#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS20	80070	hgsc.bcm.edu;ucsc.edu	37	12	43777460	43777460	+	Silent	SNP	C	C	A			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr12:43777460C>A	ENST00000389420.3	-	31	4697	c.4698G>T	c.(4696-4698)gtG>gtT	p.V1566V		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1566	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTATTTCATTCACTTGTCTGA	0.368																																																	0													150.0	139.0	142.0					12																	43777460		2203	4300	6503	SO:0001819	synonymous_variant	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4698G>T	12.37:g.43777460C>A		Somatic		WXS	SOLID	Phase_I	A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	37	CCDS31778.2																																																																																				0.368	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1		NM_025003	
APC	324	hgsc.bcm.edu	37	5	112177788	112177788	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr5:112177788G>T	ENST00000457016.1	+	16	6877	c.6497G>T	c.(6496-6498)cGa>cTa	p.R2166L	APC_ENST00000257430.4_Missense_Mutation_p.R2166L|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Missense_Mutation_p.R2166L			P25054	APC_HUMAN	adenomatous polyposis coli	2166	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AAAGGCCCACGAATTCTAAAA	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	1	Unknown(1)	skin(1)											45.0	50.0	48.0					5																	112177788		2193	4295	6488	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.6497G>T	5.37:g.112177788G>T	ENSP00000413133:p.Arg2166Leu	Somatic		WXS	SOLID	Phase_I	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.776527	0.49786	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.91237	-2.81;-2.81;-2.81	6.02	6.02	0.97574	.	0.050983	0.85682	D	0.000000	D	0.89230	0.6656	L	0.38175	1.15	0.47778	D	0.999513	P;P	0.51653	0.947;0.947	P;P	0.50590	0.645;0.571	D	0.87474	0.2416	9	.	.	.	-12.4976	13.6966	0.62582	0.07:0.0:0.93:0.0	.	2168;2166	Q4LE70;P25054	.;APC_HUMAN	L	2166	ENSP00000413133:R2166L;ENSP00000257430:R2166L;ENSP00000427089:R2166L	.	R	+	2	0	APC	112205687	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.416000	0.66417	2.857000	0.98124	0.650000	0.86243	CGA		0.348	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2		NM_000038	
BCAS3	54828	hgsc.bcm.edu;ucsc.edu	37	17	58952032	58952032	+	Silent	SNP	C	C	A			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr17:58952032C>A	ENST00000390652.5	+	9	625	c.594C>A	c.(592-594)gtC>gtA	p.V198V	BCAS3_ENST00000588462.1_Silent_p.V198V|BCAS3_ENST00000408905.3_Silent_p.V198V|BCAS3_ENST00000407086.3_Silent_p.V198V|BCAS3_ENST00000589222.1_Silent_p.V198V	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GGATCCTTGTCGTAGTCTTGC	0.328																																																	0													97.0	89.0	91.0					17																	58952032		1816	4078	5894	SO:0001819	synonymous_variant	54828			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.594C>A	17.37:g.58952032C>A		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000390652.5	37	CCDS45749.1																																																																																				0.328	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449578.1		NM_017679	
CASKIN1	57524	hgsc.bcm.edu	37	16	2236740	2236740	+	Missense_Mutation	SNP	G	G	A	rs141907746		TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr16:2236740G>A	ENST00000343516.6	-	10	1108	c.1016C>T	c.(1015-1017)tCc>tTc	p.S339F	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	339	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)		p.S339F(1)|p.S168F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						GCCCAGGGAGGACGGGAAGTA	0.667																																																	2	Substitution - Missense(2)	skin(2)											35.0	40.0	39.0					16																	2236740		2012	4159	6171	SO:0001583	missense	57524			AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.1016C>T	16.37:g.2236740G>A	ENSP00000345436:p.Ser339Phe	Somatic		WXS	SOLID	Phase_I	Q9P2P0	Missense_Mutation	SNP	ENST00000343516.6	37	CCDS42103.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239138	0.58995	.	.	ENSG00000167971	ENST00000343516;ENST00000382453	T	0.10099	2.91	4.65	4.65	0.58169	Src homology-3 domain (3);Variant SH3 (1);	.	.	.	.	T	0.28466	0.0704	L	0.50847	1.595	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.01010	-1.1482	9	0.87932	D	0	-31.5331	16.6164	0.84917	0.0:0.0:1.0:0.0	.	339	Q8WXD9	CSKI1_HUMAN	F	339;168	ENSP00000345436:S339F	ENSP00000345436:S339F	S	-	2	0	CASKIN1	2176741	1.000000	0.71417	0.859000	0.33776	0.640000	0.38277	9.514000	0.98013	2.577000	0.86979	0.563000	0.77884	TCC		0.667	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1		NM_020764	
CDCP1	64866	hgsc.bcm.edu	37	3	45127493	45127493	+	Silent	SNP	C	C	T			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr3:45127493C>T	ENST00000296129.1	-	9	2282	c.2148G>A	c.(2146-2148)ccG>ccA	p.P716P		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	716						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TTGGCTGCCTCGGCATCTCAG	0.448																																																	0													209.0	204.0	206.0					3																	45127493		2203	4300	6503	SO:0001819	synonymous_variant	64866			AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.2148G>A	3.37:g.45127493C>T		Somatic		WXS	SOLID	Phase_I	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Silent	SNP	ENST00000296129.1	37	CCDS2727.1																																																																																				0.448	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3		NM_022842	
CPSF1	29894	hgsc.bcm.edu	37	8	145623779	145623779	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr8:145623779G>T	ENST00000349769.3	-	19	1901	c.1807C>A	c.(1807-1809)Cag>Aag	p.Q603K	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	603					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GTGGGGCCCTGAGTGGCGAAG	0.662																																					NSCLC(133;1088 1848 27708 34777 35269)												0													86.0	92.0	90.0					8																	145623779		2203	4300	6503	SO:0001583	missense	29894			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1807C>A	8.37:g.145623779G>T	ENSP00000339353:p.Gln603Lys	Somatic		WXS	SOLID	Phase_I	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185955	0.78789	.	.	ENSG00000071894	ENST00000349769	T	0.41065	1.01	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	M	0.72118	2.19	0.58432	D	0.999998	B	0.28258	0.205	B	0.29440	0.102	T	0.33163	-0.9879	10	0.18710	T	0.47	-14.4254	17.2111	0.86930	0.0:0.0:1.0:0.0	.	603	Q10570	CPSF1_HUMAN	K	603	ENSP00000339353:Q603K	ENSP00000339353:Q603K	Q	-	1	0	CPSF1	145594587	1.000000	0.71417	0.974000	0.42286	0.958000	0.62258	8.514000	0.90545	2.658000	0.90341	0.655000	0.94253	CAG		0.662	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2		NM_013291	
CWH43	80157	hgsc.bcm.edu;ucsc.edu	37	4	49005842	49005842	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr4:49005842G>T	ENST00000226432.4	+	7	1076	c.893G>T	c.(892-894)tGg>tTg	p.W298L	CWH43_ENST00000513409.1_Missense_Mutation_p.W271L	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	298					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						GCATCCATGTGGCCCCAAACA	0.478																																																	0													108.0	92.0	98.0					4																	49005842		2203	4300	6503	SO:0001583	missense	80157				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.893G>T	4.37:g.49005842G>T	ENSP00000226432:p.Trp298Leu	Somatic		WXS	SOLID	Phase_I	B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	37	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.215363	0.39102	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.42131	1.57;0.98	3.91	3.91	0.45181	.	0.000000	0.50627	D	0.000103	T	0.59376	0.2189	M	0.67953	2.075	0.44871	D	0.997887	D	0.69078	0.997	D	0.65140	0.932	T	0.60692	-0.7213	9	.	.	.	.	15.3556	0.74425	0.0:0.0:1.0:0.0	.	298	Q9H720	PG2IP_HUMAN	L	298;271	ENSP00000226432:W298L;ENSP00000422802:W271L	.	W	+	2	0	CWH43	48700599	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	5.830000	0.69324	2.480000	0.83734	0.591000	0.81541	TGG		0.478	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2		NM_025087	
DNHD1	144132	hgsc.bcm.edu	37	11	6567893	6567893	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr11:6567893G>C	ENST00000527990.2	+	19	5724	c.5724G>C	c.(5722-5724)gaG>gaC	p.E1908D	DNHD1_ENST00000254579.6_Missense_Mutation_p.E1908D			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1908					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CCATTGAGGAGGCTGCCCTAC	0.557																																																	0													46.0	40.0	41.0					11																	6567893		692	1590	2282	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.5724G>C	11.37:g.6567893G>C	ENSP00000436180:p.Glu1908Asp	Somatic		WXS	SOLID	Phase_I	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.406220	0.42715	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000533649	T;T	0.26810	1.71;1.71	4.96	3.1	0.35709	.	0.057663	0.64402	D	0.000003	T	0.40956	0.1138	M	0.63843	1.955	0.34907	D	0.747083	D	0.76494	0.999	D	0.78314	0.991	T	0.49133	-0.8971	10	0.13108	T	0.6	.	10.3013	0.43654	0.1617:0.0:0.8383:0.0	.	1908	Q96M86	DNHD1_HUMAN	D	1908;1908;199	ENSP00000254579:E1908D;ENSP00000436180:E1908D	ENSP00000254579:E1908D	E	+	3	2	DNHD1	6524469	1.000000	0.71417	0.863000	0.33907	0.950000	0.60333	2.474000	0.45154	0.692000	0.31613	0.655000	0.94253	GAG		0.557	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2		NM_144666	
EGFR	1956	hgsc.bcm.edu	37	7	55259455	55259455	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr7:55259455T>C	ENST00000275493.2	+	21	2690	c.2513T>C	c.(2512-2514)cTg>cCg	p.L838P	EGFR_ENST00000454757.2_Missense_Mutation_p.L785P|EGFR_ENST00000455089.1_Missense_Mutation_p.L793P|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	838	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> V (found in a lung cancer sample; more sensitive to gefitinib than wild- type). {ECO:0000269|PubMed:15623594}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L838P(3)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CACCGCGACCTGGCAGCCAGG	0.537		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	3	Substitution - Missense(3)	lung(3)											116.0	101.0	106.0					7																	55259455		2203	4300	6503	SO:0001583	missense	1956	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2513T>C	7.37:g.55259455T>C	ENSP00000275493:p.Leu838Pro	Somatic		WXS	SOLID	Phase_I	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.759672	0.89932	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.74842	-0.88;-0.88;-0.88	5.82	5.82	0.92795	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92185	0.7522	H	0.99143	4.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95204	0.8319	10	0.87932	D	0	.	15.0046	0.71501	0.0:0.0:0.0:1.0	.	793;838	Q504U8;P00533	.;EGFR_HUMAN	P	793;708;838;785	ENSP00000415559:L793P;ENSP00000275493:L838P;ENSP00000395243:L785P	ENSP00000275493:L838P	L	+	2	0	EGFR	55226949	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.911000	0.87458	2.221000	0.72209	0.528000	0.53228	CTG		0.537	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2		NM_005228	
ETNK1	55500	hgsc.bcm.edu;ucsc.edu	37	12	22826447	22826447	+	Silent	SNP	A	A	G			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr12:22826447A>G	ENST00000266517.4	+	6	1154	c.1065A>G	c.(1063-1065)gtA>gtG	p.V355V		NM_018638.4	NP_061108.2	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1	355					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TGAGTGATGTAGACTATAGTC	0.363																																					Esophageal Squamous(42;87 913 3224 6226 43339)												0													82.0	82.0	82.0					12																	22826447		2203	4300	6503	SO:0001819	synonymous_variant	55500			BC006111	CCDS8698.1, CCDS41760.1	12p12.2	2004-07-09			ENSG00000139163	ENSG00000139163			24649	protein-coding gene	gene with protein product		609858				11912161, 11044454	Standard	XM_005253420		Approved	EKI1, EKI	uc001rft.3	Q9HBU6	OTTHUMG00000169008	ENST00000266517.4:c.1065A>G	12.37:g.22826447A>G		Somatic		WXS	SOLID	Phase_I	G5E969	Silent	SNP	ENST00000266517.4	37	CCDS8698.1	.	.	.	.	.	.	.	.	.	.	A	8.894	0.954641	0.18431	.	.	ENSG00000139163	ENST00000538218	.	.	.	4.91	0.0566	0.14319	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2245	7.6463	0.28323	0.6565:0.0:0.3435:0.0	.	.	.	.	W	346	.	.	X	+	2	0	ETNK1	22717714	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	2.213000	0.42844	-0.013000	0.14199	0.477000	0.44152	TAG		0.363	ETNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401926.2		NM_018638	
FBXO10	26267	hgsc.bcm.edu	37	9	37537374	37537374	+	Silent	SNP	T	T	A	rs186419638		TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr9:37537374T>A	ENST00000432825.2	-	3	1200	c.1152A>T	c.(1150-1152)gtA>gtT	p.V384V	RP11-613M10.8_ENST00000544475.1_5'UTR|FBXO10_ENST00000543968.1_5'Flank|FBXO10_ENST00000541829.1_Intron	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	384					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		AGCCCCCCAATACAGGGCGTG	0.587																																																	0													18.0	21.0	20.0					9																	37537374		2039	4167	6206	SO:0001819	synonymous_variant	26267			AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.1152A>T	9.37:g.37537374T>A		Somatic		WXS	SOLID	Phase_I	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	ENST00000432825.2	37	CCDS47966.1																																																																																				0.587	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3			
GABRQ	55879	hgsc.bcm.edu;ucsc.edu	37	X	151808916	151808916	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chrX:151808916C>T	ENST00000370306.2	+	2	247	c.227C>T	c.(226-228)cCg>cTg	p.P76L		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	76					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CGCCTGAGACCGAATTTTGGA	0.468																																																	0													149.0	127.0	134.0					X																	151808916		2203	4300	6503	SO:0001583	missense	55879			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.227C>T	X.37:g.151808916C>T	ENSP00000359329:p.Pro76Leu	Somatic		WXS	SOLID	Phase_I	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.685364	0.68157	.	.	ENSG00000147402	ENST00000370306;ENST00000333733	D	0.94966	-3.57	4.45	4.45	0.53987	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.38663	N	0.001609	D	0.97489	0.9178	M	0.92122	3.275	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	D	0.97530	1.0079	10	0.51188	T	0.08	.	11.3403	0.49529	0.0:1.0:0.0:0.0	.	76	Q9UN88	GBRT_HUMAN	L	76;71	ENSP00000359329:P76L	ENSP00000331410:P71L	P	+	2	0	GABRQ	151559572	0.997000	0.39634	0.931000	0.37212	0.837000	0.47467	4.668000	0.61568	2.051000	0.60960	0.529000	0.55759	CCG		0.468	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2		NM_018558	
GRIA2	2891	hgsc.bcm.edu;ucsc.edu	37	4	158254482	158254482	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr4:158254482C>A	ENST00000264426.9	+	8	1411	c.1132C>A	c.(1132-1134)Ctc>Atc	p.L378I	GRIA2_ENST00000449365.1_Missense_Mutation_p.L331I|GRIA2_ENST00000296526.7_Missense_Mutation_p.L378I|GRIA2_ENST00000507898.1_Missense_Mutation_p.L331I|GRIA2_ENST00000393815.2_Missense_Mutation_p.L331I	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	378					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CATCATGGAGCTCAAAACTAA	0.393																																																	0													41.0	44.0	43.0					4																	158254482		2200	4294	6494	SO:0001583	missense	2891				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1132C>A	4.37:g.158254482C>A	ENSP00000264426:p.Leu378Ile	Somatic		WXS	SOLID	Phase_I	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707072	0.68615	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	5.42	4.58	0.56647	.	0.000000	0.64402	D	0.000001	T	0.48059	0.1479	L	0.61218	1.895	0.58432	D	0.999998	P;D;D	0.56035	0.938;0.974;0.968	D;D;D	0.80764	0.937;0.911;0.994	T	0.49844	-0.8896	10	0.87932	D	0	.	13.8866	0.63712	0.0:0.9266:0.0:0.0734	.	378;378;331	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	I	331;331;378;378;331	ENSP00000426845:L331I;ENSP00000377403:L331I;ENSP00000296526:L378I;ENSP00000264426:L378I;ENSP00000389837:L331I	ENSP00000264426:L378I	L	+	1	0	GRIA2	158473932	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.203000	0.51075	1.282000	0.44496	0.650000	0.86243	CTC		0.393	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2			
HCFC2	29915	hgsc.bcm.edu;ucsc.edu	37	12	104461864	104461864	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr12:104461864A>C	ENST00000229330.4	+	3	556	c.452A>C	c.(451-453)gAt>gCt	p.D151A		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	151					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GAAAGCGAAGATTCAAACAAT	0.368																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)												0													165.0	160.0	162.0					12																	104461864		2203	4300	6503	SO:0001583	missense	29915			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.452A>C	12.37:g.104461864A>C	ENSP00000229330:p.Asp151Ala	Somatic		WXS	SOLID	Phase_I	B2R8Q5|C0H5X3	Missense_Mutation	SNP	ENST00000229330.4	37	CCDS9097.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.492859	0.84962	.	.	ENSG00000111727	ENST00000229330;ENST00000550444	T;T	0.73047	-0.71;-0.32	5.45	5.45	0.79879	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.87253	0.6131	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89836	0.3999	10	0.62326	D	0.03	-25.4308	15.7993	0.78439	1.0:0.0:0.0:0.0	.	151	Q9Y5Z7	HCFC2_HUMAN	A	151;62	ENSP00000229330:D151A;ENSP00000447952:D62A	ENSP00000229330:D151A	D	+	2	0	HCFC2	102985994	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.339000	0.96797	2.197000	0.70478	0.402000	0.26972	GAT		0.368	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407780.1		NM_013320	
HERC1	8925	hgsc.bcm.edu;ucsc.edu	37	15	64005710	64005710	+	Silent	SNP	C	C	T			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr15:64005710C>T	ENST00000443617.2	-	23	4392	c.4305G>A	c.(4303-4305)caG>caA	p.Q1435Q	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1435					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TGTACACATCCTGACCCTCAG	0.522																																																	0													98.0	96.0	97.0					15																	64005710		2101	4225	6326	SO:0001819	synonymous_variant	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4305G>A	15.37:g.64005710C>T		Somatic		WXS	SOLID	Phase_I	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1																																																																																				0.522	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1		NM_003922	
HSFX1	100506164	hgsc.bcm.edu	37	X	148856615	148856615	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chrX:148856615T>G	ENST00000370416.4	+	1	890	c.276T>G	c.(274-276)gaT>gaG	p.D92E		NM_016153.2	NP_057237.1	Q9UBD0	HSFX1_HUMAN	heat shock transcription factor family, X linked 1	92					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)					Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGGGAGAAGATAATCTCCTCT	0.562																																																	0																																										SO:0001583	missense	100506164				CCDS44011.1	Xq28	2011-05-26			ENSG00000171116	ENSG00000171116			29603	protein-coding gene	gene with protein product						15044259	Standard	NM_016153		Approved	LW-1		Q9UBD0	OTTHUMG00000022626	ENST00000370416.4:c.276T>G	X.37:g.148856615T>G	ENSP00000359444:p.Asp92Glu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000370416.4	37	CCDS44011.1	.	.	.	.	.	.	.	.	.	.	T	3.929	-0.016555	0.07681	.	.	ENSG00000171116	ENST00000370416	.	.	.	2.05	-4.11	0.03928	.	1.352190	0.05028	N	0.474126	T	0.18341	0.0440	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.12941	-1.0528	6	0.17369	T	0.5	-7.704	5.2003	0.15260	0.0:0.3212:0.154:0.5248	.	.	.	.	E	92	.	ENSP00000359444:D92E	D	+	3	2	HSFX1	148664423	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.001000	0.12947	-2.755000	0.00372	-1.982000	0.00454	GAT		0.562	HSFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058717.1		NM_016153	
LAMA5	3911	hgsc.bcm.edu	37	20	60906109	60906109	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr20:60906109T>C	ENST00000252999.3	-	29	3695	c.3629A>G	c.(3628-3630)cAc>cGc	p.H1210R	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1210	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			AAAGGCGCCGTGGCTGCTGAT	0.682																																																	0													21.0	24.0	23.0					20																	60906109		2196	4299	6495	SO:0001583	missense	3911			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.3629A>G	20.37:g.60906109T>C	ENSP00000252999:p.His1210Arg	Somatic		WXS	SOLID	Phase_I	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	T	16.14	3.037733	0.54896	.	.	ENSG00000130702	ENST00000252999	T	0.18502	2.21	5.08	5.08	0.68730	.	0.000000	0.85682	U	0.000000	T	0.38532	0.1044	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.15752	-1.0426	10	0.62326	D	0.03	.	14.8135	0.70013	0.0:0.0:0.0:1.0	.	1210	O15230	LAMA5_HUMAN	R	1210	ENSP00000252999:H1210R	ENSP00000252999:H1210R	H	-	2	0	LAMA5	60339504	1.000000	0.71417	0.233000	0.24025	0.008000	0.06430	6.055000	0.71103	1.905000	0.55150	0.402000	0.26972	CAC		0.682	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2		NM_005560	
LTF	4057	hgsc.bcm.edu	37	3	46480866	46480866	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr3:46480866A>T	ENST00000231751.4	-	15	2124	c.1829T>A	c.(1828-1830)cTt>cAt	p.L610H	LTF_ENST00000493056.1_5'UTR|LTF_ENST00000417439.1_Missense_Mutation_p.L608H|LTF_ENST00000426532.2_Missense_Mutation_p.L566H	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	610	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		GGCCATGGCAAGATGGCAGCT	0.547																																																	0													135.0	112.0	120.0					3																	46480866		2203	4300	6503	SO:0001583	missense	4057				CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.1829T>A	3.37:g.46480866A>T	ENSP00000231751:p.Leu610His	Somatic		WXS	SOLID	Phase_I	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	37	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	A	15.94	2.980801	0.53827	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.80259	0.4590	H	0.98466	4.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87452	0.2402	10	0.87932	D	0	.	13.5278	0.61605	1.0:0.0:0.0:0.0	.	608;597;610	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	H	610;566;608;597	ENSP00000231751:L610H;ENSP00000405719:L566H;ENSP00000405546:L608H;ENSP00000397427:L597H	ENSP00000231751:L610H	L	-	2	0	LTF	46455870	1.000000	0.71417	0.932000	0.37286	0.025000	0.11179	7.759000	0.85235	2.241000	0.73720	0.533000	0.62120	CTT		0.547	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2		NM_002343	
MUC16	94025	hgsc.bcm.edu	37	19	9085330	9085330	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr19:9085330T>C	ENST00000397910.4	-	1	6688	c.6485A>G	c.(6484-6486)gAg>gGg	p.E2162G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2162	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCAGTACTCTCAGATGTAAG	0.473																																																	0													57.0	56.0	56.0					19																	9085330		1916	4126	6042	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6485A>G	19.37:g.9085330T>C	ENSP00000381008:p.Glu2162Gly	Somatic		WXS	SOLID	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	2.274	-0.366237	0.05069	.	.	ENSG00000181143	ENST00000397910	T	0.02787	4.16	0.495	0.495	0.16890	.	.	.	.	.	T	0.03739	0.0106	N	0.08118	0	.	.	.	D	0.54772	0.968	P	0.59546	0.859	T	0.45977	-0.9224	7	0.87932	D	0	.	.	.	.	.	2162	B5ME49	.	G	2162	ENSP00000381008:E2162G	ENSP00000381008:E2162G	E	-	2	0	MUC16	8946330	0.032000	0.19561	0.032000	0.17829	0.043000	0.13939	0.781000	0.26774	0.424000	0.26061	0.260000	0.18958	GAG		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
NID1	4811	hgsc.bcm.edu	37	1	236143954	236143954	+	Splice_Site	SNP	C	C	T			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr1:236143954C>T	ENST00000264187.6	-	17	3310		c.e17-1		NID1_ENST00000366595.3_Splice_Site	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1						basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GTAAAGGTTCCTGGAGGAGGA	0.433																																																	0													48.0	52.0	50.0					1																	236143954		2203	4300	6503	SO:0001630	splice_region_variant	4811			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.3228-1G>A	1.37:g.236143954C>T		Somatic		WXS	SOLID	Phase_I	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Splice_Site	SNP	ENST00000264187.6	37	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.472370	0.63737	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6794	0.95956	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NID1	234210577	1.000000	0.71417	1.000000	0.80357	0.426000	0.31534	7.763000	0.85283	2.651000	0.90000	0.542000	0.68232	.		0.433	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2		NM_002508	Intron
NRK	203447	hgsc.bcm.edu;ucsc.edu	37	X	105197102	105197102	+	Silent	SNP	G	G	A			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chrX:105197102G>A	ENST00000243300.9	+	28	4893	c.4590G>A	c.(4588-4590)ctG>ctA	p.L1530L	NRK_ENST00000540278.1_Silent_p.L111L|NRK_ENST00000428173.2_Silent_p.L1531L	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1530	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CCAGGGTTCTGGAAAGTGAGC	0.458										HNSCC(51;0.14)																																							0													49.0	49.0	49.0					X																	105197102		1882	4108	5990	SO:0001819	synonymous_variant	203447			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.4590G>A	X.37:g.105197102G>A		Somatic		WXS	SOLID	Phase_I	Q32ND6|Q5H9K2|Q6ZMP2	Silent	SNP	ENST00000243300.9	37																																																																																					0.458	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6		NM_198465	
PLA2G2C	391013	hgsc.bcm.edu;ucsc.edu	37	1	20499305	20499305	+	Missense_Mutation	SNP	C	C	T	rs374046576		TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr1:20499305C>T	ENST00000429261.2	-	3	325	c.265G>A	c.(265-267)Gtc>Atc	p.V89I	PLA2G2C_ENST00000247992.5_Missense_Mutation_p.V90I|PLA2G2C_ENST00000495760.2_Intron			Q5R387	PA2GC_HUMAN	phospholipase A2, group IIC	89					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)	7		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.14e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.000528)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCGCCATTGACGATGTGGAAC	0.517																																																	0													71.0	72.0	72.0					1																	20499305		1977	4159	6136	SO:0001583	missense	391013					1p36.12	2010-06-04	2003-10-13		ENSG00000187980	ENSG00000187980			9032	protein-coding gene	gene with protein product			"""phospholipase A2, group IIC (possible pseudogene)"""			8838795	Standard	NM_001105572		Approved		uc009vpq.1	Q5R387	OTTHUMG00000002705	ENST00000429261.2:c.265G>A	1.37:g.20499305C>T	ENSP00000389335:p.Val89Ile	Somatic		WXS	SOLID	Phase_I	Q7M4M6	Missense_Mutation	SNP	ENST00000429261.2	37		.	.	.	.	.	.	.	.	.	.	C	4.737	0.136985	0.09032	.	.	ENSG00000187980	ENST00000429261;ENST00000247992	T;T	0.26660	1.72;1.72	5.06	-0.129	0.13502	Phospholipase A2 (3);	0.982098	0.08315	N	0.964719	T	0.20981	0.0505	L	0.47078	1.49	0.09310	N	1	B	0.22211	0.066	B	0.20955	0.032	T	0.34304	-0.9834	10	0.72032	D	0.01	.	4.6256	0.12476	0.0:0.5067:0.1517:0.3415	.	89	Q5R387	PA2GC_HUMAN	I	89;90	ENSP00000389335:V89I;ENSP00000247992:V90I	ENSP00000247992:V90I	V	-	1	0	PLA2G2C	20371892	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.629000	0.05508	-0.090000	0.12462	-0.123000	0.14984	GTC		0.517	PLA2G2C-001	PUTATIVE	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000007689.3		NM_001105572	
PRSS38	339501	hgsc.bcm.edu;ucsc.edu	37	1	228033871	228033871	+	Missense_Mutation	SNP	G	G	A	rs375623854	byFrequency	TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr1:228033871G>A	ENST00000366757.3	+	5	967	c.943G>A	c.(943-945)Gtc>Atc	p.V315I		NM_183062.2	NP_898885.1	A1L453	PRS38_HUMAN	protease, serine, 38	315						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						CACTCTCAGCGTCCTAATGGC	0.567													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		17109	0.0		0.0	False		,,,				2504	0.0																0								G	ILE/VAL	0,4406		0,0,2203	76.0	73.0	74.0		943	0.5	0.0	1		74	1,8599	1.2+/-3.3	0,1,4299	no	missense	PRSS38	NM_183062.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	315/327	228033871	1,13005	2203	4300	6503	SO:0001583	missense	339501				CCDS1563.1	1q42.13	2010-05-07			ENSG00000185888	ENSG00000185888		"""Serine peptidases / Serine peptidases"""	29625	protein-coding gene	gene with protein product	"""marapsin 2"""					12838346	Standard	NM_183062		Approved	MPN2	uc001hrh.3	A1L453	OTTHUMG00000037701	ENST00000366757.3:c.943G>A	1.37:g.228033871G>A	ENSP00000355719:p.Val315Ile	Somatic		WXS	SOLID	Phase_I	Q7RTY6	Missense_Mutation	SNP	ENST00000366757.3	37	CCDS1563.1	.	.	.	.	.	.	.	.	.	.	G	1.122	-0.655132	0.03480	0.0	1.16E-4	ENSG00000185888	ENST00000366757	D	0.88509	-2.39	4.73	0.496	0.16896	.	1.188110	0.06611	N	0.755656	T	0.71151	0.3306	N	0.08118	0	0.09310	N	1	B	0.29612	0.251	B	0.14023	0.01	T	0.59878	-0.7371	10	0.02654	T	1	.	7.052	0.25079	0.4314:0.0:0.5686:0.0	.	315	A1L453	PRS38_HUMAN	I	315	ENSP00000355719:V315I	ENSP00000355719:V315I	V	+	1	0	PRSS38	226100494	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.182000	0.09726	-0.107000	0.12088	-0.222000	0.12452	GTC		0.567	PRSS38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091981.1		NM_183062	
RP1	6101	hgsc.bcm.edu	37	8	55540233	55540233	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr8:55540233T>C	ENST00000220676.1	+	4	3939	c.3791T>C	c.(3790-3792)gTa>gCa	p.V1264A		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1264					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.V1264E(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ATGTGCACTGTAAATAAGGCT	0.448																																					Colon(91;1014 1389 7634 14542 40420)												1	Substitution - Missense(1)	ovary(1)											155.0	149.0	151.0					8																	55540233		2203	4300	6503	SO:0001583	missense	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3791T>C	8.37:g.55540233T>C	ENSP00000220676:p.Val1264Ala	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	T	10.24	1.296391	0.23650	.	.	ENSG00000104237	ENST00000220676	T	0.26810	1.71	4.85	-1.77	0.07982	.	0.812859	0.10623	N	0.653167	T	0.14830	0.0358	L	0.34521	1.04	0.09310	N	1	B	0.25667	0.131	B	0.25140	0.058	T	0.33394	-0.9870	10	0.87932	D	0	.	0.756	0.00999	0.1701:0.2926:0.1758:0.3615	.	1264	P56715	RP1_HUMAN	A	1264	ENSP00000220676:V1264A	ENSP00000220676:V1264A	V	+	2	0	RP1	55702786	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.015000	0.13355	-0.168000	0.10853	-0.256000	0.11100	GTA		0.448	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2		NM_006269	
SHMT2	6472	hgsc.bcm.edu	37	12	57627119	57627119	+	Silent	SNP	C	C	A			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr12:57627119C>A	ENST00000328923.3	+	8	1466	c.1014C>A	c.(1012-1014)gcC>gcA	p.A338A	SHMT2_ENST00000553474.1_Silent_p.A317A|SHMT2_ENST00000557487.1_Silent_p.A328A|SHMT2_ENST00000449049.3_Silent_p.A317A|SHMT2_ENST00000414700.3_Silent_p.A317A|SHMT2_ENST00000393827.4_Silent_p.A242A	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	338					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	TAGCTGTGGCCCTAAAGCAGG	0.572																																					Esophageal Squamous(150;1369 2416 49071 49364)												0													42.0	44.0	44.0					12																	57627119		2203	4300	6503	SO:0001819	synonymous_variant	6472			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.1014C>A	12.37:g.57627119C>A		Somatic		WXS	SOLID	Phase_I	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Silent	SNP	ENST00000328923.3	37	CCDS8934.1	.	.	.	.	.	.	.	.	.	.	C	3.473	-0.107618	0.06924	.	.	ENSG00000182199	ENST00000557529	.	.	.	4.62	-0.695	0.11291	.	.	.	.	.	T	0.41190	0.1148	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24119	-1.0169	4	.	.	.	-0.2111	1.5886	0.02649	0.1404:0.2942:0.1376:0.4278	.	.	.	.	T	138	.	.	P	+	1	0	SHMT2	55913386	0.009000	0.17119	0.989000	0.46669	0.395000	0.30598	-1.027000	0.03592	-0.223000	0.09943	-0.291000	0.09656	CCT		0.572	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2		NM_005412	
SLC10A2	6555	hgsc.bcm.edu	37	13	103718249	103718249	+	Nonsense_Mutation	SNP	A	A	T	rs200030539		TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr13:103718249A>T	ENST00000245312.3	-	1	947	c.351T>A	c.(349-351)taT>taA	p.Y117*		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	117					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	CATCGACCCAATAGGCCAAGA	0.502																																																	0													85.0	81.0	83.0					13																	103718249		2203	4300	6503	SO:0001587	stop_gained	6555			U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.351T>A	13.37:g.103718249A>T	ENSP00000245312:p.Tyr117*	Somatic		WXS	SOLID	Phase_I	A1L4F4|Q13839	Nonsense_Mutation	SNP	ENST00000245312.3	37	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	A	42	9.283170	0.99123	.	.	ENSG00000125255	ENST00000245312	.	.	.	5.25	-5.04	0.02964	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2304	18.5105	0.90914	0.1518:0.0:0.8482:0.0	.	.	.	.	X	117	.	ENSP00000245312:Y117X	Y	-	3	2	SLC10A2	102516250	0.997000	0.39634	0.956000	0.39512	0.897000	0.52465	0.477000	0.22196	-0.889000	0.03950	-0.256000	0.11100	TAT		0.502	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1			
SPTA1	6708	hgsc.bcm.edu;ucsc.edu	37	1	158621257	158621257	+	Splice_Site	SNP	T	T	G			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr1:158621257T>G	ENST00000368147.4	-	24	3557	c.3377A>C	c.(3376-3378)gAt>gCt	p.D1126A		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1126					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GGTATTCAAATCCTGAATGGG	0.433																																																	0													153.0	153.0	153.0					1																	158621257		1885	4112	5997	SO:0001630	splice_region_variant	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3376-1A>C	1.37:g.158621257T>G		Somatic		WXS	SOLID	Phase_I	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.065711	0.76187	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.69435	-0.4;-0.4	4.42	4.42	0.53409	.	.	.	.	.	T	0.79393	0.4438	M	0.87547	2.89	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.82641	-0.0357	9	0.56958	D	0.05	.	12.9547	0.58421	0.0:0.0:0.0:1.0	.	1126	P02549	SPTA1_HUMAN	A	1126	ENSP00000357130:D1126A;ENSP00000357129:D1126A	ENSP00000357129:D1126A	D	-	2	0	SPTA1	156887881	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.008000	0.76341	1.990000	0.58119	0.533000	0.62120	GAT		0.433	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3		NM_003126	Missense_Mutation
ST3GAL4	6484	hgsc.bcm.edu;ucsc.edu	37	11	126283465	126283465	+	Silent	SNP	C	C	T	rs374972599		TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr11:126283465C>T	ENST00000526727.1	+	9	1211	c.837C>T	c.(835-837)gcC>gcT	p.A279A	ST3GAL4_ENST00000530591.1_Silent_p.A275A|ST3GAL4_ENST00000356132.4_Silent_p.A285A|ST3GAL4_ENST00000227495.6_Silent_p.A275A|ST3GAL4_ENST00000534083.1_Silent_p.A279A|ST3GAL4_ENST00000534457.1_Silent_p.A274A|ST3GAL4_ENST00000444328.2_Silent_p.A279A|ST3GAL4_ENST00000449406.2_Silent_p.A268A|ST3GAL4_ENST00000392669.2_Silent_p.A279A|ST3GAL4_ENST00000532243.1_Silent_p.A278A			Q11206	SIA4C_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 4	279					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|monosialoganglioside sialyltransferase activity (GO:0047288)			endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)		TGCACATTGCCGGCTTTGGCT	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		16872	0.0		0.001	False		,,,				2504	0.0																0								C		0,4402		0,0,2201	106.0	93.0	97.0		825	-10.7	0.1	11		97	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	ST3GAL4	NM_006278.1		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		275/330	126283465	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	6484			X74570	CCDS8474.1, CCDS58193.1, CCDS58194.1	11q23-q24	2013-03-01	2003-01-14	2005-02-07	ENSG00000110080	ENSG00000110080	2.4.99.4	"""Sialyltransferases"""	10864	protein-coding gene	gene with protein product	"""ST3Gal IV"""	104240	"""sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase)"""	CGS23, SIAT4, NANTA3, SIAT4C		8557707, 8288606	Standard	NM_006278		Approved	STZ, SAT3, FLJ11867	uc001qds.3	Q11206	OTTHUMG00000165830	ENST00000526727.1:c.837C>T	11.37:g.126283465C>T		Somatic		WXS	SOLID	Phase_I	A8K6B2|O60497|Q8N6A6|Q8NFG7|Q96QQ9	Silent	SNP	ENST00000526727.1	37	CCDS58193.1																																																																																				0.582	ST3GAL4-003	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386470.1		NM_006278	
SYT5	6861	hgsc.bcm.edu	37	19	55690359	55690359	+	Silent	SNP	G	G	A			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr19:55690359G>A	ENST00000354308.3	-	2	420	c.51C>T	c.(49-51)ccC>ccT	p.P17P	CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000537500.1_Silent_p.P17P|SYT5_ENST00000590851.1_Missense_Mutation_p.P72L	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	17					calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GACTGGAGTCGGGAGGCGTGT	0.677																																																	0													17.0	24.0	21.0					19																	55690359		2200	4295	6495	SO:0001819	synonymous_variant	6861			X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.51C>T	19.37:g.55690359G>A		Somatic		WXS	SOLID	Phase_I	B3KWJ8|B7Z300|Q86X72	Silent	SNP	ENST00000354308.3	37	CCDS12919.1	.	.	.	.	.	.	.	.	.	.	G	0.191	-1.053533	0.01965	.	.	ENSG00000129990	ENST00000543844	.	.	.	3.54	-7.09	0.01553	.	0.184523	0.32852	U	0.005563	T	0.32675	0.0837	.	.	.	0.42411	D	0.992601	B	0.02656	0.0	B	0.01281	0.0	T	0.59700	-0.7405	8	0.29301	T	0.29	.	1.1412	0.01766	0.1036:0.341:0.2207:0.3347	.	72	B7Z300	.	L	72	.	ENSP00000441336:P72L	P	-	2	0	SYT5	60382171	0.000000	0.05858	0.018000	0.16275	0.067000	0.16453	-6.802000	0.00053	-5.364000	0.00016	-1.211000	0.01629	CCG		0.677	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1		NM_003180	
TGM1	7051	hgsc.bcm.edu	37	14	24729679	24729679	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr14:24729679A>G	ENST00000206765.6	-	4	857	c.734T>C	c.(733-735)aTc>aCc	p.I245T	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	245					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GTTGAAGAGGATGTAGATCTC	0.592																																																	0													91.0	80.0	84.0					14																	24729679		2203	4300	6503	SO:0001583	missense	7051			D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.734T>C	14.37:g.24729679A>G	ENSP00000206765:p.Ile245Thr	Somatic		WXS	SOLID	Phase_I	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.493256	0.84962	.	.	ENSG00000092295	ENST00000206765	D	0.88509	-2.39	5.49	5.49	0.81192	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.139879	0.64402	D	0.000007	D	0.91250	0.7242	M	0.76328	2.33	0.80722	D	1	P	0.52842	0.956	P	0.50082	0.63	D	0.92385	0.5916	10	0.87932	D	0	-34.1866	14.7155	0.69265	1.0:0.0:0.0:0.0	.	245	P22735	TGM1_HUMAN	T	245	ENSP00000206765:I245T	ENSP00000206765:I245T	I	-	2	0	TGM1	23799519	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.564000	0.90726	2.311000	0.77944	0.533000	0.62120	ATC		0.592	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6		NM_000359	
TNS1	7145	hgsc.bcm.edu	37	2	218683139	218683139	+	Missense_Mutation	SNP	G	G	A	rs34291329	byFrequency	TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr2:218683139G>A	ENST00000171887.4	-	24	4056	c.3604C>T	c.(3604-3606)Ccc>Tcc	p.P1202S	TNS1_ENST00000430930.1_Missense_Mutation_p.P1181S|TNS1_ENST00000419504.1_Missense_Mutation_p.P1189S	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1202					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GCCATGCTGGGATTGATGGCC	0.652													G|||	332	0.0662939	0.0514	0.0591	5008	,	,		16428	0.0169		0.0934	False		,,,				2504	0.1145																0								G	SER/PRO	208,4198	124.9+/-162.1	9,190,2004	53.0	55.0	54.0		3604	1.8	0.4	2	dbSNP_126	54	654,7946	161.9+/-214.7	27,600,3673	yes	missense	TNS1	NM_022648.4	74	36,790,5677	AA,AG,GG		7.6047,4.7208,6.6277	benign	1202/1736	218683139	862,12144	2203	4300	6503	SO:0001583	missense	7145			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.3604C>T	2.37:g.218683139G>A	ENSP00000171887:p.Pro1202Ser	Somatic		WXS	SOLID	Phase_I	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	CCDS2407.1	119	0.05448717948717949	9	0.018292682926829267	24	0.06629834254143646	12	0.02097902097902098	74	0.09762532981530343	G	2.490	-0.317753	0.05386	0.047208	0.076047	ENSG00000079308	ENST00000171887;ENST00000446688;ENST00000419504;ENST00000430930	D;T;D;D	0.91011	-2.76;2.24;-2.77;-2.77	4.61	1.8	0.24995	.	0.745176	0.12454	N	0.467518	T	0.13372	0.0324	L	0.43152	1.355	0.09310	P	0.9999999999958005	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.52749	-0.8534	9	0.10636	T	0.68	.	4.9661	0.14091	0.1568:0.0:0.4276:0.4157	rs34291329	1202;1181;1189	Q9HBL0;E9PGF5;E9PF55	TENS1_HUMAN;.;.	S	1202;340;1189;1181	ENSP00000171887:P1202S;ENSP00000394171:P340S;ENSP00000408724:P1189S;ENSP00000406016:P1181S	ENSP00000171887:P1202S	P	-	1	0	TNS1	218391384	0.275000	0.24201	0.363000	0.25875	0.806000	0.45545	0.330000	0.19715	0.190000	0.20209	0.563000	0.77884	CCC		0.652	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2		NM_022648	
USP18	11274	hgsc.bcm.edu	37	22	18640560	18640560	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4354-01A-02D-1366-10	TCGA-BP-4354-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	48897095-d6f8-481a-9dfb-b1d1e6b4c723	ee2d7355-8f21-4626-9979-9dcf6d03a88e	g.chr22:18640560C>A	ENST00000215794.7	+	2	560	c.130C>A	c.(130-132)Cgt>Agt	p.R44S		NM_017414.3	NP_059110.2	Q9UMW8	UBP18_HUMAN	ubiquitin specific peptidase 18	44					cytokine-mediated signaling pathway (GO:0019221)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|stomach(1)	10						GCCCAGAGAGCGTCCCAGGGC	0.547																																																	0													111.0	109.0	110.0					22																	18640560		2203	4300	6503	SO:0001583	missense	11274			AJ243526	CCDS13752.1	22q11.2	2008-04-11	2005-08-08		ENSG00000184979	ENSG00000184979		"""Ubiquitin-specific peptidases"""	12616	protein-coding gene	gene with protein product		607057	"""ubiquitin specific protease 18"""			12838346	Standard	NM_017414		Approved		uc002zny.3	Q9UMW8	OTTHUMG00000150104	ENST00000215794.7:c.130C>A	22.37:g.18640560C>A	ENSP00000215794:p.Arg44Ser	Somatic		WXS	SOLID	Phase_I	Q53Y90|Q6IAD9|Q9NY71	Missense_Mutation	SNP	ENST00000215794.7	37	CCDS13752.1	.	.	.	.	.	.	.	.	.	.	.	5.414	0.261530	0.10239	.	.	ENSG00000184979	ENST00000215794	T	0.06528	3.29	4.48	0.953	0.19590	.	2.692560	0.00941	N	0.002826	T	0.03651	0.0104	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38200	-0.9672	10	0.12766	T	0.61	.	5.212	0.15322	0.1989:0.6591:0.0:0.142	.	44	Q9UMW8	UBP18_HUMAN	S	44	ENSP00000215794:R44S	ENSP00000215794:R44S	R	+	1	0	USP18	17020560	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.183000	0.03079	0.119000	0.18210	0.591000	0.81541	CGT		0.547	USP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316368.1			
