#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM82	388595	hgsc.bcm.edu	37	1	16070782	16070782	+	Missense_Mutation	SNP	T	T	G	rs374481924		TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:16070782T>G	ENST00000375782.1	+	4	602	c.464T>G	c.(463-465)cTg>cGg	p.L155R	RP11-169K16.4_ENST00000418525.1_RNA|TMEM82_ENST00000465575.1_3'UTR	NM_001013641.1	NP_001013663.1	A0PJX8	TMM82_HUMAN	transmembrane protein 82	155	Leu-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|lung(5)|prostate(1)|skin(1)	13		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AACCTGCTGCTGAGCCTCGGG	0.706																																					p.L155R		.											.	TMEM82-90	0			c.T464G						.	T	ARG/LEU	0,4300		0,0,2150	8.0	8.0	8.0		464	5.3	1.0	1		8	1,8421		0,1,4210	no	missense	TMEM82	NM_001013641.1	102	0,1,6360	GG,GT,TT		0.0119,0.0,0.0079	probably-damaging	155/344	16070782	1,12721	2150	4211	6361	SO:0001583	missense	388595	exon4			TGCTGCTGAGCCT		CCDS30608.1	1p36.13	2008-02-05				ENSG00000162460			32350	protein-coding gene	gene with protein product							Standard	NM_001013641		Approved		uc001axc.4	A0PJX8		ENST00000375782.1:c.464T>G	1.37:g.16070782T>G	ENSP00000364938:p.Leu155Arg	Somatic	2	1		WXS	Illumina HiSeq	Phase_I	5	3	NM_001013641	0	0	20	34	14	B2RP27|Q5VVD4	Missense_Mutation	SNP	ENST00000375782.1	37	CCDS30608.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.700784	0.88924	0.0	1.19E-4	ENSG00000162460	ENST00000375782	T	0.60424	0.19	5.33	5.33	0.75918	.	0.077205	0.53938	D	0.000060	T	0.75796	0.3898	M	0.76328	2.33	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.79359	-0.1836	10	0.87932	D	0	-12.7185	15.2878	0.73843	0.0:0.0:0.0:1.0	.	155	A0PJX8	TMM82_HUMAN	R	155	ENSP00000364938:L155R	ENSP00000364938:L155R	L	+	2	0	TMEM82	15943369	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.610000	0.82949	2.014000	0.59158	0.533000	0.62120	CTG	.		0.706	TMEM82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008471.2	NM_001013641	
ARHGEF19	128272	broad.mit.edu;ucsc.edu	37	1	16532837	16532837	+	Splice_Site	SNP	T	T	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:16532837T>G	ENST00000270747.3	-	7	1274		c.e7-2		ARHGEF19_ENST00000478117.1_Splice_Site	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19						regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		AAACTTGGCCTGAGGGAGGGC	0.647																																					.													.	ARHGEF19-229	0			c.1138-2A>C						.						34.0	30.0	31.0					1																	16532837		2200	4289	6489	SO:0001630	splice_region_variant	128272	exon8			TTGGCCTGAGGGA	BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.1138-2A>C	1.37:g.16532837T>G		Somatic	12	0		WXS	Illumina HiSeq	Phase_I	7	3	NM_153213	0	0	1	5	4	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Splice_Site	SNP	ENST00000270747.3	37	CCDS170.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.98|16.98	3.271016|3.271016	0.59540|0.59540	.|.	.|.	ENSG00000142632|ENSG00000142632	ENST00000270747;ENST00000421561;ENST00000375607|ENST00000441785	.|T	.|0.17370	.|2.28	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	.|.	.|.	.|.	.|.	.|T	.|0.27419	.|0.0673	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.01298	.|-1.1392	.|5	.|.	.|.	.|.	.|.	12.4596|12.4596	0.55725|0.55725	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	.|P	-1|62	.|ENSP00000414370:Q62P	.|.	.|Q	-|-	.|2	.|0	ARHGEF19|ARHGEF19	16405424|16405424	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.716000|0.716000	0.41182|0.41182	7.267000|7.267000	0.78462|0.78462	1.845000|1.845000	0.53610|0.53610	0.454000|0.454000	0.30748|0.30748	.|CAG	.		0.647	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006289.1	NM_153213	Intron
TAS1R2	80834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19166252	19166252	+	Silent	SNP	C	C	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:19166252C>G	ENST00000375371.3	-	6	2382	c.2361G>C	c.(2359-2361)ctG>ctC	p.L787L		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	787					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CGATGGTGACCAGCACCCCGC	0.567																																					p.L787L		.											.	TAS1R2-93	0			c.G2361C						.						125.0	94.0	105.0					1																	19166252		2203	4300	6503	SO:0001819	synonymous_variant	80834	exon6			GGTGACCAGCACC		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.2361G>C	1.37:g.19166252C>G		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	37	16	NM_152232	0	0	0	0	0	Q5TZ19	Silent	SNP	ENST00000375371.3	37	CCDS187.1																																																																																			.		0.567	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
AGO1	26523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	36354062	36354062	+	Silent	SNP	G	G	A	rs79428335		TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:36354062G>A	ENST00000373204.4	+	2	273	c.60G>A	c.(58-60)gtG>gtA	p.V20V	AGO1_ENST00000373206.1_5'UTR	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	20					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TGCAGCAGGTGTTCCAGGCAC	0.562																																					p.V20V		.											.	.	0			c.G60A						.						73.0	70.0	71.0					1																	36354062		2203	4300	6503	SO:0001819	synonymous_variant	26523	exon2			GCAGGTGTTCCAG	AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.60G>A	1.37:g.36354062G>A		Somatic	124	0		WXS	Illumina HiSeq	Phase_I	107	30	NM_012199	0	0	8	13	5	Q5TA57|Q6P4S0	Silent	SNP	ENST00000373204.4	37	CCDS398.1																																																																																			.		0.562	AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019337.3		
UROD	7389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	45478626	45478626	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:45478626C>T	ENST00000246337.4	+	2	187	c.68C>T	c.(67-69)gCc>gTc	p.A23V	UROD_ENST00000494399.1_3'UTR|HECTD3_ENST00000372172.4_5'Flank	NM_000374.4	NP_000365.3	P06132	DCUP_HUMAN	uroporphyrinogen decarboxylase	23					heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	uroporphyrinogen decarboxylase activity (GO:0004853)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					CTGCGAGCAGCCTGGGGAGAG	0.557									Porphyria Cutanea Tarda, Type II																												p.A23V		.											.	UROD-90	0			c.C68T						.						56.0	50.0	52.0					1																	45478626		2203	4300	6503	SO:0001583	missense	7389	exon2	Familial Cancer Database	PCT-II	GAGCAGCCTGGGG	BC001778	CCDS518.1	1p34	2012-10-02			ENSG00000126088	ENSG00000126088	4.1.1.37		12591	protein-coding gene	gene with protein product		613521				3015909, 3460962	Standard	NM_000374		Approved		uc001cna.2	P06132	OTTHUMG00000008949	ENST00000246337.4:c.68C>T	1.37:g.45478626C>T	ENSP00000246337:p.Ala23Val	Somatic	66	1		WXS	Illumina HiSeq	Phase_I	61	17	NM_000374	0	0	44	81	37	A8K762|Q16863|Q16883|Q53YB8|Q53ZP6|Q6IB28|Q9BUZ0	Missense_Mutation	SNP	ENST00000246337.4	37	CCDS518.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.921742	0.92319	.	.	ENSG00000126088	ENST00000246337;ENST00000434478;ENST00000372135;ENST00000372139	D;D	0.94497	-3.44;-3.37	6.07	6.07	0.98685	Uroporphyrinogen decarboxylase (URO-D) (1);	0.000000	0.85682	D	0.000000	D	0.97380	0.9143	M	0.79805	2.47	0.80722	D	1	D;D	0.76494	0.999;0.993	D;P	0.68765	0.96;0.565	D	0.97184	0.9853	10	0.72032	D	0.01	-17.4135	20.6439	0.99570	0.0:1.0:0.0:0.0	.	23;23	B4DHV6;P06132	.;DCUP_HUMAN	V	23;23;23;16	ENSP00000246337:A23V;ENSP00000404489:A23V	ENSP00000246337:A23V	A	+	2	0	UROD	45251213	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.679000	0.84048	2.884000	0.98904	0.655000	0.94253	GCC	.		0.557	UROD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024803.1	NM_000374	
PDZK1	5174	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	145752477	145752477	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:145752477G>T	ENST00000344770.2	+	4	583	c.510G>T	c.(508-510)atG>atT	p.M170I	PDZK1_ENST00000451928.2_Intron|PDZK1_ENST00000417171.1_Missense_Mutation_p.M170I	NM_002614.4	NP_002605.2	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	170	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				carnitine transport (GO:0015879)|cell proliferation (GO:0008283)|drug transport (GO:0015893)|establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of ion transmembrane transport (GO:0034767)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of anion transport (GO:0044070)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|transporter activity (GO:0005215)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			GTGTGGCTATGAGAGCTGGAG	0.473																																					p.M170I		.											.	PDZK1-90	0			c.G510T						.						91.0	74.0	80.0					1																	145752477		2202	4299	6501	SO:0001583	missense	5174	exon5			GGCTATGAGAGCT	AF012281	CCDS72859.1, CCDS72860.1	1q21	2009-08-21			ENSG00000174827	ENSG00000174827			8821	protein-coding gene	gene with protein product		603831				9461128	Standard	NM_002614		Approved	PDZD1, NHERF3	uc001eoo.2	Q5T2W1	OTTHUMG00000013735	ENST00000344770.2:c.510G>T	1.37:g.145752477G>T	ENSP00000342143:p.Met170Ile	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	158	41	NM_002614	0	0	255	436	181	B4DPB9|E7EU02|O60450|Q5T5P6|Q9BQ41	Missense_Mutation	SNP	ENST00000344770.2	37	CCDS924.1	.	.	.	.	.	.	.	.	.	.	G	6.882	0.532176	0.13127	.	.	ENSG00000174827	ENST00000443667;ENST00000417171;ENST00000344770	T;T;T	0.26518	1.73;1.73;1.73	5.31	4.33	0.51752	PDZ/DHR/GLGF (4);	0.808792	0.11445	N	0.563343	T	0.08492	0.0211	N	0.12961	0.28	0.80722	D	1	B	0.26672	0.156	B	0.33960	0.173	T	0.13872	-1.0493	10	0.66056	D	0.02	-4.121	6.0081	0.19557	0.1032:0.195:0.7018:0.0	.	170	Q5T2W1	NHRF3_HUMAN	I	170	ENSP00000409291:M170I;ENSP00000394485:M170I;ENSP00000342143:M170I	ENSP00000342143:M170I	M	+	3	0	PDZK1	144463834	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	0.963000	0.29293	2.767000	0.95098	0.591000	0.81541	ATG	.		0.473	PDZK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038502.2	NM_002614	
RPRD2	23248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150390094	150390094	+	Silent	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:150390094T>C	ENST00000369068.4	+	2	232	c.228T>C	c.(226-228)aaT>aaC	p.N76N	RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000539519.1_Silent_p.N76N|RPRD2_ENST00000401000.4_Silent_p.N76N|RPRD2_ENST00000369067.3_Silent_p.N76N	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	76	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						ACCGTTTGAATCTCTTTTACC	0.363																																					p.N76N		.											.	RPRD2-23	0			c.T228C						.						231.0	217.0	221.0					1																	150390094		1865	4102	5967	SO:0001819	synonymous_variant	23248	exon2			TTTGAATCTCTTT	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.228T>C	1.37:g.150390094T>C		Somatic	298	0		WXS	Illumina HiSeq	Phase_I	284	97	NM_015203	0	0	17	44	27	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Silent	SNP	ENST00000369068.4	37	CCDS44216.1																																																																																			.		0.363	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
POGZ	23126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151395875	151395875	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:151395875G>T	ENST00000271715.2	-	10	1990	c.1676C>A	c.(1675-1677)aCt>aAt	p.T559N	POGZ_ENST00000540984.1_5'UTR|POGZ_ENST00000531094.1_Missense_Mutation_p.T497N|POGZ_ENST00000392723.1_Missense_Mutation_p.T506N|POGZ_ENST00000368863.2_Missense_Mutation_p.T464N|POGZ_ENST00000409503.1_Missense_Mutation_p.T550N|POGZ_ENST00000361398.3_Missense_Mutation_p.T506N|POGZ_ENST00000491586.1_Missense_Mutation_p.T506N	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	559					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AAACTTACTAGTAGATTCATA	0.443																																					p.T559N		.											.	POGZ-93	0			c.C1676A						.						104.0	95.0	98.0					1																	151395875		2203	4300	6503	SO:0001583	missense	23126	exon10			TTACTAGTAGATT	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.1676C>A	1.37:g.151395875G>T	ENSP00000271715:p.Thr559Asn	Somatic	108	1		WXS	Illumina HiSeq	Phase_I	82	35	NM_015100	0	0	0	0	0	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988053	0.93106	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000529669	T;T;T;T;T;T;T;T	0.15372	5.84;5.87;5.84;5.83;5.85;5.85;5.33;2.43	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000003	T	0.26085	0.0636	L	0.39898	1.24	0.80722	D	1	D;D;D;D;D;D	0.67145	0.993;0.963;0.996;0.996;0.996;0.993	P;P;P;D;D;P	0.77557	0.787;0.55;0.895;0.99;0.99;0.787	T	0.00708	-1.1600	10	0.54805	T	0.06	-15.1724	17.7138	0.88330	0.0:0.0:1.0:0.0	.	497;550;464;506;506;559	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	N	506;559;506;464;550;497;506;8	ENSP00000376484:T506N;ENSP00000271715:T559N;ENSP00000354467:T506N;ENSP00000357856:T464N;ENSP00000386836:T550N;ENSP00000431259:T497N;ENSP00000418408:T506N;ENSP00000432295:T8N	ENSP00000271715:T559N	T	-	2	0	POGZ	149662499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.361000	0.79497	2.763000	0.94921	0.563000	0.77884	ACT	.		0.443	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
SLC9C2	284525	hgsc.bcm.edu	37	1	173545857	173545857	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:173545857A>G	ENST00000367714.3	-	8	1267	c.845T>C	c.(844-846)gTa>gCa	p.V282A	SLC9C2_ENST00000536496.1_Missense_Mutation_p.V180A|RP3-436N22.3_ENST00000431459.1_RNA|SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	282					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										ATTCAGTCCTACAGCGGCTAA	0.368																																					p.V282A		.											.	.	0			c.T845C						.						68.0	68.0	68.0					1																	173545857		2203	4300	6503	SO:0001583	missense	284525	exon8			AGTCCTACAGCGG	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.845T>C	1.37:g.173545857A>G	ENSP00000356687:p.Val282Ala	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	59	3	NM_178527	0	0	0	0	0	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	A	13.60	2.285972	0.40394	.	.	ENSG00000162753	ENST00000367714;ENST00000536496	T;T	0.06687	3.27;3.27	5.48	4.36	0.52297	Cation/H+ exchanger (1);	0.426381	0.19800	N	0.105771	T	0.02727	0.0082	L	0.50333	1.59	0.09310	N	1	B	0.18166	0.026	B	0.23275	0.045	T	0.42548	-0.9445	10	0.23302	T	0.38	-14.6781	8.1183	0.30957	0.9095:0.0:0.0905:0.0	.	282	Q5TAH2	S9A11_HUMAN	A	282;180	ENSP00000356687:V282A;ENSP00000445437:V180A	ENSP00000356687:V282A	V	-	2	0	SLC9A11	171812480	0.049000	0.20398	0.097000	0.21041	0.518000	0.34316	4.102000	0.57776	0.925000	0.37094	-0.250000	0.11733	GTA	.		0.368	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	186158954	186158954	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:186158954A>G	ENST00000271588.4	+	107	17081	c.16852A>G	c.(16852-16854)Att>Gtt	p.I5618V	HMCN1_ENST00000367492.2_Missense_Mutation_p.I5501V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5618					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAATGGGACCATTGAATATCA	0.448																																					p.I5618V		.											.	HMCN1-113	0			c.A16852G						.						122.0	111.0	115.0					1																	186158954		2203	4300	6503	SO:0001583	missense	83872	exon107			GGGACCATTGAAT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16852A>G	1.37:g.186158954A>G	ENSP00000271588:p.Ile5618Val	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	115	31	NM_031935	0	0	1	1	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	5.555	0.287307	0.10513	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.62364	0.03;0.03	5.91	-0.414	0.12359	.	0.153154	0.56097	N	0.000026	T	0.40670	0.1126	N	0.20986	0.625	0.23896	N	0.996533	B	0.06786	0.001	B	0.06405	0.002	T	0.20538	-1.0272	10	0.45353	T	0.12	.	6.395	0.21607	0.5367:0.2325:0.2308:0.0	.	5618	Q96RW7	HMCN1_HUMAN	V	5618;5501	ENSP00000271588:I5618V;ENSP00000356462:I5501V	ENSP00000271588:I5618V	I	+	1	0	HMCN1	184425577	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	2.129000	0.42055	-0.086000	0.12550	0.533000	0.62120	ATT	.		0.448	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
LRRN2	10446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	204588079	204588079	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:204588079T>C	ENST00000367175.1	-	1	3254	c.1042A>G	c.(1042-1044)Agt>Ggt	p.S348G	RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000367176.3_Missense_Mutation_p.S348G|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367177.3_Missense_Mutation_p.S348G			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	348					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TGCAAGGCACTGAGAGCGTTG	0.617																																					p.S348G		.											.	LRRN2-514	0			c.A1042G						.						66.0	59.0	62.0					1																	204588079		2203	4300	6503	SO:0001583	missense	10446	exon3			AGGCACTGAGAGC	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1042A>G	1.37:g.204588079T>C	ENSP00000356143:p.Ser348Gly	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	37	10	NM_006338	0	0	0	0	0	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	ENST00000367175.1	37	CCDS1448.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.988226	0.53934	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.58797	0.31;0.31;0.31	5.69	5.69	0.88448	.	0.000000	0.50627	D	0.000109	T	0.74030	0.3663	M	0.68952	2.095	0.49213	D	0.999765	D	0.76494	0.999	D	0.74023	0.982	T	0.76394	-0.2975	10	0.62326	D	0.03	.	15.6141	0.76750	0.0:0.0:0.0:1.0	.	348	O75325	LRRN2_HUMAN	G	348	ENSP00000356144:S348G;ENSP00000356145:S348G;ENSP00000356143:S348G	ENSP00000356143:S348G	S	-	1	0	LRRN2	202854702	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.287000	0.72671	2.171000	0.68590	0.460000	0.39030	AGT	.		0.617	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338	
URB2	9816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	229771856	229771856	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:229771856C>T	ENST00000258243.2	+	4	1632	c.1496C>T	c.(1495-1497)tCt>tTt	p.S499F		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	499						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.S499F(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						ACGGTACTCTCTGCATGCCTC	0.577																																					p.S499F		.											.	URB2-174	1	Substitution - Missense(1)	lung(1)	c.C1496T						.						113.0	118.0	116.0					1																	229771856		2203	4300	6503	SO:0001583	missense	9816	exon4			TACTCTCTGCATG	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.1496C>T	1.37:g.229771856C>T	ENSP00000258243:p.Ser499Phe	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	174	57	NM_014777	0	0	6	7	1	Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	C	4.911	0.169357	0.09339	.	.	ENSG00000135763	ENST00000258243	T	0.33216	1.42	5.35	0.996	0.19844	.	1.134710	0.06163	N	0.676348	T	0.23094	0.0558	L	0.34521	1.04	0.09310	N	1	B	0.33448	0.412	B	0.27887	0.084	T	0.24261	-1.0165	9	.	.	.	0.0631	11.0794	0.48051	0.0671:0.3671:0.5657:0.0	.	499	Q14146	URB2_HUMAN	F	499	ENSP00000258243:S499F	.	S	+	2	0	URB2	227838479	0.357000	0.24938	0.001000	0.08648	0.004000	0.04260	1.775000	0.38584	0.327000	0.23409	-0.153000	0.13522	TCT	.		0.577	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
WNT8B	7479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	102239758	102239758	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr10:102239758G>A	ENST00000343737.5	+	3	358	c.230G>A	c.(229-231)gGg>gAg	p.G77E		NM_003393.3	NP_003384.2	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family, member 8B	77					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|negative regulation of gene expression (GO:0010629)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of gene expression (GO:0010628)|response to estradiol (GO:0032355)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		AGCCATGGTGGGCTTCGCAGT	0.582																																					p.G77E		.											.	WNT8B-625	0			c.G230A						.						54.0	49.0	50.0					10																	102239758		2203	4300	6503	SO:0001583	missense	7479	exon3			ATGGTGGGCTTCG	X91940	CCDS7494.1	10q24	2003-11-12			ENSG00000075290	ENSG00000075290		"""Wingless-type MMTV integration sites"""	12789	protein-coding gene	gene with protein product		601396				8661156	Standard	NM_003393		Approved		uc001krb.3	Q93098	OTTHUMG00000018912	ENST00000343737.5:c.230G>A	10.37:g.102239758G>A	ENSP00000340677:p.Gly77Glu	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	31	8	NM_003393	0	0	0	0	0	O00771|Q5VX55|Q8WYK9	Missense_Mutation	SNP	ENST00000343737.5	37	CCDS7494.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.368885	0.42003	.	.	ENSG00000075290	ENST00000343737	T	0.74947	-0.89	5.7	5.7	0.88788	.	1.622190	0.03427	N	0.207152	T	0.75606	0.3872	N	0.21373	0.66	0.54753	D	0.999988	P	0.38535	0.635	P	0.48982	0.597	T	0.60999	-0.7151	10	0.05351	T	0.99	.	19.8354	0.96655	0.0:0.0:1.0:0.0	.	77	Q93098	WNT8B_HUMAN	E	77	ENSP00000340677:G77E	ENSP00000340677:G77E	G	+	2	0	WNT8B	102229748	1.000000	0.71417	0.990000	0.47175	0.759000	0.43091	9.476000	0.97823	2.686000	0.91538	0.555000	0.69702	GGG	.		0.582	WNT8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049867.1	NM_003393	
NLRP14	338323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	7064099	7064099	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr11:7064099A>C	ENST00000299481.4	+	4	1188	c.842A>C	c.(841-843)cAa>cCa	p.Q281P		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	281	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GACTGGACCCAAGAACACCCA	0.448																																					p.Q281P		.											.	NLRP14-295	0			c.A842C						.						88.0	84.0	85.0					11																	7064099		2201	4296	6497	SO:0001583	missense	338323	exon4			GGACCCAAGAACA	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.842A>C	11.37:g.7064099A>C	ENSP00000299481:p.Gln281Pro	Somatic	128	1		WXS	Illumina HiSeq	Phase_I	101	33	NM_176822	0	0	0	0	0	Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	A	12.84	2.059980	0.36373	.	.	ENSG00000158077	ENST00000299481	T	0.78924	-1.22	4.57	2.08	0.27032	NACHT nucleoside triphosphatase (1);	0.164316	0.29133	N	0.013042	D	0.85186	0.5639	M	0.80183	2.485	0.09310	N	1	D	0.71674	0.998	D	0.68621	0.959	T	0.75596	-0.3263	10	0.72032	D	0.01	.	8.1401	0.31078	0.6792:0.0:0.0:0.3208	.	281	Q86W24	NAL14_HUMAN	P	281	ENSP00000299481:Q281P	ENSP00000299481:Q281P	Q	+	2	0	NLRP14	7020675	0.832000	0.29368	0.494000	0.27515	0.657000	0.38888	3.500000	0.53318	0.308000	0.22923	0.533000	0.62120	CAA	.		0.448	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
MADD	8567	hgsc.bcm.edu	37	11	47346058	47346058	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr11:47346058T>C	ENST00000311027.5	+	33	4817	c.4652T>C	c.(4651-4653)cTg>cCg	p.L1551P	MADD_ENST00000402799.1_Missense_Mutation_p.L1449P|MADD_ENST00000349238.3_Missense_Mutation_p.L1512P|MADD_ENST00000406482.1_Missense_Mutation_p.L1449P|MADD_ENST00000342922.4_Missense_Mutation_p.L1492P|MADD_ENST00000405573.2_Missense_Mutation_p.L361P|MADD_ENST00000402192.2_Missense_Mutation_p.L1491P|MADD_ENST00000407859.3_Missense_Mutation_p.L1469P|MADD_ENST00000395336.3_Missense_Mutation_p.L1551P|MADD_ENST00000395344.3_Missense_Mutation_p.L1445P	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GTGCAGGACCTGAAGACTGGT	0.602																																					p.L1551P		.											.	MADD-682	0			c.T4652C						.						78.0	76.0	77.0					11																	47346058		2201	4298	6499	SO:0001583	missense	8567	exon33			AGGACCTGAAGAC	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4652T>C	11.37:g.47346058T>C	ENSP00000310933:p.Leu1551Pro	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	38	3	NM_130475	0	0	31	31	0		Missense_Mutation	SNP	ENST00000311027.5	37	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.565942	0.86439	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.50813	3.37;3.24;3.24;3.37;3.37;3.24;3.25;3.37;3.38;0.73	5.83	5.83	0.93111	.	0.035200	0.85682	D	0.000000	T	0.51652	0.1687	L	0.27053	0.805	0.58432	D	0.999999	D;B;B;P;B;B;B;B;B;P;B	0.58970	0.984;0.215;0.133;0.785;0.21;0.321;0.321;0.199;0.312;0.679;0.199	P;B;B;P;B;B;B;B;B;B;B	0.55871	0.786;0.039;0.039;0.512;0.085;0.152;0.085;0.105;0.105;0.314;0.057	T	0.56141	-0.8028	10	0.87932	D	0	-17.8484	16.1883	0.81967	0.0:0.0:0.0:1.0	.	361;1445;1445;1551;1449;1449;1449;1512;1469;1551;1492	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	P	1492;1449;1449;1449;1512;1551;1469;1445;1551;1491;361	ENSP00000343902:L1492P;ENSP00000385585:L1449P;ENSP00000384435:L1449P;ENSP00000304505:L1512P;ENSP00000310933:L1551P;ENSP00000384204:L1469P;ENSP00000378753:L1445P;ENSP00000378745:L1551P;ENSP00000384287:L1491P;ENSP00000384483:L361P	ENSP00000310933:L1551P	L	+	2	0	MADD	47302634	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.689000	0.84165	2.231000	0.72958	0.454000	0.30748	CTG	.		0.602	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		
PRPF19	27339	hgsc.bcm.edu	37	11	60670932	60670932	+	Splice_Site	SNP	C	C	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr11:60670932C>A	ENST00000227524.4	-	3	450	c.245G>T	c.(244-246)tGg>tTg	p.W82L		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19											haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						GGAACTCACCCACTCATCCTG	0.532																																					p.W82L		.											.	PRPF19-91	0			c.G245T						.						52.0	52.0	52.0					11																	60670932		2203	4298	6501	SO:0001630	splice_region_variant	27339	exon3			CTCACCCACTCAT	BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.246+1G>T	11.37:g.60670932C>A		Somatic	15	1		WXS	Illumina HiSeq	Phase_I	22	11	NM_014502	0	0	0	0	0		Missense_Mutation	SNP	ENST00000227524.4	37	CCDS7995.1	.	.	.	.	.	.	.	.	.	.	C	32	5.171353	0.94807	.	.	ENSG00000110107	ENST00000227524;ENST00000541371	T	0.73469	-0.75	5.08	5.08	0.68730	Pre-mRNA-splicing factor 19 (1);	0.066474	0.64402	D	0.000003	D	0.89876	0.6842	M	0.93594	3.435	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.92305	0.5853	10	0.87932	D	0	-8.8421	18.2782	0.90089	0.0:1.0:0.0:0.0	.	82	Q9UMS4	PRP19_HUMAN	L	82	ENSP00000227524:W82L	ENSP00000227524:W82L	W	-	2	0	PRPF19	60427508	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.280000	0.78610	2.646000	0.89796	0.561000	0.74099	TGG	.		0.532	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396334.1	NM_014502	Missense_Mutation
PRKRIR	5612	hgsc.bcm.edu;broad.mit.edu	37	11	76062971	76062971	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr11:76062971A>T	ENST00000260045.3	-	5	1328	c.1223T>A	c.(1222-1224)cTt>cAt	p.L408H	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	408					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						GTTCTGAAAAAGAACAGAAAT	0.388																																					p.L408H		.											.	PRKRIR-93	0			c.T1223A						.						19.0	19.0	19.0					11																	76062971		2163	4223	6386	SO:0001583	missense	5612	exon5			TGAAAAAGAACAG	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1223T>A	11.37:g.76062971A>T	ENSP00000260045:p.Leu408His	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	79	22	NM_004705	0	0	12	18	6	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	37	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	A	6.750	0.507246	0.12883	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	.	.	.	4.78	4.78	0.61160	Ribonuclease H-like (1);	0.052433	0.85682	D	0.000000	T	0.50103	0.1596	L	0.45581	1.43	0.46131	D	0.998889	B	0.31318	0.319	B	0.26310	0.068	T	0.52764	-0.8532	9	0.46703	T	0.11	.	14.7428	0.69469	1.0:0.0:0.0:0.0	.	408	O43422	P52K_HUMAN	H	233;408	.	ENSP00000260045:L408H	L	-	2	0	PRKRIR	75740619	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	2.504000	0.45416	1.956000	0.56807	0.524000	0.50904	CTT	.		0.388	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
SYTL2	54843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	85445140	85445140	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr11:85445140A>T	ENST00000528231.1	-	6	1506	c.1229T>A	c.(1228-1230)aTg>aAg	p.M410K	SYTL2_ENST00000527523.1_Missense_Mutation_p.M362K|SYTL2_ENST00000316356.4_Missense_Mutation_p.M411K|SYTL2_ENST00000389960.4_Missense_Mutation_p.M410K|SYTL2_ENST00000524452.1_Missense_Mutation_p.M410K	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	410					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		ACCAGAAGTCATTGGCTGATG	0.403																																					p.M411K		.											.	SYTL2-137	0			c.T1232A						.						152.0	146.0	148.0					11																	85445140		2203	4299	6502	SO:0001583	missense	54843	exon6			GAAGTCATTGGCT	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1229T>A	11.37:g.85445140A>T	ENSP00000431701:p.Met410Lys	Somatic	182	0		WXS	Illumina HiSeq	Phase_I	156	43	NM_001162953	0	0	14	28	14	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	A	7.911	0.736457	0.15574	.	.	ENSG00000137501	ENST00000389960;ENST00000316356;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T	0.23348	2.0;2.01;2.01;1.91;2.0	5.81	-5.21	0.02815	.	.	.	.	.	T	0.10981	0.0268	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.0;0.001;0.001	T	0.34104	-0.9842	8	.	.	.	.	1.191	0.01864	0.3579:0.26:0.0884:0.2937	.	362;410;410;411;268	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15	.;.;SYTL2_HUMAN;.;.	K	410;411;410;362;410	ENSP00000374610:M410K;ENSP00000318803:M411K;ENSP00000431701:M410K;ENSP00000434010:M362K;ENSP00000435238:M410K	.	M	-	2	0	SYTL2	85122788	0.000000	0.05858	0.002000	0.10522	0.675000	0.39556	-2.151000	0.01289	-0.378000	0.07918	0.533000	0.62120	ATG	.		0.403	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	
ADAMTS8	11095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	130284505	130284505	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr11:130284505G>T	ENST00000257359.6	-	5	2193	c.1487C>A	c.(1486-1488)gCt>gAt	p.A496D		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	496	Disintegrin.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		CGTGCCGTCAGCCCAGGGCAG	0.657																																					p.A496D		.											.	ADAMTS8-226	0			c.C1487A						.						49.0	56.0	53.0					11																	130284505		2029	4184	6213	SO:0001583	missense	11095	exon5			CCGTCAGCCCAGG	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.1487C>A	11.37:g.130284505G>T	ENSP00000257359:p.Ala496Asp	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	124	39	NM_007037	0	0	0	0	0	Q9NZS0	Missense_Mutation	SNP	ENST00000257359.6	37	CCDS41732.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252974	0.80135	.	.	ENSG00000134917	ENST00000257359;ENST00000414575	T	0.63255	-0.03	5.59	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.84234	0.5427	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88705	0.3218	10	0.87932	D	0	.	14.45	0.67379	0.0708:0.0:0.9292:0.0	.	496	Q9UP79	ATS8_HUMAN	D	496;525	ENSP00000257359:A496D	ENSP00000257359:A496D	A	-	2	0	ADAMTS8	129789715	1.000000	0.71417	0.873000	0.34254	0.657000	0.38888	3.871000	0.56077	1.355000	0.45865	0.655000	0.94253	GCT	.		0.657	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385636.1	NM_007037	
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	26553127	26553127	+	Silent	SNP	G	G	A	rs560385893		TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr12:26553127G>A	ENST00000381340.3	-	53	7880	c.7464C>T	c.(7462-7464)acC>acT	p.T2488T	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2488					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GGTTCAGCACGGTGACAATGC	0.413													g|||	1	0.000199681	0.0	0.0	5008	,	,		14883	0.0		0.0	False		,,,				2504	0.001				p.T2488T		.											.	ITPR2-542	0			c.C7464T						.						122.0	119.0	120.0					12																	26553127		1920	4128	6048	SO:0001819	synonymous_variant	3709	exon53			CAGCACGGTGACA	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7464C>T	12.37:g.26553127G>A		Somatic	170	0		WXS	Illumina HiSeq	Phase_I	229	53	NM_002223	0	0	8	10	2	O94773	Silent	SNP	ENST00000381340.3	37	CCDS41764.1																																																																																			.		0.413	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
TMBIM6	7009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	50149442	50149442	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr12:50149442T>C	ENST00000267115.5	+	4	275	c.190T>C	c.(190-192)Tcc>Ccc	p.S64P	TMBIM6_ENST00000395006.4_Missense_Mutation_p.S64P|TMBIM6_ENST00000547798.1_Missense_Mutation_p.S27P|TMBIM6_ENST00000423828.1_Missense_Mutation_p.S122P|TMBIM6_ENST00000552699.1_Missense_Mutation_p.S122P|TMBIM6_ENST00000549385.1_Missense_Mutation_p.S64P	NM_003217.2	NP_003208.2	P55061	BI1_HUMAN	transmembrane BAX inhibitor motif containing 6	64					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	6						TGCCTTGGGCTCCCTGATATT	0.418																																					p.S122P		.											.	TMBIM6-90	0			c.T364C						.						175.0	173.0	174.0					12																	50149442		2203	4300	6503	SO:0001583	missense	7009	exon4			TTGGGCTCCCTGA	X75861	CCDS31797.1, CCDS44875.1	12q13.12	2013-10-08	2008-09-17	2008-09-17	ENSG00000139644	ENSG00000139644			11723	protein-coding gene	gene with protein product	"""BAX inhibitor 1"""	600748	"""testis enhanced gene transcript"""	TEGT		8530040, 9660918	Standard	NM_001098576		Approved	BI-1, BAXI1	uc001ruy.2	P55061	OTTHUMG00000169652	ENST00000267115.5:c.190T>C	12.37:g.50149442T>C	ENSP00000267115:p.Ser64Pro	Somatic	256	2		WXS	Illumina HiSeq	Phase_I	319	70	NM_001098576	2	2	1468	2069	597	B2R5M4|F8W034|O14938|Q643A7|Q96J50	Missense_Mutation	SNP	ENST00000267115.5	37	CCDS31797.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.817632	0.32145	.	.	ENSG00000139644	ENST00000546796;ENST00000549966;ENST00000547832;ENST00000547187;ENST00000546914;ENST00000552699;ENST00000267115;ENST00000541612;ENST00000549445;ENST00000549385;ENST00000548201;ENST00000423828;ENST00000542631;ENST00000550445;ENST00000549130;ENST00000552370;ENST00000395006;ENST00000547798	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03	5.65	4.49	0.54785	.	0.056827	0.64402	D	0.000001	T	0.51770	0.1694	M	0.90198	3.095	0.58432	D	0.999993	B;B;B	0.28470	0.013;0.206;0.213	B;B;B	0.31614	0.025;0.133;0.089	T	0.54234	-0.8324	10	0.45353	T	0.12	.	11.4766	0.50302	0.0:0.0:0.2833:0.7167	.	64;122;64	B7Z984;F8W034;P55061	.;.;BI1_HUMAN	P	64;64;64;64;64;122;64;64;64;64;64;122;64;64;64;64;64;27	ENSP00000450159:S64P;ENSP00000446668:S64P;ENSP00000448269:S64P;ENSP00000447400:S64P;ENSP00000448612:S64P;ENSP00000446734:S122P;ENSP00000267115:S64P;ENSP00000449904:S64P;ENSP00000448036:S64P;ENSP00000450265:S64P;ENSP00000389277:S122P;ENSP00000449907:S64P;ENSP00000450158:S64P;ENSP00000378454:S64P;ENSP00000447030:S27P	ENSP00000267115:S64P	S	+	1	0	TMBIM6	48435709	1.000000	0.71417	1.000000	0.80357	0.527000	0.34593	3.264000	0.51553	1.118000	0.41863	0.533000	0.62120	TCC	.		0.418	TMBIM6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405289.1	NM_003217	
AMHR2	269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53824991	53824991	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr12:53824991G>C	ENST00000257863.4	+	11	1536	c.1456G>C	c.(1456-1458)Gac>Cac	p.D486H	AMHR2_ENST00000550311.1_3'UTR|AMHR2_ENST00000379791.3_Missense_Mutation_p.D391H	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	486	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	GCTCCTAGAAGACTGTTGGGA	0.592																																					p.D486H		.											.	AMHR2-628	0			c.G1456C						.						77.0	78.0	78.0					12																	53824991		2203	4300	6503	SO:0001583	missense	269	exon11			CTAGAAGACTGTT	AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.1456G>C	12.37:g.53824991G>C	ENSP00000257863:p.Asp486His	Somatic	193	0		WXS	Illumina HiSeq	Phase_I	166	83	NM_020547	0	0	0	0	0	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	ENST00000257863.4	37	CCDS8858.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.579839	0.86645	.	.	ENSG00000135409	ENST00000257863;ENST00000379791	T;D	0.93247	-0.21;-3.19	4.86	4.86	0.63082	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.39834	N	0.001257	D	0.95484	0.8533	L	0.56340	1.77	0.30411	N	0.779055	D	0.89917	1.0	D	0.97110	1.0	D	0.92996	0.6419	10	0.87932	D	0	.	15.3949	0.74784	0.0:0.0:1.0:0.0	.	486	Q16671	AMHR2_HUMAN	H	486;391	ENSP00000257863:D486H;ENSP00000369117:D391H	ENSP00000257863:D486H	D	+	1	0	AMHR2	52111258	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.206000	0.77891	2.691000	0.91804	0.563000	0.77884	GAC	.		0.592	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407048.1	NM_020547	
WSCD2	9671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	108641980	108641980	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr12:108641980C>T	ENST00000332082.4	+	10	2376	c.1558C>T	c.(1558-1560)Cgc>Tgc	p.R520C	WSCD2_ENST00000547525.1_Missense_Mutation_p.R520C|WSCD2_ENST00000549903.1_Missense_Mutation_p.R540C|WSCD2_ENST00000261400.3_Missense_Mutation_p.R540C			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	520						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CAACTTCAAGCGCTCAGGGCT	0.602																																					p.R520C		.											.	WSCD2-136	0			c.C1558T						.						59.0	66.0	64.0					12																	108641980		2036	4193	6229	SO:0001583	missense	9671	exon9			TTCAAGCGCTCAG		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.1558C>T	12.37:g.108641980C>T	ENSP00000331933:p.Arg520Cys	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	95	19	NM_014653	0	0	0	0	0	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.809847	0.70797	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.58060	0.36;3.98;0.36;3.98	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.73071	0.3540	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.78285	-0.2263	10	0.87932	D	0	-44.2877	16.1113	0.81266	0.0:1.0:0.0:0.0	.	540;520	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	C	520;540;520;540	ENSP00000448047:R520C;ENSP00000261400:R540C;ENSP00000331933:R520C;ENSP00000447272:R540C	ENSP00000261400:R540C	R	+	1	0	WSCD2	107166110	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	5.717000	0.68446	2.029000	0.59856	0.655000	0.94253	CGC	.		0.602	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	39452997	39452997	+	Silent	SNP	C	C	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr13:39452997C>G	ENST00000280481.7	+	23	9105	c.8889C>G	c.(8887-8889)acC>acG	p.T2963T		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2963					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CACAAGCGACCAGTTTTGGAA	0.448																																					p.T2963T		.											.	FREM2-100	0			c.C8889G						.						162.0	148.0	153.0					13																	39452997		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon23			AGCGACCAGTTTT	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8889C>G	13.37:g.39452997C>G		Somatic	128	0		WXS	Illumina HiSeq	Phase_I	122	35	NM_207361	0	0	10	22	12	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																			.		0.448	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
ANKRD10	55608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	111532214	111532214	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr13:111532214A>T	ENST00000267339.2	-	6	1167	c.1033T>A	c.(1033-1035)Tgc>Agc	p.C345S	ANKRD10_ENST00000375758.5_3'UTR	NM_017664.2	NP_060134.2	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10	345										central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)	9	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			AGAGAACCGCACAACTCAGGG	0.547																																					p.C345S		.											.	ANKRD10-226	0			c.T1033A						.						101.0	87.0	92.0					13																	111532214		2203	4300	6503	SO:0001583	missense	55608	exon6			AACCGCACAACTC	AK000100	CCDS9520.1, CCDS66580.1	13q33.3	2013-01-10			ENSG00000088448	ENSG00000088448		"""Ankyrin repeat domain containing"""	20265	protein-coding gene	gene with protein product							Standard	NM_017664		Approved	FLJ20093	uc001vrn.3	Q9NXR5	OTTHUMG00000017349	ENST00000267339.2:c.1033T>A	13.37:g.111532214A>T	ENSP00000267339:p.Cys345Ser	Somatic	117	2		WXS	Illumina HiSeq	Phase_I	102	30	NM_017664	0	0	46	92	46	Q5VW12|Q9BV12	Missense_Mutation	SNP	ENST00000267339.2	37	CCDS9520.1	.	.	.	.	.	.	.	.	.	.	A	13.91	2.379004	0.42207	.	.	ENSG00000088448	ENST00000267339	T	0.77358	-1.09	5.28	5.28	0.74379	.	0.052781	0.85682	D	0.000000	T	0.76608	0.4011	M	0.74258	2.255	0.80722	D	1	P	0.39282	0.666	B	0.35039	0.194	T	0.79725	-0.1683	10	0.54805	T	0.06	-5.8478	15.2197	0.73303	1.0:0.0:0.0:0.0	.	345	Q9NXR5	ANR10_HUMAN	S	345	ENSP00000267339:C345S	ENSP00000267339:C345S	C	-	1	0	ANKRD10	110330215	1.000000	0.71417	0.826000	0.32828	0.377000	0.30045	5.271000	0.65553	1.996000	0.58369	0.455000	0.32223	TGC	.		0.547	ANKRD10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045783.1		
MYH6	4624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23862897	23862897	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr14:23862897T>G	ENST00000356287.3	-	21	2935	c.2906A>C	c.(2905-2907)gAg>gCg	p.E969A	MYH6_ENST00000405093.3_Missense_Mutation_p.E969A			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	969					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TGCATGCTTCTCCTTCTCCAC	0.562																																					p.E969A		.											.	MYH6-94	0			c.A2906C						.						206.0	174.0	185.0					14																	23862897		2203	4300	6503	SO:0001583	missense	4624	exon22			TGCTTCTCCTTCT	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2906A>C	14.37:g.23862897T>G	ENSP00000348634:p.Glu969Ala	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	113	33	NM_002471	0	0	0	0	0	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	t	18.08	3.544179	0.65198	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.92911	-3.13;-3.13	4.95	4.95	0.65309	.	.	.	.	.	D	0.95143	0.8426	H	0.94964	3.605	0.58432	D	0.999999	P	0.35527	0.507	B	0.41764	0.366	D	0.95789	0.8823	9	0.62326	D	0.03	.	14.9359	0.70954	0.0:0.0:0.0:1.0	.	969	P13533	MYH6_HUMAN	A	969	ENSP00000386041:E969A;ENSP00000348634:E969A	ENSP00000348634:E969A	E	-	2	0	MYH6	22932737	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	1.992000	0.58205	0.528000	0.53228	GAG	.		0.562	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
MYH7	4625	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	23897724	23897724	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr14:23897724A>C	ENST00000355349.3	-	15	1725	c.1563T>G	c.(1561-1563)atT>atG	p.I521M		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	521	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CGATGAGGTCAATGCAGGCCT	0.517																																					p.I521M		.											.	MYH7-94	0			c.T1563G						.						231.0	168.0	189.0					14																	23897724		2203	4300	6503	SO:0001583	missense	4625	exon15			GAGGTCAATGCAG	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1563T>G	14.37:g.23897724A>C	ENSP00000347507:p.Ile521Met	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	82	6	NM_000257	0	0	0	0	0	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.084286	0.55861	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.96396	-4.0	4.63	-6.69	0.01772	Myosin head, motor domain (3);	.	.	.	.	D	0.98865	0.9616	H	0.98769	4.325	0.47476	D	0.999438	P	0.35551	0.509	D	0.63192	0.912	D	0.97432	1.0016	9	0.87932	D	0	.	16.9993	0.86377	0.8517:0.0:0.1483:0.0	.	521	P12883	MYH7_HUMAN	M	521	ENSP00000347507:I521M	ENSP00000347507:I521M	I	-	3	3	MYH7	22967564	0.716000	0.27956	0.769000	0.31535	0.940000	0.58332	-0.030000	0.12308	-1.432000	0.01979	-1.028000	0.02416	ATT	.		0.517	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
RIPK3	11035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24805465	24805465	+	Silent	SNP	G	G	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr14:24805465G>T	ENST00000216274.5	-	10	1691	c.1473C>A	c.(1471-1473)ccC>ccA	p.P491P	ADCY4_ENST00000554068.2_5'Flank|ADCY4_ENST00000418030.2_5'Flank|ADCY4_ENST00000558563.1_5'Flank|RIPK3_ENST00000554338.1_5'Flank|ADCY4_ENST00000396747.3_5'Flank|RP11-934B9.3_ENST00000555591.1_Intron|ADCY4_ENST00000310677.4_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	491					activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		CTACTGGTGGGGGGTGCTGCA	0.542																																					p.P491P	Pancreas(58;918 1191 4668 13304 15331)	.											.	RIPK3-946	0			c.C1473A						.						75.0	78.0	77.0					14																	24805465		2203	4300	6503	SO:0001819	synonymous_variant	11035	exon10			TGGTGGGGGGTGC	AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.1473C>A	14.37:g.24805465G>T		Somatic	138	0		WXS	Illumina HiSeq	Phase_I	102	27	NM_006871	0	0	3	3	0	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Silent	SNP	ENST00000216274.5	37	CCDS9628.1																																																																																			.		0.542	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871	
SEC23A	10484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	39524378	39524378	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr14:39524378A>T	ENST00000307712.6	-	14	2145	c.1628T>A	c.(1627-1629)cTt>cAt	p.L543H	SEC23A_ENST00000536508.1_Missense_Mutation_p.L417H|SEC23A_ENST00000537403.1_Missense_Mutation_p.L341H|SEC23A_ENST00000545328.2_Missense_Mutation_p.L514H	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	543					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		CAGCCACCTAAGCACATCTGG	0.418																																					p.L543H		.											.	SEC23A-95	0			c.T1628A						.						137.0	129.0	132.0					14																	39524378		2203	4300	6503	SO:0001583	missense	10484	exon14			CACCTAAGCACAT	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1628T>A	14.37:g.39524378A>T	ENSP00000306881:p.Leu543His	Somatic	222	1		WXS	Illumina HiSeq	Phase_I	174	50	NM_006364	0	0	34	59	25	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	37	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.993863	0.93167	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58	5.81	5.81	0.92471	Sec23/Sec24, helical domain (2);	0.130937	0.51477	D	0.000089	D	0.95893	0.8663	H	0.94183	3.505	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.996	D;D;D	0.67382	0.94;0.94;0.951	D	0.96995	0.9725	10	0.87932	D	0	-22.7375	16.1603	0.81700	1.0:0.0:0.0:0.0	.	514;417;543	F5H365;F5H6C4;Q15436	.;.;SC23A_HUMAN	H	341;543;417;514	ENSP00000444193:L341H;ENSP00000306881:L543H;ENSP00000437715:L417H;ENSP00000445393:L514H	ENSP00000306881:L543H	L	-	2	0	SEC23A	38594129	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.138000	0.94501	2.218000	0.71995	0.450000	0.29827	CTT	.		0.418	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2		
HERC2	8924	broad.mit.edu	37	15	28460930	28460930	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr15:28460930A>C	ENST00000261609.7	-	39	6155	c.6047T>G	c.(6046-6048)gTg>gGg	p.V2016G		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTCCCTGTACACCAGCCTGTT	0.527																																					p.V2016G													.	HERC2-234	0			c.T6047G						.						19.0	19.0	19.0					15																	28460930		1991	3968	5959	SO:0001583	missense	8924	exon39			CTGTACACCAGCC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6047T>G	15.37:g.28460930A>C	ENSP00000261609:p.Val2016Gly	Somatic	76	3		WXS	Illumina HiSeq	Phase_I	83	9	NM_004667	0	0	10	11	1		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	A	12.40	1.926984	0.34002	.	.	ENSG00000128731	ENST00000261609	T	0.40756	1.02	4.28	4.28	0.50868	.	0.000000	0.64402	D	0.000002	T	0.35158	0.0922	L	0.47716	1.5	0.80722	D	1	B	0.33073	0.396	B	0.26416	0.069	T	0.36040	-0.9764	10	0.66056	D	0.02	.	13.573	0.61858	1.0:0.0:0.0:0.0	.	2016	O95714	HERC2_HUMAN	G	2016	ENSP00000261609:V2016G	ENSP00000261609:V2016G	V	-	2	0	HERC2	26134525	1.000000	0.71417	0.070000	0.20053	0.381000	0.30169	6.710000	0.74670	1.800000	0.52685	0.397000	0.26171	GTG	.		0.527	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
NR2E3	10002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	72104834	72104834	+	RNA	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr15:72104834C>T	ENST00000398840.2	+	0	920							Q9Y5X4	NR2E3_HUMAN	nuclear receptor subfamily 2, group E, member 3						eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction (GO:0007602)|positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)	3						GTTCTCCAGCCTGCCCTTCCG	0.647																																					p.L244L		.											.	NR2E3-22	0			c.C730T						.						48.0	54.0	52.0					15																	72104834		2027	4165	6192			10002	exon5			TCCAGCCTGCCCT		CCDS73750.1, CCDS73751.1	15q23	2013-01-16			ENSG00000031544	ENSG00000278570		"""Nuclear hormone receptors"""	7974	protein-coding gene	gene with protein product		604485				10220376	Standard	NM_016346		Approved	PNR, rd7, RP37	uc002ath.1	Q9Y5X4	OTTHUMG00000172841		15.37:g.72104834C>T		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	28	10	NM_016346	0	0	0	0	0	B6ZGU0|Q9UHM4	Silent	SNP	ENST00000398840.2	37																																																																																				.		0.647	NR2E3-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014249	
CHTF18	63922	broad.mit.edu;ucsc.edu	37	16	842454	842454	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr16:842454C>G	ENST00000262315.9	+	11	1405	c.1342C>G	c.(1342-1344)Ctc>Gtc	p.L448V	CHTF18_ENST00000317063.6_Missense_Mutation_p.L643V|CHTF18_ENST00000455171.2_Missense_Mutation_p.L476V	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	448					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CATCAACGTCCTCCTGAGCAT	0.721																																					p.L448V													.	CHTF18-227	0			c.C1342G						.						8.0	11.0	10.0					16																	842454		2017	4101	6118	SO:0001583	missense	63922	exon11			AACGTCCTCCTGA	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.1342C>G	16.37:g.842454C>G	ENSP00000262315:p.Leu448Val	Somatic	10	0		WXS	Illumina HiSeq	Phase_I	8	3	NM_022092	0	0	5	6	1	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	ENST00000262315.9	37	CCDS45371.1	.	.	.	.	.	.	.	.	.	.	c	18.01	3.528711	0.64860	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	T;T;T	0.28895	1.59;1.59;1.59	4.6	4.6	0.57074	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.58264	0.2110	M	0.83852	2.665	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60434	-0.7264	10	0.34782	T	0.22	-30.9585	16.3448	0.83120	0.0:1.0:0.0:0.0	.	476;448	Q8WVB6-2;Q8WVB6	.;CTF18_HUMAN	V	643;476;448	ENSP00000313029:L643V;ENSP00000406252:L476V;ENSP00000262315:L448V	ENSP00000262315:L448V	L	+	1	0	CHTF18	782455	0.997000	0.39634	0.767000	0.31495	0.512000	0.34134	2.862000	0.48388	2.264000	0.75181	0.457000	0.33378	CTC	.		0.721	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
MAPK8IP3	23162	broad.mit.edu	37	16	1815160	1815160	+	Silent	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr16:1815160G>A	ENST00000250894.4	+	20	2581	c.2424G>A	c.(2422-2424)ctG>ctA	p.L808L	MAPK8IP3_ENST00000356010.5_Silent_p.L802L	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	808					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						CGCACGTGCTGTGCATCTCCA	0.612																																					p.L808L													.	MAPK8IP3-1109	0			c.G2424A						.						29.0	33.0	32.0					16																	1815160		2126	4234	6360	SO:0001819	synonymous_variant	23162	exon20			CGTGCTGTGCATC	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.2424G>A	16.37:g.1815160G>A		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	38	3	NM_015133	0	0	6	6	0	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Silent	SNP	ENST00000250894.4	37	CCDS10442.2																																																																																			.		0.612	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439	
PKD1	5310	hgsc.bcm.edu	37	16	2155892	2155892	+	Silent	SNP	A	A	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr16:2155892A>G	ENST00000262304.4	-	20	8045	c.7837T>C	c.(7837-7839)Ttg>Ctg	p.L2613L	PKD1_ENST00000423118.1_Silent_p.L2613L|PKD1_ENST00000561991.1_5'UTR	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2613	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.		Missing (in PKD1; unknown pathological significance). {ECO:0000269|PubMed:11571556}.		anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.L2613L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACCAGGGCCAACGAGTACTCG	0.657																																					p.L2613L		.											.	PKD1-91	1	Substitution - coding silent(1)	lung(1)	c.T7837C						.						46.0	45.0	45.0					16																	2155892		1400	2465	3865	SO:0001819	synonymous_variant	5310	exon20			GGGCCAACGAGTA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7837T>C	16.37:g.2155892A>G		Somatic	48	2		WXS	Illumina HiSeq	Phase_I	67	4	NM_000296	0	0	5	6	1	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.		0.657	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
MYLK3	91807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	46766187	46766187	+	Silent	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr16:46766187C>T	ENST00000394809.4	-	4	1510	c.1395G>A	c.(1393-1395)agG>agA	p.R465R	MYLK3_ENST00000536476.1_Silent_p.R124R	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	465					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TCACCGGAGCCCTGGCTGCAC	0.657																																					p.R465R		.											.	MYLK3-374	0			c.G1395A						.						35.0	39.0	37.0					16																	46766187		2203	4300	6503	SO:0001819	synonymous_variant	91807	exon4			CGGAGCCCTGGCT	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.1395G>A	16.37:g.46766187C>T		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	110	57	NM_182493	0	0	0	0	0	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Silent	SNP	ENST00000394809.4	37	CCDS10723.2																																																																																			.		0.657	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
AMFR	267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	56435720	56435720	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr16:56435720T>C	ENST00000290649.5	-	8	1220	c.1010A>G	c.(1009-1011)aAc>aGc	p.N337S		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	337					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						GTCGTCATTGTTGACAGCCAG	0.522																																					p.N337S	Pancreas(2;144 323 39528)	.											.	AMFR-1009	0			c.A1010G						.						113.0	106.0	109.0					16																	56435720		2198	4300	6498	SO:0001583	missense	267	exon8			TCATTGTTGACAG	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.1010A>G	16.37:g.56435720T>C	ENSP00000290649:p.Asn337Ser	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	174	85	NM_001144	0	0	23	62	39	P26442|Q8IZ70	Missense_Mutation	SNP	ENST00000290649.5	37	CCDS10758.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.281024	0.80692	.	.	ENSG00000159461	ENST00000290649	T	0.66280	-0.2	5.63	5.63	0.86233	Zinc finger, RING/FYVE/PHD-type (1);	0.083860	0.85682	D	0.000000	T	0.54515	0.1863	L	0.50333	1.59	0.80722	D	1	P	0.37061	0.58	B	0.34590	0.186	T	0.52823	-0.8524	10	0.13108	T	0.6	-19.7475	15.8526	0.78943	0.0:0.0:0.0:1.0	.	337	Q9UKV5	AMFR2_HUMAN	S	337	ENSP00000290649:N337S	ENSP00000290649:N337S	N	-	2	0	AMFR	54993221	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	7.862000	0.87013	2.141000	0.66446	0.528000	0.53228	AAC	.		0.522	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256978.2		
NDEL1	81565	broad.mit.edu	37	17	8370302	8370302	+	Silent	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr17:8370302T>C	ENST00000334527.7	+	9	1196	c.999T>C	c.(997-999)cgT>cgC	p.R333R	NDEL1_ENST00000585098.1_Intron|NDEL1_ENST00000380025.4_3'UTR|NDEL1_ENST00000402554.3_3'UTR|NDEL1_ENST00000299734.7_Intron	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	333	Interaction with CENPF.|Interaction with NEFL. {ECO:0000250}.				activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						GCTCCTCGCGTCCATCGTCAG	0.627																																					p.R333R													.	NDEL1-90	0			c.T999C						.						112.0	108.0	109.0					17																	8370302		2203	4300	6503	SO:0001819	synonymous_variant	81565	exon9			CTCGCGTCCATCG	AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.999T>C	17.37:g.8370302T>C		Somatic	153	0		WXS	Illumina HiSeq	Phase_I	185	5	NM_030808	0	0	45	45	0	B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Silent	SNP	ENST00000334527.7	37	CCDS11143.1																																																																																			.		0.627	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226999.2	NM_030808	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	525	83		WXS	Illumina HiSeq		659	90	NM_145301	0	0	13	69	56	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
PEX12	5193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	33903043	33903043	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr17:33903043G>A	ENST00000225873.4	-	3	1445	c.838C>T	c.(838-840)Cct>Tct	p.P280S	SNORD7_ENST00000384567.1_RNA|RP11-1094M14.11_ENST00000592381.1_lincRNA	NM_000286.2	NP_000277.1	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	280	Poly-Pro.				peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(8)	18				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGTGGAGTAGGCAGGGCAGTC	0.478																																					p.P280S		.											.	PEX12-90	0			c.C838T						.						215.0	172.0	187.0					17																	33903043		2203	4300	6503	SO:0001583	missense	5193	exon3			GAGTAGGCAGGGC	U91521	CCDS11296.1	17q21.1	2011-02-10			ENSG00000108733	ENSG00000108733			8854	protein-coding gene	gene with protein product		601758				9090384	Standard	NM_000286		Approved		uc002hjp.3	O00623	OTTHUMG00000132951	ENST00000225873.4:c.838C>T	17.37:g.33903043G>A	ENSP00000225873:p.Pro280Ser	Somatic	128	1		WXS	Illumina HiSeq	Phase_I	147	65	NM_000286	0	0	11	17	6	B2R6M2	Missense_Mutation	SNP	ENST00000225873.4	37	CCDS11296.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.510383	0.85389	.	.	ENSG00000108733	ENST00000424525;ENST00000225873	D	0.85484	-1.99	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.87541	0.6203	M	0.71920	2.185	0.80722	D	1	D	0.54772	0.968	P	0.50231	0.635	D	0.84965	0.0879	10	0.18710	T	0.47	-19.5682	17.5698	0.87932	0.0:0.0:1.0:0.0	.	280	O00623	PEX12_HUMAN	S	280	ENSP00000225873:P280S	ENSP00000225873:P280S	P	-	1	0	PEX12	30927156	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.022000	0.93678	2.614000	0.88457	0.655000	0.94253	CCT	.		0.478	PEX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256489.2	NM_000286	
SMAD4	4089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	48581177	48581177	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr18:48581177G>A	ENST00000342988.3	+	5	1019	c.481G>A	c.(481-483)Gaa>Aaa	p.E161K	SMAD4_ENST00000452201.2_3'UTR|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000588745.1_Missense_Mutation_p.E161K|SMAD4_ENST00000398417.2_Missense_Mutation_p.E161K	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	161					atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(3)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGTGAAGGATGAATATGTGCA	0.358																																					p.E161K		.											.	SMAD4-4758	39	Whole gene deletion(36)|Unknown(3)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.G481A						.						127.0	92.0	104.0					18																	48581177		2203	4300	6503	SO:0001583	missense	4089	exon5			AAGGATGAATATG	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.481G>A	18.37:g.48581177G>A	ENSP00000341551:p.Glu161Lys	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	86	19	NM_005359	0	0	30	30	0	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	35	5.555908	0.96514	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.97688	-4.49;-4.49	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.96975	0.9012	M	0.67397	2.05	0.80722	D	1	P	0.44195	0.828	B	0.41666	0.363	D	0.97207	0.9868	10	0.59425	D	0.04	.	19.1262	0.93386	0.0:0.0:1.0:0.0	.	161	Q13485	SMAD4_HUMAN	K	161	ENSP00000341551:E161K;ENSP00000381452:E161K	ENSP00000341551:E161K	E	+	1	0	SMAD4	46835175	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.567000	0.98161	2.890000	0.99128	0.585000	0.79938	GAA	.		0.358	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
SMAD4	4089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	48581187	48581187	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr18:48581187A>G	ENST00000342988.3	+	5	1029	c.491A>G	c.(490-492)cAt>cGt	p.H164R	SMAD4_ENST00000452201.2_3'UTR|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000588745.1_Missense_Mutation_p.H164R|SMAD4_ENST00000398417.2_Missense_Mutation_p.H164R	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	164					atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(3)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GAATATGTGCATGACTTTGAG	0.368																																					p.H164R		.											.	SMAD4-4758	39	Whole gene deletion(36)|Unknown(3)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.A491G						.						148.0	105.0	119.0					18																	48581187		2203	4300	6503	SO:0001583	missense	4089	exon5			ATGTGCATGACTT	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.491A>G	18.37:g.48581187A>G	ENSP00000341551:p.His164Arg	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	102	26	NM_005359	0	0	16	16	0	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154905	0.38021	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.97378	-4.36;-4.36	5.86	4.64	0.57946	.	0.115658	0.64402	D	0.000020	D	0.92753	0.7696	L	0.29908	0.895	0.80722	D	1	B	0.25904	0.137	B	0.17979	0.02	D	0.90115	0.4195	10	0.20046	T	0.44	.	12.835	0.57767	0.8649:0.1351:0.0:0.0	.	164	Q13485	SMAD4_HUMAN	R	164	ENSP00000341551:H164R;ENSP00000381452:H164R	ENSP00000341551:H164R	H	+	2	0	SMAD4	46835185	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.912000	0.48782	2.367000	0.80283	0.528000	0.53228	CAT	.		0.368	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
TCF4	6925	hgsc.bcm.edu	37	18	52921883	52921883	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr18:52921883C>G	ENST00000356073.4	-	15	1806	c.1195G>C	c.(1195-1197)Gtt>Ctt	p.V399L	TCF4_ENST00000568740.1_Missense_Mutation_p.V374L|TCF4_ENST00000537578.1_Missense_Mutation_p.V375L|TCF4_ENST00000564228.1_Missense_Mutation_p.V328L|TCF4_ENST00000354452.3_Missense_Mutation_p.V399L|TCF4_ENST00000563760.1_5'UTR|TCF4_ENST00000544241.2_Missense_Mutation_p.V328L|TCF4_ENST00000561992.1_Missense_Mutation_p.V269L|TCF4_ENST00000567880.1_Missense_Mutation_p.V339L|TCF4_ENST00000564999.1_Missense_Mutation_p.V399L|TCF4_ENST00000568673.1_Missense_Mutation_p.V375L|TCF4_ENST00000566279.1_Missense_Mutation_p.V339L|TCF4_ENST00000565018.2_Missense_Mutation_p.V399L|TCF4_ENST00000457482.3_Missense_Mutation_p.V239L|TCF4_ENST00000561831.3_Missense_Mutation_p.V239L|TCF4_ENST00000570177.2_Missense_Mutation_p.V269L|TCF4_ENST00000398339.1_Missense_Mutation_p.V501L|TCF4_ENST00000564403.2_Missense_Mutation_p.V405L|TCF4_ENST00000540999.1_Missense_Mutation_p.V375L|TCF4_ENST00000566286.1_Missense_Mutation_p.V396L|TCF4_ENST00000537856.3_Missense_Mutation_p.V269L|TCF4_ENST00000543082.1_Missense_Mutation_p.V357L|TCF4_ENST00000570287.2_Missense_Mutation_p.V239L	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	399	Leucine-zipper.				DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		TTCCGGAGAACATGAATAGCA	0.453																																					p.V501L		.											.	TCF4-523	0			c.G1501C						.						100.0	97.0	98.0					18																	52921883		2203	4300	6503	SO:0001583	missense	6925	exon16			GGAGAACATGAAT	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1195G>C	18.37:g.52921883C>G	ENSP00000348374:p.Val399Leu	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_001243226	0	0	14	14	0	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	ENST00000356073.4	37	CCDS11960.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.754277	0.89843	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26;0.26;0.26;0.26;0.26	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.76463	0.3991	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	0.989;1.0;0.997;0.992;1.0;0.994;0.999;0.982;1.0	D;D;D;D;D;D;D;D;D	0.87578	0.961;0.998;0.97;0.992;0.996;0.961;0.961;0.911;0.994	T	0.78285	-0.2263	10	0.87932	D	0	-8.9972	18.4277	0.90614	0.0:1.0:0.0:0.0	.	375;399;239;501;399;357;328;239;396	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	L	399;239;399;357;375;375;328;269;501	ENSP00000346440:V399L;ENSP00000409447:V239L;ENSP00000348374:V399L;ENSP00000439656:V357L;ENSP00000445202:V375L;ENSP00000440731:V375L;ENSP00000441562:V328L;ENSP00000439827:V269L;ENSP00000381382:V501L	ENSP00000346440:V399L	V	-	1	0	TCF4	51072881	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.042000	0.70996	2.653000	0.90120	0.585000	0.79938	GTT	.		0.453	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199	
RNF152	220441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	59483577	59483577	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr18:59483577C>A	ENST00000312828.3	-	2	1219	c.120G>T	c.(118-120)caG>caT	p.Q40H		NM_173557.2	NP_775828.1	Q8N8N0	RN152_HUMAN	ring finger protein 152	40					apoptotic process (GO:0006915)|protein K48-linked ubiquitination (GO:0070936)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)	17		Colorectal(73;0.186)				TCCTCATCTGCTGCAGGCACA	0.622																																					p.Q40H		.											.	RNF152-226	0			c.G120T						.						48.0	50.0	49.0					18																	59483577		2203	4300	6503	SO:0001583	missense	220441	exon2			CATCTGCTGCAGG	AK096495	CCDS11978.1	18q21.33	2013-01-09			ENSG00000176641	ENSG00000176641		"""RING-type (C3HC4) zinc fingers"""	26811	protein-coding gene	gene with protein product							Standard	XM_005266650		Approved	FLJ39176	uc002lih.1	Q8N8N0	OTTHUMG00000132774	ENST00000312828.3:c.120G>T	18.37:g.59483577C>A	ENSP00000316628:p.Gln40His	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	70	29	NM_173557	0	0	4	8	4	B3KV99|Q52LA4	Missense_Mutation	SNP	ENST00000312828.3	37	CCDS11978.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404965	0.62288	.	.	ENSG00000176641	ENST00000312828	D	0.92545	-3.06	4.97	4.97	0.65823	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.427187	0.24662	N	0.036625	D	0.91355	0.7273	L	0.37561	1.115	0.41272	D	0.986853	P	0.37781	0.608	P	0.45998	0.5	D	0.91326	0.5086	10	0.48119	T	0.1	-30.3756	18.4187	0.90579	0.0:1.0:0.0:0.0	.	40	Q8N8N0	RN152_HUMAN	H	40	ENSP00000316628:Q40H	ENSP00000316628:Q40H	Q	-	3	2	RNF152	57634557	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.177000	0.58276	2.600000	0.87896	0.655000	0.94253	CAG	.		0.622	RNF152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256180.1	NM_173557	
FZR1	51343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	3527659	3527659	+	Silent	SNP	C	C	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:3527659C>A	ENST00000395095.3	+	6	501	c.501C>A	c.(499-501)ccC>ccA	p.P167P	FZR1_ENST00000441788.2_Silent_p.P167P|FZR1_ENST00000313639.8_Intron	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	167					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGGAAACCCACCCGCAAGA	0.622																																					p.P167P		.											.	FZR1-227	0			c.C501A						.						65.0	55.0	59.0					19																	3527659		2199	4296	6495	SO:0001819	synonymous_variant	51343	exon6			GAAACCCACCCGC	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.501C>A	19.37:g.3527659C>A		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	42	9	NM_001136198	0	0	17	32	15	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Silent	SNP	ENST00000395095.3	37	CCDS45916.1																																																																																			.		0.622	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
MAP2K2	5605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4117623	4117623	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:4117623T>G	ENST00000262948.5	-	2	350	c.97A>C	c.(97-99)Aac>Cac	p.N33H	MAP2K2_ENST00000599345.1_5'UTR|MAP2K2_ENST00000394867.4_5'UTR	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	33					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	TCCACCAGGTTTGCCCTGCAG	0.607																																					p.N33H		.											.	MAP2K2-510	0			c.A97C						.						61.0	63.0	62.0					19																	4117623		2203	4300	6503	SO:0001583	missense	5605	exon2			CCAGGTTTGCCCT	L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.97A>C	19.37:g.4117623T>G	ENSP00000262948:p.Asn33His	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	64	23	NM_030662	0	0	0	0	0		Missense_Mutation	SNP	ENST00000262948.5	37	CCDS12120.1	.	.	.	.	.	.	.	.	.	.	t	10.40	1.339579	0.24339	.	.	ENSG00000126934	ENST00000262948	D	0.93189	-3.18	4.14	1.96	0.26148	.	0.114851	0.56097	N	0.000021	D	0.92057	0.7483	M	0.64997	1.995	0.80722	D	1	P	0.41597	0.756	P	0.45829	0.494	D	0.88376	0.2998	10	0.45353	T	0.12	-24.2755	10.059	0.42263	0.0:0.0:0.3226:0.6774	.	33	P36507	MP2K2_HUMAN	H	33	ENSP00000262948:N33H	ENSP00000262948:N33H	N	-	1	0	MAP2K2	4068623	1.000000	0.71417	0.448000	0.26945	0.147000	0.21601	4.829000	0.62737	0.137000	0.18759	0.454000	0.30748	AAC	.		0.607	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258957.2		
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11144150	11144150	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:11144150G>C	ENST00000429416.3	+	27	4012	c.3731G>C	c.(3730-3732)cGc>cCc	p.R1244P	SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1244P|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1244P|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1244P|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1244P|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1244P|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1244P|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1244P|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1244P|SMARCA4_ENST00000538456.3_3'UTR	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1244	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CATGAGCGGCGCGCCTTCCTG	0.642			"""F, N, Mis"""		NSCLC																																p.R1244P		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4-1523	1	Unknown(1)	lung(1)	c.G3731C						.						80.0	80.0	80.0					19																	11144150		2203	4300	6503	SO:0001583	missense	6597	exon26			AGCGGCGCGCCTT	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3731G>C	19.37:g.11144150G>C	ENSP00000395654:p.Arg1244Pro	Somatic	132	1		WXS	Illumina HiSeq	Phase_I	92	21	NM_003072	0	0	49	87	38	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.948702	0.73787	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;T;T;T;T	0.87650	-2.28;-2.28;-2.28;-1.15;-1.15;-1.15;-1.15	4.74	4.74	0.60224	Helicase, C-terminal (1);	0.122489	0.48286	D	0.000187	D	0.90079	0.6901	M	0.64997	1.995	0.40709	D	0.982558	D;D;D;P;D;P;P	0.62365	0.963;0.963;0.963;0.754;0.991;0.927;0.867	P;P;P;P;P;P;P	0.60286	0.82;0.872;0.872;0.575;0.863;0.669;0.796	D	0.90809	0.4700	10	0.87932	D	0	-24.5941	10.3285	0.43807	0.0918:0.0:0.9082:0.0	.	1244;1244;1244;1244;1244;464;1244	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	P	1244;1244;1308;1244;1244;1244;1244;1244	ENSP00000395654:R1244P;ENSP00000350720:R1244P;ENSP00000343896:R1244P;ENSP00000445036:R1244P;ENSP00000392837:R1244P;ENSP00000397783:R1244P;ENSP00000414727:R1244P	ENSP00000343896:R1244P	R	+	2	0	SMARCA4	11005150	0.985000	0.35326	0.998000	0.56505	0.972000	0.66771	6.337000	0.72958	2.488000	0.83962	0.558000	0.71614	CGC	.		0.642	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
KANK2	25959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11304538	11304538	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:11304538A>T	ENST00000586659.1	-	4	532	c.218T>A	c.(217-219)cTg>cAg	p.L73Q	KANK2_ENST00000589894.1_Missense_Mutation_p.L73Q|KANK2_ENST00000355150.5_Missense_Mutation_p.L73Q|KANK2_ENST00000589359.1_Missense_Mutation_p.L73Q|KANK2_ENST00000432929.2_Missense_Mutation_p.L73Q			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	73					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GCCACGGGGCAGCGAGCTCAG	0.672																																					p.L73Q		.											.	KANK2-68	0			c.T218A						.						35.0	37.0	36.0					19																	11304538		2203	4297	6500	SO:0001583	missense	25959	exon2			CGGGGCAGCGAGC	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.218T>A	19.37:g.11304538A>T	ENSP00000465650:p.Leu73Gln	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	51	19	NM_015493	0	0	14	20	6	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	ENST00000586659.1	37	CCDS12255.1	.	.	.	.	.	.	.	.	.	.	A	12.16	1.853681	0.32791	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.48836	0.8;0.82	4.38	4.38	0.52667	.	0.000000	0.56097	D	0.000029	T	0.61800	0.2376	L	0.57536	1.79	0.35815	D	0.824149	D;D;D	0.89917	1.0;0.965;1.0	D;P;D	0.91635	0.999;0.862;0.999	T	0.67201	-0.5730	10	0.28530	T	0.3	-25.9043	12.5808	0.56390	1.0:0.0:0.0:0.0	.	73;73;73	Q63ZY3-3;Q63ZY3;Q63ZY3-2	.;KANK2_HUMAN;.	Q	73	ENSP00000395650:L73Q;ENSP00000347276:L73Q	ENSP00000347276:L73Q	L	-	2	0	KANK2	11165538	1.000000	0.71417	0.540000	0.28089	0.038000	0.13279	6.295000	0.72744	1.616000	0.50265	0.379000	0.24179	CTG	.		0.672	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453066.2	NM_015493	
ZNF791	163049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12739559	12739559	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:12739559C>A	ENST00000343325.4	+	4	1378	c.1216C>A	c.(1216-1218)Cac>Aac	p.H406N	ZNF791_ENST00000540038.1_Missense_Mutation_p.H297N|ZNF791_ENST00000458122.3_Missense_Mutation_p.H374N|ZNF791_ENST00000446165.1_3'UTR|AC010422.1_ENST00000408416.1_RNA|ZNF490_ENST00000465656.1_Intron	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	406					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						CAAGAGAAATCACACTGGAGA	0.393																																					p.H406N		.											.	ZNF791-92	0			c.C1216A						.						90.0	99.0	96.0					19																	12739559		2203	4300	6503	SO:0001583	missense	163049	exon4			AGAAATCACACTG	AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1216C>A	19.37:g.12739559C>A	ENSP00000342974:p.His406Asn	Somatic	243	0		WXS	Illumina HiSeq	Phase_I	207	77	NM_153358	0	0	2	6	4	B7Z586|Q8NC99	Missense_Mutation	SNP	ENST00000343325.4	37	CCDS12273.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828830	0.50845	.	.	ENSG00000173875	ENST00000343325;ENST00000393303;ENST00000458122;ENST00000540038	T;T;T	0.67345	-0.26;-0.26;-0.26	1.83	1.83	0.25207	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81959	0.4933	M	0.88640	2.97	0.30637	N	0.756821	D	0.76494	0.999	D	0.91635	0.999	T	0.77763	-0.2466	9	0.87932	D	0	.	9.2247	0.37398	0.0:1.0:0.0:0.0	.	406	Q3KP31	ZN791_HUMAN	N	406;388;374;297	ENSP00000342974:H406N;ENSP00000441761:H374N;ENSP00000441038:H297N	ENSP00000342974:H406N	H	+	1	0	ZNF791	12600559	1.000000	0.71417	0.865000	0.33974	0.967000	0.64934	4.955000	0.63638	1.007000	0.39238	0.491000	0.48974	CAC	.		0.393	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358	
ZNF260	339324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	37005333	37005333	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:37005333G>A	ENST00000523638.1	-	3	1929	c.808C>T	c.(808-810)Cat>Tat	p.H270Y	ZNF260_ENST00000593142.1_Missense_Mutation_p.H270Y|ZNF260_ENST00000592282.1_Missense_Mutation_p.H270Y|ZNF260_ENST00000588993.1_Missense_Mutation_p.H270Y	NM_001166036.1|NM_001166037.1|NM_001166038.1	NP_001159508.1|NP_001159509.1|NP_001159510.1	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	270					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)	15	Esophageal squamous(110;0.162)					TCTCCAATATGAATTTTCTCA	0.398																																					p.H270Y		.											.	ZNF260-90	0			c.C808T						.						123.0	122.0	122.0					19																	37005333		2203	4300	6503	SO:0001583	missense	339324	exon3			CAATATGAATTTT	AK122854	CCDS33003.1	19q13.12	2013-01-08				ENSG00000254004		"""Zinc fingers, C2H2-type"""	13499	protein-coding gene	gene with protein product		613749					Standard	NM_001166036		Approved	ozrf1, Zfp260	uc002oed.2	Q3ZCT1		ENST00000523638.1:c.808C>T	19.37:g.37005333G>A	ENSP00000429803:p.His270Tyr	Somatic	156	0		WXS	Illumina HiSeq	Phase_I	134	42	NM_001166038	0	0	3	6	3	Q0VF43	Missense_Mutation	SNP	ENST00000523638.1	37	CCDS33003.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.335259	0.81801	.	.	ENSG00000254004	ENST00000523638	T	0.67523	-0.27	4.54	4.54	0.55810	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.85720	0.5762	M	0.92412	3.305	0.50632	D	0.999883	D	0.89917	1.0	D	0.91635	0.999	D	0.89435	0.3719	9	0.87932	D	0	.	16.5613	0.84567	0.0:0.0:1.0:0.0	.	270	Q3ZCT1	ZN260_HUMAN	Y	270	ENSP00000429803:H270Y	ENSP00000429803:H270Y	H	-	1	0	ZNF260	41697173	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.645000	0.83430	2.496000	0.84212	0.561000	0.74099	CAT	.		0.398	ZNF260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109564.2	NM_001012756	
GSK3A	2931	hgsc.bcm.edu	37	19	42746451	42746451	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:42746451A>G	ENST00000222330.3	-	1	294	c.167T>C	c.(166-168)aTg>aCg	p.M56T	AC006486.1_ENST00000378108.1_5'Flank|AC006486.9_ENST00000594664.1_Intron|GSK3A_ENST00000398249.4_5'Flank	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	56	Gly-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				GCCCCCACCCATGGCCCCGAC	0.821																																					p.M56T		.											.	GSK3A-981	0			c.T167C						.																																			SO:0001583	missense	2931	exon1			CCACCCATGGCCC		CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.167T>C	19.37:g.42746451A>G	ENSP00000222330:p.Met56Thr	Somatic	3	2		WXS	Illumina HiSeq	Phase_I	4	2	NM_019884	0	0	1	4	3	O14959	Missense_Mutation	SNP	ENST00000222330.3	37	CCDS12599.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.340070	0.41398	.	.	ENSG00000105723	ENST00000222330;ENST00000544315	T	0.20738	2.05	3.88	3.88	0.44766	.	.	.	.	.	T	0.12646	0.0307	N	0.24115	0.695	0.80722	D	1	B	0.14012	0.009	B	0.10450	0.005	T	0.09530	-1.0670	9	0.16420	T	0.52	-7.7159	9.2973	0.37824	1.0:0.0:0.0:0.0	.	56	P49840	GSK3A_HUMAN	T	56;1	ENSP00000222330:M56T	ENSP00000222330:M56T	M	-	2	0	GSK3A	47438291	0.999000	0.42202	0.998000	0.56505	0.897000	0.52465	1.556000	0.36288	1.771000	0.52183	0.459000	0.35465	ATG	.		0.821	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319782.1		
NOSIP	51070	hgsc.bcm.edu;broad.mit.edu	37	19	50063190	50063190	+	Splice_Site	SNP	C	C	G	rs150449733		TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:50063190C>G	ENST00000596358.1	-	3	235		c.e3+1		NOSIP_ENST00000339093.3_Splice_Site|NOSIP_ENST00000391853.3_Splice_Site	NM_001270960.1	NP_001257889.1	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein						negative regulation of catalytic activity (GO:0043086)|negative regulation of nitric-oxide synthase activity (GO:0051001)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|skin(2)|urinary_tract(1)	11		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		TCCCAGCTCACGTGACAACAG	0.622																																					.		.											.	NOSIP-91	0			c.176+1G>C						.						83.0	59.0	67.0					19																	50063190		2203	4300	6503	SO:0001630	splice_region_variant	51070	exon4			AGCTCACGTGACA	AF132959	CCDS12772.1	19q13.3	2008-02-05				ENSG00000142546			17946	protein-coding gene	gene with protein product						11149895, 10810093	Standard	NM_015953		Approved	CGI-25	uc002pol.4	Q9Y314		ENST00000596358.1:c.176+1G>C	19.37:g.50063190C>G		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	16	3	NM_001270960	0	0	0	0	0	Q96FD2	Splice_Site	SNP	ENST00000596358.1	37	CCDS12772.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652985	0.67472	.	.	ENSG00000142546	ENST00000339093;ENST00000391853	.	.	.	5.5	2.05	0.26809	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7205	0.62723	0.4016:0.5984:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOSIP	54755002	1.000000	0.71417	0.925000	0.36789	0.978000	0.69477	4.870000	0.63035	0.241000	0.21283	0.585000	0.79938	.	C|1.000;T|0.000		0.622	NOSIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465423.1		Intron
TTYH1	57348	broad.mit.edu	37	19	54932519	54932519	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:54932519C>T	ENST00000376530.3	+	3	477	c.374C>T	c.(373-375)gCg>gTg	p.A125V	TTYH1_ENST00000301194.4_Missense_Mutation_p.A125V|TTYH1_ENST00000391739.3_Missense_Mutation_p.A174V|TTYH1_ENST00000376531.3_Missense_Mutation_p.A125V	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	125					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		CTCAGCTCTGCGCTGCTGCAC	0.622																																					p.A125V													.	TTYH1-90	0			c.C374T						.						125.0	102.0	110.0					19																	54932519		2203	4300	6503	SO:0001583	missense	57348	exon3			GCTCTGCGCTGCT	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.374C>T	19.37:g.54932519C>T	ENSP00000365713:p.Ala125Val	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	82	4	NM_020659	0	0	0	0	0	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Missense_Mutation	SNP	ENST00000376530.3	37	CCDS12893.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404884	0.83230	.	.	ENSG00000167614	ENST00000423529;ENST00000301194;ENST00000376530;ENST00000445095;ENST00000391739;ENST00000376531	T;T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46;2.46	3.75	3.75	0.43078	.	0.071799	0.56097	D	0.000029	T	0.34978	0.0916	L	0.55481	1.735	0.51482	D	0.999929	D;D;D;D;D	0.89917	1.0;0.995;0.99;0.995;1.0	D;P;P;P;D	0.83275	0.976;0.837;0.718;0.837;0.996	T	0.04840	-1.0923	9	.	.	.	-10.4751	13.8879	0.63719	0.0:1.0:0.0:0.0	.	174;40;125;125;125	B7Z1H9;Q9H313-5;Q9H313-2;Q9H313-3;Q9H313	.;.;.;.;TTYH1_HUMAN	V	121;125;125;174;174;125	ENSP00000391282:A121V;ENSP00000301194:A125V;ENSP00000365713:A125V;ENSP00000393592:A174V;ENSP00000375619:A174V;ENSP00000365714:A125V	.	A	+	2	0	TTYH1	59624331	1.000000	0.71417	0.483000	0.27378	0.558000	0.35554	6.882000	0.75589	2.021000	0.59480	0.655000	0.94253	GCG	.		0.622	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140498.1		
SLC3A1	6519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44507998	44507998	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:44507998G>T	ENST00000260649.6	+	2	650	c.574G>T	c.(574-576)Gat>Tat	p.D192Y	SLC3A1_ENST00000410056.3_Missense_Mutation_p.D192Y|SLC3A1_ENST00000409387.1_Missense_Mutation_p.D192Y|SLC3A1_ENST00000409741.1_Missense_Mutation_p.D192Y|SLC3A1_ENST00000409229.3_Missense_Mutation_p.D192Y	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	192					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	AACGATGGAAGATTTTGAGAA	0.373																																					p.D192Y		.											.	SLC3A1-90	0			c.G574T						.						111.0	107.0	108.0					2																	44507998		2203	4300	6503	SO:0001583	missense	6519	exon2			ATGGAAGATTTTG		CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.574G>T	2.37:g.44507998G>T	ENSP00000260649:p.Asp192Tyr	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	125	37	NM_000341	0	2	340	694	352	A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Missense_Mutation	SNP	ENST00000260649.6	37	CCDS1819.1	.	.	.	.	.	.	.	.	.	.	G	18.16	3.563097	0.65538	.	.	ENSG00000138079	ENST00000260649;ENST00000409387;ENST00000540334;ENST00000410056;ENST00000409741;ENST00000409229;ENST00000541289	D;D;D;D;D	0.99758	-6.65;-6.65;-5.38;-6.65;-6.65	4.74	3.86	0.44501	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.054412	0.64402	D	0.000001	D	0.99862	0.9935	H	0.98256	4.185	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.995;0.995;0.995;0.988;0.984	D	0.96726	0.9536	10	0.87932	D	0	-14.6276	13.4464	0.61144	0.0768:0.0:0.9232:0.0	.	192;192;192;192;192	Q07837;B8ZZK1;Q4J6B5;Q4J6B6;Q4J6B8	SLC31_HUMAN;.;.;.;.	Y	192;192;128;192;192;192;192	ENSP00000260649:D192Y;ENSP00000387308:D192Y;ENSP00000387337:D192Y;ENSP00000386954:D192Y;ENSP00000386620:D192Y	ENSP00000260649:D192Y	D	+	1	0	SLC3A1	44361502	1.000000	0.71417	0.989000	0.46669	0.730000	0.41778	7.381000	0.79718	1.110000	0.41699	0.655000	0.94253	GAT	.		0.373	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250676.1	NM_000341	
PNPT1	87178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55908004	55908004	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:55908004A>G	ENST00000447944.2	-	6	589	c.503T>C	c.(502-504)cTa>cCa	p.L168P		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	168					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATTAATTGCTAGGACATCAGG	0.313																																					p.L168P		.											.	PNPT1-90	0			c.T503C						.						57.0	60.0	59.0					2																	55908004		2203	4299	6502	SO:0001583	missense	87178	exon6			ATTGCTAGGACAT	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.503T>C	2.37:g.55908004A>G	ENSP00000400646:p.Leu168Pro	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	78	23	NM_033109	0	0	0	0	0	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	37	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	A	19.89	3.910089	0.72983	.	.	ENSG00000138035	ENST00000447944	T	0.68025	-0.3	5.24	5.24	0.73138	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.000000	0.64402	D	0.000001	T	0.79470	0.4451	M	0.67625	2.065	0.80722	D	1	D	0.67145	0.996	D	0.77004	0.989	T	0.78602	-0.2140	10	0.36615	T	0.2	-15.1193	15.4288	0.75075	1.0:0.0:0.0:0.0	.	168	Q8TCS8	PNPT1_HUMAN	P	168	ENSP00000400646:L168P	ENSP00000260604:L168P	L	-	2	0	PNPT1	55761508	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.590000	0.90821	2.107000	0.64212	0.383000	0.25322	CTA	.		0.313	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
FANCL	55120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	58431304	58431304	+	Silent	SNP	A	A	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:58431304A>G	ENST00000233741.4	-	6	468	c.432T>C	c.(430-432)tcT>tcC	p.S144S	FANCL_ENST00000403295.3_Silent_p.S144S|FANCL_ENST00000402135.3_Silent_p.S144S|FANCL_ENST00000403676.1_Silent_p.S27S|FANCL_ENST00000540646.1_Intron	NM_018062.3	NP_060532.2	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L	144	UBC-RWD region (URD).		S -> F (in dbSNP:rs36059257).		cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|gamete generation (GO:0007276)|protein monoubiquitination (GO:0006513)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ligase activity (GO:0016874)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)	8						GCTCTCTACCAGAAGCATCTT	0.408								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.S144S		.											.	FANCL-661	0			c.T432C						.						137.0	133.0	135.0					2																	58431304		2203	4300	6503	SO:0001819	synonymous_variant	55120	exon6	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TCTACCAGAAGCA	AK001197	CCDS1860.1, CCDS46294.1	2p16.1	2014-09-17	2003-10-14	2003-10-15	ENSG00000115392	ENSG00000115392		"""Zinc fingers, PHD-type"", ""Fanconi anemia, complementation groups"""	20748	protein-coding gene	gene with protein product		608111	"""PHD finger protein 9"""	PHF9			Standard	NM_018062		Approved	FLJ10335, FAAP43, Pog	uc002rzx.4	Q9NW38	OTTHUMG00000129349	ENST00000233741.4:c.432T>C	2.37:g.58431304A>G		Somatic	197	0		WXS	Illumina HiSeq	Phase_I	166	45	NM_018062	0	0	8	11	3	Q6GU60	Silent	SNP	ENST00000233741.4	37	CCDS1860.1	.	.	.	.	.	.	.	.	.	.	A	11.14	1.550764	0.27739	.	.	ENSG00000115392	ENST00000427708	.	.	.	6.03	1.08	0.20341	.	.	.	.	.	T	0.55784	0.1942	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47045	-0.9147	4	.	.	.	-18.6795	8.6392	0.33968	0.7171:0.0:0.2829:0.0	.	.	.	.	R	144	.	.	W	-	1	0	FANCL	58284808	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.352000	0.44080	0.161000	0.19458	0.533000	0.62120	TGG	.		0.408	FANCL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251497.1	NM_018062	
TET3	200424	hgsc.bcm.edu	37	2	74275021	74275021	+	Silent	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:74275021C>T	ENST00000409262.3	+	1	1572	c.1572C>T	c.(1570-1572)ccC>ccT	p.P524P		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	524					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TGCCCCTGCCCCCAGAACCTT	0.632																																					p.P524P		.											.	.	0			c.C1572T						.						23.0	25.0	24.0					2																	74275021		1993	4171	6164	SO:0001819	synonymous_variant	200424	exon1			CCTGCCCCCAGAA		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.1572C>T	2.37:g.74275021C>T		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	19	5	NM_144993	0	0	3	6	3	A6NEI3|Q86Z24|Q8TBM9	Silent	SNP	ENST00000409262.3	37	CCDS46339.1																																																																																			.		0.632	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
THNSL2	55258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	88482283	88482283	+	Missense_Mutation	SNP	A	A	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:88482283A>G	ENST00000324166.5	+	5	2559	c.868A>G	c.(868-870)Atc>Gtc	p.I290V	THNSL2_ENST00000449349.1_Intron|THNSL2_ENST00000496844.1_3'UTR|THNSL2_ENST00000343544.4_Missense_Mutation_p.I290V|THNSL2_ENST00000402102.1_Missense_Mutation_p.I290V|THNSL2_ENST00000358591.2_Missense_Mutation_p.I290V|THNSL2_ENST00000377254.3_Missense_Mutation_p.I290V	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	290					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						CCGCAATGACATCATCCACAG	0.512																																					p.I290V		.											.	THNSL2-91	0			c.A868G						.						93.0	89.0	90.0					2																	88482283		2203	4300	6503	SO:0001583	missense	55258	exon5			AATGACATCATCC		CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.868A>G	2.37:g.88482283A>G	ENSP00000327323:p.Ile290Val	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	88	27	NM_018271	0	0	38	74	36	B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Missense_Mutation	SNP	ENST00000324166.5	37	CCDS2002.2	.	.	.	.	.	.	.	.	.	.	A	27.0	4.789980	0.90367	.	.	ENSG00000144115	ENST00000358591;ENST00000377254;ENST00000402102;ENST00000544063;ENST00000343544;ENST00000324166	T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78	5.81	5.81	0.92471	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	T	0.20495	0.0493	L	0.37561	1.115	0.49389	D	0.999788	D;D;D	0.62365	0.991;0.987;0.979	P;P;P	0.59703	0.844;0.862;0.784	T	0.00701	-1.1603	10	0.38643	T	0.18	.	15.3313	0.74215	1.0:0.0:0.0:0.0	.	132;290;290	A8K0C1;Q86YJ6;Q86YJ6-2	.;THNS2_HUMAN;.	V	290;290;290;132;290;290	ENSP00000351402:I290V;ENSP00000366464:I290V;ENSP00000384475:I290V;ENSP00000339563:I290V;ENSP00000327323:I290V	ENSP00000327323:I290V	I	+	1	0	THNSL2	88263398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.322000	0.90000	2.219000	0.72066	0.533000	0.62120	ATC	.		0.512	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252662.1	NM_018271	
TRIM43	129868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	96260855	96260855	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:96260855A>T	ENST00000272395.2	+	3	605	c.469A>T	c.(469-471)Aat>Tat	p.N157Y		NM_001164464.1|NM_138800.1	NP_001157936.1|NP_620155.1	Q96BQ3	TRI43_HUMAN	tripartite motif containing 43	157						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|lung(7)|ovary(1)	12						AAATCAGAGAAATCTATATGA	0.403																																					p.N157Y		.											.	TRIM43-63	0			c.A469T						.						58.0	56.0	56.0					2																	96260855		2203	4299	6502	SO:0001583	missense	129868	exon3			CAGAGAAATCTAT	BK000505	CCDS2015.1	2q11	2014-02-17	2011-01-25		ENSG00000144015	ENSG00000144015		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19015	protein-coding gene	gene with protein product			"""tripartite motif-containing 43"""				Standard	NM_138800		Approved	TRIM43A	uc002suv.3	Q96BQ3	OTTHUMG00000130401	ENST00000272395.2:c.469A>T	2.37:g.96260855A>T	ENSP00000272395:p.Asn157Tyr	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	46	14	NM_138800	0	0	0	0	0	Q53TJ7	Missense_Mutation	SNP	ENST00000272395.2	37	CCDS2015.1	.	.	.	.	.	.	.	.	.	.	.	11.90	1.776990	0.31411	.	.	ENSG00000144015	ENST00000272395	T	0.06608	3.28	0.911	0.911	0.19343	.	.	.	.	.	T	0.12178	0.0296	L	0.59436	1.845	0.09310	N	1	D	0.89917	1.0	D	0.77557	0.99	T	0.17137	-1.0379	9	0.02654	T	1	-3.9711	4.1749	0.10348	1.0:0.0:0.0:0.0	.	157	Q96BQ3	TRI43_HUMAN	Y	157	ENSP00000272395:N157Y	ENSP00000272395:N157Y	N	+	1	0	TRIM43	95624582	0.197000	0.23362	0.060000	0.19600	0.268000	0.26511	0.953000	0.29162	0.680000	0.31366	0.308000	0.20428	AAT	.		0.403	TRIM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252784.1	NM_138800	
ZEB2	9839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	145156027	145156027	+	Silent	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:145156027G>A	ENST00000558170.2	-	8	3911	c.2727C>T	c.(2725-2727)ttC>ttT	p.F909F	ZEB2_ENST00000303660.4_Silent_p.F909F|ZEB2_ENST00000539609.3_Silent_p.F885F|ZEB2_ENST00000409487.3_Silent_p.F909F	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	909					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CTGGTGGCATGAAAGTAGCAG	0.498																																					p.F909F	Melanoma(33;1235 1264 5755 16332)	.											.	ZEB2-297	0			c.C2727T						.						176.0	170.0	172.0					2																	145156027		2203	4300	6503	SO:0001819	synonymous_variant	9839	exon8			TGGCATGAAAGTA	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.2727C>T	2.37:g.145156027G>A		Somatic	240	0		WXS	Illumina HiSeq	Phase_I	172	60	NM_014795	0	0	18	21	3	A0JP09|B7Z2P2|F5H814|Q9UED1	Silent	SNP	ENST00000558170.2	37	CCDS2186.1																																																																																			.		0.498	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
CD302	9936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	160637446	160637446	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:160637446T>C	ENST00000259053.4	-	3	285	c.242A>G	c.(241-243)aAg>aGg	p.K81R	LY75-CD302_ENST00000504764.1_Missense_Mutation_p.K1722R|LY75_ENST00000554112.1_Missense_Mutation_p.K1722R|CD302_ENST00000480212.1_5'UTR|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.K1666R|LY75_ENST00000553424.1_Missense_Mutation_p.K1666R|CD302_ENST00000429078.2_Missense_Mutation_p.K81R	NM_001198764.1|NM_014880.4	NP_001185693.1|NP_055695.2	Q8IX05	CD302_HUMAN	CD302 molecule	81	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				phagocytosis (GO:0006909)	cell cortex (GO:0005938)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						TTTCCATTGCTTTTTCAAAGT	0.338																																					p.K1722R		.											.	.	0			c.A5165G						.						153.0	141.0	145.0					2																	160637446		2203	4300	6503	SO:0001583	missense	100526664	exon36			CATTGCTTTTTCA	AY314007	CCDS33308.1, CCDS56139.1, CCDS74595.1	2q24.2	2011-08-30	2006-03-28		ENSG00000241399	ENSG00000241399		"""CD molecules"", ""C-type lectin domain containing"""	30843	protein-coding gene	gene with protein product	"""C-type lectin domain family 13, member A"""	612246	"""CD302 antigen"""			7584026, 7584028	Standard	NM_014880		Approved	DCL-1, KIAA0022, BIMLEC, CLEC13A		Q8IX05	OTTHUMG00000154080	ENST00000259053.4:c.242A>G	2.37:g.160637446T>C	ENSP00000259053:p.Lys81Arg	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	103	27	NM_001198759	0	0	21	21	0	A8K5G4|B4E2T9|Q15009	Missense_Mutation	SNP	ENST00000259053.4	37	CCDS33308.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.151609	0.78001	.	.	ENSG00000241399;ENSG00000241399;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000259053;ENST00000429078;ENST00000554112;ENST00000553424;ENST00000504764;ENST00000505052	T;T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1;3.1	5.21	3.98	0.46160	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.222293	0.36854	N	0.002374	T	0.14874	0.0359	L	0.51422	1.61	0.21445	N	0.99969	P;B;P;D	0.58620	0.901;0.386;0.642;0.983	P;B;B;P	0.57324	0.702;0.178;0.178;0.818	T	0.09100	-1.0690	10	0.19590	T	0.45	-28.4385	10.1369	0.42712	0.0:0.0:0.3327:0.6673	.	81;1666;1722;81	B4E2T9;O60449-3;O60449-2;Q8IX05	.;.;.;CD302_HUMAN	R	81;81;1722;1666;1722;1666	ENSP00000259053:K81R;ENSP00000394301:K81R;ENSP00000451511:K1722R;ENSP00000451446:K1666R;ENSP00000423463:K1722R;ENSP00000421035:K1666R	ENSP00000259053:K81R	K	-	2	0	LY75;CD302;LY75-CD302	160345692	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.111000	0.31159	2.097000	0.63578	0.533000	0.62120	AAG	.		0.338	CD302-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333760.1	NM_014880	
UBR3	130507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	170843265	170843265	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:170843265C>G	ENST00000272793.5	+	25	3795	c.3745C>G	c.(3745-3747)Cga>Gga	p.R1249G	UBR3_ENST00000418381.1_Missense_Mutation_p.R1249G|UBR3_ENST00000392631.1_Missense_Mutation_p.R70G			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1249					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						CTCTGAAGATCGACCTACTGG	0.408																																					p.R1249G		.											.	UBR3-68	0			c.C3745G						.						109.0	108.0	108.0					2																	170843265		2203	4300	6503	SO:0001583	missense	130507	exon25			GAAGATCGACCTA	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.3745C>G	2.37:g.170843265C>G	ENSP00000272793:p.Arg1249Gly	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	103	29	NM_172070	0	0	7	17	10	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.13|17.13	3.312099|3.312099	0.60414|0.60414	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000392632|ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631	.|T;T;T	.|0.57907	.|0.37;0.37;0.89	5.27|5.27	3.38|3.38	0.38709|0.38709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67748|0.67748	0.2926|0.2926	M|M	0.71581|0.71581	2.175|2.175	0.32414|0.32414	N|N	0.550296|0.550296	.|D;D;D	.|0.67145	.|0.993;0.996;0.987	.|D;D;D	.|0.79108	.|0.982;0.992;0.953	T|T	0.71481|0.71481	-0.4580|-0.4580	5|10	.|0.20519	.|T	.|0.43	.|.	13.7422|13.7422	0.62855|0.62855	0.4588:0.5412:0.0:0.0|0.4588:0.5412:0.0:0.0	.|.	.|1249;70;1249	.|Q6ZT12;Q6ZT12-2;E7EVK3	.|UBR3_HUMAN;.;.	M|G	306|1249;1249;1249;70	.|ENSP00000272793:R1249G;ENSP00000396068:R1249G;ENSP00000376408:R70G	.|ENSP00000272793:R1249G	I|R	+|+	3|1	3|2	UBR3|UBR3	170551511|170551511	0.662000|0.662000	0.27439|0.27439	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.024000|1.024000	0.30077|0.30077	0.530000|0.530000	0.28619|0.28619	0.585000|0.585000	0.79938|0.79938	ATC|CGA	.		0.408	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070	
DYTN	391475	hgsc.bcm.edu	37	2	207564616	207564616	+	Splice_Site	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:207564616T>C	ENST00000452335.2	-	7	672		c.e7-2		Y_RNA_ENST00000384589.1_RNA|DYTN_ENST00000477734.1_Splice_Site	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin							plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		GCTCAACACCTGAAAAACAAT	0.438																																					.		.											.	DYTN-23	0			c.556-2A>G						.						67.0	69.0	68.0					2																	207564616		1887	4116	6003	SO:0001630	splice_region_variant	391475	exon8			AACACCTGAAAAA	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.556-2A>G	2.37:g.207564616T>C		Somatic	42	0		WXS	Illumina HiSeq	Phase_I	49	3	NM_001093730	0	0	0	0	0		Splice_Site	SNP	ENST00000452335.2	37	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.386607	0.42308	.	.	ENSG00000232125	ENST00000452335	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8833	0.70550	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DYTN	207272861	1.000000	0.71417	0.997000	0.53966	0.389000	0.30415	5.505000	0.66981	2.254000	0.74563	0.459000	0.35465	.	.		0.438	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1		Intron
ANKMY1	51281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	241468551	241468551	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:241468551T>G	ENST00000272972.3	-	4	803	c.589A>C	c.(589-591)Aat>Cat	p.N197H	ANKMY1_ENST00000373318.2_Intron|ANKMY1_ENST00000405523.3_Intron|ANKMY1_ENST00000403283.1_Intron|ANKMY1_ENST00000462004.1_Intron|ANKMY1_ENST00000401804.1_Missense_Mutation_p.N286H|ANKMY1_ENST00000391987.1_Missense_Mutation_p.N197H|ANKMY1_ENST00000373320.4_Intron|ANKMY1_ENST00000536462.1_Intron|ANKMY1_ENST00000405002.1_Intron|ANKMY1_ENST00000361678.4_Intron|ANKMY1_ENST00000406958.1_Intron	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	197							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GGAATTTCATTGAGGAAGATG	0.483																																					p.N197H		.											.	ANKMY1-90	0			c.A589C						.						155.0	155.0	155.0					2																	241468551		2203	4300	6503	SO:0001583	missense	51281	exon4			TTTCATTGAGGAA	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.589A>C	2.37:g.241468551T>G	ENSP00000272972:p.Asn197His	Somatic	200	1		WXS	Illumina HiSeq	Phase_I	153	46	NM_016552	0	0	0	1	1	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	ENST00000272972.3	37	CCDS2536.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.289|4.289	0.052793|0.052793	0.08291|0.08291	.|.	.|.	ENSG00000144504|ENSG00000144504	ENST00000272972;ENST00000391987;ENST00000401804;ENST00000539830;ENST00000418708|ENST00000443318	T;T;T;T|.	0.44881|.	0.91;0.91;0.91;0.91|.	4.79|4.79	-4.57|-4.57	0.03421|0.03421	.|.	0.571564|.	0.17218|.	N|.	0.182438|.	T|T	0.49490|0.49490	0.1560|0.1560	M|M	0.72118|0.72118	2.19|2.19	0.09310|0.09310	N|N	1|1	B;B|.	0.13594|.	0.008;0.008|.	B;B|.	0.11329|.	0.006;0.006|.	T|T	0.54944|0.54944	-0.8217|-0.8217	10|5	0.66056|.	D|.	0.02|.	-7.6409|-7.6409	8.6712|8.6712	0.34152|0.34152	0.0:0.0966:0.5195:0.3839|0.0:0.0966:0.5195:0.3839	.|.	197;197|.	Q4ZFV3;Q9P2S6|.	.;ANKY1_HUMAN|.	H|P	197;197;286;197;197|141	ENSP00000272972:N197H;ENSP00000375847:N197H;ENSP00000385887:N286H;ENSP00000407015:N197H|.	ENSP00000272972:N197H|.	N|Q	-|-	1|2	0|0	ANKMY1|ANKMY1	241117224|241117224	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.190000|-0.190000	0.09615|0.09615	-0.388000|-0.388000	0.07797|0.07797	-0.313000|-0.313000	0.08912|0.08912	AAT|CAA	.		0.483	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
FITM2	128486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	42935425	42935425	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr20:42935425G>T	ENST00000396825.3	-	2	649	c.629C>A	c.(628-630)gCt>gAt	p.A210D		NM_001080472.1	NP_001073941.1	Q8N6M3	FITM2_HUMAN	fat storage-inducing transmembrane protein 2	210					cellular triglyceride homeostasis (GO:0035356)|cytoskeleton organization (GO:0007010)|lipid particle organization (GO:0034389)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of cell morphogenesis (GO:0022604)|regulation of triglyceride biosynthetic process (GO:0010866)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)				endometrium(2)|lung(2)|skin(2)	6						GAAATAAACAGCTGTGCACAG	0.522																																					p.A210D		.											.	FITM2-24	0			c.C629A						.						99.0	83.0	88.0					20																	42935425		2203	4300	6503	SO:0001583	missense	128486	exon2			TAAACAGCTGTGC	BC029662	CCDS33473.1	20q13.12	2009-04-29	2009-04-29	2009-04-29	ENSG00000197296	ENSG00000197296			16135	protein-coding gene	gene with protein product	"""fat inducing transcript 2"""	612029	"""chromosome 20 open reading frame 142"""	C20orf142		18160536	Standard	NM_001080472		Approved	dJ881L22.2, FIT2	uc002xlr.1	Q8N6M3	OTTHUMG00000032522	ENST00000396825.3:c.629C>A	20.37:g.42935425G>T	ENSP00000380037:p.Ala210Asp	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	55	18	NM_001080472	0	0	8	18	10	A1L492|B9EGQ4|Q5TE59|Q9H3Y1	Missense_Mutation	SNP	ENST00000396825.3	37	CCDS33473.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600365	0.87055	.	.	ENSG00000197296	ENST00000396825	.	.	.	5.57	5.57	0.84162	.	0.217055	0.48286	D	0.000191	D	0.82747	0.5104	M	0.84082	2.675	0.80722	D	1	D	0.63880	0.993	D	0.63877	0.919	T	0.83306	-0.0025	9	0.48119	T	0.1	.	19.5462	0.95299	0.0:0.0:1.0:0.0	.	210	Q8N6M3	FITM2_HUMAN	D	210	.	ENSP00000380037:A210D	A	-	2	0	FITM2	42368839	1.000000	0.71417	0.620000	0.29132	0.912000	0.54170	9.397000	0.97276	2.609000	0.88269	0.563000	0.77884	GCT	.		0.522	FITM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079342.2	XM_371399	
MIR124-3	406909	broad.mit.edu;bcgsc.ca	37	20	61809914	61809914	+	lincRNA	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr20:61809914G>A	ENST00000423020.1	-	0	188				MIR124-3_ENST00000384866.1_RNA																							TAAGGCACGCGGTGAATGCCA	0.682																																					.													.	.	0			.						.						20.0	24.0	23.0					20																	61809914		1567	3582	5149			406909	.			GCACGCGGTGAAT																													20.37:g.61809914G>A		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	33	9	.	0	0	0	0	0		RNA	SNP	ENST00000423020.1	37																																																																																				.		0.682	RP5-963E22.4-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000276288.1		
MYH9	4627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	36716872	36716872	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr22:36716872A>T	ENST00000216181.5	-	8	1069	c.839T>A	c.(838-840)cTc>cAc	p.L280H		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	280	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CCCAGACAGGAGATAATAGAA	0.532			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.L280H		.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9-292	0			c.T839A						.						74.0	70.0	71.0					22																	36716872		2203	4300	6503	SO:0001583	missense	4627	exon8	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	GACAGGAGATAAT		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.839T>A	22.37:g.36716872A>T	ENSP00000216181:p.Leu280His	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	40	11	NM_002473	1	0	183	306	122	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	37	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.937579	0.92458	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.94092	-3.35	5.13	5.13	0.70059	Myosin head, motor domain (2);	0.073236	0.53938	D	0.000057	D	0.97405	0.9151	H	0.99357	4.53	0.80722	D	1	D	0.63880	0.993	P	0.51895	0.683	D	0.98753	1.0721	10	0.87932	D	0	.	14.9048	0.70709	1.0:0.0:0.0:0.0	.	280	P35579	MYH9_HUMAN	H	144;280	ENSP00000216181:L280H	ENSP00000216181:L280H	L	-	2	0	MYH9	35046818	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	9.287000	0.95975	2.053000	0.61076	0.482000	0.46254	CTC	.		0.532	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
EP300	2033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	41489069	41489069	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr22:41489069C>G	ENST00000263253.7	+	1	1280	c.61C>G	c.(61-63)Ccg>Gcg	p.P21A	MIR1281_ENST00000408233.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	21	Interaction with ALX1.|Interaction with RORA.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ACTCTCATCTCCGGCCCTCTC	0.547			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.P21A		.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300-2011	0			c.C61G						.						56.0	66.0	63.0					22																	41489069		2203	4300	6503	SO:0001583	missense	2033	exon1	Familial Cancer Database	Broad Thumb-Hallux syndrome	TCATCTCCGGCCC	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.61C>G	22.37:g.41489069C>G	ENSP00000263253:p.Pro21Ala	Somatic	179	2		WXS	Illumina HiSeq	Phase_I	159	41	NM_001429	0	0	5	7	2	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929891	0.92389	.	.	ENSG00000100393	ENST00000263253	D	0.94537	-3.45	4.7	4.7	0.59300	.	0.000000	0.39020	N	0.001484	D	0.95974	0.8689	L	0.51914	1.62	0.49389	D	0.999785	D	0.76494	0.999	D	0.80764	0.994	D	0.95834	0.8860	10	0.51188	T	0.08	.	15.9919	0.80211	0.0:1.0:0.0:0.0	.	21	Q09472	EP300_HUMAN	A	21	ENSP00000263253:P21A	ENSP00000263253:P21A	P	+	1	0	EP300	39819015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.738000	0.74822	2.449000	0.82847	0.591000	0.81541	CCG	.		0.547	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
EXOSC7	23016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	45038724	45038724	+	Missense_Mutation	SNP	G	G	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr3:45038724G>C	ENST00000265564.7	+	4	448	c.400G>C	c.(400-402)Gtt>Ctt	p.V134L	EXOSC7_ENST00000461361.1_3'UTR	NM_015004.3	NP_055819.2	Q15024	EXOS7_HUMAN	exosome component 7	134					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(193;0.00911)|KIRC - Kidney renal clear cell carcinoma(197;0.0509)|Kidney(197;0.064)		GCACTGCTGGGTTCTCTATGT	0.468																																					p.V134L		.											.	EXOSC7-90	0			c.G400C						.						128.0	118.0	121.0					3																	45038724		2203	4300	6503	SO:0001583	missense	23016	exon4			TGCTGGGTTCTCT	BC012831	CCDS2725.1	3p21.32	2010-05-07			ENSG00000075914	ENSG00000075914	3.1.13.-		28112	protein-coding gene	gene with protein product		606488				11719186, 11812149	Standard	NR_023353		Approved	hRrp42p, Rrp42p, RRP42, EAP1, KIAA0116, p8	uc003coi.2	Q15024	OTTHUMG00000133095	ENST00000265564.7:c.400G>C	3.37:g.45038724G>C	ENSP00000265564:p.Val134Leu	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	101	44	NM_015004	0	0	26	52	26	Q96E72	Missense_Mutation	SNP	ENST00000265564.7	37	CCDS2725.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.573110	0.45902	.	.	ENSG00000075914	ENST00000265564	T	0.62232	0.04	5.71	-7.06	0.01568	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.510215	0.21639	N	0.071362	T	0.55940	0.1952	M	0.67625	2.065	0.49130	D	0.999757	B;B	0.09022	0.002;0.002	B;B	0.16289	0.015;0.015	T	0.26643	-1.0097	10	0.30078	T	0.28	-1.5027	19.6631	0.95882	0.2416:0.0:0.7584:0.0	.	134;134	B2RDZ9;Q15024	.;EXOS7_HUMAN	L	134	ENSP00000265564:V134L	ENSP00000265564:V134L	V	+	1	0	EXOSC7	45013728	0.981000	0.34729	0.040000	0.18447	0.953000	0.61014	0.073000	0.14640	-1.400000	0.02061	-0.224000	0.12420	GTT	.		0.468	EXOSC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256754.2	NM_015004	
ROBO1	6091	broad.mit.edu;ucsc.edu	37	3	78735047	78735047	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr3:78735047T>A	ENST00000464233.1	-	10	1304	c.1191A>T	c.(1189-1191)caA>caT	p.Q397H	ROBO1_ENST00000436010.2_Missense_Mutation_p.Q358H|ROBO1_ENST00000467549.1_Missense_Mutation_p.Q361H|ROBO1_ENST00000495273.1_Missense_Mutation_p.Q361H	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	397	Ig-like C2-type 4.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ACTGTGGTGGTTGATATGAGA	0.393																																					p.Q397H													.	ROBO1-67	0			c.A1191T						.						46.0	47.0	47.0					3																	78735047		1907	4095	6002	SO:0001583	missense	6091	exon10			TGGTGGTTGATAT	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.1191A>T	3.37:g.78735047T>A	ENSP00000420321:p.Gln397His	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	25	4	NM_002941	0	0	9	15	6	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	T	12.61	1.990616	0.35131	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.75154	-0.91;-0.91;1.62;1.62	5.42	0.145	0.14829	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.111195	0.64402	D	0.000005	T	0.68586	0.3017	N	0.21545	0.675	0.49051	D	0.999749	P;P;B;P;P	0.48998	0.814;0.918;0.012;0.469;0.778	P;P;B;B;P	0.59643	0.861;0.539;0.053;0.405;0.834	T	0.61855	-0.6977	9	.	.	.	.	7.4025	0.26973	0.0:0.42:0.1116:0.4684	.	361;397;361;361;358	Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	H	358;361;397;361;361;397	ENSP00000406043:Q358H;ENSP00000420321:Q397H;ENSP00000420637:Q361H;ENSP00000417992:Q361H	.	Q	-	3	2	ROBO1	78817737	0.047000	0.20315	0.998000	0.56505	0.644000	0.38419	-0.561000	0.05957	0.068000	0.16574	-0.468000	0.05107	CAA	.		0.393	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
OR5H1	26341	broad.mit.edu	37	3	97852336	97852336	+	Silent	SNP	G	G	A	rs138973744		TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr3:97852336G>A	ENST00000354565.2	+	1	795	c.795G>A	c.(793-795)ccG>ccA	p.P265P	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						CTGCATCTCCGCAAGCAGATG	0.438																																					p.P265P													.	OR5H1-136	0			c.G795A						.	G		0,4404		0,0,2202	107.0	115.0	112.0		795	-7.1	0.0	3	dbSNP_134	112	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	OR5H1	NM_001005338.1		0,1,6500	AA,AG,GG		0.0116,0.0,0.0077		265/314	97852336	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	26341	exon1			ATCTCCGCAAGCA	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.795G>A	3.37:g.97852336G>A		Somatic	168	0		WXS	Illumina HiSeq	Phase_I	207	5	NM_001005338	0	0	0	0	0		Silent	SNP	ENST00000354565.2	37	CCDS33797.1																																																																																			G|1.000;A|0.000		0.438	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
BOC	91653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	112991328	112991328	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr3:112991328A>C	ENST00000495514.1	+	7	1443	c.739A>C	c.(739-741)Agt>Cgt	p.S247R	BOC_ENST00000355385.3_Missense_Mutation_p.S247R|BOC_ENST00000273395.4_Missense_Mutation_p.S247R			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	247	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CAAAGGCCAGAGTCTCATTCT	0.617																																					p.S247R		.											.	BOC-157	0			c.A739C						.						164.0	157.0	159.0					3																	112991328		2203	4300	6503	SO:0001583	missense	91653	exon7			GGCCAGAGTCTCA	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.739A>C	3.37:g.112991328A>C	ENSP00000418663:p.Ser247Arg	Somatic	261	0		WXS	Illumina HiSeq	Phase_I	318	73	NM_033254	0	0	2	3	1	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	A	16.39	3.110475	0.56398	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.69685	-0.42;-0.42;-0.42	5.93	5.93	0.95920	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.043438	0.85682	D	0.000000	T	0.60932	0.2307	L	0.41573	1.285	0.50313	D	0.999862	B;B	0.16603	0.014;0.018	B;B	0.21360	0.033;0.034	T	0.56275	-0.8006	10	0.44086	T	0.13	.	16.3797	0.83452	1.0:0.0:0.0:0.0	.	247;247	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	R	247	ENSP00000418663:S247R;ENSP00000273395:S247R;ENSP00000347546:S247R	ENSP00000273395:S247R	S	+	1	0	BOC	114474018	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.474000	0.73578	2.271000	0.75665	0.533000	0.62120	AGT	.		0.617	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
RPN1	6184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	128348859	128348859	+	Missense_Mutation	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr3:128348859C>T	ENST00000296255.3	-	5	1019	c.971G>A	c.(970-972)gGc>gAc	p.G324D	RPN1_ENST00000497289.1_Missense_Mutation_p.G152D|RPN1_ENST00000490166.1_5'Flank	NM_002950.3	NP_002941.1	P04843	RPN1_HUMAN	ribophorin I	324					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|stomach(2)	13				GBM - Glioblastoma multiforme(114;0.189)		CTTCCACCCGCCAAAGAGAGG	0.458			T	EVI1	AML																																p.G324D		.		Dom	yes		3	3q21.3-q25.2	6184	ribophorin I		L	.	RPN1-652	0			c.G971A						.						76.0	74.0	74.0					3																	128348859		2203	4300	6503	SO:0001583	missense	6184	exon5			CACCCGCCAAAGA		CCDS3051.1	3q21.3	2013-03-06			ENSG00000163902	ENSG00000163902			10381	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 1 homolog (S. cerevisiae)"", ""oligosaccharyltransferase complex subunit (non-catalytic)"""	180470					Standard	NM_002950		Approved	OST1	uc003ekr.1	P04843	OTTHUMG00000159691	ENST00000296255.3:c.971G>A	3.37:g.128348859C>T	ENSP00000296255:p.Gly324Asp	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	87	41	NM_002950	0	0	282	802	520	B2R5Z0|D3DNB6|Q68DT1	Missense_Mutation	SNP	ENST00000296255.3	37	CCDS3051.1	.	.	.	.	.	.	.	.	.	.	C	32	5.165154	0.94768	.	.	ENSG00000163902	ENST00000296255;ENST00000497289;ENST00000537139;ENST00000545956	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.87051	0.6081	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90352	0.4367	9	0.87932	D	0	-19.9225	19.0082	0.92861	0.0:1.0:0.0:0.0	.	324	P04843	RPN1_HUMAN	D	324;152;95;298	.	ENSP00000296255:G324D	G	-	2	0	RPN1	129831549	1.000000	0.71417	0.920000	0.36463	0.991000	0.79684	7.380000	0.79704	2.487000	0.83934	0.591000	0.81541	GGC	.		0.458	RPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356934.2	NM_002950	
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	142268491	142268491	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr3:142268491C>A	ENST00000350721.4	-	15	3122	c.3001G>T	c.(3001-3003)Gat>Tat	p.D1001Y	ATR_ENST00000383101.3_Missense_Mutation_p.D937Y	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1001					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						GCAGCAAGATCAGGTAGTAGA	0.348								Other conserved DNA damage response genes																													p.D1001Y		.											.	ATR-1139	0			c.G3001T						.						50.0	51.0	51.0					3																	142268491		2203	4299	6502	SO:0001583	missense	545	exon15			CAAGATCAGGTAG	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.3001G>T	3.37:g.142268491C>A	ENSP00000343741:p.Asp1001Tyr	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	82	37	NM_001184	0	0	3	11	8	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	4.829	0.154136	0.09236	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.63417	-0.04;-0.04	5.59	5.59	0.84812	Armadillo-like helical (1);Armadillo-type fold (1);	0.062472	0.64402	D	0.000004	T	0.34919	0.0914	N	0.02539	-0.55	0.43453	D	0.995646	B	0.06786	0.001	B	0.08055	0.003	T	0.41466	-0.9507	10	0.02654	T	1	-18.3072	17.7702	0.88489	0.0:1.0:0.0:0.0	.	1001	Q13535	ATR_HUMAN	Y	1001;937	ENSP00000343741:D1001Y;ENSP00000372581:D937Y	ENSP00000343741:D1001Y	D	-	1	0	ATR	143751181	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.835000	0.69368	2.635000	0.89317	0.655000	0.94253	GAT	.		0.348	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
FBXL5	26234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	15640266	15640266	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr4:15640266T>C	ENST00000341285.3	-	4	572	c.448A>G	c.(448-450)Att>Gtt	p.I150V	FBXL5_ENST00000412094.2_Missense_Mutation_p.I133V|FBXL5_ENST00000382358.4_Missense_Mutation_p.I24V	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	150	Hemerythrin-like.				iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						TTCTTTTTAATATCCTTAAGC	0.368																																					p.I150V		.											.	FBXL5-226	0			c.A448G						.						76.0	67.0	70.0					4																	15640266		2201	4299	6500	SO:0001583	missense	26234	exon4			TTTTAATATCCTT	AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.448A>G	4.37:g.15640266T>C	ENSP00000344866:p.Ile150Val	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	65	21	NM_001193534	0	0	78	159	81	A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Missense_Mutation	SNP	ENST00000341285.3	37	CCDS3415.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	31|31	5.081114|5.081114	0.94050|0.94050	.|.	.|.	ENSG00000118564|ENSG00000118564	ENST00000341285;ENST00000412094;ENST00000382358;ENST00000512066;ENST00000503196;ENST00000509314|ENST00000513163	T;T;T|.	0.38722|.	1.18;1.17;1.12|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59169|0.59169	0.2174|0.2174	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	P;P|.	0.51791|.	0.948;0.913|.	D;P|.	0.67103|.	0.949;0.891|.	T|T	0.55431|0.55431	-0.8142|-0.8142	10|5	0.72032|.	D|.	0.01|.	-22.925|-22.925	16.1306|16.1306	0.81436|0.81436	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	133;150|.	Q9UKA1-2;Q9UKA1|.	.;FBXL5_HUMAN|.	V|C	150;133;24;112;95;95|70	ENSP00000344866:I150V;ENSP00000408679:I133V;ENSP00000371795:I24V|.	ENSP00000344866:I150V|.	I|Y	-|-	1|2	0|0	FBXL5|FBXL5	15249364|15249364	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	8.034000|8.034000	0.88864|0.88864	2.209000|2.209000	0.71365|0.71365	0.528000|0.528000	0.53228|0.53228	ATT|TAT	.		0.368	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214235.2		
GC	2638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	72620174	72620174	+	Silent	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr4:72620174G>A	ENST00000273951.8	-	10	1559	c.1216C>T	c.(1216-1218)Cta>Tta	p.L406L	GC_ENST00000513476.1_Silent_p.L406L|GC_ENST00000503472.1_5'UTR|GC_ENST00000504199.1_Silent_p.L425L	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	406	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	TCTGCACATAGTTCTTGTCCC	0.308																																					p.L425L		.											.	GC-93	0			c.C1273T						.						77.0	76.0	76.0					4																	72620174		2203	4300	6503	SO:0001819	synonymous_variant	2638	exon11			CACATAGTTCTTG	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.1216C>T	4.37:g.72620174G>A		Somatic	45	0		WXS	Illumina HiSeq	Phase_I	54	16	NM_001204307	0	0	0	0	0	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Silent	SNP	ENST00000273951.8	37	CCDS3550.1																																																																																			.		0.308	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2		
USO1	8615	broad.mit.edu;ucsc.edu	37	4	76703850	76703850	+	Missense_Mutation	SNP	T	T	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr4:76703850T>A	ENST00000538159.1	+	9	700	c.700T>A	c.(700-702)Tgt>Agt	p.C234S	USO1_ENST00000514213.2_Missense_Mutation_p.C217S			O60763	USO1_HUMAN	USO1 vesicle transport factor	232	Globular head.				ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AGTTGAAGATTGTTTGATTTT	0.308																																					.													.	USO1-25	0			.						.						29.0	27.0	27.0					4																	76703850		1801	4055	5856	SO:0001583	missense	8615	.			GAAGATTGTTTGA	AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.700T>A	4.37:g.76703850T>A	ENSP00000440586:p.Cys234Ser	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	8	5	.	0	0	36	50	14	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Missense_Mutation	SNP	ENST00000538159.1	37		.	.	.	.	.	.	.	.	.	.	T	22.9	4.354011	0.82243	.	.	ENSG00000138768	ENST00000508939;ENST00000538159;ENST00000514213;ENST00000264904	T;T	0.46819	0.86;0.86	5.82	5.82	0.92795	Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	T	0.68577	0.3016	M	0.80746	2.51	0.80722	D	1	D;D	0.65815	0.985;0.995	P;P	0.62089	0.891;0.898	T	0.72364	-0.4316	10	0.56958	D	0.05	.	16.1917	0.81992	0.0:0.0:0.0:1.0	.	234;232	F5GYR8;O60763	.;USO1_HUMAN	S	67;234;217;160	ENSP00000440586:C234S;ENSP00000444850:C217S	ENSP00000264904:C160S	C	+	1	0	USO1	76922874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.481000	0.81124	2.216000	0.71823	0.533000	0.62120	TGT	.		0.308	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003715	
TERT	7015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1282605	1282605	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr5:1282605T>G	ENST00000310581.5	-	3	1765	c.1708A>C	c.(1708-1710)Aag>Cag	p.K570Q	TERT_ENST00000334602.6_Missense_Mutation_p.K570Q|TERT_ENST00000296820.5_Missense_Mutation_p.K570Q|TERT_ENST00000508104.2_Missense_Mutation_p.K570Q	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	570			K -> N (in AA susceptibility; abolishes telomerase catalytic activity but no effect on binding to TERC). {ECO:0000269|PubMed:16990594, ECO:0000269|PubMed:19760749}.		DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	AGCCTGTTCTTTTGAAACGTG	0.517									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																												p.K570Q		.											.	TERT-1272	0			c.A1708C						.						119.0	114.0	116.0					5																	1282605		2203	4300	6503	SO:0001583	missense	7015	exon3	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	TGTTCTTTTGAAA	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.1708A>C	5.37:g.1282605T>G	ENSP00000309572:p.Lys570Gln	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	51	13	NM_001193376	0	0	0	0	0	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	ENST00000310581.5	37	CCDS3861.2	.	.	.	.	.	.	.	.	.	.	T	15.08	2.727919	0.48833	.	.	ENSG00000164362	ENST00000310581;ENST00000296820;ENST00000334602;ENST00000508104	D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13	4.64	3.42	0.39159	Telomerase ribonucleoprotein complex - RNA-binding domain (2);	0.049349	0.85682	D	0.000000	D	0.93969	0.8069	M	0.92026	3.265	0.49213	D	0.999767	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.97110	0.952;1.0;0.972	D	0.93578	0.6910	10	0.72032	D	0.01	-0.3505	11.0502	0.47882	0.0:0.0:0.1562:0.8438	.	570;570;570	O14746-3;O14746;Q8NG38	.;TERT_HUMAN;.	Q	570	ENSP00000309572:K570Q;ENSP00000296820:K570Q;ENSP00000334346:K570Q;ENSP00000426042:K570Q	ENSP00000296820:K570Q	K	-	1	0	TERT	1335605	1.000000	0.71417	0.999000	0.59377	0.854000	0.48673	2.991000	0.49409	0.585000	0.29608	0.379000	0.24179	AAG	.		0.517	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2		
CDH6	1004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	31323226	31323226	+	Silent	SNP	T	T	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr5:31323226T>G	ENST00000265071.2	+	12	2449	c.2184T>G	c.(2182-2184)acT>acG	p.T728T		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	728					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CGGACCCCACTGCCCCGCCAT	0.557																																					p.T728T		.											.	CDH6-159	0			c.T2184G						.						42.0	43.0	42.0					5																	31323226		2203	4300	6503	SO:0001819	synonymous_variant	1004	exon12			CCCCACTGCCCCG	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2184T>G	5.37:g.31323226T>G		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	34	5	NM_004932	0	1	186	233	46	A8K5H5|Q9BWS0	Silent	SNP	ENST00000265071.2	37	CCDS3894.1																																																																																			.		0.557	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	
JMY	133746	hgsc.bcm.edu	37	5	78610479	78610479	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr5:78610479C>A	ENST00000396137.4	+	9	2926	c.2464C>A	c.(2464-2466)Cca>Aca	p.P822T	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	822	Pro-rich.				'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		ccctcccccaccaccaccacc	0.542																																					p.P822T		.											.	JMY-227	0			c.C2464A						.																																			SO:0001583	missense	133746	exon9			CCCCCACCACCAC	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2464C>A	5.37:g.78610479C>A	ENSP00000379441:p.Pro822Thr	Somatic	26	1		WXS	Illumina HiSeq	Phase_I	18	3	NM_152405	0	0	1	1	0	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	37	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639613	0.29157	.	.	ENSG00000152409	ENST00000396137	D	0.89681	-2.55	4.69	3.8	0.43715	.	0.692508	0.13482	N	0.384606	D	0.93400	0.7895	M	0.70275	2.135	0.45837	D	0.998707	D	0.89917	1.0	D	0.91635	0.999	D	0.90329	0.4350	10	0.29301	T	0.29	.	14.3113	0.66416	0.0:0.8498:0.1502:0.0	.	822	Q8N9B5	JMY_HUMAN	T	822	ENSP00000379441:P822T	ENSP00000379441:P822T	P	+	1	0	JMY	78646235	1.000000	0.71417	0.009000	0.14445	0.106000	0.19336	4.961000	0.63681	0.930000	0.37217	0.650000	0.86243	CCA	.		0.542	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405	
TRIM36	55521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	114515696	114515696	+	Silent	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr5:114515696G>A	ENST00000282369.3	-	1	160	c.39C>T	c.(37-39)atC>atT	p.I13I	TRIM36_ENST00000379618.2_Silent_p.I13I|TRIM36_ENST00000514154.1_5'UTR|TRIM36_ENST00000379617.2_Silent_p.I13I	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	13					acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TCAATTCCATGATGTAGCCAA	0.577																																					p.I13I		.											.	TRIM36-725	0			c.C39T						.						116.0	117.0	117.0					5																	114515696		2202	4300	6502	SO:0001819	synonymous_variant	55521	exon1			TTCCATGATGTAG	AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.39C>T	5.37:g.114515696G>A		Somatic	162	0		WXS	Illumina HiSeq	Phase_I	137	47	NM_001017397	0	0	0	0	0	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Silent	SNP	ENST00000282369.3	37	CCDS4115.1																																																																																			.		0.577	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700	
PCDHGA1	56114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140712438	140712438	+	Silent	SNP	A	A	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr5:140712438A>G	ENST00000517417.1	+	1	2187	c.2187A>G	c.(2185-2187)ggA>ggG	p.G729G	PCDHGA1_ENST00000378105.3_Silent_p.G729G	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	729					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCTTCGGGAGGCGGCTTAG	0.662																																					p.G729G		.											.	PCDHGA1-137	0			c.A2187G						.						64.0	69.0	68.0					5																	140712438		2203	4300	6503	SO:0001819	synonymous_variant	56114	exon1			TTCGGGAGGCGGC	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2187A>G	5.37:g.140712438A>G		Somatic	91	0		WXS	Illumina HiSeq	Phase_I	98	37	NM_018912	0	0	3	3	0	Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	37	CCDS54922.1																																																																																			.		0.662	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
LARS	51520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	145506033	145506033	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr5:145506033T>C	ENST00000394434.2	-	28	3122	c.2956A>G	c.(2956-2958)Atg>Gtg	p.M986V	LARS_ENST00000545646.1_Missense_Mutation_p.M940V|LARS_ENST00000510191.1_Missense_Mutation_p.M932V|LARS_ENST00000274562.9_Missense_Mutation_p.M959V	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	986					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	ACTTTCTTCATGTATTTCTTC	0.428																																					p.M986V		.											.	LARS-90	0			c.A2956G						.						202.0	156.0	171.0					5																	145506033		2202	4300	6502	SO:0001583	missense	51520	exon28			TCTTCATGTATTT	AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.2956A>G	5.37:g.145506033T>C	ENSP00000377954:p.Met986Val	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	86	24	NM_020117	0	0	24	58	34	A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	Missense_Mutation	SNP	ENST00000394434.2	37	CCDS34265.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.399675	0.42512	.	.	ENSG00000133706	ENST00000394434;ENST00000545646;ENST00000540713;ENST00000510191;ENST00000274562	T;T;T;T	0.63913	-0.06;-0.06;-0.06;-0.07	5.17	5.17	0.71159	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.037152	0.85682	D	0.000000	T	0.66157	0.2761	M	0.86864	2.845	0.80722	D	1	B;P;B	0.38335	0.007;0.627;0.001	B;B;B	0.36030	0.007;0.216;0.007	T	0.68401	-0.5418	10	0.25751	T	0.34	.	15.1805	0.72952	0.0:0.0:0.0:1.0	.	959;940;986	B4DER1;F5H698;Q9P2J5	.;.;SYLC_HUMAN	V	986;940;295;932;959	ENSP00000377954:M986V;ENSP00000437791:M940V;ENSP00000426005:M932V;ENSP00000274562:M959V	ENSP00000274562:M959V	M	-	1	0	LARS	145486226	1.000000	0.71417	0.937000	0.37676	0.899000	0.52679	5.892000	0.69790	2.178000	0.69098	0.455000	0.32223	ATG	.		0.428	LARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000373367.1	NM_020117	
PDGFRB	5159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	149511592	149511592	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr5:149511592G>T	ENST00000261799.4	-	8	1662	c.1193C>A	c.(1192-1194)gCc>gAc	p.A398D		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	398	Ig-like C2-type 4.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCATGGAAGGCCCGCATGGT	0.607			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																p.A398D		.		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	PDGFRB-1499	0			c.C1193A						.						129.0	106.0	114.0					5																	149511592		2203	4300	6503	SO:0001583	missense	5159	exon8			TGGAAGGCCCGCA	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.1193C>A	5.37:g.149511592G>T	ENSP00000261799:p.Ala398Asp	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	53	11	NM_002609	0	0	10	10	0	B5A957|Q8N5L4	Missense_Mutation	SNP	ENST00000261799.4	37	CCDS4303.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318803	0.81469	.	.	ENSG00000113721	ENST00000261799;ENST00000544453	T	0.76968	-1.06	5.52	4.65	0.58169	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000079	D	0.86908	0.6046	M	0.79805	2.47	0.41506	D	0.988315	D;D	0.89917	0.992;1.0	D;D	0.77004	0.959;0.989	D	0.88006	0.2759	10	0.87932	D	0	.	10.3808	0.44110	0.1488:0.0:0.8512:0.0	.	398;398	A8KAM8;P09619	.;PGFRB_HUMAN	D	398;68	ENSP00000261799:A398D	ENSP00000261799:A398D	A	-	2	0	PDGFRB	149491785	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	4.122000	0.57910	1.325000	0.45301	0.655000	0.94253	GCC	.		0.607	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	
PRPF4B	8899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	4032504	4032504	+	Missense_Mutation	SNP	A	A	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr6:4032504A>C	ENST00000337659.6	+	2	853	c.753A>C	c.(751-753)aaA>aaC	p.K251N	PRPF4B_ENST00000538861.1_Missense_Mutation_p.K237N	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	251	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				CTCAAGAGAAAATTGGTAAGG	0.343																																					p.K251N		.											.	PRPF4B-1308	0			c.A753C						.						123.0	134.0	131.0					6																	4032504		2203	4300	6503	SO:0001583	missense	8899	exon2			AGAGAAAATTGGT	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.753A>C	6.37:g.4032504A>C	ENSP00000337194:p.Lys251Asn	Somatic	216	0		WXS	Illumina HiSeq	Phase_I	188	79	NM_003913	0	0	17	28	11	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	ENST00000337659.6	37	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.997406	0.54147	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.67865	-0.29;-0.29	5.61	-1.1	0.09872	.	0.000000	0.85682	D	0.000000	T	0.28699	0.0711	L	0.36672	1.1	0.32528	N	0.535323	P	0.43477	0.808	B	0.33960	0.173	T	0.13255	-1.0516	10	0.32370	T	0.25	.	10.743	0.46164	0.6402:0.0:0.3598:0.0	.	251	Q13523	PRP4B_HUMAN	N	251;237	ENSP00000337194:K251N;ENSP00000439331:K237N	ENSP00000337194:K251N	K	+	3	2	PRPF4B	3977503	0.997000	0.39634	0.223000	0.23860	0.955000	0.61496	1.838000	0.39211	-0.329000	0.08527	0.533000	0.62120	AAA	.		0.343	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		
MUC21	394263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30954340	30954340	+	Missense_Mutation	SNP	A	A	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr6:30954340A>T	ENST00000376296.3	+	2	629	c.388A>T	c.(388-390)Agt>Tgt	p.S130C	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	130	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CACACCCTCCAGTGGGGCCAG	0.607																																					p.S130C		.											.	MUC21-92	0			c.A388T						.						164.0	155.0	158.0					6																	30954340		2203	4300	6503	SO:0001583	missense	394263	exon2			CCCTCCAGTGGGG	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.388A>T	6.37:g.30954340A>T	ENSP00000365473:p.Ser130Cys	Somatic	255	0		WXS	Illumina HiSeq	Phase_I	249	57	NM_001010909	0	0	0	0	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	A	9.389	1.074974	0.20227	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.03301	3.98	3.34	-1.87	0.07737	.	.	.	.	.	T	0.01092	0.0036	N	0.24115	0.695	0.09310	N	1	D	0.53619	0.961	P	0.47162	0.54	T	0.47433	-0.9118	8	.	.	.	.	4.8046	0.13314	0.3103:0.0:0.5043:0.1854	.	130	Q5SSG8	MUC21_HUMAN	C	130	ENSP00000365473:S130C	.	S	+	1	0	MUC21	31062319	0.007000	0.16637	0.000000	0.03702	0.014000	0.08584	1.200000	0.32247	-0.218000	0.10018	-0.425000	0.05940	AGT	.		0.607	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	51889440	51889440	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr6:51889440C>G	ENST00000371117.3	-	32	5443	c.5168G>C	c.(5167-5169)aGa>aCa	p.R1723T	PKHD1_ENST00000340994.4_Missense_Mutation_p.R1723T	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1723	IPT/TIG 12; atypical.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGCCCACCCTCTGATGCAGTC	0.532																																					p.R1723T		.											.	PKHD1-603	0			c.G5168C						.						87.0	86.0	86.0					6																	51889440		2203	4300	6503	SO:0001583	missense	5314	exon32			CACCCTCTGATGC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5168G>C	6.37:g.51889440C>G	ENSP00000360158:p.Arg1723Thr	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	97	28	NM_170724	0	0	5	12	7	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.071085	0.55646	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87256	-2.05;-2.23	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.91543	0.7329	M	0.66939	2.045	0.35080	D	0.763272	D;D	0.76494	0.99;0.999	D;D	0.77557	0.96;0.99	D	0.91115	0.4925	10	0.45353	T	0.12	.	18.6881	0.91573	0.0:1.0:0.0:0.0	.	1723;1723	P08F94-2;P08F94	.;PKHD1_HUMAN	T	1723	ENSP00000360158:R1723T;ENSP00000341097:R1723T	ENSP00000341097:R1723T	R	-	2	0	PKHD1	51997399	1.000000	0.71417	0.878000	0.34440	0.146000	0.21551	5.086000	0.64474	2.659000	0.90383	0.650000	0.86243	AGA	.		0.532	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
LIMK1	3984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73530183	73530183	+	Missense_Mutation	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr7:73530183G>A	ENST00000336180.2	+	13	1513	c.1462G>A	c.(1462-1464)Gag>Aag	p.E488K	LIMK1_ENST00000538333.3_Missense_Mutation_p.E454K|LIMK1_ENST00000418310.1_Missense_Mutation_p.E518K	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	488	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	CATGGTGGACGAGAAGACTCA	0.607																																					p.E488K		.											.	LIMK1-523	0			c.G1462A						.						101.0	83.0	89.0					7																	73530183		2203	4300	6503	SO:0001583	missense	3984	exon13			GTGGACGAGAAGA	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1462G>A	7.37:g.73530183G>A	ENSP00000336740:p.Glu488Lys	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	76	22	NM_002314	0	0	40	50	10	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	ENST00000336180.2	37	CCDS5563.1	.	.	.	.	.	.	.	.	.	.	g	14.48	2.547545	0.45383	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000538333	T;T;T	0.62232	0.04;0.04;0.04	5.25	3.45	0.39498	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.210321	0.48767	D	0.000162	T	0.43942	0.1270	N	0.17345	0.48	0.50813	D	0.999895	P;P	0.48834	0.543;0.916	B;B	0.42386	0.364;0.386	T	0.28427	-1.0044	10	0.39692	T	0.17	-19.111	8.804	0.34927	0.0834:0.1523:0.7643:0.0	.	454;488	B7Z6I8;P53667	.;LIMK1_HUMAN	K	518;488;488;454	ENSP00000409717:E518K;ENSP00000336740:E488K;ENSP00000444452:E454K	ENSP00000336740:E488K	E	+	1	0	LIMK1	73168119	1.000000	0.71417	0.039000	0.18376	0.059000	0.15707	7.647000	0.83462	0.627000	0.30340	-0.240000	0.12126	GAG	.		0.607	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
STYXL1	51657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	75633079	75633079	+	Missense_Mutation	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr7:75633079T>C	ENST00000248600.1	-	7	1036	c.694A>G	c.(694-696)Att>Gtt	p.I232V	STYXL1_ENST00000431581.1_Missense_Mutation_p.I232V|STYXL1_ENST00000340062.5_Missense_Mutation_p.I136V|STYXL1_ENST00000360591.3_3'UTR|STYXL1_ENST00000451157.1_Missense_Mutation_p.I232V|STYXL1_ENST00000359697.3_Missense_Mutation_p.I232V	NM_016086.2	NP_057170.1	Q9Y6J8	STYL1_HUMAN	serine/threonine/tyrosine interacting-like 1	232	Tyrosine-protein phosphatase.				intracellular signal transduction (GO:0035556)|protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	10						TCCTTACCAATGAAGTGACAC	0.537																																					p.I232V		.											.	STYXL1-278	0			c.A694G						.						113.0	87.0	96.0					7																	75633079		2203	4300	6503	SO:0001583	missense	51657	exon7			TACCAATGAAGTG	AF069762	CCDS5580.1	7q11.23	2011-06-09	2005-09-22	2005-09-22	ENSG00000127952	ENSG00000127952		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	18165	protein-coding gene	gene with protein product			"""dual specificity phosphatase 24 (putative)"""	DUSP24		9757831	Standard	NM_016086		Approved	MK-STYX	uc003uel.3	Q9Y6J8	OTTHUMG00000130459	ENST00000248600.1:c.694A>G	7.37:g.75633079T>C	ENSP00000248600:p.Ile232Val	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	80	47	NM_016086	0	0	0	0	0	Q9UBP1|Q9UK06|Q9UK07|Q9UKG2|Q9UKG3	Missense_Mutation	SNP	ENST00000248600.1	37	CCDS5580.1	.	.	.	.	.	.	.	.	.	.	T	10.43	1.347287	0.24426	.	.	ENSG00000127952	ENST00000248600;ENST00000359697;ENST00000340062;ENST00000404050;ENST00000431581;ENST00000454618;ENST00000451157	D;D;D;D;T;D	0.88124	-2.34;-2.34;-2.34;-2.34;0.0;-2.34	3.74	-3.86	0.04230	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.287194	0.36374	N	0.002630	T	0.79435	0.4445	L	0.52823	1.66	0.80722	D	1	B;B;B;B;B;B	0.33748	0.423;0.172;0.096;0.01;0.087;0.086	B;B;B;B;B;B	0.32805	0.153;0.133;0.081;0.007;0.12;0.124	T	0.66212	-0.5980	10	0.62326	D	0.03	.	8.0828	0.30754	0.0:0.0993:0.6291:0.2716	.	232;232;232;136;232;136	Q9Y6J8-3;C9J4H0;Q9Y6J8-2;Q9Y6J8-4;Q9Y6J8;Q7Z3H6	.;.;.;.;STYL1_HUMAN;.	V	232;232;136;232;232;187;232	ENSP00000248600:I232V;ENSP00000352726:I232V;ENSP00000343383:I136V;ENSP00000392221:I232V;ENSP00000406073:I187V;ENSP00000411812:I232V	ENSP00000248600:I232V	I	-	1	0	STYXL1	75471015	0.998000	0.40836	0.219000	0.23793	0.709000	0.40893	0.666000	0.25097	-0.708000	0.05015	0.460000	0.39030	ATT	.		0.537	STYXL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344825.1	NM_016086	
STYXL1	51657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	75643205	75643205	+	Splice_Site	SNP	T	T	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr7:75643205T>C	ENST00000248600.1	-	5	650	c.308A>G	c.(307-309)gAt>gGt	p.D103G	STYXL1_ENST00000431581.1_Splice_Site_p.D103G|STYXL1_ENST00000340062.5_Intron|STYXL1_ENST00000360591.3_Intron|STYXL1_ENST00000460184.2_5'UTR|STYXL1_ENST00000451157.1_Splice_Site_p.D103G|STYXL1_ENST00000359697.3_Splice_Site_p.D103G	NM_016086.2	NP_057170.1	Q9Y6J8	STYL1_HUMAN	serine/threonine/tyrosine interacting-like 1	103	Rhodanese.				intracellular signal transduction (GO:0035556)|protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	10						AGGCACAAGATCTGAGAGTGG	0.498																																					p.D103G		.											.	STYXL1-278	0			c.A308G						.						125.0	109.0	114.0					7																	75643205		2203	4300	6503	SO:0001630	splice_region_variant	51657	exon5			ACAAGATCTGAGA	AF069762	CCDS5580.1	7q11.23	2011-06-09	2005-09-22	2005-09-22	ENSG00000127952	ENSG00000127952		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	18165	protein-coding gene	gene with protein product			"""dual specificity phosphatase 24 (putative)"""	DUSP24		9757831	Standard	NM_016086		Approved	MK-STYX	uc003uel.3	Q9Y6J8	OTTHUMG00000130459	ENST00000248600.1:c.308-1A>G	7.37:g.75643205T>C		Somatic	165	0		WXS	Illumina HiSeq	Phase_I	189	89	NM_016086	0	0	0	0	0	Q9UBP1|Q9UK06|Q9UK07|Q9UKG2|Q9UKG3	Missense_Mutation	SNP	ENST00000248600.1	37	CCDS5580.1	.	.	.	.	.	.	.	.	.	.	T	9.558	1.117639	0.20877	.	.	ENSG00000127952	ENST00000248600;ENST00000359697;ENST00000404050;ENST00000431581;ENST00000454618;ENST00000451157	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.26	-5.09	0.02920	Rhodanese-like (4);	2.770220	0.00966	N	0.003162	T	0.14787	0.0357	N	0.16478	0.41	0.26750	N	0.970228	B;B;B	0.10296	0.003;0.001;0.002	B;B;B	0.11329	0.006;0.001;0.003	T	0.18209	-1.0344	10	0.22706	T	0.39	.	7.9066	0.29765	0.1461:0.5762:0.0:0.2777	.	103;103;103	C9J4H0;Q9Y6J8-2;Q9Y6J8	.;.;STYL1_HUMAN	G	103;103;103;103;58;103	ENSP00000248600:D103G;ENSP00000352726:D103G;ENSP00000392221:D103G;ENSP00000411812:D103G	ENSP00000248600:D103G	D	-	2	0	STYXL1	75481141	0.053000	0.20554	0.002000	0.10522	0.015000	0.08874	-0.109000	0.10840	-0.873000	0.04032	0.454000	0.30748	GAT	.		0.498	STYXL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344825.1	NM_016086	Missense_Mutation
NRCAM	4897	hgsc.bcm.edu;broad.mit.edu	37	7	107836289	107836289	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr7:107836289G>T	ENST00000425651.2	-	12	1378	c.1379C>A	c.(1378-1380)gCa>gAa	p.A460E	NRCAM_ENST00000379028.3_Missense_Mutation_p.A460E|NRCAM_ENST00000379024.4_Missense_Mutation_p.A441E|NRCAM_ENST00000413765.2_Missense_Mutation_p.A441E|NRCAM_ENST00000351718.4_Missense_Mutation_p.A454E|NRCAM_ENST00000379022.4_Missense_Mutation_p.A460E	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	460	Ig-like 5.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						GAGTGTGTTTGCAGGTGTGAG	0.403																																					p.A460E		.											.	NRCAM-156	0			c.C1379A						.						153.0	133.0	140.0					7																	107836289		2203	4300	6503	SO:0001583	missense	4897	exon12			GTGTTTGCAGGTG		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.1379C>A	7.37:g.107836289G>T	ENSP00000401244:p.Ala460Glu	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	59	3	NM_001037132	0	0	17	17	0	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	37	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	G	4.258	0.046854	0.08243	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979	T;T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66;1.66	5.2	2.26	0.28386	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.402640	0.27650	N	0.018433	T	0.13798	0.0334	N	0.25825	0.765	0.35757	D	0.819842	B;B;B;B;B	0.10296	0.001;0.002;0.003;0.002;0.001	B;B;B;B;B	0.17979	0.005;0.02;0.013;0.008;0.006	T	0.24404	-1.0161	10	0.02654	T	1	.	2.5345	0.04711	0.1394:0.1264:0.4743:0.2599	.	460;441;441;454;460	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	E	460;460;441;460;454;441;460;460;454	ENSP00000368314:A460E;ENSP00000407858:A441E;ENSP00000325269:A454E;ENSP00000368310:A441E;ENSP00000401244:A460E;ENSP00000368308:A460E	ENSP00000325269:A454E	A	-	2	0	NRCAM	107623525	0.894000	0.30519	0.896000	0.35187	0.983000	0.72400	1.999000	0.40806	0.512000	0.28257	0.563000	0.77884	GCA	.		0.403	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
ZNF786	136051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	148767681	148767681	+	Missense_Mutation	SNP	G	G	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr7:148767681G>T	ENST00000491431.1	-	4	2247	c.2183C>A	c.(2182-2184)cCc>cAc	p.P728H	ZNF786_ENST00000451334.3_Missense_Mutation_p.P691H|ZNF786_ENST00000316286.9_Missense_Mutation_p.P642H	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	728					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GGGCCTCTCGGGCCTGTGGAT	0.567																																					p.P728H		.											.	ZNF786-50	0			c.C2183A						.						131.0	135.0	133.0					7																	148767681		2045	4211	6256	SO:0001583	missense	136051	exon4			CTCTCGGGCCTGT	AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.2183C>A	7.37:g.148767681G>T	ENSP00000417470:p.Pro728His	Somatic	241	1		WXS	Illumina HiSeq	Phase_I	297	138	NM_152411	0	0	2	2	0	A1A568|B4DMI1	Missense_Mutation	SNP	ENST00000491431.1	37	CCDS47738.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678888	0.47886	.	.	ENSG00000197362	ENST00000316286;ENST00000491431;ENST00000451334	T;T;T	0.19394	2.15;2.15;2.15	4.62	3.7	0.42460	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36444	N	0.002595	T	0.34745	0.0908	L	0.42581	1.335	0.31365	N	0.68091	D	0.89917	1.0	D	0.77004	0.989	T	0.21484	-1.0244	10	0.87932	D	0	-21.2407	10.48	0.44687	0.0:0.3127:0.6873:0.0	.	728	Q8N393	ZN786_HUMAN	H	642;728;691	ENSP00000313516:P642H;ENSP00000417470:P728H;ENSP00000404984:P691H	ENSP00000313516:P642H	P	-	2	0	ZNF786	148398614	0.001000	0.12720	0.900000	0.35374	0.789000	0.44602	0.774000	0.26675	2.411000	0.81874	0.591000	0.81541	CCC	.		0.567	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352751.1	NM_152411	
GIMAP6	474344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	150325338	150325338	+	Silent	SNP	G	G	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr7:150325338G>A	ENST00000328902.5	-	3	564	c.348C>T	c.(346-348)atC>atT	p.I116I	GIMAP6_ENST00000493969.1_Missense_Mutation_p.R42C	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	116	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGGATAAGACGATGGCTTGGC	0.632																																					p.R42C		.											.	GIMAP6-93	0			c.C124T						.						57.0	59.0	58.0					7																	150325338		2203	4300	6503	SO:0001819	synonymous_variant	474344	exon3			TAAGACGATGGCT	AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.348C>T	7.37:g.150325338G>A		Somatic	137	0		WXS	Illumina HiSeq	Phase_I	155	36	NM_001244071	0	0	6	6	0	C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	ENST00000328902.5	37	CCDS34778.1	.	.	.	.	.	.	.	.	.	.	G	8.530	0.870870	0.17322	.	.	ENSG00000133561	ENST00000493969	.	.	.	4.07	-6.18	0.02085	.	.	.	.	.	T	0.30386	0.0763	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.44034	-0.9354	5	0.87932	D	0	.	2.4155	0.04435	0.2705:0.4128:0.199:0.1177	.	.	.	.	C	42	.	ENSP00000418304:R42C	R	-	1	0	GIMAP6	149956271	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.968000	0.03817	-1.017000	0.03367	-1.157000	0.01802	CGT	.		0.632	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353457.1	NM_024711	
PXDNL	137902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	52336162	52336162	+	Missense_Mutation	SNP	C	C	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr8:52336162C>G	ENST00000356297.4	-	14	1868	c.1768G>C	c.(1768-1770)Gtg>Ctg	p.V590L	PXDNL_ENST00000543296.1_Missense_Mutation_p.V590L	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	590	Ig-like C2-type 4.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				ATGTTGGTCACAGCAAGGCCA	0.453																																					p.V590L		.											.	PXDNL-70	0			c.G1768C						.						109.0	115.0	113.0					8																	52336162		2106	4234	6340	SO:0001583	missense	137902	exon14			TGGTCACAGCAAG		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1768G>C	8.37:g.52336162C>G	ENSP00000348645:p.Val590Leu	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	36	17	NM_144651	0	0	0	0	0	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	C	9.782	1.175500	0.21704	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.66638	-0.22;-0.22	4.59	2.79	0.32731	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50633	0.1627	N	0.25789	0.76	0.09310	N	1	B	0.14438	0.01	B	0.21151	0.033	T	0.36986	-0.9725	9	0.30854	T	0.27	.	7.6374	0.28274	0.0:0.7996:0.0:0.2004	.	590	A1KZ92	PXDNL_HUMAN	L	590	ENSP00000348645:V590L;ENSP00000444865:V590L	ENSP00000348645:V590L	V	-	1	0	PXDNL	52498715	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.388000	0.07352	0.476000	0.27440	-0.757000	0.03467	GTG	.		0.453	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
DMRT2	10655	hgsc.bcm.edu	37	9	1051930	1051930	+	Missense_Mutation	SNP	C	C	G	rs112585712	byFrequency	TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr9:1051930C>G	ENST00000358146.2	+	1	317	c.317C>G	c.(316-318)aCt>aGt	p.T106S	DMRT2_ENST00000382251.3_Missense_Mutation_p.T106S|DMRT2_ENST00000412350.2_Missense_Mutation_p.T106S|DMRT2_ENST00000259622.6_Missense_Mutation_p.T106S|DMRT2_ENST00000302441.6_Missense_Mutation_p.T106S|DMRT2_ENST00000382255.3_Missense_Mutation_p.T106S			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	106					embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		GAGCGCTGCACTCCCGCGGGC	0.786													C|||	131	0.0261581	0.0015	0.0187	5008	,	,		9377	0.006		0.0537	False		,,,				2504	0.0573				p.T106S		.											.	DMRT2-514	0			c.C317G						.						1.0	1.0	1.0					9																	1051930		747	1711	2458	SO:0001583	missense	10655	exon2			GCTGCACTCCCGC	AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.317C>G	9.37:g.1051930C>G	ENSP00000350865:p.Thr106Ser	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	3	3	NM_006557	0	0	0	0	0	B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Missense_Mutation	SNP	ENST00000358146.2	37	CCDS6444.1	52	0.023809523809523808	4	0.008130081300813009	8	0.022099447513812154	1	0.0017482517482517483	39	0.051451187335092345	C	8.378	0.836916	0.16891	.	.	ENSG00000173253	ENST00000382255;ENST00000382251;ENST00000412350;ENST00000302441;ENST00000358146;ENST00000259622	T;T;T;T;T;T	0.39997	1.05;2.04;1.05;2.04;2.04;1.05	3.82	0.583	0.17417	.	1.094080	0.07099	N	0.840084	T	0.03739	0.0106	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.14420	-1.0473	10	0.10636	T	0.68	0.1877	8.3816	0.32474	0.0:0.6844:0.1394:0.1761	.	106;106	Q05C20;Q9Y5R5	.;DMRT2_HUMAN	S	106	ENSP00000371690:T106S;ENSP00000371686:T106S;ENSP00000397494:T106S;ENSP00000305785:T106S;ENSP00000350865:T106S;ENSP00000259622:T106S	ENSP00000259622:T106S	T	+	2	0	DMRT2	1041930	0.001000	0.12720	0.003000	0.11579	0.005000	0.04900	-0.165000	0.09968	0.267000	0.21916	0.491000	0.48974	ACT	C|0.976;G|0.024		0.786	DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051492.1	NM_006557	
SCAI	286205	broad.mit.edu	37	9	127790688	127790688	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr9:127790688C>A	ENST00000336505.6	-	5	454	c.396G>T	c.(394-396)caG>caT	p.Q132H	SCAI_ENST00000373549.4_Missense_Mutation_p.Q155H	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion	132	Necessary to inhibit MKL1-induced SRF transcriptional activity. {ECO:0000250}.|Required for interaction with MKL1. {ECO:0000250}.				negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.Q155H(9)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						GATAGTATAGCTGCCCAATCT	0.338																																					p.Q155H													.	SCAI-138	9	Substitution - Missense(9)	prostate(4)|kidney(3)|lung(2)	c.G465T						.						102.0	98.0	99.0					9																	127790688		1845	4080	5925	SO:0001583	missense	286205	exon6			GTATAGCTGCCCA	AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.396G>T	9.37:g.127790688C>A	ENSP00000336756:p.Gln132His	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	98	9	NM_173690	0	0	0	0	0	Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	Missense_Mutation	SNP	ENST00000336505.6	37	CCDS48017.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068788	0.76301	.	.	ENSG00000173611	ENST00000336505;ENST00000373549	T;T	0.57595	0.39;0.4	5.75	5.75	0.90469	.	0.103001	0.64402	D	0.000002	T	0.73426	0.3585	M	0.70275	2.135	0.53688	D	0.999974	D;D	0.65815	0.991;0.995	D;D	0.78314	0.991;0.989	T	0.74429	-0.3668	10	0.87932	D	0	-10.9266	19.2998	0.94140	0.0:1.0:0.0:0.0	.	132;155	Q8N9R8;Q8N9R8-2	SCAI_HUMAN;.	H	132;155	ENSP00000336756:Q132H;ENSP00000362650:Q155H	ENSP00000336756:Q132H	Q	-	3	2	SCAI	126830509	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.623000	0.46435	2.866000	0.98385	0.650000	0.86243	CAG	.		0.338	SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054055.3	NM_173690	
TOR1A	1861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	132576423	132576423	+	Missense_Mutation	SNP	T	T	G			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr9:132576423T>G	ENST00000351698.4	-	5	875	c.827A>C	c.(826-828)cAc>cCc	p.H276P		NM_000113.2	NP_000104.1	O14656	TOR1A_HUMAN	torsin family 1, member A (torsin A)	276	Interaction with KLC1.				ATP catabolic process (GO:0006200)|cell adhesion (GO:0007155)|chaperone mediated protein folding requiring cofactor (GO:0051085)|chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|ER-associated misfolded protein catabolic process (GO:0071712)|intermediate filament cytoskeleton organization (GO:0045104)|neuron projection development (GO:0031175)|nuclear envelope organization (GO:0006998)|nuclear membrane organization (GO:0071763)|organelle organization (GO:0006996)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|protein deneddylation (GO:0000338)|protein homooligomerization (GO:0051260)|protein localization to nucleus (GO:0034504)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of protein localization to cell surface (GO:2000008)|response to oxidative stress (GO:0006979)|synaptic vesicle transport (GO:0048489)|wound healing, spreading of cells (GO:0044319)	cell junction (GO:0030054)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cytoskeletal protein binding (GO:0008092)|kinesin binding (GO:0019894)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20		Ovarian(14;0.00556)				CATTTTTAGGTGTTTGTATTC	0.453																																					p.H276P		.											.	TOR1A-90	0			c.A827C						.						163.0	156.0	159.0					9																	132576423		2203	4300	6503	SO:0001583	missense	1861	exon5			TTTAGGTGTTTGT	AF007871	CCDS6930.1	9q32-q34	2008-07-21	2004-11-24	2004-11-26	ENSG00000136827	ENSG00000136827			3098	protein-coding gene	gene with protein product		605204	"""dystonia 1, torsion (autosomal dominant; torsin A)"""	DYT1		10644435	Standard	NM_000113		Approved	DQ2	uc004byl.3	O14656	OTTHUMG00000020794	ENST00000351698.4:c.827A>C	9.37:g.132576423T>G	ENSP00000345719:p.His276Pro	Somatic	263	0		WXS	Illumina HiSeq	Phase_I	231	69	NM_000113	0	0	18	40	22	B2RB58|Q53Y64|Q96CA0	Missense_Mutation	SNP	ENST00000351698.4	37	CCDS6930.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.269693	0.80469	.	.	ENSG00000136827	ENST00000427355;ENST00000351698	T	0.71579	-0.58	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.87740	0.6253	M	0.94063	3.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90894	0.4763	10	0.87932	D	0	-9.1277	14.3493	0.66688	0.0:0.0:0.0:1.0	.	276	O14656	TOR1A_HUMAN	P	245;276	ENSP00000345719:H276P	ENSP00000345719:H276P	H	-	2	0	TOR1A	131616244	1.000000	0.71417	0.928000	0.36995	0.803000	0.45373	7.698000	0.84413	1.974000	0.57490	0.459000	0.35465	CAC	.		0.453	TOR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054611.1	NM_000113	
FUT7	2529	broad.mit.edu	37	9	139925712	139925712	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr9:139925712C>A	ENST00000314412.6	-	2	1497	c.479G>T	c.(478-480)tGg>tTg	p.W160L	ABCA2_ENST00000371605.3_5'Flank|C9orf139_ENST00000314330.2_Intron|ABCA2_ENST00000265662.5_5'Flank	NM_004479.3	NP_004470.1	Q11130	FUT7_HUMAN	fucosyltransferase 7 (alpha (1,3) fucosyltransferase)	160					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|leukocyte migration involved in immune response (GO:0002522)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|lung(4)|ovary(1)|skin(1)	8	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		CGAGGGCCCCCAGTGGGGCTC	0.687																																					p.W160L													.	FUT7-90	0			c.G479T						.						13.0	17.0	15.0					9																	139925712		2171	4262	6433	SO:0001583	missense	2529	exon2			GGCCCCCAGTGGG	X78031, AB012668	CCDS7022.1	9q34.3	2013-02-26			ENSG00000180549	ENSG00000180549		"""Fucosyltransferases"""	4018	protein-coding gene	gene with protein product		602030				8207002, 8182079	Standard	NM_004479		Approved		uc004ckq.2	Q11130	OTTHUMG00000020964	ENST00000314412.6:c.479G>T	9.37:g.139925712C>A	ENSP00000318142:p.Trp160Leu	Somatic	14	0		WXS	Illumina HiSeq	Phase_I	15	3	NM_004479	0	0	0	0	0	B2R7U7|Q6DK54	Missense_Mutation	SNP	ENST00000314412.6	37	CCDS7022.1	.	.	.	.	.	.	.	.	.	.	c	2.448	-0.327108	0.05350	.	.	ENSG00000180549	ENST00000314412	T	0.21543	2.0	4.74	-2.18	0.07037	.	6.541200	0.00678	N	0.000671	T	0.09158	0.0226	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23655	-1.0182	10	0.49607	T	0.09	5.1204	2.6034	0.04872	0.0942:0.3189:0.2336:0.3533	.	160	Q11130	FUT7_HUMAN	L	160	ENSP00000318142:W160L	ENSP00000318142:W160L	W	-	2	0	FUT7	139045533	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-1.554000	0.02172	-0.380000	0.07894	-0.251000	0.11542	TGG	.		0.687	FUT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055220.1	NM_004479	
USP9X	8239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	40999924	40999924	+	Missense_Mutation	SNP	C	C	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chrX:40999924C>A	ENST00000324545.8	+	7	1303	c.670C>A	c.(670-672)Ctt>Att	p.L224I	USP9X_ENST00000378308.2_Missense_Mutation_p.L224I	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	224					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GCTAGTGGATCTTCTCAACAA	0.318																																					p.L224I	Ovarian(172;1807 2695 35459 49286)	.											.	USP9X-563	0			c.C670A						.						111.0	99.0	103.0					X																	40999924		2203	4298	6501	SO:0001583	missense	8239	exon7			GTGGATCTTCTCA	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.670C>A	X.37:g.40999924C>A	ENSP00000316357:p.Leu224Ile	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	80	55	NM_001039591	0	0	7	38	31	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926912	0.73327	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.03982	3.75;3.74	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.24044	0.0582	M	0.79475	2.455	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.74348	0.983;0.963	T	0.00104	-1.2059	10	0.45353	T	0.12	.	19.5004	0.95091	0.0:1.0:0.0:0.0	.	224;224	Q93008-1;Q93008	.;USP9X_HUMAN	I	224	ENSP00000367558:L224I;ENSP00000316357:L224I	ENSP00000316357:L224I	L	+	1	0	USP9X	40884868	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.611000	0.61162	2.560000	0.86352	0.594000	0.82650	CTT	.		0.318	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
SHROOM4	57477	hgsc.bcm.edu	37	X	50350698	50350698	+	Silent	SNP	C	C	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chrX:50350698C>T	ENST00000289292.7	-	6	3727	c.3444G>A	c.(3442-3444)gaG>gaA	p.E1148E	SHROOM4_ENST00000460112.3_Silent_p.E1032E|SHROOM4_ENST00000376020.2_Silent_p.E1148E			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1148	Glu-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cctcctcctcctcctcttcct	0.557													C|||	1	0.000264901	0.0	0.0014	3775	,	,		12007	0.0		0.0	False		,,,				2504	0.0				p.E1148E		.											.	SHROOM4-131	0			c.G3444A						.						22.0	20.0	21.0					X																	50350698		2203	4298	6501	SO:0001819	synonymous_variant	57477	exon6			CTCCTCCTCCTCT	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3444G>A	X.37:g.50350698C>T		Somatic	8	0		WXS	Illumina HiSeq	Phase_I	12	2	NM_020717	0	0	0	0	0	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	ENST00000289292.7	37	CCDS35277.1																																																																																			.		0.557	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
PDE4DIP	9659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	144915498	144915498	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr1:144915498delT	ENST00000369354.3	-	14	2116	c.1927delA	c.(1927-1929)atgfs	p.M643fs	PDE4DIP_ENST00000479408.2_Frame_Shift_Del_p.M430fs|PDE4DIP_ENST00000530740.1_Frame_Shift_Del_p.M780fs|PDE4DIP_ENST00000529945.1_Frame_Shift_Del_p.M806fs|PDE4DIP_ENST00000369351.3_Frame_Shift_Del_p.M643fs|PDE4DIP_ENST00000313382.9_Frame_Shift_Del_p.M709fs|PDE4DIP_ENST00000369349.3_Frame_Shift_Del_p.M643fs|PDE4DIP_ENST00000313431.9_Frame_Shift_Del_p.M806fs|PDE4DIP_ENST00000369359.4_Frame_Shift_Del_p.M780fs|PDE4DIP_ENST00000369356.4_Frame_Shift_Del_p.M643fs			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	643				M -> V (in Ref. 4; CAD91152). {ECO:0000305}.	cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGAATCTCCATTTCATGTTCC	0.468			T	PDGFRB	MPD																																p.M806fs		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP-663	0			c.2416delA						.						319.0	290.0	300.0					1																	144915498		2203	4296	6499	SO:0001589	frameshift_variant	9659	exon10			.	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1927delA	1.37:g.144915498delT	ENSP00000358360:p.Met643fs	Somatic	452	0		WXS	Illumina HiSeq	Phase_I	447	85	NM_001002811	0	0	0	0	0	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Frame_Shift_Del	DEL	ENST00000369354.3	37	CCDS30824.1																																																																																			.		0.468	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
PROSER1	80209	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	39587574	39587574	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr13:39587574delA	ENST00000352251.3	-	11	2648	c.1815delT	c.(1813-1815)gttfs	p.V605fs	PROSER1_ENST00000350125.3_Frame_Shift_Del_p.V583fs|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	605	Ser-rich.																TTTTGATCATAACAGGAAGAG	0.517																																					p.V605fs		.											.	.	0			c.1815delT						.						153.0	163.0	159.0					13																	39587574		2203	4300	6503	SO:0001589	frameshift_variant	80209	exon11			.	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1815delT	13.37:g.39587574delA	ENSP00000332034:p.Val605fs	Somatic	247	0		WXS	Illumina HiSeq	Phase_I	191	72	NM_025138	0	0	0	0	0	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Frame_Shift_Del	DEL	ENST00000352251.3	37	CCDS9368.2																																																																																			.		0.517	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
CPSF3	51692	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	9570989	9570994	+	In_Frame_Del	DEL	TTCTGA	TTCTGA	-			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	TTCTGA	TTCTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:9570989_9570994delTTCTGA	ENST00000238112.3	+	4	527_532	c.321_326delTTCTGA	c.(319-327)ctttctgat>ctt	p.SD108del	CPSF3_ENST00000460593.1_In_Frame_Del_p.SD71del	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa	108					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		GATGGCTTCTTTCTGATTATGTCAAA	0.35																																					p.107_109del	Colon(194;1259 2048 3845 5218 19985)	.											.	CPSF3-153	0			c.321_326del						.																																			SO:0001651	inframe_deletion	51692	exon4			.	AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.321_326delTTCTGA	2.37:g.9570989_9570994delTTCTGA	ENSP00000238112:p.Ser108_Asp109del	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	133	41	NM_016207	0	0	0	0	0	O14769|Q53RS2|Q96F36	In_Frame_Del	DEL	ENST00000238112.3	37	CCDS1664.1																																																																																			.		0.350	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206843.1	NM_016207	
SH3TC1	54436	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	8229750	8229752	+	In_Frame_Del	DEL	ACC	ACC	-			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	ACC	ACC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr4:8229750_8229752delACC	ENST00000245105.3	+	12	2396_2398	c.2329_2331delACC	c.(2329-2331)accdel	p.T777del	SH3TC1_ENST00000539824.1_In_Frame_Del_p.T701del	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	777										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GGCCTCCCTGACCCCGGGCACAG	0.685																																					p.777_777del	NSCLC(145;2298 2623 35616 37297)	.											.	SH3TC1-154	0			c.2329_2331del						.																																			SO:0001651	inframe_deletion	54436	exon12			.	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2329_2331delACC	4.37:g.8229750_8229752delACC	ENSP00000245105:p.Thr777del	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	49	12	NM_018986	0	0	0	0	0	Q4W5G5	In_Frame_Del	DEL	ENST00000245105.3	37	CCDS3399.1																																																																																			.		0.685	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
CENPE	1062	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	104041471	104041471	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr4:104041471delT	ENST00000265148.3	-	44	7252	c.7163delA	c.(7162-7164)aatfs	p.N2388fs	CENPE_ENST00000380026.3_Frame_Shift_Del_p.N2267fs	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2388	Kinetochore-binding domain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ATGCAGTGAATTTTCCAGCTC	0.333																																					p.N2388fs		.											.	CENPE-277	0			c.7163delA						.						106.0	90.0	96.0					4																	104041471		2202	4296	6498	SO:0001589	frameshift_variant	1062	exon44			.	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.7163delA	4.37:g.104041471delT	ENSP00000265148:p.Asn2388fs	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	62	18	NM_001813	0	0	0	0	0	A6NKY9|A8K2U7|Q4LE75	Frame_Shift_Del	DEL	ENST00000265148.3	37	CCDS34042.1																																																																																			.		0.333	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SLC34A1	6569	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	176824798	176824800	+	In_Frame_Del	DEL	CTT	CTT	-	rs387907506		TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr5:176824798_176824800delCTT	ENST00000324417.5	+	13	1522_1524	c.1431_1433delCTT	c.(1429-1434)cacttc>cac	p.F480del	SLC34A1_ENST00000513614.1_3'UTR	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	480					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCTCTGTCACTTCTTCTTCAAC	0.616																																					p.477_478del		.											.	SLC34A1-91	0			c.1431_1433del						.																																			SO:0001651	inframe_deletion	6569	exon13			.	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1431_1433delCTT	5.37:g.176824804_176824806delCTT	ENSP00000321424:p.Phe480del	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	118	26	NM_003052	0	0	0	0	0	B4DPE3	In_Frame_Del	DEL	ENST00000324417.5	37	CCDS4418.1																																																																																			.		0.616	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052	
EFCAB5	374786	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	28405254	28405255	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr17:28405254_28405255insA	ENST00000394835.3	+	15	2951_2952	c.2759_2760insA	c.(2758-2763)ccaaagfs	p.PK920fs	EFCAB5_ENST00000394832.2_Intron|EFCAB5_ENST00000320856.5_Frame_Shift_Ins_p.PK796fs	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	920							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						ATCCAATTTCCAAAGCCACACC	0.411																																					p.P920fs		.											.	EFCAB5-70	0			c.2759_2760insA						.																																			SO:0001589	frameshift_variant	374786	exon15			.	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.2762dupA	17.37:g.28405257_28405257dupA	ENSP00000378312:p.Pro920fs	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	88	19	NM_198529	0	0	0	0	0	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Frame_Shift_Ins	INS	ENST00000394835.3	37	CCDS11254.2																																																																																			.		0.411	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
DARS	1615	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	136673870	136673871	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr2:136673870_136673871insA	ENST00000264161.4	-	11	1246_1247	c.1031_1032insT	c.(1030-1032)ctafs	p.L344fs	DARS_ENST00000537273.1_Frame_Shift_Ins_p.L244fs	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	344					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	ATTCTAGTCTTAGAGTTGGCTC	0.366																																					p.L344fs		.											.	DARS-91	0			c.1032_1033insT						.																																			SO:0001589	frameshift_variant	1615	exon11			.	J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.1032dupT	2.37:g.136673871_136673871dupA	ENSP00000264161:p.Leu344fs	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	153	48	NM_001349	0	0	0	0	0	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Frame_Shift_Ins	INS	ENST00000264161.4	37	CCDS2180.1																																																																																			.		0.366	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349	
LRBA	987	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	151827133	151827134	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr4:151827133_151827134insT	ENST00000357115.3	-	13	1854_1855	c.1611_1612insA	c.(1609-1614)aaatctfs	p.S538fs	LRBA_ENST00000535741.1_Frame_Shift_Ins_p.S538fs|LRBA_ENST00000510413.1_Frame_Shift_Ins_p.S538fs|LRBA_ENST00000507224.1_Frame_Shift_Ins_p.S538fs	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	538						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CTAACATGAGATTTGGAAGACT	0.396																																					p.S538fs		.											.	LRBA-157	0			c.1612_1613insA						.																																			SO:0001589	frameshift_variant	987	exon13			.	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1612dupA	4.37:g.151827136_151827136dupT	ENSP00000349629:p.Ser538fs	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	67	27	NM_006726	0	0	0	0	0	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Frame_Shift_Ins	INS	ENST00000357115.3	37	CCDS3773.1																																																																																			.		0.396	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
ZNF3	7551	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	99669265	99669266	+	Frame_Shift_Ins	INS	-	-	C			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr7:99669265_99669266insC	ENST00000424697.1	-	6	1147_1148	c.841_842insG	c.(841-843)gagfs	p.E281fs	ZNF3_ENST00000303915.6_Frame_Shift_Ins_p.E281fs|ZNF3_ENST00000299667.4_Frame_Shift_Ins_p.E281fs|ZNF3_ENST00000413658.2_Intron	NM_001278284.1|NM_001278287.1|NM_001278290.1|NM_001278291.1|NM_001278292.1|NM_032924.3	NP_001265213.1|NP_001265216.1|NP_001265219.1|NP_001265220.1|NP_001265221.1|NP_116313.3	P17036	ZNF3_HUMAN	zinc finger protein 3	281					cell differentiation (GO:0030154)|leukocyte activation (GO:0045321)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	25	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			ATAGGGTTTCTCCCCCGTGTGG	0.515																																					p.E281fs		.											.	ZNF3-91	0			c.842_843insG						.																																			SO:0001589	frameshift_variant	7551	exon6			.	AF027136	CCDS43618.1, CCDS43619.1	7q22.1	2013-01-08	2006-05-05					"""Zinc fingers, C2H2-type"", ""-"""	13089	protein-coding gene	gene with protein product		194510	"""zinc finger protein 3 (A8-51)"""				Standard	NM_032924		Approved	A8-51, KOX25, PP838, FLJ20216, HF.12, Zfp113	uc003usr.4	P17036		ENST00000424697.1:c.842dupG	7.37:g.99669270_99669270dupC	ENSP00000415358:p.Glu281fs	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	113	28	NM_032924	0	0	0	0	0	D6W5U0|P13683|Q9HBR4|Q9NNX8|Q9NXJ1|Q9UC15|Q9UC16	Frame_Shift_Ins	INS	ENST00000424697.1	37	CCDS43619.1																																																																																			.		0.515	ZNF3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336247.3	NM_017715	
ENGASE	64772	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	77077140	77077141	+	Missense_Mutation	DNP	TC	TC	CG			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr17:77077140_77077141TC>CG	ENST00000579016.1	+	6	857_858	c.857_858TC>CG	c.(856-858)cTC>cCG	p.L286P	ENGASE_ENST00000539857.2_Missense_Mutation_p.L100P	NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	286						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						CAAGACGAACTCAACCAGCACA	0.658																																					p.L286P		.											.	ENGASE	0			c.C858G						.																																			SO:0001583	missense	64772	exon6			CGAACTCAACCAG	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	Exception_encountered	17.37:g.77077140_77077141delinsCG	ENSP00000462333:p.Leu286Pro	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	16.0		0	0	0	0	0	Q659F0|Q8TB86|Q9H6U4	Missense_Mutation	DNP	ENST00000579016.1	37	CCDS42394.1																																																																																			.		0.658	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	NM_022759	
KDM4B	23030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5082512	5082513	+	Missense_Mutation	DNP	TC	TC	CA			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr19:5082512_5082513TC>CA	ENST00000159111.4	+	9	1133_1134	c.915_916TC>CA	c.(913-918)acTCag>acCAag	p.Q306K	KDM4B_ENST00000536461.1_Missense_Mutation_p.Q306K|KDM4B_ENST00000381759.4_Missense_Mutation_p.Q306K	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	306	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						AAGTGGCCACTCAGGTAAAAGC	0.594																																					p.Q306K		.											.	KDM4B	0			c.C916A						.																																			SO:0001583	missense	23030	exon9			GCCACTCAGGTAA	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		Exception_encountered	19.37:g.5082512_5082513delinsCA	ENSP00000159111:p.Gln306Lys	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	9.0		0	0	0	0	0	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	DNP	ENST00000159111.4	37	CCDS12138.1																																																																																			.		0.594	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
TMEM67	91147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	94797545	94797546	+	Missense_Mutation	DNP	TA	TA	CT			TCGA-B9-5156-01A-01D-1589-08	TCGA-B9-5156-10A-01D-1589-08	TA	TA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8faa0a9e-10a4-41ed-8293-e403028434e8	8355a879-8264-4bba-88a4-f6db446dffa8	g.chr8:94797545_94797546TA>CT	ENST00000453321.3	+	12	1285_1286	c.1227_1228TA>CT	c.(1225-1230)taTAtt>taCTtt	p.I410F	TMEM67_ENST00000409623.3_Missense_Mutation_p.I329F	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	410					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			AACATCAATATATTTTGGCTGT	0.337																																					p.I410F		.											.	TMEM67	0			c.A1228T						.																																			SO:0001583	missense	91147	exon12			CAATATATTTTGG	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	Exception_encountered	8.37:g.94797545_94797546delinsCT	ENSP00000389998:p.Ile410Phe	Somatic	268.0	1.0		WXS	Illumina HiSeq	Phase_I	228.0	69.0		0	0	0	0	0	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	DNP	ENST00000453321.3	37	CCDS6258.2																																																																																			.		0.337	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704	
