#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DNAJC16	23341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	15894410	15894410	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:15894410G>A	ENST00000375847.3	+	15	2251	c.2087G>A	c.(2086-2088)gGt>gAt	p.G696D	DNAJC16_ENST00000483270.1_3'UTR|DNAJC16_ENST00000375849.1_Intron|RP4-680D5.8_ENST00000606186.1_RNA	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	696					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GACTACACTGGTTATGTACTG	0.443																																					p.G696D		.											.	DNAJC16-226	0			c.G2087A						.						148.0	134.0	139.0					1																	15894410		2203	4300	6503	SO:0001583	missense	23341	exon15			ACACTGGTTATGT	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.2087G>A	1.37:g.15894410G>A	ENSP00000365007:p.Gly696Asp	Somatic	162	0		WXS	Illumina HiSeq	Phase_I	123	26	NM_015291	0	0	8	21	13	Q68D57|Q86X32|Q8N5P4	Missense_Mutation	SNP	ENST00000375847.3	37	CCDS30606.1	.	.	.	.	.	.	.	.	.	.	G	31	5.059726	0.93846	.	.	ENSG00000116138	ENST00000375847	D	0.94417	-3.42	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.97173	0.9076	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97352	0.9964	10	0.87932	D	0	-20.3895	18.8118	0.92061	0.0:0.0:1.0:0.0	.	696	Q9Y2G8	DJC16_HUMAN	D	696	ENSP00000365007:G696D	ENSP00000365007:G696D	G	+	2	0	DNAJC16	15766997	1.000000	0.71417	0.501000	0.27601	0.987000	0.75469	9.238000	0.95380	2.790000	0.95986	0.655000	0.94253	GGT	.		0.443	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
BAI2	576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	32203282	32203282	+	Silent	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:32203282G>A	ENST00000373658.3	-	19	3188	c.2847C>T	c.(2845-2847)acC>acT	p.T949T	BAI2_ENST00000398538.1_Silent_p.T937T|BAI2_ENST00000398556.3_Silent_p.T897T|BAI2_ENST00000527361.1_Silent_p.T949T|BAI2_ENST00000257070.4_Silent_p.T949T|BAI2_ENST00000398547.1_Silent_p.T882T|BAI2_ENST00000440175.2_Silent_p.T591T|BAI2_ENST00000398542.1_Silent_p.T882T|BAI2_ENST00000373655.2_Silent_p.T949T|BAI2_ENST00000465256.1_5'Flank	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	949					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TGGCGAGCAGGGTGAGCAGCG	0.667																																					p.T949T		.											.	BAI2-526	0			c.C2847T						.						40.0	39.0	39.0					1																	32203282		2202	4299	6501	SO:0001819	synonymous_variant	576	exon19			GAGCAGGGTGAGC	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.2847C>T	1.37:g.32203282G>A		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	56	22	NM_001703	0	0	0	1	1	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Silent	SNP	ENST00000373658.3	37	CCDS346.2																																																																																			.		0.667	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
CSMD2	114784	hgsc.bcm.edu	37	1	34128679	34128679	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:34128679C>G	ENST00000373380.1	-	5	905	c.685G>C	c.(685-687)Gtg>Ctg	p.V229L	CSMD2_ENST00000373381.4_Missense_Mutation_p.V1356L|CSMD2_ENST00000373388.2_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1316	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTGTCAAACACCAGGAAGTGT	0.592																																					p.V1316L		.											.	CSMD2-103	0			c.G3946C						.						69.0	62.0	65.0					1																	34128679		2203	4300	6503	SO:0001583	missense	114784	exon26			CAAACACCAGGAA	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.685G>C	1.37:g.34128679C>G	ENSP00000362478:p.Val229Leu	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_052896	0	0	0	0	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		.	.	.	.	.	.	.	.	.	.	C	26.3	4.720946	0.89205	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.17528	2.27;2.27	5.22	5.22	0.72569	CUB (5);	0.000000	0.85682	D	0.000000	T	0.33731	0.0873	L	0.46947	1.48	0.80722	D	1	P;D;D	0.65815	0.816;0.995;0.96	P;P;P	0.62382	0.667;0.901;0.838	T	0.00872	-1.1532	10	0.42905	T	0.14	.	18.1292	0.89596	0.0:1.0:0.0:0.0	.	229;1316;1356	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	L	1356;229	ENSP00000362479:V1356L;ENSP00000362478:V229L	ENSP00000241312:V1316L	V	-	1	0	CSMD2	33901266	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.776000	0.85560	2.606000	0.88127	0.561000	0.74099	GTG	.		0.592	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
LEPROT	54741	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	65895651	65895651	+	Silent	SNP	C	C	A	rs147651845	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:65895651C>A	ENST00000371065.4	+	3	337	c.199C>A	c.(199-201)Cgg>Agg	p.R67R	LEPR_ENST00000371060.3_Intron|LEPROT_ENST00000484243.1_3'UTR|LEPR_ENST00000344610.8_Intron|LEPR_ENST00000371059.3_Intron|LEPR_ENST00000349533.6_Intron|LEPR_ENST00000406510.3_Intron	NM_001198681.1|NM_017526.4	NP_001185610.1|NP_059996.1	O15243	OBRG_HUMAN	leptin receptor overlapping transcript	67					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			kidney(1)|large_intestine(1)|lung(5)	7				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TAGTGCCTGTCGGGAACTGGC	0.453																																					p.R76R		.											.	LEPROT-90	0			c.C226A						.						337.0	318.0	325.0					1																	65895651		2203	4300	6503	SO:0001819	synonymous_variant	54741	exon4			GCCTGTCGGGAAC	Y12670	CCDS630.1, CCDS72801.1	1p31.2	2008-02-05			ENSG00000213625	ENSG00000213625			29477	protein-coding gene	gene with protein product	"""leptin receptor gene related protein"""	613461				9207021	Standard	NM_001198681		Approved	OBRGRP, OB-RGRP, VPS55, FLJ90360	uc001dcf.3	O15243	OTTHUMG00000009065	ENST00000371065.4:c.199C>A	1.37:g.65895651C>A		Somatic	428	2		WXS	Illumina HiSeq	Phase_I	189	17	NM_001198681	0	0	175	175	0	Q6FHL5	Silent	SNP	ENST00000371065.4	37	CCDS630.1																																																																																			C|1.000;T|0.000		0.453	LEPROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025132.4	NM_017526	
ABCA4	24	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94502837	94502837	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:94502837C>A	ENST00000370225.3	-	25	3763	c.3677G>T	c.(3676-3678)gGt>gTt	p.G1226V		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1226					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AAGTTCTTGACCAATGCACTC	0.478																																					p.G1226V		.											.	ABCA4-162	0			c.G3677T						.						120.0	117.0	118.0					1																	94502837		2203	4300	6503	SO:0001583	missense	24	exon25			TCTTGACCAATGC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3677G>T	1.37:g.94502837C>A	ENSP00000359245:p.Gly1226Val	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	80	14	NM_000350	0	0	0	0	0	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522436	0.85600	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	T	0.80123	-1.34	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.90954	0.7156	H	0.96080	3.765	0.80722	D	1	D	0.56746	0.977	P	0.55011	0.766	D	0.93070	0.6482	10	0.87932	D	0	.	19.5916	0.95514	0.0:1.0:0.0:0.0	.	1226	P78363	ABCA4_HUMAN	V	18;1226	ENSP00000359245:G1226V	ENSP00000359245:G1226V	G	-	2	0	ABCA4	94275425	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.320000	0.79064	2.861000	0.98227	0.655000	0.94253	GGT	.		0.478	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
KCNA2	3737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	111146524	111146524	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:111146524C>A	ENST00000485317.1	-	3	1554	c.881G>T	c.(880-882)cGt>cTt	p.R294L	KCNA2_ENST00000369770.3_Missense_Mutation_p.R294L|KCNA2_ENST00000316361.4_Missense_Mutation_p.R294L|KCNA2_ENST00000440270.1_Missense_Mutation_p.R294L|KCNA2_ENST00000525120.1_5'Flank			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	294					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	CCGGATGACACGGAGGATGGC	0.537																																					p.R294L	Pancreas(18;568 735 10587 23710 36357)	.											.	KCNA2-91	0			c.G881T						.						102.0	103.0	103.0					1																	111146524		2203	4300	6503	SO:0001583	missense	3737	exon3			ATGACACGGAGGA	L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.881G>T	1.37:g.111146524C>A	ENSP00000433109:p.Arg294Leu	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	92	33	NM_001204269	0	0	0	1	1	Q86XG6	Missense_Mutation	SNP	ENST00000485317.1	37	CCDS827.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212566	0.58452	.	.	ENSG00000177301	ENST00000369770;ENST00000485317;ENST00000440270;ENST00000316361	D;D;D;D	0.99005	-4.93;-5.32;-5.32;-5.32	5.87	5.87	0.94306	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99704	0.9887	H	0.98818	4.34	0.80722	D	1	D;D	0.71674	0.998;0.962	D;P	0.71414	0.973;0.748	D	0.97484	1.0049	10	0.87932	D	0	.	20.2182	0.98305	0.0:1.0:0.0:0.0	.	294;294	Q86XG6;P16389	.;KCNA2_HUMAN	L	294	ENSP00000358785:R294L;ENSP00000433109:R294L;ENSP00000415257:R294L;ENSP00000314520:R294L	ENSP00000314520:R294L	R	-	2	0	KCNA2	110948047	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.770000	0.85390	2.785000	0.95823	0.655000	0.94253	CGT	.		0.537	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128001.2	NM_004974	
SPAG17	200162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	118535132	118535132	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:118535132A>T	ENST00000336338.5	-	36	5383	c.5318T>A	c.(5317-5319)gTc>gAc	p.V1773D		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1773						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ATTCTTTATGACCTCATGCTG	0.473																																					p.V1773D		.											.	SPAG17-158	0			c.T5318A						.						116.0	112.0	113.0					1																	118535132		2203	4300	6503	SO:0001583	missense	200162	exon36			TTTATGACCTCAT		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5318T>A	1.37:g.118535132A>T	ENSP00000337804:p.Val1773Asp	Somatic	174	0		WXS	Illumina HiSeq	Phase_I	100	25	NM_206996	0	0	0	0	0	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	A	18.16	3.562988	0.65538	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.19105	2.17	5.38	3.1	0.35709	.	0.311094	0.33854	N	0.004486	T	0.13329	0.0323	L	0.54323	1.7	0.41943	D	0.990622	P	0.47677	0.899	P	0.48227	0.571	T	0.02301	-1.1180	10	0.66056	D	0.02	.	5.9646	0.19318	0.6602:0.0:0.3398:0.0	.	1773	Q6Q759	SPG17_HUMAN	D	1773;253	ENSP00000337804:V1773D	ENSP00000337804:V1773D	V	-	2	0	SPAG17	118336655	1.000000	0.71417	0.993000	0.49108	0.946000	0.59487	3.048000	0.49862	0.886000	0.36113	-0.250000	0.11733	GTC	.		0.473	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
HRNR	388697	hgsc.bcm.edu	37	1	152187192	152187192	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:152187192G>A	ENST00000368801.2	-	3	6988	c.6913C>T	c.(6913-6915)Cat>Tat	p.H2305Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2305					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCGGACCCATGTCGGCCGCGA	0.612																																					p.H2305Y		.											.	HRNR-93	0			c.C6913T						.						7.0	12.0	11.0					1																	152187192		1487	3704	5191	SO:0001583	missense	388697	exon3			ACCCATGTCGGCC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.6913C>T	1.37:g.152187192G>A	ENSP00000357791:p.His2305Tyr	Somatic	1440	0		WXS	Illumina HiSeq	Phase_I	1346	83	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	5.809	0.333472	0.11013	.	.	ENSG00000197915	ENST00000368801	T	0.18810	2.19	3.38	1.4	0.22301	.	.	.	.	.	T	0.04543	0.0124	L	0.48642	1.525	0.09310	N	1	B	0.21821	0.061	B	0.14578	0.011	T	0.44406	-0.9330	9	0.11485	T	0.65	.	5.4473	0.16541	0.1147:0.0:0.6863:0.199	.	2305	Q86YZ3	HORN_HUMAN	Y	2305	ENSP00000357791:H2305Y	ENSP00000357791:H2305Y	H	-	1	0	HRNR	150453816	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.807000	0.04520	0.232000	0.21100	0.650000	0.86243	CAT	.		0.612	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
CADM3	57863	broad.mit.edu	37	1	159169659	159169659	+	Silent	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:159169659G>A	ENST00000368125.4	+	8	1228	c.1071G>A	c.(1069-1071)cgG>cgA	p.R357R	CADM3_ENST00000368124.4_Silent_p.R391R|CTA-134P22.2_ENST00000609696.1_RNA|CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000497636.1_3'UTR	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	357					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.R391R(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					ACTTGATCCGGCACAAAGGTC	0.562																																					p.R391R													.	CADM3-92	2	Substitution - coding silent(2)	endometrium(1)|central_nervous_system(1)	c.G1173A						.						95.0	75.0	82.0					1																	159169659		2203	4300	6503	SO:0001819	synonymous_variant	57863	exon9			GATCCGGCACAAA	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.1071G>A	1.37:g.159169659G>A		Somatic	35	1		WXS	Illumina HiSeq	Phase_I	44	4	NM_021189	0	0	0	0	0	Q8IZQ9|Q9NVJ5|Q9UJP1	Silent	SNP	ENST00000368125.4	37	CCDS44251.1																																																																																			.		0.562	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189	
FMO4	2329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	171303684	171303684	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:171303684T>C	ENST00000367749.3	+	8	1292	c.962T>C	c.(961-963)aTt>aCt	p.I321T		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	321					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					GAAGAAAACATTGATGTTGTG	0.368																																					p.I321T	Pancreas(24;816 862 7754 7993 32832)	.											.	FMO4-537	0			c.T962C						.						92.0	95.0	94.0					1																	171303684		2203	4300	6503	SO:0001583	missense	2329	exon8			AAAACATTGATGT	BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.962T>C	1.37:g.171303684T>C	ENSP00000356723:p.Ile321Thr	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	79	31	NM_002022	0	0	4	8	4	Q53XR0	Missense_Mutation	SNP	ENST00000367749.3	37	CCDS1295.1	.	.	.	.	.	.	.	.	.	.	T	18.64	3.668252	0.67814	.	.	ENSG00000076258	ENST00000367749	T	0.56941	0.43	5.63	4.47	0.54385	.	0.249916	0.40144	N	0.001171	T	0.72170	0.3427	M	0.93978	3.48	0.41142	D	0.985967	D	0.69078	0.997	D	0.77557	0.99	T	0.80176	-0.1491	10	0.87932	D	0	-9.0886	12.3662	0.55230	0.0:0.0:0.1412:0.8588	.	321	P31512	FMO4_HUMAN	T	321	ENSP00000356723:I321T	ENSP00000356723:I321T	I	+	2	0	FMO4	169570308	1.000000	0.71417	0.246000	0.24233	0.910000	0.53928	6.102000	0.71486	0.918000	0.36919	0.528000	0.53228	ATT	.		0.368	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086223.1	NM_002022	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	180063597	180063597	+	Missense_Mutation	SNP	A	A	T	rs573430116		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:180063597A>T	ENST00000367607.3	+	34	8775	c.8357A>T	c.(8356-8358)cAg>cTg	p.Q2786L	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2786					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CTTAGCAATCAGGAGCTTCTT	0.388																																					p.Q2786L		.											.	CEP350-26	0			c.A8357T						.						59.0	59.0	59.0					1																	180063597		2203	4300	6503	SO:0001583	missense	9857	exon34			GCAATCAGGAGCT	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.8357A>T	1.37:g.180063597A>T	ENSP00000356579:p.Gln2786Leu	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	47	16	NM_014810	0	0	7	12	5	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	A	17.39	3.377132	0.61735	.	.	ENSG00000135837	ENST00000367607;ENST00000417046	T	0.61859	0.07	5.31	5.31	0.75309	.	0.000000	0.44902	D	0.000414	T	0.70657	0.3249	M	0.72118	2.19	0.45662	D	0.998587	D;P	0.60160	0.987;0.935	D;P	0.67725	0.953;0.614	T	0.72007	-0.4420	9	.	.	.	.	9.4328	0.38620	0.9192:0.0:0.0808:0.0	.	2786;2786	E7EU22;Q5VT06	.;CE350_HUMAN	L	2786;250	ENSP00000356579:Q2786L	.	Q	+	2	0	CEP350	178330220	1.000000	0.71417	0.993000	0.49108	0.935000	0.57460	2.342000	0.43992	2.126000	0.65437	0.482000	0.46254	CAG	.		0.388	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
OBSCN	84033	hgsc.bcm.edu	37	1	228494611	228494611	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:228494611T>C	ENST00000422127.1	+	45	11980	c.11936T>C	c.(11935-11937)gTg>gCg	p.V3979A	OBSCN_ENST00000570156.2_Missense_Mutation_p.V4936A|OBSCN_ENST00000366709.4_Missense_Mutation_p.V1098A|OBSCN_ENST00000284548.11_Missense_Mutation_p.V3979A|OBSCN_ENST00000366707.4_Missense_Mutation_p.V1613A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3979	Ig-like 41.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTGCGCCTGTGCGGTTCCTC	0.662																																					p.V4936A		.											.	OBSCN-403	0			c.T14807C						.						10.0	12.0	11.0					1																	228494611		2080	4192	6272	SO:0001583	missense	84033	exon56			CGCCTGTGCGGTT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11936T>C	1.37:g.228494611T>C	ENSP00000409493:p.Val3979Ala	Somatic	6	2		WXS	Illumina HiSeq	Phase_I	9	8	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	T	14.85	2.657906	0.47467	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.05382	3.45;3.45;3.45;3.45	5.75	5.75	0.90469	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.10252	0.0251	M	0.71206	2.165	0.33071	D	0.535386	B;P	0.35872	0.333;0.525	B;B	0.39660	0.306;0.116	T	0.06807	-1.0806	10	0.10111	T	0.7	.	11.8999	0.52678	0.0:0.0698:0.0:0.9302	.	3979;3979	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	A	3979;3979;1613;1098	ENSP00000284548:V3979A;ENSP00000409493:V3979A;ENSP00000355668:V1613A;ENSP00000355670:V1098A	ENSP00000284548:V3979A	V	+	2	0	OBSCN	226561234	0.986000	0.35501	0.213000	0.23690	0.014000	0.08584	2.048000	0.41278	2.198000	0.70561	0.379000	0.24179	GTG	.		0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2M3	127062	broad.mit.edu	37	1	248367073	248367073	+	Missense_Mutation	SNP	G	G	A	rs138010167	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:248367073G>A	ENST00000456743.1	+	1	742	c.704G>A	c.(703-705)cGc>cAc	p.R235H		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R235H(2)		endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GAGGGTCGTCGCAAAGCTTTT	0.468													g|||	2	0.000399361	0.0	0.0	5008	,	,		20996	0.001		0.001	False		,,,				2504	0.0				p.R235H													.	OR2M3-70	2	Substitution - Missense(2)	large_intestine(2)	c.G704A						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	257.0	244.0	248.0		704	-3.3	0.0	1	dbSNP_134	248	0,8600		0,0,4300	no	missense	OR2M3	NM_001004689.1	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	235/313	248367073	1,13005	2203	4300	6503	SO:0001583	missense	127062	exon1			GTCGTCGCAAAGC		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.704G>A	1.37:g.248367073G>A	ENSP00000389625:p.Arg235His	Somatic	399	0		WXS	Illumina HiSeq	Phase_I	253	5	NM_001004689	0	0	0	0	0	B9EH06|Q6IEY0	Missense_Mutation	SNP	ENST00000456743.1	37	CCDS31107.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	6.305	0.424298	0.11928	2.27E-4	0.0	ENSG00000228198	ENST00000456743	T	0.00034	8.87	2.25	-3.31	0.04988	GPCR, rhodopsin-like superfamily (1);	1.276350	0.06104	N	0.665935	T	0.00073	0.0002	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.04386	-1.0955	10	0.41790	T	0.15	.	7.4052	0.26987	0.6672:0.0:0.3328:0.0	.	235	Q8NG83	OR2M3_HUMAN	H	235	ENSP00000389625:R235H	ENSP00000389625:R235H	R	+	2	0	OR2M3	246433696	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.791000	0.00767	-0.925000	0.03775	0.398000	0.26397	CGC	G|1.000;A|0.000		0.468	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689	
TLL2	7093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	98136535	98136535	+	Missense_Mutation	SNP	C	C	A	rs150738442		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr10:98136535C>A	ENST00000357947.3	-	18	2587	c.2362G>T	c.(2362-2364)Gcg>Tcg	p.A788S		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	788	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TTGGGGCTCGCCAGGGTCCCC	0.567																																					p.A788S		.											.	TLL2-93	0			c.G2362T						.						66.0	66.0	66.0					10																	98136535		2203	4300	6503	SO:0001583	missense	7093	exon18			GGCTCGCCAGGGT	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2362G>T	10.37:g.98136535C>A	ENSP00000350630:p.Ala788Ser	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	104	33	NM_012465	0	0	0	0	0	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.609563	0.28623	.	.	ENSG00000095587	ENST00000357947	T	0.16897	2.31	4.98	4.07	0.47477	CUB (5);	1.170570	0.06454	N	0.728224	T	0.05044	0.0135	N	0.00666	-1.275	0.22842	N	0.998661	B	0.10296	0.003	B	0.11329	0.006	T	0.36648	-0.9739	10	0.17832	T	0.49	.	3.874	0.09048	0.193:0.6039:0.0:0.2031	.	788	Q9Y6L7	TLL2_HUMAN	S	788	ENSP00000350630:A788S	ENSP00000350630:A788S	A	-	1	0	TLL2	98126525	0.000000	0.05858	0.988000	0.46212	0.744000	0.42396	0.481000	0.22260	1.431000	0.47355	0.655000	0.94253	GCG	C|1.000;T|0.000		0.567	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
GBF1	8729	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	104130546	104130546	+	Missense_Mutation	SNP	G	G	T	rs7894865	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr10:104130546G>T	ENST00000369983.3	+	29	3846	c.3586G>T	c.(3586-3588)Gtg>Ttg	p.V1196L		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	1196					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CTGCTTCCTTGTGGAGCGGGC	0.542																																					p.V1197L		.											.	GBF1-91	0			c.G3589T						.						182.0	147.0	159.0					10																	104130546		2203	4300	6503	SO:0001583	missense	8729	exon29			TTCCTTGTGGAGC	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.3586G>T	10.37:g.104130546G>T	ENSP00000359000:p.Val1196Leu	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	101	40	NM_001199378	0	0	15	33	18	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.360689	0.24598	.	.	ENSG00000107862	ENST00000369983	T	0.12569	2.67	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.22936	0.0554	N	0.17872	0.535	0.80722	D	1	B;B;D	0.58970	0.107;0.025;0.984	B;B;D	0.68192	0.037;0.016;0.956	T	0.05289	-1.0894	10	0.19590	T	0.45	-16.6116	19.277	0.94036	0.0:0.0:1.0:0.0	.	1196;1196;1196	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	L	1196	ENSP00000359000:V1196L	ENSP00000359000:V1196L	V	+	1	0	GBF1	104120536	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	7.674000	0.83992	2.782000	0.95742	0.655000	0.94253	GTG	G|0.996;A|0.004		0.542	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
SUFU	51684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104353417	104353417	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr10:104353417C>A	ENST00000369902.3	+	5	788	c.622C>A	c.(622-624)Cta>Ata	p.L208I	SUFU_ENST00000471000.1_3'UTR|SUFU_ENST00000369899.2_Missense_Mutation_p.L208I|SUFU_ENST00000423559.2_Missense_Mutation_p.L208I|RNU6-43P_ENST00000384302.1_RNA	NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	208					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		CACTGAAGAGCTACACTCAGC	0.607			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation																												p.L208I		.	yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	.	SUFU-2246	0			c.C622A						.						99.0	83.0	89.0					10																	104353417		2203	4300	6503	SO:0001583	missense	51684	exon5	Familial Cancer Database		GAAGAGCTACACT	AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.622C>A	10.37:g.104353417C>A	ENSP00000358918:p.Leu208Ile	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	73	39	NM_001178133	0	0	13	26	13	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	ENST00000369902.3	37	CCDS7537.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614385	0.87359	.	.	ENSG00000107882	ENST00000369902;ENST00000369899;ENST00000423559	D;D;D	0.83755	-1.76;-1.76;-1.76	6.08	4.21	0.49690	Suppressor of fused domain (1);	0.062987	0.64402	D	0.000004	D	0.91088	0.7195	M	0.93763	3.455	0.53005	D	0.999963	P;P;D	0.61697	0.816;0.78;0.99	P;P;P	0.61132	0.789;0.683;0.884	D	0.91841	0.5483	10	0.72032	D	0.01	-14.0459	8.8655	0.35282	0.0:0.7723:0.0:0.2277	.	208;208;208	Q9UMX1;Q9UMX1-2;Q9UMX1-3	SUFU_HUMAN;.;.	I	208	ENSP00000358918:L208I;ENSP00000358915:L208I;ENSP00000411597:L208I	ENSP00000358915:L208I	L	+	1	2	SUFU	104343407	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	2.022000	0.41030	1.557000	0.49525	0.655000	0.94253	CTA	.		0.607	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050089.1	NM_016169	
POLR2L	5441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	840428	840428	+	Silent	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:840428G>A	ENST00000322028.4	-	2	184	c.148C>T	c.(148-150)Ctg>Ttg	p.L50L	TSPAN4_ENST00000397396.1_5'Flank|TSPAN4_ENST00000397411.2_5'Flank|TSPAN4_ENST00000397408.1_5'Flank|TSPAN4_ENST00000397397.2_5'Flank	NM_021128.4	NP_066951.1	P62875	RPAB5_HUMAN	polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa	50					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|RNA splicing (GO:0008380)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			lung(1)	1		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACGTGGGCCAGCAGCATCCGG	0.637																																					p.L50L		.											.	POLR2L-90	0			c.C148T						.						159.0	125.0	137.0					11																	840428		2203	4298	6501	SO:0001819	synonymous_variant	5441	exon2			GGGCCAGCAGCAT	U37690	CCDS7720.1	11p15	2013-01-21	2002-08-29		ENSG00000177700	ENSG00000177700		"""RNA polymerase subunits"""	9199	protein-coding gene	gene with protein product		601189	"""polymerase (RNA) II (DNA directed) polypeptide L (7.6kD)"""			8786124	Standard	NM_021128		Approved	RPB10beta, RBP10, RPABC5, RPB7.6, hRPB7.6, hsRPB10b	uc001lsc.3	P62875	OTTHUMG00000133316	ENST00000322028.4:c.148C>T	11.37:g.840428G>A		Somatic	193	0		WXS	Illumina HiSeq	Phase_I	173	48	NM_021128	0	0	162	311	149	P52436|Q6FHX3	Silent	SNP	ENST00000322028.4	37	CCDS7720.1																																																																																			.		0.637	POLR2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257114.1	NM_021128	
SAAL1	113174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	18101957	18101957	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:18101957C>G	ENST00000524803.1	-	12	1463	c.1414G>C	c.(1414-1416)Gtt>Ctt	p.V472L	SAAL1_ENST00000529318.1_Missense_Mutation_p.V474L|SAAL1_ENST00000300013.4_Missense_Mutation_p.V471L			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	472										breast(2)|large_intestine(5)|lung(8)	15						TAAGTCTGAACCTTCAAACTT	0.318																																					p.V472L		.											.	SAAL1-90	0			c.G1414C						.						59.0	62.0	61.0					11																	18101957		2200	4293	6493	SO:0001583	missense	113174	exon12			TCTGAACCTTCAA	AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.1414G>C	11.37:g.18101957C>G	ENSP00000432487:p.Val472Leu	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	68	16	NM_138421	0	0	2	5	3	A6NH05	Missense_Mutation	SNP	ENST00000524803.1	37	CCDS31439.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.29|11.29	1.595377|1.595377	0.28445|0.28445	.|.	.|.	ENSG00000166788|ENSG00000166788	ENST00000532452|ENST00000524803;ENST00000300013;ENST00000529318	.|T;T;T	.|0.32023	.|1.47;1.47;1.47	5.56|5.56	4.65|4.65	0.58169|0.58169	.|.	.|0.883413	.|0.10083	.|N	.|0.718158	T|T	0.25568|0.25568	0.0622|0.0622	L|L	0.40543|0.40543	1.245|1.245	0.25551|0.25551	N|N	0.987081|0.987081	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.08055	.|0.003;0.003;0.003	T|T	0.20207|0.20207	-1.0282|-1.0282	5|10	.|0.22109	.|T	.|0.4	-0.1106|-0.1106	9.5663|9.5663	0.39400|0.39400	0.0:0.783:0.1416:0.0753|0.0:0.783:0.1416:0.0753	.|.	.|474;472;472	.|E9PRZ1;G1UCX3;Q96ER3	.|.;.;SAAL1_HUMAN	S|L	130|472;471;474	.|ENSP00000432487:V472L;ENSP00000300013:V471L;ENSP00000432216:V474L	.|ENSP00000300013:V471L	R|V	-|-	3|1	2|0	SAAL1|SAAL1	18058533|18058533	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.389000|0.389000	0.30415|0.30415	1.161000|1.161000	0.31773|0.31773	1.485000|1.485000	0.48380|0.48380	0.549000|0.549000	0.68633|0.68633	AGG|GTT	.		0.318	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389728.1	NM_138421	
ARRB1	408	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	74979954	74979954	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:74979954C>T	ENST00000420843.2	-	14	1169	c.1072G>A	c.(1072-1074)Gag>Aag	p.E358K	ARRB1_ENST00000393505.4_Missense_Mutation_p.E358K|ARRB1_ENST00000360025.3_Missense_Mutation_p.E350K	NM_004041.4	NP_004032.2	P49407	ARRB1_HUMAN	arrestin, beta 1	358	Interaction with TRAF6.				activation of MAPK activity (GO:0000187)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|Notch signaling pathway (GO:0007219)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of GTPase activity (GO:0043547)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-Golgi vesicle-mediated transport (GO:0006892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)|transcription from RNA polymerase II promoter (GO:0006366)	basolateral plasma membrane (GO:0016323)|chromatin (GO:0000785)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|pseudopodium (GO:0031143)	angiotensin receptor binding (GO:0031701)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|enzyme inhibitor activity (GO:0004857)|GTPase activator activity (GO:0005096)|insulin-like growth factor receptor binding (GO:0005159)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|large_intestine(2)|lung(4)|prostate(1)	11						GGGGGTTCCTCTTTGGGCTTG	0.622																																					p.E358K		.											.	ARRB1-567	0			c.G1072A						.						125.0	113.0	117.0					11																	74979954		2200	4293	6493	SO:0001583	missense	408	exon14			GTTCCTCTTTGGG	BC003636	CCDS31640.1, CCDS44684.1	11q13	2008-12-11			ENSG00000137486	ENSG00000137486			711	protein-coding gene	gene with protein product	"""arrestin 2"""	107940		ARR1		8486659	Standard	NM_004041		Approved		uc001owe.2	P49407	OTTHUMG00000165444	ENST00000420843.2:c.1072G>A	11.37:g.74979954C>T	ENSP00000409581:p.Glu358Lys	Somatic	101	1		WXS	Illumina HiSeq	Phase_I	98	33	NM_004041	0	0	7	7	0	B6V9G8|O75625|O75630|Q2PP20|Q9BTK8	Missense_Mutation	SNP	ENST00000420843.2	37	CCDS44684.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	3.999914|3.999914	0.74818|0.74818	.|.	.|.	ENSG00000137486|ENSG00000137486	ENST00000420843;ENST00000393505;ENST00000360025|ENST00000532447	T;T;T|.	0.10960|.	2.83;2.84;2.82|.	4.36|4.36	4.36|4.36	0.52297|0.52297	Immunoglobulin E-set (1);Arrestin, C-terminal (1);|.	0.142117|.	0.44483|.	D|.	0.000450|.	T|T	0.38134|0.38134	0.1029|0.1029	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B;B|.	0.25850|.	0.12;0.136|.	B;B|.	0.31495|.	0.079;0.131|.	T|T	0.25641|0.25641	-1.0126|-1.0126	10|5	0.41790|.	T|.	0.15|.	-10.8909|-10.8909	14.4868|14.4868	0.67622|0.67622	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	350;358|.	P49407-2;P49407|.	.;ARRB1_HUMAN|.	K|K	358;358;350|174	ENSP00000409581:E358K;ENSP00000377141:E358K;ENSP00000353124:E350K|.	ENSP00000353124:E350K|.	E|R	-|-	1|2	0|0	ARRB1|ARRB1	74657602|74657602	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	6.899000|6.899000	0.75682|0.75682	2.281000|2.281000	0.76405|0.76405	0.555000|0.555000	0.69702|0.69702	GAG|AGA	.		0.622	ARRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384092.3	NM_004041	
GAB2	9846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	77934564	77934564	+	Silent	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:77934564G>A	ENST00000361507.4	-	6	1546	c.1461C>T	c.(1459-1461)gaC>gaT	p.D487D	GAB2_ENST00000340149.2_Silent_p.D449D	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	487					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			AGCCAAGTGAGTCAAAGTGAT	0.557																																					p.D487D		.											.	GAB2-663	0			c.C1461T						.						218.0	207.0	211.0					11																	77934564		2200	4292	6492	SO:0001819	synonymous_variant	9846	exon6			AAGTGAGTCAAAG	AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1461C>T	11.37:g.77934564G>A		Somatic	270	0		WXS	Illumina HiSeq	Phase_I	229	70	NM_080491	0	0	2	2	0	A2RRM2|A6NEW9|A7MD36|O60317	Silent	SNP	ENST00000361507.4	37	CCDS8259.1																																																																																			.		0.557	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491	
CASP5	838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	104879534	104879534	+	Splice_Site	SNP	T	T	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:104879534T>G	ENST00000260315.3	-	2	180	c.181A>C	c.(181-183)Aaa>Caa	p.K61Q	CASP5_ENST00000531367.1_Intron|CASP5_ENST00000393139.2_Splice_Site_p.K28Q|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000444749.2_Intron|CASP5_ENST00000393141.2_Splice_Site_p.K74Q|CASP5_ENST00000526056.1_Splice_Site_p.K74Q			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	61	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		CCAGTCTTACTTTTTACACTG	0.388																																					p.K74Q		.											.	CASP5-661	0			c.A220C						.						101.0	95.0	97.0					11																	104879534		2202	4299	6501	SO:0001630	splice_region_variant	838	exon2			TCTTACTTTTTAC		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.181+1A>C	11.37:g.104879534T>G		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	58	23	NM_001136112	0	0	0	0	0	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Missense_Mutation	SNP	ENST00000260315.3	37	CCDS8328.2	.	.	.	.	.	.	.	.	.	.	.	8.417	0.845448	0.16963	.	.	ENSG00000137757	ENST00000393141;ENST00000393139;ENST00000260315;ENST00000526056;ENST00000456094	T;T;T;T;T	0.26810	4.66;1.71;4.68;4.66;2.75	1.45	0.338	0.15974	DEATH-like (1);Caspase Recruitment (2);	0.671852	0.11352	U	0.572858	T	0.09642	0.0237	N	0.08118	0	0.09310	N	1	B;B	0.28636	0.218;0.183	B;B	0.21546	0.035;0.021	T	0.31916	-0.9926	9	.	.	.	.	3.7847	0.08695	0.0:0.7446:0.0:0.2554	.	61;74	P51878;P51878-5	CASP5_HUMAN;.	Q	74;28;61;74;45	ENSP00000376849:K74Q;ENSP00000376847:K28Q;ENSP00000260315:K61Q;ENSP00000436877:K74Q;ENSP00000415241:K45Q	.	K	-	1	0	CASP5	104384744	0.989000	0.36119	0.124000	0.21820	0.011000	0.07611	0.266000	0.18534	0.155000	0.19261	-0.182000	0.12963	AAA	.		0.388	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347	Missense_Mutation
KDM5A	5927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	404935	404935	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr12:404935G>C	ENST00000399788.2	-	26	4621	c.4259C>G	c.(4258-4260)cCt>cGt	p.P1420R	KDM5A_ENST00000540838.1_5'Flank|KDM5A_ENST00000382815.4_Missense_Mutation_p.P1420R	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1420					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						GCTCTTCCGAGGTTGTTTCCT	0.408			T	NUP98	AML																																p.P1420R		.		Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	.	KDM5A-227	0			c.C4259G						.						97.0	94.0	95.0					12																	404935		1825	4074	5899	SO:0001583	missense	5927	exon26			TTCCGAGGTTGTT		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.4259C>G	12.37:g.404935G>C	ENSP00000382688:p.Pro1420Arg	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	143	54	NM_001042603	0	0	7	18	11	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551819	0.65311	.	.	ENSG00000073614	ENST00000399788;ENST00000382815	D;D	0.85171	-1.95;-1.77	5.42	5.42	0.78866	.	0.118506	0.64402	D	0.000015	D	0.88254	0.6387	L	0.29908	0.895	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.85541	0.1215	10	0.25751	T	0.34	-15.9882	19.5762	0.95446	0.0:0.0:1.0:0.0	.	1420;1420	P29375;P29375-2	KDM5A_HUMAN;.	R	1420	ENSP00000382688:P1420R;ENSP00000372265:P1420R	ENSP00000372265:P1420R	P	-	2	0	KDM5A	275196	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.505000	0.97989	2.699000	0.92147	0.561000	0.74099	CCT	.		0.408	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
AEBP2	121536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	19615463	19615463	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr12:19615463G>C	ENST00000398864.3	+	2	717	c.691G>C	c.(691-693)Gat>Cat	p.D231H	AEBP2_ENST00000360995.4_Missense_Mutation_p.D15H|AEBP2_ENST00000541908.1_Missense_Mutation_p.D2H|AEBP2_ENST00000266508.9_Missense_Mutation_p.D231H	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	231	Interaction with RBBP4.|Ser-rich.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					TACTATAATGGATGTAGACAG	0.328																																					p.D231H		.											.	AEBP2-23	0			c.G691C						.						57.0	51.0	53.0					12																	19615463		1877	4113	5990	SO:0001583	missense	121536	exon2			ATAATGGATGTAG		CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.691G>C	12.37:g.19615463G>C	ENSP00000381840:p.Asp231His	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	32	13	NM_001114176	0	0	9	17	8	Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	ENST00000398864.3	37	CCDS44841.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.961310	0.74016	.	.	ENSG00000139154	ENST00000538425;ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995	D;T;D;D;T	0.91631	-2.52;-0.65;-2.88;-2.88;-0.45	5.55	4.66	0.58398	.	.	.	.	.	D	0.91938	0.7447	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	P	0.62885	0.908	D	0.93102	0.6509	9	0.66056	D	0.02	4.244	14.732	0.69388	0.0692:0.0:0.9308:0.0	.	231	Q6ZN18	AEBP2_HUMAN	H	2;2;231;165;231;15	ENSP00000444255:D2H;ENSP00000437983:D2H;ENSP00000381840:D231H;ENSP00000266508:D231H;ENSP00000354267:D15H	ENSP00000266508:D231H	D	+	1	0	AEBP2	19506730	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	1.578000	0.49821	0.655000	0.94253	GAT	.		0.328	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401575.1	NM_153207	
PFKM	5213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	48538849	48538849	+	Silent	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr12:48538849C>A	ENST00000312352.7	+	21	2067	c.2028C>A	c.(2026-2028)gcC>gcA	p.A676A	PFKM_ENST00000359794.5_Silent_p.A676A|PFKM_ENST00000551804.1_Silent_p.A645A|PFKM_ENST00000340802.6_Silent_p.A747A|PFKM_ENST00000547587.1_Silent_p.A676A|PFKM_ENST00000395233.2_Silent_p.A645A	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	676	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GGAATTTTGCCACTAAGATGG	0.473																																					p.A747A		.											.	PFKM-254	0			c.C2241A						.						99.0	96.0	97.0					12																	48538849		2203	4300	6503	SO:0001819	synonymous_variant	5213	exon23			TTTTGCCACTAAG	M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.2028C>A	12.37:g.48538849C>A		Somatic	71	0		WXS	Illumina HiSeq	Phase_I	119	42	NM_001166686	0	0	160	289	129	J3KNX3|Q16814|Q16815|Q6ZTT1	Silent	SNP	ENST00000312352.7	37	CCDS8760.1																																																																																			.		0.473	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406490.1	NM_000289	
NCKAP1L	3071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54903761	54903761	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr12:54903761T>G	ENST00000293373.6	+	7	806	c.727T>G	c.(727-729)Tca>Gca	p.S243A	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.S193A|NCKAP1L_ENST00000552211.1_3'UTR	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	243					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						CCCTGCTAATTCAGATACAGT	0.488																																					p.S243A		.											.	NCKAP1L-93	0			c.T727G						.						146.0	139.0	141.0					12																	54903761		2203	4300	6503	SO:0001583	missense	3071	exon7			GCTAATTCAGATA	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.727T>G	12.37:g.54903761T>G	ENSP00000293373:p.Ser243Ala	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	150	56	NM_005337	0	0	0	0	0	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.948714	0.53186	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.32515	1.45;1.45	5.83	5.83	0.93111	.	0.066512	0.64402	D	0.000007	T	0.25791	0.0628	L	0.38838	1.175	0.40526	D	0.980889	P	0.38473	0.633	B	0.38194	0.267	T	0.06058	-1.0848	10	0.18276	T	0.48	-7.392	14.1522	0.65392	0.0:0.0:0.0:1.0	.	243	P55160	NCKPL_HUMAN	A	243;193	ENSP00000293373:S243A;ENSP00000445596:S193A	ENSP00000293373:S243A	S	+	1	0	NCKAP1L	53190028	1.000000	0.71417	0.930000	0.37139	0.606000	0.37113	7.701000	0.84566	2.216000	0.71823	0.460000	0.39030	TCA	.		0.488	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
RFC5	5985	broad.mit.edu	37	12	118462710	118462710	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr12:118462710C>A	ENST00000454402.2	+	6	594	c.476C>A	c.(475-477)tCa>tAa	p.S159*	RFC5_ENST00000229043.3_Nonsense_Mutation_p.S74*|RFC5_ENST00000392542.2_Nonsense_Mutation_p.S138*	NM_001206801.1|NM_007370.5	NP_001193730.1|NP_031396.1	P40937	RFC5_HUMAN	replication factor C (activator 1) 5, 36.5kDa	159					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AACTATCTGTCAAAGATCATC	0.458																																					p.S159X													.	RFC5-227	0			c.C476A						.						85.0	86.0	85.0					12																	118462710		2203	4300	6503	SO:0001587	stop_gained	5985	exon6			ATCTGTCAAAGAT		CCDS9185.1, CCDS41843.2	12q24.3	2010-04-21	2002-08-29		ENSG00000111445	ENSG00000111445		"""ATPases / AAA-type"""	9973	protein-coding gene	gene with protein product		600407	"""replication factor C (activator 1) 5 (36.5kD)"""			7774928	Standard	NM_007370		Approved	RFC36	uc001twq.3	P40937	OTTHUMG00000156438	ENST00000454402.2:c.476C>A	12.37:g.118462710C>A	ENSP00000408295:p.Ser159*	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	57	4	NM_007370	0	0	17	17	0	A8MZ62|B3KSX8	Nonsense_Mutation	SNP	ENST00000454402.2	37	CCDS9185.1	.	.	.	.	.	.	.	.	.	.	C	43	9.842294	0.99277	.	.	ENSG00000111445	ENST00000449641;ENST00000537315;ENST00000229043;ENST00000454402;ENST00000392542	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.9222	18.1093	0.89530	0.0:1.0:0.0:0.0	.	.	.	.	X	74;74;74;159;138	.	ENSP00000229043:S74X	S	+	2	0	RFC5	116947093	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.715000	0.84713	2.561000	0.86390	0.563000	0.77884	TCA	.		0.458	RFC5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344196.2	NM_007370	
DCAF4	26094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	73412735	73412735	+	Splice_Site	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr14:73412735G>A	ENST00000358377.2	+	7	898	c.678G>A	c.(676-678)aaG>aaA	p.K226K	DCAF4_ENST00000553457.1_Splice_Site_p.K126K|DCAF4_ENST00000394234.2_Splice_Site_p.K126K|DCAF4_ENST00000509153.1_Splice_Site_p.K165K|DCAF4_ENST00000555042.1_Splice_Site_p.K226K|DCAF4_ENST00000353777.3_Splice_Site_p.K165K	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	226					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						CCAACCGGAAGGTACGTTGCC	0.527																																					p.K226K		.											.	DCAF4-92	0			c.G678A						.						142.0	128.0	132.0					14																	73412735		2203	4300	6503	SO:0001630	splice_region_variant	26094	exon7			CCGGAAGGTACGT	BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.678+1G>A	14.37:g.73412735G>A		Somatic	135	1		WXS	Illumina HiSeq	Phase_I	146	53	NM_001163508	0	0	0	0	0	B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Silent	SNP	ENST00000358377.2	37	CCDS9809.1																																																																																			.		0.527	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361058.1	NM_015604	Silent
ATXN3	4287	hgsc.bcm.edu	37	14	92537397	92537397	+	Splice_Site	SNP	T	T	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr14:92537397T>C	ENST00000532032.1	-	10	882	c.873A>G	c.(871-873)aaA>aaG	p.K291K	ATXN3_ENST00000429774.2_Splice_Site_p.K284K|ATXN3_ENST00000340660.6_Splice_Site_p.K236K|ATXN3_ENST00000502250.1_Splice_Site_p.K112K|ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000545170.1_Silent_p.R300R|ATXN3_ENST00000503767.1_Splice_Site_p.K276K|ATXN3_ENST00000393287.5_Splice_Site_p.K291K			P54252	ATX3_HUMAN	ataxin 3	291					actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		tttgctgctgTCTGAAACATT	0.403																																					p.T130A	Esophageal Squamous(190;752 2094 29897 44875 49530)	.											.	ATXN3-522	0			c.A388G						.						24.0	28.0	27.0					14																	92537397		2182	4295	6477	SO:0001630	splice_region_variant	4287	exon6			CTGCTGTCTGAAA	U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.873-1A>G	14.37:g.92537397T>C		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	29	3	NM_001164778	0	0	0	0	0	A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	Missense_Mutation	SNP	ENST00000532032.1	37																																																																																				.		0.403	ATXN3-015	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000388065.1	NM_004993	Silent
RYR3	6263	broad.mit.edu	37	15	33962623	33962623	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr15:33962623T>G	ENST00000389232.4	+	38	5796	c.5726T>G	c.(5725-5727)gTt>gGt	p.V1909G	RYR3_ENST00000415757.3_Missense_Mutation_p.V1909G	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1909	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.V1909G(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTGCTAGGGGTTCCTTTggaa	0.473																																					p.V1909G													.	RYR3-520	1	Substitution - Missense(1)	kidney(1)	c.T5726G						.						29.0	34.0	33.0					15																	33962623		1904	4132	6036	SO:0001583	missense	6263	exon38			TAGGGGTTCCTTT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5726T>G	15.37:g.33962623T>G	ENSP00000373884:p.Val1909Gly	Somatic	36	11		WXS	Illumina HiSeq	Phase_I	40	17	NM_001243996	0	0	0	0	0	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.722948	0.48728	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.68025	-0.3;-0.25	5.99	5.99	0.97316	.	0.238660	0.33610	N	0.004737	T	0.60418	0.2267	L	0.43923	1.385	0.58432	D	0.999993	B;B	0.29766	0.256;0.0	B;B	0.24848	0.056;0.0	T	0.61667	-0.7016	10	0.72032	D	0.01	.	15.6603	0.77182	0.0:0.0:0.0:1.0	.	1909;1909	Q15413-2;Q15413	.;RYR3_HUMAN	G	1909	ENSP00000373884:V1909G;ENSP00000399610:V1909G	ENSP00000354735:V1909G	V	+	2	0	RYR3	31749915	1.000000	0.71417	0.995000	0.50966	0.576000	0.36127	5.995000	0.70631	2.284000	0.76573	0.528000	0.53228	GTT	.		0.473	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
GDE1	51573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	19516303	19516303	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:19516303A>C	ENST00000353258.3	-	5	928	c.748T>G	c.(748-750)Ttt>Gtt	p.F250V	CTA-363E6.7_ENST00000569345.1_RNA	NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	250	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						ATCATAACAAATATAAAATGT	0.403																																					p.F250V		.											.	GDE1-70	0			c.T748G						.						161.0	151.0	154.0					16																	19516303		2197	4300	6497	SO:0001583	missense	51573	exon5			TAACAAATATAAA		CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.748T>G	16.37:g.19516303A>C	ENSP00000261386:p.Phe250Val	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	164	51	NM_016641	0	0	58	88	30	O43334|Q6PKF7|Q7KYR4	Missense_Mutation	SNP	ENST00000353258.3	37	CCDS10578.1	.	.	.	.	.	.	.	.	.	.	A	5.389	0.256908	0.10185	.	.	ENSG00000006007	ENST00000353258	T	0.27557	1.66	5.66	3.41	0.39046	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.193879	0.56097	D	0.000040	T	0.13884	0.0336	N	0.08118	0	0.23533	N	0.997474	B	0.24368	0.102	B	0.24701	0.055	T	0.20840	-1.0263	10	0.28530	T	0.3	-7.2402	5.9584	0.19286	0.7453:0.0:0.1327:0.122	.	250	Q9NZC3	GDE1_HUMAN	V	250	ENSP00000261386:F250V	ENSP00000261386:F250V	F	-	1	0	GDE1	19423804	0.998000	0.40836	0.125000	0.21846	0.104000	0.19210	3.728000	0.54991	0.417000	0.25871	0.533000	0.62120	TTT	.		0.403	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254274.2	NM_016641	
EEF2K	29904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	22237117	22237117	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:22237117C>T	ENST00000263026.5	+	2	541	c.67C>T	c.(67-69)Cat>Tat	p.H23Y		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	23			H -> R (in dbSNP:rs9935059). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17344846}.		insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		CCGAGCTGGCCATGATGGTGA	0.557																																					p.H23Y	NSCLC(195;1411 2157 20319 27471 51856)	.											.	EEF2K-856	0			c.C67T						.						56.0	55.0	55.0					16																	22237117		2197	4300	6497	SO:0001583	missense	29904	exon2			GCTGGCCATGATG	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.67C>T	16.37:g.22237117C>T	ENSP00000263026:p.His23Tyr	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	92	20	NM_013302	0	0	0	2	2	Q8N588	Missense_Mutation	SNP	ENST00000263026.5	37	CCDS10604.1	.	.	.	.	.	.	.	.	.	.	C	1.297	-0.605948	0.03717	.	.	ENSG00000103319	ENST00000263026	T	0.08102	3.13	5.82	5.82	0.92795	.	0.750933	0.13237	N	0.403188	T	0.06142	0.0159	L	0.34521	1.04	0.09310	N	1	B	0.18863	0.031	B	0.19148	0.024	T	0.45891	-0.9230	10	0.02654	T	1	-9.8593	8.7204	0.34436	0.1519:0.7677:0.0:0.0804	.	23	O00418	EF2K_HUMAN	Y	23	ENSP00000263026:H23Y	ENSP00000263026:H23Y	H	+	1	0	EEF2K	22144618	0.005000	0.15991	0.338000	0.25549	0.158000	0.22134	0.566000	0.23593	2.757000	0.94681	0.655000	0.94253	CAT	.		0.557	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302	
CX3CL1	6376	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57413588	57413588	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:57413588A>G	ENST00000006053.6	+	2	224	c.113A>G	c.(112-114)aAg>aGg	p.K38R	CX3CL1_ENST00000565912.1_5'UTR|CX3CL1_ENST00000564948.1_Intron|CX3CL1_ENST00000563383.1_Missense_Mutation_p.K44R	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	38	Chemokine.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						ACGTGCAGCAAGATGACATCA	0.522																																					p.K38R		.											.	CX3CL1-226	0			c.A113G						.						181.0	129.0	146.0					16																	57413588		2198	4300	6498	SO:0001583	missense	6376	exon2			GCAGCAAGATGAC	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.113A>G	16.37:g.57413588A>G	ENSP00000006053:p.Lys38Arg	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	85	19	NM_002996	0	0	121	166	45	O00672	Missense_Mutation	SNP	ENST00000006053.6	37	CCDS10779.1	.	.	.	.	.	.	.	.	.	.	A	10.55	1.382853	0.25031	.	.	ENSG00000006210	ENST00000006053	T	0.05199	3.48	2.87	0.504	0.16946	Chemokine interleukin-8-like domain (3);	0.903877	0.09116	N	0.846367	T	0.05777	0.0151	L	0.41710	1.295	0.23421	N	0.997716	B	0.17268	0.021	B	0.18871	0.023	T	0.42481	-0.9449	10	0.87932	D	0	-13.2272	3.0514	0.06171	0.602:0.2553:0.1427:0.0	.	38	P78423	X3CL1_HUMAN	R	38	ENSP00000006053:K38R	ENSP00000006053:K38R	K	+	2	0	CX3CL1	55971089	0.037000	0.19845	0.149000	0.22428	0.245000	0.25701	-0.164000	0.09983	0.081000	0.16988	0.254000	0.18369	AAG	.		0.522	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257345.3	NM_002996	
SLC12A4	6560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67981315	67981315	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:67981315C>G	ENST00000316341.3	-	16	2131	c.1991G>C	c.(1990-1992)gGg>gCg	p.G664A	SLC12A4_ENST00000338335.3_Missense_Mutation_p.G664A|SLC12A4_ENST00000537830.2_Missense_Mutation_p.G658A|SLC12A4_ENST00000422611.2_Missense_Mutation_p.G666A|SLC12A4_ENST00000576616.1_Missense_Mutation_p.G664A|CTC-479C5.17_ENST00000590594.1_lincRNA|SLC12A4_ENST00000541864.2_Missense_Mutation_p.G633A|SLC12A4_ENST00000572037.1_Missense_Mutation_p.G616A	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	664					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCCTCGGATCCCGTCACCCCA	0.672																																					p.G666A		.											.	SLC12A4-91	0			c.G1997C						.						46.0	56.0	53.0					16																	67981315		2195	4299	6494	SO:0001583	missense	6560	exon15			CGGATCCCGTCAC		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.1991G>C	16.37:g.67981315C>G	ENSP00000318557:p.Gly664Ala	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	34	8	NM_001145962	0	0	32	53	21	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	37	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	C	35	5.435871	0.96168	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	D;D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99;-4.99	5.76	5.76	0.90799	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.98748	0.9579	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D	0.89917	0.994;0.999;1.0;0.982;0.982;0.986	D;D;D;P;P;D	0.97110	0.95;0.992;1.0;0.854;0.854;0.91	D	0.99872	1.1098	10	0.72032	D	0.01	.	19.9738	0.97296	0.0:1.0:0.0:0.0	.	666;664;633;658;664;664	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	A	666;633;658;664;664	ENSP00000395983:G666A;ENSP00000438334:G633A;ENSP00000445962:G658A;ENSP00000343374:G664A;ENSP00000318557:G664A	ENSP00000318557:G664A	G	-	2	0	SLC12A4	66538816	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.760000	0.85248	2.732000	0.93576	0.655000	0.94253	GGG	.		0.672	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
NFATC3	4775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	68224719	68224719	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:68224719C>A	ENST00000346183.3	+	9	2171	c.2147C>A	c.(2146-2148)cCa>cAa	p.P716Q	NFATC3_ENST00000575270.1_Missense_Mutation_p.P716Q|NFATC3_ENST00000329524.4_Missense_Mutation_p.P716Q|NFATC3_ENST00000349223.5_Missense_Mutation_p.P716Q|NFATC3_ENST00000535127.2_3'UTR|SNORA48_ENST00000391143.1_RNA	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	716					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		TCTTCAGTTCCATCTTTGCCT	0.383																																					p.P716Q		.											.	NFATC3-92	0			c.C2147A						.						107.0	99.0	101.0					16																	68224719		2198	4300	6498	SO:0001583	missense	4775	exon9			CAGTTCCATCTTT	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.2147C>A	16.37:g.68224719C>A	ENSP00000300659:p.Pro716Gln	Somatic	206	0		WXS	Illumina HiSeq	Phase_I	171	95	NM_173163	0	0	3	11	8	O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	ENST00000346183.3	37	CCDS10860.1	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808656	0.70797	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524;ENST00000535127	T;T;T	0.14516	2.5;2.5;2.5	5.55	4.59	0.56863	.	0.059669	0.64402	D	0.000002	T	0.33206	0.0855	M	0.72894	2.215	0.44079	D	0.996834	P;D;P;P	0.57257	0.747;0.979;0.747;0.747	P;P;P;P	0.58970	0.499;0.849;0.499;0.499	T	0.14144	-1.0483	10	0.72032	D	0.01	-2.556	15.7347	0.77834	0.1378:0.8622:0.0:0.0	.	716;716;716;716	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	Q	716;716;716;237	ENSP00000264008:P716Q;ENSP00000300659:P716Q;ENSP00000331324:P716Q	ENSP00000331324:P716Q	P	+	2	0	NFATC3	66782220	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.294000	0.78760	1.330000	0.45394	-0.321000	0.08615	CCA	.		0.383	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555	
CHMP1A	5119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	89715819	89715819	+	Silent	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:89715819C>T	ENST00000397901.3	-	4	448	c.192G>A	c.(190-192)cgG>cgA	p.R64R	CHMP1A_ENST00000535997.2_5'UTR|CHMP1A_ENST00000253475.5_Missense_Mutation_p.D58N|CHMP1A_ENST00000547614.1_5'UTR|CHMP1A_ENST00000550102.1_Silent_p.R64R	NM_002768.3	NP_002759.2	Q9HD42	CHM1A_HUMAN	charged multivesicular body protein 1A	64					cytokinesis (GO:0000910)|gene silencing (GO:0016458)|mitotic chromosome condensation (GO:0007076)|negative regulation of transcription by glucose (GO:0045014)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|proteolysis (GO:0006508)|transcription, DNA-templated (GO:0006351)|vesicle-mediated transport (GO:0016192)	condensed nuclear chromosome (GO:0000794)|early endosome (GO:0005769)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|nuclear matrix (GO:0016363)	metallopeptidase activity (GO:0008237)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|ovary(1)	3		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		GGGACGCCATCCGAAGCCAGT	0.602																																					p.D58N		.											.	.	0			c.G172A						.						90.0	104.0	99.0					16																	89715819		2154	4245	6399	SO:0001819	synonymous_variant	5119	exon3			CGCCATCCGAAGC	U58048	CCDS45552.1	16q24.3	2011-09-21	2011-09-21	2007-03-20	ENSG00000131165	ENSG00000131165		"""Charged multivesicular body proteins"""	8740	protein-coding gene	gene with protein product		164010	"""procollagen (type III) N-endopeptidase"", ""chromatin modifying protein 1A"""	PRSM1, PCOLN3		11559748, 11559747	Standard	NM_002768		Approved	KIAA0047, CHMP1, Vps46A	uc002fnu.4	Q9HD42	OTTHUMG00000169521	ENST00000397901.3:c.192G>A	16.37:g.89715819C>T		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	210	63	NM_001083314	0	0	58	89	31	A2RU09|Q14468|Q15779|Q96G31	Missense_Mutation	SNP	ENST00000397901.3	37	CCDS45552.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.674550	0.29693	.	.	ENSG00000131165	ENST00000253475	.	.	.	5.38	-6.01	0.02199	.	0.480369	0.15538	N	0.257085	T	0.22244	0.0536	.	.	.	0.09310	N	0.999992	B	0.12013	0.005	B	0.09377	0.004	T	0.15009	-1.0452	8	0.87932	D	0	0.0142	3.6277	0.08119	0.1185:0.3755:0.2125:0.2936	.	58	A6NG32	.	N	58	.	ENSP00000253475:D58N	D	-	1	0	CHMP1A	88243320	0.002000	0.14202	0.974000	0.42286	0.700000	0.40528	-1.471000	0.02344	-0.529000	0.06358	-1.157000	0.01802	GAT	.		0.602	CHMP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404581.1	NM_002768	
CDK10	8558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	89756963	89756963	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr16:89756963C>T	ENST00000353379.7	+	3	206	c.163C>T	c.(163-165)Cgg>Tgg	p.R55W	CDK10_ENST00000514965.1_3'UTR|CDK10_ENST00000331006.8_Missense_Mutation_p.R8W|CDK10_ENST00000505473.1_5'UTR	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	55	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		CATTCCAGATCGGGCCCGGGA	0.592																																					p.R55W		.											.	CDK10-508	0			c.C163T						.						195.0	162.0	173.0					16																	89756963		2198	4300	6498	SO:0001583	missense	8558	exon3			CCAGATCGGGCCC	L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.163C>T	16.37:g.89756963C>T	ENSP00000338673:p.Arg55Trp	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	144	28	NM_052988	0	0	0	1	1	A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Missense_Mutation	SNP	ENST00000353379.7	37	CCDS10984.2	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617358	0.87359	.	.	ENSG00000185324	ENST00000331006;ENST00000393082;ENST00000353379	T;T	0.66995	0.87;-0.24	5.1	3.11	0.35812	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84906	0.5576	M	0.92268	3.29	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.996;0.999	D	0.87752	0.2592	10	0.87932	D	0	-35.2961	14.2251	0.65853	0.2716:0.7284:0.0:0.0	.	49;55;49	B7Z319;Q15131;B3KQJ3	.;CDK10_HUMAN;.	W	8;26;55	ENSP00000329957:R8W;ENSP00000338673:R55W	ENSP00000329957:R8W	R	+	1	2	CDK10	88284464	1.000000	0.71417	0.996000	0.52242	0.815000	0.46073	3.632000	0.54287	0.517000	0.28361	0.561000	0.74099	CGG	.		0.592	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269925.2		
ACAP1	9744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7250507	7250507	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:7250507G>A	ENST00000158762.3	+	14	1495	c.1289G>A	c.(1288-1290)tGg>tAg	p.W430*		NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	430	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.|Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						GCCCCGGAGTGGGCCAGCATC	0.657																																					p.W430X		.											.	ACAP1-153	0			c.G1289A						.						75.0	86.0	82.0					17																	7250507		2203	4300	6503	SO:0001587	stop_gained	9744	exon14			CGGAGTGGGCCAG	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.1289G>A	17.37:g.7250507G>A	ENSP00000158762:p.Trp430*	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	121	38	NM_014716	0	0	2	2	0	Q53XN9	Nonsense_Mutation	SNP	ENST00000158762.3	37	CCDS11101.1	.	.	.	.	.	.	.	.	.	.	G	40	8.222149	0.98712	.	.	ENSG00000072818	ENST00000158762	.	.	.	4.77	4.77	0.60923	.	0.120594	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3166	0.74085	0.0:0.0:1.0:0.0	.	.	.	.	X	430	.	ENSP00000158762:W430X	W	+	2	0	ACAP1	7191231	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.244000	0.95423	2.480000	0.83734	0.462000	0.41574	TGG	.		0.657	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220049.4	NM_014716	
ATAD5	79915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	29162059	29162059	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:29162059G>C	ENST00000321990.4	+	2	1338	c.960G>C	c.(958-960)aaG>aaC	p.K320N	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	320					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TACGCTTTAAGACAGTTACTG	0.378																																					p.K320N		.											.	ATAD5-93	0			c.G960C						.						51.0	54.0	53.0					17																	29162059		2173	4287	6460	SO:0001583	missense	79915	exon2			CTTTAAGACAGTT		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.960G>C	17.37:g.29162059G>C	ENSP00000313171:p.Lys320Asn	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	61	22	NM_024857	0	0	0	0	0	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	9.891	1.204236	0.22205	.	.	ENSG00000176208	ENST00000321990	T	0.11930	2.73	5.91	2.57	0.30868	.	0.221364	0.38778	N	0.001570	T	0.29061	0.0722	M	0.66939	2.045	0.29942	N	0.821002	D;D	0.76494	0.999;0.997	D;P	0.71656	0.974;0.879	T	0.06789	-1.0807	10	0.87932	D	0	.	7.1115	0.25392	0.4358:0.0:0.5642:0.0	.	320;320	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	N	320	ENSP00000313171:K320N	ENSP00000313171:K320N	K	+	3	2	ATAD5	26186185	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	1.162000	0.31786	0.850000	0.35239	-0.136000	0.14681	AAG	.		0.378	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
LRRC37B	114659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	30348539	30348539	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:30348539G>T	ENST00000341671.7	+	1	379	c.374G>T	c.(373-375)cGg>cTg	p.R125L	LRRC37B_ENST00000327564.7_Missense_Mutation_p.R152L|LRRC37B_ENST00000584368.1_Missense_Mutation_p.R137L|LRRC37B_ENST00000394713.3_Missense_Mutation_p.R125L|LRRC37B_ENST00000543378.2_Missense_Mutation_p.R43L	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	125						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				AATGACAAGCGGACTCCAGAA	0.537																																					p.R125L		.											.	LRRC37B-92	0			c.G374T						.						67.0	72.0	70.0					17																	30348539		2203	4299	6502	SO:0001583	missense	114659	exon1			ACAAGCGGACTCC	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.374G>T	17.37:g.30348539G>T	ENSP00000340519:p.Arg125Leu	Somatic	167	0		WXS	Illumina HiSeq	Phase_I	153	49	NM_052888	0	0	1	1	0	Q17RC9|Q5YKG6	Missense_Mutation	SNP	ENST00000341671.7	37	CCDS32609.1	.	.	.	.	.	.	.	.	.	.	N	0	-2.679426	0.00102	.	.	ENSG00000185158	ENST00000543378;ENST00000327564;ENST00000394713;ENST00000341671	T;T;T;T	0.48836	1.03;0.8;1.92;0.83	1.88	-3.76	0.04359	.	.	.	.	.	T	0.08846	0.0219	N	0.00210	-1.845	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08027	-1.0742	9	0.09338	T	0.73	.	1.1007	0.01683	0.17:0.2722:0.3459:0.2118	.	125;125	Q17RC9;Q96QE4	.;LR37B_HUMAN	L	43;152;125;125	ENSP00000443345:R43L;ENSP00000332536:R152L;ENSP00000378202:R125L;ENSP00000340519:R125L	ENSP00000332536:R152L	R	+	2	0	LRRC37B	27372652	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.498000	0.06420	-2.354000	0.00614	-1.626000	0.00786	CGG	.		0.537	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888	
KRTAP4-3	85290	hgsc.bcm.edu	37	17	39324228	39324228	+	Missense_Mutation	SNP	C	C	A	rs192418439	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:39324228C>A	ENST00000391356.2	-	1	196	c.197G>T	c.(196-198)aGg>aTg	p.R66M		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	66	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			gcaggtggtcctgcagcagct	0.627																																					p.R66M		.											.	KRTAP4-3-22	0			c.G197T						.						3.0	5.0	4.0					17																	39324228		1442	3508	4950	SO:0001583	missense	85290	exon1			GTGGTCCTGCAGC	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.197G>T	17.37:g.39324228C>A	ENSP00000375151:p.Arg66Met	Somatic	19	2		WXS	Illumina HiSeq	Phase_I	29	9	NM_033187	0	0	0	0	0		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	272	0.12454212454212454	19	0.03861788617886179	47	0.1298342541436464	119	0.20804195804195805	87	0.11477572559366754	.	5.704	0.314484	0.10789	.	.	ENSG00000196156	ENST00000391356	T	0.01446	4.88	4.66	-9.31	0.00646	.	.	.	.	.	T	0.00012	0.0000	M	0.86953	2.85	0.09310	N	1	P	0.36438	0.553	B	0.33042	0.157	T	0.10776	-1.0615	9	0.56958	D	0.05	.	0.7924	0.01060	0.2961:0.1605:0.1481:0.3953	.	66	Q9BYR4	KRA43_HUMAN	M	66	ENSP00000375151:R66M	ENSP00000375151:R66M	R	-	2	0	KRTAP4-3	36577754	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.405000	0.00239	-5.285000	0.00017	-0.913000	0.02753	AGG	C|0.876;A|0.125		0.627	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
ABI3	51225	broad.mit.edu	37	17	47299547	47299547	+	Silent	SNP	T	T	C	rs572814048		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:47299547T>C	ENST00000225941.1	+	7	1395	c.897T>C	c.(895-897)ccT>ccC	p.P299P	ABI3_ENST00000419580.2_Silent_p.P293P	NM_001135186.1|NM_016428.2	NP_001128658.1|NP_057512	Q9P2A4	ABI3_HUMAN	ABI family, member 3	299	Pro-rich.				cellular component movement (GO:0006928)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	12			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			GATTTGGGCCTGATGAGCCCA	0.622										HNSCC(55;0.14)																											p.P299P													.	ABI3-90	0			c.T897C						.						79.0	77.0	77.0					17																	47299547		2203	4300	6503	SO:0001819	synonymous_variant	51225	exon7			TGGGCCTGATGAG	AB037886	CCDS11546.1, CCDS45725.1	17q21.3	2011-03-04	2008-09-12		ENSG00000108798	ENSG00000108798			29859	protein-coding gene	gene with protein product		606363				10978530, 11956071	Standard	NM_001135186		Approved	NESH, SSH3BP3	uc002iop.1	Q9P2A4	OTTHUMG00000161306	ENST00000225941.1:c.897T>C	17.37:g.47299547T>C		Somatic	149	0		WXS	Illumina HiSeq	Phase_I	183	4	NM_016428	0	0	24	24	0	C9IZN8|Q9H0P6	Silent	SNP	ENST00000225941.1	37	CCDS11546.1																																																																																			.		0.622	ABI3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364475.1	NM_016428	
MFSD11	79157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74772621	74772621	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:74772621C>T	ENST00000588460.1	+	12	3225	c.1183C>T	c.(1183-1185)Cag>Tag	p.Q395*	MFSD11_ENST00000355954.3_Nonsense_Mutation_p.Q343*|MFSD11_ENST00000586622.1_Nonsense_Mutation_p.Q395*|MFSD11_ENST00000593181.1_Nonsense_Mutation_p.Q343*|MFSD11_ENST00000336509.4_Nonsense_Mutation_p.Q395*|MFSD11_ENST00000590514.1_Nonsense_Mutation_p.Q395*|MFSD11_ENST00000590070.1_3'UTR	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	395						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						CAAGTTTGTTCAGGTAACCTC	0.423																																					p.Q395X		.											.	MFSD11-91	0			c.C1183T						.						165.0	158.0	160.0					17																	74772621		2203	4300	6503	SO:0001587	stop_gained	79157	exon12			TTTGTTCAGGTAA	BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.1183C>T	17.37:g.74772621C>T	ENSP00000464932:p.Gln395*	Somatic	236	0		WXS	Illumina HiSeq	Phase_I	220	108	NM_001242532	0	0	0	0	0	O43442|Q9NXI5	Nonsense_Mutation	SNP	ENST00000588460.1	37	CCDS11750.1	.	.	.	.	.	.	.	.	.	.	C	39	7.628628	0.98399	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.9106	19.2358	0.93858	0.0:1.0:0.0:0.0	.	.	.	.	X	395;343	.	ENSP00000337240:Q395X	Q	+	1	0	MFSD11	72284216	1.000000	0.71417	0.995000	0.50966	0.966000	0.64601	7.624000	0.83124	2.529000	0.85273	0.563000	0.77884	CAG	.		0.423	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451516.1	NM_024311	
RPTOR	57521	hgsc.bcm.edu	37	17	78858927	78858927	+	Silent	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:78858927C>T	ENST00000306801.3	+	17	2324	c.1962C>T	c.(1960-1962)gaC>gaT	p.D654D	RPTOR_ENST00000544334.2_Intron|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	654					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						TGGTCAGCGACGGGAGCCCCA	0.687																																					p.D654D		.											.	RPTOR-847	0			c.C1962T						.						36.0	27.0	30.0					17																	78858927		2192	4283	6475	SO:0001819	synonymous_variant	57521	exon17			CAGCGACGGGAGC		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.1962C>T	17.37:g.78858927C>T		Somatic	5	2		WXS	Illumina HiSeq	Phase_I	12	6	NM_020761	0	0	11	35	24	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Silent	SNP	ENST00000306801.3	37	CCDS11773.1																																																																																			.		0.687	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
SYT4	6860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	40853823	40853823	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr18:40853823C>T	ENST00000255224.3	-	2	939	c.571G>A	c.(571-573)Gac>Aac	p.D191N	SYT4_ENST00000590752.1_Missense_Mutation_p.D173N|SYT4_ENST00000586678.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	191	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						ATATATGGGTCAGAGGTCATC	0.438																																					p.D191N	NSCLC(85;81 1419 2855 22820 35912)	.											.	SYT4-132	0			c.G571A						.						78.0	77.0	78.0					18																	40853823		2203	4300	6503	SO:0001583	missense	6860	exon2			ATGGGTCAGAGGT	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.571G>A	18.37:g.40853823C>T	ENSP00000255224:p.Asp191Asn	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	112	46	NM_020783	0	0	0	0	0	B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979225	0.92982	.	.	ENSG00000132872	ENST00000255224	T	0.14516	2.5	5.87	5.87	0.94306	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.43188	0.1236	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.19192	-1.0313	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	173;191	B4DEU3;Q9H2B2	.;SYT4_HUMAN	N	191	ENSP00000255224:D191N	ENSP00000255224:D191N	D	-	1	0	SYT4	39107821	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.729000	0.84864	2.941000	0.99782	0.655000	0.94253	GAC	.		0.438	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
MRPL54	116541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	3765208	3765208	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr19:3765208G>A	ENST00000330133.4	+	2	200	c.163G>A	c.(163-165)Gcc>Acc	p.A55T		NM_172251.2	NP_758455.1	Q6P161	RM54_HUMAN	mitochondrial ribosomal protein L54	55						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		GACCAGCGAGGCCCTCAAGGA	0.572																																					p.A55T		.											.	MRPL54-90	0			c.G163A						.						109.0	90.0	96.0					19																	3765208		2202	4300	6502	SO:0001583	missense	116541	exon2			AGCGAGGCCCTCA		CCDS12111.1	19p13.3	2012-11-14			ENSG00000183617	ENSG00000183617		"""Mitochondrial ribosomal proteins / large subunits"""	16685	protein-coding gene	gene with protein product		611858				11551941	Standard	NM_172251		Approved		uc002lyq.4	Q6P161	OTTHUMG00000180873	ENST00000330133.4:c.163G>A	19.37:g.3765208G>A	ENSP00000331849:p.Ala55Thr	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	50	24	NM_172251	1	0	75	142	66		Missense_Mutation	SNP	ENST00000330133.4	37	CCDS12111.1	.	.	.	.	.	.	.	.	.	.	G	5.440	0.266338	0.10294	.	.	ENSG00000183617	ENST00000330133	.	.	.	4.9	1.59	0.23543	.	0.387651	0.25753	N	0.028522	T	0.22704	0.0548	N	0.19112	0.55	0.09310	N	0.999999	B	0.14438	0.01	B	0.12837	0.008	T	0.18840	-1.0324	9	0.16420	T	0.52	-5.8698	8.109	0.30903	0.2723:0.0:0.7277:0.0	.	55	Q6P161	RM54_HUMAN	T	55	.	ENSP00000331849:A55T	A	+	1	0	MRPL54	3716208	0.988000	0.35896	0.368000	0.25939	0.019000	0.09904	2.395000	0.44459	0.485000	0.27652	0.462000	0.41574	GCC	.		0.572	MRPL54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453443.1	NM_172251	
ANKLE1	126549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	17396342	17396342	+	Silent	SNP	C	C	T	rs111432888		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr19:17396342C>T	ENST00000394458.3	+	7	1755	c.1479C>T	c.(1477-1479)gcC>gcT	p.A493A	ANKLE1_ENST00000433424.2_3'UTR|ANKLE1_ENST00000598347.1_Silent_p.A467A|ANKLE1_ENST00000404085.1_Silent_p.A489A|ANKLE1_ENST00000594072.1_Silent_p.A456A	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	493	GIY-YIG. {ECO:0000255|PROSITE- ProRule:PRU00977}.									large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						GGACGAGGGCCCGGCCATATG	0.617																																					p.A493A		.											.	.	0			c.C1479T						.						85.0	93.0	91.0					19																	17396342		2203	4300	6503	SO:0001819	synonymous_variant	126549	exon7			GAGGGCCCGGCCA	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.1479C>T	19.37:g.17396342C>T		Somatic	126	1		WXS	Illumina HiSeq	Phase_I	167	54	NM_152363	0	0	0	0	0	A8VU82|Q8N8J8	Silent	SNP	ENST00000394458.3	37	CCDS12354.2																																																																																			C|0.500;T|0.500		0.617	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325392.2	NM_152363	
ZFP14	57677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36831787	36831787	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr19:36831787C>T	ENST00000270001.7	-	5	1056	c.941G>A	c.(940-942)tGt>tAt	p.C314Y		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	314					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					ACATTCCTTACATTCATAGAG	0.418																																					p.C314Y		.											.	ZFP14-91	0			c.G941A						.						97.0	100.0	99.0					19																	36831787		2203	4300	6503	SO:0001583	missense	57677	exon5			TCCTTACATTCAT	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.941G>A	19.37:g.36831787C>T	ENSP00000270001:p.Cys314Tyr	Somatic	212	1		WXS	Illumina HiSeq	Phase_I	104	39	NM_020917	0	0	1	3	2	A7MD23	Missense_Mutation	SNP	ENST00000270001.7	37	CCDS33002.1	.	.	.	.	.	.	.	.	.	.	c	17.95	3.513281	0.64522	.	.	ENSG00000142065	ENST00000270001;ENST00000392172	D	0.85088	-1.94	3.92	3.92	0.45320	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000146	D	0.94584	0.8255	H	0.96518	3.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96261	0.9191	10	0.87932	D	0	.	15.2044	0.73165	0.0:1.0:0.0:0.0	.	314;314	A8KAN8;Q9HCL3	.;ZFP14_HUMAN	Y	314	ENSP00000270001:C314Y	ENSP00000270001:C314Y	C	-	2	0	ZFP14	41523627	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.282000	0.78630	2.177000	0.69029	0.549000	0.68633	TGT	.		0.418	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917	
ZNF225	7768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44635911	44635911	+	Silent	SNP	A	A	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr19:44635911A>C	ENST00000262894.6	+	5	1424	c.1144A>C	c.(1144-1146)Aga>Cga	p.R382R	ZNF225_ENST00000590612.1_Silent_p.R382R|ZNF225_ENST00000592780.1_3'UTR	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				AAAGAGCTTCAGATGGGCCTC	0.408																																					p.R382R		.											.	.	0			c.A1144C						.						74.0	80.0	78.0					19																	44635911		2182	4282	6464	SO:0001819	synonymous_variant	7768	exon5			AGCTTCAGATGGG	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.1144A>C	19.37:g.44635911A>C		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	101	47	NM_013362	0	0	0	1	1	A8K8S2|Q53F12|Q9NS46|Q9UID8	Silent	SNP	ENST00000262894.6	37	CCDS46100.1																																																																																			.		0.408	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
ZNF547	284306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57888699	57888699	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr19:57888699G>A	ENST00000282282.3	+	4	505	c.355G>A	c.(355-357)Gca>Aca	p.A119T	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	119					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CACGTGTCCAGCACATCTTCA	0.517																																					p.A119T		.											.	ZNF547-91	0			c.G355A						.						100.0	88.0	92.0					19																	57888699		2203	4300	6503	SO:0001583	missense	284306	exon4			TGTCCAGCACATC	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.355G>A	19.37:g.57888699G>A	ENSP00000282282:p.Ala119Thr	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	91	27	NM_173631	0	0	0	1	1	A8K5Z9|Q96NC4	Missense_Mutation	SNP	ENST00000282282.3	37	CCDS33131.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.727951	0.30593	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	T	0.05855	3.38	2.09	-1.39	0.08997	.	.	.	.	.	T	0.05823	0.0152	L	0.37800	1.135	0.09310	N	1	P;B;P	0.51057	0.728;0.141;0.941	B;B;B	0.43889	0.358;0.031;0.435	T	0.36311	-0.9753	9	0.42905	T	0.14	.	6.7967	0.23729	0.4946:0.0:0.5054:0.0	.	119;119;119	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	T	119	ENSP00000282282:A119T	ENSP00000282282:A119T	A	+	1	0	ZNF547	62580511	0.000000	0.05858	0.004000	0.12327	0.227000	0.25037	-0.074000	0.11450	-0.246000	0.09611	0.491000	0.48974	GCA	.		0.517	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631	
ADAM17	6868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	9630624	9630624	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:9630624C>T	ENST00000310823.3	-	19	2339	c.2157G>A	c.(2155-2157)atG>atA	p.M719I	IAH1_ENST00000545602.1_Intron	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	719					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		ATGCAGAATCCATGCTGCTCA	0.537																																					p.M719I		.											.	ADAM17-659	0			c.G2157A						.						54.0	51.0	52.0					2																	9630624		2203	4300	6503	SO:0001583	missense	6868	exon19			AGAATCCATGCTG	U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.2157G>A	2.37:g.9630624C>T	ENSP00000309968:p.Met719Ile	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	55	11	NM_003183	0	0	12	17	5	O60226	Missense_Mutation	SNP	ENST00000310823.3	37	CCDS1665.1	.	.	.	.	.	.	.	.	.	.	C	9.835	1.189343	0.21954	.	.	ENSG00000151694	ENST00000310823	T	0.19806	2.12	5.46	5.46	0.80206	.	0.145332	0.64402	N	0.000007	T	0.14399	0.0348	N	0.12182	0.205	0.80722	D	1	B;B;B	0.13145	0.0;0.007;0.007	B;B;B	0.12156	0.0;0.007;0.007	T	0.11792	-1.0573	10	0.19590	T	0.45	.	19.3715	0.94490	0.0:1.0:0.0:0.0	.	438;719;719	Q53RS1;B2RNB2;P78536	.;.;ADA17_HUMAN	I	719	ENSP00000309968:M719I	ENSP00000309968:M719I	M	-	3	0	ADAM17	9548075	1.000000	0.71417	1.000000	0.80357	0.113000	0.19764	2.684000	0.46951	2.570000	0.86706	0.456000	0.33151	ATG	.		0.537	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
FAM49A	81553	hgsc.bcm.edu;broad.mit.edu	37	2	16736394	16736394	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:16736394A>T	ENST00000381323.3	-	11	1071	c.851T>A	c.(850-852)aTa>aAa	p.I284K	FAM49A_ENST00000355549.2_Missense_Mutation_p.I284K|FAM49A_ENST00000406434.1_Missense_Mutation_p.I284K	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	284						intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			CAAAACTTTTATGCAGCCTTT	0.458																																					p.I284K		.											.	FAM49A-226	0			c.T851A						.						52.0	51.0	51.0					2																	16736394		2203	4300	6503	SO:0001583	missense	81553	exon11			ACTTTTATGCAGC	AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.851T>A	2.37:g.16736394A>T	ENSP00000370724:p.Ile284Lys	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	34	7	NM_030797	0	0	0	0	0	B3KNZ1|Q53QW2	Missense_Mutation	SNP	ENST00000381323.3	37	CCDS1688.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.832727	0.91036	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549	T;T;T	0.55234	0.53;0.53;0.53	5.37	5.37	0.77165	.	0.041280	0.85682	D	0.000000	T	0.74642	0.3743	M	0.84683	2.71	0.80722	D	1	D	0.61080	0.989	D	0.71656	0.974	T	0.79593	-0.1739	10	0.87932	D	0	-26.8426	14.8606	0.70379	1.0:0.0:0.0:0.0	.	284	Q9H0Q0	FA49A_HUMAN	K	284	ENSP00000370724:I284K;ENSP00000384771:I284K;ENSP00000347744:I284K	ENSP00000347744:I284K	I	-	2	0	FAM49A	16599875	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.288000	0.96055	2.170000	0.68504	0.533000	0.62120	ATA	.		0.458	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207203.2	NM_030797	
PIGF	5281	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	46815297	46815297	+	Intron	SNP	T	T	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:46815297T>C	ENST00000281382.6	-	5	717				PIGF_ENST00000306465.4_Missense_Mutation_p.S190G	NM_002643.3	NP_002634.1	Q07326	PIGF_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class F						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)			breast(1)|endometrium(1)|lung(1)|stomach(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			ctataagtgctaCGTTTTCTT	0.388																																					p.S190G		.											.	PIGF-226	0			c.A568G						.						107.0	95.0	100.0					2																	46815297		2203	4300	6503	SO:0001627	intron_variant	5281	exon6			AAGTGCTACGTTT		CCDS1827.1, CCDS1828.1	2p21-p16	2013-02-26	2006-06-28		ENSG00000151665	ENSG00000151665		"""Phosphatidylinositol glycan anchor biosynthesis"""	8962	protein-coding gene	gene with protein product		600153	"""phosphatidylinositol glycan, class F"""			8575782, 8463218	Standard	NM_173074		Approved		uc002rvd.3	Q07326	OTTHUMG00000128816	ENST00000281382.6:c.546+4316A>G	2.37:g.46815297T>C		Somatic	53	0		WXS	Illumina HiSeq	Phase_I	46	22	NM_173074	0	0	1	13	12	Q8WW20	Missense_Mutation	SNP	ENST00000281382.6	37	CCDS1827.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.485331	0.26598	.	.	ENSG00000151665	ENST00000306465	.	.	.	4.19	-1.01	0.10169	.	.	.	.	.	T	0.27559	0.0677	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.11329	0.006	T	0.28681	-1.0036	7	0.87932	D	0	.	4.1091	0.10050	0.0:0.1982:0.3574:0.4443	.	190	Q07326-2	.	G	190	.	ENSP00000302663:S190G	S	-	1	0	PIGF	46668801	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.098000	0.11024	-0.159000	0.11021	-0.438000	0.05819	AGC	.		0.388	PIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250749.2	NM_173074	
TTC7A	57217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	47300864	47300864	+	Silent	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:47300864C>T	ENST00000319190.5	+	20	2747	c.2379C>T	c.(2377-2379)ggC>ggT	p.G793G	AC073283.7_ENST00000421759.1_RNA|TTC7A_ENST00000409245.1_Silent_p.G759G|C2orf61_ENST00000464527.2_Intron|RP11-761B3.1_ENST00000422269.1_Intron|TTC7A_ENST00000394850.2_Silent_p.G817G|TTC7A_ENST00000263737.6_Silent_p.G439G	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	793					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GTCGGCTGGGCCACAAGAGCT	0.652																																					p.G793G		.											.	TTC7A-136	0			c.C2379T						.						66.0	61.0	63.0					2																	47300864		2203	4300	6503	SO:0001819	synonymous_variant	57217	exon20			GCTGGGCCACAAG	AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.2379C>T	2.37:g.47300864C>T		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	62	24	NM_020458	0	0	14	25	11	Q6PIX4|Q8ND67|Q9BUS3	Silent	SNP	ENST00000319190.5	37	CCDS33193.1																																																																																			.		0.652	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329667.2	XM_372927	
SPTBN1	6711	hgsc.bcm.edu	37	2	54876308	54876308	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:54876308A>G	ENST00000356805.4	+	25	5464	c.5183A>G	c.(5182-5184)cAg>cGg	p.Q1728R	SPTBN1_ENST00000333896.5_Missense_Mutation_p.Q1715R	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1728	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GAACTGGGACAGGACTATGAG	0.552																																					p.Q1728R		.											.	SPTBN1-140	0			c.A5183G						.						82.0	70.0	74.0					2																	54876308		2203	4300	6503	SO:0001583	missense	6711	exon25			TGGGACAGGACTA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.5183A>G	2.37:g.54876308A>G	ENSP00000349259:p.Gln1728Arg	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	74	4	NM_003128	0	0	169	169	0	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.936737	0.92458	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.48201	0.82;0.82	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.73385	0.3580	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.985;0.996	T	0.77840	-0.2438	10	0.59425	D	0.04	.	16.2826	0.82703	1.0:0.0:0.0:0.0	.	1715;1728	Q01082-3;Q01082	.;SPTB2_HUMAN	R	1728;1715	ENSP00000349259:Q1728R;ENSP00000334156:Q1715R	ENSP00000334156:Q1715R	Q	+	2	0	SPTBN1	54729812	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.281000	0.95811	2.253000	0.74438	0.454000	0.30748	CAG	.		0.552	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
IL1R2	7850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	102626224	102626224	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:102626224G>T	ENST00000332549.3	+	3	497	c.268G>T	c.(268-270)Gac>Tac	p.D90Y	IL1R2_ENST00000441002.1_Missense_Mutation_p.D90Y|IL1R2_ENST00000393414.2_Missense_Mutation_p.D90Y	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	90	Ig-like C2-type 1.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						GTGGGCCCAGGACGGTGCTCT	0.597																																					p.D90Y	Pancreas(106;189 1628 2302 5133 12295)	.											.	IL1R2-522	0			c.G268T						.						139.0	147.0	145.0					2																	102626224		2203	4300	6503	SO:0001583	missense	7850	exon3			GCCCAGGACGGTG	X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.268G>T	2.37:g.102626224G>T	ENSP00000330959:p.Asp90Tyr	Somatic	359	1		WXS	Illumina HiSeq	Phase_I	270	85	NM_001261419	0	0	0	0	0	D3DVJ5|Q6LCE6|Q9UE68	Missense_Mutation	SNP	ENST00000332549.3	37	CCDS2054.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711212	0.30322	.	.	ENSG00000115590	ENST00000332549;ENST00000393414;ENST00000457817;ENST00000441002	T;T;T;T	0.62788	0.0;0.0;0.0;0.0	5.8	4.92	0.64577	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.512100	0.21363	N	0.075776	T	0.59770	0.2218	M	0.76002	2.32	0.09310	N	1	B	0.16396	0.017	B	0.14023	0.01	T	0.57039	-0.7879	10	0.56958	D	0.05	.	7.7685	0.28993	0.0807:0.0:0.756:0.1633	.	90	P27930	IL1R2_HUMAN	Y	90	ENSP00000330959:D90Y;ENSP00000377066:D90Y;ENSP00000408415:D90Y;ENSP00000414611:D90Y	ENSP00000330959:D90Y	D	+	1	0	IL1R2	101992656	0.347000	0.24853	0.015000	0.15790	0.125000	0.20455	1.279000	0.33191	1.466000	0.48025	-0.268000	0.10319	GAC	.		0.597	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253191.1	NM_004633	
CYBRD1	79901	broad.mit.edu	37	2	172379114	172379114	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:172379114G>A	ENST00000321348.4	+	1	257	c.59G>A	c.(58-60)gGc>gAc	p.G20D	CYBRD1_ENST00000468308.1_3'UTR|CYBRD1_ENST00000409484.1_Intron|CYBRD1_ENST00000375252.3_Missense_Mutation_p.G20D	NM_024843.3	NP_079119.3	Q53TN4	CYBR1_HUMAN	cytochrome b reductase 1	20	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				cellular iron ion homeostasis (GO:0006879)|response to iron ion (GO:0010039)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|oxidoreductase activity, oxidizing metal ions (GO:0016722)			endometrium(1)|kidney(1)|large_intestine(3)|liver(2)|lung(3)	10						CTGCTCGTCGGCTTCCTGTCG	0.652																																					p.G20D													.	CYBRD1-90	0			c.G59A						.						68.0	64.0	65.0					2																	172379114		2203	4300	6503	SO:0001583	missense	79901	exon1			TCGTCGGCTTCCT	AK027115	CCDS2244.1, CCDS46449.1, CCDS58736.1	2q31	2013-03-14			ENSG00000071967	ENSG00000071967		"""Cytochrome b genes"""	20797	protein-coding gene	gene with protein product	"""ferric-chelate reductase 3"", ""cytochrome b561 family, member A2"""	605745				11230685	Standard	NM_001127383		Approved	DCYTB, FLJ23462, FRRS3, CYB561A2	uc002ugy.4	Q53TN4	OTTHUMG00000132260	ENST00000321348.4:c.59G>A	2.37:g.172379114G>A	ENSP00000319141:p.Gly20Asp	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	37	4	NM_024843	0	0	13	15	2	B2RE79|B4DWD7|Q6KC16|Q6KC17|Q6P147|Q6ZR51|Q9H0Q8|Q9H5G5	Missense_Mutation	SNP	ENST00000321348.4	37	CCDS2244.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.041589	0.93685	.	.	ENSG00000071967	ENST00000321348;ENST00000375252	T	0.64991	-0.13	4.85	3.97	0.46021	Cytochrome b561/ferric reductase transmembrane (1);	0.000000	0.85682	D	0.000000	D	0.83857	0.5345	H	0.95187	3.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.87446	0.2398	10	0.87932	D	0	-8.9137	12.2705	0.54704	0.0833:0.0:0.9167:0.0	.	20;20	Q53TN4-2;Q53TN4	.;CYBR1_HUMAN	D	20	ENSP00000319141:G20D	ENSP00000319141:G20D	G	+	2	0	CYBRD1	172087360	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	8.808000	0.91939	1.030000	0.39839	0.563000	0.77884	GGC	.		0.652	CYBRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255344.2	NM_024843	
RAPH1	65059	broad.mit.edu	37	2	204305855	204305855	+	Silent	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:204305855C>T	ENST00000319170.5	-	14	2357	c.2058G>A	c.(2056-2058)ccG>ccA	p.P686P	RAPH1_ENST00000374493.3_Silent_p.P738P|RAPH1_ENST00000457812.1_Intron|ABI2_ENST00000295851.5_3'UTR	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	686					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGGGTGTTGGCGGCTTAAACA	0.577																																					p.P686P													.	RAPH1-1151	0			c.G2058A						.						62.0	61.0	61.0					2																	204305855		2203	4299	6502	SO:0001819	synonymous_variant	65059	exon14			TGTTGGCGGCTTA	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.2058G>A	2.37:g.204305855C>T		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	92	5	NM_213589	0	0	0	0	0	Q96Q37|Q9C0I2	Silent	SNP	ENST00000319170.5	37	CCDS2359.1																																																																																			.		0.577	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
NINL	22981	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	25457543	25457543	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr20:25457543C>T	ENST00000278886.6	-	17	2457	c.2384G>A	c.(2383-2385)cGc>cAc	p.R795H	NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	795					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CATCTGGGCGCGCTTCTCGCT	0.692																																					p.R795H													.	NINL-94	0			c.G2384A						.						43.0	36.0	39.0					20																	25457543		2203	4300	6503	SO:0001583	missense	22981	exon17			TGGGCGCGCTTCT		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.2384G>A	20.37:g.25457543C>T	ENSP00000278886:p.Arg795His	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	26	4	NM_025176	0	0	6	18	12	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	C	7.781	0.709555	0.15239	.	.	ENSG00000101004	ENST00000278886	T	0.25912	1.77	3.48	2.25	0.28309	.	1.732920	0.03095	N	0.160239	T	0.10465	0.0256	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28396	-1.0045	10	0.10636	T	0.68	-0.6342	5.269	0.15615	0.0:0.1397:0.0:0.8603	.	795	Q9Y2I6	NINL_HUMAN	H	795	ENSP00000278886:R795H	ENSP00000278886:R795H	R	-	2	0	NINL	25405543	0.015000	0.18098	0.001000	0.08648	0.000000	0.00434	0.998000	0.29744	0.426000	0.26116	-0.672000	0.03802	CGC	.		0.692	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
UMODL1	89766	broad.mit.edu	37	21	43529716	43529716	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr21:43529716G>A	ENST00000408910.2	+	10	1564	c.1564G>A	c.(1564-1566)Gct>Act	p.A522T	UMODL1_ENST00000400424.2_Missense_Mutation_p.A450T|C21orf128_ENST00000329015.2_5'Flank|UMODL1_ENST00000400427.1_Missense_Mutation_p.A450T|UMODL1_ENST00000408989.2_Missense_Mutation_p.A522T	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	522	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CTGCTCACCGGCTGCCTGGTG	0.627																																					p.A522T	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)												.	UMODL1-93	0			c.G1564A						.						70.0	83.0	79.0					21																	43529716		2051	4178	6229	SO:0001583	missense	89766	exon10			TCACCGGCTGCCT		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1564G>A	21.37:g.43529716G>A	ENSP00000386147:p.Ala522Thr	Somatic	115	1		WXS	Illumina HiSeq	Phase_I	89	4	NM_173568	0	0	0	0	0	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	6.981	0.551127	0.13374	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	D;D;D;D	0.92149	-1.54;-2.98;-1.54;-2.98	3.23	1.34	0.21922	EGF-like calcium-binding, conserved site (1);Epidermal growth factor-like (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	1.885950	0.03158	N	0.168966	D	0.87010	0.6071	N	0.16790	0.44	0.09310	N	1	B;B	0.32753	0.383;0.055	B;B	0.40009	0.316;0.093	T	0.77357	-0.2618	10	0.27785	T	0.31	-3.9791	5.9046	0.18986	0.2526:0.0:0.7474:0.0	.	522;522	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	T	450;450;522;522	ENSP00000383279:A450T;ENSP00000383276:A450T;ENSP00000386126:A522T;ENSP00000386147:A522T	ENSP00000383276:A450T	A	+	1	0	UMODL1	42402785	0.000000	0.05858	0.006000	0.13384	0.003000	0.03518	0.384000	0.20668	0.364000	0.24374	-0.150000	0.13652	GCT	.		0.627	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
ITGB2	3689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	46306670	46306670	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr21:46306670A>C	ENST00000397850.2	-	16	2680	c.2228T>G	c.(2227-2229)cTc>cGc	p.L743R	ITGB2_ENST00000397854.3_Missense_Mutation_p.L686R|ITGB2_ENST00000355153.4_Missense_Mutation_p.L743R|ITGB2_ENST00000397852.1_Missense_Mutation_p.L743R|ITGB2_ENST00000397857.1_Missense_Mutation_p.L743R|ITGB2_ENST00000302347.5_Missense_Mutation_p.L743R			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	743					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	CTGGGACTTGAGCTTCTCCTT	0.617																																					p.L743R		.											.	ITGB2-717	0			c.T2228G						.						110.0	88.0	96.0					21																	46306670		2203	4300	6503	SO:0001583	missense	3689	exon15			GACTTGAGCTTCT	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.2228T>G	21.37:g.46306670A>C	ENSP00000380948:p.Leu743Arg	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	43	6	NM_000211	0	0	126	126	0	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	37	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	A	2.100	-0.406333	0.04832	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347	D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	4.62	2.16	0.27623	Integrin beta subunit, cytoplasmic (2);	.	.	.	.	T	0.78483	0.4290	L	0.34521	1.04	0.30302	N	0.789334	P;P	0.37276	0.589;0.589	B;B	0.43018	0.405;0.315	T	0.67795	-0.5578	9	0.15066	T	0.55	.	1.6167	0.02705	0.5553:0.1773:0.0964:0.171	.	686;743	A8MYE6;P05107	.;ITB2_HUMAN	R	743;743;686;743;743;743	ENSP00000380950:L743R;ENSP00000380955:L743R;ENSP00000380952:L686R;ENSP00000347279:L743R;ENSP00000380948:L743R;ENSP00000303242:L743R	ENSP00000303242:L743R	L	-	2	0	ITGB2	45131098	1.000000	0.71417	0.996000	0.52242	0.100000	0.18952	1.319000	0.33655	0.157000	0.19338	-0.250000	0.11733	CTC	.		0.617	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
NF2	4771	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30038223	30038223	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr22:30038223C>A	ENST00000338641.4	+	4	837	c.396C>A	c.(394-396)taC>taA	p.Y132*	NF2_ENST00000361166.4_Nonsense_Mutation_p.Y132*|NF2_ENST00000403435.1_Nonsense_Mutation_p.Y132*|NF2_ENST00000413209.2_Nonsense_Mutation_p.Y132*|NF2_ENST00000403999.3_Nonsense_Mutation_p.Y132*|NF2_ENST00000353887.4_Nonsense_Mutation_p.Y49*|NF2_ENST00000361676.4_Nonsense_Mutation_p.Y90*|NF2_ENST00000347330.5_Nonsense_Mutation_p.Y49*|NF2_ENST00000334961.7_Nonsense_Mutation_p.Y49*|NF2_ENST00000397789.3_Nonsense_Mutation_p.Y132*|NF2_ENST00000361452.4_Nonsense_Mutation_p.Y91*	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	132	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.V122_K149del(5)|p.?(3)|p.L127_P134del(1)|p.K123fs*2(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						AAAAGATCTACTGCCCTCCTG	0.468			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.Y132X		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	10	Deletion - In frame(6)|Unknown(3)|Deletion - Frameshift(1)	soft_tissue(8)|large_intestine(1)|stomach(1)	c.C396A						.						95.0	90.0	92.0					22																	30038223		2203	4300	6503	SO:0001587	stop_gained	4771	exon4	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	GATCTACTGCCCT	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.396C>A	22.37:g.30038223C>A	ENSP00000344666:p.Tyr132*	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	55	37	NM_000268	0	0	1	3	2	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Nonsense_Mutation	SNP	ENST00000338641.4	37	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	C	39	7.545417	0.98348	.	.	ENSG00000186575	ENST00000413209;ENST00000347330;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.45	2.11	0.27256	.	0.116668	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5018	0.50441	0.0:0.7981:0.0:0.2019	.	.	.	.	X	132;49;132;132;91;132;132;49;49;132;90;132	.	.	Y	+	3	2	NF2	28368223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.702000	0.37836	0.657000	0.30906	0.655000	0.94253	TAC	.		0.468	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
ITPR1	3708	bcgsc.ca	37	3	4685828	4685828	+	Silent	SNP	A	A	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:4685828A>T	ENST00000443694.2	+	6	534	c.534A>T	c.(532-534)atA>atT	p.I178I	ITPR1_ENST00000456211.2_Silent_p.I178I|ITPR1_ENST00000357086.4_Silent_p.I178I|ITPR1_ENST00000423119.2_Silent_p.I178I|ITPR1_ENST00000354582.6_Silent_p.I178I|ITPR1_ENST00000544951.1_Silent_p.I178I|ITPR1_ENST00000302640.8_Silent_p.I178I			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	178	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	AGGTGGTCATAGGTGACAAGG	0.493																																					p.I178I													.	ITPR1-710	0			c.A534T						.						100.0	97.0	98.0					3																	4685828		2008	4180	6188	SO:0001819	synonymous_variant	3708	exon8			GGTCATAGGTGAC	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.534A>T	3.37:g.4685828A>T		Somatic	19	0		WXS	Illumina HiSeq	Phase_1	24	4	NM_001099952	0	0	0	0	0	E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	ENST00000443694.2	37	CCDS54551.1																																																																																			.		0.493	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
STAC	6769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	36587768	36587768	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:36587768T>G	ENST00000273183.3	+	11	1496	c.1196T>G	c.(1195-1197)cTa>cGa	p.L399R	STAC_ENST00000457375.2_Missense_Mutation_p.L338R	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	399					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						CTTGATGTACTAGAAAACATC	0.493																																					p.L399R		.											.	STAC-94	0			c.T1196G						.						151.0	131.0	138.0					3																	36587768		2203	4300	6503	SO:0001583	missense	6769	exon11			ATGTACTAGAAAA	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.1196T>G	3.37:g.36587768T>G	ENSP00000273183:p.Leu399Arg	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	80	62	NM_003149	0	0	0	0	0	B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	37	CCDS2662.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.126023	0.77436	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000544687	T;T	0.09445	2.98;2.98	5.17	5.17	0.71159	Src homology-3 domain (1);Variant SH3 (1);	0.074155	0.56097	D	0.000036	T	0.33904	0.0879	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.10200	-1.0640	10	0.87932	D	0	.	13.5546	0.61751	0.0:0.0:0.0:1.0	.	338;399	E9PEA7;Q99469	.;STAC_HUMAN	R	399;338;331	ENSP00000273183:L399R;ENSP00000393713:L338R	ENSP00000273183:L399R	L	+	2	0	STAC	36562772	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.936000	0.70153	2.074000	0.62210	0.533000	0.62120	CTA	.		0.493	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	47061276	47061276	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:47061276T>A	ENST00000409792.3	-	19	7447	c.7405A>T	c.(7405-7407)Aaa>Taa	p.K2469*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2469	Interaction with POLR2A.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCTTTGCTTTTCTTTGCTAGT	0.428			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.K2469X		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.A7405T						.						286.0	251.0	263.0					3																	47061276		2203	4300	6503	SO:0001587	stop_gained	29072	exon19			TGCTTTTCTTTGC	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7405A>T	3.37:g.47061276T>A	ENSP00000386759:p.Lys2469*	Somatic	151	1		WXS	Illumina HiSeq	Phase_I	85	72	NM_014159	0	0	5	11	6	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	48	14.332947	0.99790	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6824	0.77381	0.0:0.0:0.0:1.0	.	.	.	.	X	2469	.	ENSP00000386759:K2469X	K	-	1	0	SETD2	47036280	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.701000	0.84566	2.367000	0.80283	0.528000	0.53228	AAA	.		0.428	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
NPRL2	10641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50386372	50386372	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:50386372T>A	ENST00000232501.3	-	5	956	c.518A>T	c.(517-519)gAt>gTt	p.D173V	CYB561D2_ENST00000418577.1_5'Flank|ZMYND10_ENST00000231749.3_5'Flank|CYB561D2_ENST00000232508.5_5'Flank|XXcos-LUCA11.5_ENST00000606589.1_5'Flank|CYB561D2_ENST00000424512.1_5'Flank|CYB561D2_ENST00000425346.1_5'Flank|NPRL2_ENST00000493465.1_5'Flank	NM_006545.4	NP_006536.3	Q8WTW4	NPRL2_HUMAN	nitrogen permease regulator-like 2 (S. cerevisiae)	173					negative regulation of kinase activity (GO:0033673)|protein phosphorylation (GO:0006468)		GTPase activator activity (GO:0005096)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	11						GACAGGTACATCATACTCCTG	0.537																																					p.D173V		.											.	NPRL2-278	0			c.A518T						.						133.0	126.0	128.0					3																	50386372		2203	4300	6503	SO:0001583	missense	10641	exon5			GGTACATCATACT	AF040708	CCDS2826.1	3p21.3	2010-03-30	2010-03-30	2010-03-30	ENSG00000114388	ENSG00000114388			24969	protein-coding gene	gene with protein product		607072	"""tumor suppressor candidate 4"""	TUSC4		11085536	Standard	NM_006545		Approved	NPR2L, NPR2	uc003daj.1	Q8WTW4	OTTHUMG00000156864	ENST00000232501.3:c.518A>T	3.37:g.50386372T>A	ENSP00000232501:p.Asp173Val	Somatic	165	1		WXS	Illumina HiSeq	Phase_I	149	107	NM_006545	0	0	0	14	14	A8K831|Q6FGS2|Q9Y249|Q9Y497	Missense_Mutation	SNP	ENST00000232501.3	37	CCDS2826.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.945242	0.73672	.	.	ENSG00000114388	ENST00000232501	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.72534	0.3472	M	0.80422	2.495	0.80722	D	1	P	0.51057	0.941	P	0.51016	0.656	T	0.73113	-0.4085	9	0.30854	T	0.27	-20.1441	15.7486	0.77967	0.0:0.0:0.0:1.0	.	173	Q8WTW4	NPRL2_HUMAN	V	173	.	ENSP00000232501:D173V	D	-	2	0	NPRL2	50361376	1.000000	0.71417	0.990000	0.47175	0.940000	0.58332	7.968000	0.87980	2.122000	0.65172	0.533000	0.62120	GAT	.		0.537	NPRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346299.1	NM_006545	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52441190	52441190	+	Splice_Site	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:52441190C>T	ENST00000460680.1	-	7	1051	c.580G>A	c.(580-582)Ggg>Agg	p.G194R	BAP1_ENST00000296288.5_Splice_Site_p.G194R	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TGGTGCCTACCATGGTCAATG	0.597			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.G194R	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1-1032	1	Unknown(1)	eye(1)	c.G580A						.						59.0	57.0	58.0					3																	52441190		2203	4300	6503	SO:0001630	splice_region_variant	8314	exon7			GCCTACCATGGTC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.580+1G>A	3.37:g.52441190C>T		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	52	34	NM_004656	0	0	0	6	6	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	35	5.425433	0.96131	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.66995	-0.24;-0.24	6.05	6.05	0.98169	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.85682	D	0.000000	D	0.86756	0.6009	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87932	0.2711	10	0.66056	D	0.02	-7.544	20.6086	0.99469	0.0:1.0:0.0:0.0	.	194	Q92560	BAP1_HUMAN	R	194	ENSP00000417132:G194R;ENSP00000296288:G194R	ENSP00000296288:G194R	G	-	1	0	BAP1	52416230	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.783000	0.85696	2.880000	0.98712	0.655000	0.94253	GGG	.		0.597	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		Missense_Mutation
ZBTB11	27107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	101378652	101378652	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr3:101378652G>C	ENST00000312938.4	-	6	2601	c.2021C>G	c.(2020-2022)aCa>aGa	p.T674R	Y_RNA_ENST00000364251.1_RNA	NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	674					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CTTTACACCTGTGTGCTTTAA	0.373																																					p.T674R		.											.	ZBTB11-91	0			c.C2021G						.						118.0	117.0	117.0					3																	101378652		2203	4300	6503	SO:0001583	missense	27107	exon6			ACACCTGTGTGCT	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2021C>G	3.37:g.101378652G>C	ENSP00000326200:p.Thr674Arg	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	99	36	NM_014415	0	0	2	7	5	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	37	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560004	0.86335	.	.	ENSG00000066422	ENST00000312938	T	0.25749	1.78	5.09	5.09	0.68999	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.054542	0.64402	D	0.000001	T	0.47838	0.1467	L	0.52206	1.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48103	-0.9064	10	0.87932	D	0	-12.7873	18.48	0.90808	0.0:0.0:1.0:0.0	.	674	O95625	ZBT11_HUMAN	R	674	ENSP00000326200:T674R	ENSP00000326200:T674R	T	-	2	0	ZBTB11	102861342	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.181000	0.94874	2.387000	0.81309	0.491000	0.48974	ACA	.		0.373	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
KCTD8	386617	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	44450342	44450342	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr4:44450342C>T	ENST00000360029.3	-	1	482	c.199G>A	c.(199-201)Gac>Aac	p.D67N	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	67	BTB.				protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						AAAGTACTGTCCGGGACGCTG	0.682										HNSCC(17;0.042)																											p.D67N		.											.	KCTD8-92	0			c.G199A						.						25.0	21.0	22.0					4																	44450342		2190	4277	6467	SO:0001583	missense	386617	exon1			TACTGTCCGGGAC	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.199G>A	4.37:g.44450342C>T	ENSP00000353129:p.Asp67Asn	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	36	14	NM_198353	0	0	2	4	2	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.187972	0.57909	.	.	ENSG00000183783	ENST00000360029	T	0.46451	0.87	3.59	3.59	0.41128	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	D	0.000001	T	0.34337	0.0894	L	0.28014	0.82	0.58432	D	0.999992	B	0.31640	0.333	B	0.37091	0.241	T	0.28902	-1.0029	10	0.42905	T	0.14	.	14.3619	0.66779	0.0:1.0:0.0:0.0	.	67	Q6ZWB6	KCTD8_HUMAN	N	67	ENSP00000353129:D67N	ENSP00000353129:D67N	D	-	1	0	KCTD8	44145099	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.682000	0.68182	1.810000	0.52873	0.467000	0.42956	GAC	.		0.682	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
PPAT	5471	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	57262889	57262889	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr4:57262889G>A	ENST00000264220.2	-	10	1390	c.1253C>T	c.(1252-1254)gCt>gTt	p.A418V	RP11-646I6.6_ENST00000602749.1_lincRNA	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	418					'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	TGGTGGTGAAGCTACTCGAAT	0.338																																					p.A418V		.											.	PPAT-90	0			c.C1253T						.						130.0	121.0	124.0					4																	57262889		2203	4299	6502	SO:0001583	missense	5471	exon10			GGTGAAGCTACTC		CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.1253C>T	4.37:g.57262889G>A	ENSP00000264220:p.Ala418Val	Somatic	154	1		WXS	Illumina HiSeq	Phase_I	77	30	NM_002703	0	0	7	8	1		Missense_Mutation	SNP	ENST00000264220.2	37	CCDS3505.1	.	.	.	.	.	.	.	.	.	.	G	34	5.298750	0.95574	.	.	ENSG00000128059	ENST00000264220	D	0.99252	-5.63	5.77	5.77	0.91146	Phosphoribosyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.99483	0.9816	M	0.86097	2.795	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.98931	1.0787	10	0.87932	D	0	-26.581	19.9883	0.97356	0.0:0.0:1.0:0.0	.	418	Q06203	PUR1_HUMAN	V	418	ENSP00000264220:A418V	ENSP00000264220:A418V	A	-	2	0	PPAT	56957646	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.649000	0.98487	2.722000	0.93159	0.555000	0.69702	GCT	.		0.338	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	
CDC20B	166979	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	54429246	54429246	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr5:54429246C>A	ENST00000381375.2	-	6	836	c.691G>T	c.(691-693)Gac>Tac	p.D231Y	CDC20B_ENST00000334206.5_Missense_Mutation_p.D231Y|CDC20B_ENST00000296733.1_Missense_Mutation_p.D231Y|CDC20B_ENST00000322374.6_Missense_Mutation_p.D231Y			Q86Y33	CD20B_HUMAN	cell division cycle 20B	231										kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			TTACAGTAGTCATTTCGAAGA	0.353																																					p.D231Y		.											.	CDC20B-90	0			c.G691T						.						99.0	100.0	100.0					5																	54429246		2203	4300	6503	SO:0001583	missense	166979	exon6			AGTAGTCATTTCG	AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287		"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""				Standard	NM_152623		Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.691G>T	5.37:g.54429246C>A	ENSP00000370781:p.Asp231Tyr	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	99	37	NM_001170402	0	0	0	0	0	B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	Missense_Mutation	SNP	ENST00000381375.2	37	CCDS54852.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642068	0.67244	.	.	ENSG00000164287	ENST00000334206;ENST00000296733;ENST00000381375;ENST00000322374	T;T;T;T	0.10099	2.91;2.91;2.91;2.91	4.97	4.1	0.47936	WD40 repeat-like-containing domain (1);	0.000000	0.49305	D	0.000156	T	0.41789	0.1174	M	0.93328	3.405	0.80722	D	1	D;D;P;D	0.89917	0.999;0.97;0.949;1.0	D;P;P;D	0.74348	0.976;0.808;0.648;0.983	T	0.56607	-0.7951	10	0.87932	D	0	-6.0811	13.2244	0.59907	0.0:0.9223:0.0:0.0777	.	231;231;231;231	Q86Y33-4;Q86Y33-3;Q86Y33;Q86Y33-2	.;.;CD20B_HUMAN;.	Y	231	ENSP00000335664:D231Y;ENSP00000296733:D231Y;ENSP00000370781:D231Y;ENSP00000315720:D231Y	ENSP00000296733:D231Y	D	-	1	0	CDC20B	54465003	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.180000	0.65048	1.303000	0.44873	0.650000	0.86243	GAC	.		0.353	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369715.1	NM_152623	
OTP	23440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	76932809	76932809	+	Missense_Mutation	SNP	G	G	C	rs148662448	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr5:76932809G>C	ENST00000306422.3	-	2	1422	c.284C>G	c.(283-285)gCc>gGc	p.A95G	OTP_ENST00000515716.1_5'UTR	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	95					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		CTGCTGGCCGGCTTGGCTGGG	0.677																																					p.A95G		.											.	OTP-69	0			c.C284G						.						56.0	64.0	61.0					5																	76932809		2203	4300	6503	SO:0001583	missense	23440	exon2			TGGCCGGCTTGGC		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.284C>G	5.37:g.76932809G>C	ENSP00000302814:p.Ala95Gly	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	152	49	NM_032109	0	0	0	0	0		Missense_Mutation	SNP	ENST00000306422.3	37	CCDS4039.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506573	0.64410	.	.	ENSG00000171540	ENST00000306422	D	0.95588	-3.75	5.42	4.53	0.55603	Homeodomain-related (1);Homeodomain-like (1);	1.125700	0.06735	N	0.777347	D	0.90143	0.6920	N	0.08118	0	0.36166	D	0.848472	B	0.06786	0.001	B	0.04013	0.001	T	0.76332	-0.2998	10	0.21014	T	0.42	.	15.0725	0.72049	0.0:0.1428:0.8572:0.0	.	95	Q5XKR4	OTP_HUMAN	G	95	ENSP00000302814:A95G	ENSP00000302814:A95G	A	-	2	0	OTP	76968565	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	4.154000	0.58125	1.376000	0.46267	0.655000	0.94253	GCC	G|0.995;A|0.005		0.677	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220016.2		
AFF4	27125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	132270292	132270292	+	Silent	SNP	T	T	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr5:132270292T>G	ENST00000265343.5	-	3	844	c.465A>C	c.(463-465)tcA>tcC	p.S155S	AFF4_ENST00000491831.1_5'UTR|AFF4_ENST00000378595.3_Silent_p.S155S	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	155	Ser-rich.				spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TATTGTTATATGACTCACGGT	0.522																																					p.S155S	Ovarian(126;889 1733 2942 10745 11605)	.											.	AFF4-229	0			c.A465C						.						146.0	141.0	143.0					5																	132270292		2203	4300	6503	SO:0001819	synonymous_variant	27125	exon3			GTTATATGACTCA	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.465A>C	5.37:g.132270292T>G		Somatic	183	0		WXS	Illumina HiSeq	Phase_I	147	65	NM_014423	0	0	15	25	10	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Silent	SNP	ENST00000265343.5	37	CCDS4164.1																																																																																			.		0.522	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423	
DST	667	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	56480769	56480769	+	Missense_Mutation	SNP	C	C	T	rs148062292		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr6:56480769C>T	ENST00000370765.6	-	24	7603	c.7496G>A	c.(7495-7497)cGg>cAg	p.R2499Q	DST_ENST00000312431.6_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1795					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCGGCCACCCGGTACTTTTT	0.512																																					p.R2499Q		.											.	DST-523	0			c.G7496A						.	C	GLN/ARG,	0,4406		0,0,2203	71.0	77.0	75.0		7496,	5.9	1.0	6	dbSNP_134	75	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	DST	NM_001723.5,NM_015548.4	43,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	2499/2650,	56480769	1,13005	2203	4300	6503	SO:0001583	missense	667	exon24			GCCACCCGGTACT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7496G>A	6.37:g.56480769C>T	ENSP00000359801:p.Arg2499Gln	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	114	44	NM_001723	0	0	0	0	0	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	37	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	C	9.658	1.143434	0.21205	0.0	1.16E-4	ENSG00000151914	ENST00000370765	T	0.72725	-0.68	5.94	5.94	0.96194	.	.	.	.	.	T	0.55033	0.1895	.	.	.	0.09310	N	0.999998	B	0.29253	0.239	B	0.15870	0.014	T	0.58730	-0.7585	7	0.66056	D	0.02	.	20.3593	0.98849	0.0:1.0:0.0:0.0	.	2499	Q03001-3	.	Q	2499	ENSP00000359801:R2499Q	ENSP00000359801:R2499Q	R	-	2	0	DST	56588728	0.989000	0.36119	0.993000	0.49108	0.251000	0.25915	3.295000	0.51794	2.822000	0.97130	0.557000	0.71058	CGG	C|1.000;T|0.000		0.512	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
SEPT7	989	hgsc.bcm.edu;bcgsc.ca	37	7	35930344	35930344	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr7:35930344A>T	ENST00000435235.1	+	10	1212	c.780A>T	c.(778-780)aaA>aaT	p.K260N	SEPT7_ENST00000494488.2_Missense_Mutation_p.K299N|SEPT7_ENST00000399034.2_Missense_Mutation_p.K314N|SEPT7_ENST00000399035.3_Missense_Mutation_p.K312N|SEPT7_ENST00000350320.6_Missense_Mutation_p.K312N|SEPT7_ENST00000432293.2_Intron			Q16181	SEPT7_HUMAN	septin 7	313	Septin-type G.				cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						GAAGCAGAAAACTTGCAGCTG	0.338																																					p.K312N		.											.	.	0			c.A936T						.						51.0	46.0	48.0					7																	35930344		1836	4089	5925	SO:0001583	missense	989	exon10			CAGAAAACTTGCA	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.780A>T	7.37:g.35930344A>T	ENSP00000413507:p.Lys260Asn	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	27	15	NM_001011553	0	0	48	48	0	Q52M76|Q6NX50	Missense_Mutation	SNP	ENST00000435235.1	37		.	.	.	.	.	.	.	.	.	.	A	15.31	2.797066	0.50208	.	.	ENSG00000122545	ENST00000435235;ENST00000399034;ENST00000350320;ENST00000399035;ENST00000537785;ENST00000493670;ENST00000494488	T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57	4.94	0.725	0.18242	.	0.000000	0.85682	U	0.000000	T	0.52338	0.1728	M	0.71920	2.185	0.80722	D	1	P;P;P	0.38420	0.63;0.63;0.63	B;B;B	0.42625	0.393;0.393;0.393	T	0.54364	-0.8305	10	0.62326	D	0.03	.	9.3111	0.37905	0.7223:0.0:0.2777:0.0	.	258;312;313	B4DNE4;E7EPK1;Q16181	.;.;SEPT7_HUMAN	N	260;314;312;312;258;260;299	ENSP00000413507:K260N;ENSP00000381992:K314N;ENSP00000344868:K312N;ENSP00000381993:K312N;ENSP00000438395:K299N	ENSP00000344868:K312N	K	+	3	2	SEPT7	35896869	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.373000	0.34272	0.300000	0.22699	0.460000	0.39030	AAA	.		0.338	SEPT7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000338285.1	NM_001788	
CDK13	8621	broad.mit.edu	37	7	40134552	40134552	+	Silent	SNP	A	A	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr7:40134552A>G	ENST00000181839.4	+	14	5117	c.4512A>G	c.(4510-4512)agA>agG	p.R1504R	CDK13_ENST00000340829.5_Silent_p.R1444R	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1504					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						CAACTGGCAGAGGCAGAGGCA	0.483																																					p.R1504R													.	CDK13-548	0			c.A4512G						.						102.0	103.0	103.0					7																	40134552		2203	4300	6503	SO:0001819	synonymous_variant	8621	exon14			TGGCAGAGGCAGA	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.4512A>G	7.37:g.40134552A>G		Somatic	125	0		WXS	Illumina HiSeq	Phase_I	162	3	NM_003718	0	0	19	19	0	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Silent	SNP	ENST00000181839.4	37	CCDS5461.1																																																																																			.		0.483	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718	
FOXP2	93986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	114299729	114299729	+	Splice_Site	SNP	G	G	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr7:114299729G>A	ENST00000393494.2	+	13	1926		c.e13+1		FOXP2_ENST00000393500.3_Splice_Site|FOXP2_ENST00000408937.3_Splice_Site|FOXP2_ENST00000393489.3_Splice_Site|FOXP2_ENST00000393498.2_Splice_Site|FOXP2_ENST00000403559.4_Splice_Site|FOXP2_ENST00000393491.3_Splice_Site|FOXP2_ENST00000350908.4_Splice_Site			O15409	FOXP2_HUMAN	forkhead box P2						camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						AACTTGGAAGGTAACTACTTT	0.388																																					.		.											.	FOXP2-295	0			c.1647+1G>A						.						109.0	103.0	105.0					7																	114299729		2203	4300	6503	SO:0001630	splice_region_variant	93986	exon13			TGGAAGGTAACTA	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1647+1G>A	7.37:g.114299729G>A		Somatic	96	0		WXS	Illumina HiSeq	Phase_I	58	25	NM_014491	0	0	0	0	0	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Splice_Site	SNP	ENST00000393494.2	37	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.189262	0.57909	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FOXP2	114086965	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.879000	0.98667	0.650000	0.86243	.	.		0.388	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	Intron
NDUFB2	4708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	140402766	140402766	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr7:140402766T>A	ENST00000476279.1	+	2	273	c.199T>A	c.(199-201)Ttc>Atc	p.F67I	NDUFB2_ENST00000204307.5_Missense_Mutation_p.F57I|NDUFB2_ENST00000476470.1_Missense_Mutation_p.F3I|NDUFB2_ENST00000464564.2_3'UTR|NDUFB2_ENST00000472695.1_Missense_Mutation_p.F3I|NDUFB2_ENST00000247866.4_Missense_Mutation_p.F67I|NDUFB2_ENST00000475276.1_Missense_Mutation_p.F40I|NDUFB2_ENST00000460088.1_Missense_Mutation_p.F3I|NDUFB2_ENST00000465506.1_Missense_Mutation_p.F67I|NDUFB2_ENST00000482954.1_Missense_Mutation_p.F3I|NDUFB2_ENST00000471136.1_Missense_Mutation_p.F55I|NDUFB2_ENST00000461457.1_Intron			O95178	NDUB2_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa	67					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|stomach(1)	10	Melanoma(164;0.00956)					ACTCATGTGGTTCTGGATTCT	0.547																																					p.F67I		.											.	NDUFB2-91	0			c.T199A						.						183.0	180.0	181.0					7																	140402766		2203	4300	6503	SO:0001583	missense	4708	exon2			ATGTGGTTCTGGA	AF050639	CCDS5862.1	7q34	2011-07-04	2002-08-29		ENSG00000090266	ENSG00000090266		"""Mitochondrial respiratory chain complex / Complex I"""	7697	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase AGGG subunit"", ""complex I AGGG subunit"""	603838	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 (8kD, AGGG)"""			9763677, 9878551	Standard	NM_004546		Approved	AGGG, CI-AGGG	uc003vwa.3	O95178	OTTHUMG00000157424	ENST00000476279.1:c.199T>A	7.37:g.140402766T>A	ENSP00000419087:p.Phe67Ile	Somatic	216	1		WXS	Illumina HiSeq	Phase_I	231	73	NM_004546	1	0	305	619	313	Q6FGI6	Missense_Mutation	SNP	ENST00000476279.1	37	CCDS5862.1	.	.	.	.	.	.	.	.	.	.	T	32	5.121335	0.94385	.	.	ENSG00000090266	ENST00000482954;ENST00000476279;ENST00000247866;ENST00000465506;ENST00000204307;ENST00000464566;ENST00000460088;ENST00000472695;ENST00000476470;ENST00000471136;ENST00000475276	.	.	.	6.06	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.79986	0.4541	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82341	-0.0505	9	0.87932	D	0	-19.9545	11.7302	0.51732	0.0:0.0689:0.0:0.9311	.	67	O95178	NDUB2_HUMAN	I	3;67;67;67;57;66;3;3;3;55;40	.	ENSP00000204307:F57I	F	+	1	0	NDUFB2	140049235	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.019000	0.76412	1.127000	0.42034	0.533000	0.62120	TTC	.		0.547	NDUFB2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348784.1	NM_004546	
SGK223	157285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	8234118	8234118	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr8:8234118C>A	ENST00000520004.1	-	3	2065	c.1801G>T	c.(1801-1803)Ggt>Tgt	p.G601C	SGK223_ENST00000330777.4_Missense_Mutation_p.G601C			Q86YV5	SG223_HUMAN		603							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										ATAGCGACACCGTTGGTCCGG	0.662																																					p.G601C	GBM(34;731 755 10259 33573 33867)	.											.	.	0			c.G1801T						.						33.0	37.0	36.0					8																	8234118		1991	4172	6163	SO:0001583	missense	0	exon2			CGACACCGTTGGT																												ENST00000520004.1:c.1801G>T	8.37:g.8234118C>A	ENSP00000428054:p.Gly601Cys	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	88	23	NM_001080826	0	0	2	6	4	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.965915	0.53507	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.60299	0.2;0.2	4.16	3.28	0.37604	.	0.672928	0.13029	N	0.419511	T	0.62588	0.2440	L	0.29908	0.895	0.25653	N	0.986074	D	0.76494	0.999	D	0.65010	0.931	T	0.54077	-0.8347	10	0.72032	D	0.01	.	11.5527	0.50729	0.0:0.9104:0.0:0.0896	.	601	Q86YV5	SG223_HUMAN	C	601	ENSP00000330930:G601C;ENSP00000428054:G601C	ENSP00000330930:G601C	G	-	1	0	AC068353.1	8271528	0.017000	0.18338	0.019000	0.16419	0.011000	0.07611	0.576000	0.23744	1.057000	0.40506	0.467000	0.42956	GGT	.		0.662	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
ZNF395	55893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	28209093	28209093	+	Silent	SNP	C	C	A	rs145491469	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr8:28209093C>A	ENST00000344423.5	-	7	1283	c.1152G>T	c.(1150-1152)ccG>ccT	p.P384P	ZNF395_ENST00000523202.1_Silent_p.P384P|ZNF395_ENST00000523095.1_Silent_p.P384P	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	384					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GGGAGGACTCCGGGCCAGGAT	0.642																																					p.P384P		.											.	ZNF395-90	0			c.G1152T						.						62.0	73.0	69.0					8																	28209093		2203	4299	6502	SO:0001819	synonymous_variant	55893	exon7			GGACTCCGGGCCA	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1152G>T	8.37:g.28209093C>A		Somatic	160	1		WXS	Illumina HiSeq	Phase_I	178	62	NM_018660	0	0	11	19	8	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Silent	SNP	ENST00000344423.5	37	CCDS6067.1																																																																																			C|1.000;T|0.000		0.642	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
ZBTB10	65986	hgsc.bcm.edu	37	8	81399527	81399527	+	Missense_Mutation	SNP	T	T	G	rs185916023	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr8:81399527T>G	ENST00000430430.1	+	2	1261	c.482T>G	c.(481-483)gTg>gGg	p.V161G	ZBTB10_ENST00000379091.4_Intron|Y_RNA_ENST00000605948.1_RNA|ZBTB10_ENST00000455036.3_Missense_Mutation_p.V161G|ZBTB10_ENST00000426744.2_Missense_Mutation_p.V161G	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	161	Gly-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			CCGGCGACTGTGGATCTGGAG	0.706													T|||	8	0.00159744	0.0015	0.0	5008	,	,		13529	0.0		0.006	False		,,,				2504	0.0				p.V161G		.											.	ZBTB10-522	0			c.T482G						.	T	GLY/VAL,GLY/VAL	5,3779		0,5,1887	9.0	11.0	10.0		482,482	-0.7	0.8	8		10	26,8024		0,26,3999	yes	missense,missense	ZBTB10	NM_001105539.1,NM_023929.3	109,109	0,31,5886	GG,GT,TT		0.323,0.1321,0.262	benign,benign	161/872,161/848	81399527	31,11803	1892	4025	5917	SO:0001583	missense	65986	exon1			CGACTGTGGATCT	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.482T>G	8.37:g.81399527T>G	ENSP00000387462:p.Val161Gly	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	4	2	NM_023929	0	1	1	2	0	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	ENST00000430430.1	37	CCDS47880.1	7	0.003205128205128205	1	0.0020325203252032522	0	0.0	0	0.0	6	0.0079155672823219	T	13.00	2.106749	0.37145	0.001321	0.00323	ENSG00000205189	ENST00000430430;ENST00000455036;ENST00000426744	T;T;T	0.10573	2.87;2.87;2.86	3.75	-0.741	0.11112	.	1.665380	0.04291	N	0.345463	T	0.05090	0.0136	N	0.19112	0.55	0.47511	D	0.999447	B;B	0.13145	0.004;0.007	B;B	0.16289	0.004;0.015	T	0.23833	-1.0177	10	0.72032	D	0.01	.	4.1032	0.10025	0.396:0.1092:0.0:0.4948	.	161;161	Q96DT7;Q96DT7-2	ZBT10_HUMAN;.	G	161	ENSP00000387462:V161G;ENSP00000412036:V161G;ENSP00000416134:V161G	ENSP00000416134:V161G	V	+	2	0	ZBTB10	81562082	0.995000	0.38212	0.796000	0.32109	0.801000	0.45260	0.316000	0.19469	0.047000	0.15862	0.379000	0.24179	GTG	T|0.997;G|0.003		0.706	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929	
PLEC	5339	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	144998457	144998457	+	Silent	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr8:144998457C>T	ENST00000322810.4	-	31	6220	c.6051G>A	c.(6049-6051)ctG>ctA	p.L2017L	PLEC_ENST00000398774.2_Silent_p.L1848L|PLEC_ENST00000527096.1_Silent_p.L1903L|PLEC_ENST00000354958.2_Silent_p.L1858L|PLEC_ENST00000356346.3_Silent_p.L1866L|PLEC_ENST00000436759.2_Silent_p.L1907L|PLEC_ENST00000357649.2_Silent_p.L1884L|PLEC_ENST00000354589.3_Silent_p.L1880L|PLEC_ENST00000345136.3_Silent_p.L1880L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2017	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTGCTCCTCCAGCCGCCGCC	0.706																																					p.L2017L		.											.	PLEC-141	0			c.G6051A						.						7.0	9.0	8.0					8																	144998457		1983	4065	6048	SO:0001819	synonymous_variant	5339	exon31			CTCCTCCAGCCGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6051G>A	8.37:g.144998457C>T		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	18	8	NM_201380	0	0	6	11	5	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			.		0.706	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
VPS13A	23230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	79955424	79955424	+	Silent	SNP	T	T	A	rs144477984	byFrequency	TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr9:79955424T>A	ENST00000360280.3	+	50	7244	c.6984T>A	c.(6982-6984)gcT>gcA	p.A2328A	VPS13A_ENST00000357409.5_Silent_p.A2328A|VPS13A_ENST00000376636.3_Silent_p.A2289A|VPS13A_ENST00000376634.4_Silent_p.A2328A	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2328					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TATCAGTGGCTGAAGAAGGAA	0.333																																					p.A2328A		.											.	VPS13A-161	0			c.T6984A						.						88.0	91.0	90.0					9																	79955424		2203	4295	6498	SO:0001819	synonymous_variant	23230	exon50			AGTGGCTGAAGAA	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.6984T>A	9.37:g.79955424T>A		Somatic	122	0		WXS	Illumina HiSeq	Phase_I	91	42	NM_001018038	0	0	7	14	7	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	ENST00000360280.3	37	CCDS6655.1																																																																																			T|1.000;C|0.000		0.333	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
MUSK	4593	broad.mit.edu	37	9	113530177	113530177	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr9:113530177C>G	ENST00000374448.4	+	9	1132	c.998C>G	c.(997-999)gCt>gGt	p.A333G	MUSK_ENST00000189978.5_Missense_Mutation_p.A333G|MUSK_ENST00000416899.2_Missense_Mutation_p.A333G	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	333	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						GCAAAAGATGCTCTTGTTTTT	0.493																																					p.A333G													.	MUSK-1379	0			c.C998G						.						109.0	111.0	110.0					9																	113530177		1933	4142	6075	SO:0001583	missense	4593	exon8			AAGATGCTCTTGT	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.998C>G	9.37:g.113530177C>G	ENSP00000363571:p.Ala333Gly	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	137	3	NM_005592	0	0	0	0	0	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	ENST00000374448.4	37	CCDS48005.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.584564	0.28268	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000416899	T	0.76709	-1.04	5.08	4.18	0.49190	Frizzled domain (3);	0.565076	0.19549	N	0.111619	T	0.69342	0.3100	L	0.35487	1.065	0.39963	D	0.974694	B	0.16802	0.019	B	0.30105	0.111	T	0.63532	-0.6616	10	0.23891	T	0.37	.	12.7243	0.57162	0.0:0.9202:0.0:0.0798	.	333	O15146	MUSK_HUMAN	G	339;333;333;339	ENSP00000363571:A333G	ENSP00000189978:A339G	A	+	2	0	MUSK	112569998	0.262000	0.24073	0.667000	0.29798	0.696000	0.40369	2.200000	0.42724	1.291000	0.44653	0.591000	0.81541	GCT	.		0.493	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
SLC9A7	84679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	46491075	46491075	+	Silent	SNP	A	A	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:46491075A>T	ENST00000328306.4	-	14	1708	c.1683T>A	c.(1681-1683)gtT>gtA	p.V561V	SLC9A7_ENST00000464933.1_5'UTR	NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	561					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						GATCGGGGTCAACACCAACTC	0.498																																					p.V562V	Pancreas(118;454 1696 1930 13865 39976)	.											.	SLC9A7-132	0			c.T1686A						.						110.0	90.0	97.0					X																	46491075		2203	4300	6503	SO:0001819	synonymous_variant	84679	exon14			GGGGTCAACACCA	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.1683T>A	X.37:g.46491075A>T		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	48	17	NM_001257291	0	0	0	0	0	O75827|Q5JXP9	Silent	SNP	ENST00000328306.4	37	CCDS14269.1																																																																																			.		0.498	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591	
HUWE1	10075	hgsc.bcm.edu;broad.mit.edu	37	X	53564649	53564649	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:53564649C>T	ENST00000342160.3	-	77	12462	c.12005G>A	c.(12004-12006)cGc>cAc	p.R4002H	HUWE1_ENST00000262854.6_Missense_Mutation_p.R4002H			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	4002					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAGCTCTTGGCGGAAATATCT	0.473																																					p.R4002H		.											.	HUWE1-280	0			c.G12005A						.						55.0	43.0	47.0					X																	53564649		2203	4300	6503	SO:0001583	missense	10075	exon78			TCTTGGCGGAAAT	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.12005G>A	X.37:g.53564649C>T	ENSP00000340648:p.Arg4002His	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	36	3	NM_031407	0	0	0	0	0	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.197762	0.58126	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.76709	-1.04;-1.04	5.78	5.78	0.91487	HECT (1);	0.000000	0.85682	D	0.000000	D	0.85358	0.5678	L	0.53617	1.68	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.74674	0.984;0.958;0.981	D	0.85951	0.1464	10	0.62326	D	0.03	.	15.9981	0.80268	0.0:1.0:0.0:0.0	.	824;4002;3986	Q5H935;Q7Z6Z7;Q7Z6Z7-2	.;HUWE1_HUMAN;.	H	4002	ENSP00000340648:R4002H;ENSP00000262854:R4002H	ENSP00000262854:R4002H	R	-	2	0	HUWE1	53581374	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.019000	0.76412	2.580000	0.87095	0.600000	0.82982	CGC	.		0.473	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
POU3F4	5456	hgsc.bcm.edu	37	X	82764046	82764046	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:82764046G>T	ENST00000373200.2	+	1	778	c.714G>T	c.(712-714)ttG>ttT	p.L238F	RP3-326L13.2_ENST00000607095.1_RNA|RP3-326L13.3_ENST00000607789.1_lincRNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	238	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						TCGAAGGCTTGCAGCTGAGCT	0.567																																					p.L238F		.											.	POU3F4-131	0			c.G714T						.						67.0	53.0	58.0					X																	82764046		2203	4300	6503	SO:0001583	missense	5456	exon1			AGGCTTGCAGCTG	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.714G>T	X.37:g.82764046G>T	ENSP00000362296:p.Leu238Phe	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	75	4	NM_000307	0	0	0	0	0	B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854438	0.51376	.	.	ENSG00000196767	ENST00000373200	D	0.86694	-2.16	5.07	0.844	0.18943	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.64402	D	0.000006	D	0.93367	0.7885	M	0.93638	3.44	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.90691	0.4613	10	0.87932	D	0	.	6.3022	0.21119	0.2413:0.0:0.631:0.1276	.	238	P49335	PO3F4_HUMAN	F	238	ENSP00000362296:L238F	ENSP00000362296:L238F	L	+	3	2	POU3F4	82650702	1.000000	0.71417	0.997000	0.53966	0.845000	0.48019	1.627000	0.37050	0.096000	0.17463	0.525000	0.51046	TTG	.		0.567	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307	
NXF3	56000	broad.mit.edu	37	X	102332664	102332664	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:102332664C>T	ENST00000395065.3	-	18	1563	c.1462G>A	c.(1462-1464)Gtg>Atg	p.V488M	NXF3_ENST00000425644.1_Missense_Mutation_p.V160M	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	488	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						TTGTCATTCACGATGCACAGA	0.557																																					p.V488M													.	NXF3-205	0			c.G1462A						.						183.0	123.0	143.0					X																	102332664		2203	4300	6503	SO:0001583	missense	56000	exon18			CATTCACGATGCA	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.1462G>A	X.37:g.102332664C>T	ENSP00000378504:p.Val488Met	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	149	5	NM_022052	0	0	0	0	0	B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	ENST00000395065.3	37	CCDS14503.1	.	.	.	.	.	.	.	.	.	.	C	4.378	0.069632	0.08436	.	.	ENSG00000147206	ENST00000395065;ENST00000425644	T	0.51325	0.71	4.44	-8.88	0.00789	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.751316	0.12753	N	0.441969	T	0.44932	0.1317	M	0.67953	2.075	0.80722	D	1	D	0.58620	0.983	P	0.49332	0.607	T	0.73094	-0.4091	10	0.48119	T	0.1	0.7011	9.1203	0.36784	0.0:0.1538:0.2768:0.5694	.	488	Q9H4D5	NXF3_HUMAN	M	488;160	ENSP00000378504:V488M	ENSP00000378504:V488M	V	-	1	0	NXF3	102219320	0.125000	0.22332	0.005000	0.12908	0.007000	0.05969	-0.114000	0.10757	-3.615000	0.00132	-1.314000	0.01303	GTG	.		0.557	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	
RERE	473	broad.mit.edu;bcgsc.ca	37	1	8425998	8425998	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:8425998delT	ENST00000337907.3	-	14	1955	c.1321delA	c.(1321-1323)accfs	p.T441fs	RERE_ENST00000400907.2_Frame_Shift_Del_p.T441fs|RERE_ENST00000400908.2_Frame_Shift_Del_p.T441fs|RERE_ENST00000476556.1_5'UTR|RERE_ENST00000377464.1_Frame_Shift_Del_p.T173fs|RERE_ENST00000460659.1_5'UTR	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	441	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GCTTCGGGGGTCTTCTTCCAA	0.622																																					p.T441fs													.	RERE-515	0			c.1321delA						.						47.0	47.0	47.0					1																	8425998		2203	4300	6503	SO:0001589	frameshift_variant	473	exon14			CGGGGGTCTTCTT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1321delA	1.37:g.8425998delT	ENSP00000338629:p.Thr441fs	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	37	9	NM_012102	0	0	0	0	0	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Frame_Shift_Del	DEL	ENST00000337907.3	37	CCDS95.1																																																																																			.		0.622	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
DNAJC16	23341	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	15894493	15894493	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr1:15894493delG	ENST00000375847.3	+	15	2334	c.2170delG	c.(2170-2172)gggfs	p.G724fs	DNAJC16_ENST00000483270.1_3'UTR|DNAJC16_ENST00000375849.1_Intron|RP4-680D5.8_ENST00000606186.1_RNA	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	724					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GGAAGCCATAGGGTCGTGCAG	0.512																																					p.G724fs		.											.	DNAJC16-226	0			c.2170delG						.						124.0	103.0	110.0					1																	15894493		2203	4300	6503	SO:0001589	frameshift_variant	23341	exon15			.	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.2170delG	1.37:g.15894493delG	ENSP00000365007:p.Gly724fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	75	17	NM_015291	0	0	0	0	0	Q68D57|Q86X32|Q8N5P4	Frame_Shift_Del	DEL	ENST00000375847.3	37	CCDS30606.1																																																																																			.		0.512	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
OR51A4	401666	broad.mit.edu	37	11	4967850	4967856	+	Frame_Shift_Del	DEL	AGGGAAG	AGGGAAG	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	AGGGAAG	AGGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:4967850_4967856delAGGGAAG	ENST00000380373.2	-	1	500_506	c.475_481delCTTCCCT	c.(475-483)cttcccttcfs	p.LPF159fs	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGAAAGGGAAGGGAAGAACCAGGAGC	0.44																																					p.159_161del													.	OR51A4-71	0			c.475_481del						.																																			SO:0001589	frameshift_variant	401666	exon1			AAGGGAAGGGAAG	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.475_481delCTTCCCT	11.37:g.4967850_4967856delAGGGAAG	ENSP00000369731:p.Leu159fs	Somatic	318	0		WXS	Illumina HiSeq	Phase_I	351	43	NM_001005329	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000380373.2	37	CCDS31367.1																																																																																			.		0.440	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
OR51A2	401667	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	4976463	4976469	+	Frame_Shift_Del	DEL	AGGGAAG	AGGGAAG	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	AGGGAAG	AGGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr11:4976463_4976469delAGGGAAG	ENST00000380371.1	-	1	474_480	c.475_481delCTTCCCT	c.(475-483)cttcccttcfs	p.LPF159fs	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGAAAGGGAAGGGAAGAACCAGGAGC	0.44																																					p.159_161del		.											.	OR51A2-68	0			c.475_481del						.																																			SO:0001589	frameshift_variant	401667	exon1			.	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.475_481delCTTCCCT	11.37:g.4976463_4976469delAGGGAAG	ENSP00000369729:p.Leu159fs	Somatic	244	0		WXS	Illumina HiSeq	Phase_I	164	27	NM_001004748	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000380371.1	37	CCDS31368.1																																																																																			.		0.440	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142809.1	NM_001004748	
ZNF30	90075	broad.mit.edu;bcgsc.ca	37	19	35434608	35434608	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr19:35434608delG	ENST00000601142.1	+	5	975	c.738delG	c.(736-738)aagfs	p.K246fs	ZNF30_ENST00000303586.7_Frame_Shift_Del_p.K247fs|ZNF30_ENST00000439785.1_Frame_Shift_Del_p.K247fs|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000426813.2_Frame_Shift_Del_p.K165fs			P17039	ZNF30_HUMAN	zinc finger protein 30	246					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		TATATGGAAAGCTTACCCGGC	0.443																																					p.K247fs													.	ZNF30-24	0			c.741delG						.						42.0	49.0	47.0					19																	35434608		2115	4243	6358	SO:0001589	frameshift_variant	90075	exon5			TGGAAAGCTTACC	X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.738delG	19.37:g.35434608delG	ENSP00000469954:p.Lys246fs	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	19	8	NM_001099438	0	0	0	0	0	A5PLP1|A8K320|B4DIC0|Q6N068	Frame_Shift_Del	DEL	ENST00000601142.1	37	CCDS46045.1																																																																																			.		0.443	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1	NM_194325	
TMEM144	55314	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	159138552	159138552	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr4:159138552delA	ENST00000296529.6	+	5	832	c.312delA	c.(310-312)ttafs	p.L104fs	TMEM144_ENST00000514558.1_Frame_Shift_Del_p.L104fs	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	104						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		TTAATGCCTTAACTGGCTGGG	0.378																																					p.L104fs		.											.	TMEM144-90	0			c.312delA						.						110.0	105.0	107.0					4																	159138552		2203	4300	6503	SO:0001589	frameshift_variant	55314	exon5			.	AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.312delA	4.37:g.159138552delA	ENSP00000296529:p.Leu104fs	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	62	26	NM_018342	0	0	0	0	0	D3DP24|Q49A05|Q9NUT3	Frame_Shift_Del	DEL	ENST00000296529.6	37	CCDS3799.1																																																																																			.		0.378	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365597.1	NM_018342	
SEPT7	989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	35930341	35930341	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr7:35930341delA	ENST00000435235.1	+	10	1209	c.777delA	c.(775-777)agafs	p.R259fs	SEPT7_ENST00000494488.2_Frame_Shift_Del_p.R298fs|SEPT7_ENST00000399034.2_Frame_Shift_Del_p.R313fs|SEPT7_ENST00000399035.3_Frame_Shift_Del_p.R311fs|SEPT7_ENST00000350320.6_Frame_Shift_Del_p.R311fs|SEPT7_ENST00000432293.2_Intron			Q16181	SEPT7_HUMAN	septin 7	312	Septin-type G.				cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						ACAGAAGCAGAAAACTTGCAG	0.333																																					p.R311fs		.											.	.	0			c.933delA						.						51.0	46.0	48.0					7																	35930341		1835	4089	5924	SO:0001589	frameshift_variant	989	exon10			.	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.777delA	7.37:g.35930341delA	ENSP00000413507:p.Arg259fs	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	31	15	NM_001011553	0	0	0	0	0	Q52M76|Q6NX50	Frame_Shift_Del	DEL	ENST00000435235.1	37																																																																																				.		0.333	SEPT7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000338285.1	NM_001788	
MCTS1	28985	hgsc.bcm.edu	37	X	119739295	119739296	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:119739295_119739296delCC	ENST00000371317.5	+	2	302_303	c.45_46delCC	c.(43-48)atccagfs	p.Q16fs	MCTS1_ENST00000487133.1_3'UTR|MCTS1_ENST00000371315.3_Frame_Shift_Del_p.Q17fs	NM_014060.2	NP_054779.1	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1	16					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|ribosome disassembly (GO:0032790)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|stomach(1)|urinary_tract(1)	10						CCAACTGCATCCAGTTGAAAAC	0.337																																					p.16_17del		.											.	MCTS1-130	0			c.48_49del						.																																			SO:0001589	frameshift_variant	28985	exon2			.	AB034206	CCDS14601.1, CCDS48160.1	Xq24	2008-05-14			ENSG00000232119	ENSG00000232119			23357	protein-coding gene	gene with protein product		300587				9766643	Standard	NM_014060		Approved	MCT-1	uc011mub.2	Q9ULC4	OTTHUMG00000022303	ENST00000371317.5:c.45_46delCC	X.37:g.119739295_119739296delCC	ENSP00000360367:p.Gln16fs	Somatic	163	0		WXS	Illumina HiSeq	Phase_I	127	19	NM_001137554	0	0	0	0	0	B4DGY2|Q502X6	Frame_Shift_Del	DEL	ENST00000371317.5	37	CCDS14601.1																																																																																			.		0.337	MCTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058110.1	NM_014060	
STAG2	10735	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	123184115	123184118	+	Frame_Shift_Del	DEL	AATG	AATG	-			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	AATG	AATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:123184115_123184118delAATG	ENST00000371160.1	+	11	1263_1266	c.973_976delAATG	c.(973-978)aatgacfs	p.ND325fs	STAG2_ENST00000371145.3_Frame_Shift_Del_p.ND325fs|STAG2_ENST00000218089.9_Frame_Shift_Del_p.ND325fs|STAG2_ENST00000371157.3_Frame_Shift_Del_p.ND325fs|STAG2_ENST00000371144.3_Frame_Shift_Del_p.ND325fs|STAG2_ENST00000354548.5_Frame_Shift_Del_p.ND256fs|STAG2_ENST00000469481.1_Intron	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	325	SCD. {ECO:0000255|PROSITE- ProRule:PRU00750}.				meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TGCCTTTCTTAATGACAGTTATTT	0.412																																					p.325_326del		.											.	STAG2-134	0			c.973_976del						.																																			SO:0001589	frameshift_variant	10735	exon11			.	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.973_976delAATG	X.37:g.123184115_123184118delAATG	ENSP00000360202:p.Asn325fs	Somatic	252	0		WXS	Illumina HiSeq	Phase_I	179	61	NM_001042749	0	0	0	0	0	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Frame_Shift_Del	DEL	ENST00000371160.1	37	CCDS14607.1																																																																																			.		0.412	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
KRT18P55	284085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	26604362	26604363	+	RNA	INS	-	-	A	rs540929081		TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr17:26604362_26604363insA	ENST00000577198.1	-	0	598_599				AC061975.8_ENST00000385109.1_RNA	NR_028334.1				keratin 18 pseudogene 55																		GTGAAGTTCATGCTGTCCGGGG	0.51																																					.		.											.	.	0			.						.																																					284085	.			.			17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26604362_26604363insA		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	76	35	.	0	0	0	0	0		RNA	INS	ENST00000577198.1	37																																																																																				.		0.510	KRT18P55-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000446194.1	NR_028334	
CDC14B	8555	bcgsc.ca	37	9	99296440	99296441	+	Splice_Site	INS	-	-	TACA			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr9:99296440_99296441insTACA	ENST00000375241.1	-	9	1167		c.e9-1		CDC14B_ENST00000265659.2_Splice_Site|CDC14B_ENST00000375242.3_Splice_Site|CDC14B_ENST00000375236.1_Splice_Site|CDC14B_ENST00000463569.1_Splice_Site|CDC14B_ENST00000375240.3_Splice_Site	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B						activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				TGGTGGTAACCTACATAAAGAA	0.337																																					.													.	CDC14B-228	0			c.605-1->TGTA						.																																			SO:0001630	splice_region_variant	8555	exon10			GGTAACCTACATA	AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.716-1->TGTA	9.37:g.99296441_99296444dupTACA		Somatic	34	0		WXS	Illumina HiSeq	Phase_1	16	5	NM_001077181	0	0	0	0	0	A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Splice_Site	INS	ENST00000375241.1	37	CCDS6722.1																																																																																			.		0.337	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053278.2	NM_033331	Intron
MCTS1	28985	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	119739292	119739293	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:119739292_119739293insAT	ENST00000371317.5	+	2	299_300	c.42_43insAT	c.(43-45)atcfs	p.I15fs	MCTS1_ENST00000487133.1_3'UTR|MCTS1_ENST00000371315.3_Frame_Shift_Ins_p.I16fs	NM_014060.2	NP_054779.1	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1	15					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|ribosome disassembly (GO:0032790)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|stomach(1)|urinary_tract(1)	10						TGTCCAACTGCATCCAGTTGAA	0.332																																					p.C15fs		.											.	MCTS1-130	0			c.45_46insAT						.																																			SO:0001589	frameshift_variant	28985	exon2			.	AB034206	CCDS14601.1, CCDS48160.1	Xq24	2008-05-14			ENSG00000232119	ENSG00000232119			23357	protein-coding gene	gene with protein product		300587				9766643	Standard	NM_014060		Approved	MCT-1	uc011mub.2	Q9ULC4	OTTHUMG00000022303	ENST00000371317.5:c.43_44dupAT	X.37:g.119739293_119739294dupAT	ENSP00000360367:p.Ile15fs	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	131	28	NM_001137554	0	0	0	0	0	B4DGY2|Q502X6	Frame_Shift_Ins	INS	ENST00000371317.5	37	CCDS14601.1																																																																																			.		0.332	MCTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058110.1	NM_014060	
SLC4A10	57282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	162711596	162711597	+	Missense_Mutation	DNP	CT	CT	AG			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chr2:162711596_162711597CT>AG	ENST00000446997.1	+	5	626_627	c.533_534CT>AG	c.(532-534)aCT>aAG	p.T178K	SLC4A10_ENST00000415876.2_Missense_Mutation_p.T178K|SLC4A10_ENST00000535165.1_Missense_Mutation_p.T178K|SLC4A10_ENST00000272716.5_Missense_Mutation_p.T178K|SLC4A10_ENST00000375514.5_Missense_Mutation_p.T189K|SLC4A10_ENST00000421911.1_Missense_Mutation_p.T178K|SLC4A10_ENST00000493021.1_3'UTR	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	178					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	CTGAATGGAACTGTGTTGCTGG	0.396																																					p.T178K		.											.	SLC4A10	0			c.T567G						.																																			SO:0001583	missense	57282	exon6			TGGAACTGTGTTG		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	Exception_encountered	2.37:g.162711596_162711597delinsAG	ENSP00000393066:p.Thr178Lys	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	33.0		0	0	0	0	0	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	DNP	ENST00000446997.1	37	CCDS54411.1																																																																																			.		0.396	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
MCTS1	28985	hgsc.bcm.edu;bcgsc.ca	37	X	119739295	119739296	+	Nonsense_Mutation	DNP	CC	CC	AT			TCGA-BQ-5875-01A-11D-1589-08	TCGA-BQ-5875-11A-01D-1589-08	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1f52ff0c-1578-4669-ad59-9130f5d4d0e6	f76f9283-5634-45e1-a751-f3275a7a0d7e	g.chrX:119739295_119739296CC>AT	ENST00000371317.5	+	2	302_303	c.45_46CC>AT	c.(43-48)atCCag>atATag	p.Q16*	MCTS1_ENST00000487133.1_3'UTR|MCTS1_ENST00000371315.3_Nonsense_Mutation_p.Q17*	NM_014060.2	NP_054779.1	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1	16					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|ribosome disassembly (GO:0032790)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|stomach(1)|urinary_tract(1)	10						CCAACTGCATCCAGTTGAAAAC	0.337																																					p.Q17*		.											.	MCTS1	0			c.C49T						.																																			SO:0001587	stop_gained	28985	exon2			TGCATCCAGTTGA	AB034206	CCDS14601.1, CCDS48160.1	Xq24	2008-05-14			ENSG00000232119	ENSG00000232119			23357	protein-coding gene	gene with protein product		300587				9766643	Standard	NM_014060		Approved	MCT-1	uc011mub.2	Q9ULC4	OTTHUMG00000022303	Exception_encountered	X.37:g.119739295_119739296delinsAT	ENSP00000360367:p.Gln16*	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	30.0		0	0	0	0	0	B4DGY2|Q502X6	Nonsense_Mutation	DNP	ENST00000371317.5	37	CCDS14601.1																																																																																			.		0.337	MCTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058110.1	NM_014060	
