0166	0.0029	5008	,	,		8213	0.0		0.001	False		,,,				2504	0.0				p.G56R		.											.	NEUROG2-92	0			c.G166C						.						3.0	4.0	4.0					4																	113436466		1749	3372	5121	SO:0001583	missense	63973	exon2			CAGCCCCGCGCTG	AF303002	CCDS3698.1	4q25	2013-05-21			ENSG00000178403	ENSG00000178403		"""Basic helix-loop-helix proteins"""	13805	protein-coding gene	gene with protein product		606624					Standard	NM_024019		Approved	Atoh4, Math4A, ngn-2, bHLHa8, NGN2	uc003ias.3	Q9H2A3	OTTHUMG00000132907	ENST00000313341.3:c.166G>C	4.37:g.113436466C>G	ENSP00000317333:p.Gly56Arg	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	26	17	NM_024019	0	0	0	0	0	Q8N416	Missense_Mutation	SNP	ENST00000313341.3	37	CCDS3698.1	8	0.003663003663003663	8	0.016260162601626018	0	0.0	0	0.0	0	0.0	C	3.865	-0.029028	0.07589	.	.	ENSG00000178403	ENST00000313341	D	0.90620	-2.7	3.36	1.47	0.22746	.	.	.	.	.	T	0.67088	0.2856	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.59773	-0.7391	9	0.16896	T	0.51	-5.8759	5.1708	0.15108	0.2372:0.5317:0.2311:0.0	.	56	Q9H2A3	NGN2_HUMAN	R	56	ENSP00000317333:G56R	ENSP00000317333:G56R	G	-	1	0	NEUROG2	113655915	0.000000	0.05858	0.030000	0.17652	0.080000	0.17528	0.492000	0.22435	1.729000	0.51567	0.306000	0.20318	GGG	C|0.996;G|0.004		0.776	NEUROG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256414.1	NM_024019	
ANK2	287	bcgsc.ca	37	4	114275831	114275831	+	Missense_Mutation	SNP	G	G	C	rs201005444		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:114275831G>C	ENST00000357077.4	+	38	6110	c.6057G>C	c.(6055-6057)aaG>aaC	p.K2019N	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.K1986N|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2019					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CAAAACAAAAGCAGCCACAAG	0.438																																					p.K2019N													.	ANK2-583	0			c.G6057C						.						43.0	50.0	47.0					4																	114275831		2197	4299	6496	SO:0001583	missense	287	exon38			ACAAAAGCAGCCA	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6057G>C	4.37:g.114275831G>C	ENSP00000349588:p.Lys2019Asn	Somatic	91	0		WXS	Illumina HiSeq	Phase_1	68	32	NM_001148	0	0	1	1	0	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.519176	0.44866	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.69806	-0.42;-0.43	5.53	0.508	0.16972	.	0.000000	0.64402	D	0.000016	T	0.73171	0.3553	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.994;0.997	T	0.68100	-0.5498	9	.	.	.	.	6.1849	0.20491	0.4325:0.0:0.4502:0.1173	.	1986;2019	Q01484;Q01484-4	ANK2_HUMAN;.	N	2019;1986	ENSP00000349588:K2019N;ENSP00000264366:K1986N	.	K	+	3	2	ANK2	114495280	0.770000	0.28543	0.525000	0.27900	0.799000	0.45148	0.923000	0.28757	0.054000	0.16065	0.563000	0.77884	AAG	.		0.438	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
MAML3	55534	bcgsc.ca	37	4	140646955	140646955	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:140646955A>G	ENST00000509479.2	-	4	3222	c.2366T>C	c.(2365-2367)cTc>cCc	p.L789P	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					CTGTGGCTGGAGGTGCTGCCG	0.512																																					p.L785P													.	MAML3-455	0			c.T2354C						.						89.0	94.0	92.0					4																	140646955		2082	4228	6310	SO:0001583	missense	55534	exon5			GGCTGGAGGTGCT	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.2366T>C	4.37:g.140646955A>G	ENSP00000421180:p.Leu789Pro	Somatic	51	0		WXS	Illumina HiSeq	Phase_1	29	13	NM_018717	0	0	0	0	0		Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.41|11.41	1.631090|1.631090	0.28978|0.28978	.|.	.|.	ENSG00000196782|ENSG00000196782	ENST00000509479;ENST00000538400|ENST00000502696	T|.	0.22743|.	1.94|.	5.29|5.29	4.08|4.08	0.47627|0.47627	.|.	0.274240|.	0.31347|.	N|.	0.007812|.	T|T	0.64843|0.64843	0.2635|0.2635	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	B;B|.	0.10296|.	0.003;0.003|.	B;B|.	0.09377|.	0.004;0.004|.	T|T	0.62248|0.62248	-0.6894|-0.6894	9|5	.|.	.|.	.|.	.|.	11.2123|11.2123	0.48806|0.48806	0.9274:0.0:0.0726:0.0|0.9274:0.0:0.0726:0.0	.|.	789;785|.	E7EVW8;Q96JK9|.	.;MAML3_HUMAN|.	P|P	789;96|133	ENSP00000421180:L789P|.	.|.	L|S	-|-	2|1	0|0	MAML3|MAML3	140866405|140866405	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	2.384000|2.384000	0.44362|0.44362	0.821000|0.821000	0.34540|0.34540	0.533000|0.533000	0.62120|0.62120	CTC|TCC	.		0.512	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
TBC1D9	23158	broad.mit.edu	37	4	141580761	141580761	+	Nonsense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:141580761G>C	ENST00000442267.2	-	11	1976	c.1902C>G	c.(1900-1902)taC>taG	p.Y634*		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	634	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TGGTGTTGTAGTAATCTGGGA	0.458																																					p.Y634X													.	TBC1D9-23	0			c.C1902G						.						59.0	60.0	60.0					4																	141580761		2054	4210	6264	SO:0001587	stop_gained	23158	exon11			GTTGTAGTAATCT	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.1902C>G	4.37:g.141580761G>C	ENSP00000411197:p.Tyr634*	Somatic	17	0		WXS	Illumina HiSeq	Phase_I	5	2	NM_015130	0	0	19	19	0	A6H8U8|D3DNZ1|O94958	Nonsense_Mutation	SNP	ENST00000442267.2	37	CCDS47136.1	.	.	.	.	.	.	.	.	.	.	G	39	7.814800	0.98504	.	.	ENSG00000109436	ENST00000442267	.	.	.	5.62	4.78	0.61160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.5126	0.67797	0.0702:0.0:0.9297:0.0	.	.	.	.	X	634	.	ENSP00000411197:Y634X	Y	-	3	2	TBC1D9	141800211	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.869000	0.99810	1.370000	0.46153	0.655000	0.94253	TAC	.		0.458	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
PDCD6	10016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	311485	311485	+	Missense_Mutation	SNP	G	G	A	rs368897410		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:311485G>A	ENST00000264933.4	+	5	545	c.445G>A	c.(445-447)Gac>Aac	p.D149N	AHRR_ENST00000505113.1_Intron|PDCD6_ENST00000505221.1_Intron|AHRR_ENST00000316418.5_Intron|AHRR_ENST00000512529.1_Intron|PDCD6_ENST00000507528.1_Missense_Mutation_p.D147N|PDCD6_ENST00000511482.1_3'UTR	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	149	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			GATTGCCTTCGACGACTTCAT	0.582																																					p.D149N		.											.	PDCD6-290	0			c.G445A						.	G	,ASN/ASP,	1,4405	2.1+/-5.4	0,1,2202	92.0	76.0	81.0		,445,	5.7	0.9	5		81	0,8600		0,0,4300	no	intron,missense,intron	PDCD6,AHRR	NM_001242412.1,NM_013232.3,NM_020731.4	,23,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,probably-damaging,	,149/192,	311485	1,13005	2203	4300	6503	SO:0001583	missense	10016	exon5			GCCTTCGACGACT	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.445G>A	5.37:g.311485G>A	ENSP00000264933:p.Asp149Asn	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	163	44	NM_013232	0	0	162	162	0	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000264933.4	37	CCDS3854.1	.	.	.	.	.	.	.	.	.	.	g	36	5.640171	0.96693	2.27E-4	0.0	ENSG00000249915	ENST00000264933;ENST00000507528;ENST00000507473	T;T;T	0.79141	1.36;1.36;-1.24	5.72	5.72	0.89469	EF-hand-like domain (1);	.	.	.	.	D	0.88789	0.6532	M	0.82132	2.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.89735	0.3929	9	0.87932	D	0	.	17.3651	0.87362	0.0:0.0:1.0:0.0	.	147;149	Q2YDC2;O75340	.;PDCD6_HUMAN	N	149;147;62	ENSP00000264933:D149N;ENSP00000423815:D147N;ENSP00000425370:D62N	ENSP00000264933:D149N	D	+	1	0	PDCD6	364485	1.000000	0.71417	0.914000	0.36105	0.835000	0.47333	9.347000	0.97059	2.692000	0.91855	0.655000	0.94253	GAC	.		0.582	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
NSUN2	54888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	6616902	6616902	+	Missense_Mutation	SNP	G	G	T	rs138724893		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:6616902G>T	ENST00000264670.6	-	9	1270	c.959C>A	c.(958-960)aCg>aAg	p.T320K	NSUN2_ENST00000539938.1_Missense_Mutation_p.T84K|NSUN2_ENST00000506139.1_Missense_Mutation_p.T285K	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	320					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)	p.T320M(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						TAGTGAACACGTGGAATACAC	0.468																																					p.T320K		.											.	NSUN2-91	1	Substitution - Missense(1)	prostate(1)	c.C959A						.						151.0	133.0	139.0					5																	6616902		2203	4300	6503	SO:0001583	missense	54888	exon9			GAACACGTGGAAT	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.959C>A	5.37:g.6616902G>T	ENSP00000264670:p.Thr320Lys	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	86	38	NM_017755	0	0	12	29	17	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	CCDS3869.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517699	0.85495	.	.	ENSG00000037474	ENST00000264670;ENST00000539938;ENST00000506139	T;T;T	0.26810	1.71;1.71;1.71	5.56	4.69	0.59074	Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (1);	0.092104	0.85682	D	0.000000	T	0.70133	0.3189	H	0.99507	4.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84435	0.0579	10	0.87932	D	0	-41.0989	14.8419	0.70233	0.0693:0.0:0.9307:0.0	.	285;320	B4DQW2;Q08J23	.;NSUN2_HUMAN	K	320;84;285	ENSP00000264670:T320K;ENSP00000444338:T84K;ENSP00000420957:T285K	ENSP00000264670:T320K	T	-	2	0	NSUN2	6669902	1.000000	0.71417	0.047000	0.18901	0.855000	0.48748	8.772000	0.91757	1.498000	0.48600	0.650000	0.86243	ACG	G|1.000;A|0.000		0.468	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
C5orf51	285636	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	41911262	41911262	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:41911262A>T	ENST00000381647.2	+	4	486	c.467A>T	c.(466-468)aAa>aTa	p.K156I	C5orf51_ENST00000505931.2_3'UTR	NM_175921.4	NP_787117.3	A6NDU8	CE051_HUMAN	chromosome 5 open reading frame 51	156										endometrium(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						CTCTTAAGAAAATCCAGTTTG	0.383																																					p.K156I													.	C5orf51-68	0			c.A467T						.						82.0	81.0	82.0					5																	41911262		2203	4300	6503	SO:0001583	missense	285636	exon4			TAAGAAAATCCAG	AL833916, AK094002	CCDS34151.1	5p13.1	2008-07-18			ENSG00000205765	ENSG00000205765			27750	protein-coding gene	gene with protein product						14702039	Standard	NM_175921		Approved	LOC285636	uc003jmo.3	A6NDU8	OTTHUMG00000162084	ENST00000381647.2:c.467A>T	5.37:g.41911262A>T	ENSP00000371061:p.Lys156Ile	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	11	7	NM_175921	0	0	4	8	4	A2RRM9	Missense_Mutation	SNP	ENST00000381647.2	37	CCDS34151.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.179632	0.78564	.	.	ENSG00000205765	ENST00000381647	D	0.83163	-1.69	5.7	5.7	0.88788	.	0.046992	0.85682	D	0.000000	D	0.84831	0.5559	N	0.24115	0.695	0.29480	N	0.856424	D	0.89917	1.0	D	0.71656	0.974	T	0.82432	-0.0460	10	0.72032	D	0.01	-7.918	14.5359	0.67960	1.0:0.0:0.0:0.0	.	156	A6NDU8	CE051_HUMAN	I	156	ENSP00000371061:K156I	ENSP00000371061:K156I	K	+	2	0	C5orf51	41947019	1.000000	0.71417	0.939000	0.37840	0.970000	0.65996	4.742000	0.62103	2.175000	0.68902	0.383000	0.25322	AAA	.		0.383	C5orf51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367144.1	NM_175921	
SV2C	22987	bcgsc.ca	37	5	75490896	75490896	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:75490896C>T	ENST00000502798.2	+	3	1175	c.733C>T	c.(733-735)Ctc>Ttc	p.L245F	SV2C_ENST00000322285.7_Missense_Mutation_p.L245F	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	245					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TGGCTTCTTTCTCTTCTGTCG	0.388																																					p.L245F													.	SV2C-91	0			c.C733T						.						335.0	316.0	322.0					5																	75490896		1860	4100	5960	SO:0001583	missense	22987	exon3			TTCTTTCTCTTCT	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.733C>T	5.37:g.75490896C>T	ENSP00000423541:p.Leu245Phe	Somatic	267	0		WXS	Illumina HiSeq	Phase_1	86	10	NM_014979	0	0	0	0	0	Q496K1|Q9UPU8	Missense_Mutation	SNP	ENST00000502798.2	37	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333761	0.81801	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.74106	-0.81;-0.81	5.27	5.27	0.74061	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.061421	0.64402	D	0.000002	D	0.86644	0.5982	M	0.77616	2.38	0.80722	D	1	D	0.67145	0.996	D	0.70716	0.97	D	0.87838	0.2649	10	0.72032	D	0.01	-28.5958	19.2542	0.93940	0.0:1.0:0.0:0.0	.	245	Q496J9	SV2C_HUMAN	F	245	ENSP00000423541:L245F;ENSP00000316983:L245F	ENSP00000316983:L245F	L	+	1	0	SV2C	75526652	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.880000	0.69698	2.617000	0.88574	0.655000	0.94253	CTC	.		0.388	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4		
BHMT	635	bcgsc.ca	37	5	78426877	78426877	+	Missense_Mutation	SNP	G	G	A	rs201007228		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:78426877G>A	ENST00000274353.5	+	8	1266	c.1159G>A	c.(1159-1161)Gaa>Aaa	p.E387K	BHMT_ENST00000524080.1_Missense_Mutation_p.E234K|DMGDH_ENST00000520388.1_Intron	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	387					amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.E387*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	GCAGCAGAAAGAAGCCACAAC	0.458																																					p.E387K													.	BHMT-91	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1159A						.						111.0	124.0	120.0					5																	78426877		2203	4300	6503	SO:0001583	missense	635	exon8			CAGAAAGAAGCCA	BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.1159G>A	5.37:g.78426877G>A	ENSP00000274353:p.Glu387Lys	Somatic	167	0		WXS	Illumina HiSeq	Phase_1	98	38	NM_001713	0	0	106	114	8	Q9UNI9	Missense_Mutation	SNP	ENST00000274353.5	37	CCDS4046.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.028421	0.93518	.	.	ENSG00000145692	ENST00000274353;ENST00000524080	T;T	0.36157	1.35;1.27	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.53562	0.1804	M	0.80616	2.505	0.80722	D	1	D;P	0.54207	0.965;0.907	P;B	0.49301	0.606;0.312	T	0.57860	-0.7738	10	0.48119	T	0.1	-14.6116	19.5116	0.95144	0.0:0.0:1.0:0.0	.	234;387	E5RJH0;Q93088	.;BHMT1_HUMAN	K	387;234	ENSP00000274353:E387K;ENSP00000428240:E234K	ENSP00000274353:E387K	E	+	1	0	BHMT	78462633	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.813000	0.99286	2.619000	0.88677	0.655000	0.94253	GAA	.		0.458	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226961.1	NM_001713	
SNCAIP	9627	bcgsc.ca	37	5	121776345	121776345	+	Missense_Mutation	SNP	C	C	T	rs200684003		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:121776345C>T	ENST00000261368.8	+	7	1580	c.1318C>T	c.(1318-1320)Ctt>Ttt	p.L440F	SNCAIP_ENST00000503116.2_Missense_Mutation_p.L487F|CTC-210G5.1_ENST00000509993.1_RNA|CTC-210G5.1_ENST00000510972.1_RNA|SNCAIP_ENST00000504884.2_3'UTR|SNCAIP_ENST00000261367.7_Missense_Mutation_p.L487F|CTC-210G5.1_ENST00000503529.1_RNA|SNCAIP_ENST00000542191.1_5'UTR|SNCAIP_ENST00000379533.2_Missense_Mutation_p.L487F|SNCAIP_ENST00000414317.2_Missense_Mutation_p.L42F|SNCAIP_ENST00000379536.2_Missense_Mutation_p.L380F|CTC-210G5.1_ENST00000506053.1_RNA|SNCAIP_ENST00000379538.3_Missense_Mutation_p.L74F	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	440					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TCTGTGGCTTCTTCAGTTTAT	0.423																																					p.L440F													.	SNCAIP-92	0			c.C1318T						.																																			SO:0001583	missense	9627	exon7			TGGCTTCTTCAGT	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1318C>T	5.37:g.121776345C>T	ENSP00000261368:p.Leu440Phe	Somatic	96	0		WXS	Illumina HiSeq	Phase_1	49	18	NM_005460	0	0	1	1	0	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	37	CCDS4131.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022509	0.93462	.	.	ENSG00000064692	ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000379538;ENST00000261367;ENST00000414317;ENST00000447854;ENST00000503116	T;T;T;T;T;T;T;T	0.72725	-0.67;-0.63;-0.63;-0.67;-0.67;-0.63;-0.22;-0.68	5.22	5.22	0.72569	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.86748	0.6007	M	0.87097	2.86	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.998;0.998;0.999;0.974;0.999;0.997;0.999;0.994;0.999	D	0.88628	0.3167	10	0.87932	D	0	-14.0135	18.9723	0.92719	0.0:1.0:0.0:0.0	.	380;68;42;487;380;74;74;487;440	D6R9G8;Q9NVG1;B7Z995;Q9Y6H5-6;Q9Y6H5-4;Q9Y6H5-5;Q9Y6H5-2;Q9Y6H5-3;Q9Y6H5	.;.;.;.;.;.;.;.;SNCAP_HUMAN	F	380;440;487;380;74;487;42;80;487	ENSP00000422106:L380F;ENSP00000261368:L440F;ENSP00000368848:L487F;ENSP00000368851:L380F;ENSP00000368854:L74F;ENSP00000261367:L487F;ENSP00000394392:L42F;ENSP00000423199:L487F	ENSP00000261367:L487F	L	+	1	0	SNCAIP	121804244	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.347000	0.79356	2.717000	0.92951	0.650000	0.86243	CTT	.		0.423	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1		
MEGF10	84466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	126753406	126753406	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:126753406G>A	ENST00000274473.6	+	11	1474	c.1207G>A	c.(1207-1209)Gga>Aga	p.G403R	MEGF10_ENST00000418761.2_Missense_Mutation_p.G403R|MEGF10_ENST00000503335.2_Missense_Mutation_p.G403R|MEGF10_ENST00000508365.1_Missense_Mutation_p.G403R	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	403	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ATGTTCTCCTGGATTCTACGG	0.532																																					p.G403R		.											.	MEGF10-94	0			c.G1207A						.						121.0	103.0	109.0					5																	126753406		2203	4300	6503	SO:0001583	missense	84466	exon11			TCTCCTGGATTCT	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1207G>A	5.37:g.126753406G>A	ENSP00000274473:p.Gly403Arg	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	106	49	NM_032446	0	0	0	0	0	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	33	5.226760	0.95173	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	5.69	5.69	0.88448	EGF-like, laminin (2);	0.000000	0.64402	D	0.000001	D	0.89392	0.6702	H	0.95816	3.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.90450	0.4438	10	0.44086	T	0.13	-11.0125	19.8251	0.96614	0.0:0.0:1.0:0.0	.	403;403	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	R	403	ENSP00000423354:G403R;ENSP00000423195:G403R;ENSP00000416284:G403R;ENSP00000274473:G403R	ENSP00000274473:G403R	G	+	1	0	MEGF10	126781305	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.864000	0.99589	2.692000	0.91855	0.655000	0.94253	GGA	.		0.532	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	
BRD8	10902	bcgsc.ca	37	5	137500547	137500547	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:137500547A>G	ENST00000254900.5	-	12	1958	c.1587T>C	c.(1585-1587)gtT>gtC	p.V529V	BRD8_ENST00000455658.2_Silent_p.V488V|BRD8_ENST00000230901.5_Silent_p.V602V|BRD8_ENST00000515014.1_5'UTR|BRD8_ENST00000411594.2_Silent_p.V532V|BRD8_ENST00000402931.1_Silent_p.V529V	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	529					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTGTGGCTGGAACAACTCCAG	0.512																																					p.V602V													.	BRD8-91	0			c.T1806C						.						121.0	115.0	117.0					5																	137500547		2203	4300	6503	SO:0001819	synonymous_variant	10902	exon13			GGCTGGAACAACT	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.1587T>C	5.37:g.137500547A>G		Somatic	104	0		WXS	Illumina HiSeq	Phase_1	74	34	NM_006696	0	0	49	53	4	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Silent	SNP	ENST00000254900.5	37	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	A	4.750	0.139404	0.09083	.	.	ENSG00000112983	ENST00000441656	.	.	.	5.38	1.76	0.24704	.	.	.	.	.	T	0.42854	0.1221	.	.	.	0.40378	D	0.979411	.	.	.	.	.	.	T	0.26608	-1.0098	4	.	.	.	-0.852	1.596	0.02664	0.5081:0.1325:0.2309:0.1285	.	.	.	.	S	523	.	.	F	-	2	0	BRD8	137528446	0.981000	0.34729	0.997000	0.53966	0.984000	0.73092	0.125000	0.15749	0.164000	0.19529	0.397000	0.26171	TTC	.		0.512	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
PCDHGC3	5098	hgsc.bcm.edu	37	5	140856534	140856534	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:140856534G>C	ENST00000308177.3	+	1	955	c.851G>C	c.(850-852)gGc>gCc	p.G284A	PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	284	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACTCCTTCGGCAGCCACAAC	0.592																																					p.G284A		.											.	PCDHGC3-24	0			c.G851C						.						49.0	55.0	53.0					5																	140856534		2203	4300	6503	SO:0001583	missense	5098	exon1			CCTTCGGCAGCCA	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.851G>C	5.37:g.140856534G>C	ENSP00000312070:p.Gly284Ala	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	386	102	NM_032402	0	0	27	27	0	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	ENST00000308177.3	37	CCDS4261.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.905262	0.33628	.	.	ENSG00000240184	ENST00000308177	T	0.48522	0.81	5.38	5.38	0.77491	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.49457	0.1558	N	0.16233	0.39	0.36092	D	0.843523	D;D	0.61697	0.984;0.99	P;D	0.63113	0.847;0.911	T	0.47471	-0.9115	9	0.16896	T	0.51	.	17.4859	0.87688	0.0:0.0:1.0:0.0	.	284;284	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	A	284	ENSP00000312070:G284A	ENSP00000312070:G284A	G	+	2	0	PCDHGC3	140836718	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.632000	0.83247	2.806000	0.96561	0.655000	0.94253	GGC	.		0.592	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
ARAP3	64411	bcgsc.ca	37	5	141041304	141041304	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:141041304G>C	ENST00000239440.4	-	21	3131	c.3066C>G	c.(3064-3066)tgC>tgG	p.C1022W	ARAP3_ENST00000513878.1_Missense_Mutation_p.C684W|ARAP3_ENST00000508305.1_Missense_Mutation_p.C853W|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1022	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						CCCGCGGCAGGCAGCCAATCA	0.567																																					p.C1022W													.	ARAP3-291	0			c.C3066G						.						86.0	92.0	90.0					5																	141041304		2203	4300	6503	SO:0001583	missense	64411	exon21			CGGCAGGCAGCCA	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3066C>G	5.37:g.141041304G>C	ENSP00000239440:p.Cys1022Trp	Somatic	203	0		WXS	Illumina HiSeq	Phase_1	462	129	NM_022481	0	0	0	0	0	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064941	0.55432	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.18810	2.19;2.19;2.19	5.15	1.26	0.21427	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.584844	0.19353	N	0.116346	T	0.31888	0.0811	L	0.50333	1.59	0.51012	D	0.999905	P;D;P	0.69078	0.668;0.997;0.73	B;D;P	0.63877	0.276;0.919;0.712	T	0.04005	-1.0985	10	0.66056	D	0.02	.	7.1033	0.25351	0.2125:0.1232:0.6643:0.0	.	684;853;1022	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	W	853;1022;684	ENSP00000421826:C853W;ENSP00000239440:C1022W;ENSP00000421468:C684W	ENSP00000239440:C1022W	C	-	3	2	ARAP3	141021488	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	0.862000	0.27899	0.327000	0.23409	0.655000	0.94253	TGC	.		0.567	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
FGF1	2246	bcgsc.ca	37	5	141974880	141974880	+	Missense_Mutation	SNP	A	A	G	rs201277854		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:141974880A>G	ENST00000359370.6	-	4	522	c.443T>C	c.(442-444)cTc>cCc	p.L148P	FGF1_ENST00000407758.1_3'UTR|FGF1_ENST00000419524.2_Missense_Mutation_p.L148P|AC005592.2_ENST00000443800.1_RNA|AC005592.2_ENST00000414314.1_RNA|FGF1_ENST00000494579.1_5'UTR|FGF1_ENST00000360966.5_3'UTR|FGF1_ENST00000337706.2_Missense_Mutation_p.L148P|FGF1_ENST00000378046.1_Missense_Mutation_p.L148P	NM_000800.4|NM_001144892.2|NM_001144934.1|NM_001144935.1|NM_001257205.1|NM_001257206.1|NM_001257207.1|NM_001257210.1|NM_001257212.1|NM_033137.2	NP_000791.1|NP_001138364.1|NP_001138406.1|NP_001138407.1|NP_001244134.1|NP_001244135.1|NP_001244136.1|NP_001244139.1|NP_001244141.1|NP_149128.1	P05230	FGF1_HUMAN	fibroblast growth factor 1 (acidic)	148					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|branch elongation involved in ureteric bud branching (GO:0060681)|cell differentiation (GO:0030154)|cellular response to heat (GO:0034605)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesonephric epithelium development (GO:0072163)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	fibroblast growth factor receptor binding (GO:0005104)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|S100 protein binding (GO:0044548)			large_intestine(1)|lung(2)	3		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Amlexanox(DB01025)|Pazopanib(DB06589)|Pentosan Polysulfate(DB00686)	TGGCAGGGGGAGAAACAAGAT	0.493																																					p.L148P													.	FGF1-947	0			c.T443C						.						83.0	81.0	82.0					5																	141974880		2203	4300	6503	SO:0001583	missense	2246	exon4			AGGGGGAGAAACA	X59065	CCDS4275.1, CCDS4276.1	5q31.3-q33.2	2014-01-30			ENSG00000113578	ENSG00000113578		"""Endogenous ligands"""	3665	protein-coding gene	gene with protein product	"""heparin-binding growth factor 1"", ""endothelial cell growth factor, alpha"", ""endothelial cell growth factor, beta"""	131220		FGFA		1697263, 3523756	Standard	NM_033137		Approved	AFGF, ECGF, ECGFA, ECGFB, HBGF1, ECGF-beta, FGF-alpha, GLIO703	uc031slo.1	P05230	OTTHUMG00000059703	ENST00000359370.6:c.443T>C	5.37:g.141974880A>G	ENSP00000352329:p.Leu148Pro	Somatic	57	0		WXS	Illumina HiSeq	Phase_1	42	20	NM_001257209	0	0	1	1	0	B2R5T0|D3DQF2|P07502|Q16588	Missense_Mutation	SNP	ENST00000359370.6	37	CCDS4275.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.570251	0.86542	.	.	ENSG00000113578	ENST00000359370;ENST00000378046;ENST00000337706;ENST00000441680;ENST00000419524	D;D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48;-2.48	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000003	D	0.96278	0.8786	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97431	1.0015	10	0.87932	D	0	.	16.2718	0.82624	1.0:0.0:0.0:0.0	.	147;148	A8K147;P05230	.;FGF1_HUMAN	P	148	ENSP00000352329:L148P;ENSP00000367285:L148P;ENSP00000338548:L148P;ENSP00000404742:L148P;ENSP00000396195:L148P	ENSP00000338548:L148P	L	-	2	0	FGF1	141955064	1.000000	0.71417	0.995000	0.50966	0.944000	0.59088	8.782000	0.91809	2.239000	0.73571	0.528000	0.53228	CTC	A|0.999;G|0.001		0.493	FGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132735.2	NM_000800	
TCERG1	10915	hgsc.bcm.edu	37	5	145838701	145838701	+	Silent	SNP	T	T	C	rs555146294		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:145838701T>C	ENST00000296702.5	+	4	731	c.693T>C	c.(691-693)gcT>gcC	p.A231A	TCERG1_ENST00000394421.2_Silent_p.A231A	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	231	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.A231A(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			aggctcaggctcaggcacaag	0.687													T|||	1	0.000199681	0.0	0.0	5008	,	,		12922	0.0		0.0	False		,,,				2504	0.001				p.A231A		.											.	TCERG1-92	2	Substitution - coding silent(2)	kidney(1)|endometrium(1)	c.T693C						.						29.0	33.0	32.0					5																	145838701		2203	4300	6503	SO:0001819	synonymous_variant	10915	exon4			TCAGGCTCAGGCA	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.693T>C	5.37:g.145838701T>C		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	129	8	NM_006706	0	0	6	6	0	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																			.		0.687	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
HAVCR1	26762	bcgsc.ca	37	5	156482504	156482504	+	Silent	SNP	A	A	C	rs141472249		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:156482504A>C	ENST00000339252.3	-	2	619	c.87T>G	c.(85-87)ggT>ggG	p.G29G	HAVCR1_ENST00000523175.1_Silent_p.G29G|HAVCR1_ENST00000425854.1_Silent_p.G29G|HAVCR1_ENST00000544197.1_Silent_p.G29G|HAVCR1_ENST00000522693.1_Silent_p.G29G	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	Ig-like V-type.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)	p.G29G(1)		endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGACAGATGGACCTGCCTCTC	0.473																																					p.G29G													.	HAVCR1-92	1	Substitution - coding silent(1)	skin(1)	c.T87G						.						52.0	55.0	54.0					5																	156482504		1955	4153	6108	SO:0001819	synonymous_variant	26762	exon3			AGATGGACCTGCC	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.87T>G	5.37:g.156482504A>C		Somatic	38	3		WXS	Illumina HiSeq	Phase_1	54	35	NM_001099414	0	0	43	80	37	O43656	Silent	SNP	ENST00000339252.3	37	CCDS43392.1																																																																																			A|0.998;C|0.002		0.473	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
PANK3	79646	bcgsc.ca	37	5	167991022	167991022	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:167991022A>C	ENST00000239231.6	-	4	1000	c.684T>G	c.(682-684)tgT>tgG	p.C228W	PANK3_ENST00000520504.1_Intron	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	228					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.C228C(1)		NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		CAAAACTTTCACAGCCAGTCA	0.383																																					p.C228W													.	PANK3-91	1	Substitution - coding silent(1)	lung(1)	c.T684G						.						129.0	144.0	139.0					5																	167991022		2203	4300	6503	SO:0001583	missense	79646	exon4			ACTTTCACAGCCA	AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.684T>G	5.37:g.167991022A>C	ENSP00000239231:p.Cys228Trp	Somatic	247	0		WXS	Illumina HiSeq	Phase_1	91	33	NM_024594	0	0	15	17	2	D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	ENST00000239231.6	37	CCDS4368.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.201052	0.58234	.	.	ENSG00000120137	ENST00000239231	D	0.99552	-6.15	4.73	3.56	0.40772	.	0.000000	0.85682	D	0.000000	D	0.99619	0.9861	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98750	1.0720	10	0.72032	D	0.01	-15.015	9.6307	0.39778	0.9168:0.0:0.0832:0.0	.	228	Q9H999	PANK3_HUMAN	W	228	ENSP00000239231:C228W	ENSP00000239231:C228W	C	-	3	2	PANK3	167923600	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	1.680000	0.37607	0.771000	0.33359	0.383000	0.25322	TGT	.		0.383	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252793.2	NM_024594	
SLIT3	6586	bcgsc.ca	37	5	168690617	168690617	+	Intron	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:168690617C>G	ENST00000519560.1	-	2	617				SLIT3_ENST00000332966.8_Intron|SLIT3_ENST00000404867.3_Intron|MIR585_ENST00000384887.1_RNA|SLIT3_ENST00000521130.1_Intron	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)						apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			gttacagcagccctagcatac	0.537																																					.	Ovarian(29;311 847 10864 17279 24903)												.	.	0			.						.																																			SO:0001627	intron_variant	693170	.			CAGCAGCCCTAGC	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.198-12154G>C	5.37:g.168690617C>G		Somatic	23	0		WXS	Illumina HiSeq	Phase_1	21	17	.	0	0	0	0	0	A6H8U9|J3KNP3|O95804|Q9UFH5	RNA	SNP	ENST00000519560.1	37	CCDS4369.1																																																																																			.		0.537	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
FBXW11	23291	bcgsc.ca	37	5	171384675	171384675	+	Missense_Mutation	SNP	C	C	T	rs201948522		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:171384675C>T	ENST00000265094.5	-	2	210	c.73G>A	c.(73-75)Ggc>Agc	p.G25S	FBXW11_ENST00000425623.2_Intron|FBXW11_ENST00000296933.6_Intron|FBXW11_ENST00000393802.2_Intron	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	25					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTGGCGCAGCCTAGCCACAAA	0.512																																					p.G25S													.	FBXW11-272	0			c.G73A						.						94.0	95.0	94.0					5																	171384675		2203	4300	6503	SO:0001583	missense	23291	exon2			CGCAGCCTAGCCA	AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.73G>A	5.37:g.171384675C>T	ENSP00000265094:p.Gly25Ser	Somatic	144	1		WXS	Illumina HiSeq	Phase_1	99	58	NM_012300	0	0	0	0	0	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Missense_Mutation	SNP	ENST00000265094.5	37	CCDS34289.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713661	0.89112	.	.	ENSG00000072803	ENST00000265094;ENST00000517395	T;T	0.71103	0.01;-0.54	5.49	5.49	0.81192	.	0.133777	0.48767	D	0.000161	T	0.51363	0.1670	N	0.08118	0	0.80722	D	1	P	0.48694	0.914	B	0.44044	0.439	T	0.56733	-0.7930	10	0.02654	T	1	-12.0164	17.1698	0.86826	0.0:1.0:0.0:0.0	.	25	Q9UKB1	FBW1B_HUMAN	S	25	ENSP00000265094:G25S;ENSP00000428753:G25S	ENSP00000265094:G25S	G	-	1	0	FBXW11	171317280	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.615000	0.61190	2.565000	0.86533	0.655000	0.94253	GGC	.		0.512	FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300	
TFAP2A	7020	hgsc.bcm.edu	37	6	10398708	10398708	+	Missense_Mutation	SNP	T	T	G	rs201591227		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:10398708T>G	ENST00000482890.1	-	8	1608	c.1256A>C	c.(1255-1257)aAc>aCc	p.N419T	TFAP2A_ENST00000379608.3_Missense_Mutation_p.N413T|TFAP2A_ENST00000497266.1_5'Flank|TFAP2A_ENST00000319516.4_Missense_Mutation_p.N415T|TFAP2A_ENST00000379604.2_Missense_Mutation_p.N419T|TFAP2A_ENST00000379613.3_Missense_Mutation_p.N421T			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	419					anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				CGTGTGGCTGTTGGGGTTGTT	0.622																																					p.N419T		.											.	TFAP2A-91	0			c.A1256C						.						317.0	330.0	326.0					6																	10398708		2203	4300	6503	SO:0001583	missense	7020	exon7			TGGCTGTTGGGGT	X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.1256A>C	6.37:g.10398708T>G	ENSP00000418541:p.Asn419Thr	Somatic	715	1		WXS	Illumina HiSeq	Phase_I	1832	626	NM_003220	0	0	0	0	0	Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	ENST00000482890.1	37	CCDS4510.1	.	.	.	.	.	.	.	.	.	.	T	12.06	1.825513	0.32237	.	.	ENSG00000137203	ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890	D;D;D;D;D	0.97114	-4.25;-4.25;-4.25;-4.25;-4.25	5.41	5.41	0.78517	.	0.042320	0.85682	D	0.000000	D	0.97247	0.9100	L	0.55481	1.735	0.80722	D	1	D;D;D	0.71674	0.993;0.983;0.998	D;P;D	0.83275	0.968;0.829;0.996	D	0.96866	0.9636	10	0.34782	T	0.22	-13.6146	15.4442	0.75216	0.0:0.0:0.0:1.0	.	415;419;413	Q5TAV5;P05549;Q8N1C6	.;AP2A_HUMAN;.	T	421;419;415;413;419	ENSP00000368933:N421T;ENSP00000368924:N419T;ENSP00000316516:N415T;ENSP00000368928:N413T;ENSP00000418541:N419T	ENSP00000316516:N415T	N	-	2	0	TFAP2A	10506694	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.249000	0.58766	2.048000	0.60808	0.533000	0.62120	AAC	.		0.622	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220	
ELOVL2	54898	bcgsc.ca	37	6	11005704	11005704	+	Silent	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:11005704A>C	ENST00000354666.3	-	3	239	c.156T>G	c.(154-156)ggT>ggG	p.G52G		NM_017770.3	NP_060240.3	Q9NXB9	ELOV2_HUMAN	ELOVL fatty acid elongase 2	52					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	fatty acid elongase activity (GO:0009922)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(2)	14	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			TATACTTGTTACCCAGCCATA	0.443																																					p.G52G													.	ELOVL2-90	0			c.T156G						.																																			SO:0001819	synonymous_variant	54898	exon3			CTTGTTACCCAGC	AK000341	CCDS4518.1	6p24.1	2011-05-25	2011-05-25		ENSG00000197977	ENSG00000197977			14416	protein-coding gene	gene with protein product		611814	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2"""			12371743, 16564093	Standard	NM_017770		Approved	Ssc2	uc003mzp.4	Q9NXB9	OTTHUMG00000014252	ENST00000354666.3:c.156T>G	6.37:g.11005704A>C		Somatic	55	0		WXS	Illumina HiSeq	Phase_1	38	21	NM_017770	0	0	0	0	0	Q6P9E1|Q86W94	Silent	SNP	ENST00000354666.3	37	CCDS4518.1																																																																																			.		0.443	ELOVL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039849.1		
CAP2	10486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	17507928	17507928	+	Silent	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:17507928T>C	ENST00000229922.2	+	6	1033	c.501T>C	c.(499-501)acT>acC	p.T167T	CAP2_ENST00000378990.2_Silent_p.T141T|CAP2_ENST00000465994.1_Intron|CAP2_ENST00000489374.1_Intron|CAP2_ENST00000493172.1_Intron	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	167					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			CCTTTTACACTAACAGGGTCT	0.413																																					p.T167T		.											.	CAP2-91	0			c.T501C						.						138.0	124.0	129.0					6																	17507928		2203	4300	6503	SO:0001819	synonymous_variant	10486	exon6			TTACACTAACAGG	BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.501T>C	6.37:g.17507928T>C		Somatic	143	0		WXS	Illumina HiSeq	Phase_I	132	50	NM_006366	0	0	4	13	9	B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Silent	SNP	ENST00000229922.2	37	CCDS4539.1																																																																																			.		0.413	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2		
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056427	26056427	+	Missense_Mutation	SNP	T	T	G	rs182693914		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:26056427T>G	ENST00000343677.2	-	1	272	c.230A>C	c.(229-231)aAc>aCc	p.N77T		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	77	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						GATACGGCTGTTGTTTTTCTC	0.527																																					p.N77T		.											.	HIST1H1C-231	0			c.A230C						.						106.0	111.0	109.0					6																	26056427		2203	4300	6503	SO:0001583	missense	3006	exon1			CGGCTGTTGTTTT	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.230A>C	6.37:g.26056427T>G	ENSP00000339566:p.Asn77Thr	Somatic	162	2		WXS	Illumina HiSeq	Phase_I	476	201	NM_005319	0	0	40	46	6	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	T	18.74	3.688031	0.68271	.	.	ENSG00000187837	ENST00000343677	T	0.08984	3.03	5.63	5.63	0.86233	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.152097	0.56097	D	0.000023	T	0.24275	0.0588	M	0.85945	2.785	0.80722	D	1	D	0.64830	0.994	D	0.71870	0.975	T	0.02617	-1.1133	10	0.66056	D	0.02	-32.5039	15.3144	0.74062	0.0:0.0:0.0:1.0	.	77	P16403	H12_HUMAN	T	77	ENSP00000339566:N77T	ENSP00000339566:N77T	N	-	2	0	HIST1H1C	26164406	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	6.087000	0.71362	2.271000	0.75665	0.533000	0.62120	AAC	.		0.527	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
BTN3A2	11118	bcgsc.ca	37	6	26370630	26370630	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:26370630T>G	ENST00000356386.2	+	5	702	c.514T>G	c.(514-516)Tac>Gac	p.Y172D	BTN3A2_ENST00000396948.1_Missense_Mutation_p.Y172D|BTN3A2_ENST00000532994.1_3'UTR|BTN3A2_ENST00000396934.3_Missense_Mutation_p.Y149D|BTN3A2_ENST00000508906.2_Missense_Mutation_p.Y130D|BTN3A2_ENST00000377708.2_Missense_Mutation_p.Y172D|BTN3A2_ENST00000527422.1_Missense_Mutation_p.Y172D	NM_001197246.2|NM_001197247.1|NM_007047.3	NP_001184175.1|NP_001184176.1|NP_008978.2	P78410	BT3A2_HUMAN	butyrophilin, subfamily 3, member A2	172					interferon-gamma secretion (GO:0072643)|T cell mediated immunity (GO:0002456)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)	10						CACCGGCTGGTACCCCCAACC	0.537																																					p.Y172D													.	BTN3A2-90	0			c.T514G						.						118.0	106.0	110.0					6																	26370630		2203	4300	6503	SO:0001583	missense	11118	exon3			GGCTGGTACCCCC	U90546	CCDS4605.1, CCDS56399.1, CCDS56400.1	6p22.1	2014-01-14			ENSG00000186470	ENSG00000186470		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1139	protein-coding gene	gene with protein product		613594				9149941	Standard	NM_007047		Approved	BTN3.2	uc010jqi.2	P78410	OTTHUMG00000014450	ENST00000356386.2:c.514T>G	6.37:g.26370630T>G	ENSP00000348751:p.Tyr172Asp	Somatic	106	0		WXS	Illumina HiSeq	Phase_1	96	51	NM_001197246	0	0	68	75	7	B4DRT7|B4E103|F5H791|F8W6E0|O00477|O15338|O75658|Q76PA0|Q9BU81|Q9NR44	Missense_Mutation	SNP	ENST00000356386.2	37	CCDS4605.1	.	.	.	.	.	.	.	.	.	.	t	11.20	1.569103	0.28003	.	.	ENSG00000186470	ENST00000532865;ENST00000535620;ENST00000527422;ENST00000356386;ENST00000396934;ENST00000377708;ENST00000396948;ENST00000508906	T;T;T;T;T;T;T	0.15952	2.38;3.13;3.13;3.13;3.13;3.13;3.13	2.31	1.11	0.20524	Immunoglobulin-like fold (1);	.	.	.	.	T	0.19087	0.0458	M	0.92649	3.33	0.09310	N	1	P;P	0.49783	0.928;0.747	P;B	0.49922	0.626;0.422	T	0.09015	-1.0694	9	0.87932	D	0	.	4.3039	0.10937	0.0:0.1712:0.0:0.8288	.	149;172	F8W6E0;P78410	.;BT3A2_HUMAN	D	130;172;172;172;149;172;172;130	ENSP00000435952:Y130D;ENSP00000432138:Y172D;ENSP00000348751:Y172D;ENSP00000380140:Y149D;ENSP00000366937:Y172D;ENSP00000380152:Y172D;ENSP00000442687:Y130D	ENSP00000348751:Y172D	Y	+	1	0	BTN3A2	26478609	0.958000	0.32768	0.007000	0.13788	0.004000	0.04260	1.202000	0.32271	0.320000	0.23234	-0.722000	0.03604	TAC	.		0.537	BTN3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040113.2		
TRIM39	56658	bcgsc.ca	37	6	30297131	30297131	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:30297131G>C	ENST00000396547.1	+	2	197	c.37G>C	c.(37-39)Gca>Cca	p.A13P	HCG18_ENST00000602550.1_RNA|TRIM39_ENST00000540416.1_Missense_Mutation_p.A13P|TRIM39_ENST00000396548.1_Missense_Mutation_p.A13P|HCG18_ENST00000426882.1_RNA|HCG18_ENST00000412685.2_RNA|TRIM39_ENST00000376656.4_Missense_Mutation_p.A13P|HCG18_ENST00000454129.1_RNA|TRIM39-RPP21_ENST00000513556.1_5'Flank|HCG18_ENST00000413358.2_RNA|HCG18_ENST00000602290.1_RNA|HCG18_ENST00000438412.1_RNA|HCG18_ENST00000454269.1_RNA|TRIM39_ENST00000376659.5_Missense_Mutation_p.A13P|TRIM39_ENST00000396551.3_Missense_Mutation_p.A13P			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	13					apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						TGGGGCCTCTGCAGCCTCTAC	0.478																																					p.A13P													.	TRIM39-161	0			c.G37C						.						104.0	138.0	126.0					6																	30297131		1507	2708	4215	SO:0001583	missense	56658	exon3			GCCTCTGCAGCCT	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.37G>C	6.37:g.30297131G>C	ENSP00000379796:p.Ala13Pro	Somatic	271	1		WXS	Illumina HiSeq	Phase_1	148	70	NM_172016	0	0	6	7	1	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	ENST00000396547.1	37	CCDS34377.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.621641	0.46736	.	.	ENSG00000204599	ENST00000458516;ENST00000440271;ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000449040;ENST00000428728;ENST00000396548;ENST00000428404;ENST00000376659;ENST00000428555;ENST00000396547	T;T;T;T;T;T;T;T;T;T;T	0.80909	-0.34;-1.3;-0.0;-0.03;0.03;-0.28;-0.0;-1.43;-0.0;1.25;-0.03	4.87	4.0	0.46444	.	0.000000	0.40908	D	0.000988	T	0.39545	0.1082	N	0.08118	0	0.35341	D	0.786512	B;P	0.35656	0.38;0.514	B;B	0.29524	0.103;0.093	T	0.38520	-0.9657	10	0.29301	T	0.29	.	7.4849	0.27427	0.1893:0.0:0.8107:0.0	.	13;13	Q9HCM9;Q9HCM9-2	TRI39_HUMAN;.	P	13	ENSP00000405928:A13P;ENSP00000394768:A13P;ENSP00000379800:A13P;ENSP00000365844:A13P;ENSP00000439400:A13P;ENSP00000406019:A13P;ENSP00000379797:A13P;ENSP00000405498:A13P;ENSP00000365847:A13P;ENSP00000397952:A13P;ENSP00000379796:A13P	ENSP00000365844:A13P	A	+	1	0	TRIM39	30405110	0.994000	0.37717	1.000000	0.80357	0.958000	0.62258	2.069000	0.41481	1.275000	0.44379	0.561000	0.74099	GCA	.		0.478	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016	
HLA-DQB2	3120	ucsc.edu	37	6	32726670	32726670	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:32726670T>G	ENST00000437316.2	-	3	666	c.603A>C	c.(601-603)caA>caC	p.Q201H	HLA-DQB2_ENST00000411527.1_Missense_Mutation_p.Q201H|HLA-DQB2_ENST00000435145.2_Missense_Mutation_p.Q201H			P05538	DQB2_HUMAN	major histocompatibility complex, class II, DQ beta 2	205	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|B cell affinity maturation (GO:0002344)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of alpha-beta T cell activation (GO:0046635)|positive regulation of antigen processing and presentation (GO:0002579)|positive regulation of T-helper 1 type immune response (GO:0002827)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome (GO:0005769)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)|toxic substance binding (GO:0015643)	p.Q201H(1)		endometrium(1)|kidney(1)|lung(1)|prostate(2)	5						GGTGCTCCACTTGGCAGGTGT	0.557																																					p.Q201H													.	.	1	Substitution - Missense(1)	lung(1)	c.A603C						.																																			SO:0001583	missense	3120	exon3			CTCCACTTGGCAG	M83890	CCDS56419.1	6p21.3	2013-01-11			ENSG00000232629	ENSG00000232629		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4945	protein-coding gene	gene with protein product		615161		HLA-DXB		2564844	Standard	NM_001198858		Approved		uc003oby.4	P05538	OTTHUMG00000031125	ENST00000437316.2:c.603A>C	6.37:g.32726670T>G	ENSP00000396330:p.Gln201His	Somatic	64	5		WXS	Illumina HiSeq		59	6	NM_001198858	0	0	1	2	1	A6NIA5|Q29826|Q29870|Q29871|Q29872|Q29873|Q5SR06	Missense_Mutation	SNP	ENST00000437316.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0|0	-2.589726|-2.589726	0.00126|0.00126	.|.	.|.	ENSG00000232629|ENSG00000232629	ENST00000427449|ENST00000437316;ENST00000435145;ENST00000411527	.|T;T;T	.|0.02974	.|4.09;4.09;4.09	3.29|3.29	-6.57|-6.57	0.01842|0.01842	.|.	.|0.675264	.|0.13136	.|N	.|0.411048	T|T	0.00271|0.00271	0.0008|0.0008	N|N	0.02420|0.02420	-0.555|-0.555	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.04013	.|0.001;0.001	T|T	0.35351|0.35351	-0.9792|-0.9792	5|10	.|0.22706	.|T	.|0.39	.|.	2.9567|2.9567	0.05878|0.05878	0.5247:0.0905:0.1114:0.2733|0.5247:0.0905:0.1114:0.2733	.|.	.|201;201	.|A2ADX3;Q5SR06	.|.;.	T|H	200|201	.|ENSP00000396330:Q201H;ENSP00000410512:Q201H;ENSP00000390431:Q201H	.|ENSP00000390431:Q201H	K|Q	-|-	2|3	0|2	HLA-DQB2|HLA-DQB2	32834648|32834648	0.000000|0.000000	0.05858|0.05858	0.082000|0.082000	0.20525|0.20525	0.630000|0.630000	0.37929|0.37929	-4.960000|-4.960000	0.00165|0.00165	-3.644000|-3.644000	0.00127|0.00127	-1.678000|-1.678000	0.00738|0.00738	AAG|CAA	.		0.557	HLA-DQB2-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000076216.2		
ANKS1A	23294	ucsc.edu	37	6	34985432	34985432	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:34985432G>C	ENST00000360359.3	+	11	1744	c.1606G>C	c.(1606-1608)Gcc>Ccc	p.A536P	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	536					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.A536T(1)		cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CCAGCAGGGCGCCTGCCACAA	0.682																																					p.A536P													.	ANKS1A-94	1	Substitution - Missense(1)	lung(1)	c.G1606C						.						28.0	33.0	31.0					6																	34985432		2202	4298	6500	SO:0001583	missense	23294	exon11			CAGGGCGCCTGCC	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.1606G>C	6.37:g.34985432G>C	ENSP00000353518:p.Ala536Pro	Somatic	36	0		WXS	Illumina HiSeq		123	21	NM_015245	0	0	2	2	0	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	37	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623241	0.46840	.	.	ENSG00000064999	ENST00000360359	T	0.37752	1.18	5.05	2.26	0.28386	.	0.283944	0.25022	N	0.033745	T	0.14700	0.0355	L	0.29908	0.895	0.53688	D	0.999971	P	0.52842	0.956	P	0.46975	0.533	T	0.02232	-1.1191	10	0.35671	T	0.21	-11.9378	7.0156	0.24887	0.4021:0.0:0.5979:0.0	.	536	Q92625	ANS1A_HUMAN	P	536	ENSP00000353518:A536P	ENSP00000353518:A536P	A	+	1	0	ANKS1A	35093410	0.008000	0.16893	0.981000	0.43875	0.981000	0.71138	0.721000	0.25911	0.648000	0.30732	-0.140000	0.14226	GCC	.		0.682	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
DST	667	bcgsc.ca	37	6	56417908	56417908	+	Missense_Mutation	SNP	T	T	G	rs78180015		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:56417908T>G	ENST00000361203.3	-	57	15056	c.15049A>C	c.(15049-15051)Aca>Cca	p.T5017P	DST_ENST00000421834.2_Missense_Mutation_p.T2931P|DST_ENST00000244364.6_Missense_Mutation_p.T2605P|DST_ENST00000370769.4_Missense_Mutation_p.T5019P|DST_ENST00000370788.2_Missense_Mutation_p.T2931P|DST_ENST00000446842.2_Missense_Mutation_p.T4693P|DST_ENST00000370754.5_Missense_Mutation_p.T5197P|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	5017					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTATTGGCTGTGTTGTTCAGT	0.413																																					p.T2605P													.	DST-523	0			c.A7813C						.						152.0	151.0	151.0					6																	56417908		1883	4123	6006	SO:0001583	missense	667	exon42			TGGCTGTGTTGTT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.15049A>C	6.37:g.56417908T>G	ENSP00000354508:p.Thr5017Pro	Somatic	159	0		WXS	Illumina HiSeq	Phase_1	151	60	NM_015548	0	0	9	10	1	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	T	9.647	1.140469	0.21205	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25;1.25	5.76	2.67	0.31697	.	0.535968	0.16734	N	0.201714	T	0.10337	0.0253	L	0.40543	1.245	0.27971	N	0.936394	P;P;B;B;B	0.37398	0.593;0.592;0.449;0.09;0.211	B;B;B;B;B	0.34489	0.124;0.184;0.12;0.046;0.104	T	0.13150	-1.0520	9	0.32370	T	0.25	.	5.3734	0.16152	0.2714:0.5297:0.0:0.1989	.	2931;5019;5197;5017;2605	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	P	2605;5197;5019;2931;4693;2931;5017	ENSP00000244364:T2605P;ENSP00000359790:T5197P;ENSP00000359805:T5019P;ENSP00000400883:T2931P;ENSP00000393645:T4693P;ENSP00000359824:T2931P;ENSP00000354508:T5017P	ENSP00000244364:T2605P	T	-	1	0	DST	56525867	0.683000	0.27633	0.300000	0.25030	0.984000	0.73092	1.334000	0.33827	0.288000	0.22398	0.533000	0.62120	ACA	.		0.413	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
SMPD2	6610	broad.mit.edu	37	6	109764877	109764877	+	Silent	SNP	A	A	G	rs142982624|rs370460899	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:109764877A>G	ENST00000258052.3	+	10	1400	c.1041A>G	c.(1039-1041)ggA>ggG	p.G347G	PPIL6_ENST00000440797.2_5'Flank|PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000424445.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	347					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		TGGCGGCTGGAGGAGGGGCCG	0.632																																					p.G347G													.	SMPD2-90	0			c.A1041G						.						41.0	52.0	48.0					6																	109764877		2202	4300	6502	SO:0001819	synonymous_variant	6610	exon10			GGCTGGAGGAGGG	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.1041A>G	6.37:g.109764877A>G		Somatic	52	0		WXS	Illumina HiSeq	Phase_I	111	30	NM_003080	0	0	6	6	0	Q5TED1|Q9BWR3	Silent	SNP	ENST00000258052.3	37	CCDS5075.1																																																																																			.		0.632	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1		
VGLL2	245806	bcgsc.ca	37	6	117589438	117589438	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:117589438A>C	ENST00000326274.5	+	2	365	c.175A>C	c.(175-177)Acc>Ccc	p.T59P	VGLL2_ENST00000352536.3_Missense_Mutation_p.T59P	NM_182645.3	NP_872586.1	Q8N8G2	VGLL2_HUMAN	vestigial-like family member 2	59					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|kidney(1)|lung(3)	5				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		TTCCAGCCAAACCCCAGCCAG	0.532																																					p.T59P													.	VGLL2-90	0			c.A175C						.						108.0	134.0	125.0					6																	117589438		2202	4300	6502	SO:0001583	missense	245806	exon2			AGCCAAACCCCAG	AY056583	CCDS5114.1, CCDS5115.1	6q22.31	2014-03-03	2014-03-03		ENSG00000170162	ENSG00000170162			20232	protein-coding gene	gene with protein product		609979	"""vestigial like 2 (Drosophila)"""			12376544	Standard	NM_153453		Approved		uc003pxn.3	Q8N8G2	OTTHUMG00000015451	ENST00000326274.5:c.175A>C	6.37:g.117589438A>C	ENSP00000320957:p.Thr59Pro	Somatic	320	2		WXS	Illumina HiSeq	Phase_1	602	210	NM_182645	0	0	0	0	0	Q8WWX1	Missense_Mutation	SNP	ENST00000326274.5	37	CCDS5115.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.342450	0.41498	.	.	ENSG00000170162	ENST00000352536;ENST00000326274	T	0.46819	0.86	5.05	5.05	0.67936	.	0.409080	0.24147	N	0.041111	T	0.10594	0.0259	N	0.08118	0	0.30774	N	0.742725	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.10177	-1.0641	10	0.26408	T	0.33	-11.3886	7.1855	0.25797	0.8309:0.0:0.1691:0.0	.	59;59	Q8N8G2-2;Q8N8G2	.;VGLL2_HUMAN	P	59	ENSP00000320957:T59P	ENSP00000320957:T59P	T	+	1	0	VGLL2	117696131	0.377000	0.25106	1.000000	0.80357	0.993000	0.82548	0.615000	0.24329	2.123000	0.65237	0.459000	0.35465	ACC	.		0.532	VGLL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041975.2	NM_153453	
FAM184A	79632	bcgsc.ca	37	6	119282964	119282964	+	Silent	SNP	T	T	G	rs534758163	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:119282964T>G	ENST00000338891.7	-	17	3746	c.3303A>C	c.(3301-3303)ccA>ccC	p.P1101P	FAM184A_ENST00000352896.5_Silent_p.P932P|FAM184A_ENST00000368475.4_Silent_p.P897P|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000521531.1_Silent_p.P1017P	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	1101						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						GCACTGGCTGTGGAAGTGGTT	0.448													T|||	6	0.00119808	0.0023	0.0	5008	,	,		15675	0.0		0.003	False		,,,				2504	0.0				p.P1101P													.	FAM184A-519	0			c.A3303C						.						191.0	198.0	196.0					6																	119282964		1937	4147	6084	SO:0001819	synonymous_variant	79632	exon17			TGGCTGTGGAAGT	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.3303A>C	6.37:g.119282964T>G		Somatic	278	1		WXS	Illumina HiSeq	Phase_1	51	23	NM_024581	0	0	6	6	0	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Silent	SNP	ENST00000338891.7	37	CCDS43499.1																																																																																			.		0.448	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
PBOV1	59351	bcgsc.ca	37	6	138539226	138539226	+	Missense_Mutation	SNP	C	C	T	rs200344940		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:138539226C>T	ENST00000527246.2	-	1	401	c.307G>A	c.(307-309)Gaa>Aaa	p.E103K	KIAA1244_ENST00000251691.4_Intron	NM_021635.2	NP_067648.1	Q9GZY1	PBOV1_HUMAN	prostate and breast cancer overexpressed 1	103						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)	1	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00055)|GBM - Glioblastoma multiforme(68;0.000674)		AATATGGCTTCTGAAGATAAT	0.388																																					p.E103K													.	.	0			c.G307A						.						187.0	193.0	191.0					6																	138539226		2203	4300	6503	SO:0001583	missense	59351	exon1			TGGCTTCTGAAGA	AF189269	CCDS5190.1	6q23.3	2012-02-09			ENSG00000254440	ENSG00000254440			21079	protein-coding gene	gene with protein product		605669				12553037, 11156405	Standard	NM_021635		Approved	UC28, UROC28	uc003qhv.3	Q9GZY1	OTTHUMG00000167040	ENST00000527246.2:c.307G>A	6.37:g.138539226C>T	ENSP00000432353:p.Glu103Lys	Somatic	127	0		WXS	Illumina HiSeq	Phase_1	62	24	NM_021635	0	0	0	0	0		Missense_Mutation	SNP	ENST00000527246.2	37	CCDS5190.1	.	.	.	.	.	.	.	.	.	.	C	7.997	0.754479	0.15778	.	.	ENSG00000254440	ENST00000527246	T	0.44482	0.92	3.24	-2.56	0.06268	.	.	.	.	.	T	0.06005	0.0156	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.31503	-0.9941	9	0.87932	D	0	.	0.2202	0.00167	0.2162:0.2517:0.185:0.3472	.	103	Q9GZY1	PBOV1_HUMAN	K	103	ENSP00000432353:E103K	ENSP00000432353:E103K	E	-	1	0	PBOV1	138580919	0.927000	0.31430	0.000000	0.03702	0.050000	0.14768	2.144000	0.42197	-0.465000	0.06953	-0.492000	0.04666	GAA	.		0.388	PBOV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392617.1	NM_021635	
PHACTR2	9749	bcgsc.ca	37	6	144086447	144086447	+	Silent	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:144086447G>C	ENST00000427704.2	+	6	841	c.711G>C	c.(709-711)tcG>tcC	p.S237S	PHACTR2_ENST00000367584.4_Silent_p.S225S|PHACTR2_ENST00000367582.3_Silent_p.S168S|PHACTR2_ENST00000440869.2_Silent_p.S248S|PHACTR2_ENST00000305766.6_Silent_p.S157S	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	237							protein phosphatase inhibitor activity (GO:0004864)			NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		CATCAGCTTCGCCATCCACTT	0.433																																					p.S248S	Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)												.	PHACTR2-92	0			c.G744C						.						96.0	97.0	97.0					6																	144086447		1963	4155	6118	SO:0001819	synonymous_variant	9749	exon6			AGCTTCGCCATCC	AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.711G>C	6.37:g.144086447G>C		Somatic	142	0		WXS	Illumina HiSeq	Phase_1	76	30	NM_001100164	0	0	11	11	0	A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Silent	SNP	ENST00000427704.2	37	CCDS47492.1																																																																																			.		0.433	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042528.2	NM_014721	
UTRN	7402	bcgsc.ca	37	6	144808805	144808805	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:144808805A>C	ENST00000367545.3	+	28	3944	c.3944A>C	c.(3943-3945)aAc>aCc	p.N1315T		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1315					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GAGGCTTTCAACAGCCGATAT	0.478																																					p.N1315T													.	UTRN-95	0			c.A3944C						.						88.0	95.0	93.0					6																	144808805		2203	4300	6503	SO:0001583	missense	7402	exon28			CTTTCAACAGCCG	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3944A>C	6.37:g.144808805A>C	ENSP00000356515:p.Asn1315Thr	Somatic	147	0		WXS	Illumina HiSeq	Phase_1	98	52	NM_007124	0	0	4	4	0	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.970742	0.74246	.	.	ENSG00000152818	ENST00000367545	T	0.14144	2.53	5.13	3.95	0.45737	.	0.000000	0.56097	D	0.000040	T	0.24160	0.0585	M	0.73962	2.25	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	T	0.02457	-1.1156	10	0.72032	D	0.01	.	11.1426	0.48411	0.927:0.0:0.073:0.0	.	1315	P46939	UTRO_HUMAN	T	1315	ENSP00000356515:N1315T	ENSP00000356515:N1315T	N	+	2	0	UTRN	144850498	1.000000	0.71417	0.635000	0.29338	0.932000	0.56968	9.287000	0.95975	0.885000	0.36088	0.533000	0.62120	AAC	.		0.478	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
SYNE1	23345	bcgsc.ca	37	6	152470619	152470619	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:152470619C>G	ENST00000367255.5	-	136	25236	c.24635G>C	c.(24634-24636)cGc>cCc	p.R8212P	SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000354674.4_Missense_Mutation_p.R367P|SYNE1_ENST00000539504.1_Missense_Mutation_p.R367P|SYNE1_ENST00000448038.1_Missense_Mutation_p.R8141P|SYNE1_ENST00000423061.1_Missense_Mutation_p.R8141P|SYNE1_ENST00000341594.5_Missense_Mutation_p.R7824P|SYNE1_ENST00000265368.4_Missense_Mutation_p.R8212P|SYNE1_ENST00000356820.4_Missense_Mutation_p.R2736P	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8212					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TACAGGCAGGCGGATCAGTTT	0.468										HNSCC(10;0.0054)																											p.R8212P													.	SYNE1-607	0			c.G24635C						.						83.0	80.0	81.0					6																	152470619		2203	4300	6503	SO:0001583	missense	23345	exon136			GGCAGGCGGATCA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24635G>C	6.37:g.152470619C>G	ENSP00000356224:p.Arg8212Pro	Somatic	101	1		WXS	Illumina HiSeq	Phase_1	89	39	NM_182961	0	0	0	0	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918688	0.92249	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.58358	0.41;4.54;1.35;0.38;0.34;0.39;0.55;2.45;1.52;4.53	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000012	T	0.65228	0.2671	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998	D;D;D;D;D	0.87578	0.992;0.992;0.996;0.998;0.953	T	0.67027	-0.5774	10	0.72032	D	0.01	.	19.4997	0.95089	0.0:1.0:0.0:0.0	.	8212;8212;8141;8141;414	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	P	8212;367;858;8141;8212;8141;7824;2736;374;369;1134;367	ENSP00000356224:R8212P;ENSP00000441052:R367P;ENSP00000356226:R858P;ENSP00000396024:R8141P;ENSP00000265368:R8212P;ENSP00000390975:R8141P;ENSP00000341887:R7824P;ENSP00000349276:R2736P;ENSP00000356220:R1134P;ENSP00000346701:R367P	ENSP00000265368:R8212P	R	-	2	0	SYNE1	152512312	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.674000	0.54598	2.611000	0.88343	0.655000	0.94253	CGC	.		0.468	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
NOX3	50508	bcgsc.ca	37	6	155776042	155776042	+	Missense_Mutation	SNP	C	C	A	rs200865731		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:155776042C>A	ENST00000159060.2	-	3	260	c.158G>T	c.(157-159)tGg>tTg	p.W53L		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	53					detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TGCTCGTGCCCAAGCCAGTGT	0.368																																					p.W53L													.	NOX3-91	0			c.G158T						.																																			SO:0001583	missense	50508	exon3			CGTGCCCAAGCCA	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.158G>T	6.37:g.155776042C>A	ENSP00000159060:p.Trp53Leu	Somatic	38	0		WXS	Illumina HiSeq	Phase_1	12	9	NM_015718	0	0	0	0	0	Q9HBJ9	Missense_Mutation	SNP	ENST00000159060.2	37	CCDS5250.1	.	.	.	.	.	.	.	.	.	.	C	9.987	1.229856	0.22542	.	.	ENSG00000074771	ENST00000159060	D	0.94931	-3.56	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000014	D	0.93429	0.7904	L	0.35854	1.095	0.52501	D	0.999955	D	0.89917	1.0	D	0.83275	0.996	D	0.88911	0.3359	10	0.02654	T	1	-13.8466	20.3011	0.98612	0.0:1.0:0.0:0.0	.	53	Q9HBY0	NOX3_HUMAN	L	53	ENSP00000159060:W53L	ENSP00000159060:W53L	W	-	2	0	NOX3	155817734	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	6.321000	0.72881	2.804000	0.96469	0.650000	0.86243	TGG	C|0.999;A|0.001		0.368	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
ARID1B	57492	bcgsc.ca	37	6	157454175	157454175	+	Silent	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:157454175C>G	ENST00000350026.5	+	7	2347	c.2346C>G	c.(2344-2346)ggC>ggG	p.G782G	ARID1B_ENST00000275248.4_Silent_p.G724G|ARID1B_ENST00000367148.1_Silent_p.G782G|ARID1B_ENST00000346085.5_Silent_p.G795G	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	782					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TTATGGCAGGCACACAAAGAA	0.458																																					p.G795G													.	ARID1B-154	0			c.C2385G						.						80.0	76.0	77.0					6																	157454175		2203	4300	6503	SO:0001819	synonymous_variant	57492	exon8			GGCAGGCACACAA	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.2346C>G	6.37:g.157454175C>G		Somatic	67	1		WXS	Illumina HiSeq	Phase_1	55	33	NM_020732	0	0	14	14	0	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	ENST00000350026.5	37	CCDS5251.2																																																																																			.		0.458	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
PLG	5340	broad.mit.edu	37	6	161152867	161152867	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:161152867C>A	ENST00000308192.9	+	12	1592	c.1529C>A	c.(1528-1530)cCc>cAc	p.P510H		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	510	Kringle 5. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GCCCAGGAGCCCCATAGACAC	0.527																																					p.P510H													.	PLG-94	0			c.C1529A	GRCh37	CM068062	PLG	M		.						89.0	96.0	93.0					6																	161152867		2203	4300	6503	SO:0001583	missense	5340	exon12			AGGAGCCCCATAG	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1529C>A	6.37:g.161152867C>A	ENSP00000308938:p.Pro510His	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	110	4	NM_000301	0	0	0	0	0	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.296297	0.60086	.	.	ENSG00000122194	ENST00000308192	T	0.66638	-0.22	4.47	4.47	0.54385	Kringle (4);Kringle-like fold (1);	0.000000	0.39146	U	0.001457	D	0.84871	0.5568	H	0.97131	3.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88999	0.3420	10	0.87932	D	0	.	12.4909	0.55899	0.0:1.0:0.0:0.0	.	510	P00747	PLMN_HUMAN	H	510	ENSP00000308938:P510H	ENSP00000308938:P510H	P	+	2	0	PLG	161072857	1.000000	0.71417	0.999000	0.59377	0.285000	0.27093	5.440000	0.66563	2.305000	0.77605	0.557000	0.71058	CCC	.		0.527	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
SFT2D1	113402	bcgsc.ca	37	6	166738061	166738061	+	Missense_Mutation	SNP	A	A	C	rs78154309		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr6:166738061A>C	ENST00000361731.3	-	6	483	c.374T>G	c.(373-375)gTg>gGg	p.V125G	SFT2D1_ENST00000487841.1_5'UTR	NM_145169.1	NP_660152.1			SFT2 domain containing 1											NS(1)|central_nervous_system(1)|large_intestine(3)|upper_aerodigestive_tract(1)	6		Breast(66;0.000148)|Prostate(117;0.109)|Ovarian(120;0.199)		OV - Ovarian serous cystadenocarcinoma(33;2.63e-19)|BRCA - Breast invasive adenocarcinoma(81;4.92e-06)|GBM - Glioblastoma multiforme(31;4.58e-05)		GCAGAATAACACAGCCAGTCC	0.368																																					p.V125G													.	SFT2D1-514	0			c.T374G						.						117.0	106.0	110.0					6																	166738061		2203	4300	6503	SO:0001583	missense	113402	exon6			AATAACACAGCCA	AF041429	CCDS5292.1	6q27	2008-02-05	2005-07-25	2005-07-25	ENSG00000198818	ENSG00000198818			21102	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 83"""	C6orf83			Standard	NM_145169		Approved	MGC19825, pRGR1	uc003qux.3	Q8WV19	OTTHUMG00000016001	ENST00000361731.3:c.374T>G	6.37:g.166738061A>C	ENSP00000354590:p.Val125Gly	Somatic	69	0		WXS	Illumina HiSeq	Phase_1	51	22	NM_145169	0	0	53	72	19		Missense_Mutation	SNP	ENST00000361731.3	37	CCDS5292.1	.	.	.	.	.	.	.	.	.	.	A	9.538	1.112522	0.20795	.	.	ENSG00000198818	ENST00000361731	T	0.60797	0.16	5.07	3.9	0.45041	.	0.327095	0.28595	N	0.014781	T	0.32041	0.0816	L	0.53617	1.68	0.21020	N	0.999807	B	0.30937	0.301	B	0.29440	0.102	T	0.25710	-1.0124	10	0.87932	D	0	-17.8432	9.058	0.36416	0.9119:0.0:0.0881:0.0	.	125	Q8WV19	SFT2A_HUMAN	G	125	ENSP00000354590:V125G	ENSP00000354590:V125G	V	-	2	0	SFT2D1	166658051	0.575000	0.26692	0.001000	0.08648	0.312000	0.27988	6.815000	0.75242	0.762000	0.33152	0.519000	0.50382	GTG	.		0.368	SFT2D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043061.2	NM_145169	
INTS1	26173	bcgsc.ca	37	7	1524994	1524994	+	Missense_Mutation	SNP	G	G	C	rs201952847		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:1524994G>C	ENST00000404767.3	-	23	3173	c.3088C>G	c.(3088-3090)Ctg>Gtg	p.L1030V	INTS1_ENST00000389470.4_Missense_Mutation_p.L1192V	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	1030					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		AGGTCCCGCAGCAGCCACTGA	0.692																																					p.L1030V													.	.	0			c.C3088G						.						32.0	46.0	41.0					7																	1524994		2087	4208	6295	SO:0001583	missense	26173	exon23			CCCGCAGCAGCCA	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.3088C>G	7.37:g.1524994G>C	ENSP00000385722:p.Leu1030Val	Somatic	62	0		WXS	Illumina HiSeq	Phase_1	104	57	NM_001080453	0	0	10	10	0	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	37	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734445	0.69189	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.53857	0.6;0.62	5.31	4.23	0.50019	.	0.000000	0.64402	D	0.000001	T	0.60521	0.2275	L	0.61387	1.9	0.52501	D	0.999954	P;P	0.52316	0.897;0.952	P;P	0.54924	0.764;0.764	T	0.60835	-0.7184	10	0.45353	T	0.12	.	11.3697	0.49692	0.1569:0.0:0.8431:0.0	.	1198;1030	A4D213;Q8N201	.;INT1_HUMAN	V	1030;1192	ENSP00000385722:L1030V;ENSP00000374121:L1192V	ENSP00000374121:L1192V	L	-	1	2	INTS1	1491520	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.675000	0.46875	2.485000	0.83878	0.561000	0.74099	CTG	.		0.692	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1		
TNRC18	84629	bcgsc.ca	37	7	5427392	5427392	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:5427392A>C	ENST00000430969.1	-	5	2411	c.2063T>G	c.(2062-2064)gTg>gGg	p.V688G	TNRC18_ENST00000399537.4_Missense_Mutation_p.V688G	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	688							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CTGCCGGGCCACAGCCACTGC	0.677																																					p.V688G													.	TNRC18-46	0			c.T2063G						.						29.0	34.0	33.0					7																	5427392		1817	3913	5730	SO:0001583	missense	84629	exon5			CGGGCCACAGCCA	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.2063T>G	7.37:g.5427392A>C	ENSP00000395538:p.Val688Gly	Somatic	82	0		WXS	Illumina HiSeq	Phase_1	252	164	NM_001080495	0	0	15	17	2	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	a	13.46	2.244619	0.39697	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000413081	T;T	0.18960	2.18;2.18	4.47	4.47	0.54385	.	.	.	.	.	T	0.45316	0.1336	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.48525	-0.9028	9	0.87932	D	0	.	13.7834	0.63094	1.0:0.0:0.0:0.0	.	688	O15417	TNC18_HUMAN	G	688;688;90	ENSP00000382452:V688G;ENSP00000395538:V688G	ENSP00000382452:V688G	V	-	2	0	TNRC18	5393918	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.684000	0.91242	1.641000	0.50575	0.454000	0.30748	GTG	.		0.677	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
HOXA4	3201	hgsc.bcm.edu	37	7	27170159	27170159	+	Missense_Mutation	SNP	C	C	T	rs6962314	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:27170159C>T	ENST00000360046.5	-	1	259	c.194G>A	c.(193-195)gGc>gAc	p.G65D	HOXA4_ENST00000428284.2_Missense_Mutation_p.G65D|HOXA3_ENST00000521401.1_Intron|HOXA-AS2_ENST00000521687.1_RNA|HOXA-AS2_ENST00000521159.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS2_ENST00000517550.1_RNA|HOXA-AS3_ENST00000518848.1_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	65	Pro-rich (part of the transcriptional activation domain).				anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						CTCTCGGCCGCCGCCCGCGTG	0.801													C|||	762	0.152157	0.2284	0.232	5008	,	,		3644	0.1359		0.1014	False		,,,				2504	0.0613				p.G65D		.											.	HOXA4-153	0			c.G194A						.	C	ASP/GLY	255,1391		4,247,572	1.0	1.0	1.0		194	2.0	1.0	7	dbSNP_116	1	269,3643		9,251,1696	no	missense	HOXA4	NM_002141.4	94	13,498,2268	TT,TC,CC		6.8763,15.4921,9.4279	probably-damaging	65/321	27170159	524,5034	823	1956	2779	SO:0001583	missense	3201	exon1			CGGCCGCCGCCCG		CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.194G>A	7.37:g.27170159C>T	ENSP00000353151:p.Gly65Asp	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	7	7	NM_002141	0	0	0	0	0	A4D180|O43366	Missense_Mutation	SNP	ENST00000360046.5	37	CCDS5405.1	367	0.16804029304029305	137	0.2784552845528455	73	0.20165745856353592	75	0.13111888111888112	82	0.10817941952506596	C	17.17	3.321133	0.60634	0.154921	0.068763	ENSG00000197576	ENST00000360046;ENST00000428284	T;T	0.50277	0.75;0.75	4.04	2.04	0.26737	.	3.419590	0.01272	U	0.009493	T	0.00012	0.0000	L	0.29908	0.895	0.45634	P	0.001434999999999964	B	0.24186	0.099	B	0.19391	0.025	T	0.10776	-1.0615	9	0.33141	T	0.24	.	5.9117	0.19031	0.0:0.5528:0.2427:0.2045	rs6962314;rs58352262	65	Q00056	HXA4_HUMAN	D	65	ENSP00000353151:G65D;ENSP00000408845:G65D	ENSP00000353151:G65D	G	-	2	0	HOXA4	27136684	0.002000	0.14202	0.997000	0.53966	0.870000	0.49936	1.131000	0.31406	0.828000	0.34709	0.298000	0.19748	GGC	C|0.832;T|0.168		0.801	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059534.4		
GCK	2645	ucsc.edu	37	7	44186168	44186168	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:44186168C>A	ENST00000403799.3	-	8	1382	c.913G>T	c.(913-915)Gtg>Ttg	p.V305L	GCK_ENST00000395796.3_Missense_Mutation_p.V304L|GCK_ENST00000345378.2_Missense_Mutation_p.V306L|GCK_ENST00000437084.1_Missense_Mutation_p.V288L	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	305	Hexokinase type-2.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						CTGAGCAGCACAAGCCGCACC	0.627																																					p.V306L													.	GCK-416	0			c.G916T						.						100.0	88.0	92.0					7																	44186168		2203	4300	6503	SO:0001583	missense	2645	exon8			GCAGCACAAGCCG	AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.913G>T	7.37:g.44186168C>A	ENSP00000384247:p.Val305Leu	Somatic	81	0		WXS	Illumina HiSeq		346	107	NM_033507	0	0	0	0	0	A4D2J2|A4D2J3|Q05810	Missense_Mutation	SNP	ENST00000403799.3	37	CCDS5479.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.921425	0.52653	.	.	ENSG00000106633	ENST00000403799;ENST00000395796;ENST00000345378;ENST00000437084	D;D;D;D	0.96940	-4.18;-4.18;-4.18;-4.18	4.77	2.9	0.33743	Hexokinase, C-terminal (1);	0.192236	0.44097	N	0.000484	D	0.94470	0.8220	M	0.67625	2.065	0.58432	D	0.999999	B;B;B	0.33044	0.395;0.013;0.343	B;B;B	0.28916	0.096;0.027;0.058	D	0.91605	0.5298	10	0.56958	D	0.05	-17.2758	14.3797	0.66902	0.0:0.7175:0.2825:0.0	.	305;306;304	P35557;P35557-2;P35557-3	HXK4_HUMAN;.;.	L	305;304;306;288	ENSP00000384247:V305L;ENSP00000379142:V304L;ENSP00000223366:V306L;ENSP00000402840:V288L	ENSP00000223366:V306L	V	-	1	0	GCK	44152693	0.936000	0.31750	0.464000	0.27143	0.554000	0.35429	2.046000	0.41260	0.402000	0.25451	-0.282000	0.10007	GTG	.		0.627	GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251069.2		
ELN	2006	bcgsc.ca	37	7	73466289	73466289	+	Missense_Mutation	SNP	G	G	C	rs200525318		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:73466289G>C	ENST00000252034.7	+	17	1324	c.925G>C	c.(925-927)Gca>Cca	p.A309P	ELN_ENST00000320492.7_Missense_Mutation_p.A273P|ELN_ENST00000445912.1_Missense_Mutation_p.A309P|ELN_ENST00000380553.4_Missense_Mutation_p.A192P|ELN_ENST00000458204.1_Missense_Mutation_p.A299P|ELN_ENST00000357036.5_Missense_Mutation_p.A314P|ELN_ENST00000380584.4_Missense_Mutation_p.A295P|ELN_ENST00000380575.4_Missense_Mutation_p.A299P|ELN_ENST00000380562.4_Missense_Mutation_p.A309P|ELN_ENST00000380576.5_Missense_Mutation_p.A309P|ELN_ENST00000429192.1_Missense_Mutation_p.A314P|ELN_ENST00000320399.6_Missense_Mutation_p.A309P|ELN_ENST00000414324.1_Missense_Mutation_p.A304P|ELN_ENST00000358929.4_Missense_Mutation_p.A309P	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	309	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				AGCTGCAGCAGCAGCCGCTAA	0.647			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""				OREG0018112	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A314P				Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN-95	0			c.G940C						.						35.0	41.0	39.0					7																	73466289		2182	4265	6447	SO:0001583	missense	2006	exon17			GCAGCAGCAGCCG		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.925G>C	7.37:g.73466289G>C	ENSP00000252034:p.Ala309Pro	Somatic	73	0	1145	WXS	Illumina HiSeq	Phase_1	209	112	NM_001081753	0	0	0	0	0	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	G	11.82	1.751682	0.31046	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000438906;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58797	0.44;0.42;0.53;0.42;0.31;0.4;0.48;0.35;0.51;0.49;0.43;0.48;0.56;0.5;0.41	4.64	4.64	0.57946	.	.	.	.	.	T	0.65123	0.2661	L	0.38175	1.15	0.23496	N	0.997552	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.85130	0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997;0.997	T	0.54708	-0.8253	9	0.19590	T	0.45	.	13.47	0.61278	0.0:0.0:1.0:0.0	.	309;278;273;304;299;309;299;314;314;309;192;265;295;309	E7ENM0;E9PBM4;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.;.	P	309;309;309;273;287;304;309;299;295;299;314;314;278;192;309;309	ENSP00000389857:A309P;ENSP00000252034:A309P;ENSP00000351807:A309P;ENSP00000315607:A273P;ENSP00000406949:A287P;ENSP00000392575:A304P;ENSP00000369936:A309P;ENSP00000369949:A299P;ENSP00000369958:A295P;ENSP00000403162:A299P;ENSP00000349540:A314P;ENSP00000391129:A314P;ENSP00000369926:A192P;ENSP00000369950:A309P;ENSP00000313565:A309P	ENSP00000252034:A309P	A	+	1	0	ELN	73104225	0.984000	0.35163	0.074000	0.20217	0.083000	0.17756	5.009000	0.63998	2.319000	0.78375	0.449000	0.29647	GCA	.		0.647	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
TRIM73	375593	hgsc.bcm.edu	37	7	75028469	75028469	+	Silent	SNP	A	A	G	rs142958137	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:75028469A>G	ENST00000437796.1	+	1	271	c.252A>G	c.(250-252)ccA>ccG	p.P84P	TRIM73_ENST00000323819.3_Silent_p.P84P|TRIM73_ENST00000447409.2_Silent_p.P84P|TRIM73_ENST00000450434.1_5'UTR|TRIM73_ENST00000430211.1_Silent_p.P84P			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	84						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						CTGGGGACCCAGAGCCCAAGG	0.667													G|||	3571	0.713059	0.7163	0.6974	5008	,	,		6749	0.874		0.5527	False		,,,				2504	0.7188				p.P84P		.											.	TRIM74-40	0			c.A252G						.						9.0	28.0	23.0					7																	75028469		810	2167	2977	SO:0001819	synonymous_variant	378108	exon2			GGACCCAGAGCCC	AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		ENST00000437796.1:c.252A>G	7.37:g.75028469A>G		Somatic	1	0		WXS	Illumina HiSeq	Phase_I	14	11	NM_198853	0	0	0	8	8	Q8N0S3	Silent	SNP	ENST00000437796.1	37	CCDS34665.1																																																																																			.		0.667	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342950.1		
DTX2	113878	hgsc.bcm.edu	37	7	76131725	76131725	+	Silent	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:76131725T>C	ENST00000324432.5	+	9	1851	c.1341T>C	c.(1339-1341)caT>caC	p.H447H	DTX2_ENST00000446600.1_Silent_p.H356H|DTX2_ENST00000446820.2_Silent_p.H400H|DTX2_ENST00000430490.2_Silent_p.H447H|DTX2_ENST00000413936.2_Silent_p.H447H|DTX2_ENST00000307569.8_Silent_p.H400H	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	447					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						AGTGCAGCCATGCCTTCCACC	0.632																																					p.H447H		.											.	DTX2-524	0			c.T1341C						.																																			SO:0001819	synonymous_variant	113878	exon8			CAGCCATGCCTTC		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1341T>C	7.37:g.76131725T>C		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	186	23	NM_001102594	0	0	35	53	18	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	ENST00000324432.5	37	CCDS5587.1																																																																																			.		0.632	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
ABCB4	5244	bcgsc.ca	37	7	87072688	87072688	+	Missense_Mutation	SNP	T	T	C	rs201292029	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:87072688T>C	ENST00000265723.4	-	12	1414	c.1303A>G	c.(1303-1305)Aag>Gag	p.K435E	ABCB4_ENST00000358400.3_Missense_Mutation_p.K435E|ABCB4_ENST00000359206.3_Missense_Mutation_p.K435E|ABCB4_ENST00000545634.1_Missense_Mutation_p.K435E|ABCB4_ENST00000453593.1_Missense_Mutation_p.K435E	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	435	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	GTTGTGCTCTTCCCACAGCCA	0.512													t|||	742	0.148163	0.0756	0.1931	5008	,	,		17284	0.2688		0.2237	False		,,,				2504	0.0123				p.K435E													.	ABCB4-96	0			c.A1303G						.						145.0	134.0	138.0					7																	87072688		2203	4300	6503	SO:0001583	missense	5244	exon12			TGCTCTTCCCACA	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.1303A>G	7.37:g.87072688T>C	ENSP00000265723:p.Lys435Glu	Somatic	183	1		WXS	Illumina HiSeq	Phase_1	85	47	NM_018850	0	0	3	3	0	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	t	27.9	4.870037	0.91587	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.98914	-5.23;-5.23;-5.23;-5.23;-5.23	5.05	5.05	0.67936	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.99563	0.9843	H	0.99475	4.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.99;0.984	D	0.97526	1.0076	10	0.87932	D	0	-14.9061	14.7881	0.69819	0.0:0.0:0.0:1.0	.	435;435;435	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	E	435	ENSP00000352135:K435E;ENSP00000351172:K435E;ENSP00000265723:K435E;ENSP00000392983:K435E;ENSP00000437465:K435E	ENSP00000265723:K435E	K	-	1	0	ABCB4	86910624	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.293000	0.72731	1.893000	0.54813	0.383000	0.25322	AAG	.		0.512	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
MUC17	140453	bcgsc.ca	37	7	100675714	100675714	+	Silent	SNP	G	G	C	rs538405099	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:100675714G>C	ENST00000306151.4	+	3	1081	c.1017G>C	c.(1015-1017)acG>acC	p.T339T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	339	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TAACAAGTACGCCTGCCAGCA	0.478													G|||	197	0.0393371	0.0408	0.0648	5008	,	,		24116	0.0278		0.0696	False		,,,				2504	0.0				p.T339T													.	MUC17-95	0			c.G1017C						.						169.0	179.0	176.0					7																	100675714		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			AAGTACGCCTGCC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1017G>C	7.37:g.100675714G>C		Somatic	334	0		WXS	Illumina HiSeq	Phase_1	250	93	NM_001040105	0	0	0	0	0	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																			.		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
CAV2	858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116140377	116140377	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:116140377T>A	ENST00000222693.4	+	2	606	c.214T>A	c.(214-216)Tgc>Agc	p.C72S	AC002066.1_ENST00000446355.2_RNA|CAV2_ENST00000462876.1_3'UTR|CAV2_ENST00000393480.2_Missense_Mutation_p.C72S|CAV2_ENST00000343213.2_Intron	NM_001206747.1|NM_001206748.1|NM_001233.4	NP_001193676.1|NP_001193677.1|NP_001224.1	P51636	CAV2_HUMAN	caveolin 2	72					caveola assembly (GO:0070836)|endoplasmic reticulum organization (GO:0007029)|mitochondrion organization (GO:0007005)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of endothelial cell proliferation (GO:0001938)|protein oligomerization (GO:0051259)|regulation of mitosis (GO:0007088)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)|vesicle docking (GO:0048278)|vesicle fusion (GO:0006906)|vesicle organization (GO:0016050)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	D1 dopamine receptor binding (GO:0031748)|protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(1)|skin(1)	3	all_epithelial(6;1.53e-06)|Lung NSC(10;0.00592)|all_lung(10;0.00642)		STAD - Stomach adenocarcinoma(10;0.00878)			AGTGTGGATCTGCAGCCATGC	0.542																																					p.C72S		.											.	CAV2-90	0			c.T214A						.						169.0	138.0	149.0					7																	116140377		2203	4300	6503	SO:0001583	missense	858	exon2			TGGATCTGCAGCC	AF035752	CCDS5765.1, CCDS5766.1	7q31	2006-02-09			ENSG00000105971	ENSG00000105971			1528	protein-coding gene	gene with protein product		601048				8552590, 10087206	Standard	NM_001233		Approved	CAV	uc003vid.3	P51636	OTTHUMG00000023414	ENST00000222693.4:c.214T>A	7.37:g.116140377T>A	ENSP00000222693:p.Cys72Ser	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	348	92	NM_001233	0	1	100	156	55	A4D0U2|Q9UGM7	Missense_Mutation	SNP	ENST00000222693.4	37	CCDS5766.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420268	0.83559	.	.	ENSG00000105971	ENST00000222693;ENST00000393480	D;D	0.92249	-3.0;-3.0	4.6	4.6	0.57074	.	0.193833	0.56097	D	0.000032	D	0.93213	0.7838	M	0.85197	2.74	0.39643	D	0.970342	P	0.35656	0.514	B	0.41135	0.348	D	0.93194	0.6586	10	0.36615	T	0.2	-15.4697	14.2879	0.66258	0.0:0.0:0.0:1.0	.	72	P51636	CAV2_HUMAN	S	72	ENSP00000222693:C72S;ENSP00000377120:C72S	ENSP00000222693:C72S	C	+	1	0	CAV2	115927613	0.972000	0.33761	1.000000	0.80357	0.995000	0.86356	1.530000	0.36007	1.828000	0.53243	0.460000	0.39030	TGC	.		0.542	CAV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059735.4	NM_001233	
MET	4233	bcgsc.ca	37	7	116380999	116380999	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:116380999T>G	ENST00000318493.6	+	5	1808	c.1621T>G	c.(1621-1623)Tgc>Ggc	p.C541G	MET_ENST00000495962.1_3'UTR|MET_ENST00000436117.2_Missense_Mutation_p.C541G|MET_ENST00000397752.3_Missense_Mutation_p.C541G			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GTGTGGCTGGTGCCACGACAA	0.522			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.C541G				Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	0			c.T1621G						.						112.0	115.0	114.0					7																	116380999		1964	4139	6103	SO:0001583	missense	4233	exon5	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GGCTGGTGCCACG	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1621T>G	7.37:g.116380999T>G	ENSP00000317272:p.Cys541Gly	Somatic	115	0		WXS	Illumina HiSeq	Phase_1	81	35	NM_000245	0	0	139	161	22	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.557636	0.86231	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.31769	1.48;1.48;1.48	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.60521	0.2275	M	0.83953	2.67	0.80722	D	1	D;P;D;D;D;D;D;D	0.89917	1.0;0.931;0.978;0.998;0.999;0.999;0.995;0.999	D;D;P;D;D;D;P;D	0.87578	0.998;0.948;0.872;0.996;0.99;0.986;0.878;0.976	T	0.65865	-0.6064	10	0.72032	D	0.01	.	16.3594	0.83251	0.0:0.0:0.0:1.0	.	541;541;541;541;541;541;541;541	B5A929;E7EQ94;B5A930;B5A934;B5A937;B5A939;P08581-2;P08581	.;.;.;.;.;.;.;MET_HUMAN	G	541	ENSP00000380860:C541G;ENSP00000317272:C541G;ENSP00000410980:C541G	ENSP00000317272:C541G	C	+	1	0	MET	116168235	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.208000	0.58486	2.266000	0.75297	0.455000	0.32223	TGC	.		0.522	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
NUP205	23165	bcgsc.ca	37	7	135290919	135290919	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:135290919A>G	ENST00000285968.6	+	20	2876	c.2850A>G	c.(2848-2850)ggA>ggG	p.G950G		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	950					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TAATGGCTGGATTTGTGGAGT	0.318																																					p.G950G													.	NUP205-207	0			c.A2850G						.						186.0	186.0	186.0					7																	135290919		2203	4300	6503	SO:0001819	synonymous_variant	23165	exon20			GGCTGGATTTGTG	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.2850A>G	7.37:g.135290919A>G		Somatic	224	0		WXS	Illumina HiSeq	Phase_1	182	63	NM_015135	0	0	16	19	3	A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	37	CCDS34759.1																																																																																			.		0.318	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
SLC13A4	26266	bcgsc.ca	37	7	135384143	135384143	+	Missense_Mutation	SNP	T	T	G	rs201310555		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:135384143T>G	ENST00000354042.4	-	8	1554	c.865A>C	c.(865-867)Acc>Ccc	p.T289P		NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	289					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						ATGAGGCTGGTGGAGGTGCCG	0.507																																					p.T289P													.	SLC13A4-90	0			c.A865C						.						128.0	113.0	118.0					7																	135384143		2203	4300	6503	SO:0001583	missense	26266	exon8			GGCTGGTGGAGGT	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.865A>C	7.37:g.135384143T>G	ENSP00000297282:p.Thr289Pro	Somatic	39	1		WXS	Illumina HiSeq	Phase_1	75	45	NM_012450	0	0	0	0	0	A4D1Q4|Q8N631	Missense_Mutation	SNP	ENST00000354042.4	37	CCDS5840.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.996515	0.35226	.	.	ENSG00000164707	ENST00000354042	T	0.02177	4.41	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.04182	0.0116	N	0.13198	0.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.52815	-0.8525	10	0.02654	T	1	.	14.2529	0.66031	0.0:0.0:0.0:1.0	.	158;289	Q59HF0;Q9UKG4	.;S13A4_HUMAN	P	289	ENSP00000297282:T289P	ENSP00000297282:T289P	T	-	1	0	SLC13A4	135034683	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.054000	0.64275	2.246000	0.74042	0.533000	0.62120	ACC	T|0.999;G|0.001		0.507	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	NM_012450	
OR9A2	135924	hgsc.bcm.edu	37	7	142724166	142724166	+	Silent	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:142724166C>G	ENST00000350513.2	-	1	116	c.54G>C	c.(52-54)ggG>ggC	p.G18G		NM_001001658.1	NP_001001658.1	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A, member 2	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(3)|endometrium(4)|large_intestine(1)|lung(14)|skin(3)	25	Melanoma(164;0.059)					GTCCTTGGGACCCAGGGAAGC	0.408																																					p.G18G		.											.	OR9A2-69	0			c.G54C						.						77.0	75.0	76.0					7																	142724166		2203	4300	6503	SO:0001819	synonymous_variant	135924	exon1			TTGGGACCCAGGG		CCDS34767.1	7q34	2014-07-10			ENSG00000179468	ENSG00000179468		"""GPCR / Class A : Olfactory receptors"""	15093	protein-coding gene	gene with protein product							Standard	NM_001001658		Approved		uc003wcc.1	Q8NGT5	OTTHUMG00000158386	ENST00000350513.2:c.54G>C	7.37:g.142724166C>G		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_001001658	0	0	0	0	0	B9EH51|Q6IF71|Q8NGD9	Silent	SNP	ENST00000350513.2	37	CCDS34767.1																																																																																			.		0.408	OR9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350862.1		
SSPO	23145	hgsc.bcm.edu	37	7	149485465	149485465	+	RNA	SNP	A	A	C	rs200617080		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:149485465A>C	ENST00000378016.2	+	0	3871							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTGTCCCCCCACCTGCCATGA	0.652																																					p.T1291P		.											.	.	0			c.A3871C						.						32.0	39.0	37.0					7																	149485465		2072	4192	6264			23145	exon27			CCCCCCACCTGCC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149485465A>C		Somatic	36	1		WXS	Illumina HiSeq	Phase_I	175	96	NM_198455	0	0	0	0	0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																				A|0.996;C|0.004		0.652	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
LRRC61	65999	hgsc.bcm.edu	37	7	150033986	150033986	+	Silent	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:150033986C>G	ENST00000359623.4	+	3	624	c.36C>G	c.(34-36)ggC>ggG	p.G12G	LRRC61_ENST00000323078.7_Silent_p.G12G|LRRC61_ENST00000493307.1_Silent_p.G12G	NM_001142928.1	NP_001136400.1	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	12										endometrium(2)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			GAGAGGCTGGCGGACTGCAGA	0.637																																					p.G12G		.											.	LRRC61-90	0			c.C36G						.						47.0	54.0	51.0					7																	150033986		2203	4300	6503	SO:0001819	synonymous_variant	65999	exon2			GGCTGGCGGACTG	BC001354	CCDS5901.1	7q31-q35	2006-02-07			ENSG00000127399	ENSG00000127399			21704	protein-coding gene	gene with protein product							Standard	NM_023942		Approved	MGC3036, FLJ31392, HSPC295	uc003wgv.4	Q9BV99	OTTHUMG00000158326	ENST00000359623.4:c.36C>G	7.37:g.150033986C>G		Somatic	109	2		WXS	Illumina HiSeq	Phase_I	413	108	NM_023942	0	1	43	44	0	B3KUW0|D3DWY8	Silent	SNP	ENST00000359623.4	37	CCDS5901.1																																																																																			.		0.637	LRRC61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350696.1	NM_023942	
TMEM176A	55365	ucsc.edu	37	7	150500797	150500797	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:150500797C>A	ENST00000484928.1	+	5	1013	c.432C>A	c.(430-432)taC>taA	p.Y144*	TMEM176A_ENST00000461345.1_Nonsense_Mutation_p.Y85*|TMEM176A_ENST00000004103.3_Nonsense_Mutation_p.Y144*|TMEM176B_ENST00000447204.2_5'Flank			Q96HP8	T176A_HUMAN	transmembrane protein 176A	144					negative regulation of dendritic cell differentiation (GO:2001199)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|lung(7)|ovary(2)|stomach(1)	12			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GATATGGCTACTCTTATTACA	0.537																																					p.Y144X													.	TMEM176A-92	0			c.C432A						.						70.0	75.0	73.0					7																	150500797		2203	4300	6503	SO:0001587	stop_gained	55365	exon5			TGGCTACTCTTAT	AF258340	CCDS5909.1	7q36.1	2006-09-04			ENSG00000002933	ENSG00000002933			24930	protein-coding gene	gene with protein product		610334				12097419, 8889548	Standard	NM_018487		Approved	HCA112	uc003whx.1	Q96HP8	OTTHUMG00000158114	ENST00000484928.1:c.432C>A	7.37:g.150500797C>A	ENSP00000417626:p.Tyr144*	Somatic	76	1		WXS	Illumina HiSeq		204	54	NM_018487	1	2	861	895	31	D3DX00|Q9NYC7	Nonsense_Mutation	SNP	ENST00000484928.1	37	CCDS5909.1	.	.	.	.	.	.	.	.	.	.	C	8.438	0.850128	0.17034	.	.	ENSG00000002933	ENST00000484928;ENST00000004103;ENST00000461345;ENST00000475536;ENST00000468689	.	.	.	.	.	.	.	3.470060	0.00622	N	0.000457	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-3.8712	.	.	.	.	.	.	.	X	144;144;85;96;85	.	ENSP00000004103:Y144X	Y	+	3	2	TMEM176A	150131730	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.145000	0.16157	0.119000	0.18210	0.121000	0.15741	TAC	.		0.537	TMEM176A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350222.1	NM_018487	
GALNTL5	168391	bcgsc.ca	37	7	151699853	151699853	+	Missense_Mutation	SNP	A	A	G	rs200114484		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:151699853A>G	ENST00000392800.2	+	6	967	c.713A>G	c.(712-714)gAg>gGg	p.E238G	GALNTL5_ENST00000431418.2_Missense_Mutation_p.E238G|GALNTL5_ENST00000483959.1_3'UTR	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	238	Catalytic subdomain A.				spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		GTATGGCTGGAGCCCCTGCTG	0.517																																					p.E238G													.	GALNTL5-92	0			c.A713G						.						95.0	90.0	91.0					7																	151699853		2203	4300	6503	SO:0001583	missense	168391	exon6			GGCTGGAGCCCCT	AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.713A>G	7.37:g.151699853A>G	ENSP00000376548:p.Glu238Gly	Somatic	63	0		WXS	Illumina HiSeq	Phase_1	60	31	NM_145292	0	0	0	0	0	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	37	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.084186	0.76642	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.68025	-0.3;-0.3	4.83	4.83	0.62350	Glycosyl transferase, family 2 (1);	0.143577	0.32386	N	0.006165	D	0.87309	0.6145	H	0.98048	4.135	0.45747	D	0.998645	D	0.63880	0.993	D	0.65323	0.934	D	0.91788	0.5441	10	0.87932	D	0	.	14.04	0.64669	1.0:0.0:0.0:0.0	.	238	Q7Z4T8	GLTL5_HUMAN	G	238	ENSP00000392582:E238G;ENSP00000376548:E238G	ENSP00000376548:E238G	E	+	2	0	GALNTL5	151330786	1.000000	0.71417	1.000000	0.80357	0.613000	0.37349	6.923000	0.75817	2.160000	0.67779	0.528000	0.53228	GAG	.		0.517	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292	
PAXIP1	22976	bcgsc.ca	37	7	154745994	154745994	+	Missense_Mutation	SNP	T	T	C	rs78770148		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:154745994T>C	ENST00000404141.1	-	16	2946	c.2792A>G	c.(2791-2793)gAa>gGa	p.E931G	PAXIP1_ENST00000473219.1_5'UTR|RP11-5C23.1_ENST00000608064.1_RNA|RP11-5C23.2_ENST00000609134.1_RNA|PAXIP1_ENST00000397192.1_Missense_Mutation_p.E931G			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	931	BRCT 5. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GAAGCATTCTTCCAGCCACTC	0.448																																					p.E931G													.	PAXIP1-228	0			c.A2792G						.						100.0	100.0	100.0					7																	154745994		1994	4181	6175	SO:0001583	missense	22976	exon16			CATTCTTCCAGCC	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.2792A>G	7.37:g.154745994T>C	ENSP00000384048:p.Glu931Gly	Somatic	124	0		WXS	Illumina HiSeq	Phase_1	68	26	NM_007349	0	0	4	5	1	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	ENST00000404141.1	37	CCDS47753.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.832103	0.50845	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	T;T	0.79845	-1.31;-1.31	4.61	4.61	0.57282	BRCT (4);	0.109676	0.38164	U	0.001800	D	0.87505	0.6194	M	0.75615	2.305	0.58432	D	0.999997	D;D;D	0.76494	0.999;0.992;0.992	D;P;P	0.66351	0.943;0.853;0.812	D	0.86385	0.1732	10	0.30078	T	0.28	-31.4357	14.3281	0.66534	0.0:0.0:0.0:1.0	.	884;897;931	B4DEQ6;Q6ZW49-1;Q6ZW49	.;.;PAXI1_HUMAN	G	931;931;755;884	ENSP00000384048:E931G;ENSP00000380376:E931G	ENSP00000319149:E884G	E	-	2	0	PAXIP1	154376927	1.000000	0.71417	0.970000	0.41538	0.666000	0.39218	7.702000	0.84576	1.847000	0.53656	0.528000	0.53228	GAA	.		0.448	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
CSMD1	64478	bcgsc.ca	37	8	2820801	2820801	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr8:2820801C>G	ENST00000520002.1	-	61	9955	c.9400G>C	c.(9400-9402)Gcc>Ccc	p.A3134P	CSMD1_ENST00000602723.1_Missense_Mutation_p.A2957P|CSMD1_ENST00000400186.3_Missense_Mutation_p.A2957P|CSMD1_ENST00000537824.1_Missense_Mutation_p.A3133P|CSMD1_ENST00000542608.1_Missense_Mutation_p.A2956P|CSMD1_ENST00000602557.1_Missense_Mutation_p.A3134P			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3134	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.A3133S(1)|p.A2862S(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAGAGGATGGCGGAGTGAGAG	0.582																																					p.A3133P													.	CSMD1-86	2	Substitution - Missense(2)	large_intestine(2)	c.G9397C						.																																			SO:0001583	missense	64478	exon60			GGATGGCGGAGTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9400G>C	8.37:g.2820801C>G	ENSP00000430733:p.Ala3134Pro	Somatic	156	0		WXS	Illumina HiSeq	Phase_1	132	44	NM_033225	0	0	0	0	0	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.70|11.70	1.717641|1.717641	0.30413|0.30413	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.64618|.	-0.11;-0.11;-0.11;-0.11|.	5.69|5.69	4.82|4.82	0.62117|0.62117	Complement control module (2);Sushi/SCR/CCP (3);|.	0.072136|.	0.53938|.	D|.	0.000044|.	T|T	0.61286|0.61286	0.2335|0.2335	L|L	0.54863|0.54863	1.705|1.705	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.998;0.995|.	D;D;D|.	0.91635|.	0.999;0.991;0.947|.	T|T	0.59359|0.59359	-0.7469|-0.7469	10|5	0.39692|.	T|.	0.17|.	.|.	11.0295|11.0295	0.47763|0.47763	0.0:0.8583:0.0:0.1417|0.0:0.8583:0.0:0.1417	.|.	3134;3134;2956|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	P|P	2957;3134;2995;3133;2956|2550	ENSP00000383047:A2957P;ENSP00000430733:A3134P;ENSP00000441462:A3133P;ENSP00000446243:A2956P|.	ENSP00000320445:A2995P|.	A|R	-|-	1|2	0|0	CSMD1|CSMD1	2808208|2808208	0.981000|0.981000	0.34729|0.34729	0.885000|0.885000	0.34714|0.34714	0.079000|0.079000	0.17450|0.17450	2.561000|2.561000	0.45905|0.45905	1.418000|1.418000	0.47098|0.47098	-0.126000|-0.126000	0.14955|0.14955	GCC|CGC	.		0.582	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
MFHAS1	9258	bcgsc.ca	37	8	8749589	8749589	+	Missense_Mutation	SNP	T	T	C	rs201528283		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr8:8749589T>C	ENST00000276282.6	-	1	1566	c.980A>G	c.(979-981)gAt>gGt	p.D327G		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	327										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GCGGTTATTATCCAGCCACAA	0.642																																					p.D327G	Melanoma(103;1201 2045 17515 28966)												.	MFHAS1-90	0			c.A980G						.																																			SO:0001583	missense	9258	exon1			TTATTATCCAGCC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.980A>G	8.37:g.8749589T>C	ENSP00000276282:p.Asp327Gly	Somatic	84	0		WXS	Illumina HiSeq	Phase_1	95	53	NM_004225	0	0	2	2	0	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.586236	0.66105	.	.	ENSG00000147324	ENST00000276282	T	0.24723	1.84	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.32793	0.0841	N	0.17872	0.535	0.80722	D	1	D	0.76494	0.999	D	0.68353	0.957	T	0.07790	-1.0754	10	0.19590	T	0.45	.	14.6924	0.69096	0.0:0.0:0.0:1.0	.	327	Q9Y4C4	MFHA1_HUMAN	G	327	ENSP00000276282:D327G	ENSP00000276282:D327G	D	-	2	0	MFHAS1	8786999	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.929000	0.87595	2.059000	0.61396	0.460000	0.39030	GAT	T|0.999;C|0.001		0.642	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
DPYSL2	1808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	26505196	26505196	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr8:26505196T>A	ENST00000311151.5	+	11	1573	c.1161T>A	c.(1159-1161)aaT>aaA	p.N387K	DPYSL2_ENST00000521913.1_Missense_Mutation_p.N351K|DPYSL2_ENST00000523027.1_Missense_Mutation_p.N351K	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	387					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)			breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		CCAGCACCAATGCAGCCAAAG	0.552																																					p.N492K		.											.	DPYSL2-153	0			c.T1476A						.						133.0	121.0	125.0					8																	26505196		2203	4300	6503	SO:0001583	missense	1808	exon11			CACCAATGCAGCC	D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.1161T>A	8.37:g.26505196T>A	ENSP00000309539:p.Asn387Lys	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	190	118	NM_001197293	0	0	25	84	59	A8K5H2|B4DR31|D3DSS7|O00424	Missense_Mutation	SNP	ENST00000311151.5	37	CCDS6051.1	.	.	.	.	.	.	.	.	.	.	T	19.82	3.898016	0.72639	.	.	ENSG00000092964	ENST00000545637;ENST00000521913;ENST00000311151;ENST00000522745;ENST00000523027	D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07	5.22	-6.76	0.01732	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.96144	0.8743	M	0.92367	3.3	0.53688	D	0.999974	D;P	0.76494	0.999;0.835	D;B	0.83275	0.996;0.269	D	0.94988	0.8132	10	0.66056	D	0.02	-27.4582	18.9516	0.92643	0.0:0.601:0.0:0.399	.	387;443	Q16555;Q59GB4	DPYL2_HUMAN;.	K	26;351;387;387;351	ENSP00000427985:N351K;ENSP00000309539:N387K;ENSP00000428909:N387K;ENSP00000431117:N351K	ENSP00000309539:N387K	N	+	3	2	DPYSL2	26561113	0.000000	0.05858	0.783000	0.31826	0.973000	0.67179	-2.232000	0.01205	-1.277000	0.02411	-1.098000	0.02139	AAT	.		0.552	DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216904.3	NM_001386	
TMEM67	91147	bcgsc.ca	37	8	94800161	94800161	+	Missense_Mutation	SNP	A	A	C	rs79555627		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr8:94800161A>C	ENST00000453321.3	+	14	1560	c.1502A>C	c.(1501-1503)aAc>aCc	p.N501T	TMEM67_ENST00000409623.3_Missense_Mutation_p.N420T	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	501					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			AAAGATGCCAACAGCCAGTCT	0.378																																					p.N501T													.	TMEM67-92	0			c.A1502C						.						164.0	145.0	152.0					8																	94800161		2203	4300	6503	SO:0001583	missense	91147	exon14			ATGCCAACAGCCA	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.1502A>C	8.37:g.94800161A>C	ENSP00000389998:p.Asn501Thr	Somatic	88	0		WXS	Illumina HiSeq	Phase_1	74	40	NM_153704	0	0	6	6	0	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	ENST00000453321.3	37	CCDS6258.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.205|0.205	-1.041705|-1.041705	0.02013|0.02013	.|.	.|.	ENSG00000164953|ENSG00000164953	ENST00000453321;ENST00000409623|ENST00000520680	D;D|.	0.96685|.	-4.09;-4.09|.	5.94|5.94	-3.96|-3.96	0.04106|0.04106	.|.	1.048890|.	0.07378|.	N|.	0.886978|.	T|T	0.17450|0.17450	0.0419|0.0419	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B;B|.	0.28055|.	0.01;0.014;0.199|.	B;B;B|.	0.27076|.	0.013;0.033;0.076|.	T|T	0.29088|0.29088	-1.0023|-1.0023	9|5	.|.	.|.	.|.	0.2887|0.2887	6.3924|6.3924	0.21593|0.21593	0.4842:0.2195:0.2963:0.0|0.4842:0.2195:0.2963:0.0	.|.	501;420;420|.	Q5HYA8;B3KRU5;G5E9H2|.	MKS3_HUMAN;.;.|.	T|H	501;420|108	ENSP00000389998:N501T;ENSP00000386966:N420T|.	.|.	N|Q	+|+	2|3	0|2	TMEM67|TMEM67	94869337|94869337	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.034000|-0.034000	0.12225|0.12225	-0.993000|-0.993000	0.03467|0.03467	-0.379000|-0.379000	0.06801|0.06801	AAC|CAA	.		0.378	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704	
UBR5	51366	bcgsc.ca	37	8	103300468	103300468	+	Silent	SNP	T	T	C	rs199686475		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr8:103300468T>C	ENST00000520539.1	-	36	5346	c.4740A>G	c.(4738-4740)ggA>ggG	p.G1580G	UBR5_ENST00000220959.4_Silent_p.G1580G|UBR5_ENST00000519528.1_5'UTR|UBR5_ENST00000521922.1_Silent_p.G1574G	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1580					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GATCCTCTTCTCCAGCCACAC	0.423																																					p.G1580G	Ovarian(131;96 1741 5634 7352 27489)												.	UBR5-761	0			c.A4740G						.						177.0	154.0	162.0					8																	103300468		2203	4300	6503	SO:0001819	synonymous_variant	51366	exon36			CTCTTCTCCAGCC	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.4740A>G	8.37:g.103300468T>C		Somatic	99	0		WXS	Illumina HiSeq	Phase_1	105	61	NM_015902	0	0	14	18	4	B2RP24|J3KMW7|O94970|Q9NPL3	Silent	SNP	ENST00000520539.1	37	CCDS34933.1																																																																																			T|0.999;C|0.001		0.423	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
EMC2	9694	hgsc.bcm.edu;broad.mit.edu	37	8	109498794	109498794	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr8:109498794C>G	ENST00000220853.3	+	11	896	c.861C>G	c.(859-861)gaC>gaG	p.D287E	EMC2_ENST00000520294.1_3'UTR	NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	287						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											CTGTCGAAGACATGTTGGAAA	0.338																																					p.D287E		.											.	.	0			c.C861G						.						80.0	80.0	80.0					8																	109498794		2203	4300	6503	SO:0001583	missense	9694	exon11			CGAAGACATGTTG	BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.861C>G	8.37:g.109498794C>G	ENSP00000220853:p.Asp287Glu	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	26	3	NM_014673	0	0	48	48	0	Q8WUE1	Missense_Mutation	SNP	ENST00000220853.3	37	CCDS6309.1	.	.	.	.	.	.	.	.	.	.	C	9.035	0.988299	0.18966	.	.	ENSG00000104412	ENST00000220853	.	.	.	5.95	5.95	0.96441	.	0.043479	0.85682	D	0.000000	T	0.23330	0.0564	N	0.01800	-0.715	0.45076	D	0.998095	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	9	0.02654	T	1	-19.3849	13.5585	0.61775	0.0:0.9292:0.0:0.0708	.	287	Q15006	TTC35_HUMAN	E	287	.	ENSP00000220853:D287E	D	+	3	2	TTC35	109567970	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.646000	0.46630	2.817000	0.96982	0.563000	0.77884	GAC	.		0.338	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380717.1	NM_014673	
LRRC24	441381	hgsc.bcm.edu	37	8	145748092	145748092	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr8:145748092C>T	ENST00000529415.2	-	5	1426	c.1309G>A	c.(1309-1311)Ggg>Agg	p.G437R	LRRC24_ENST00000533758.1_Missense_Mutation_p.G434R|LRRC14_ENST00000292524.1_3'UTR|LRRC14_ENST00000528528.1_3'UTR			Q50LG9	LRC24_HUMAN	leucine rich repeat containing 24	437						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(1)|lung(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CCCGGAGGCCCCCGCGCCTTT	0.692																																					p.G437R		.											.	LRRC24-90	0			c.G1309A						.						9.0	10.0	10.0					8																	145748092		2166	4273	6439	SO:0001583	missense	441381	exon5			GAGGCCCCCGCGC	AB178281	CCDS34969.1	8q24.3	2013-01-11			ENSG00000254402	ENSG00000254402		"""Immunoglobulin superfamily / I-set domain containing"""	28947	protein-coding gene	gene with protein product						7584026	Standard	NM_001024678		Approved	LRRC14OS	uc003zdm.3	Q50LG9	OTTHUMG00000165180	ENST00000529415.2:c.1309G>A	8.37:g.145748092C>T	ENSP00000434849:p.Gly437Arg	Somatic	6	2		WXS	Illumina HiSeq	Phase_I	22	19	NM_001024678	0	0	0	5	5		Missense_Mutation	SNP	ENST00000529415.2	37	CCDS34969.1	.	.	.	.	.	.	.	.	.	.	C	8.413	0.844629	0.16963	.	.	ENSG00000254402	ENST00000529415;ENST00000533758	T;T	0.55234	0.67;0.53	4.06	3.17	0.36434	.	1.184250	0.05990	N	0.645793	T	0.36386	0.0965	N	0.24115	0.695	0.09310	N	1	B;B	0.33583	0.418;0.047	B;B	0.33521	0.165;0.017	T	0.27571	-1.0070	10	0.15066	T	0.55	.	5.7465	0.18122	0.0:0.6941:0.2006:0.1053	.	434;437	G3V1D8;Q50LG9	.;LRC24_HUMAN	R	437;434	ENSP00000434849:G437R;ENSP00000435653:G434R	ENSP00000434849:G437R	G	-	1	0	LRRC24	145718900	0.462000	0.25791	0.003000	0.11579	0.002000	0.02628	2.025000	0.41059	1.286000	0.44565	-0.305000	0.09177	GGG	.		0.692	LRRC24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382501.2	NM_001024678	
PTPRD	5789	bcgsc.ca	37	9	8507427	8507427	+	Silent	SNP	C	C	G	rs202247306		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:8507427C>G	ENST00000381196.4	-	19	2094	c.1551G>C	c.(1549-1551)ggG>ggC	p.G517G	PTPRD_ENST00000537002.1_Silent_p.G514G|PTPRD_ENST00000360074.4_Silent_p.G504G|PTPRD_ENST00000358503.5_Silent_p.G504G|PTPRD_ENST00000355233.5_Silent_p.G517G|PTPRD_ENST00000397617.3_Silent_p.G507G|PTPRD_ENST00000486161.1_Silent_p.G517G|PTPRD_ENST00000540109.1_Silent_p.G517G|PTPRD_ENST00000397611.3_Silent_p.G514G|PTPRD_ENST00000356435.5_Silent_p.G517G|PTPRD_ENST00000397606.3_Silent_p.G507G	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	517					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTAGTGGCTGCCCTGGTACTA	0.428										TSP Lung(15;0.13)																											p.G517G													.	PTPRD-912	0			c.G1551C						.						152.0	144.0	147.0					9																	8507427		2203	4300	6503	SO:0001819	synonymous_variant	5789	exon11			TGGCTGCCCTGGT	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1551G>C	9.37:g.8507427C>G		Somatic	139	0		WXS	Illumina HiSeq	Phase_1	44	16	NM_130392	0	0	0	0	0	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	37	CCDS43786.1																																																																																			C|0.999;G|0.001		0.428	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
TEK	7010	bcgsc.ca	37	9	27173339	27173339	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:27173339A>G	ENST00000380036.4	+	6	1322	c.880A>G	c.(880-882)Aag>Gag	p.K294E	TEK_ENST00000406359.4_Missense_Mutation_p.K294E|TEK_ENST00000519097.1_Missense_Mutation_p.K190E	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	294	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	CACAGGCTGGAAGGGTCTGCA	0.488																																					p.K294E													.	TEK-1584	0			c.A880G						.						158.0	126.0	137.0					9																	27173339		2203	4300	6503	SO:0001583	missense	7010	exon6			GGCTGGAAGGGTC	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.880A>G	9.37:g.27173339A>G	ENSP00000369375:p.Lys294Glu	Somatic	93	0		WXS	Illumina HiSeq	Phase_1	30	12	NM_000459	0	0	0	0	0	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	A	13.73	2.323590	0.41096	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000346448;ENST00000406359;ENST00000519080	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.53	1.67	0.24075	Epidermal growth factor-like (1);EGF-like region, conserved site (2);	0.649250	0.14087	N	0.342261	T	0.73257	0.3564	M	0.66939	2.045	0.28602	N	0.909084	B;B;B;B;B;B	0.27823	0.002;0.06;0.002;0.19;0.008;0.161	B;B;B;B;B;B	0.24155	0.007;0.025;0.002;0.051;0.007;0.026	T	0.60429	-0.7265	10	0.25751	T	0.34	.	13.1595	0.59537	0.5962:0.4038:0.0:0.0	.	190;327;294;147;294;294	E7EWI2;Q59HG2;B5A953;E5RIV9;B4DHD3;Q02763	.;.;.;.;.;TIE2_HUMAN	E	190;294;294;294;147	ENSP00000430686:K190E;ENSP00000369375:K294E;ENSP00000383977:K294E;ENSP00000428337:K147E	ENSP00000343716:K294E	K	+	1	0	TEK	27163339	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.642000	0.37207	0.091000	0.17302	0.528000	0.53228	AAG	.		0.488	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
KIAA1045	23349	bcgsc.ca	37	9	34972515	34972515	+	Missense_Mutation	SNP	G	G	C	rs201479121		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:34972515G>C	ENST00000242315.3	+	3	633	c.551G>C	c.(550-552)aGc>aCc	p.S184T	KIAA1045_ENST00000544237.1_Missense_Mutation_p.S184T|KIAA1045_ENST00000476115.2_3'UTR	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	184							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			ACAGGCTGGAGCTGCCACTAC	0.562																																					p.S184T													.	KIAA1045-69	0			c.G551C						.						44.0	58.0	54.0					9																	34972515		2033	4168	6201	SO:0001583	missense	23349	exon3			GCTGGAGCTGCCA	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.551G>C	9.37:g.34972515G>C	ENSP00000242315:p.Ser184Thr	Somatic	77	0		WXS	Illumina HiSeq	Phase_1	152	100	NM_015297	0	0	0	0	0	B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	37	CCDS43796.1	.	.	.	.	.	.	.	.	.	.	g	29.8	5.034296	0.93575	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	5.73	5.73	0.89815	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.78117	0.4233	M	0.66939	2.045	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.75291	-0.3369	9	0.37606	T	0.19	3.3022	18.8848	0.92372	0.0:0.0:1.0:0.0	.	184	Q9UPV7	K1045_HUMAN	T	184	.	ENSP00000242315:S184T	S	+	2	0	KIAA1045	34962515	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.743000	0.91592	2.700000	0.92200	0.655000	0.94253	AGC	.		0.562	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592	
PIGO	84720	bcgsc.ca	37	9	35089137	35089137	+	Silent	SNP	A	A	C	rs200684520		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:35089137A>C	ENST00000378617.3	-	11	3616	c.3222T>G	c.(3220-3222)ggT>ggG	p.G1074G	PIGO_ENST00000298004.5_Silent_p.G657G|PIGO_ENST00000361778.2_Silent_p.G657G|PIGO_ENST00000341666.3_Silent_p.G1074G	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	1074					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.G1074G(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGCTCACAGCACCATCCACTC	0.522																																					p.G1074G													.	PIGO-290	1	Substitution - coding silent(1)	prostate(1)	c.T3222G						.						124.0	113.0	117.0					9																	35089137		2203	4300	6503	SO:0001819	synonymous_variant	84720	exon11			CACAGCACCATCC	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.3222T>G	9.37:g.35089137A>C		Somatic	107	0		WXS	Illumina HiSeq	Phase_1	98	63	NM_032634	0	0	36	48	12	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Silent	SNP	ENST00000378617.3	37	CCDS6575.1																																																																																			A|0.999;C|0.001		0.522	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634	
TLN1	7094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35711016	35711016	+	Silent	SNP	C	C	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:35711016C>T	ENST00000314888.9	-	31	4436	c.4083G>A	c.(4081-4083)aaG>aaA	p.K1361K	TLN1_ENST00000540444.1_Silent_p.K1361K	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1361	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TATCACACTCCTTCTGGCCGG	0.532																																					p.K1361K		.											.	TLN1-609	0			c.G4083A						.						107.0	94.0	98.0					9																	35711016		2203	4300	6503	SO:0001819	synonymous_variant	7094	exon31			ACACTCCTTCTGG	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4083G>A	9.37:g.35711016C>T		Somatic	49	0		WXS	Illumina HiSeq	Phase_I	184	49	NM_006289	0	0	84	135	51	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Silent	SNP	ENST00000314888.9	37	CCDS35009.1																																																																																			.		0.532	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
RASEF	158158	bcgsc.ca	37	9	85615928	85615928	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:85615928C>A	ENST00000376447.3	-	10	1580	c.1320G>T	c.(1318-1320)ttG>ttT	p.L440F		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	440					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TCAAGGTAGACAAGCCGCTGT	0.527																																					p.L440F													.	RASEF-280	0			c.G1320T						.						77.0	73.0	74.0					9																	85615928		2203	4300	6503	SO:0001583	missense	158158	exon10			GGTAGACAAGCCG	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.1320G>T	9.37:g.85615928C>A	ENSP00000365630:p.Leu440Phe	Somatic	65	0		WXS	Illumina HiSeq	Phase_1	50	23	NM_152573	0	0	5	5	0	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	37	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760639	0.69763	.	.	ENSG00000165105	ENST00000376447	T	0.62232	0.04	5.92	4.08	0.47627	.	0.157867	0.43919	D	0.000512	T	0.70090	0.3184	L	0.60455	1.87	0.80722	D	1	D	0.65815	0.995	P	0.61533	0.89	T	0.72279	-0.4340	10	0.72032	D	0.01	.	9.1415	0.36906	0.0:0.7804:0.0:0.2196	.	440	Q8IZ41	RASEF_HUMAN	F	440	ENSP00000365630:L440F	ENSP00000365630:L440F	L	-	3	2	RASEF	84805748	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.556000	0.36288	1.523000	0.49018	0.585000	0.79938	TTG	.		0.527	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
ZCCHC6	79670	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	88940291	88940291	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:88940291G>C	ENST00000375963.3	-	12	1919	c.1747C>G	c.(1747-1749)Cgg>Ggg	p.R583G	ZCCHC6_ENST00000375961.2_Missense_Mutation_p.R583G|ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.R460G|ZCCHC6_ENST00000469004.1_5'Flank	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	583	PAP-associated 1.				RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TTCAATTCCCGAGATACCAAT	0.403																																					p.R583G		.											.	ZCCHC6-92	0			c.C1747G						.						101.0	98.0	99.0					9																	88940291		2203	4300	6503	SO:0001583	missense	79670	exon12			ATTCCCGAGATAC	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.1747C>G	9.37:g.88940291G>C	ENSP00000365130:p.Arg583Gly	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	34	12	NM_024617	0	0	6	7	1	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.583577	0.65992	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963	T;T;T	0.78707	-1.2;-1.2;-1.2	5.1	5.1	0.69264	PAP/25A-associated (1);	0.000000	0.85682	D	0.000000	D	0.87358	0.6157	M	0.76838	2.35	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88322	0.2963	10	0.72032	D	0.01	-11.8038	13.6554	0.62336	0.0:0.0:0.8455:0.1544	.	460;583	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	G	460;583;583	ENSP00000365127:R460G;ENSP00000365128:R583G;ENSP00000365130:R583G	ENSP00000365127:R460G	R	-	1	2	ZCCHC6	88130111	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.937000	0.56575	2.658000	0.90341	0.650000	0.86243	CGG	.		0.403	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
FOXE1	2304	bcgsc.ca	37	9	100616627	100616627	+	Missense_Mutation	SNP	G	G	C	rs199664273		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:100616627G>C	ENST00000375123.3	+	1	1092	c.431G>C	c.(430-432)cGc>cCc	p.R144P		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	144					anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				AGCTTCCTGCGCCGCCGCAAG	0.726																																					p.R144P													.	FOXE1-130	0			c.G431C						.						14.0	20.0	18.0					9																	100616627		2083	4116	6199	SO:0001583	missense	2304	exon1			TCCTGCGCCGCCG	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.431G>C	9.37:g.100616627G>C	ENSP00000364265:p.Arg144Pro	Somatic	43	0		WXS	Illumina HiSeq	Phase_1	65	41	NM_004473	0	0	0	0	0	O75765|Q5T109|Q99526	Missense_Mutation	SNP	ENST00000375123.3	37	CCDS35078.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956089	0.92726	.	.	ENSG00000178919	ENST00000375123	D	0.96073	-3.9	4.22	4.22	0.49857	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (2);	0.000000	0.64402	U	0.000003	D	0.98140	0.9386	M	0.92833	3.35	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.99342	1.0912	10	0.72032	D	0.01	.	15.7425	0.77910	0.0:0.0:1.0:0.0	.	144	O00358	FOXE1_HUMAN	P	144	ENSP00000364265:R144P	ENSP00000364265:R144P	R	+	2	0	FOXE1	99656448	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.089000	0.89525	2.077000	0.62373	0.557000	0.71058	CGC	.		0.726	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053341.1		
HSDL2	84263	bcgsc.ca	37	9	115166387	115166387	+	Missense_Mutation	SNP	G	G	C	rs184202621	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:115166387G>C	ENST00000398805.3	+	2	357	c.130G>C	c.(130-132)Gcc>Ccc	p.A44P	HSDL2_ENST00000398803.1_Missense_Mutation_p.A44P|HSDL2_ENST00000262542.7_Intron|HSDL2_ENST00000488101.1_Intron|HSDL2_ENST00000539114.1_5'UTR	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	44						membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						TGCAAAGACCGCCCAGCCACA	0.418													G|||	311	0.0621006	0.0416	0.1124	5008	,	,		18257	0.0804		0.0954	False		,,,				2504	0.001				p.A44P													.	HSDL2-90	0			c.G130C						.						87.0	83.0	84.0					9																	115166387		1965	4150	6115	SO:0001583	missense	84263	exon2			AAGACCGCCCAGC	AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.130G>C	9.37:g.115166387G>C	ENSP00000381785:p.Ala44Pro	Somatic	84	1		WXS	Illumina HiSeq	Phase_1	84	35	NM_032303	0	0	50	50	0	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	ENST00000398805.3	37	CCDS43864.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366799	0.41902	.	.	ENSG00000119471	ENST00000398805;ENST00000398803	D;D	0.87729	-2.29;-2.29	6.07	-1.25	0.09405	NAD(P)-binding domain (1);	0.313593	0.38663	N	0.001613	D	0.85137	0.5628	M	0.67397	2.05	0.37713	D	0.924656	P;D	0.54964	0.879;0.969	B;P	0.44811	0.276;0.461	D	0.85039	0.0922	10	0.62326	D	0.03	.	13.4084	0.60926	0.4014:0.0:0.5986:0.0	.	44;44	Q6YN16-2;Q6YN16	.;HSDL2_HUMAN	P	44	ENSP00000381785:A44P;ENSP00000381783:A44P	ENSP00000381783:A44P	A	+	1	0	HSDL2	114206208	0.044000	0.20184	0.000000	0.03702	0.127000	0.20565	1.192000	0.32150	-0.401000	0.07644	-0.982000	0.02568	GCC	A|0.001;G|0.999		0.418	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053681.1	NM_032303	
AKNA	80709	broad.mit.edu	37	9	117139572	117139572	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:117139572A>C	ENST00000307564.4	-	3	676	c.515T>G	c.(514-516)gTg>gGg	p.V172G	AKNA_ENST00000374075.5_Missense_Mutation_p.V91G|AKNA_ENST00000312033.3_Missense_Mutation_p.V172G|AKNA_ENST00000223791.3_5'Flank|AKNA_ENST00000374088.3_Missense_Mutation_p.V172G	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	172					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GCCAGAAGCCACCCAGCCCCT	0.592																																					p.V172G													.	AKNA-94	0			c.T515G						.						58.0	54.0	55.0					9																	117139572		2203	4300	6503	SO:0001583	missense	80709	exon3			GAAGCCACCCAGC	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.515T>G	9.37:g.117139572A>C	ENSP00000303769:p.Val172Gly	Somatic	76	2		WXS	Illumina HiSeq	Phase_I	187	34	NM_030767	0	0	10	12	2	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	37	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.093091	0.56075	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000374075;ENST00000312033;ENST00000394574	T;T;T;T	0.48836	2.05;2.05;2.05;0.8	4.64	-1.48	0.08745	.	1.095500	0.07239	N	0.863913	T	0.41373	0.1156	L	0.32530	0.975	0.09310	N	1	B;B;D	0.57571	0.005;0.006;0.98	B;B;P	0.52957	0.007;0.003;0.714	T	0.30909	-0.9962	10	0.44086	T	0.13	-3.2628	2.0987	0.03675	0.4642:0.2985:0.0918:0.1455	.	172;172;91	Q7Z591-6;Q7Z591;Q7Z591-2	.;AKNA_HUMAN;.	G	172;172;91;172;172	ENSP00000303769:V172G;ENSP00000363201:V172G;ENSP00000363188:V91G;ENSP00000309222:V172G	ENSP00000303769:V172G	V	-	2	0	AKNA	116179393	0.000000	0.05858	0.022000	0.16811	0.296000	0.27459	0.023000	0.13533	-0.083000	0.12618	0.379000	0.24179	GTG	.		0.592	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
PRRC2B	84726	bcgsc.ca	37	9	134343066	134343066	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:134343066T>G	ENST00000357304.4	+	12	1892	c.1837T>G	c.(1837-1839)Tcc>Gcc	p.S613A	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000405995.1_Missense_Mutation_p.S613A|PRRC2B_ENST00000458550.1_Missense_Mutation_p.S613A	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	613							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						AGAGGCTGGGTCCCCTGCACA	0.567																																					p.S613A													.	PRRC2B-24	0			c.T1837G						.						50.0	58.0	55.0					9																	134343066		2035	4203	6238	SO:0001583	missense	84726	exon12			GCTGGGTCCCCTG	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.1837T>G	9.37:g.134343066T>G	ENSP00000349856:p.Ser613Ala	Somatic	37	0		WXS	Illumina HiSeq	Phase_1	51	33	NM_013318	0	0	14	15	1	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.504032	0.85176	.	.	ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550;ENST00000422467	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.55	5.55	0.83447	.	0.000000	0.41500	U	0.000862	T	0.28665	0.0710	L	0.60455	1.87	0.80722	D	1	D	0.58268	0.982	D	0.67548	0.952	T	0.05886	-1.0858	10	0.08179	T	0.78	-12.7152	14.8125	0.70006	0.0:0.0:0.0:1.0	.	613	Q5JSZ5	PRC2B_HUMAN	A	613;613;613;153	ENSP00000384606:S613A;ENSP00000349856:S613A;ENSP00000398853:S613A;ENSP00000391063:S153A	ENSP00000349856:S613A	S	+	1	0	PRRC2B	133332887	1.000000	0.71417	0.999000	0.59377	0.936000	0.57629	4.801000	0.62532	2.238000	0.73509	0.533000	0.62120	TCC	.		0.567	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SETX	23064	bcgsc.ca	37	9	135139873	135139873	+	Missense_Mutation	SNP	G	G	C	rs200507089	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:135139873G>C	ENST00000224140.5	-	26	7969	c.7787C>G	c.(7786-7788)gCt>gGt	p.A2596G	SETX_ENST00000372169.2_Missense_Mutation_p.A2625G|SETX_ENST00000393220.1_Missense_Mutation_p.A2563G|SETX_ENST00000477049.1_5'UTR	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	2596					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GCTGCTCAGAGCAGCCACTAC	0.632																																					p.A2596G													.	SETX-93	0			c.C7787G						.						41.0	56.0	51.0					9																	135139873		2203	4300	6503	SO:0001583	missense	23064	exon26			CTCAGAGCAGCCA	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.7787C>G	9.37:g.135139873G>C	ENSP00000224140:p.Ala2596Gly	Somatic	171	0		WXS	Illumina HiSeq	Phase_1	266	155	NM_015046	0	0	6	12	6	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769164	0.31320	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.91464	-2.13;-2.85;-2.32;-1.83	3.94	3.05	0.35203	.	1.152070	0.06508	N	0.737540	D	0.86066	0.5844	L	0.40543	1.245	0.09310	N	1	B;B;B	0.21606	0.058;0.035;0.058	B;B;B	0.25291	0.04;0.027;0.059	T	0.72717	-0.4209	10	0.33940	T	0.23	.	6.0704	0.19885	0.0995:0.0:0.7149:0.1856	.	2563;2596;2625	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	G	2596;867;2625;2563	ENSP00000224140:A2596G;ENSP00000409143:A867G;ENSP00000361242:A2625G;ENSP00000376913:A2563G	ENSP00000224140:A2596G	A	-	2	0	SETX	134129694	0.013000	0.17824	0.001000	0.08648	0.004000	0.04260	1.066000	0.30604	0.995000	0.38917	0.491000	0.48974	GCT	.		0.632	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
SNAPC4	6621	bcgsc.ca	37	9	139272015	139272015	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:139272015T>G	ENST00000298532.2	-	21	4632	c.4264A>C	c.(4264-4266)Aca>Cca	p.T1422P		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CATGTGGCTGTCGTGCAGCCC	0.667																																					p.T1422P													.	SNAPC4-90	0			c.A4264C						.						28.0	28.0	28.0					9																	139272015		2186	4259	6445	SO:0001583	missense	6621	exon21			TGGCTGTCGTGCA	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.4264A>C	9.37:g.139272015T>G	ENSP00000298532:p.Thr1422Pro	Somatic	65	0		WXS	Illumina HiSeq	Phase_1	104	55	NM_003086	0	0	3	4	1		Missense_Mutation	SNP	ENST00000298532.2	37	CCDS6998.1	.	.	.	.	.	.	.	.	.	.	t	5.063	0.197262	0.09599	.	.	ENSG00000165684	ENST00000298532	T	0.24908	1.83	1.9	-1.14	0.09741	.	1823.230000	0.00166	N	0.000002	T	0.13457	0.0326	N	0.08118	0	0.09310	N	1	B	0.18166	0.026	B	0.15484	0.013	T	0.16837	-1.0389	10	0.25751	T	0.34	-0.1638	6.2023	0.20583	0.0:0.3728:0.0:0.6272	.	1422	Q5SXM2	SNPC4_HUMAN	P	1422	ENSP00000298532:T1422P	ENSP00000298532:T1422P	T	-	1	0	SNAPC4	138391836	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.908000	0.04063	-0.316000	0.08690	-0.364000	0.07487	ACA	.		0.667	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	NM_003086	
GLRA2	2742	bcgsc.ca	37	X	14599357	14599357	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:14599357C>G	ENST00000218075.4	+	4	853	c.323C>G	c.(322-324)gCg>gGg	p.A108G	GLRA2_ENST00000443437.2_Missense_Mutation_p.A19G|GLRA2_ENST00000355020.4_Missense_Mutation_p.A108G	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	108					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	TCACGGCTGGCGTACAGTGAG	0.483													C|||	367	0.0972185	0.0386	0.0951	3775	,	,		14374	0.129		0.1143	False		,,,				2504	0.0051				p.A108G													.	GLRA2-131	0			c.C323G						.						124.0	114.0	117.0					X																	14599357		2203	4300	6503	SO:0001583	missense	2742	exon5			GGCTGGCGTACAG		CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.323C>G	X.37:g.14599357C>G	ENSP00000218075:p.Ala108Gly	Somatic	133	0		WXS	Illumina HiSeq	Phase_1	82	35	NM_001118885	0	0	0	0	0	A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	ENST00000218075.4	37	CCDS14160.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.078293	0.76528	.	.	ENSG00000101958	ENST00000443437;ENST00000218075;ENST00000355020;ENST00000415367	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36	5.72	5.72	0.89469	Neurotransmitter-gated ion-channel ligand-binding (3);	0.052089	0.85682	D	0.000000	D	0.87943	0.6305	M	0.74258	2.255	0.80722	D	1	P;B;B	0.44877	0.845;0.093;0.271	P;B;B	0.54372	0.75;0.161;0.275	D	0.88632	0.3170	10	0.66056	D	0.02	.	18.8728	0.92322	0.0:1.0:0.0:0.0	.	92;108;108	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	G	19;108;108;92	ENSP00000387756:A19G;ENSP00000218075:A108G;ENSP00000347123:A108G;ENSP00000391606:A92G	ENSP00000218075:A108G	A	+	2	0	GLRA2	14509278	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.701000	0.84566	2.404000	0.81709	0.600000	0.82982	GCG	.		0.483	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055829.1		
CDKL5	6792	hgsc.bcm.edu	37	X	18646492	18646492	+	Splice_Site	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:18646492G>C	ENST00000379989.3	+	19	2783	c.2498G>C	c.(2497-2499)aGc>aCc	p.S833T	CDKL5_ENST00000379996.3_Splice_Site_p.S833T	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	833					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					TTCTTTCAGAGCCAGCCATTA	0.522																																					p.S833T		.											.	CDKL5-838	0			c.G2498C						.						228.0	244.0	238.0					X																	18646492		2203	4300	6503	SO:0001630	splice_region_variant	6792	exon18			TTCAGAGCCAGCC	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2497-1G>C	X.37:g.18646492G>C		Somatic	576	0		WXS	Illumina HiSeq	Phase_I	2096	296	NM_003159	0	0	0	0	0	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577737	0.28180	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.72394	-0.65;-0.65	5.73	4.81	0.61882	.	0.074767	0.85682	D	0.000000	T	0.57125	0.2032	N	0.19112	0.55	0.31747	N	0.635103	B	0.21071	0.051	B	0.15052	0.012	T	0.63075	-0.6718	10	0.52906	T	0.07	-18.3408	15.1993	0.73122	0.0:0.1372:0.8628:0.0	.	833	O76039	CDKL5_HUMAN	T	833	ENSP00000369332:S833T;ENSP00000369325:S833T	ENSP00000369325:S833T	S	+	2	0	CDKL5	18556413	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.004000	0.49513	2.398000	0.81561	0.594000	0.82650	AGC	.		0.522	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	Missense_Mutation
DMD	1756	bcgsc.ca	37	X	31854856	31854856	+	Missense_Mutation	SNP	T	T	G	rs202090289		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:31854856T>G	ENST00000357033.4	-	49	7385	c.7179A>C	c.(7177-7179)aaA>aaC	p.K2393N	DMD_ENST00000378677.2_Missense_Mutation_p.K2389N|DMD_ENST00000359836.1_5'UTR|DMD_ENST00000378707.3_5'UTR|DMD_ENST00000343523.2_5'UTR|DMD_ENST00000541735.1_5'UTR|DMD_ENST00000474231.1_5'UTR	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2393					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GAGTGGCTGGTTTTTCCTTGT	0.428																																					p.K2393N													.	DMD-265	0			c.A7179C						.						221.0	181.0	194.0					X																	31854856		2202	4300	6502	SO:0001583	missense	1756	exon49			GGCTGGTTTTTCC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.7179A>C	X.37:g.31854856T>G	ENSP00000354923:p.Lys2393Asn	Somatic	108	0		WXS	Illumina HiSeq	Phase_1	57	30	NM_004006	0	0	0	0	0	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.23|10.23	1.291994|1.291994	0.23564|0.23564	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280|ENST00000465285	T;T;T|.	0.34275|.	1.37;1.37;1.37|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.37012|.	U|.	0.002288|.	T|T	0.53916|0.53916	0.1826|0.1826	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	P;P;P;P;P|.	0.44139|.	0.827;0.734;0.734;0.734;0.734|.	P;B;B;B;B|.	0.49192|.	0.602;0.398;0.398;0.243;0.243|.	T|T	0.51387|0.51387	-0.8712|-0.8712	10|5	0.17832|.	T|.	0.49|.	.|.	13.4217|13.4217	0.61001|0.61001	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2385;2393;2389;1052;1049|.	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6|.	.;DMD_HUMAN;.;.;.|.	N|P	2385;1052;1049;89;2389;2393;2393;2270|122	ENSP00000350765:K89N;ENSP00000367948:K2389N;ENSP00000354923:K2393N|.	ENSP00000354923:K2393N|.	K|T	-|-	3|1	2|0	DMD|DMD	31764777|31764777	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	2.978000|2.978000	0.49305|0.49305	1.887000|1.887000	0.54652|0.54652	0.345000|0.345000	0.21793|0.21793	AAA|ACC	.		0.428	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
RPGR	6103	hgsc.bcm.edu	37	X	38145451	38145451	+	Intron	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:38145451T>C	ENST00000339363.3	-	14	2688				RPGR_ENST00000309513.3_Intron|RPGR_ENST00000318842.7_Intron|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.E934G|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000338898.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						tccttcctcctcttccccctc	0.607																																					p.E934G		.											.	RPGR-131	0			c.A2801G						.						7.0	4.0	5.0					X																	38145451		1732	3246	4978	SO:0001627	intron_variant	6103	exon15			TCCTCCTCTTCCC	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+895A>G	X.37:g.38145451T>C		Somatic	2	0		WXS	Illumina HiSeq	Phase_I	4	2	NM_001034853	0	0	0	0	0	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	37		.	.	.	.	.	.	.	.	.	.	-	4.134	0.023256	0.08006	.	.	ENSG00000156313	ENST00000378505	T	0.39056	1.1	1.68	-2.28	0.06826	.	971.910000	0.00824	N	0.001616	T	0.33381	0.0861	L	0.47716	1.5	0.09310	N	0.999997	B	0.09022	0.002	B	0.04013	0.001	T	0.14699	-1.0463	10	0.39692	T	0.17	.	2.8465	0.05545	0.2182:0.1695:0.0:0.6124	.	934	E9PE28	.	G	934	ENSP00000367766:E934G	ENSP00000367766:E934G	E	-	2	0	RPGR	38030395	0.000000	0.05858	0.005000	0.12908	0.000000	0.00434	-0.472000	0.06623	-0.068000	0.12953	0.000000	0.15137	GAG	.		0.607	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328	
MAOA	4128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	43590945	43590945	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:43590945A>C	ENST00000338702.3	+	8	923	c.800A>C	c.(799-801)aAa>aCa	p.K267T	MAOA_ENST00000542639.1_Missense_Mutation_p.K134T	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	267					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	TTTTAGTGCAAATACGTAATT	0.418																																					p.K267T		.											.	MAOA-194	0			c.A800C						.						110.0	82.0	92.0					X																	43590945		2203	4300	6503	SO:0001583	missense	4128	exon8			AGTGCAAATACGT		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.800A>C	X.37:g.43590945A>C	ENSP00000340684:p.Lys267Thr	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	95	30	NM_000240	0	0	0	0	0	B4DF46|Q16426	Missense_Mutation	SNP	ENST00000338702.3	37	CCDS14260.1	.	.	.	.	.	.	.	.	.	.	A	10.50	1.367611	0.24771	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	D;D	0.92699	-3.09;-3.09	5.81	-4.19	0.03835	Amine oxidase (1);	0.452762	0.27682	N	0.018281	D	0.92280	0.7551	M	0.86420	2.815	0.40067	D	0.975962	B	0.20887	0.049	B	0.28991	0.097	T	0.76729	-0.2852	10	0.72032	D	0.01	.	16.9162	0.86152	0.7596:0.0:0.2404:0.0	.	267	P21397	AOFA_HUMAN	T	267;134	ENSP00000340684:K267T;ENSP00000440846:K134T	ENSP00000340684:K267T	K	+	2	0	MAOA	43475889	0.137000	0.22531	0.008000	0.14137	0.362000	0.29581	-0.156000	0.10100	-1.760000	0.01312	-0.488000	0.04728	AAA	.		0.418	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1	NM_000240	
NDUFB11	54539	broad.mit.edu;bcgsc.ca	37	X	47002143	47002143	+	Splice_Site	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:47002143T>G	ENST00000377811.3	-	2	1032	c.208A>C	c.(208-210)Aac>Cac	p.N70H	RBM10_ENST00000377604.3_5'Flank|RBM10_ENST00000345781.6_5'Flank|NDUFB11_ENST00000276062.8_Splice_Site_p.N70H|RBM10_ENST00000329236.7_5'Flank	NM_001135998.2	NP_001129470.1	Q9NX14	NDUBB_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa	70					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)				endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7						GAGTCTGGGTTCTGTGGAGAA	0.512																																					p.N70H	Ovarian(77;454 1296 7908 21551 37072)												.	NDUFB11-130	0			c.A208C						.						128.0	108.0	114.0					X																	47002143		2203	4300	6503	SO:0001630	splice_region_variant	54539	exon2			CTGGGTTCTGTGG	AF044213	CCDS14273.1, CCDS48100.1	Xp11.3	2011-07-04			ENSG00000147123	ENSG00000147123		"""Mitochondrial respiratory chain complex / Complex I"""	20372	protein-coding gene	gene with protein product	"""complex I NP17.3 subunit"""	300403				10544803, 12381726	Standard	NM_019056		Approved	ESSS, NP17.3, Np15	uc004dhc.3	Q9NX14	OTTHUMG00000021433	ENST00000377811.3:c.208-1A>C	X.37:g.47002143T>G		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	187	7	NM_019056	0	0	0	0	0	Q5JRR3|Q5JRR4|Q6IAB6|Q8WZ96|Q9BXX9	Missense_Mutation	SNP	ENST00000377811.3	37	CCDS48100.1	.	.	.	.	.	.	.	.	.	.	t	18.64	3.666621	0.67814	.	.	ENSG00000147123	ENST00000377811;ENST00000447793;ENST00000276062	.	.	.	4.26	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.68522	0.3010	M	0.76574	2.34	0.47407	D	0.999411	P;P	0.51933	0.948;0.949	P;P	0.57425	0.82;0.786	T	0.71948	-0.4438	9	0.72032	D	0.01	-20.6174	9.3073	0.37883	0.0:0.0:0.0:1.0	.	70;70	Q9NX14;Q9NX14-2	NDUBB_HUMAN;.	H	70;74;70	.	ENSP00000276062:N70H	N	-	1	0	NDUFB11	46887087	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.736000	0.68597	1.653000	0.50694	0.437000	0.28790	AAC	.		0.512	NDUFB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056382.1	NM_019056	Missense_Mutation
GNL3L	54552	hgsc.bcm.edu	37	X	54578752	54578752	+	Silent	SNP	A	A	C	rs201849856		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:54578752A>C	ENST00000336470.4	+	13	1348	c.1209A>C	c.(1207-1209)ccA>ccC	p.P403P	GNL3L_ENST00000360845.2_Silent_p.P403P	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	403					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						ATATACCACCACCAGCCACTC	0.502																																					p.P403P		.											.	GNL3L-131	0			c.A1209C						.						181.0	141.0	155.0					X																	54578752		2203	4300	6503	SO:0001819	synonymous_variant	54552	exon13			ACCACCACCAGCC	AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.1209A>C	X.37:g.54578752A>C		Somatic	145	2		WXS	Illumina HiSeq	Phase_I	558	198	NM_001184819	0	0	16	16	0		Silent	SNP	ENST00000336470.4	37	CCDS14360.1																																																																																			.		0.502	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056805.1	NM_019067	
AMER1	139285	hgsc.bcm.edu	37	X	63412720	63412720	+	Silent	SNP	T	T	C	rs200897699		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:63412720T>C	ENST00000330258.3	-	2	719	c.447A>G	c.(445-447)ggA>ggG	p.G149G	AMER1_ENST00000374869.3_Silent_p.G149G|AMER1_ENST00000403336.1_Silent_p.G149G	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	149					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TCTCTGTGGCTCCAGCCACAG	0.532																																					p.G149G		.											.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.A447G						.						34.0	37.0	36.0					X																	63412720		2203	4297	6500	SO:0001819	synonymous_variant	139285	exon2			TGTGGCTCCAGCC	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.447A>G	X.37:g.63412720T>C		Somatic	71	1		WXS	Illumina HiSeq	Phase_I	407	137	NM_152424	0	0	1	1	0	A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	37	CCDS14377.2																																																																																			.		0.532	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
NLGN3	54413	hgsc.bcm.edu	37	X	70387444	70387444	+	Silent	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:70387444G>C	ENST00000358741.3	+	7	1800	c.1497G>C	c.(1495-1497)tcG>tcC	p.S499S	NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Silent_p.S459S|NLGN3_ENST00000374051.3_Silent_p.S479S	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	499					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					GCTACGGCTCGCCTACCTACT	0.567																																					p.S499S	Esophageal Squamous(103;760 1488 16849 22250 40351)	.											.	NLGN3-131	0			c.G1497C						.						83.0	69.0	74.0					X																	70387444		2203	4300	6503	SO:0001819	synonymous_variant	54413	exon7			CGGCTCGCCTACC	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1497G>C	X.37:g.70387444G>C		Somatic	126	0		WXS	Illumina HiSeq	Phase_I	339	160	NM_181303	0	0	0	0	0	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	ENST00000358741.3	37	CCDS55441.1																																																																																			.		0.567	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977	
NOX1	27035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	100099033	100099033	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:100099033T>C	ENST00000372966.3	-	13	1808	c.1603A>G	c.(1603-1605)Act>Gct	p.T535A	NOX1_ENST00000372960.4_Missense_Mutation_p.T498A|NOX1_ENST00000217885.5_Missense_Mutation_p.T486A|NOX1_ENST00000372964.1_Intron	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	535	Interaction with NOXO1.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						TTTGCCAAAGTCCGAGGGCCA	0.433																																					p.T535A		.											.	NOX1-131	0			c.A1603G						.						65.0	51.0	55.0					X																	100099033		2202	4299	6501	SO:0001583	missense	27035	exon13			CCAAAGTCCGAGG	AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.1603A>G	X.37:g.100099033T>C	ENSP00000362057:p.Thr535Ala	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	34	13	NM_007052	0	0	0	0	0	A8K836|O95691|Q2PP02	Missense_Mutation	SNP	ENST00000372966.3	37	CCDS14474.1	.	.	.	.	.	.	.	.	.	.	t	0.927	-0.714078	0.03206	.	.	ENSG00000007952	ENST00000372966;ENST00000217885;ENST00000372960	D;T;D	0.94650	-3.48;0.09;-3.48	5.09	-0.337	0.12654	Ferric reductase, NAD binding (1);	0.458064	0.22296	N	0.061923	T	0.70456	0.3226	N	0.00277	-1.72	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.70938	-0.4736	10	0.02654	T	1	-0.2036	5.1658	0.15084	0.0:0.3874:0.3302:0.2825	.	498;486;535	A6NGA6;Q9Y5S8-3;Q9Y5S8	.;.;NOX1_HUMAN	A	535;486;498	ENSP00000362057:T535A;ENSP00000217885:T486A;ENSP00000362051:T498A	ENSP00000217885:T486A	T	-	1	0	NOX1	99985689	0.000000	0.05858	0.000000	0.03702	0.904000	0.53231	0.069000	0.14552	-0.326000	0.08564	0.483000	0.47432	ACT	.		0.433	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057495.1	NM_007052	
RNF128	79589	broad.mit.edu	37	X	105970391	105970391	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:105970391T>G	ENST00000255499.2	+	1	498	c.248T>G	c.(247-249)gTc>gGc	p.V83G	RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	83	PA.				negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						GTGGCTGGGGTCCTGGTACCG	0.672																																					p.V83G													.	RNF128-227	0			c.T248G						.						15.0	14.0	14.0					X																	105970391		2176	4243	6419	SO:0001583	missense	79589	exon1			CTGGGGTCCTGGT	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.248T>G	X.37:g.105970391T>G	ENSP00000255499:p.Val83Gly	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	116	42	NM_194463	0	0	19	28	9	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Missense_Mutation	SNP	ENST00000255499.2	37	CCDS14521.1	.	.	.	.	.	.	.	.	.	.	T	17.90	3.501839	0.64298	.	.	ENSG00000133135	ENST00000255499	T	0.13778	2.56	4.53	3.36	0.38483	.	0.583687	0.17419	N	0.174901	T	0.24890	0.0604	M	0.67700	2.07	0.47037	D	0.999294	P	0.52061	0.95	P	0.55303	0.773	T	0.00844	-1.1543	10	0.48119	T	0.1	.	7.2331	0.26053	0.0:0.1061:0.0:0.8939	.	83	Q8TEB7	RN128_HUMAN	G	83	ENSP00000255499:V83G	ENSP00000255499:V83G	V	+	2	0	RNF128	105857047	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	1.620000	0.36976	0.553000	0.29044	-0.438000	0.05819	GTC	.		0.672	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	
NXT2	55916	bcgsc.ca	37	X	108779193	108779193	+	5'Flank	SNP	A	A	C	rs201184200		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:108779193A>C	ENST00000372106.1	+	0	0				NXT2_ENST00000218004.1_Missense_Mutation_p.T28P|NXT2_ENST00000372107.1_5'Flank|NXT2_ENST00000372103.1_5'Flank	NM_001242617.1	NP_001229546.1	Q9NPJ8	NXT2_HUMAN	nuclear transport factor 2-like export factor 2						mRNA transport (GO:0051028)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|large_intestine(1)|lung(1)|ovary(1)	6						GGGGCCACACACCAGCCACTC	0.413																																					p.T28P													.	NXT2-109	0			c.A82C						.						45.0	42.0	43.0					X																	108779193		2203	4300	6503	SO:0001631	upstream_gene_variant	55916	exon1			CCACACACCAGCC	AF246127	CCDS14546.1, CCDS56605.1, CCDS56606.1	Xq22.3	2008-02-05			ENSG00000101888	ENSG00000101888			18151	protein-coding gene	gene with protein product		300320				11073998	Standard	NM_018698		Approved	P15-2	uc004eoe.2	Q9NPJ8	OTTHUMG00000022185		X.37:g.108779193A>C	Exception_encountered	Somatic	26	2		WXS	Illumina HiSeq	Phase_1	33	24	NM_018698	0	0	0	0	0	D3DUY1|Q0VAN8|Q5JYV5|Q5JYV6|Q5JYV7|Q9H8U0|Q9NQ64|Q9NRL7|Q9Y3M4|Q9Y3M5	Missense_Mutation	SNP	ENST00000372106.1	37	CCDS56605.1	.	.	.	.	.	.	.	.	.	.	A	6.093	0.385362	0.11524	.	.	ENSG00000101888	ENST00000218004	.	.	.	4.23	-4.18	0.03846	.	3.130020	0.01274	N	0.009521	T	0.24928	0.0605	.	.	.	0.09310	N	1	P	0.39624	0.681	B	0.38755	0.281	T	0.12785	-1.0534	8	0.48119	T	0.1	.	2.0266	0.03520	0.2841:0.1585:0.4006:0.1568	.	28	Q9NPJ8-3	.	P	28	.	ENSP00000218004:T28P	T	+	1	0	NXT2	108665849	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.474000	0.06607	-1.039000	0.03275	-0.553000	0.04205	ACC	.		0.413	NXT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057886.1	NM_018698	
DOCK11	139818	bcgsc.ca	37	X	117761500	117761500	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:117761500T>C	ENST00000276202.7	+	33	3685	c.3622T>C	c.(3622-3624)Tca>Cca	p.S1208P	DOCK11_ENST00000276204.6_Missense_Mutation_p.S1208P	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1208					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TGGCTTTACTTCACCTGCCAA	0.393																																					p.S1208P													.	DOCK11-93	0			c.T3622C						.						124.0	123.0	123.0					X																	117761500		2203	4300	6503	SO:0001583	missense	139818	exon33			TTTACTTCACCTG	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3622T>C	X.37:g.117761500T>C	ENSP00000276202:p.Ser1208Pro	Somatic	139	0		WXS	Illumina HiSeq	Phase_1	69	22	NM_144658	0	0	23	23	0	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	T	14.34	2.507611	0.44558	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.18657	2.2;2.2	5.67	5.67	0.87782	.	1.404080	0.04119	N	0.316040	T	0.30324	0.0761	L	0.59436	1.845	0.49299	D	0.999775	B;B	0.24533	0.105;0.0	B;B	0.22601	0.04;0.001	T	0.05920	-1.0856	10	0.36615	T	0.2	-0.8924	15.0248	0.71659	0.0:0.0:0.0:1.0	.	1208;1208	A6NIW2;Q5JSL3	.;DOC11_HUMAN	P	1208	ENSP00000276204:S1208P;ENSP00000276202:S1208P	ENSP00000276202:S1208P	S	+	1	0	DOCK11	117645528	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.126000	0.64721	1.999000	0.58509	0.481000	0.45027	TCA	.		0.393	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658	
AIFM1	9131	bcgsc.ca	37	X	129270135	129270135	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:129270135G>C	ENST00000287295.3	-	12	1420	c.1190C>G	c.(1189-1191)gCt>gGt	p.A397G	AIFM1_ENST00000319908.3_Missense_Mutation_p.A393G|AIFM1_ENST00000460436.2_Missense_Mutation_p.A58G|AIFM1_ENST00000346424.2_Missense_Mutation_p.A110G|AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000440263.1_Missense_Mutation_p.A45G	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	397	FAD-dependent oxidoreductase. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	CAGGCCCACAGCTGCCACTAT	0.483																																					p.A397G													.	AIFM1-586	0			c.C1190G						.						46.0	42.0	43.0					X																	129270135		2203	4300	6503	SO:0001583	missense	9131	exon12			CCCACAGCTGCCA	AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1190C>G	X.37:g.129270135G>C	ENSP00000287295:p.Ala397Gly	Somatic	87	1		WXS	Illumina HiSeq	Phase_1	71	45	NM_004208	0	0	17	17	0	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	ENST00000287295.3	37	CCDS14618.1	.	.	.	.	.	.	.	.	.	.	G	35	5.524927	0.96431	.	.	ENSG00000156709	ENST00000460436;ENST00000346424;ENST00000319908;ENST00000440263;ENST00000287295	T;T;D;T;D	0.88046	0.92;0.93;-2.33;0.96;-2.33	6.01	6.01	0.97437	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.88789	0.6532	L	0.46885	1.475	0.80722	D	1	P;D;P	0.60575	0.876;0.988;0.898	P;P;P	0.56434	0.575;0.779;0.798	D	0.84579	0.0660	10	0.09084	T	0.74	-13.2159	19.3824	0.94542	0.0:0.0:1.0:0.0	.	110;393;397	O95831-2;O95831-3;O95831	.;.;AIFM1_HUMAN	G	58;110;393;45;397	ENSP00000431222:A58G;ENSP00000316320:A110G;ENSP00000315122:A393G;ENSP00000405879:A45G;ENSP00000287295:A397G	ENSP00000287295:A397G	A	-	2	0	AIFM1	129097816	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.620000	0.83070	2.531000	0.85337	0.600000	0.82982	GCT	.		0.483	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2		
FRMD7	90167	bcgsc.ca	37	X	131219749	131219749	+	Missense_Mutation	SNP	T	T	C	rs201803600		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:131219749T>C	ENST00000298542.4	-	7	680	c.505A>G	c.(505-507)Agc>Ggc	p.S169G	FRMD7_ENST00000370879.1_Missense_Mutation_p.S49G|FRMD7_ENST00000464296.1_Missense_Mutation_p.S154G	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	169	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					TCAGCTGGGCTCCTGCCACTG	0.493																																					p.S169G													.	FRMD7-228	0			c.A505G						.						71.0	61.0	64.0					X																	131219749		2203	4300	6503	SO:0001583	missense	90167	exon7			CTGGGCTCCTGCC	AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.505A>G	X.37:g.131219749T>C	ENSP00000298542:p.Ser169Gly	Somatic	80	0		WXS	Illumina HiSeq	Phase_1	35	19	NM_194277	0	0	0	0	0	C0LLJ3|Q5JX99	Missense_Mutation	SNP	ENST00000298542.4	37	CCDS35397.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.629900	0.67015	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	T;T;T	0.81415	-0.81;-1.49;-1.49	5.71	5.71	0.89125	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.202977	0.51477	D	0.000093	D	0.88104	0.6347	M	0.85542	2.76	0.54753	D	0.999983	P;D	0.64830	0.86;0.994	P;P	0.60949	0.453;0.881	D	0.89393	0.3690	10	0.87932	D	0	.	9.0861	0.36581	0.2791:0.0:0.0:0.7209	.	154;169	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	G	49;169;154	ENSP00000359916:S49G;ENSP00000298542:S169G;ENSP00000417996:S154G	ENSP00000298542:S169G	S	-	1	0	FRMD7	131047430	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.195000	0.51013	1.920000	0.55613	0.486000	0.48141	AGC	.		0.493	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1	NM_194277	
GPC4	2239	bcgsc.ca	37	X	132437060	132437060	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:132437060A>C	ENST00000370828.3	-	9	2030	c.1506T>G	c.(1504-1506)tgT>tgG	p.C502W	GPC4_ENST00000535467.1_Missense_Mutation_p.C432W	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	502					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					GCTGATACTCACAGCCACTTC	0.453																																					p.C502W													.	GPC4-226	0			c.T1506G						.						218.0	192.0	201.0					X																	132437060		2203	4300	6503	SO:0001583	missense	2239	exon9			ATACTCACAGCCA	AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.1506T>G	X.37:g.132437060A>C	ENSP00000359864:p.Cys502Trp	Somatic	406	0		WXS	Illumina HiSeq	Phase_1	332	109	NM_001448	0	0	79	106	27	B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Missense_Mutation	SNP	ENST00000370828.3	37	CCDS14637.1	.	.	.	.	.	.	.	.	.	.	a	15.11	2.735606	0.49045	.	.	ENSG00000076716	ENST00000370828;ENST00000536418;ENST00000535467	T;T	0.52057	0.68;0.68	5.42	3.02	0.34903	.	0.000000	0.85682	D	0.000000	T	0.66336	0.2779	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.64672	-0.6352	10	0.87932	D	0	-20.3119	7.2693	0.26248	0.7483:0.0:0.2517:0.0	.	502	O75487	GPC4_HUMAN	W	502;496;432	ENSP00000359864:C502W;ENSP00000444959:C432W	ENSP00000359864:C502W	C	-	3	2	GPC4	132264726	0.930000	0.31532	0.997000	0.53966	0.896000	0.52359	0.017000	0.13399	0.223000	0.20920	-0.365000	0.07479	TGT	.		0.453	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058338.1	NM_001448	
SAGE1	55511	bcgsc.ca	37	X	134990742	134990742	+	Silent	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:134990742A>G	ENST00000370709.3	+	11	1407	c.1407A>G	c.(1405-1407)ggA>ggG	p.G469G	SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000324447.3_Silent_p.G469G|SAGE1_ENST00000535938.1_Silent_p.G469G			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	469						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					ATATGGCAGGAGCTAGTATTC	0.423																																					p.G469G													.	SAGE1-133	0			c.A1407G						.						157.0	153.0	154.0					X																	134990742		2203	4300	6503	SO:0001819	synonymous_variant	55511	exon12			GGCAGGAGCTAGT	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.1407A>G	X.37:g.134990742A>G		Somatic	196	2		WXS	Illumina HiSeq	Phase_1	86	33	NM_018666	0	0	0	0	0	Q5JNW0	Silent	SNP	ENST00000370709.3	37	CCDS14652.1																																																																																			.		0.423	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
CNGA2	1260	hgsc.bcm.edu	37	X	150906986	150906986	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:150906986T>C	ENST00000329903.4	+	1	64	c.31T>C	c.(31-33)Tcc>Ccc	p.S11P		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	11					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					TGTGAAGAGCTCCCCAGCCAA	0.517																																					p.S11P		.											.	CNGA2-193	0			c.T31C						.						208.0	153.0	171.0					X																	150906986		2203	4300	6503	SO:0001583	missense	1260	exon2			AAGAGCTCCCCAG	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.31T>C	X.37:g.150906986T>C	ENSP00000328478:p.Ser11Pro	Somatic	171	1		WXS	Illumina HiSeq	Phase_I	613	160	NM_005140	0	0	0	0	0	A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	T	13.84	2.356630	0.41801	.	.	ENSG00000183862	ENST00000329903	D	0.97870	-4.58	4.85	4.85	0.62838	.	0.438060	0.23624	N	0.046217	D	0.95714	0.8606	N	0.08118	0	0.29499	N	0.855084	D	0.54601	0.967	D	0.63033	0.91	D	0.91985	0.5598	10	0.52906	T	0.07	.	9.6231	0.39734	0.0:0.0:0.0:1.0	.	11	Q16280	CNGA2_HUMAN	P	11	ENSP00000328478:S11P	ENSP00000328478:S11P	S	+	1	0	CNGA2	150657642	1.000000	0.71417	1.000000	0.80357	0.110000	0.19582	2.734000	0.47368	1.794000	0.52575	0.486000	0.48141	TCC	.		0.517	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
F8	2157	bcgsc.ca	37	X	154124444	154124444	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:154124444A>G	ENST00000360256.4	-	22	6537	c.6337T>C	c.(6337-6339)Tcc>Ccc	p.S2113P		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2113	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TAGAGGCTGGAGAACTTCTGA	0.403																																					p.S2113P													.	F8-182	0			c.T6337C						.						158.0	152.0	154.0					X																	154124444		2203	4300	6503	SO:0001583	missense	2157	exon22			GGCTGGAGAACTT	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6337T>C	X.37:g.154124444A>G	ENSP00000353393:p.Ser2113Pro	Somatic	256	1		WXS	Illumina HiSeq	Phase_1	158	48	NM_000132	0	0	1	1	0	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	a	19.08	3.757309	0.69648	.	.	ENSG00000185010	ENST00000360256	D	0.98296	-4.85	5.56	4.32	0.51571	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.265891	0.42548	D	0.000681	D	0.98226	0.9413	M	0.73598	2.24	0.38720	D	0.953421	D	0.76494	0.999	D	0.71414	0.973	D	0.98824	1.0748	10	0.72032	D	0.01	-5.8601	4.594	0.12320	0.7353:0.0:0.0915:0.1732	.	2113	P00451	FA8_HUMAN	P	2113	ENSP00000353393:S2113P	ENSP00000353393:S2113P	S	-	1	0	F8	153777638	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	3.782000	0.55401	1.850000	0.53721	0.486000	0.48141	TCC	.		0.403	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
PTPN14	5784	broad.mit.edu	37	1	214557049	214557051	+	In_Frame_Del	DEL	CCT	CCT	-	rs143136196|rs376331360|rs189081489|rs539310988	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:214557049_214557051delCCT	ENST00000366956.5	-	13	2341_2343	c.2147_2149delAGG	c.(2146-2151)gaggct>gct	p.E716del	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	716	Poly-Glu.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)	p.E716delE(1)		NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GATTCTGGAGCCTCCTCCTCCTC	0.626																																					p.716_717del	Colon(92;557 1424 24372 34121 40073)												.	PTPN14-290	1	Deletion - In frame(1)	liver(1)	c.2147_2149del						.																																			SO:0001651	inframe_deletion	5784	exon13			CTGGAGCCTCCTC	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2147_2149delAGG	1.37:g.214557058_214557060delCCT	ENSP00000355923:p.Glu716del	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	229	8	NM_005401	0	0	0	0	0	Q5VSI0	In_Frame_Del	DEL	ENST00000366956.5	37	CCDS1514.1																																																																																			.		0.626	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
PRB2	653247	broad.mit.edu	37	12	11545949	11545951	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	TGC	TGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:11545949_11545951delTGC	ENST00000389362.4	-	3	1096_1098	c.1061_1063delGCA	c.(1060-1065)agcaag>aag	p.S354del	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	354	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			CTTCGGGACTTGCTGCCTCCTTG	0.601																																					p.354_355del													.	PRB2-22	0			c.1061_1063del						.																																			SO:0001651	inframe_deletion	653247	exon3			GGGACTTGCTGCC	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.1061_1063delGCA	12.37:g.11545952_11545954delTGC	ENSP00000374013:p.Ser354del	Somatic	554	0		WXS	Illumina HiSeq	Phase_I	1460	15	NM_006248	0	0	0	0	0	O00599|P02811|P04281	In_Frame_Del	DEL	ENST00000389362.4	37	CCDS41757.2																																																																																			.		0.601	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
SLC24A1	9187	broad.mit.edu	37	15	65918177	65918179	+	In_Frame_Del	DEL	CTG	CTG	-	rs370680044		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:65918177_65918179delCTG	ENST00000261892.6	+	2	2046_2048	c.1759_1761delCTG	c.(1759-1761)ctgdel	p.L591del	SLC24A1_ENST00000546330.1_In_Frame_Del_p.L591del|SLC24A1_ENST00000399033.4_In_Frame_Del_p.L591del|SLC24A1_ENST00000544319.2_In_Frame_Del_p.L591del|SLC24A1_ENST00000537259.1_In_Frame_Del_p.L591del|SLC24A1_ENST00000339868.6_In_Frame_Del_p.L591del	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	591					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						GTGGGAGAGCCTGCTGCTGCTGC	0.547																																					p.587_587del													.	.	0			c.1759_1761del						.			99,3943		8,83,1930						4.1	1.0			151	234,7914		7,220,3847	no	coding	SLC24A1	NM_004727.2		15,303,5777	A1A1,A1R,RR		2.8719,2.4493,2.7317				333,11857				SO:0001651	inframe_deletion	9187	exon2			GAGAGCCTGCTGC	AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.1759_1761delCTG	15.37:g.65918186_65918188delCTG	ENSP00000261892:p.Leu591del	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	273	13	NM_004727	0	0	0	0	0	O43485|O75184|Q17RM9	In_Frame_Del	DEL	ENST00000261892.6	37	CCDS45284.1																																																																																			.		0.547	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727	
RELB	5971	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	45515450	45515452	+	In_Frame_Del	DEL	CCG	CCG	-			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	CCG	CCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:45515450_45515452delCCG	ENST00000221452.8	+	4	570_572	c.420_422delCCG	c.(418-423)ttccgc>ttc	p.R141del	RELB_ENST00000505236.1_In_Frame_Del_p.R138del|RELB_ENST00000540120.1_In_Frame_Del_p.R141del	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	141	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		GCATGCGCTTCCGCTACGAGTGC	0.754																																					.		.											.	RELB-847	0			.						.																																			SO:0001651	inframe_deletion	5971	.			.	M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.420_422delCCG	19.37:g.45515450_45515452delCCG	ENSP00000221452:p.Arg141del	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	74	33	.	0	0	0	0	0	Q6GTX7|Q9UEI7	Targeted_Region	DEL	ENST00000221452.8	37	CCDS46110.1																																																																																			.		0.754	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000367361.2		
C2orf71	388939	broad.mit.edu	37	2	29295647	29295649	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:29295647_29295649delTCC	ENST00000331664.5	-	1	1478_1480	c.1479_1481delGGA	c.(1477-1482)gaggaa>gaa	p.493_494EE>E		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	493					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						CATTTTGTCTTCCTCCTCCTCCT	0.542																																					p.493_494del													.	C2orf71-91	0			c.1479_1481del						.																																			SO:0001651	inframe_deletion	388939	exon1			TTGTCTTCCTCCT		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1479_1481delGGA	2.37:g.29295656_29295658delTCC	ENSP00000332809:p.Glu494del	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	771	7	NM_001029883	0	0	0	0	0		In_Frame_Del	DEL	ENST00000331664.5	37	CCDS42669.1																																																																																			.		0.542	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
AHCY	191	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	32868894	32868914	+	In_Frame_Del	DEL	CTGGGCTTGCTTCTCAGTTAG	CTGGGCTTGCTTCTCAGTTAG	-			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	CTGGGCTTGCTTCTCAGTTAG	CTGGGCTTGCTTCTCAGTTAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr20:32868894_32868914delCTGGGCTTGCTTCTCAGTTAG	ENST00000217426.2	-	10	1302_1322	c.1225_1245delCTAACTGAGAAGCAAGCCCAG	c.(1225-1245)ctaactgagaagcaagcccagdel	p.LTEKQAQ409del	CTD-3216D2.5_ENST00000609218.1_RNA|RP4-785G19.5_ENST00000512005.1_RNA|AHCY_ENST00000538132.1_In_Frame_Del_p.LTEKQAQ381del	NM_000687.2	NP_000678.1	P23526	SAHH_HUMAN	adenosylhomocysteinase	409					cellular nitrogen compound metabolic process (GO:0034641)|chronic inflammatory response to antigenic stimulus (GO:0002439)|circadian sleep/wake cycle (GO:0042745)|homocysteine biosynthetic process (GO:0071268)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|S-adenosylhomocysteine catabolic process (GO:0019510)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	adenosylhomocysteinase activity (GO:0004013)|adenyl nucleotide binding (GO:0030554)|NAD binding (GO:0051287)			endometrium(6)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TGCCCAGGTACTGGGCTTGCTTCTCAGTTAGCTTGGTCAAC	0.566																																					p.409_415del		.											.	AHCY-91	0			c.1225_1245del						.																																			SO:0001651	inframe_deletion	191	exon10			.	M61832	CCDS13233.1, CCDS54457.1	20q11.22	2009-06-12	2009-06-12		ENSG00000101444	ENSG00000101444	3.3.1.1		343	protein-coding gene	gene with protein product		180960	"""S-adenosylhomocysteine hydrolase"""			7079734, 6580258	Standard	NM_001161766		Approved	SAHH	uc002xai.3	P23526	OTTHUMG00000140098	ENST00000217426.2:c.1225_1245delCTAACTGAGAAGCAAGCCCAG	20.37:g.32868894_32868914delCTGGGCTTGCTTCTCAGTTAG	ENSP00000217426:p.Leu409_Gln415del	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	104	26	NM_000687	0	0	0	0	0	A8K307|B3KUN3|E1P5P2|F5H737|Q96A36	In_Frame_Del	DEL	ENST00000217426.2	37	CCDS13233.1																																																																																			.		0.566	AHCY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078773.2	NM_000687	
NEFH	4744	broad.mit.edu	37	22	29885754	29885777	+	In_Frame_Del	DEL	AAGTCCCCAGTGAAGGAAGAAGCA	AAGTCCCCAGTGAAGGAAGAAGCA	-	rs139600064|rs531060059	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	AAGTCCCCAGTGAAGGAAGAAGCA	AAGTCCCCAGTGAAGGAAGAAGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr22:29885754_29885777delAAGTCCCCAGTGAAGGAAGAAGCA	ENST00000310624.6	+	4	2158_2181	c.2125_2148delAAGTCCCCAGTGAAGGAAGAAGCA	c.(2125-2148)aagtccccagtgaaggaagaagcadel	p.KSPVKEEA709del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	715	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.E715K(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TGAGAAGGCCAAGTCCCCAGTGAAGGAAGAAGCAAAGTCCCCTG	0.562																																					p.709_716del													.	NEFH-90	1	Substitution - Missense(1)	skin(1)	c.2125_2148del						.																																			SO:0001651	inframe_deletion	4744	exon4			AAGGCCAAGTCCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2125_2148delAAGTCCCCAGTGAAGGAAGAAGCA	22.37:g.29885754_29885777delAAGTCCCCAGTGAAGGAAGAAGCA	ENSP00000311997:p.Lys709_Ala716del	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	379	8	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
DBR1	51163	broad.mit.edu	37	3	137880741	137880743	+	In_Frame_Del	DEL	TCG	TCG	-	rs376362448|rs2622736	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	TCG	TCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:137880741_137880743delTCG	ENST00000260803.4	-	8	1776_1778	c.1623_1625delCGA	c.(1621-1626)gacgat>gat	p.541_542DD>D	DBR1_ENST00000505015.2_In_Frame_Del_p.307_308DD>D	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	541					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						TTAAGCTGCATCGTCATCATCAT	0.394																																					p.541_542del													.	DBR1-90	0			c.1623_1625del						.																																			SO:0001651	inframe_deletion	51163	exon8			GCTGCATCGTCAT	AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.1623_1625delCGA	3.37:g.137880741_137880743delTCG	ENSP00000260803:p.Asp542del	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	342	8	NM_016216	0	0	0	0	0	Q96GH0|Q9NXQ6	In_Frame_Del	DEL	ENST00000260803.4	37	CCDS33863.1																																																																																			.		0.394	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357585.1		
FGF10	2255	broad.mit.edu	37	5	44388715	44388717	+	In_Frame_Del	DEL	AGC	AGC	-	rs576181814		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	AGC	AGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:44388715_44388717delAGC	ENST00000264664.4	-	1	182_184	c.68_70delGCT	c.(67-72)tgcttt>ttt	p.C23del	RP11-473L15.2_ENST00000502457.1_RNA	NM_004465.1	NP_004456.1	O15520	FGF10_HUMAN	fibroblast growth factor 10	23					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchiole morphogenesis (GO:0060436)|bud elongation involved in lung branching (GO:0060449)|bud outgrowth involved in lung branching (GO:0060447)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell migration (GO:0010631)|epithelial cell proliferation (GO:0050673)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|ERK1 and ERK2 cascade (GO:0070371)|establishment of mitotic spindle orientation (GO:0000132)|Fc-epsilon receptor signaling pathway (GO:0038095)|female genitalia morphogenesis (GO:0048807)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|hair follicle morphogenesis (GO:0031069)|Harderian gland development (GO:0070384)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte proliferation (GO:0043616)|lacrimal gland development (GO:0032808)|limb bud formation (GO:0060174)|lung epithelium development (GO:0060428)|lung proximal/distal axis specification (GO:0061115)|lung saccule development (GO:0060430)|male genitalia morphogenesis (GO:0048808)|mammary gland bud formation (GO:0060615)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal-epithelial cell signaling involved in lung development (GO:0060496)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|metanephros morphogenesis (GO:0003338)|muscle cell fate commitment (GO:0042693)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|pancreas development (GO:0031016)|phosphatidylinositol-mediated signaling (GO:0048015)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of ATPase activity (GO:0032781)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urothelial cell proliferation (GO:0050677)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of white fat cell proliferation (GO:0070352)|prostatic bud formation (GO:0060513)|protein localization to cell surface (GO:0034394)|radial glial cell differentiation (GO:0060019)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of saliva secretion (GO:0046877)|regulation of smoothened signaling pathway (GO:0008589)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|salivary gland development (GO:0007431)|secretion by lung epithelial cell involved in lung growth (GO:0061033)|semicircular canal fusion (GO:0060879)|smooth muscle cell differentiation (GO:0051145)|somatic stem cell maintenance (GO:0035019)|spleen development (GO:0048536)|submandibular salivary gland formation (GO:0060661)|tear secretion (GO:0070075)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tissue regeneration (GO:0042246)|Type II pneumocyte differentiation (GO:0060510)|urothelial cell proliferation (GO:0050674)|white fat cell differentiation (GO:0050872)|wound healing (GO:0042060)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chemoattractant activity (GO:0042056)|fibroblast growth factor receptor binding (GO:0005104)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|type 2 fibroblast growth factor receptor binding (GO:0005111)			haematopoietic_and_lymphoid_tissue(1)|lung(11)|skin(1)	13	Lung NSC(6;1.12e-06)					AGCAACAAAAAGCAGCAGCAGCA	0.537																																					p.23_24del													.	FGF10-522	0			c.68_70del						.																																			SO:0001651	inframe_deletion	2255	exon1			ACAAAAAGCAGCA		CCDS3950.1	5p13-p12	2008-02-05			ENSG00000070193	ENSG00000070193			3666	protein-coding gene	gene with protein product		602115				9287324	Standard	NM_004465		Approved		uc003jog.1	O15520	OTTHUMG00000131153	ENST00000264664.4:c.68_70delGCT	5.37:g.44388724_44388726delAGC	ENSP00000264664:p.Cys23del	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	245	6	NM_004465	0	0	0	0	0	C7FDY0|Q6FHR3|Q6FHT6|Q96P59	In_Frame_Del	DEL	ENST00000264664.4	37	CCDS3950.1																																																																																			.		0.537	FGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253845.2	NM_004465	
URGCP	55665	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	43916495	43916495	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:43916495delC	ENST00000453200.1	-	6	3060	c.2567delG	c.(2566-2568)ggcfs	p.G856fs	URGCP_ENST00000443736.1_Frame_Shift_Del_p.G813fs|URGCP_ENST00000336086.6_Frame_Shift_Del_p.G813fs|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000402306.3_Frame_Shift_Del_p.G847fs|URGCP_ENST00000447717.3_Frame_Shift_Del_p.G813fs|URGCP_ENST00000223341.7_Frame_Shift_Del_p.G813fs|URGCP_ENST00000497914.1_5'UTR			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	856	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAAGCCGTCGCCCTGTTTCTC	0.637																																					p.G856fs		.											.	URGCP-94	0			c.2567delG						.						29.0	31.0	30.0					7																	43916495		1994	4175	6169	SO:0001589	frameshift_variant	55665	exon6			.		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2567delG	7.37:g.43916495delC	ENSP00000396918:p.Gly856fs	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	167	39	NM_001077663	0	0	0	0	0	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Frame_Shift_Del	DEL	ENST00000453200.1	37	CCDS47578.1																																																																																			.		0.637	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
PLXNA3	55558	broad.mit.edu	37	X	153688565	153688565	+	Frame_Shift_Del	DEL	G	G	-	rs375310385		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:153688565delG	ENST00000369682.3	+	2	217	c.42delG	c.(40-42)gtgfs	p.V14fs		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	14					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.A17fs*39(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCCTTGCCGTGGGGGGGGCCC	0.682																																					p.V14fs													.	PLXNA3-132	1	Insertion - Frameshift(1)	ovary(1)	c.42delG						.			47,59,3613		1,0,29,16,2,35,20,1525,499	34.0	32.0	33.0			0.6	0.0	X		33	69,109,6290		1,0,27,40,3,50,53,2275,1663	no	codingComplex	PLXNA3	NM_017514.3		2,0,56,56,5,85,73,3800,2162	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		2.752,2.8502,2.7879			153688565	116,168,9903	2202	4292	6494	SO:0001589	frameshift_variant	55558	exon2			TGCCGTGGGGGGG	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.42delG	X.37:g.153688565delG	ENSP00000358696:p.Val14fs	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	408	7	NM_017514	0	0	0	0	0	Q5HY36	Frame_Shift_Del	DEL	ENST00000369682.3	37	CCDS14752.1																																																																																			.		0.682	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
TAS1R1	80835	broad.mit.edu	37	1	6638984	6638985	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:6638984_6638985insT	ENST00000333172.6	+	6	2059_2060	c.1866_1867insT	c.(1867-1869)tttfs	p.F623fs	ZBTB48_ENST00000377674.4_5'Flank|TAS1R1_ENST00000328191.4_3'UTR|TAS1R1_ENST00000351136.3_Frame_Shift_Ins_p.F369fs	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	623					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TCTATGGCTTCTTTGGGGAACC	0.599																																					p.F622fs													.	TAS1R1-516	0			c.1866_1867insT						.																																			SO:0001589	frameshift_variant	80835	exon6			TGGCTTCTTTGGG		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.1869dupT	1.37:g.6638987_6638987dupT	ENSP00000331867:p.Phe623fs	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	148	32	NM_138697	0	0	0	0	0	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Frame_Shift_Ins	INS	ENST00000333172.6	37	CCDS81.1																																																																																			.		0.599	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
AZIN2	113451	broad.mit.edu	37	1	33583680	33583681	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:33583680_33583681insC	ENST00000294517.6	+	11	1794_1795	c.1207_1208insC	c.(1207-1209)gccfs	p.A403fs	ADC_ENST00000484656.1_3'UTR|ADC_ENST00000398167.1_Frame_Shift_Ins_p.A423fs|ADC_ENST00000373441.1_Frame_Shift_Ins_p.A423fs|ADC_ENST00000373443.3_Frame_Shift_Ins_p.A403fs	NM_052998.2	NP_443724.1	Q96A70	AZIN2_HUMAN		403					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of protein catabolic process (GO:0042177)|ornithine metabolic process (GO:0006591)|polyamine biosynthetic process (GO:0006596)|polyamine metabolic process (GO:0006595)|positive regulation of catalytic activity (GO:0043085)|positive regulation of polyamine transmembrane transport (GO:1902269)|putrescine transport (GO:0015847)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|trans-Golgi network membrane organization (GO:0098629)	axon (GO:0030424)|cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|granular vesicle (GO:1990005)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	catalytic activity (GO:0003824)|ornithine decarboxylase activator activity (GO:0042978)|putrescine transmembrane transporter activity (GO:0015489)			NS(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)			L-Arginine(DB00125)	GGGGACCCAGGCCTGCCACATC	0.614																																					p.A403fs													.	ADC-92	0			c.1207_1208insC						.																																			SO:0001589	frameshift_variant	113451	exon11			ACCCAGGCCTGCC																												ENST00000294517.6:c.1209dupC	1.37:g.33583682_33583682dupC	ENSP00000294517:p.Ala403fs	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	199	3	NM_052998	0	0	0	0	0	B2RDU5|D3DPQ9|Q5TIF4|Q5TIF5|Q5TIF6|Q8TF56|Q96L54|Q96L55|Q96L56|Q96L57|Q96MD9	Frame_Shift_Ins	INS	ENST00000294517.6	37	CCDS375.1																																																																																			.		0.614	ADC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011867.1		
PPT1	5538	broad.mit.edu	37	1	40535489	40535490	+	IGR	INS	-	-	G	rs367744502|rs200369781|rs370362556	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:40535489_40535490insG	ENST00000433473.3	-	0	2740				CAP1_ENST00000372797.3_Frame_Shift_Ins_p.R313fs|CAP1_ENST00000372792.2_Frame_Shift_Ins_p.R313fs|CAP1_ENST00000372805.3_Frame_Shift_Ins_p.R313fs|CAP1_ENST00000372798.1_Frame_Shift_Ins_p.R312fs|CAP1_ENST00000479759.1_3'UTR|CAP1_ENST00000340450.3_Frame_Shift_Ins_p.R312fs|CAP1_ENST00000372802.1_Frame_Shift_Ins_p.R312fs	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1						adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CATCCCCCAAACGAGCCACAAA	0.505																																					p.K312fs													.	CAP1-91	0			c.936_937insG						.																																			SO:0001628	intergenic_variant	10487	exon9			CCCCAAACGAGCC	U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495		1.37:g.40535489_40535490insG		Somatic	93	0		WXS	Illumina HiSeq	Phase_I	117	8	NM_006367	0	0	0	0	0	B4DY24|Q6FGQ4	Frame_Shift_Ins	INS	ENST00000433473.3	37	CCDS447.1																																																																																			.		0.505	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013126.2	NM_000310	
SCMH1	22955	hgsc.bcm.edu	37	1	41579112	41579113	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:41579112_41579113insG	ENST00000326197.7	-	7	856_857	c.557_558insC	c.(556-558)ccafs	p.P186fs	SCMH1_ENST00000456518.2_Intron|SCMH1_ENST00000372595.1_Frame_Shift_Ins_p.P125fs|SCMH1_ENST00000361705.3_Frame_Shift_Ins_p.P139fs|SCMH1_ENST00000397174.2_Frame_Shift_Ins_p.P166fs|SCMH1_ENST00000372596.1_Frame_Shift_Ins_p.P125fs|SCMH1_ENST00000397171.2_Frame_Shift_Ins_p.P125fs|SCMH1_ENST00000337495.5_Frame_Shift_Ins_p.P196fs|SCMH1_ENST00000402904.2_Frame_Shift_Ins_p.P186fs|SCMH1_ENST00000361191.5_Frame_Shift_Ins_p.P125fs|SCMH1_ENST00000372597.1_Frame_Shift_Ins_p.P139fs					sex comb on midleg homolog 1 (Drosophila)											breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				CAATAGTGGCTGGGCAAATGAA	0.53																																					p.P196fs		.											.	SCMH1-90	0			c.588_589insC						.																																			SO:0001589	frameshift_variant	22955	exon8			.	AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.558dupC	1.37:g.41579115_41579115dupG	ENSP00000318094:p.Pro186fs	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	107	20	NM_001172219	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000326197.7	37	CCDS30688.1																																																																																			.		0.530	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015656.1		
WDR78	79819	broad.mit.edu	37	1	67390432	67390433	+	Frame_Shift_Ins	INS	-	-	G	rs557595505		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:67390432_67390433insG	ENST00000371026.3	-	1	137_138	c.82_83insC	c.(82-84)caafs	p.Q28fs	MIER1_ENST00000371012.2_5'Flank|MIER1_ENST00000371016.1_5'Flank|WDR78_ENST00000431318.1_5'UTR|WDR78_ENST00000371022.3_Frame_Shift_Ins_p.Q28fs|MIER1_ENST00000401041.1_5'Flank|MIER1_ENST00000371018.3_5'Flank|MIER1_ENST00000355977.6_5'Flank|MIER1_ENST00000371014.1_5'Flank|WDR78_ENST00000371023.3_Frame_Shift_Ins_p.Q28fs|MIER1_ENST00000357692.2_5'Flank	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	28					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						CCCCTTTTTTTGGCCGCCTCTG	0.644																																					p.Q28fs													.	WDR78-92	0			c.83_84insC						.																																			SO:0001589	frameshift_variant	79819	exon1			TTTTTTTGGCCGC	BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.83dupC	1.37:g.67390434_67390434dupG	ENSP00000360065:p.Gln28fs	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	350	12	NM_024763	0	0	0	0	0	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Frame_Shift_Ins	INS	ENST00000371026.3	37	CCDS635.1																																																																																			.		0.644	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025404.1	NM_024763	
AMPD2	271	broad.mit.edu	37	1	110167929	110167930	+	Frame_Shift_Ins	INS	-	-	C	rs202115880		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:110167929_110167930insC	ENST00000256578.3	+	2	618_619	c.258_259insC	c.(259-261)cggfs	p.R87fs	AMPD2_ENST00000528454.1_5'UTR|AMPD2_ENST00000358729.4_Intron|AMPD2_ENST00000342115.4_Frame_Shift_Ins_p.R6fs|AMPD2_ENST00000526301.1_3'UTR|AMPD2_ENST00000528667.1_Frame_Shift_Ins_p.R87fs|AMPD2_ENST00000393688.3_5'Flank	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	87					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		CTGCAGAGGCTCGGGGTGGTCT	0.703																																					p.A86fs													.	AMPD2-292	0			c.258_259insC						.																																			SO:0001589	frameshift_variant	271	exon3			AGAGGCTCGGGGT	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.259dupC	1.37:g.110167930_110167930dupC	ENSP00000256578:p.Arg87fs	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	121	22	NM_001257360	0	0	0	0	0	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Frame_Shift_Ins	INS	ENST00000256578.3	37	CCDS805.1																																																																																			.		0.703	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1		
CGN	57530	bcgsc.ca	37	1	151491486	151491487	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:151491486_151491487insT	ENST00000271636.7	+	2	624_625	c.491_492insT	c.(490-495)gcttccfs	p.S165fs		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	159	Head.|Interacts with ZO-2.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CCGAAAGTGGCTTCCCCAGGTA	0.584																																					p.A164fs													.	CGN-93	0			c.491_492insT						.																																			SO:0001589	frameshift_variant	57530	exon2			AAGTGGCTTCCCC	AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.493dupT	1.37:g.151491488_151491488dupT	ENSP00000271636:p.Ser165fs	Somatic	129	0		WXS	Illumina HiSeq	Phase_1	364	69	NM_020770	0	0	0	0	0	A6H8L3|A7MD22|Q5T386|Q9NR25	Frame_Shift_Ins	INS	ENST00000271636.7	37	CCDS999.1																																																																																			.		0.584	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
S100A7	6278	bcgsc.ca	37	1	153430290	153430291	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:153430290_153430291insG	ENST00000368723.3	-	3	407_408	c.297_298insC	c.(295-300)ggcagcfs	p.S100fs	S100A7_ENST00000368722.1_Frame_Shift_Ins_p.S100fs	NM_002963.3	NP_002954.2	P31151	S10A7_HUMAN	S100 calcium binding protein A7	100					angiogenesis (GO:0001525)|defense response to Gram-negative bacterium (GO:0050829)|epidermis development (GO:0008544)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of granulocyte chemotaxis (GO:0071624)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of T cell chemotaxis (GO:0010820)|response to lipopolysaccharide (GO:0032496)|response to reactive oxygen species (GO:0000302)|sequestering of metal ion (GO:0051238)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(5)|skin(2)	10	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGTCACTGGCTGCCCCCGGAAC	0.515																																					p.S100fs													.	S100A7-91	0			c.298_299insC						.																																			SO:0001589	frameshift_variant	6278	exon3			ACTGGCTGCCCCC	BC034687	CCDS1039.1	1q21	2013-01-10	2006-09-11		ENSG00000143556	ENSG00000143556		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10497	protein-coding gene	gene with protein product		600353	"""S100 calcium-binding protein A7 (psoriasin 1)"", ""S100 calcium binding protein A7 (psoriasin 1)"""	PSOR1		1940442	Standard	NM_002963		Approved	S100A7c	uc001fbv.1	P31151	OTTHUMG00000013123	ENST00000368723.3:c.298dupC	1.37:g.153430291_153430291dupG	ENSP00000357712:p.Ser100fs	Somatic	88	0		WXS	Illumina HiSeq	Phase_1	199	36	NM_002963	0	0	0	0	0	Q5SY67|Q6FGE3|Q9H1E2	Frame_Shift_Ins	INS	ENST00000368723.3	37	CCDS1039.1																																																																																			.		0.515	S100A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036789.1	NM_002963	
MIA3	375056	bcgsc.ca	37	1	222837351	222837352	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr1:222837351_222837352insC	ENST00000344922.5	+	27	5299_5300	c.5274_5275insC	c.(5275-5277)ccafs	p.P1759fs	MIA3_ENST00000340535.7_Frame_Shift_Ins_p.P637fs|RP11-378J18.8_ENST00000608771.1_RNA|MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Frame_Shift_Ins_p.P1759fs	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1759	Pro-rich.				chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		TTAATATGGCTCCAAAAGGGCC	0.485																																					p.A1758fs													.	MIA3-98	0			c.5274_5275insC						.																																			SO:0001589	frameshift_variant	375056	exon27			TATGGCTCCAAAA		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.5276dupC	1.37:g.222837353_222837353dupC	ENSP00000340900:p.Pro1759fs	Somatic	77	0		WXS	Illumina HiSeq	Phase_1	120	22	NM_198551	0	0	0	0	0	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Frame_Shift_Ins	INS	ENST00000344922.5	37	CCDS41470.1																																																																																			.		0.485	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
ITPRIP	85450	bcgsc.ca	37	10	106074688	106074689	+	Frame_Shift_Ins	INS	-	-	G	rs536937676	byFrequency	TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr10:106074688_106074689insG	ENST00000337478.1	-	2	1292_1293	c.1121_1122insC	c.(1120-1122)ccafs	p.P374fs	ITPRIP_ENST00000278071.2_Frame_Shift_Ins_p.P374fs|ITPRIP_ENST00000358187.2_Frame_Shift_Ins_p.P374fs|RP11-127L20.5_ENST00000472915.2_RNA	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	374						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						TGCTGGAGGCTGGGGTGCCCTC	0.589																																					p.P374fs													.	ITPRIP-90	0			c.1122_1123insC						.																																			SO:0001589	frameshift_variant	85450	exon2			GGAGGCTGGGGTG	AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.1122dupC	10.37:g.106074692_106074692dupG	ENSP00000337178:p.Pro374fs	Somatic	104	0		WXS	Illumina HiSeq	Phase_1	339	96	NM_001272013	0	0	0	0	0	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Frame_Shift_Ins	INS	ENST00000337478.1	37	CCDS7557.1																																																																																			.		0.589	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050204.1	NM_033397	
PDHX	8050	bcgsc.ca	37	11	34988257	34988258	+	Frame_Shift_Ins	INS	-	-	ACTCCAGCCCCCC	rs146230351|rs118054792		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:34988257_34988258insACTCCAGCCCCCC	ENST00000227868.4	+	6	796_797	c.712_713insACTCCAGCCCCCC	c.(712-714)acafs	p.T238fs	PDHX_ENST00000448838.3_Frame_Shift_Ins_p.T223fs|PDHX_ENST00000430469.2_Intron			O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X	238					cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)	p.T238P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	16	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			TCCAGCCCCCACAGCCACTCCC	0.53																																					p.T238fs													.	PDHX-226	1	Substitution - Missense(1)	large_intestine(1)	c.712_713insACTCCAGCCCCCC						.																																			SO:0001589	frameshift_variant	8050	exon6			GCCCCCACAGCCA	U82328	CCDS7896.1, CCDS44569.1, CCDS53616.1	11p13	2008-02-05			ENSG00000110435	ENSG00000110435			21350	protein-coding gene	gene with protein product		608769				9467010, 12372595	Standard	NM_003477		Approved	E3BP, proX, PDX1, OPDX, DLDBP	uc001mvt.3	O00330	OTTHUMG00000166491	Exception_encountered	11.37:g.34988257_34988258insACTCCAGCCCCCC	ENSP00000227868:p.Thr238fs	Somatic	119	0		WXS	Illumina HiSeq	Phase_1	180	0	NM_003477	0	0	0	0	0	B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Frame_Shift_Ins	INS	ENST00000227868.4	37	CCDS7896.1																																																																																			.		0.530	PDHX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390017.1	NM_003477	
DAGLA	747	broad.mit.edu	37	11	61495728	61495729	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:61495728_61495729insG	ENST00000257215.5	+	7	856_857	c.740_741insG	c.(739-744)cagcggfs	p.R248fs		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	248					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CGGCAGCGGCAGCGGGCCAAGC	0.624																																					p.Q247fs													.	DAGLA-92	0			c.740_741insG						.																																			SO:0001589	frameshift_variant	747	exon7			AGCGGCAGCGGGC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.741dupG	11.37:g.61495729_61495729dupG	ENSP00000257215:p.Arg248fs	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	314	5	NM_006133	0	0	0	0	0	A7E233|Q6WQJ0	Frame_Shift_Ins	INS	ENST00000257215.5	37	CCDS31578.1																																																																																			.		0.624	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
GDPD5	81544	broad.mit.edu	37	11	75146590	75146591	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr11:75146590_75146591insG	ENST00000336898.3	-	17	2616_2617	c.1779_1780insC	c.(1777-1782)ggcagcfs	p.S594fs	GDPD5_ENST00000533805.1_Frame_Shift_Ins_p.S349fs|GDPD5_ENST00000376282.3_Frame_Shift_Ins_p.S475fs|GDPD5_ENST00000526177.1_Frame_Shift_Ins_p.S456fs|GDPD5_ENST00000533784.1_Frame_Shift_Ins_p.S475fs|GDPD5_ENST00000529721.1_Frame_Shift_Ins_p.S594fs|GDPD5_ENST00000443276.2_3'UTR	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	594					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						TTGGTGTGGCTGCCACCCCCTC	0.579																																					p.S594fs													.	GDPD5-91	0			c.1780_1781insC						.																																			SO:0001589	frameshift_variant	81544	exon17			TGTGGCTGCCACC	AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.1780dupC	11.37:g.75146591_75146591dupG	ENSP00000337972:p.Ser594fs	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	307	4	NM_030792	0	0	0	0	0	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Frame_Shift_Ins	INS	ENST00000336898.3	37	CCDS8238.1																																																																																			.		0.579	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1	NM_030792	
KRT83	3889	broad.mit.edu	37	12	52715037	52715038	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:52715037_52715038insT	ENST00000293670.3	-	1	144_145	c.82_83insA	c.(82-84)agcfs	p.S28fs		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	28	Head.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GCAGCAGCGGCTTGGCCGGGGC	0.678																																					p.S28fs	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)												.	KRT83-91	0			c.83_84insA						.			68,4106		1,66,2020						3.7	1.0			35	108,8010		0,108,3951	no	frameshift	KRT83	NM_002282.3		1,174,5971	A1A1,A1R,RR		1.3304,1.6291,1.4318				176,12116				SO:0001589	frameshift_variant	3889	exon1			CAGCGGCTTGGCC	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.83dupA	12.37:g.52715039_52715039dupT	ENSP00000293670:p.Ser28fs	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	167	9	NM_002282	0	0	0	0	0	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Frame_Shift_Ins	INS	ENST00000293670.3	37	CCDS8823.1																																																																																			.		0.678	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282	
ARHGEF25	115557	bcgsc.ca	37	12	58010627	58010628	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:58010627_58010628insC	ENST00000286494.4	+	15	2153_2154	c.1693_1694insC	c.(1693-1695)accfs	p.T565fs	AC025165.8_ENST00000356672.3_RNA|AC025165.8_ENST00000444467.1_RNA|AC025165.8_ENST00000610219.1_RNA|ARHGEF25_ENST00000477314.1_3'UTR|ARHGEF25_ENST00000333972.7_Frame_Shift_Ins_p.T604fs|AC025165.8_ENST00000593846.1_RNA	NM_182947.3	NP_891992	Q86VW2	ARHGP_HUMAN	Rho guanine nucleotide exchange factor (GEF) 25	565						cytosol (GO:0005829)|myofibril (GO:0030016)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	28						AACTCCAAAAACCCCTCCCTGC	0.54																																					p.T604fs													.	ARHGEF25-653	0			c.1810_1811insC						.																																			SO:0001589	frameshift_variant	115557	exon16			CCAAAAACCCCTC		CCDS8947.1, CCDS44931.1	12q13.3	2011-11-16			ENSG00000240771	ENSG00000240771		"""Rho guanine nucleotide exchange factors"""	30275	protein-coding gene	gene with protein product	"""RAC/CDC42 exchange factor"""	610215				12547822	Standard	NM_182947		Approved	GEFT, p63RhoGEF	uc009zpy.4	Q86VW2	OTTHUMG00000152516	ENST00000286494.4:c.1697dupC	12.37:g.58010631_58010631dupC	ENSP00000286494:p.Thr565fs	Somatic	205	0		WXS	Illumina HiSeq	Phase_1	252	71	NM_001111270	0	0	0	0	0	A6NJH5|A9CQZ6|F8W7Z4|Q8WV84|Q96E63	Frame_Shift_Ins	INS	ENST00000286494.4	37	CCDS8947.1																																																																																			.		0.540	ARHGEF25-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000326561.1	NM_133483	
SLC26A10	65012	bcgsc.ca	37	12	58017668	58017669	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:58017668_58017669insG	ENST00000320442.4	+	8	1414_1415	c.1103_1104insG	c.(1102-1107)ctggggfs	p.LG368fs	SLC26A10_ENST00000379218.2_Frame_Shift_Ins_p.LG368fs	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	368						integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					CTGCTGTGGCTGGGGCCCTTCT	0.569																																					p.L368fs													.	SLC26A10-531	0			c.1103_1104insG						.																																			SO:0001589	frameshift_variant	65012	exon8			TGTGGCTGGGGCC		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1107dupG	12.37:g.58017672_58017672dupG	ENSP00000320217:p.Leu368fs	Somatic	112	0		WXS	Illumina HiSeq	Phase_1	289	72	NM_133489	0	0	0	0	0	A6NMJ2|B6ZDQ3|Q6ZWI7	Frame_Shift_Ins	INS	ENST00000320442.4	37	CCDS8949.2																																																																																			.		0.569	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2		
LINC00173	100287569	broad.mit.edu	37	12	116972647	116972648	+	RNA	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr12:116972647_116972648insC	ENST00000480237.1	+	0	918_919					NR_027345.1		Q6ZV60	YL023_HUMAN	long intergenic non-protein coding RNA 173																		GCATTCCCGGGCAGCCGCTGCA	0.604																																					.													.	.	0			.						.																																					100287569	.			TCCCGGGCAGCCG	AC090670, BC038547, BC121822		12q24.22	2012-10-12	2011-08-11	2011-08-11	ENSG00000196668	ENSG00000196668		"""Long non-coding RNAs"""	33791	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 173"""	NCRNA00173			Standard	NR_027345		Approved	FLJ42957	uc001tvx.1	Q6ZV60	OTTHUMG00000157726		12.37:g.116972648_116972648dupC		Somatic	56	0		WXS	Illumina HiSeq	Phase_I	104	6	.	0	0	0	0	0		RNA	INS	ENST00000480237.1	37																																																																																				.		0.604	LINC00173-002	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000349521.1	NR_027345	
ONECUT1	3175	broad.mit.edu	37	15	53081466	53081467	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:53081466_53081467insG	ENST00000305901.5	-	1	742_743	c.615_616insC	c.(613-618)gccgccfs	p.A206fs	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	206					B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		GTGGGCATGGCGGCCCCCGGGT	0.713																																					p.A206fs													.	ONECUT1-68	0			c.616_617insC						.																																			SO:0001589	frameshift_variant	3175	exon1			GCATGGCGGCCCC	U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.616dupC	15.37:g.53081468_53081468dupG	ENSP00000302630:p.Ala206fs	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	311	6	NM_004498	0	0	0	0	0	B2RTV4|Q99744|Q9UMR6	Frame_Shift_Ins	INS	ENST00000305901.5	37	CCDS10150.1																																																																																			.		0.713	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254849.2		
ADPGK	83440	broad.mit.edu	37	15	73044826	73044827	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:73044826_73044827insT	ENST00000311669.8	-	7	1439_1440	c.1346_1347insA	c.(1345-1347)aagfs	p.K449fs	ADPGK_ENST00000456471.2_Frame_Shift_Ins_p.K175fs	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	450	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						CTACTACTGGCTTGTTTGGGTT	0.49																																					p.K449fs													.	ADPGK-90	0			c.1347_1348insA						.																																			SO:0001589	frameshift_variant	83440	exon7			TACTGGCTTGTTT	AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.1347dupA	15.37:g.73044828_73044828dupT	ENSP00000312250:p.Lys449fs	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	310	7	NM_031284	0	0	0	0	0	Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Frame_Shift_Ins	INS	ENST00000311669.8	37	CCDS42057.1																																																																																			.		0.490	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420434.1	NM_031284	
MFGE8	4240	bcgsc.ca	37	15	89453134	89453135	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr15:89453134_89453135insG	ENST00000566497.1	-	2	154_155	c.93_94insC	c.(91-96)ccctgcfs	p.C32fs	MFGE8_ENST00000539437.1_Frame_Shift_Ins_p.C24fs|MFGE8_ENST00000542878.1_Intron|MFGE8_ENST00000268151.7_Frame_Shift_Ins_p.C32fs|MFGE8_ENST00000268150.8_Frame_Shift_Ins_p.C32fs|MFGE8_ENST00000559997.1_Intron			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	32	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					CCGTTGTGGCAGGGGTTTTTGG	0.545																																					p.C32fs													.	MFGE8-91	0			c.94_95insC						.																																			SO:0001589	frameshift_variant	4240	exon2			TGTGGCAGGGGTT	U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.94dupC	15.37:g.89453138_89453138dupG	ENSP00000456281:p.Cys32fs	Somatic	104	3		WXS	Illumina HiSeq	Phase_1	257	68	NM_001114614	0	0	0	0	0	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Frame_Shift_Ins	INS	ENST00000566497.1	37	CCDS10347.1																																																																																			.		0.545	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000432804.1	NM_005928	
METTL22	79091	bcgsc.ca	37	16	8736397	8736398	+	Frame_Shift_Ins	INS	-	-	TCCCTCCC	rs138698854|rs202173100		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:8736397_8736398insTCCCTCCC	ENST00000381920.3	+	9	1243_1244	c.985_986insTCCCTCCC	c.(985-987)acafs	p.T329fs	METTL22_ENST00000568967.1_3'UTR|METTL22_ENST00000561758.1_Frame_Shift_Ins_p.T273fs	NM_024109.2	NP_077014.2	Q9BUU2	MET22_HUMAN	methyltransferase like 22	329						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			large_intestine(5)|lung(4)	9						AAATGCCTGCACAGCCATACTG	0.535																																					p.T329fs													.	METTL22-90	0			c.985_986insTCCCTCCC						.																																			SO:0001589	frameshift_variant	79091	exon9			GCCTGCACAGCCA	AK022495	CCDS10533.2	16p13.2	2014-07-15	2011-03-03	2011-03-03	ENSG00000067365	ENSG00000067365			28368	protein-coding gene	gene with protein product		615261	"""chromosome 16 open reading frame 68"""	C16orf68		24140279	Standard	XM_005255570		Approved	FLJ12433,MGC2654	uc002cyz.3	Q9BUU2	OTTHUMG00000129694	Exception_encountered	16.37:g.8736397_8736398insTCCCTCCC	ENSP00000371345:p.Thr329fs	Somatic	230	0		WXS	Illumina HiSeq	Phase_1	312	0	NM_024109	0	0	0	0	0	B2RD29|D3DUF2|Q6XYB4|Q9HA03	Frame_Shift_Ins	INS	ENST00000381920.3	37	CCDS10533.2																																																																																			.		0.535	METTL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251901.1	NM_024109	
ANKRD11	29123	broad.mit.edu	37	16	89352564	89352565	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr16:89352564_89352565insC	ENST00000301030.4	-	8	1234_1235	c.774_775insG	c.(772-777)gggaacfs	p.N259fs	ANKRD11_ENST00000378330.2_Frame_Shift_Ins_p.N259fs	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	259					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TGCTGCGGGTTCCCTCCGTACC	0.579																																					p.N259fs													.	ANKRD11-139	0			c.775_776insG						.																																			SO:0001589	frameshift_variant	29123	exon8			GCGGGTTCCCTCC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.775dupG	16.37:g.89352567_89352567dupC	ENSP00000301030:p.Asn259fs	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	536	7	NM_013275	0	0	0	0	0	Q6NTG1|Q6QMF8	Frame_Shift_Ins	INS	ENST00000301030.4	37	CCDS32513.1																																																																																			.		0.579	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
ALDOC	230	bcgsc.ca	37	17	26900783	26900784	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:26900783_26900784insG	ENST00000226253.4	-	8	1443_1444	c.968_969insC	c.(967-969)gctfs	p.A323fs	PIGS_ENST00000395346.2_5'Flank|RP11-192H23.5_ENST00000585189.1_RNA|PIGS_ENST00000543734.1_5'Flank|ALDOC_ENST00000395319.3_Frame_Shift_Ins_p.A295fs|ALDOC_ENST00000395321.2_Frame_Shift_Ins_p.A323fs|PIGS_ENST00000308360.7_5'Flank	NM_005165.2	NP_005156.1	P09972	ALDOC_HUMAN	aldolase C, fructose-bisphosphate	323					aging (GO:0007568)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|organ regeneration (GO:0031100)|protein heterotetramerization (GO:0051290)|protein homotetramerization (GO:0051289)|response to hypoxia (GO:0001666)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	cytoskeletal protein binding (GO:0008092)|fructose-bisphosphate aldolase activity (GO:0004332)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Lung NSC(42;0.00431)					CCTCAGTGGCAGCCCCAGCATT	0.653																																					p.A323fs													.	ALDOC-651	0			c.969_970insC						.																																			SO:0001589	frameshift_variant	230	exon8			AGTGGCAGCCCCA	AF054987	CCDS11236.1	17q11.2	2013-09-20			ENSG00000109107	ENSG00000109107	4.1.2.13		418	protein-coding gene	gene with protein product		103870					Standard	XM_005257947		Approved		uc002hbp.3	P09972	OTTHUMG00000132605	ENST00000226253.4:c.969dupC	17.37:g.26900784_26900784dupG	ENSP00000226253:p.Ala323fs	Somatic	155	0		WXS	Illumina HiSeq	Phase_1	567	121	NM_005165	0	0	0	0	0	B2R5R3|Q3SYL3|Q6FH94|Q6P0L5	Frame_Shift_Ins	INS	ENST00000226253.4	37	CCDS11236.1																																																																																			.		0.653	ALDOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255839.4		
FKBP10	60681	broad.mit.edu	37	17	39975558	39975559	+	Frame_Shift_Ins	INS	-	-	C	rs137853883		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:39975558_39975559insC	ENST00000321562.4	+	5	928_929	c.824_825insC	c.(823-828)ctccccfs	p.LP275fs	FKBP10_ENST00000544340.1_5'UTR	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	275					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		ACGCTGGAGCTCCCCCCCGGCT	0.634																																					p.L275fs													.	FKBP10-227	0			c.824_825insC						.																																			SO:0001589	frameshift_variant	60681	exon5			TGGAGCTCCCCCC	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.831dupC	17.37:g.39975565_39975565dupC	ENSP00000317232:p.Leu275fs	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	492	6	NM_021939	0	0	0	0	0	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Frame_Shift_Ins	INS	ENST00000321562.4	37	CCDS11409.1																																																																																			.		0.634	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257410.2	NM_021939	
KAT2A	2648	broad.mit.edu;bcgsc.ca	37	17	40272817	40272818	+	Frame_Shift_Ins	INS	-	-	C	rs200262131		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:40272817_40272818insC	ENST00000225916.5	-	2	422_423	c.369_370insG	c.(367-372)tggaaafs	p.K124fs	HSPB9_ENST00000355067.3_5'Flank|CTD-2132N18.3_ENST00000592574.1_Frame_Shift_Ins_p.K158fs	NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	124					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)	p.K124E(1)		central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						TTGGGGTTTTTCCAGCCATTAC	0.584																																					p.K124fs													.	KAT2A-523	1	Substitution - Missense(1)	prostate(1)	c.370_371insG						.																																			SO:0001589	frameshift_variant	2648	exon2			GGTTTTTCCAGCC	AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.370dupG	17.37:g.40272819_40272819dupC	ENSP00000225916:p.Lys124fs	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	300	85	NM_021078	0	0	0	0	0	Q8N1A2|Q9UCW1	Frame_Shift_Ins	INS	ENST00000225916.5	37	CCDS11417.1																																																																																			.		0.584	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1	NM_021078	
GHDC	84514	broad.mit.edu	37	17	40344321	40344322	+	Frame_Shift_Ins	INS	-	-	C	rs371381917		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:40344321_40344322insC	ENST00000301671.8	-	4	1267_1268	c.826_827insG	c.(826-828)gccfs	p.A276fs	GHDC_ENST00000436923.2_Frame_Shift_Ins_p.A276fs|GHDC_ENST00000428494.2_Frame_Shift_Ins_p.A237fs|GHDC_ENST00000590520.1_5'Flank|GHDC_ENST00000587427.1_Frame_Shift_Ins_p.A276fs|GHDC_ENST00000414034.3_Frame_Shift_Ins_p.A276fs|GHDC_ENST00000593209.1_Frame_Shift_Ins_p.A276fs			Q8N2G8	GHDC_HUMAN	GH3 domain containing	276						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		GGCCCCGAGGGCAGCCACAGCC	0.663																																					p.A276fs													.	GHDC-90	0			c.827_828insG						.																																			SO:0001589	frameshift_variant	84514	exon5			CCGAGGGCAGCCA	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.827dupG	17.37:g.40344322_40344322dupC	ENSP00000301671:p.Ala276fs	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	507	13	NM_001142623	0	0	0	0	0	B4DQS4|E9PDB5|Q9BXM6	Frame_Shift_Ins	INS	ENST00000301671.8	37	CCDS11422.1																																																																																			.		0.663	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
BRCA1	672	bcgsc.ca	37	17	41197706	41197707	+	In_Frame_Ins	INS	-	-	GGGGGGGGT	rs138690298		TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:41197706_41197707insGGGGGGGGT	ENST00000357654.3	-	23	5698_5699	c.5580_5581insACCCCCCCC	c.(5578-5583)cacagc>cacACCCCCCCCagc	p.1860_1861HS>HTPPS	BRCA1_ENST00000491747.2_In_Frame_Ins_p.756_757HS>HTPPS|BRCA1_ENST00000493795.1_In_Frame_Ins_p.1813_1814HS>HTPPS|BRCA1_ENST00000586385.1_In_Frame_Ins_p.170_171HS>HTPPS|BRCA1_ENST00000468300.1_3'UTR|BRCA1_ENST00000354071.3_In_Frame_Ins_p.1595_1596HS>HTPPS|BRCA1_ENST00000309486.4_In_Frame_Ins_p.1564_1565HS>HTPPS|BRCA1_ENST00000591849.1_In_Frame_Ins_p.93_94HS>HTPPS|BRCA1_ENST00000346315.3_In_Frame_Ins_p.1621_1622HS>HTPPS|BRCA1_ENST00000591534.1_In_Frame_Ins_p.351_352HS>HTPPS|BRCA1_ENST00000351666.3_In_Frame_Ins_p.677_678HS>HTPPS|BRCA1_ENST00000471181.2_In_Frame_Ins_p.1881_1882HS>HTPPS|BRCA1_ENST00000352993.3_In_Frame_Ins_p.718_719HS>HTPPS	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1860					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CAGTAGTGGCTGTGGGGGATCT	0.584			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.S1882delinsTPPS			yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1-3415	0			c.5644_5645insACCCCCCCC						.		,,,,	345,583,3336		0,0,345,0,583,1204					,,,,	1.9	0.0		dbSNP_134	62	468,928,6858		0,0,468,0,928,2731	no	codingComplex,utr-3,codingComplex,codingComplex,codingComplex	BRCA1	NM_007300.3,NM_007299.3,NM_007298.3,NM_007297.3,NM_007294.3	,,,,	0,0,813,0,1511,3935	A1A1,A1A2,A1R,A2A2,A2R,RR		16.913,21.7636,18.5653	,,,,	,,,,		813,1511,10194				SO:0001652	inframe_insertion	672	exon24	Familial Cancer Database		AGTGGCTGTGGGG	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.5580_5581insACCCCCCCC	17.37:g.41197706_41197707insGGGGGGGGT	ENSP00000350283:p.His1860_Ser1861insThrProPro	Somatic	37	0		WXS	Illumina HiSeq	Phase_1	111	8	NM_007300	0	0	0	0	0	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	In_Frame_Ins	INS	ENST00000357654.3	37	CCDS11453.1																																																																																			.		0.584	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
WNT3	7473	bcgsc.ca	37	17	44851096	44851097	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr17:44851096_44851097insG	ENST00000225512.5	-	2	421_422	c.259_260insC	c.(259-261)cgcfs	p.R87fs		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	87					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GTTCCAGCGGCGGCCCCGGAAC	0.644																																					p.W87fs													.	WNT3-522	0			c.260_261insC						.																																			SO:0001589	frameshift_variant	7473	exon2			CAGCGGCGGCCCC	AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.260dupC	17.37:g.44851098_44851098dupG	ENSP00000225512:p.Arg87fs	Somatic	93	0		WXS	Illumina HiSeq	Phase_1	313	80	NM_030753	0	0	0	0	0	Q2M237|Q9H1J9	Frame_Shift_Ins	INS	ENST00000225512.5	37	CCDS11505.1																																																																																			.		0.644	WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440427.1	NM_030753	
PPAN	56342	bcgsc.ca	37	19	10218222	10218223	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:10218222_10218223insG	ENST00000253107.7	+	3	337_338	c.231_232insG	c.(232-234)gggfs	p.G78fs	PPAN_ENST00000556468.1_Frame_Shift_Ins_p.G78fs|SNORD105_ENST00000386910.1_RNA|PPAN-P2RY11_ENST00000428358.1_Frame_Shift_Ins_p.G78fs|SNORD105B_ENST00000458770.1_RNA|PPAN-P2RY11_ENST00000393796.4_Frame_Shift_Ins_p.G78fs|PPAN_ENST00000393793.1_Frame_Shift_Ins_p.G25fs	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	78	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			TGGCAGTGGCTGGGCCCCTCGG	0.49																																					p.A77fs													.	PPAN-90	0			c.231_232insG						.																																			SO:0001589	frameshift_variant	56342	exon3			AGTGGCTGGGCCC	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.234dupG	19.37:g.10218225_10218225dupG	ENSP00000253107:p.Gly78fs	Somatic	89	0		WXS	Illumina HiSeq	Phase_1	266	105	NM_020230	0	0	0	0	0	C9J3F9|Q9BW97|Q9H170	Frame_Shift_Ins	INS	ENST00000253107.7	37	CCDS12225.1																																																																																			.		0.490	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	NM_020230	
DNMT1	1786	broad.mit.edu	37	19	10250846	10250847	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:10250846_10250847insC	ENST00000340748.4	-	32	3868_3869	c.3633_3634insG	c.(3631-3636)ctgcccfs	p.P1212fs	DNMT1_ENST00000589538.1_Intron|DNMT1_ENST00000359526.4_Frame_Shift_Ins_p.P1228fs|DNMT1_ENST00000540357.1_Frame_Shift_Ins_p.P1212fs			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	1212	Catalytic.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.|SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CCCTTCTGGGGCAGCCGCTGGC	0.624																																					p.P1228fs													.	DNMT1-660	0			c.3682_3683insG						.																																			SO:0001589	frameshift_variant	1786	exon33			TCTGGGGCAGCCG	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.3634dupG	19.37:g.10250847_10250847dupC	ENSP00000345739:p.Pro1212fs	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	208	16	NM_001130823	0	0	0	0	0	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Frame_Shift_Ins	INS	ENST00000340748.4	37	CCDS12228.1																																																																																			.		0.624	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
FOSB	2354	bcgsc.ca	37	19	45974012	45974013	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:45974012_45974013insC	ENST00000353609.3	+	2	844_845	c.252_253insC	c.(253-255)cagfs	p.Q85fs	FOSB_ENST00000585836.1_Frame_Shift_Ins_p.Q46fs|FOSB_ENST00000590335.1_Frame_Shift_Ins_p.Q85fs|FOSB_ENST00000591858.1_Frame_Shift_Ins_p.Q46fs|FOSB_ENST00000592436.1_Frame_Shift_Ins_p.Q85fs|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000586615.1_Frame_Shift_Ins_p.Q36fs|FOSB_ENST00000417353.2_Frame_Shift_Ins_p.Q85fs|FOSB_ENST00000443841.2_Intron|FOSB_ENST00000592811.1_Frame_Shift_Ins_p.Q36fs	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	85					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		AGTCCCAGGGGCAGCCACTGGC	0.658																																					p.G84fs													.	FOSB-848	0			c.252_253insC						.																																			SO:0001589	frameshift_variant	2354	exon2			CCAGGGGCAGCCA		CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.253dupC	19.37:g.45974013_45974013dupC	ENSP00000245919:p.Gln85fs	Somatic	209	0		WXS	Illumina HiSeq	Phase_1	426	79	NM_006732	0	0	0	0	0	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Frame_Shift_Ins	INS	ENST00000353609.3	37	CCDS12664.1																																																																																			.		0.658	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459561.1	NM_006732	
NUP62	23636	bcgsc.ca	37	19	50411672	50411673	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr19:50411672_50411673insG	ENST00000596217.1	-	2	3279_3280	c.1392_1393insC	c.(1390-1395)cccgccfs	p.A465fs	NUP62_ENST00000352066.3_Frame_Shift_Ins_p.A465fs|NUP62_ENST00000413454.1_Frame_Shift_Ins_p.A465fs|NUP62_ENST00000597029.1_Frame_Shift_Ins_p.A465fs|NUP62_ENST00000422090.2_Frame_Shift_Ins_p.A465fs|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000600583.1_5'Flank|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000597723.1_Frame_Shift_Ins_p.A389fs			P37198	NUP62_HUMAN	nucleoporin 62kDa	465					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CTGGTGTCGGCGGGGGCCCCGG	0.579																																					p.A465fs													.	NUP62-615	0			c.1393_1394insC						.																																			SO:0001589	frameshift_variant	23636	exon2			TGTCGGCGGGGGC	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.1393dupC	19.37:g.50411677_50411677dupG	ENSP00000471191:p.Ala465fs	Somatic	248	2		WXS	Illumina HiSeq	Phase_1	695	114	NM_001193357	0	0	0	0	0	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Frame_Shift_Ins	INS	ENST00000596217.1	37	CCDS12788.1																																																																																			.		0.579	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
ABCG8	64241	bcgsc.ca	37	2	44079968	44079969	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:44079968_44079969insA	ENST00000272286.2	+	6	1015_1016	c.925_926insA	c.(925-927)tacfs	p.Y309fs		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	309	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	AGCCATCGGCTACCCCTGTCCT	0.594																																					p.Y309_P310delinsX													.	ABCG8-94	0			c.925_926insA						.																																			SO:0001589	frameshift_variant	64241	exon6			ATCGGCTACCCCT	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.926dupA	2.37:g.44079969_44079969dupA	ENSP00000272286:p.Tyr309fs	Somatic	100	0		WXS	Illumina HiSeq	Phase_1	376	72	NM_022437	0	0	0	0	0	Q53QN8	Nonsense_Mutation	INS	ENST00000272286.2	37	CCDS1815.1																																																																																			.		0.594	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437	
TGFBRAP1	9392	bcgsc.ca	37	2	105924084	105924085	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:105924084_105924085insC	ENST00000393359.2	-	2	1100_1101	c.674_675insG	c.(673-675)ggcfs	p.G225fs	TGFBRAP1_ENST00000258449.1_Frame_Shift_Ins_p.G225fs			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	225	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						GCCCTCCGGGGCCCGCCAGCAG	0.594																																					p.G225fs	Esophageal Squamous(183;794 2019 9730 21801 48859)												.	TGFBRAP1-91	0			c.675_676insG						.																																			SO:0001589	frameshift_variant	9392	exon2			TCCGGGGCCCGCC	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.675dupG	2.37:g.105924087_105924087dupC	ENSP00000377027:p.Gly225fs	Somatic	235	4		WXS	Illumina HiSeq	Phase_1	747	123	NM_004257	0	0	0	0	0	A8K5R7|D3DVJ8|O60466	Frame_Shift_Ins	INS	ENST00000393359.2	37	CCDS2067.1																																																																																			.		0.594	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257	
IWS1	55677	bcgsc.ca	37	2	128262546	128262547	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr2:128262546_128262547insG	ENST00000295321.4	-	3	1191_1192	c.932_933insC	c.(931-933)cctfs	p.P311fs	IWS1_ENST00000486662.1_5'Flank|AC010976.2_ENST00000599001.1_RNA|IWS1_ENST00000455721.2_Frame_Shift_Ins_p.P318fs	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	311	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		AGTCACTGGCAGGCCCCTTCTG	0.54																																					p.P311fs													.	IWS1-91	0			c.933_934insC						.																																			SO:0001589	frameshift_variant	55677	exon3			ACTGGCAGGCCCC	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.933dupC	2.37:g.128262548_128262548dupG	ENSP00000295321:p.Pro311fs	Somatic	224	1		WXS	Illumina HiSeq	Phase_1	215	65	NM_017969	0	0	0	0	0	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Frame_Shift_Ins	INS	ENST00000295321.4	37	CCDS2146.1																																																																																			.		0.540	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
SLC41A3	54946	bcgsc.ca	37	3	125786910	125786911	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr3:125786910_125786911insT	ENST00000315891.6	-	2	390_391	c.152_153insA	c.(151-153)aagfs	p.K51fs	SLC41A3_ENST00000346785.5_Frame_Shift_Ins_p.K51fs|AC117422.1_ENST00000581281.1_RNA|SLC41A3_ENST00000508835.1_Intron|SLC41A3_ENST00000514023.1_5'UTR|SLC41A3_ENST00000360370.4_Frame_Shift_Ins_p.K51fs	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		TCTCCAGTGGCTTGGGGGTCAC	0.639																																					p.K51fs													.	SLC41A3-90	0			c.153_154insA						.																																			SO:0001589	frameshift_variant	54946	exon2			CAGTGGCTTGGGG		CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.153dupA	3.37:g.125786912_125786912dupT	ENSP00000326070:p.Lys51fs	Somatic	167	0		WXS	Illumina HiSeq	Phase_1	709	137	NM_001008486	0	0	0	0	0	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Frame_Shift_Ins	INS	ENST00000315891.6	37	CCDS33843.1																																																																																			.		0.639	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1	NM_017836	
FGFR3	2261	broad.mit.edu	37	4	1807542	1807543	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:1807542_1807543insG	ENST00000260795.2	+	12	1813_1814	c.1711_1712insG	c.(1711-1713)cggfs	p.R571fs	FGFR3_ENST00000412135.2_Frame_Shift_Ins_p.R459fs|FGFR3_ENST00000340107.4_Frame_Shift_Ins_p.R573fs|FGFR3_ENST00000352904.1_Frame_Shift_Ins_p.R459fs|FGFR3_ENST00000440486.2_Frame_Shift_Ins_p.R571fs|FGFR3_ENST00000481110.2_Frame_Shift_Ins_p.R572fs			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	571	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	gcgggcgcggcggcccccgggc	0.703		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.R573fs				Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3-9542	0			c.1717_1718insG						.																																			SO:0001589	frameshift_variant	2261	exon13	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	GCGCGGCGGCCCC	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1713dupG	4.37:g.1807544_1807544dupG	ENSP00000260795:p.Arg571fs	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	318	7	NM_001163213	0	0	0	0	0	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Frame_Shift_Ins	INS	ENST00000260795.2	37	CCDS3353.1																																																																																			.		0.703	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
PCDH10	57575	broad.mit.edu	37	4	134072600	134072601	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr4:134072600_134072601insC	ENST00000264360.5	+	1	2131_2132	c.1305_1306insC	c.(1306-1308)cggfs	p.R436fs	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	436	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A435A(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CTGTAGTGGCTCGGGACCGGGG	0.594																																					p.A435fs													.	PCDH10-92	1	Substitution - coding silent(1)	lung(1)	c.1305_1306insC						.																																			SO:0001589	frameshift_variant	57575	exon1			AGTGGCTCGGGAC	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1306dupC	4.37:g.134072601_134072601dupC	ENSP00000264360:p.Arg436fs	Somatic	235	0		WXS	Illumina HiSeq	Phase_I	547	5	NM_032961	0	0	0	0	0	Q4W5F6|Q96SF0	Frame_Shift_Ins	INS	ENST00000264360.5	37	CCDS34063.1																																																																																			.		0.594	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
FAM53C	51307	broad.mit.edu	37	5	137680780	137680781	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr5:137680780_137680781insG	ENST00000239906.5	+	4	831_832	c.403_404insG	c.(403-405)cggfs	p.R135fs	RP11-256P1.1_ENST00000504539.1_RNA|FAM53C_ENST00000507506.1_3'UTR|FAM53C_ENST00000434981.2_Frame_Shift_Ins_p.R135fs|FAM53C_ENST00000513056.1_Intron	NM_016605.2	NP_057689.1	Q9NYF3	FA53C_HUMAN	family with sequence similarity 53, member C	135										breast(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GCCGGTGTGGCGGCCCGCCCCC	0.683																																					p.R135fs													.	FAM53C-91	0			c.403_404insG						.																																			SO:0001589	frameshift_variant	51307	exon4			GTGTGGCGGCCCG	AF251040	CCDS4204.1	5q31	2008-02-05	2004-11-24	2004-11-26	ENSG00000120709	ENSG00000120709			1336	protein-coding gene	gene with protein product		609372	"""chromosome 5 open reading frame 6"""	C5orf6		11087669, 11161817	Standard	NM_001135647		Approved		uc003lcv.3	Q9NYF3	OTTHUMG00000129201	ENST00000239906.5:c.405dupG	5.37:g.137680782_137680782dupG	ENSP00000239906:p.Arg135fs	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	465	10	NM_001135647	0	0	0	0	0	B2RDJ5|D3DQB9	Frame_Shift_Ins	INS	ENST00000239906.5	37	CCDS4204.1																																																																																			.		0.683	FAM53C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251278.2	NM_016605	
PODXL	5420	broad.mit.edu	37	7	131195806	131195807	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr7:131195806_131195807insG	ENST00000378555.3	-	2	733_734	c.486_487insC	c.(484-489)agcagcfs	p.S163fs	PODXL_ENST00000537928.1_Frame_Shift_Ins_p.S163fs|PODXL_ENST00000322985.9_Frame_Shift_Ins_p.S163fs|PODXL_ENST00000541194.1_Frame_Shift_Ins_p.S165fs|PODXL_ENST00000465001.1_5'Flank			O00592	PODXL_HUMAN	podocalyxin-like	163	Thr-rich.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ACACTGTGGCTGCTTTTCCCCC	0.535																																					p.S163fs													.	PODXL-136	0			c.487_488insC						.																																			SO:0001589	frameshift_variant	5420	exon2			TGTGGCTGCTTTT		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.487dupC	7.37:g.131195807_131195807dupG	ENSP00000367817:p.Ser163fs	Somatic	263	0		WXS	Illumina HiSeq	Phase_I	1216	8	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	Frame_Shift_Ins	INS	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.535	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
CRAT	1384	bcgsc.ca	37	9	131864811	131864812	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chr9:131864811_131864812insT	ENST00000318080.2	-	5	791_792	c.497_498insA	c.(496-498)aagfs	p.K166fs	RP11-247A12.1_ENST00000434250.1_RNA|CRAT_ENST00000464290.1_5'UTR	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	166					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	TGCACAGTGGCTTCCCCCCCAG	0.609																																					p.K166fs													.	CRAT-90	0			c.498_499insA						.																																			SO:0001589	frameshift_variant	1384	exon5			CAGTGGCTTCCCC	X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.498dupA	9.37:g.131864813_131864813dupT	ENSP00000315013:p.Lys166fs	Somatic	295	0		WXS	Illumina HiSeq	Phase_1	956	174	NM_000755	0	0	0	0	0	Q5T952|Q9BW16	Frame_Shift_Ins	INS	ENST00000318080.2	37	CCDS6919.1																																																																																			.		0.609	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253700.1		
APEX2	27301	broad.mit.edu	37	X	55033524	55033525	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:55033524_55033525insA	ENST00000374987.3	+	6	1279_1280	c.1213_1214insA	c.(1213-1215)caafs	p.Q405fs	ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	405					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						TAGCTGTCCCCAAGCCTCTCCT	0.584								Other BER factors																													p.Q405fs													.	APEX2-659	0			c.1213_1214insA						.																																			SO:0001589	frameshift_variant	27301	exon6			TGTCCCCAAGCCT	AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.1215dupA	X.37:g.55033526_55033526dupA	ENSP00000364126:p.Gln405fs	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	171	7	NM_014481	0	0	0	0	0	Q9Y5X7	Frame_Shift_Ins	INS	ENST00000374987.3	37	CCDS14365.1																																																																																			.		0.584	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056845.1		
UTP14A	10813	broad.mit.edu	37	X	129045830	129045831	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:129045830_129045831insG	ENST00000394422.3	+	6	498_499	c.470_471insG	c.(469-474)ctggttfs	p.V158fs	RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371051.5_Frame_Shift_Ins_p.V104fs|UTP14A_ENST00000371042.3_5'Flank|UTP14A_ENST00000425117.2_Intron	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	158					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						GCAGAGCAGCTGGTTTTTCCCC	0.5																																					p.L157fs													.	UTP14A-132	0			c.470_471insG						.																																			SO:0001589	frameshift_variant	10813	exon6			AGCAGCTGGTTTT	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.472dupG	X.37:g.129045832_129045832dupG	ENSP00000377944:p.Val158fs	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	315	9	NM_006649	0	0	0	0	0	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Frame_Shift_Ins	INS	ENST00000394422.3	37	CCDS14615.1																																																																																			.		0.500	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649	
BCORL1	63035	broad.mit.edu	37	X	129146953	129146954	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B9-4117-01A-01D-1252-08	TCGA-B9-4117-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	022fd0e9-aeef-4d27-a58a-66acca664e1d	1dfccb8c-84c0-4831-983e-08d93bf00ad4	g.chrX:129146953_129146954insG	ENST00000218147.7	+	4	402_403	c.205_206insG	c.(205-207)agcfs	p.S69fs	BCORL1_ENST00000303743.5_Frame_Shift_Ins_p.S69fs|BCORL1_ENST00000359304.2_Frame_Shift_Ins_p.S69fs|BCORL1_ENST00000540052.1_Frame_Shift_Ins_p.S69fs			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	69					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TGGAAGTGGCAGCAATGCCCGG	0.574																																					p.S69fs													.	BCORL1-294	0			c.205_206insG						.			70,3624		0,55,15,1529,511						4.1	1.0			70	78,6349		0,54,24,2296,1703	no	frameshift	BCORL1	NM_021946.4		0,109,39,3825,2214	A1A1,A1R,A1,RR,R		1.2136,1.895,1.4623				148,9973				SO:0001589	frameshift_variant	63035	exon3			AGTGGCAGCAATG	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.206dupG	X.37:g.129146954_129146954dupG	ENSP00000218147:p.Ser69fs	Somatic	237	0		WXS	Illumina HiSeq	Phase_I	765	9	NM_021946	0	0	0	0	0	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Frame_Shift_Ins	INS	ENST00000218147.7	37	CCDS14616.1																																																																																			.		0.574	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
