#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLCH2	9651	ucsc.edu;bcgsc.ca	37	1	2415964	2415964	+	Silent	SNP	C	C	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:2415964C>T	ENST00000419816.2	+	5	997	c.723C>T	c.(721-723)cgC>cgT	p.R241R	PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000378488.3_Silent_p.R241R|PLCH2_ENST00000449969.1_Silent_p.R214R|PLCH2_ENST00000378486.3_Silent_p.R241R			O75038	PLCH2_HUMAN	phospholipase C, eta 2	241	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		TGTCCACCCGCCGGGACCTCT	0.592																																					p.R241R													.	PLCH2-229	0			c.C723T						.						51.0	60.0	57.0					1																	2415964		2053	4195	6248	SO:0001819	synonymous_variant	9651	exon5			CACCCGCCGGGAC	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.723C>T	1.37:g.2415964C>T		Somatic	57	0		WXS	Illumina HiSeq		39	4	NM_014638	0	0	0	0	0	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Silent	SNP	ENST00000419816.2	37																																																																																				.		0.592	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
VPS13D	55187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	12327038	12327038	+	Silent	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:12327038T>C	ENST00000358136.3	+	14	1825	c.1695T>C	c.(1693-1695)acT>acC	p.T565T	VPS13D_ENST00000356315.4_Silent_p.T565T	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CAGAAGGAACTATGTTTCCTC	0.408																																					p.T565T		.											.	VPS13D-95	0			c.T1695C						.						124.0	114.0	117.0					1																	12327038		2203	4300	6503	SO:0001819	synonymous_variant	55187	exon14			AGGAACTATGTTT	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.1695T>C	1.37:g.12327038T>C		Somatic	141	0		WXS	Illumina HiSeq	Phase_I	168	30	NM_015378	0	0	1	1	0		Silent	SNP	ENST00000358136.3	37	CCDS30588.1																																																																																			.		0.408	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
MTF1	4520	broad.mit.edu	37	1	38323066	38323066	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:38323066T>C	ENST00000373036.4	-	2	405	c.265A>G	c.(265-267)Atg>Gtg	p.M89V	MTF1_ENST00000468190.1_5'UTR	NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	89					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CCCTGGGACATTGCTTCATGA	0.468																																					p.M89V													.	MTF1-92	0			c.A265G						.						201.0	170.0	180.0					1																	38323066		2203	4300	6503	SO:0001583	missense	4520	exon2			GGGACATTGCTTC	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.265A>G	1.37:g.38323066T>C	ENSP00000362127:p.Met89Val	Somatic	178	0		WXS	Illumina HiSeq	Phase_I	179	4	NM_005955	0	0	1	1	0	B2RAK6|Q96CB1	Missense_Mutation	SNP	ENST00000373036.4	37	CCDS30676.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.805707	0.50315	.	.	ENSG00000188786	ENST00000373036	T	0.10288	2.89	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.09512	0.0234	L	0.50333	1.59	0.45515	D	0.998474	B	0.18610	0.029	B	0.12156	0.007	T	0.07404	-1.0774	10	0.02654	T	1	.	11.135	0.48368	0.0:0.0715:0.0:0.9285	.	89	Q14872	MTF1_HUMAN	V	89	ENSP00000362127:M89V	ENSP00000362127:M89V	M	-	1	0	MTF1	38095653	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.968000	0.70413	2.177000	0.69029	0.533000	0.62120	ATG	.		0.468	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	
PTPRF	5792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	44058242	44058242	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:44058242C>G	ENST00000359947.4	+	11	2123	c.1783C>G	c.(1783-1785)Ccc>Gcc	p.P595A	PTPRF_ENST00000438120.1_Missense_Mutation_p.P595A|PTPRF_ENST00000422171.2_Missense_Mutation_p.P54A|PTPRF_ENST00000372413.3_Missense_Mutation_p.P595A|PTPRF_ENST00000372414.3_Missense_Mutation_p.P595A	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	595	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CGTCTTCACCCCCACCATTGA	0.602																																					p.P595A		.											.	PTPRF-232	0			c.C1783G						.						99.0	83.0	88.0					1																	44058242		2203	4300	6503	SO:0001583	missense	5792	exon11			TTCACCCCCACCA	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.1783C>G	1.37:g.44058242C>G	ENSP00000353030:p.Pro595Ala	Somatic	96	1		WXS	Illumina HiSeq	Phase_I	81	32	NM_002840	0	0	1	7	6	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.664|9.664	1.144961|1.144961	0.21288|0.21288	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171|ENST00000412568;ENST00000414879	T;T;T;T;T|.	0.52754|.	0.65;2.31;0.65;2.31;0.65|.	4.43|4.43	4.43|4.43	0.53597|0.53597	Fibronectin, type III (2);Immunoglobulin-like fold (1);|.	0.000000|0.000000	0.34002|0.34002	N|N	0.004350|0.004350	T|T	0.36468|0.36468	0.0968|0.0968	N|N	0.17901|0.17901	0.54|0.54	0.23519|0.23519	N|N	0.9975|0.9975	B;B;B;P;P|.	0.49090|.	0.004;0.0;0.118;0.919;0.552|.	B;B;B;P;B|.	0.48454|.	0.013;0.0;0.026;0.578;0.146|.	T|T	0.24297|0.24297	-1.0164|-1.0164	10|6	0.06494|.	T|.	0.89|.	.|.	17.924|17.924	0.88977|0.88977	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	251;54;354;595;595|.	Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586|.	.;.;.;.;PTPRF_HUMAN|.	A|R	595;595;595;595;54|262;119	ENSP00000353030:P595A;ENSP00000398822:P595A;ENSP00000361491:P595A;ENSP00000361490:P595A;ENSP00000387885:P54A|.	ENSP00000353030:P595A|.	P|P	+|+	1|2	0|0	PTPRF|PTPRF	43830829|43830829	0.792000|0.792000	0.28813|0.28813	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	1.791000|1.791000	0.38744|0.38744	2.398000|2.398000	0.81561|0.81561	0.561000|0.561000	0.74099|0.74099	CCC|CCC	.		0.602	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
POMGNT1	55624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	46654508	46654508	+	3'UTR	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:46654508G>T	ENST00000371984.3	-	0	2574				POMGNT1_ENST00000485714.1_5'Flank|POMGNT1_ENST00000396420.3_3'UTR|POMGNT1_ENST00000371992.1_Missense_Mutation_p.N710K|POMGNT1_ENST00000535522.1_3'UTR|POMGNT1_ENST00000371986.3_Missense_Mutation_p.N710K	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)						protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					CTGTCCATGGGTTGGGCACAG	0.577																																					p.N710K		.											.	POMGNT1-91	0			c.C2130A						.						56.0	55.0	55.0					1																	46654508		876	1991	2867	SO:0001624	3_prime_UTR_variant	55624	exon23			CCATGGGTTGGGC		CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.*434C>A	1.37:g.46654508G>T		Somatic	72	0		WXS	Illumina HiSeq	Phase_I	71	9	NM_001243766	0	0	30	35	5	D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Missense_Mutation	SNP	ENST00000371984.3	37	CCDS531.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812764	0.32053	.	.	ENSG00000085998	ENST00000371992;ENST00000371986	T;T	0.33438	1.41;1.41	5.24	2.3	0.28687	.	1.133680	0.06705	N	0.772169	T	0.23330	0.0564	.	.	.	0.09310	N	0.999997	B	0.11235	0.004	B	0.09377	0.004	T	0.31420	-0.9944	9	0.87932	D	0	-1.0E-4	4.1207	0.10104	0.0857:0.1588:0.5908:0.1646	.	710	Q5VST3	.	K	710	ENSP00000361060:N710K;ENSP00000361054:N710K	ENSP00000361054:N710K	N	-	3	2	POMGNT1	46427095	0.092000	0.21681	0.001000	0.08648	0.912000	0.54170	1.599000	0.36751	0.432000	0.26286	-0.140000	0.14226	AAC	.		0.577	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020146.1	NM_017739	
FAM73A	374986	bcgsc.ca	37	1	78325733	78325733	+	Silent	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:78325733T>C	ENST00000370791.3	+	11	1229	c.1197T>C	c.(1195-1197)ctT>ctC	p.L399L	FAM73A_ENST00000443751.2_Silent_p.L361L	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	399						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		AGGTAATTCTTTCAGAATCAG	0.343																																					p.L399L													.	FAM73A-91	0			c.T1197C						.						43.0	44.0	44.0					1																	78325733		2203	4300	6503	SO:0001819	synonymous_variant	374986	exon11			AATTCTTTCAGAA		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.1197T>C	1.37:g.78325733T>C		Somatic	46	0		WXS	Illumina HiSeq	Phase_1	82	4	NM_198549	0	0	12	12	0	Q6MZG0	Silent	SNP	ENST00000370791.3	37	CCDS681.1																																																																																			.		0.343	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
C1orf52	148423	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	85725088	85725088	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:85725088T>G	ENST00000471115.1	-	1	237	c.229A>C	c.(229-231)Aac>Cac	p.N77H	C1orf52_ENST00000294661.4_5'UTR|C1orf52_ENST00000344356.5_Missense_Mutation_p.N77H	NM_198077.3	NP_932343.1	Q8N6N3	CA052_HUMAN	chromosome 1 open reading frame 52	77							poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)	10				all cancers(265;0.0105)|Epithelial(280;0.0293)		ATCTGTTTGTTGAGCGGATTG	0.652											OREG0013580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N77H		.											.	C1orf52-91	0			c.A229C						.						52.0	58.0	56.0					1																	85725088		2203	4300	6503	SO:0001583	missense	148423	exon1			GTTTGTTGAGCGG	BC029538	CCDS703.1	1p22.3	2008-02-05			ENSG00000162642	ENSG00000162642			24871	protein-coding gene	gene with protein product						11891061	Standard	NM_198077		Approved	gm117, FLJ44982	uc001dkv.3	Q8N6N3	OTTHUMG00000009966	ENST00000471115.1:c.229A>C	1.37:g.85725088T>G	ENSP00000419417:p.Asn77His	Somatic	90	1	1239	WXS	Illumina HiSeq	Phase_I	85	32	NM_198077	0	0	3	9	6	B3KX89|Q8TDK5|Q8TDK6	Missense_Mutation	SNP	ENST00000471115.1	37	CCDS703.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.937500	0.73557	.	.	ENSG00000162642	ENST00000471115;ENST00000344356	.	.	.	5.74	3.39	0.38822	.	0.000000	0.85682	D	0.000000	T	0.32376	0.0827	L	0.59436	1.845	0.44000	D	0.996708	B;B	0.24368	0.102;0.102	B;B	0.25291	0.051;0.059	T	0.35822	-0.9773	9	0.52906	T	0.07	-1.2675	4.3274	0.11046	0.1115:0.0677:0.196:0.6248	.	77;77	Q8N6N3-2;Q8N6N3	.;CA052_HUMAN	H	77	.	ENSP00000345092:N77H	N	-	1	0	C1orf52	85497676	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.383000	0.52471	1.080000	0.41073	0.519000	0.50382	AAC	.		0.652	C1orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027616.2	NM_198077	
LRRC8D	55144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	90399406	90399406	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:90399406A>T	ENST00000337338.5	+	3	1186	c.779A>T	c.(778-780)aAa>aTa	p.K260I	LRRC8D_ENST00000394593.3_Missense_Mutation_p.K260I	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	260					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		ACTGGCTTTAAATTTTCAGCT	0.458																																					p.K260I		.											.	LRRC8D-92	0			c.A779T						.						44.0	42.0	43.0					1																	90399406		2203	4300	6503	SO:0001583	missense	55144	exon3			GCTTTAAATTTTC	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.779A>T	1.37:g.90399406A>T	ENSP00000338887:p.Lys260Ile	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	44	16	NM_018103	0	0	10	20	10	D3DT29|Q6UWB2|Q9NVW3	Missense_Mutation	SNP	ENST00000337338.5	37	CCDS726.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.464588	0.43736	.	.	ENSG00000171492	ENST00000337338;ENST00000394593;ENST00000441269	T;T;T	0.49432	1.35;1.35;0.78	5.88	5.88	0.94601	.	0.111169	0.64402	D	0.000017	T	0.30070	0.0753	L	0.36672	1.1	0.48696	D	0.99969	P	0.40376	0.715	B	0.42062	0.374	T	0.07121	-1.0789	9	.	.	.	.	16.3009	0.82811	1.0:0.0:0.0:0.0	.	260	Q7L1W4	LRC8D_HUMAN	I	260	ENSP00000338887:K260I;ENSP00000378093:K260I;ENSP00000405784:K260I	.	K	+	2	0	LRRC8D	90171994	1.000000	0.71417	0.980000	0.43619	0.959000	0.62525	4.701000	0.61810	2.246000	0.74042	0.533000	0.62120	AAA	.		0.458	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
DNTTIP2	30836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94342829	94342829	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:94342829A>C	ENST00000436063.2	-	2	719	c.662T>G	c.(661-663)aTt>aGt	p.I221S	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		TCCTGGTACAATCTTACTATC	0.393																																					p.I221S		.											.	.	0			c.T662G						.						157.0	156.0	157.0					1																	94342829		1874	4097	5971	SO:0001583	missense	30836	exon2			GGTACAATCTTAC	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.662T>G	1.37:g.94342829A>C	ENSP00000411010:p.Ile221Ser	Somatic	264	0		WXS	Illumina HiSeq	Phase_I	295	109	NM_014597	0	0	23	38	15	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	ENST00000436063.2	37	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	A	7.865	0.726984	0.15439	.	.	ENSG00000067334	ENST00000436063	T	0.16743	2.32	4.97	-4.84	0.03151	.	1.525530	0.03836	N	0.269774	T	0.04998	0.0134	L	0.56769	1.78	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.45308	-0.9270	10	0.72032	D	0.01	.	0.8184	0.01107	0.315:0.2126:0.2868:0.1855	.	221	Q5QJE6	TDIF2_HUMAN	S	221	ENSP00000411010:I221S	ENSP00000352137:I221S	I	-	2	0	DNTTIP2	94115417	0.000000	0.05858	0.000000	0.03702	0.318000	0.28184	0.416000	0.21198	-0.444000	0.07170	0.533000	0.62120	ATT	.		0.393	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
SASS6	163786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	100572514	100572514	+	Silent	SNP	A	A	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:100572514A>C	ENST00000287482.5	-	12	1502	c.1362T>G	c.(1360-1362)gtT>gtG	p.V454V	SASS6_ENST00000462159.1_5'UTR|SASS6_ENST00000535161.1_Silent_p.V287V	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	454					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		CAAGTTTTTTAACTGTAGCTT	0.249																																					p.V454V		.											.	SASS6-70	0			c.T1362G						.						68.0	68.0	68.0					1																	100572514		2189	4293	6482	SO:0001819	synonymous_variant	163786	exon12			TTTTTTAACTGTA	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1362T>G	1.37:g.100572514A>C		Somatic	37	0		WXS	Illumina HiSeq	Phase_I	38	11	NM_194292	0	0	0	2	2	D3DT55|Q8N3K0	Silent	SNP	ENST00000287482.5	37	CCDS764.1																																																																																			.		0.249	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	NM_194292	
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:145367739A>G	ENST00000342960.5	+	83	10370	c.10335A>G	c.(10333-10335)aaA>aaG	p.K3445K	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	750						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K3445K(4)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.413																																					p.K3445K													.	.	4	Substitution - coding silent(4)	prostate(3)|kidney(1)	c.A10335G						.																																			SO:0001819	synonymous_variant	100132406	exon83			GGGGAAAAAAAGA	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10335A>G	1.37:g.145367739A>G		Somatic	153	1		WXS	Illumina HiSeq	Phase_I	167	4	NM_001039703	0	0	7	148	141	Q5RHC0|Q9NWN6	Silent	SNP	ENST00000342960.5	37	CCDS53355.1																																																																																			.		0.413	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
HORMAD1	84072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150679129	150679129	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:150679129T>A	ENST00000361824.2	-	10	809	c.704A>T	c.(703-705)aAt>aTt	p.N235I	HORMAD1_ENST00000322343.7_Missense_Mutation_p.N228I|HORMAD1_ENST00000368995.4_Missense_Mutation_p.N155I|HORMAD1_ENST00000368993.2_Missense_Mutation_p.N235I	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	235					blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TGAGTCAATATTTTCCATTCG	0.343																																					p.N235I		.											.	HORMAD1-92	0			c.A704T						.						202.0	191.0	195.0					1																	150679129		2203	4300	6503	SO:0001583	missense	84072	exon10			TCAATATTTTCCA	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.704A>T	1.37:g.150679129T>A	ENSP00000355167:p.Asn235Ile	Somatic	209	0		WXS	Illumina HiSeq	Phase_I	226	86	NM_032132	0	0	0	0	0	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Missense_Mutation	SNP	ENST00000361824.2	37	CCDS967.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.617697	0.66787	.	.	ENSG00000143452	ENST00000368995;ENST00000368993;ENST00000368992;ENST00000540570;ENST00000322343;ENST00000361824;ENST00000368987;ENST00000442853	T;T;T;T	0.47177	0.85;1.42;1.43;1.42	5.48	4.34	0.51931	.	0.219611	0.53938	D	0.000043	T	0.38188	0.1031	L	0.32530	0.975	0.28943	N	0.890864	D;D;D	0.71674	0.998;0.988;0.964	D;P;P	0.65010	0.931;0.878;0.65	T	0.28004	-1.0057	10	0.72032	D	0.01	-12.6203	7.2033	0.25893	0.0:0.2218:0.0:0.7781	.	155;228;235	Q86X24-4;Q86X24-2;Q86X24	.;.;HORM1_HUMAN	I	155;235;164;155;228;235;164;157	ENSP00000357991:N155I;ENSP00000357989:N235I;ENSP00000326489:N228I;ENSP00000355167:N235I	ENSP00000326489:N228I	N	-	2	0	HORMAD1	148945753	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	1.692000	0.37731	2.092000	0.63282	0.383000	0.25322	AAT	.		0.343	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084722.1	NM_032132	
ACKR1	2532	ucsc.edu;bcgsc.ca	37	1	159176128	159176128	+	Missense_Mutation	SNP	C	C	A	rs1801482		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:159176128C>A	ENST00000368122.2	+	2	1578	c.899C>A	c.(898-900)aCg>aAg	p.T300K	DARC_ENST00000368121.2_Missense_Mutation_p.T302K|DARC_ENST00000537147.1_Missense_Mutation_p.T300K|CTA-134P22.2_ENST00000609696.1_RNA	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		300					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					TGTGTGGCTACGCCCCTGCTC	0.602																																					p.T302K													.	DARC-659	0			c.C905A						.						175.0	186.0	183.0					1																	159176128		2203	4300	6503	SO:0001583	missense	2532	exon1			TGGCTACGCCCCT																												ENST00000368122.2:c.899C>A	1.37:g.159176128C>A	ENSP00000357104:p.Thr300Lys	Somatic	547	4		WXS	Illumina HiSeq		550	203	NM_001122951	0	0	0	0	0	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	ENST00000368122.2	37	CCDS1183.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156946	0.57259	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.37235	1.21;1.21;1.21	5.4	3.5	0.40072	.	0.000000	0.32970	U	0.005426	T	0.33731	0.0873	L	0.46157	1.445	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.12760	-1.0535	10	0.72032	D	0.01	-3.3211	7.7112	0.28679	0.0:0.7476:0.1643:0.0881	rs1801482	302;300	Q5Y7A1;Q16570	.;DUFFY_HUMAN	K	300;300;300;302	ENSP00000357104:T300K;ENSP00000441985:T300K;ENSP00000357103:T302K	ENSP00000352341:T300K	T	+	2	0	DARC	157442752	0.000000	0.05858	0.001000	0.08648	0.794000	0.44872	-0.106000	0.10890	0.738000	0.32606	0.655000	0.94253	ACG	.		0.602	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2		
ARHGAP30	257106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161019045	161019045	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:161019045C>T	ENST00000368013.3	-	12	2086	c.1766G>A	c.(1765-1767)tGt>tAt	p.C589Y	ARHGAP30_ENST00000368015.1_Missense_Mutation_p.C412Y|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.C589Y	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	589					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GTCCAGGGAACAGCAGCTGGG	0.572																																					p.C589Y		.											.	ARHGAP30-25	0			c.G1766A						.						95.0	101.0	99.0					1																	161019045		2203	4300	6503	SO:0001583	missense	257106	exon12			AGGGAACAGCAGC	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.1766G>A	1.37:g.161019045C>T	ENSP00000356992:p.Cys589Tyr	Somatic	203	1		WXS	Illumina HiSeq	Phase_I	212	52	NM_001025598	0	0	0	0	0	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166948	0.57476	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017;ENST00000368015	T;T;T	0.39592	2.8;2.61;1.07	5.18	5.18	0.71444	.	0.000000	0.53938	D	0.000049	T	0.52041	0.1710	M	0.71581	2.175	0.36206	D	0.851054	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.59742	-0.7397	10	0.66056	D	0.02	.	9.7641	0.40550	0.0:0.906:0.0:0.094	.	589;589	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	Y	589;589;441;412	ENSP00000356995:C589Y;ENSP00000356992:C589Y;ENSP00000356994:C412Y	ENSP00000356992:C589Y	C	-	2	0	ARHGAP30	159285669	0.999000	0.42202	0.997000	0.53966	0.980000	0.70556	3.126000	0.50477	2.422000	0.82143	0.555000	0.69702	TGT	.		0.572	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
CREG1	8804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	167515357	167515357	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:167515357A>G	ENST00000370509.4	-	3	665	c.640T>C	c.(640-642)Tat>Cat	p.Y214H	CREG1_ENST00000466652.1_5'UTR	NM_003851.2	NP_003842.1	O75629	CREG1_HUMAN	cellular repressor of E1A-stimulated genes 1	214					cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|transcription factor complex (GO:0005667)	FMN binding (GO:0010181)|oxidoreductase activity (GO:0016491)|transcription corepressor activity (GO:0003714)										ACATTATAATATTCTTCTGGT	0.438																																					p.Y214H		.											.	CREG1-186	0			c.T640C						.						70.0	73.0	72.0					1																	167515357		2203	4300	6503	SO:0001583	missense	8804	exon3			TATAATATTCTTC	AF084523	CCDS1262.1	1q24	2008-02-05	2004-09-22	2004-09-22	ENSG00000143162	ENSG00000143162			2351	protein-coding gene	gene with protein product			"""cellular repressor of E1A-stimulated genes"""	CREG		9710587	Standard	NM_003851		Approved		uc001gel.3	O75629	OTTHUMG00000034682	ENST00000370509.4:c.640T>C	1.37:g.167515357A>G	ENSP00000359540:p.Tyr214His	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	67	29	NM_003851	0	0	68	125	57	B2RDD4|Q8N9A3	Missense_Mutation	SNP	ENST00000370509.4	37	CCDS1262.1	.	.	.	.	.	.	.	.	.	.	A	19.78	3.891151	0.72524	.	.	ENSG00000143162	ENST00000370509	.	.	.	5.86	5.86	0.93980	FMN-binding split barrel-related (1);FMN-binding split barrel (1);	0.000000	0.85682	D	0.000000	D	0.83326	0.5230	M	0.91818	3.245	0.53005	D	0.999968	D	0.89917	1.0	D	0.97110	1.0	D	0.87426	0.2385	8	0.87932	D	0	-7.3711	16.2453	0.82441	1.0:0.0:0.0:0.0	.	214	O75629	CREG1_HUMAN	H	214	.	ENSP00000359540:Y214H	Y	-	1	0	CREG1	165781981	1.000000	0.71417	0.810000	0.32431	0.581000	0.36288	8.428000	0.90278	2.241000	0.73720	0.533000	0.62120	TAT	.		0.438	CREG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083911.1	NM_003851	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	185984290	185984290	+	Splice_Site	SNP	G	G	A	rs568290303	byFrequency	TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:185984290G>A	ENST00000271588.4	+	31	4859		c.e31-1		HMCN1_ENST00000367492.2_Splice_Site	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1						response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATCCTTTGTAGTTCCACCTAG	0.338																																					.		.											.	HMCN1-113	0			c.4631-1G>A						.						72.0	71.0	71.0					1																	185984290		2203	4299	6502	SO:0001630	splice_region_variant	83872	exon31			TTTGTAGTTCCAC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4631-1G>A	1.37:g.185984290G>A		Somatic	129	1		WXS	Illumina HiSeq	Phase_I	93	37	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Splice_Site	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501313	0.85176	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1551	0.93507	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HMCN1	184250913	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	8.911000	0.92721	2.583000	0.87209	0.557000	0.71058	.	.		0.338	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	Intron
PLEKHA6	22874	broad.mit.edu;ucsc.edu	37	1	204199641	204199641	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:204199641A>G	ENST00000272203.3	-	18	2799	c.2483T>C	c.(2482-2484)aTg>aCg	p.M828T	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.M848T	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	828										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GTGCCGCCGCATTCGGTCAAT	0.652																																					p.M828T													.	PLEKHA6-654	0			c.T2483C						.						36.0	30.0	32.0					1																	204199641		2203	4298	6501	SO:0001583	missense	22874	exon18			CGCCGCATTCGGT	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2483T>C	1.37:g.204199641A>G	ENSP00000272203:p.Met828Thr	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	9	3	NM_014935	0	0	12	15	3	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	A	18.92	3.726061	0.69074	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.13538	2.58;3.04	5.24	5.24	0.73138	.	0.044871	0.85682	D	0.000000	T	0.32734	0.0839	M	0.73962	2.25	0.53688	D	0.999974	P	0.45827	0.867	P	0.55112	0.769	T	0.05954	-1.0854	10	0.72032	D	0.01	-30.7964	14.7958	0.69876	1.0:0.0:0.0:0.0	.	828	Q9Y2H5	PKHA6_HUMAN	T	828;848	ENSP00000272203:M828T;ENSP00000402046:M848T	ENSP00000272203:M828T	M	-	2	0	PLEKHA6	202466264	1.000000	0.71417	0.997000	0.53966	0.716000	0.41182	8.402000	0.90205	1.972000	0.57404	0.379000	0.24179	ATG	.		0.652	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
ENTPD7	57089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	101460770	101460770	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr10:101460770T>G	ENST00000370489.4	+	11	1554	c.1376T>G	c.(1375-1377)tTc>tGc	p.F459C		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	459						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		ACTCAGAGATTCAAGAATGGC	0.433																																					p.F459C		.											.	ENTPD7-91	0			c.T1376G						.						361.0	321.0	334.0					10																	101460770		2203	4300	6503	SO:0001583	missense	57089	exon11			AGAGATTCAAGAA	AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.1376T>G	10.37:g.101460770T>G	ENSP00000359520:p.Phe459Cys	Somatic	407	0		WXS	Illumina HiSeq	Phase_I	272	93	NM_020354	0	0	11	18	7	B2RB83|B3KP21|D3DR64	Missense_Mutation	SNP	ENST00000370489.4	37	CCDS7480.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.321910	0.81580	.	.	ENSG00000198018	ENST00000370489	T	0.12255	2.7	5.21	5.21	0.72293	.	0.056019	0.64402	D	0.000001	T	0.41282	0.1152	M	0.85197	2.74	0.53688	D	0.999977	D	0.76494	0.999	D	0.70935	0.971	T	0.42949	-0.9421	10	0.59425	D	0.04	-26.5929	14.9011	0.70681	0.0:0.0:0.0:1.0	.	459	Q9NQZ7	ENTP7_HUMAN	C	459	ENSP00000359520:F459C	ENSP00000359520:F459C	F	+	2	0	ENTPD7	101450760	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.860000	0.86993	2.192000	0.70111	0.523000	0.50628	TTC	.		0.433	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049809.2	NM_020354	
Unknown	0	broad.mit.edu;ucsc.edu	37	11	5989644	5989644	+	IGR	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:5989644C>A								OR56A3 (20053 upstream) : OR52L1 (17477 downstream)																							ACAGCCAGTGCTGCCAGCTCT	0.532																																					p.Q27H													.	.	0			c.G81T						.						80.0	86.0	84.0					11																	5989644		692	1591	2283	SO:0001628	intergenic_variant	390084	exon1			CCAGTGCTGCCAG																													11.37:g.5989644C>A		Somatic	22	0		WXS	Illumina HiSeq	Phase_I	15	7	NM_001146033	0	0	0	0	0		Missense_Mutation	SNP		37																																																																																				.	0	0.532								
AGBL2	79841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47711964	47711964	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:47711964T>G	ENST00000525123.1	-	10	1580	c.1295A>C	c.(1294-1296)aAt>aCt	p.N432T	AGBL2_ENST00000529712.1_5'UTR|AGBL2_ENST00000298861.4_Missense_Mutation_p.N432T|AGBL2_ENST00000528244.1_Missense_Mutation_p.N394T|AGBL2_ENST00000357610.3_Missense_Mutation_p.N432T	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	432						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						GTAAACGGTATTTCCTGCTAG	0.498																																					p.N432T		.											.	AGBL2-92	0			c.A1295C						.						123.0	112.0	116.0					11																	47711964		2201	4298	6499	SO:0001583	missense	79841	exon10			ACGGTATTTCCTG		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.1295A>C	11.37:g.47711964T>G	ENSP00000435582:p.Asn432Thr	Somatic	173	1		WXS	Illumina HiSeq	Phase_I	132	32	NM_024783	0	0	3	5	2	A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Missense_Mutation	SNP	ENST00000525123.1	37	CCDS7944.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.092430	0.76756	.	.	ENSG00000165923	ENST00000525123;ENST00000357610;ENST00000298861;ENST00000528244	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	5.57	5.57	0.84162	Peptidase M14, carboxypeptidase A (1);	0.000000	0.85682	D	0.000000	T	0.45915	0.1366	H	0.95004	3.61	0.54753	D	0.999988	D;D;D	0.89917	1.0;0.999;0.997	D;D;D	0.85130	0.997;0.994;0.986	T	0.61342	-0.7082	9	.	.	.	-23.8875	16.0241	0.80528	0.0:0.0:0.0:1.0	.	394;394;432	F6U0I4;B4DZS1;Q5U5Z8	.;.;CBPC2_HUMAN	T	432;432;432;394	ENSP00000435582:N432T;ENSP00000350228:N432T;ENSP00000298861:N432T;ENSP00000436630:N394T	.	N	-	2	0	AGBL2	47668540	1.000000	0.71417	0.510000	0.27712	0.857000	0.48899	7.429000	0.80309	2.248000	0.74166	0.533000	0.62120	AAT	.		0.498	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383726.2	NM_024783	
TMEM132A	54972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	60696113	60696113	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:60696113G>C	ENST00000453848.2	+	4	705	c.547G>C	c.(547-549)Gcc>Ccc	p.A183P	TMEM132A_ENST00000005286.4_Missense_Mutation_p.A183P			Q24JP5	T132A_HUMAN	transmembrane protein 132A	183						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						ATCCCTGGGCGCCTGCGTGGT	0.642																																					p.A183P		.											.	TMEM132A-227	0			c.G547C						.						45.0	49.0	48.0					11																	60696113		2171	4243	6414	SO:0001583	missense	54972	exon4			CTGGGCGCCTGCG	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.547G>C	11.37:g.60696113G>C	ENSP00000405823:p.Ala183Pro	Somatic	151	1		WXS	Illumina HiSeq	Phase_I	94	44	NM_178031	0	0	0	1	1	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989179	0.74589	.	.	ENSG00000006118	ENST00000453848;ENST00000005286	T;T	0.06142	3.34;3.34	4.32	4.32	0.51571	.	0.800173	0.10694	N	0.644830	T	0.19127	0.0459	L	0.44542	1.39	0.40027	D	0.975487	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.69307	0.946;0.963;0.963	T	0.01844	-1.1262	10	0.87932	D	0	.	14.9848	0.71339	0.0:0.0:1.0:0.0	.	172;183;183	Q24JP5-3;Q24JP5;Q24JP5-2	.;T132A_HUMAN;.	P	183	ENSP00000405823:A183P;ENSP00000005286:A183P	ENSP00000005286:A183P	A	+	1	0	TMEM132A	60452689	0.909000	0.30893	0.990000	0.47175	0.909000	0.53808	4.221000	0.58574	2.136000	0.66102	0.462000	0.41574	GCC	.		0.642	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
CCDC88B	283234	broad.mit.edu	37	11	64111815	64111815	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:64111815C>A	ENST00000356786.5	+	14	1846	c.1802C>A	c.(1801-1803)cCt>cAt	p.P601H	CCDC88B_ENST00000301897.4_5'UTR|CCDC88B_ENST00000463837.1_3'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	601						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CTCCAGAGCCCTGCCTCTGTG	0.642																																					p.P601H													.	CCDC88B-94	0			c.C1802A						.						33.0	36.0	35.0					11																	64111815		2201	4297	6498	SO:0001583	missense	283234	exon14			AGAGCCCTGCCTC	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1802C>A	11.37:g.64111815C>A	ENSP00000349238:p.Pro601His	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	53	3	NM_032251	0	0	1	1	0	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	.	.	.	.	.	.	.	.	.	.	c	9.520	1.108125	0.20714	.	.	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.28069	1.63	3.54	1.52	0.23074	.	.	.	.	.	T	0.21267	0.0512	L	0.32530	0.975	0.09310	N	0.999998	B;B;B	0.14805	0.011;0.004;0.011	B;B;B	0.14023	0.007;0.004;0.01	T	0.21552	-1.0242	9	0.46703	T	0.11	.	6.1863	0.20500	0.1954:0.6944:0.0:0.1102	.	601;250;601	B2RTU8;A6NC98-3;A6NC98	.;.;CC88B_HUMAN	H	601	ENSP00000349238:P601H	ENSP00000349238:P601H	P	+	2	0	CCDC88B	63868391	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-0.875000	0.04205	0.253000	0.21552	0.450000	0.29827	CCT	.		0.642	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251	
DPF2	5977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65113198	65113198	+	Silent	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:65113198G>A	ENST00000528416.1	+	7	832	c.699G>A	c.(697-699)ttG>ttA	p.L233L	DPF2_ENST00000252268.4_Silent_p.L247L|DPF2_ENST00000415073.2_Intron|DPF2_ENST00000532264.1_3'UTR	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	233					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						ACTCCCACTTGGCTGAGGAGG	0.512																																					p.L233L		.											.	DPF2-91	0			c.G699A						.						78.0	71.0	73.0					11																	65113198		2201	4297	6498	SO:0001819	synonymous_variant	5977	exon7			CCACTTGGCTGAG	U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.699G>A	11.37:g.65113198G>A		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	66	27	NM_006268	0	0	9	24	15	A8K7C9|B4DT58	Silent	SNP	ENST00000528416.1	37	CCDS8100.1																																																																																			.		0.512	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
SPTBN2	6712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66468283	66468283	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:66468283G>T	ENST00000533211.1	-	17	3618	c.3287C>A	c.(3286-3288)aCc>aAc	p.T1096N	SPTBN2_ENST00000529997.1_Missense_Mutation_p.T1096N|SPTBN2_ENST00000309996.2_Missense_Mutation_p.T1096N			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1096					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CTCAGGCAGGGTGGCCGGCCC	0.692																																					p.T1096N		.											.	SPTBN2-155	0			c.C3287A						.						16.0	18.0	17.0					11																	66468283		2193	4285	6478	SO:0001583	missense	6712	exon16			GGCAGGGTGGCCG	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.3287C>A	11.37:g.66468283G>T	ENSP00000432568:p.Thr1096Asn	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	27	15	NM_006946	0	0	0	0	0	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414677	0.62511	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.34275	1.37;1.37;1.37	4.7	4.7	0.59300	.	0.059484	0.64402	D	0.000001	T	0.20981	0.0505	N	0.12182	0.205	0.36280	D	0.855746	B	0.28026	0.198	B	0.28305	0.088	T	0.20075	-1.0286	10	0.27785	T	0.31	.	11.7357	0.51763	0.0:0.0:0.8233:0.1767	.	1096	O15020	SPTN2_HUMAN	N	1096	ENSP00000432568:T1096N;ENSP00000311489:T1096N;ENSP00000433593:T1096N	ENSP00000311489:T1096N	T	-	2	0	SPTBN2	66224859	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.377000	0.73145	2.446000	0.82766	0.491000	0.48974	ACC	.		0.692	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
LRP5	4041	hgsc.bcm.edu	37	11	68125147	68125147	+	Missense_Mutation	SNP	C	C	G	rs80358306		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:68125147C>G	ENST00000294304.7	+	3	624	c.518C>G	c.(517-519)aCg>aGg	p.T173R		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	173	Beta-propeller 1.		T -> M (in EVR4; an individual with abnormal retinal vasculature and retinal folds). {ECO:0000269|PubMed:15024691}.		adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGGGGTGAGACGCCCCGGATT	0.547																																					p.T173R		.											.	LRP5-661	0			c.C518G	GRCh37	CM041034	LRP5	M	rs80358306	.						62.0	55.0	58.0					11																	68125147		2200	4294	6494	SO:0001583	missense	4041	exon3			GTGAGACGCCCCG	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.518C>G	11.37:g.68125147C>G	ENSP00000294304:p.Thr173Arg	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_002335	0	0	5	5	0	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801004	0.31869	.	.	ENSG00000162337	ENST00000294304	D	0.95069	-3.6	3.56	1.67	0.24075	Six-bladed beta-propeller, TolB-like (1);	0.121287	0.34291	U	0.004093	D	0.87406	0.6169	N	0.08118	0	0.29685	N	0.841388	P	0.39624	0.681	B	0.44044	0.439	T	0.82792	-0.0282	10	0.27082	T	0.32	.	10.4313	0.44409	0.0:0.8325:0.0:0.1675	.	173	O75197	LRP5_HUMAN	R	173	ENSP00000294304:T173R	ENSP00000294304:T173R	T	+	2	0	LRP5	67881723	0.014000	0.17966	0.966000	0.40874	0.693000	0.40251	0.181000	0.16880	0.495000	0.27882	-0.463000	0.05309	ACG	C|0.999;T|0.001		0.547	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
RSF1	51773	ucsc.edu	37	11	77412780	77412780	+	Silent	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:77412780T>C	ENST00000308488.6	-	6	1796	c.1494A>G	c.(1492-1494)aaA>aaG	p.K498K	RSF1_ENST00000360355.2_Silent_p.K467K|RSF1_ENST00000480887.1_Silent_p.K246K			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	498					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			GCTCACCTGTTTTCATACTTG	0.398																																					p.K498K													.	RSF1-93	0			c.A1494G						.						141.0	137.0	138.0					11																	77412780		2200	4292	6492	SO:0001819	synonymous_variant	51773	exon6			ACCTGTTTTCATA	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.1494A>G	11.37:g.77412780T>C		Somatic	308	0		WXS	Illumina HiSeq		256	2	NM_016578	0	0	8	8	0	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Silent	SNP	ENST00000308488.6	37	CCDS8253.1																																																																																			.		0.398	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	82877600	82877600	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:82877600A>G	ENST00000298281.4	+	5	2113	c.1661A>G	c.(1660-1662)gAt>gGt	p.D554G		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	554					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GATATTCGGGATCCAAGGCGA	0.423																																					p.D554G		.											.	PCF11-23	0			c.A1661G						.						80.0	76.0	77.0					11																	82877600		1873	4113	5986	SO:0001583	missense	51585	exon5			TTCGGGATCCAAG	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1661A>G	11.37:g.82877600A>G	ENSP00000298281:p.Asp554Gly	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	73	19	NM_015885	0	0	5	6	1	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.007795	0.75046	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.56611	1.4;0.45;0.46	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000008	T	0.63189	0.2490	L	0.32530	0.975	0.58432	D	0.999996	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.94	T	0.60409	-0.7269	9	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	554;554	E9PQ01;O94913	.;PCF11_HUMAN	G	554	ENSP00000298281:D554G;ENSP00000434540:D554G;ENSP00000431567:D554G	.	D	+	2	0	PCF11	82555248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.615000	0.90920	2.326000	0.78906	0.533000	0.62120	GAT	.		0.423	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
SNX19	399979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	130785820	130785820	+	Silent	SNP	T	T	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr11:130785820T>A	ENST00000265909.4	-	1	584	c.15A>T	c.(13-15)acA>acT	p.T5T	SNX19_ENST00000539184.1_Intron|SNX19_ENST00000533214.1_Silent_p.T5T|SNX19_ENST00000528555.1_Intron|SNX19_ENST00000533318.1_Intron|SNX19_ENST00000530356.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	5					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		ACGGTGGCACTGTTTCTGTCT	0.542																																					p.T5T		.											.	SNX19-229	0			c.A15T						.						50.0	44.0	46.0					11																	130785820		2201	4297	6498	SO:0001819	synonymous_variant	399979	exon1			TGGCACTGTTTCT	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.15A>T	11.37:g.130785820T>A		Somatic	56	0		WXS	Illumina HiSeq	Phase_I	29	13	NM_014758	0	0	2	6	4	E9PKB9|Q8IV55	Silent	SNP	ENST00000265909.4	37	CCDS31721.1																																																																																			.		0.542	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758	
ATN1	1822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7045767	7045767	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr12:7045767C>A	ENST00000356654.4	+	5	1574	c.1337C>A	c.(1336-1338)cCt>cAt	p.P446H	ATN1_ENST00000396684.2_Missense_Mutation_p.P446H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	446	Poly-Pro.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CCACCACCTCCTCCCTATGGC	0.627																																					p.P446H		.											.	ATN1-139	0			c.C1337A						.						149.0	144.0	146.0					12																	7045767		2203	4300	6503	SO:0001583	missense	1822	exon5			CACCTCCTCCCTA	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1337C>A	12.37:g.7045767C>A	ENSP00000349076:p.Pro446His	Somatic	377	0		WXS	Illumina HiSeq	Phase_I	366	144	NM_001007026	0	0	12	25	13	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	c	12.53	1.964846	0.34659	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.55413	0.52;0.52;0.52	3.88	3.88	0.44766	.	.	.	.	.	T	0.63390	0.2507	L	0.40543	1.245	0.46416	D	0.999032	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.988	T	0.63721	-0.6573	9	0.38643	T	0.18	.	16.2396	0.82401	0.0:1.0:0.0:0.0	.	446;446	Q86V38;P54259	.;ATN1_HUMAN	H	446;446;446;31	ENSP00000349076:P446H;ENSP00000379915:P446H;ENSP00000441744:P446H	ENSP00000229279:P31H	P	+	2	0	ATN1	6916028	0.028000	0.19301	0.947000	0.38551	0.354000	0.29330	0.722000	0.25925	1.883000	0.54544	0.586000	0.80456	CCT	.		0.627	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
AEBP2	121536	hgsc.bcm.edu	37	12	19665400	19665400	+	Splice_Site	SNP	G	G	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr12:19665400G>C	ENST00000398864.3	+	6	1393		c.e6+1		AEBP2_ENST00000266508.9_Splice_Site|AEBP2_ENST00000360995.4_Splice_Site|AEBP2_ENST00000541908.1_Splice_Site	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2						chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					CTGAAGACATGTAAGTATTTG	0.249																																					.		.											.	AEBP2-23	0			c.1367+1G>C						.						61.0	57.0	58.0					12																	19665400		1792	4062	5854	SO:0001630	splice_region_variant	121536	exon6			AGACATGTAAGTA		CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.1367+1G>C	12.37:g.19665400G>C		Somatic	10	0		WXS	Illumina HiSeq	Phase_I	16	2	NM_153207	0	0	0	0	0	Q59FS5|Q6ZN62|Q96BG3	Splice_Site	SNP	ENST00000398864.3	37	CCDS44841.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424790	0.83667	.	.	ENSG00000139154	ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995;ENST00000512223;ENST00000398731	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5514	0.95322	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AEBP2	19556667	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.609000	0.90898	2.705000	0.92388	0.650000	0.86243	.	.		0.249	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401575.1	NM_153207	Intron
NAB2	4665	hgsc.bcm.edu	37	12	57487273	57487273	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr12:57487273A>G	ENST00000300131.3	+	6	1738	c.1360A>G	c.(1360-1362)Atc>Gtc	p.I454V	NAB2_ENST00000357680.4_3'UTR|NAB2_ENST00000342556.6_Intron	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	454					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GAGCCGACACATCCTGCAGCA	0.687																																					p.I454V		.											.	NAB2-92	0			c.A1360G						.						12.0	13.0	13.0					12																	57487273		2160	4249	6409	SO:0001583	missense	4665	exon6			CGACACATCCTGC	BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.1360A>G	12.37:g.57487273A>G	ENSP00000300131:p.Ile454Val	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	13	6	NM_005967	0	0	8	10	2	B2RAK3|O76006|Q14797	Missense_Mutation	SNP	ENST00000300131.3	37	CCDS8930.1	.	.	.	.	.	.	.	.	.	.	A	15.79	2.937547	0.52972	.	.	ENSG00000166886	ENST00000300131	.	.	.	4.62	4.62	0.57501	.	0.073328	0.53938	D	0.000047	T	0.33030	0.0849	N	0.14661	0.345	0.80722	D	1	B	0.29508	0.246	B	0.21546	0.035	T	0.17623	-1.0363	9	0.33940	T	0.23	-2.7571	12.2861	0.54793	1.0:0.0:0.0:0.0	.	454	Q15742	NAB2_HUMAN	V	454	.	ENSP00000300131:I454V	I	+	1	0	NAB2	55773540	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.437000	0.66544	2.077000	0.62373	0.459000	0.35465	ATC	.		0.687	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967	
PITPNM2	57605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	123479959	123479959	+	Silent	SNP	C	C	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr12:123479959C>T	ENST00000542749.1	-	12	2094	c.2031G>A	c.(2029-2031)caG>caA	p.Q677Q	PITPNM2_ENST00000320201.4_Silent_p.Q677Q|PITPNM2_ENST00000392428.1_Silent_p.Q398Q|PITPNM2_ENST00000280562.5_Silent_p.Q677Q			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	677					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CCTGGTGCTGCTGGATGGTAT	0.637																																					p.Q677Q		.											.	PITPNM2-228	0			c.G2031A						.						58.0	67.0	64.0					12																	123479959		2203	4299	6502	SO:0001819	synonymous_variant	57605	exon13			GTGCTGCTGGATG	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.2031G>A	12.37:g.123479959C>T		Somatic	104	0		WXS	Illumina HiSeq	Phase_I	150	43	NM_020845	0	0	1	3	2	Q9P271	Silent	SNP	ENST00000542749.1	37	CCDS9242.1																																																																																			.		0.637	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
PYGL	5836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	51387749	51387749	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr14:51387749C>T	ENST00000216392.7	-	6	1029	c.697G>A	c.(697-699)Ggc>Agc	p.G233S	PYGL_ENST00000532462.1_Missense_Mutation_p.G233S|PYGL_ENST00000544180.2_Missense_Mutation_p.G199S	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	233					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	TTCATGTAGCCGGGCACGGGG	0.512																																					p.G233S		.											.	PYGL-91	0			c.G697A						.						91.0	93.0	92.0					14																	51387749		2203	4300	6503	SO:0001583	missense	5836	exon6			TGTAGCCGGGCAC		CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.697G>A	14.37:g.51387749C>T	ENSP00000216392:p.Gly233Ser	Somatic	103	1		WXS	Illumina HiSeq	Phase_I	71	42	NM_002863	0	0	1	3	2	A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Missense_Mutation	SNP	ENST00000216392.7	37	CCDS32080.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.389863	0.82902	.	.	ENSG00000100504	ENST00000532462;ENST00000544180;ENST00000216392	D;D;D	0.97138	-4.26;-4.26;-4.26	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.99143	0.9704	H	0.97564	4.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.99026	1.0819	10	0.87932	D	0	-14.2229	19.3504	0.94381	0.0:1.0:0.0:0.0	.	199;233;233	F5H816;E9PK47;P06737	.;.;PYGL_HUMAN	S	233;199;233	ENSP00000431657:G233S;ENSP00000443787:G199S;ENSP00000216392:G233S	ENSP00000216392:G233S	G	-	1	0	PYGL	50457499	1.000000	0.71417	1.000000	0.80357	0.040000	0.13550	7.750000	0.85110	2.885000	0.99019	0.655000	0.94253	GGC	.		0.512	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390654.3	NM_002863	
TTC7B	145567	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	91161893	91161893	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr14:91161893C>G	ENST00000328459.6	-	6	849	c.728G>C	c.(727-729)aGa>aCa	p.R243T	TTC7B_ENST00000357056.2_Missense_Mutation_p.R243T|RP11-661G16.2_ENST00000553712.1_RNA	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	243										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				GAGAAGCTCTCTAAATCTTCC	0.413																																					p.R243T		.											.	TTC7B-92	0			c.G728C						.						138.0	111.0	120.0					14																	91161893		2203	4300	6503	SO:0001583	missense	145567	exon6			AGCTCTCTAAATC	BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.728G>C	14.37:g.91161893C>G	ENSP00000336127:p.Arg243Thr	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	42	23	NM_001010854	0	0	0	3	3	Q86U24|Q86VT3	Missense_Mutation	SNP	ENST00000328459.6	37	CCDS32140.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671065	0.47781	.	.	ENSG00000165914	ENST00000555768;ENST00000357056;ENST00000328459;ENST00000557766	T;T	0.66638	0.45;-0.22	5.72	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.69278	0.3093	M	0.82517	2.595	0.80722	D	1	B	0.30482	0.281	B	0.27796	0.083	T	0.72279	-0.4340	10	0.87932	D	0	-14.3324	14.3423	0.66636	0.0:0.9283:0.0:0.0717	.	243	Q86TV6	TTC7B_HUMAN	T	141;243;243;163	ENSP00000349564:R243T;ENSP00000336127:R243T	ENSP00000336127:R243T	R	-	2	0	TTC7B	90231646	1.000000	0.71417	0.781000	0.31783	0.002000	0.02628	7.184000	0.77705	1.420000	0.47138	-0.229000	0.12294	AGA	.		0.413	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2		
TYRO3	7301	hgsc.bcm.edu	37	15	41854918	41854918	+	Splice_Site	SNP	T	T	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr15:41854918T>G	ENST00000263798.3	+	4	804		c.e4+2		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		ATGTAACAGGTGAGCAGCCTC	0.582																																					.		.											.	TYRO3-1388	0			c.580+2T>G						.						22.0	20.0	21.0					15																	41854918		2203	4300	6503	SO:0001630	splice_region_variant	7301	exon4			AACAGGTGAGCAG	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.580+2T>G	15.37:g.41854918T>G		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	31	8	NM_006293	0	0	0	0	0	O14953|Q86VR3	Splice_Site	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	t	21.2	4.113398	0.77210	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5013	0.67724	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39642210	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.037000	0.70956	2.007000	0.58848	0.387000	0.25754	.	.		0.582	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		Intron
MAPKBP1	23005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42105966	42105966	+	Missense_Mutation	SNP	G	G	A	rs374717785		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr15:42105966G>A	ENST00000456763.2	+	10	1181	c.985G>A	c.(985-987)Gtc>Atc	p.V329I	MAPKBP1_ENST00000221214.6_Intron|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.V211I|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.V323I|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.V323I	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	329								p.V323I(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CATTGCTAGCGTCACCGAGGC	0.592																																					p.V329I		.											.	MAPKBP1-589	1	Substitution - Missense(1)	large_intestine(1)	c.G985A						.	A	ILE/VAL,ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	115.0	106.0	109.0		985,967	-6.3	0.1	15		109	0,8600		0,0,4300	no	missense,missense	MAPKBP1	NM_001128608.1,NM_014994.2	29,29	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign,benign	329/1515,323/1509	42105966	3,13003	2203	4300	6503	SO:0001583	missense	23005	exon10			GCTAGCGTCACCG	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.985G>A	15.37:g.42105966G>A	ENSP00000393099:p.Val329Ile	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	153	42	NM_001128608	0	0	0	0	0	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	g	0.324	-0.960053	0.02267	6.81E-4	0.0	ENSG00000137802	ENST00000457542;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T	0.42131	1.08;0.98;1.15;1.24	5.64	-6.33	0.01988	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.593302	0.19314	N	0.117308	T	0.28962	0.0719	L	0.38531	1.155	0.09310	N	0.999993	B;B;B;B	0.12013	0.001;0.005;0.001;0.001	B;B;B;B	0.13407	0.001;0.009;0.001;0.002	T	0.05053	-1.0909	10	0.21014	T	0.42	-1.6987	18.1757	0.89760	0.2499:0.0:0.7501:0.0	.	211;323;329;323	F8WC21;O60336-2;O60336;O60336-6	.;.;MABP1_HUMAN;.	I	323;211;329;323	ENSP00000397570:V323I;ENSP00000260357:V211I;ENSP00000393099:V329I;ENSP00000426154:V323I	ENSP00000260357:V211I	V	+	1	0	MAPKBP1	39893258	0.000000	0.05858	0.055000	0.19348	0.822000	0.46500	-0.443000	0.06862	-1.516000	0.01782	-1.913000	0.00520	GTC	.		0.592	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
AP4E1	23431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	51289917	51289917	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr15:51289917T>A	ENST00000261842.5	+	18	2847	c.2741T>A	c.(2740-2742)aTa>aAa	p.I914K	AP4E1_ENST00000560508.1_Missense_Mutation_p.I839K	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	914					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		ACTGAATACATACACTCAAAT	0.353																																					p.I914K		.											.	AP4E1-90	0			c.T2741A						.						66.0	68.0	67.0					15																	51289917		2196	4294	6490	SO:0001583	missense	23431	exon18			AATACATACACTC	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2741T>A	15.37:g.51289917T>A	ENSP00000261842:p.Ile914Lys	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	146	65	NM_007347	0	0	0	1	1	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	ENST00000261842.5	37	CCDS32240.1	.	.	.	.	.	.	.	.	.	.	T	4.902	0.167570	0.09339	.	.	ENSG00000081014	ENST00000261842	T	0.16457	2.34	5.2	4.06	0.47325	Coatomer, beta subunit, C-terminal (1);	0.708362	0.14326	N	0.326718	T	0.08179	0.0204	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.13407	0.009	T	0.26430	-1.0103	10	0.52906	T	0.07	-0.4045	3.9914	0.09538	0.0:0.1738:0.2024:0.6238	.	914	Q9UPM8	AP4E1_HUMAN	K	914	ENSP00000261842:I914K	ENSP00000261842:I914K	I	+	2	0	AP4E1	49077209	0.972000	0.33761	0.226000	0.23910	0.357000	0.29423	2.092000	0.41700	0.804000	0.34136	0.383000	0.25322	ATA	.		0.353	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1		
PIAS1	8554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	68479999	68479999	+	Silent	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr15:68479999T>C	ENST00000249636.6	+	14	1930	c.1782T>C	c.(1780-1782)agT>agC	p.S594S	PIAS1_ENST00000545237.1_Silent_p.S596S	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	594	4 X 4 AA repeats of N-T-S-L.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						ATCAGTTAAGTGCAGGAGGCA	0.502																																					p.S594S		.											.	PIAS1-637	0			c.T1782C						.						85.0	83.0	83.0					15																	68479999		2018	4191	6209	SO:0001819	synonymous_variant	8554	exon14			GTTAAGTGCAGGA	AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.1782T>C	15.37:g.68479999T>C		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	77	34	NM_016166	0	0	3	8	5	B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Silent	SNP	ENST00000249636.6	37	CCDS45290.1																																																																																			.		0.502	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419642.2		
ZNF688	146542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30581595	30581595	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr16:30581595G>A	ENST00000223459.6	-	3	1577	c.473C>T	c.(472-474)gCc>gTc	p.A158V	ZNF688_ENST00000395219.1_Missense_Mutation_p.A144V|AC002310.7_ENST00000486926.1_RNA|AC002310.7_ENST00000492040.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CGGGTCCCAGGCAGCATTTTT	0.672																																					p.A158V		.											.	ZNF688-68	0			c.C473T						.						29.0	32.0	31.0					16																	30581595		2197	4299	6496	SO:0001583	missense	146542	exon3			TCCCAGGCAGCAT	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.473C>T	16.37:g.30581595G>A	ENSP00000223459:p.Ala158Val	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	46	19	NM_145271	0	0	2	4	2	A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000223459.6	37	CCDS10684.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.817925	0.32145	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.04194	3.68;3.91	4.26	0.961	0.19638	.	.	.	.	.	T	0.04003	0.0112	L	0.41236	1.265	0.09310	N	1	B;B	0.14438	0.002;0.01	B;B	0.11329	0.003;0.006	T	0.43523	-0.9386	9	0.28530	T	0.3	.	3.1826	0.06589	0.2262:0.0:0.5648:0.209	.	158;144	P0C7X2;A8MV39	ZN688_HUMAN;.	V	144;158	ENSP00000378645:A144V;ENSP00000223459:A158V	ENSP00000223459:A158V	A	-	2	0	ZNF688	30489096	0.018000	0.18449	0.721000	0.30653	0.192000	0.23643	1.655000	0.37345	0.546000	0.28920	0.460000	0.39030	GCC	.		0.672	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255544.2	NM_145271	
RPGRIP1L	23322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	53708941	53708941	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr16:53708941A>C	ENST00000379925.3	-	7	920	c.870T>G	c.(868-870)atT>atG	p.I290M	RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.I290M|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.I290M|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.I290M	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	290					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CTTGAAGCTGAATAAATTTTC	0.308																																					p.I290M		.											.	RPGRIP1L-91	0			c.T870G						.						131.0	117.0	122.0					16																	53708941		2197	4297	6494	SO:0001583	missense	23322	exon7			AAGCTGAATAAAT		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.870T>G	16.37:g.53708941A>C	ENSP00000369257:p.Ile290Met	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	71	31	NM_001127897	0	0	0	0	0	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	A	11.30	1.597979	0.28445	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	D;D	0.89875	-2.58;-2.58	5.98	4.87	0.63330	.	0.287071	0.33834	N	0.004504	T	0.77638	0.4160	L	0.36672	1.1	0.80722	D	1	B;B;B;P	0.38250	0.351;0.241;0.241;0.624	B;B;B;B	0.32342	0.071;0.071;0.071;0.144	T	0.76244	-0.3030	10	0.48119	T	0.1	-8.1579	0.3735	0.00383	0.3487:0.18:0.1302:0.3411	.	290;290;290;290	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	M	290	ENSP00000369257:I290M;ENSP00000262135:I290M	ENSP00000262135:I290M	I	-	3	3	RPGRIP1L	52266442	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.557000	0.36299	2.293000	0.77203	0.477000	0.44152	ATT	.		0.308	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
SLC16A13	201232	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	6942204	6942204	+	Silent	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr17:6942204C>G	ENST00000308027.6	+	3	1385	c.1077C>G	c.(1075-1077)ctC>ctG	p.L359L		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	359						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						GGCCTCCTCTCTCAGGTAAGT	0.537																																					p.L359L		.											.	SLC16A13-92	0			c.C1077G						.						56.0	70.0	65.0					17																	6942204		2188	4242	6430	SO:0001819	synonymous_variant	201232	exon3			TCCTCTCTCAGGT	BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.1077C>G	17.37:g.6942204C>G		Somatic	172	1		WXS	Illumina HiSeq	Phase_I	198	13	NM_201566	0	0	0	0	0	A3KMG3|A5PKU5|Q2VP92	Silent	SNP	ENST00000308027.6	37	CCDS11085.1																																																																																			.		0.537	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219923.2		
CHRNB1	1140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7357711	7357711	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr17:7357711C>G	ENST00000306071.2	+	8	983	c.916C>G	c.(916-918)Ccc>Gcc	p.P306A	CHRNB1_ENST00000576360.1_Intron|CHRNB1_ENST00000536404.2_Missense_Mutation_p.P234A|CHRNB1_ENST00000575379.1_5'Flank	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	306					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	ACTATCAGTACCCATTATTAT	0.512																																					p.P306A		.											.	CHRNB1-92	0			c.C916G						.						307.0	238.0	262.0					17																	7357711		2203	4300	6503	SO:0001583	missense	1140	exon8			TCAGTACCCATTA	X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.916C>G	17.37:g.7357711C>G	ENSP00000304290:p.Pro306Ala	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	214	60	NM_000747	0	0	0	0	0	B7Z5H1|Q8IZ46|Q96FB8	Missense_Mutation	SNP	ENST00000306071.2	37	CCDS11106.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212473	0.58452	.	.	ENSG00000170175	ENST00000306071;ENST00000536404	D;D	0.85339	-1.97;-1.97	4.92	4.92	0.64577	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95245	0.8458	H	0.99074	4.42	0.80722	D	1	D	0.63880	0.993	P	0.61132	0.884	D	0.97341	0.9957	10	0.87932	D	0	.	15.675	0.77311	0.0:1.0:0.0:0.0	.	306	P11230	ACHB_HUMAN	A	306;234	ENSP00000304290:P306A;ENSP00000439209:P234A	ENSP00000304290:P306A	P	+	1	0	CHRNB1	7298435	1.000000	0.71417	0.998000	0.56505	0.270000	0.26580	7.818000	0.86416	2.300000	0.77407	0.298000	0.19748	CCC	.		0.512	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226942.3		
SHBG	6462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7536218	7536218	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr17:7536218C>A	ENST00000380450.4	+	7	1032	c.1001C>A	c.(1000-1002)gCt>gAt	p.A334D	SHBG_ENST00000340624.5_Intron|SHBG_ENST00000441599.2_Intron|SHBG_ENST00000572262.1_Missense_Mutation_p.A222D|SHBG_ENST00000576478.1_Intron|SHBG_ENST00000575903.1_Missense_Mutation_p.A316D|SHBG_ENST00000570547.1_Intron|SHBG_ENST00000572182.1_Intron|SHBG_ENST00000416273.3_Intron|SHBG_ENST00000574539.1_Intron|SHBG_ENST00000576728.1_Intron|SHBG_ENST00000575314.1_Missense_Mutation_p.A276D	NM_001040.3	NP_001031.2	P04278	SHBG_HUMAN	sex hormone-binding globulin	334	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.			A -> L (in Ref. 2; AAC18778). {ECO:0000305}.	primary spermatocyte growth (GO:0007285)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	androgen binding (GO:0005497)	p.0?(1)|p.?(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_cancers(10;0.0867)		READ - Rectum adenocarcinoma(115;0.168)	Danazol(DB01406)|Drostanolone(DB00858)|Estradiol(DB00783)|Estropipate(DB04574)|Fluoxymesterone(DB01185)|Hydrocortisone(DB00741)|Methyltestosterone(DB06710)|Mitotane(DB00648)|Norethindrone(DB00717)|Spironolactone(DB00421)|Testosterone(DB00624)|transdermal testosterone gel(DB05275)	TTAGGCCTGGCTCCCCTCCTT	0.557											OREG0024140	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A334D		.											.	SHBG-90	2	Unknown(1)|Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)|bone(1)	c.C1001A						.						60.0	53.0	55.0					17																	7536218		2203	4300	6503	SO:0001583	missense	6462	exon7			GCCTGGCTCCCCT		CCDS11117.1, CCDS54082.1, CCDS54083.1, CCDS58513.1, CCDS73961.1, CCDS73962.1	17p13.1	2013-09-19			ENSG00000129214	ENSG00000129214			10839	protein-coding gene	gene with protein product	"""androgen binding protein"""	182205				2587256	Standard	NM_001146279		Approved	ABP, TEBG, MGC126834, MGC138391	uc002gie.2	P04278	OTTHUMG00000108153	ENST00000380450.4:c.1001C>A	17.37:g.7536218C>A	ENSP00000369816:p.Ala334Asp	Somatic	79	1	642	WXS	Illumina HiSeq	Phase_I	73	35	NM_001040	0	0	0	0	0	B0FWH4|E9PGW1|F5H5Z8|I3L1N7|P14689|Q16616|Q3MIL0|Q6ISD2	Missense_Mutation	SNP	ENST00000380450.4	37	CCDS11117.1	.	.	.	.	.	.	.	.	.	.	C	9.158	1.018027	0.19355	.	.	ENSG00000129214	ENST00000380450	T	0.79749	-1.3	4.68	-9.36	0.00629	Concanavalin A-like lectin/glucanase (1);	2.122320	0.01800	N	0.032838	T	0.65048	0.2654	L	0.38175	1.15	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.50558	-0.8814	10	0.17369	T	0.5	3.0464	5.421	0.16400	0.303:0.4871:0.12:0.0899	.	334	P04278	SHBG_HUMAN	D	334	ENSP00000369816:A334D	ENSP00000369816:A334D	A	+	2	0	SHBG	7476943	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.654000	0.00855	-1.994000	0.00972	-0.344000	0.07964	GCT	.		0.557	SHBG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226957.2	NM_001040	
ALOXE3	59344	broad.mit.edu	37	17	8018295	8018295	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr17:8018295G>A	ENST00000448843.2	-	5	855	c.515C>T	c.(514-516)gCc>gTc	p.A172V	ALOXE3_ENST00000318227.3_Missense_Mutation_p.A304V|ALOXE3_ENST00000380149.1_Missense_Mutation_p.A328V	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	172	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						CTTTGTCAAGGCAAATTTCTT	0.507																																					p.A304V													.	ALOXE3-229	0			c.C911T						.						222.0	199.0	207.0					17																	8018295		2203	4300	6503	SO:0001583	missense	59344	exon5			GTCAAGGCAAATT	AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.515C>T	17.37:g.8018295G>A	ENSP00000400581:p.Ala172Val	Somatic	371	0		WXS	Illumina HiSeq	Phase_I	356	7	NM_001165960	0	0	0	0	0	B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Missense_Mutation	SNP	ENST00000448843.2	37	CCDS11130.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.773525	0.49786	.	.	ENSG00000179148	ENST00000380149;ENST00000318227;ENST00000448843	D;D;D	0.89485	-2.52;-2.52;-2.52	5.85	4.88	0.63580	Lipoxygenase, C-terminal (2);	0.312877	0.26939	N	0.021729	D	0.83161	0.5194	L	0.47716	1.5	0.28933	N	0.891461	B;B;B	0.34181	0.44;0.003;0.062	B;B;B	0.30646	0.118;0.003;0.011	T	0.80025	-0.1555	10	0.72032	D	0.01	-12.3324	7.6914	0.28569	0.0822:0.0:0.7559:0.1619	.	304;172;172	B7Z3W0;Q9BYJ1;B3KVD2	.;LOXE3_HUMAN;.	V	328;304;172	ENSP00000369494:A328V;ENSP00000314879:A304V;ENSP00000400581:A172V	ENSP00000314879:A304V	A	-	2	0	ALOXE3	7959020	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	5.429000	0.66495	1.477000	0.48234	0.655000	0.94253	GCC	.		0.507	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441475.1		
SLC6A4	6532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	28543164	28543164	+	Missense_Mutation	SNP	G	G	T	rs200924626		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr17:28543164G>T	ENST00000401766.2	-	6	1420	c.908C>A	c.(907-909)cCt>cAt	p.P303H	SLC6A4_ENST00000261707.3_Missense_Mutation_p.P303H			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	303					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	CCAGGCTCCAGGGAGGGTGGC	0.522													G|||	1	0.000199681	0.0	0.0014	5008	,	,		12429	0.0		0.0	False		,,,				2504	0.0				p.P303H		.											.	SLC6A4-94	0			c.C908A						.						70.0	71.0	71.0					17																	28543164		2203	4300	6503	SO:0001583	missense	6532	exon7			GCTCCAGGGAGGG	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.908C>A	17.37:g.28543164G>T	ENSP00000385822:p.Pro303His	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	118	40	NM_001045	0	0	0	0	0	Q5EE02	Missense_Mutation	SNP	ENST00000401766.2	37	CCDS11256.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	33	5.232955	0.95207	.	.	ENSG00000108576	ENST00000394821;ENST00000401766;ENST00000261707	T;T	0.78481	-1.18;-1.18	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.90335	0.6976	M	0.87617	2.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90653	0.4584	10	0.87932	D	0	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	303	P31645	SC6A4_HUMAN	H	345;303;303	ENSP00000385822:P303H;ENSP00000261707:P303H	ENSP00000261707:P303H	P	-	2	0	SLC6A4	25567290	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.803000	0.99136	2.941000	0.99782	0.655000	0.94253	CCT	G|0.999;T|0.000		0.522	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045	
SPATA20	64847	broad.mit.edu	37	17	48627419	48627419	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr17:48627419G>A	ENST00000356488.4	+	7	971	c.888G>A	c.(886-888)atG>atA	p.M296I	SPATA20_ENST00000006658.6_Missense_Mutation_p.M312I|SPATA20_ENST00000393244.3_Missense_Mutation_p.M252I|SPATA20_ENST00000511937.1_3'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	296					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			CCCAGCAGATGGCCTTGCATA	0.617																																					p.M312I													.	SPATA20-90	0			c.G936A						.						158.0	163.0	161.0					17																	48627419		2203	4300	6503	SO:0001583	missense	64847	exon8			GCAGATGGCCTTG		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.888G>A	17.37:g.48627419G>A	ENSP00000348878:p.Met296Ile	Somatic	451	0		WXS	Illumina HiSeq	Phase_I	430	6	NM_022827	0	0	84	87	3	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	37	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	G	32	5.126463	0.94429	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.31510	1.49;1.49;1.49	5.53	5.53	0.82687	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);	0.000000	0.85682	D	0.000000	T	0.49830	0.1580	M	0.72353	2.195	0.80722	D	1	P;P;P	0.51240	0.609;0.943;0.863	B;P;P	0.53722	0.168;0.733;0.614	T	0.44651	-0.9314	10	0.44086	T	0.13	-5.8568	19.4936	0.95062	0.0:0.0:1.0:0.0	.	322;296;312	B4DZC5;Q8TB22;Q8TB22-2	.;SPT20_HUMAN;.	I	312;296;252	ENSP00000006658:M312I;ENSP00000348878:M296I;ENSP00000376935:M252I	ENSP00000006658:M312I	M	+	3	0	SPATA20	45982418	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.029000	0.88807	2.605000	0.88082	0.655000	0.94253	ATG	.		0.617	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
TEX2	55852	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	62223780	62223780	+	IGR	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr17:62223780C>A	ENST00000583097.1	-	0	4852				SNORA76_ENST00000408535.2_lincRNA|SNORD104_ENST00000362883.1_RNA			Q8IWB9	TEX2_HUMAN	testis expressed 2						signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TTGCGCATAACTGGGGCCGCC	0.627																																					.													.	.	0			.						.						113.0	121.0	118.0					17																	62223780		876	1991	2867	SO:0001628	intergenic_variant	677842	.			GCATAACTGGGGC	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9			17.37:g.62223780C>A		Somatic	171	0		WXS	Illumina HiSeq	Phase_I	196	71	.	0	0	0	0	0	Q6AHZ5|Q8N3L0|Q9C0C5	RNA	SNP	ENST00000583097.1	37																																																																																				.		0.627	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
HDHD2	84064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	44639349	44639349	+	Splice_Site	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr18:44639349A>T	ENST00000300605.6	-	6	827	c.675T>A	c.(673-675)acT>acA	p.T225T	HDHD2_ENST00000587841.1_5'UTR	NM_032124.4	NP_115500.1	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain containing 2	225						extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(2)|lung(1)|skin(1)	6						GATACATACCAGTCTTTACTA	0.408																																					p.T225T		.											.	HDHD2-90	0			c.T675A						.						115.0	100.0	105.0					18																	44639349		2203	4300	6503	SO:0001630	splice_region_variant	84064	exon6			CATACCAGTCTTT	AL136681	CCDS32829.1	18q21.1	2008-02-05				ENSG00000167220			25364	protein-coding gene	gene with protein product						11230166	Standard	NM_032124		Approved	DKFZP564D1378	uc002lcs.3	Q9H0R4		ENST00000300605.6:c.676+1T>A	18.37:g.44639349A>T		Somatic	72	0		WXS	Illumina HiSeq	Phase_I	86	28	NM_032124	0	0	0	1	1	A8K7T3|Q96NV4	Silent	SNP	ENST00000300605.6	37	CCDS32829.1																																																																																			.		0.408	HDHD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450668.2	NM_032124	Silent
GRIN3B	116444	bcgsc.ca	37	19	1004657	1004657	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:1004657T>C	ENST00000234389.3	+	3	1176	c.1157T>C	c.(1156-1158)gTg>gCg	p.V386A	AC004528.4_ENST00000588380.1_RNA|GRIN3B_ENST00000588335.1_Intron	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	386					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGGGCCACGGTGGGCAGCTGG	0.716																																					p.V386A													.	GRIN3B-90	0			c.T1157C						.						9.0	10.0	10.0					19																	1004657		2141	4171	6312	SO:0001583	missense	116444	exon3			CCACGGTGGGCAG		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1157T>C	19.37:g.1004657T>C	ENSP00000234389:p.Val386Ala	Somatic	21	0		WXS	Illumina HiSeq	Phase_1	11	7	NM_138690	0	0	0	0	0	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.756680	0.49362	.	.	ENSG00000116032	ENST00000234389	D	0.91631	-2.88	4.4	4.4	0.53042	.	0.067157	0.64402	D	0.000017	D	0.89660	0.6779	L	0.59436	1.845	0.37366	D	0.911436	P	0.52316	0.952	B	0.41510	0.359	D	0.91764	0.5422	10	0.66056	D	0.02	.	12.4879	0.55883	0.0:0.0:0.0:1.0	.	386	O60391	NMD3B_HUMAN	A	386	ENSP00000234389:V386A	ENSP00000234389:V386A	V	+	2	0	GRIN3B	955657	1.000000	0.71417	0.947000	0.38551	0.713000	0.41058	4.393000	0.59665	1.648000	0.50643	0.382000	0.24955	GTG	.		0.716	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
REXO1	57455	broad.mit.edu	37	19	1821535	1821535	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:1821535G>A	ENST00000170168.4	-	5	2471	c.2377C>T	c.(2377-2379)Cac>Tac	p.H793Y	CTB-31O20.4_ENST00000590531.1_RNA|CTB-31O20.4_ENST00000587741.1_RNA|CTB-31O20.4_ENST00000593201.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	793						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GATGGACTGTGGGCGATTCGC	0.642																																					p.H793Y													.	REXO1-90	0			c.C2377T						.						204.0	154.0	171.0					19																	1821535		2203	4300	6503	SO:0001583	missense	57455	exon5			GACTGTGGGCGAT	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.2377C>T	19.37:g.1821535G>A	ENSP00000170168:p.His793Tyr	Somatic	187	0		WXS	Illumina HiSeq	Phase_I	123	5	NM_020695	0	0	8	8	0	Q9ULT2	Missense_Mutation	SNP	ENST00000170168.4	37	CCDS32866.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.900374	0.52227	.	.	ENSG00000079313	ENST00000170168;ENST00000543452	T	0.24723	1.84	4.5	4.5	0.54988	.	0.474100	0.20491	N	0.091291	T	0.34745	0.0908	M	0.76002	2.32	0.58432	D	0.999999	B;B	0.28998	0.026;0.23	B;B	0.33690	0.038;0.168	T	0.33650	-0.9860	10	0.72032	D	0.01	-37.2863	14.4921	0.67657	0.0:0.0:1.0:0.0	.	102;793	B4DWY3;Q8N1G1	.;REXO1_HUMAN	Y	793;65	ENSP00000170168:H793Y	ENSP00000170168:H793Y	H	-	1	0	REXO1	1772535	1.000000	0.71417	0.930000	0.37139	0.671000	0.39405	7.646000	0.83445	2.314000	0.78098	0.561000	0.74099	CAC	.		0.642	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1	NM_020695	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9083127	9083127	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:9083127C>A	ENST00000397910.4	-	1	8891	c.8688G>T	c.(8686-8688)gaG>gaT	p.E2896D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2897	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACTTGGGACCTCAGAAAACT	0.507																																					p.E2896D		.											.	MUC16-566	0			c.G8688T						.						75.0	69.0	71.0					19																	9083127		1897	4124	6021	SO:0001583	missense	94025	exon1			TGGGACCTCAGAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.8688G>T	19.37:g.9083127C>A	ENSP00000381008:p.Glu2896Asp	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	29	6	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	2.382	-0.341788	0.05243	.	.	ENSG00000181143	ENST00000397910	T	0.02606	4.23	0.773	-1.55	0.08558	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	.	.	.	B	0.19817	0.039	B	0.15484	0.013	T	0.45906	-0.9229	8	0.87932	D	0	.	2.2074	0.03939	0.0:0.3584:0.3406:0.301	.	2896	B5ME49	.	D	2896	ENSP00000381008:E2896D	ENSP00000381008:E2896D	E	-	3	2	MUC16	8944127	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	-0.875000	0.04205	-0.903000	0.03881	0.313000	0.20887	GAG	.		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CACNA1A	773	broad.mit.edu	37	19	13338336	13338336	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:13338336C>T	ENST00000360228.5	-	37	5533	c.5534G>A	c.(5533-5535)cGc>cAc	p.R1845H	CACNA1A_ENST00000574822.1_5'Flank|CACNA1A_ENST00000573710.2_Intron	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1846					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GTAAGGCATGCGGCCCCTGGC	0.493																																					p.R1845H													.	CACNA1A-67	0			c.G5534A						.						48.0	49.0	49.0					19																	13338336		1877	4112	5989	SO:0001583	missense	773	exon37			GGCATGCGGCCCC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5534G>A	19.37:g.13338336C>T	ENSP00000353362:p.Arg1845His	Somatic	91	1		WXS	Illumina HiSeq	Phase_I	56	3	NM_001127222	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	c	24.9	4.580140	0.86645	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018	D	0.96459	-4.02	4.55	4.55	0.56014	.	0.000000	0.64402	D	0.000001	D	0.98264	0.9425	M	0.88640	2.97	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.99581	1.0973	10	0.87932	D	0	.	16.0868	0.81060	0.0:1.0:0.0:0.0	.	1845	Q9NS88	.	H	1845;1851;1846	ENSP00000353362:R1845H	ENSP00000349520:R1846H	R	-	2	0	CACNA1A	13199336	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.764000	0.85297	2.079000	0.62486	0.298000	0.19748	CGC	.		0.493	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
SUGP2	10147	broad.mit.edu	37	19	19141834	19141834	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:19141834T>G	ENST00000601879.1	-	2	344	c.47A>C	c.(46-48)cAa>cCa	p.Q16P	ARMC6_ENST00000269932.6_5'Flank|ARMC6_ENST00000392335.2_5'Flank|SUGP2_ENST00000598202.1_Intron|SUGP2_ENST00000600377.1_Missense_Mutation_p.Q30P|SUGP2_ENST00000452918.2_Missense_Mutation_p.Q16P|SUGP2_ENST00000456085.2_5'UTR|ARMC6_ENST00000546344.1_5'Flank|ARMC6_ENST00000535612.1_5'Flank|SUGP2_ENST00000337018.6_Missense_Mutation_p.Q16P			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	16					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GGCTTTTTCTTGTAATACAGC	0.393																																					p.Q16P													.	SUGP2-91	0			c.A47C						.						276.0	249.0	258.0					19																	19141834		2203	4300	6503	SO:0001583	missense	10147	exon2			TTTTCTTGTAATA	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.47A>C	19.37:g.19141834T>G	ENSP00000472286:p.Gln16Pro	Somatic	311	0		WXS	Illumina HiSeq	Phase_I	183	5	NM_014884	0	0	7	7	0	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	ENST00000601879.1	37	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.025814	0.75390	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918	T;T;T	0.15372	2.43;2.43;2.43	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000007	T	0.29158	0.0725	L	0.27053	0.805	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.78314	0.979;0.991	T	0.05370	-1.0889	10	0.87932	D	0	-17.7682	14.0226	0.64565	0.0:0.0:0.0:1.0	.	16;16	A8K5G0;Q8IX01	.;SUGP2_HUMAN	P	16	ENSP00000337926:Q16P;ENSP00000332373:Q16P;ENSP00000389380:Q16P	ENSP00000332373:Q16P	Q	-	2	0	SUGP2	19002834	1.000000	0.71417	0.919000	0.36401	0.970000	0.65996	4.512000	0.60469	1.987000	0.57996	0.528000	0.53228	CAA	.		0.393	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1	NM_001017392	
IRF2BP1	26145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	46387423	46387423	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:46387423G>A	ENST00000302165.3	-	1	1953	c.1610C>T	c.(1609-1611)gCg>gTg	p.A537V		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	537	Cys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		CGGGCCCTGCGCCTTGATGAA	0.677																																					p.A537V		.											.	IRF2BP1-90	0			c.C1610T						.						30.0	30.0	30.0					19																	46387423		2203	4299	6502	SO:0001583	missense	26145	exon1			CCCTGCGCCTTGA	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.1610C>T	19.37:g.46387423G>A	ENSP00000307265:p.Ala537Val	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	67	7	NM_015649	0	0	1	1	0	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Missense_Mutation	SNP	ENST00000302165.3	37	CCDS12678.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.574987	0.65878	.	.	ENSG00000170604	ENST00000302165	D	0.86230	-2.09	4.58	4.58	0.56647	Zinc finger, C3HC4 RING-type (1);	0.382217	0.24182	N	0.040786	T	0.75961	0.3921	N	0.22421	0.69	0.30785	N	0.741587	P	0.43750	0.816	B	0.32533	0.147	T	0.77253	-0.2656	10	0.33940	T	0.23	.	14.914	0.70781	0.0:0.0:1.0:0.0	.	537	Q8IU81	I2BP1_HUMAN	V	537	ENSP00000307265:A537V	ENSP00000307265:A537V	A	-	2	0	IRF2BP1	51079263	0.964000	0.33143	0.999000	0.59377	0.968000	0.65278	2.896000	0.48656	2.362000	0.80069	0.563000	0.77884	GCG	.		0.677	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461683.1	NM_015649	
SLC6A16	28968	broad.mit.edu	37	19	49793532	49793532	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:49793532G>T	ENST00000335875.4	-	12	2300	c.2059C>A	c.(2059-2061)Ccc>Acc	p.P687T	SLC6A16_ENST00000454748.3_3'UTR	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	687					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		GGCCTGAAGGGAATCCTATGT	0.512																																					p.P687T													.	SLC6A16-94	0			c.C2059A						.						134.0	131.0	132.0					19																	49793532		1973	4140	6113	SO:0001583	missense	28968	exon12			TGAAGGGAATCCT	AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.2059C>A	19.37:g.49793532G>T	ENSP00000338627:p.Pro687Thr	Somatic	249	1		WXS	Illumina HiSeq	Phase_I	241	7	NM_014037	0	0	8	8	0	Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	ENST00000335875.4	37	CCDS42590.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225175	0.39300	.	.	ENSG00000063127	ENST00000335875	T	0.73575	-0.76	4.48	-6.15	0.02105	.	4.217680	0.00807	N	0.001479	T	0.43986	0.1272	N	0.14661	0.345	0.20196	N	0.999923	P	0.38148	0.62	B	0.29176	0.099	T	0.48456	-0.9034	10	0.14656	T	0.56	.	0.1872	0.00130	0.2591:0.257:0.223:0.2609	.	687	Q9GZN6	S6A16_HUMAN	T	687	ENSP00000338627:P687T	ENSP00000338627:P687T	P	-	1	0	SLC6A16	54485344	0.000000	0.05858	0.001000	0.08648	0.190000	0.23558	0.031000	0.13710	-0.642000	0.05480	0.543000	0.68304	CCC	.		0.512	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465503.2	NM_014037	
FAM71E1	112703	hgsc.bcm.edu;broad.mit.edu	37	19	50970929	50970929	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:50970929G>A	ENST00000600100.1	-	4	1061	c.697C>T	c.(697-699)Cgc>Tgc	p.R233C	FAM71E1_ENST00000595790.1_Missense_Mutation_p.R217C			Q6IPT2	F71E1_HUMAN	family with sequence similarity 71, member E1	233										breast(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		AAGCGCAGGCGGTAGAGCAGC	0.612																																					p.R217C		.											.	FAM71E1-44	0			c.C649T						.						26.0	27.0	26.0					19																	50970929		2195	4290	6485	SO:0001583	missense	112703	exon4			GCAGGCGGTAGAG		CCDS33081.1	19q13.33	2007-11-20				ENSG00000142530			25107	protein-coding gene	gene with protein product							Standard	XM_005258472		Approved		uc002psg.3	Q6IPT2		ENST00000600100.1:c.697C>T	19.37:g.50970929G>A	ENSP00000472421:p.Arg233Cys	Somatic	14	0		WXS	Illumina HiSeq	Phase_I	11	4	NM_138411	0	0	1	2	1	Q96EJ5|Q9BSM9	Missense_Mutation	SNP	ENST00000600100.1	37		.	.	.	.	.	.	.	.	.	.	g	15.85	2.955383	0.53293	.	.	ENSG00000142530	ENST00000391816;ENST00000270620	T;T	0.17854	2.25;2.25	4.0	0.356	0.16074	.	0.791977	0.10938	N	0.617646	T	0.29914	0.0748	L	0.51422	1.61	0.42510	D	0.992969	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.95	T	0.19877	-1.0292	10	0.66056	D	0.02	-6.3609	5.8158	0.18492	0.096:0.0:0.5658:0.3382	.	233;217	Q6IPT2;Q6IPT2-2	F71E1_HUMAN;.	C	233;217	ENSP00000375692:R233C;ENSP00000270620:R217C	ENSP00000270620:R217C	R	-	1	0	FAM71E1	55662741	1.000000	0.71417	0.998000	0.56505	0.724000	0.41520	2.576000	0.46033	0.057000	0.16193	0.462000	0.41574	CGC	.		0.612	FAM71E1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464754.2		
ZFP28	140612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57066282	57066282	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:57066282T>C	ENST00000301318.3	+	8	2199	c.2128T>C	c.(2128-2130)Ttt>Ctt	p.F710L	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	710					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		TGGGAAGGCCTTTGGTGATAA	0.443																																					p.F710L	Ovarian(124;554 1662 19430 21141 52494)	.											.	ZFP28-91	0			c.T2128C						.						105.0	105.0	105.0					19																	57066282		2203	4300	6503	SO:0001583	missense	140612	exon8			AAGGCCTTTGGTG		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.2128T>C	19.37:g.57066282T>C	ENSP00000301318:p.Phe710Leu	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	128	45	NM_020828	0	0	0	0	0	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	37	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.714627	0.68730	.	.	ENSG00000196867	ENST00000301318	T	0.46063	0.88	4.0	2.98	0.34508	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47093	D	0.000249	T	0.64659	0.2618	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66488	-0.5911	10	0.87932	D	0	.	8.4668	0.32960	0.0:0.0964:0.0:0.9036	.	710	Q8NHY6	ZFP28_HUMAN	L	710	ENSP00000301318:F710L	ENSP00000301318:F710L	F	+	1	0	ZFP28	61758094	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.655000	0.67981	0.710000	0.31997	0.454000	0.30748	TTT	.		0.443	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
ZFP28	140612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57066298	57066298	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr19:57066298C>A	ENST00000301318.3	+	8	2215	c.2144C>A	c.(2143-2145)tCc>tAc	p.S715Y	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	715					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GATAACTCATCCTGTACTCAA	0.433																																					p.S715Y	Ovarian(124;554 1662 19430 21141 52494)	.											.	ZFP28-91	0			c.C2144A						.						108.0	108.0	108.0					19																	57066298		2203	4300	6503	SO:0001583	missense	140612	exon8			ACTCATCCTGTAC		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.2144C>A	19.37:g.57066298C>A	ENSP00000301318:p.Ser715Tyr	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	130	45	NM_020828	0	0	0	0	0	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	37	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	C	0.336	-0.953021	0.02285	.	.	ENSG00000196867	ENST00000301318	T	0.36878	1.23	4.0	2.86	0.33363	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44902	D	0.000413	T	0.22742	0.0549	L	0.35723	1.085	0.20074	N	0.999935	P	0.39181	0.663	B	0.37346	0.247	T	0.07481	-1.0770	10	0.17832	T	0.49	.	7.0155	0.24885	0.0:0.7197:0.1785:0.1018	.	715	Q8NHY6	ZFP28_HUMAN	Y	715	ENSP00000301318:S715Y	ENSP00000301318:S715Y	S	+	2	0	ZFP28	61758110	0.001000	0.12720	0.992000	0.48379	0.984000	0.73092	1.178000	0.31981	2.228000	0.72767	0.555000	0.69702	TCC	.		0.433	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
ASAP2	8853	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	9533671	9533671	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:9533671T>C	ENST00000281419.3	+	24	2919	c.2579T>C	c.(2578-2580)tTg>tCg	p.L860S	ASAP2_ENST00000315273.4_Missense_Mutation_p.L815S|ASAP2_ENST00000491413.1_3'UTR	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	860	Pro-rich.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						ATGGAAGCCTTGAGCCAGCCG	0.701																																					p.L860S		.											.	ASAP2-90	0			c.T2579C						.						13.0	15.0	14.0					2																	9533671		2199	4294	6493	SO:0001583	missense	8853	exon24			AAGCCTTGAGCCA	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2579T>C	2.37:g.9533671T>C	ENSP00000281419:p.Leu860Ser	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	19	6	NM_003887	0	0	8	8	0	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.260257	0.23051	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.58506	0.42;0.33	5.36	5.36	0.76844	Src homology-3 domain (1);	4.673060	0.00166	N	0.000005	T	0.67702	0.2921	N	0.19112	0.55	0.35637	D	0.81066	D;B	0.69078	0.997;0.011	D;B	0.75484	0.986;0.01	T	0.56956	-0.7893	10	0.18710	T	0.47	.	15.3426	0.74309	0.0:0.0:0.0:1.0	.	815;860	O43150-2;O43150	.;ASAP2_HUMAN	S	860;815	ENSP00000281419:L860S;ENSP00000316404:L815S	ENSP00000281419:L860S	L	+	2	0	ASAP2	9451122	1.000000	0.71417	0.799000	0.32177	0.419000	0.31324	4.442000	0.59988	2.034000	0.60081	0.379000	0.24179	TTG	.		0.701	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
NRBP1	29959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27664588	27664588	+	Missense_Mutation	SNP	G	G	A	rs141700147	byFrequency	TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:27664588G>A	ENST00000233557.3	+	19	2349	c.1517G>A	c.(1516-1518)cGg>cAg	p.R506Q	KRTCAP3_ENST00000288873.3_5'Flank|NRBP1_ENST00000379863.3_Missense_Mutation_p.R514Q|NRBP1_ENST00000379852.3_Missense_Mutation_p.R506Q|KRTCAP3_ENST00000407293.1_5'Flank|KRTCAP3_ENST00000543753.1_5'Flank			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	506					ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)	p.R506Q(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					GACCAGAGCCGGTTGACTTCT	0.547													G|||	6	0.00119808	0.0045	0.0	5008	,	,		18142	0.0		0.0	False		,,,				2504	0.0				p.R506Q		.											.	NRBP1-334	1	Substitution - Missense(1)	large_intestine(1)	c.G1517A						.	G	GLN/ARG	4,4402	9.9+/-24.2	0,4,2199	179.0	183.0	182.0		1517	5.7	1.0	2	dbSNP_134	182	1,8599	1.2+/-3.3	0,1,4299	yes	missense	NRBP1	NM_013392.2	43	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	possibly-damaging	506/536	27664588	5,13001	2203	4300	6503	SO:0001583	missense	29959	exon18			AGAGCCGGTTGAC	AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.1517G>A	2.37:g.27664588G>A	ENSP00000233557:p.Arg506Gln	Somatic	314	1		WXS	Illumina HiSeq	Phase_I	334	127	NM_013392	0	0	27	62	35	B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	ENST00000233557.3	37	CCDS1753.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.944186	0.73672	9.08E-4	1.16E-4	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863	T;T;T	0.14022	2.84;2.84;2.54	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.14399	0.0348	L	0.43152	1.355	0.58432	D	0.999999	B;B;B	0.32302	0.363;0.239;0.154	B;B;B	0.24701	0.022;0.055;0.025	T	0.02093	-1.1215	10	0.45353	T	0.12	-8.6676	18.2912	0.90131	0.0:0.0:1.0:0.0	.	486;514;506	B4DW31;F8W6G1;Q9UHY1	.;.;NRBP_HUMAN	Q	506;486;506;514	ENSP00000233557:R506Q;ENSP00000369181:R506Q;ENSP00000369192:R514Q	ENSP00000233557:R506Q	R	+	2	0	NRBP1	27518092	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	6.787000	0.75099	2.662000	0.90505	0.561000	0.74099	CGG	G|1.000;A|0.000		0.547	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1	NM_013392	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu	37	2	32693046	32693046	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:32693046T>C	ENST00000421745.2	+	28	5781	c.5647T>C	c.(5647-5649)Tac>Cac	p.Y1883H		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1883					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TGGTCATACCTACATCTTGCC	0.388																																					p.Y1883H	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6-233	0			c.T5647C						.						66.0	68.0	68.0					2																	32693046		2203	4300	6503	SO:0001583	missense	57448	exon28			CATACCTACATCT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5647T>C	2.37:g.32693046T>C	ENSP00000393596:p.Tyr1883His	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	34	3	NM_016252	0	0	10	10	0	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	T	24.2	4.501275	0.85176	.	.	ENSG00000115760	ENST00000421745	T	0.74421	-0.84	5.9	5.9	0.94986	.	0.147925	0.47852	D	0.000217	T	0.82208	0.4987	L	0.44542	1.39	0.54753	D	0.999989	D	0.71674	0.998	D	0.78314	0.991	D	0.83740	0.0203	10	0.72032	D	0.01	.	16.378	0.83412	0.0:0.0:0.0:1.0	.	1883	Q9NR09	BIRC6_HUMAN	H	1883	ENSP00000393596:Y1883H	ENSP00000393596:Y1883H	Y	+	1	0	BIRC6	32546550	1.000000	0.71417	0.990000	0.47175	0.982000	0.71751	7.846000	0.86887	2.277000	0.76020	0.529000	0.55759	TAC	.		0.388	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
SLC8A1	6546	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	40656328	40656328	+	Missense_Mutation	SNP	G	G	T	rs370199920		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:40656328G>T	ENST00000403092.1	-	2	1126	c.1093C>A	c.(1093-1095)Cgc>Agc	p.R365S	SLC8A1_ENST00000406391.2_Missense_Mutation_p.R365S|SLC8A1_ENST00000542756.1_Missense_Mutation_p.R365S|SLC8A1_ENST00000332839.4_Missense_Mutation_p.R365S|SLC8A1_ENST00000408028.2_Missense_Mutation_p.R365S|SLC8A1_ENST00000405269.1_Missense_Mutation_p.R365S|SLC8A1_ENST00000405901.3_Missense_Mutation_p.R365S|SLC8A1_ENST00000402441.1_Missense_Mutation_p.R365S|SLC8A1_ENST00000542024.1_Missense_Mutation_p.R365S|SLC8A1_ENST00000406785.2_Missense_Mutation_p.R365S			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	365					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GCTTGAATGCGATAAAATGCT	0.433																																					p.R365S		.											.	SLC8A1-93	0			c.C1093A						.						165.0	157.0	160.0					2																	40656328		2203	4300	6503	SO:0001583	missense	6546	exon1			GAATGCGATAAAA		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1093C>A	2.37:g.40656328G>T	ENSP00000384763:p.Arg365Ser	Somatic	236	0		WXS	Illumina HiSeq	Phase_I	267	14	NM_001252624	0	0	1	1	0	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509948	0.64522	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.53857	0.65;0.68;0.67;0.68;0.65;0.65;0.67;0.6;0.65;0.64	6.17	5.29	0.74685	Heat shock protein DnaJ, N-terminal (1);	0.049164	0.85682	D	0.000000	T	0.78233	0.4251	M	0.91663	3.23	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.996;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.995;1.0;0.996;1.0	D	0.83814	0.0243	10	0.87932	D	0	.	14.9877	0.71362	0.0:0.0:0.857:0.143	.	365;365;365;365;365	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	S	365	ENSP00000383886:R365S;ENSP00000440727:R365S;ENSP00000384763:R365S;ENSP00000385678:R365S;ENSP00000385188:R365S;ENSP00000385535:R365S;ENSP00000332931:R365S;ENSP00000384908:R365S;ENSP00000385811:R365S;ENSP00000443515:R365S	ENSP00000332931:R365S	R	-	1	0	SLC8A1	40509832	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	7.812000	0.86109	1.600000	0.50102	0.655000	0.94253	CGC	.		0.433	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
MSH6	2956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	48027125	48027125	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:48027125C>G	ENST00000234420.5	+	4	2155	c.2003C>G	c.(2002-2004)tCc>tGc	p.S668C	FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Missense_Mutation_p.S538C|MSH6_ENST00000538136.1_Missense_Mutation_p.S366C	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	668					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAGTCTGATTCCATTGGGTTG	0.433			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.S668C		.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6-3014	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.C2003G						.						152.0	146.0	148.0					2																	48027125		2203	4300	6503	SO:0001583	missense	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CTGATTCCATTGG	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.2003C>G	2.37:g.48027125C>G	ENSP00000234420:p.Ser668Cys	Somatic	274	0		WXS	Illumina HiSeq	Phase_I	282	107	NM_000179	0	0	5	13	8	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735857	0.49045	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.88664	-2.04;-2.12;-2.41	4.8	3.92	0.45320	DNA mismatch repair protein MutS, connector (1);	0.361706	0.32518	N	0.005990	D	0.93112	0.7807	M	0.76574	2.34	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.976	D;D;P	0.67231	0.95;0.95;0.738	D	0.93502	0.6845	10	0.72032	D	0.01	-2.7325	12.8528	0.57867	0.0:0.9212:0.0:0.0788	.	538;668;668	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	C	668;666;538;366	ENSP00000234420:S668C;ENSP00000446475:S538C;ENSP00000438580:S366C	ENSP00000234420:S668C	S	+	2	0	MSH6	47880629	1.000000	0.71417	0.996000	0.52242	0.942000	0.58702	5.875000	0.69660	1.243000	0.43853	0.460000	0.39030	TCC	.		0.433	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
CCDC88A	55704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55566741	55566741	+	Silent	SNP	T	T	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:55566741T>G	ENST00000436346.1	-	13	2218	c.1377A>C	c.(1375-1377)tcA>tcC	p.S459S	CCDC88A_ENST00000336838.6_Silent_p.S459S|AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000608103.1_RNA|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000594078.1_RNA|CCDC88A_ENST00000263630.8_Silent_p.S459S|AC012358.8_ENST00000599475.1_RNA|CCDC88A_ENST00000413716.2_Silent_p.S459S	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	459					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						ATAATCTACTTGATGTCAACT	0.363																																					p.S459S		.											.	CCDC88A-94	0			c.A1377C						.						92.0	91.0	92.0					2																	55566741		2203	4300	6503	SO:0001819	synonymous_variant	55704	exon13			TCTACTTGATGTC	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.1377A>C	2.37:g.55566741T>G		Somatic	105	1		WXS	Illumina HiSeq	Phase_I	95	29	NM_018084	0	0	2	3	1	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Silent	SNP	ENST00000436346.1	37																																																																																				.		0.363	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
TCF7L1	83439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	85536242	85536242	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:85536242T>C	ENST00000282111.3	+	12	1699	c.1424T>C	c.(1423-1425)aTg>aCg	p.M475T		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	475					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CACGGGAGCATGCTGGACTCC	0.652																																					p.M475T		.											.	TCF7L1-585	0			c.T1424C						.						93.0	102.0	99.0					2																	85536242		2203	4300	6503	SO:0001583	missense	83439	exon12			GGAGCATGCTGGA	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.1424T>C	2.37:g.85536242T>C	ENSP00000282111:p.Met475Thr	Somatic	307	1		WXS	Illumina HiSeq	Phase_I	264	89	NM_031283	0	0	1	1	0	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000282111.3	37	CCDS1971.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.097296	0.56075	.	.	ENSG00000152284	ENST00000282111	T	0.34072	1.38	5.11	0.36	0.16097	.	0.117117	0.85682	N	0.000000	T	0.37972	0.1023	L	0.54323	1.7	0.29754	N	0.836071	P	0.50156	0.932	P	0.58391	0.838	T	0.35301	-0.9794	10	0.13108	T	0.6	.	3.6615	0.08240	0.1572:0.2705:0.0:0.5722	.	475	Q9HCS4	TF7L1_HUMAN	T	475	ENSP00000282111:M475T	ENSP00000282111:M475T	M	+	2	0	TCF7L1	85389753	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.286000	0.43496	-0.075000	0.12798	0.448000	0.29417	ATG	.		0.652	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	
EIF5B	9669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	100015354	100015354	+	Silent	SNP	A	A	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:100015354A>C	ENST00000289371.6	+	23	3739	c.3537A>C	c.(3535-3537)acA>acC	p.T1179T		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	1179					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTGAAGCTACAGATATTCTTG	0.398																																					p.T1179T	Colon(162;2388 2567 2705 3444)	.											.	EIF5B-93	0			c.A3537C						.						70.0	64.0	66.0					2																	100015354		1859	4090	5949	SO:0001819	synonymous_variant	9669	exon23			AGCTACAGATATT	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.3537A>C	2.37:g.100015354A>C		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	86	33	NM_015904	0	0	63	109	46	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Silent	SNP	ENST00000289371.6	37	CCDS42721.1																																																																																			.		0.398	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904	
CXCR4	7852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	136873381	136873381	+	Silent	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:136873381G>T	ENST00000241393.3	-	2	221	c.117C>A	c.(115-117)atC>atA	p.I39I	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Silent_p.I43I	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	39					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TGGGCAGGAAGATTTTATTGA	0.438																																					p.I43I		.											.	CXCR4-1082	0			c.C129A						.						128.0	129.0	128.0					2																	136873381		2203	4300	6503	SO:0001819	synonymous_variant	7852	exon1			CAGGAAGATTTTA	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.117C>A	2.37:g.136873381G>T		Somatic	145	1		WXS	Illumina HiSeq	Phase_I	163	61	NM_001008540	0	0	14	15	1	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Silent	SNP	ENST00000241393.3	37	CCDS46420.1																																																																																			.		0.438	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
TTN	7273	hgsc.bcm.edu;broad.mit.edu	37	2	179585887	179585887	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:179585887G>A	ENST00000591111.1	-	77	22132	c.21908C>T	c.(21907-21909)gCa>gTa	p.A7303V	TTN_ENST00000589042.1_Missense_Mutation_p.A7620V|TTN_ENST00000342992.6_Missense_Mutation_p.A6376V|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12867	Ig-like 55.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCCTGCTTTGCAACTTTTGA	0.358																																					p.A7620V		.											.	TTN-636	0			c.C22859T						.						60.0	55.0	57.0					2																	179585887		1801	4069	5870	SO:0001583	missense	7273	exon79			TGCTTTGCAACTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.21908C>T	2.37:g.179585887G>A	ENSP00000465570:p.Ala7303Val	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	58	6	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	11.67	1.706674	0.30232	.	.	ENSG00000155657	ENST00000342992	T	0.62788	-0.0	6.16	4.29	0.51040	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.26448	0.0646	N	0.00611	-1.325	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31943	-0.9925	9	0.87932	D	0	.	3.744	0.08541	0.2145:0.2654:0.5201:0.0	.	7303	Q8WZ42	TITIN_HUMAN	V	6376	ENSP00000343764:A6376V	ENSP00000343764:A6376V	A	-	2	0	TTN	179294132	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.296000	0.51802	2.937000	0.99478	0.650000	0.86243	GCA	.		0.358	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DNAH7	56171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	196749321	196749321	+	Silent	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:196749321T>C	ENST00000312428.6	-	35	5851	c.5751A>G	c.(5749-5751)caA>caG	p.Q1917Q		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1917					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CAGTGACAAATTGATAATCAT	0.433																																					p.Q1917Q		.											.	DNAH7-102	0			c.A5751G						.						77.0	75.0	76.0					2																	196749321		1911	4123	6034	SO:0001819	synonymous_variant	56171	exon35			GACAAATTGATAA	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5751A>G	2.37:g.196749321T>C		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	106	33	NM_018897	0	0	0	0	0	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	CCDS42794.1																																																																																			.		0.433	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
GTF3C3	9330	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	197636546	197636546	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:197636546T>G	ENST00000263956.3	-	15	2275	c.2186A>C	c.(2185-2187)aAc>aCc	p.N729T		NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	729					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						ATTTTCTGGGTTTTTCAGCAT	0.423																																					p.N729T													.	GTF3C3-97	0			c.A2186C						.						172.0	154.0	160.0					2																	197636546		2203	4300	6503	SO:0001583	missense	9330	exon15			TCTGGGTTTTTCA	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.2186A>C	2.37:g.197636546T>G	ENSP00000263956:p.Asn729Thr	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	114	5	NM_012086	0	0	25	32	7	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	T	14.18	2.458810	0.43634	.	.	ENSG00000119041	ENST00000263956	T	0.46063	0.88	5.21	5.21	0.72293	Tetratricopeptide-like helical (1);	0.144557	0.64402	D	0.000010	T	0.31482	0.0798	L	0.29908	0.895	0.80722	D	1	B	0.27068	0.167	B	0.22880	0.042	T	0.07809	-1.0753	10	0.23891	T	0.37	-14.7458	15.2501	0.73539	0.0:0.0:0.0:1.0	.	729	Q9Y5Q9	TF3C3_HUMAN	T	729	ENSP00000263956:N729T	ENSP00000263956:N729T	N	-	2	0	GTF3C3	197344791	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.868000	0.87116	2.180000	0.69256	0.528000	0.53228	AAC	.		0.423	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
ERBB4	2066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	212426810	212426810	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:212426810C>A	ENST00000342788.4	-	20	2615	c.2305G>T	c.(2305-2307)Gct>Tct	p.A769S	ERBB4_ENST00000402597.1_Missense_Mutation_p.A759S|ERBB4_ENST00000436443.1_Missense_Mutation_p.A769S	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	769	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	ATGATCAGAGCTTCCTGTAAG	0.403										TSP Lung(8;0.080)																											p.A769S		.											.	ERBB4-1461	0			c.G2305T						.						81.0	75.0	77.0					2																	212426810		2203	4300	6503	SO:0001583	missense	2066	exon20			TCAGAGCTTCCTG	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2305G>T	2.37:g.212426810C>A	ENSP00000342235:p.Ala769Ser	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	107	42	NM_001042599	0	0	0	0	0	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	32	5.153661	0.94645	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.64085	-0.08;-0.08;-0.08	5.36	5.36	0.76844	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81847	0.4909	M	0.82517	2.595	0.80722	D	1	D;P;D;D	0.76494	0.999;0.738;0.999;0.999	D;D;D;D	0.91635	0.999;0.911;0.998;0.999	D	0.83933	0.0307	10	0.72032	D	0.01	.	19.4633	0.94927	0.0:1.0:0.0:0.0	.	759;759;769;769	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	S	769;769;759	ENSP00000342235:A769S;ENSP00000403204:A769S;ENSP00000385565:A759S	ENSP00000342235:A769S	A	-	1	0	ERBB4	212135055	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.776000	0.85560	2.666000	0.90696	0.655000	0.94253	GCT	.		0.403	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
NCOA6	23054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	33329544	33329544	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr20:33329544T>C	ENST00000374796.2	-	12	7086	c.4516A>G	c.(4516-4518)Aaa>Gaa	p.K1506E	NCOA6_ENST00000359003.2_Missense_Mutation_p.K1506E			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1506					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						CCAGGGGGTTTAATTGTCACA	0.463																																					p.K1506E		.											.	NCOA6-292	0			c.A4516G						.						78.0	70.0	73.0					20																	33329544		2203	4300	6503	SO:0001583	missense	23054	exon11			GGGGTTTAATTGT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4516A>G	20.37:g.33329544T>C	ENSP00000363929:p.Lys1506Glu	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	107	43	NM_014071	0	0	2	10	8	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	37	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.203458	0.58234	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.34859	1.34;1.34	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000002	T	0.38852	0.1056	L	0.27053	0.805	0.39212	D	0.963341	D	0.60575	0.988	P	0.54759	0.76	T	0.16482	-1.0401	10	0.25106	T	0.35	-8.9946	15.5409	0.76048	0.0:0.0:0.0:1.0	.	1506	Q14686	NCOA6_HUMAN	E	1506	ENSP00000363929:K1506E;ENSP00000351894:K1506E	ENSP00000351894:K1506E	K	-	1	0	NCOA6	32793205	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.330000	0.65899	2.254000	0.74563	0.482000	0.46254	AAA	.		0.463	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
RIMS4	140730	hgsc.bcm.edu	37	20	43379383	43379383	+	IGR	SNP	C	C	G	rs199821276	byFrequency	TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr20:43379383C>G	ENST00000372851.3	-	0	5203				KCNK15_ENST00000372861.3_Missense_Mutation_p.C299W	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				TGGAGAGGTGCGCCCGCGACA	0.741													C|||	12	0.00239617	0.0	0.0029	5008	,	,		10240	0.0		0.0089	False		,,,				2504	0.001				p.C299W		.											.	KCNK15-90	0			c.C897G						.	C	TRP/CYS	2,3470		0,2,1734	4.0	3.0	3.0		897	-4.4	0.0	20		3	6,6426		0,6,3210	yes	missense	KCNK15	NM_022358.3	215	0,8,4944	GG,GC,CC		0.0933,0.0576,0.0808	benign	299/331	43379383	8,9896	1736	3216	4952	SO:0001628	intergenic_variant	60598	exon2			GAGGTGCGCCCGC		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546		20.37:g.43379383C>G		Somatic	2	1		WXS	Illumina HiSeq	Phase_I	2	2	NM_022358	0	0	3	11	8	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	37	CCDS13338.1	.	.	.	.	.	.	.	.	.	.	C	9.082	0.999523	0.19121	5.76E-4	9.33E-4	ENSG00000124249	ENST00000372861	T	0.12255	2.7	4.16	-4.41	0.03590	.	647.572000	0.00589	U	0.000342	T	0.09113	0.0225	N	0.12182	0.205	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.41980	-0.9478	10	0.56958	D	0.05	.	11.1373	0.48381	0.0:0.6098:0.1794:0.2108	.	299	Q9H427	KCNKF_HUMAN	W	299	ENSP00000361952:C299W	ENSP00000361952:C299W	C	+	3	2	KCNK15	42812797	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	0.239000	0.18023	-0.430000	0.07318	0.563000	0.77884	TGC	.		0.741	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	
SLC5A3	6526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	35468362	35468362	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr21:35468362G>A	ENST00000381151.3	+	2	1377	c.865G>A	c.(865-867)Gcc>Acc	p.A289T	SLC5A3_ENST00000608209.1_Missense_Mutation_p.A289T|AP000320.7_ENST00000362077.4_RNA|MRPS6_ENST00000399312.2_Intron			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	289					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						GGTCCTTGCAGCCAAAAACAT	0.478																																					p.A289T		.											.	SLC5A3-92	0			c.G865A						.						102.0	98.0	100.0					21																	35468362		2203	4300	6503	SO:0001583	missense	6526	exon2			CTTGCAGCCAAAA		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.865G>A	21.37:g.35468362G>A	ENSP00000370543:p.Ala289Thr	Somatic	217	0		WXS	Illumina HiSeq	Phase_I	190	80	NM_006933	0	0	2	2	0	O43489	Missense_Mutation	SNP	ENST00000381151.3	37	CCDS33549.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936080	0.73442	.	.	ENSG00000198743	ENST00000381151	D	0.88975	-2.45	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.96482	0.8852	H	0.96365	3.81	0.58432	D	0.999999	D	0.89917	1.0	D	0.79108	0.992	D	0.97583	1.0112	10	0.87932	D	0	.	18.2056	0.89853	0.0:0.0:1.0:0.0	.	289	P53794	SC5A3_HUMAN	T	289	ENSP00000370543:A289T	ENSP00000370543:A289T	A	+	1	0	SLC5A3	34390232	1.000000	0.71417	0.922000	0.36590	0.963000	0.63663	9.869000	0.99810	2.589000	0.87451	0.609000	0.83330	GCC	.		0.478	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000141037.1		
ZBTB21	49854	broad.mit.edu	37	21	43412280	43412280	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr21:43412280C>T	ENST00000310826.5	-	3	2108	c.1925G>A	c.(1924-1926)gGc>gAc	p.G642D	ZBTB21_ENST00000398499.1_Missense_Mutation_p.G642D|ZBTB21_ENST00000398505.3_Intron|ZBTB21_ENST00000465968.1_Intron|ZBTB21_ENST00000398511.3_Missense_Mutation_p.G642D	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	642					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										ACCAGGCTTGCCGCGCCTTAA	0.438																																					p.G642D													.	.	0			c.G1925A						.						65.0	63.0	64.0					21																	43412280		2203	4300	6503	SO:0001583	missense	49854	exon3			GGCTTGCCGCGCC	AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.1925G>A	21.37:g.43412280C>T	ENSP00000308759:p.Gly642Asp	Somatic	126	0		WXS	Illumina HiSeq	Phase_I	137	4	NM_001098402	0	0	5	5	0	Q5R2W1|Q5R2W2|Q6P4R0	Missense_Mutation	SNP	ENST00000310826.5	37	CCDS13678.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130570	0.37630	.	.	ENSG00000173276	ENST00000310826;ENST00000398499;ENST00000398511	T;T;T	0.08008	3.14;3.14;3.14	5.44	3.52	0.40303	.	0.508219	0.20986	N	0.082125	T	0.06280	0.0162	N	0.14661	0.345	0.26287	N	0.978185	B	0.31383	0.321	B	0.29267	0.1	T	0.20773	-1.0265	10	0.48119	T	0.1	-2.4439	15.4343	0.75133	0.0:0.7363:0.2636:0.0	.	642	Q9ULJ3	ZN295_HUMAN	D	642	ENSP00000308759:G642D;ENSP00000381512:G642D;ENSP00000381523:G642D	ENSP00000308759:G642D	G	-	2	0	ZNF295	42285349	1.000000	0.71417	0.943000	0.38184	0.996000	0.88848	1.579000	0.36536	0.591000	0.29711	0.591000	0.81541	GGC	.		0.438	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727	
POTEH	23784	hgsc.bcm.edu;bcgsc.ca	37	22	16287580	16287580	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr22:16287580G>T	ENST00000343518.6	-	1	357	c.306C>A	c.(304-306)tgC>tgA	p.C102*		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	102										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						AGCAGTGGCAGCACCACTTGC	0.597																																					p.C102X		.											.	POTEH-1	0			c.C306A						.						67.0	81.0	76.0					22																	16287580		1945	3669	5614	SO:0001587	stop_gained	23784	exon1			GTGGCAGCACCAC	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.306C>A	22.37:g.16287580G>T	ENSP00000340610:p.Cys102*	Somatic	1092	2		WXS	Illumina HiSeq	Phase_I	417	167	NM_001136213	0	0	0	0	0	A2CEK4|A6NCI1|A9Z1W0	Nonsense_Mutation	SNP	ENST00000343518.6	37	CCDS46658.1	.	.	.	.	.	.	.	.	.	.	.	13.12	2.143668	0.37825	.	.	ENSG00000198062	ENST00000343518;ENST00000355872	.	.	.	0.168	0.168	0.15012	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	102	.	ENSP00000340610:C102X	C	-	3	2	POTEH	14667580	0.005000	0.15991	0.025000	0.17156	0.026000	0.11368	0.263000	0.18478	0.278000	0.22164	0.283000	0.19423	TGC	.		0.597	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
CENPM	79019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	42342456	42342456	+	Silent	SNP	C	C	G	rs372178394		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr22:42342456C>G	ENST00000215980.5	-	2	189	c.102G>C	c.(100-102)tcG>tcC	p.S34S	CENPM_ENST00000402338.1_5'UTR|CENPM_ENST00000404067.1_5'UTR|CENPM_ENST00000402420.1_5'UTR|CENPM_ENST00000407253.3_Silent_p.S34S	NM_024053.3	NP_076958.1	Q9NSP4	CENPM_HUMAN	centromere protein M	34					mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|prostate(1)	3						CTTTGAGCATCGAGTCCGCCA	0.647											OREG0026600	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S34S		.											.	CENPM-90	0			c.G102C						.						36.0	31.0	33.0					22																	42342456		2203	4299	6502	SO:0001819	synonymous_variant	79019	exon2			GAGCATCGAGTCC	BC000705	CCDS14025.1, CCDS46719.1, CCDS46720.1	22q13.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000100162	ENSG00000100162			18352	protein-coding gene	gene with protein product		610152	"""chromosome 22 open reading frame 18"""	C22orf18		16622420, 16622419	Standard	NM_001110215		Approved	Pane1, CENP-M, MGC861	uc003bbn.3	Q9NSP4	OTTHUMG00000151277	ENST00000215980.5:c.102G>C	22.37:g.42342456C>G		Somatic	39	0	908	WXS	Illumina HiSeq	Phase_I	32	4	NM_024053	0	0	3	4	1	A7LM22|B1AHQ9|Q6I9W3	Silent	SNP	ENST00000215980.5	37	CCDS14025.1																																																																																			.		0.647	CENPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322058.1	NM_024053	
UBP1	7342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	33434887	33434887	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr3:33434887G>C	ENST00000283629.3	-	14	1979	c.1450C>G	c.(1450-1452)Ctg>Gtg	p.L484V	UBP1_ENST00000283628.5_Missense_Mutation_p.L484V|UBP1_ENST00000486388.1_5'UTR|UBP1_ENST00000447368.2_Missense_Mutation_p.L448V	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	484					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						TTAAACACCAGCGCAAGTTTT	0.348																																					p.L484V		.											.	UBP1-537	0			c.C1450G						.						80.0	80.0	80.0					3																	33434887		2203	4300	6503	SO:0001583	missense	7342	exon14			ACACCAGCGCAAG	AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.1450C>G	3.37:g.33434887G>C	ENSP00000283629:p.Leu484Val	Somatic	98	1		WXS	Illumina HiSeq	Phase_I	114	86	NM_014517	0	0	1	8	7	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638021	0.29157	.	.	ENSG00000153560	ENST00000283629;ENST00000447368;ENST00000283628	T;T;T	0.17054	2.31;2.3;2.31	5.89	-10.4	0.00318	.	0.543122	0.21143	N	0.079443	T	0.08670	0.0215	L	0.29908	0.895	0.09310	N	1	B;B	0.22683	0.073;0.002	B;B	0.27380	0.079;0.004	T	0.09058	-1.0692	10	0.30854	T	0.27	-0.7132	10.5024	0.44813	0.239:0.0:0.5623:0.1987	.	448;484	Q9NZI7-4;Q9NZI7	.;UBIP1_HUMAN	V	484;448;484	ENSP00000283629:L484V;ENSP00000395558:L448V;ENSP00000283628:L484V	ENSP00000283628:L484V	L	-	1	2	UBP1	33409891	0.000000	0.05858	0.002000	0.10522	0.981000	0.71138	-0.034000	0.12225	-2.077000	0.00874	-0.262000	0.10625	CTG	.		0.348	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517	
FBXO45	200933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	196304554	196304554	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr3:196304554A>T	ENST00000311630.6	+	2	846	c.549A>T	c.(547-549)caA>caT	p.Q183H	FBXO45_ENST00000440469.1_Missense_Mutation_p.Q4H	NM_001105573.1	NP_001099043.1	P0C2W1	FBSP1_HUMAN	F-box protein 45	183	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				anterior commissure morphogenesis (GO:0021960)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|corticospinal tract morphogenesis (GO:0021957)|neuron migration (GO:0001764)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|synapse assembly involved in innervation (GO:0060386)	cell junction (GO:0030054)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	7	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		TGCAGTGCCAAGGTTATGTGG	0.547																																					p.Q183H		.											.	FBXO45-614	0			c.A549T						.						48.0	49.0	49.0					3																	196304554		1953	4148	6101	SO:0001583	missense	200933	exon2			GTGCCAAGGTTAT	AK025697	CCDS46985.1	3q29	2008-02-05			ENSG00000174013	ENSG00000174013		"""F-boxes /  ""other"""""	29148	protein-coding gene	gene with protein product		609112					Standard	NM_001105573		Approved	Fbx45	uc010iai.3	P0C2W1	OTTHUMG00000155571	ENST00000311630.6:c.549A>T	3.37:g.196304554A>T	ENSP00000310332:p.Gln183His	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	27	23	NM_001105573	0	0	0	3	3	A6NF90|D3DXB5	Missense_Mutation	SNP	ENST00000311630.6	37	CCDS46985.1	.	.	.	.	.	.	.	.	.	.	A	9.264	1.043862	0.19748	.	.	ENSG00000174013	ENST00000440469;ENST00000311630	T;T	0.60171	0.21;0.21	4.95	2.42	0.29668	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.052694	0.85682	N	0.000000	T	0.25754	0.0627	N	0.01789	-0.72	0.54753	D	0.999983	B	0.11235	0.004	B	0.12156	0.007	T	0.02450	-1.1157	10	0.25106	T	0.35	-22.4406	6.7957	0.23725	0.6401:0.0:0.3599:0.0	.	183	P0C2W1	FBSP1_HUMAN	H	4;183	ENSP00000389868:Q4H;ENSP00000310332:Q183H	ENSP00000310332:Q183H	Q	+	3	2	FBXO45	197788951	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.363000	0.52321	0.403000	0.25479	0.374000	0.22700	CAA	.		0.547	FBXO45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340687.2		
YTHDC1	91746	hgsc.bcm.edu	37	4	69202908	69202908	+	Silent	SNP	C	C	T	rs548927284	byFrequency	TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr4:69202908C>T	ENST00000344157.4	-	4	1055	c.720G>A	c.(718-720)gaG>gaA	p.E240E	YTHDC1_ENST00000579690.1_Silent_p.E240E|YTHDC1_ENST00000355665.3_Silent_p.E240E	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	240	Glu-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						cctcctcctcctcttcctcct	0.478																																					p.E240E		.											.	YTHDC1-92	0			c.G720A						.						141.0	100.0	114.0					4																	69202908		2203	4300	6503	SO:0001819	synonymous_variant	91746	exon4			CTCCTCCTCTTCC	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.720G>A	4.37:g.69202908C>T		Somatic	28	0		WXS	Illumina HiSeq	Phase_I	34	3	NM_001031732	0	0	7	10	3	Q4W5Q3|Q7Z622|Q8TF35	Silent	SNP	ENST00000344157.4	37	CCDS33992.1																																																																																			.		0.478	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
YTHDC1	91746	hgsc.bcm.edu	37	4	69202911	69202911	+	Silent	SNP	T	T	C	rs568654350|rs548927284	byFrequency	TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr4:69202911T>C	ENST00000344157.4	-	4	1052	c.717A>G	c.(715-717)gaA>gaG	p.E239E	YTHDC1_ENST00000579690.1_Silent_p.E239E|YTHDC1_ENST00000355665.3_Silent_p.E239E	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	239	Glu-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						cctcctcctcttcctcctcct	0.473																																					p.E239E		.											.	YTHDC1-92	0			c.A717G						.						133.0	94.0	107.0					4																	69202911		2203	4300	6503	SO:0001819	synonymous_variant	91746	exon4			CTCCTCTTCCTCC	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.717A>G	4.37:g.69202911T>C		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	32	3	NM_001031732	0	0	6	10	4	Q4W5Q3|Q7Z622|Q8TF35	Silent	SNP	ENST00000344157.4	37	CCDS33992.1																																																																																			.		0.473	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
MFAP3L	9848	bcgsc.ca	37	4	170913237	170913237	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr4:170913237C>G	ENST00000361618.3	-	3	829	c.522G>C	c.(520-522)atG>atC	p.M174I	MFAP3L_ENST00000393704.3_Missense_Mutation_p.M71I|RP11-6E9.4_ENST00000508955.1_RNA	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		GGCTGCTCATCATGCACAGGC	0.517																																					p.M174I													.	MFAP3L-91	0			c.G522C						.						136.0	131.0	133.0					4																	170913237		2203	4300	6503	SO:0001583	missense	9848	exon3			GCTCATCATGCAC	AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.522G>C	4.37:g.170913237C>G	ENSP00000354583:p.Met174Ile	Somatic	119	1		WXS	Illumina HiSeq	Phase_1	96	4	NM_021647	0	0	26	26	0	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Missense_Mutation	SNP	ENST00000361618.3	37	CCDS34103.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.678269	0.88542	.	.	ENSG00000198948	ENST00000393704;ENST00000361618;ENST00000512698	D;D;D	0.98192	-4.78;-1.79;-4.71	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.98261	0.9424	M	0.61703	1.905	0.80722	D	1	P	0.51537	0.946	P	0.55161	0.77	D	0.98186	1.0460	10	0.39692	T	0.17	-2.1688	19.4847	0.95025	0.0:1.0:0.0:0.0	.	174	O75121	MFA3L_HUMAN	I	71;174;71	ENSP00000377307:M71I;ENSP00000354583:M174I;ENSP00000422791:M71I	ENSP00000354583:M174I	M	-	3	0	MFAP3L	171149812	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.602000	0.87976	0.555000	0.69702	ATG	.		0.517	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363043.2	NM_021647	
TRIO	7204	broad.mit.edu	37	5	14381318	14381318	+	Missense_Mutation	SNP	A	A	G	rs34701068		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:14381318A>G	ENST00000344204.4	+	21	3551	c.3527A>G	c.(3526-3528)cAg>cGg	p.Q1176R	TRIO_ENST00000509967.2_Missense_Mutation_p.Q1127R|TRIO_ENST00000537187.1_Missense_Mutation_p.Q1176R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1176					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CAGCACACCCAGGAGCTCCTG	0.493																																					p.Q1176R													.	TRIO-562	0			c.A3527G						.						78.0	77.0	77.0					5																	14381318		2203	4300	6503	SO:0001583	missense	7204	exon21			ACACCCAGGAGCT	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3527A>G	5.37:g.14381318A>G	ENSP00000339299:p.Gln1176Arg	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	119	6	NM_007118	0	0	9	9	0	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908445	0.52333	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.42513	0.97;0.97;0.97	5.28	5.28	0.74379	.	0.122258	0.56097	D	0.000026	T	0.44726	0.1307	L	0.38838	1.175	0.51482	D	0.999921	P;P;B	0.48640	0.913;0.73;0.006	P;B;B	0.50314	0.637;0.312;0.012	T	0.32745	-0.9895	10	0.40728	T	0.16	.	15.2206	0.73308	1.0:0.0:0.0:0.0	.	1127;1176;1176	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	R	1176;1176;1127;863	ENSP00000339299:Q1176R;ENSP00000446348:Q1176R;ENSP00000445592:Q1127R	ENSP00000339299:Q1176R	Q	+	2	0	TRIO	14434318	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.310000	0.96267	2.000000	0.58554	0.533000	0.62120	CAG	.		0.493	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
MYO10	4651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	16764479	16764479	+	Silent	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:16764479G>T	ENST00000513610.1	-	12	1660	c.1206C>A	c.(1204-1206)gcC>gcA	p.A402A		NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	402	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						ACAGAGCCATGGCCAGGGAGT	0.547																																					p.A402A		.											.	MYO10-3	0			c.C1206A						.						107.0	103.0	105.0					5																	16764479		2098	4241	6339	SO:0001819	synonymous_variant	4651	exon12			AGCCATGGCCAGG	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.1206C>A	5.37:g.16764479G>T		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	103	44	NM_012334	0	0	4	5	1	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	37	CCDS54834.1																																																																																			.		0.547	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
ADAMTS12	81792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	33561191	33561191	+	Missense_Mutation	SNP	G	G	C	rs183308563	byFrequency	TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:33561191G>C	ENST00000504830.1	-	20	4401	c.4066C>G	c.(4066-4068)Cct>Gct	p.P1356A	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.P1271A	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1356	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CTTTTTGCAGGGTCAGGTCTC	0.572										HNSCC(64;0.19)			G|||	2	0.000399361	0.0	0.0	5008	,	,		13628	0.002		0.0	False		,,,				2504	0.0				p.P1356A		.											.	ADAMTS12-232	0			c.C4066G						.						131.0	118.0	123.0					5																	33561191		2203	4300	6503	SO:0001583	missense	81792	exon20			TTGCAGGGTCAGG	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4066C>G	5.37:g.33561191G>C	ENSP00000422554:p.Pro1356Ala	Somatic	189	0		WXS	Illumina HiSeq	Phase_I	180	67	NM_030955	0	0	0	0	0	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	17.73	3.461381	0.63513	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.59638	0.25;0.25	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.66982	0.2845	L	0.31120	0.905	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75020	0.974;0.985	T	0.67397	-0.5681	10	0.46703	T	0.11	.	18.7866	0.91957	0.0:0.0:1.0:0.0	.	1271;1356	P58397-3;P58397	.;ATS12_HUMAN	A	1356;1271	ENSP00000422554:P1356A;ENSP00000344847:P1271A	ENSP00000344847:P1271A	P	-	1	0	ADAMTS12	33596948	1.000000	0.71417	0.998000	0.56505	0.557000	0.35523	6.077000	0.71275	2.528000	0.85240	0.650000	0.86243	CCT	G|0.999;C|0.001		0.572	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
PARP8	79668	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	50137860	50137860	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:50137860A>T	ENST00000281631.5	+	26	2681	c.2523A>T	c.(2521-2523)aaA>aaT	p.K841N	PARP8_ENST00000505554.1_Missense_Mutation_p.K820N|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000503750.2_Missense_Mutation_p.K799N|PARP8_ENST00000505697.2_Missense_Mutation_p.K841N|PARP8_ENST00000514067.2_Missense_Mutation_p.K799N	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	841	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				GCATTCACAAAGAGATCCTCC	0.358																																					p.K841N		.											.	PARP8-586	0			c.A2523T						.						86.0	82.0	83.0					5																	50137860		2203	4300	6503	SO:0001583	missense	79668	exon27			TCACAAAGAGATC	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.2523A>T	5.37:g.50137860A>T	ENSP00000281631:p.Lys841Asn	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	101	43	NM_001178055	0	0	9	18	9	Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	ENST00000281631.5	37	CCDS3954.1	.	.	.	.	.	.	.	.	.	.	A	15.51	2.855481	0.51376	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000281631;ENST00000514067;ENST00000505554	.	.	.	6.08	3.7	0.42460	Poly(ADP-ribose) polymerase, catalytic domain (1);	0.058378	0.64402	D	0.000002	T	0.41465	0.1160	L	0.44542	1.39	0.80722	D	1	P;B;B	0.37781	0.608;0.447;0.319	B;B;B	0.35114	0.193;0.196;0.096	T	0.12941	-1.0528	8	.	.	.	-15.5759	10.485	0.44717	0.8695:0.0:0.1305:0.0	.	733;799;841	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	N	841;799;841;799;820	.	.	K	+	3	2	PARP8	50173617	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.471000	0.45127	0.545000	0.28902	-0.256000	0.11100	AAA	.		0.358	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615	
VCAN	1462	broad.mit.edu	37	5	82835856	82835856	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:82835856C>A	ENST00000265077.3	+	8	7599	c.7034C>A	c.(7033-7035)aCg>aAg	p.T2345K	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.T1358K|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2345	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GAAGGACCCACGGTGGCACCT	0.468																																					p.T2345K													.	VCAN-238	0			c.C7034A						.						87.0	81.0	83.0					5																	82835856		2203	4300	6503	SO:0001583	missense	1462	exon8			GACCCACGGTGGC	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7034C>A	5.37:g.82835856C>A	ENSP00000265077:p.Thr2345Lys	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	104	3	NM_004385	0	0	2	2	0	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	C	7.177	0.588857	0.13812	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.15256	2.44;2.44	6.07	5.16	0.70880	.	0.394765	0.24534	N	0.037699	T	0.20414	0.0491	L	0.48642	1.525	0.09310	N	0.999993	D;D	0.62365	0.991;0.984	P;P	0.52672	0.706;0.607	T	0.14282	-1.0478	10	0.24483	T	0.36	.	5.2285	0.15408	0.1423:0.6391:0.1377:0.081	.	1358;2345	P13611-2;P13611	.;CSPG2_HUMAN	K	2345;1358	ENSP00000265077:T2345K;ENSP00000340062:T1358K	ENSP00000265077:T2345K	T	+	2	0	VCAN	82871612	0.027000	0.19231	0.016000	0.15963	0.113000	0.19764	1.141000	0.31528	1.471000	0.48121	0.650000	0.86243	ACG	.		0.468	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	89989974	89989974	+	Silent	SNP	A	A	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:89989974A>T	ENST00000405460.2	+	33	7497	c.7401A>T	c.(7399-7401)acA>acT	p.T2467T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2467	Calx-beta 17. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TCTGGATGACATCATGGATCA	0.488																																					p.T2467T		.											.	GPR98-103	0			c.A7401T						.						67.0	66.0	66.0					5																	89989974		1926	4127	6053	SO:0001819	synonymous_variant	84059	exon33			GATGACATCATGG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7401A>T	5.37:g.89989974A>T		Somatic	52	0		WXS	Illumina HiSeq	Phase_I	51	23	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	9.244	1.039019	0.19669	.	.	ENSG00000164199	ENST00000509621	.	.	.	5.92	-3.15	0.05233	.	.	.	.	.	T	0.36908	0.0984	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35968	-0.9767	4	.	.	.	.	1.1269	0.01736	0.4642:0.1847:0.1714:0.1797	.	.	.	.	L	33	.	.	H	+	2	0	GPR98	90025730	0.645000	0.27286	0.979000	0.43373	0.943000	0.58893	-0.090000	0.11163	-0.108000	0.12066	0.533000	0.62120	CAT	.		0.488	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
PCDHGC4	56098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140865325	140865325	+	Silent	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:140865325C>G	ENST00000306593.1	+	1	585	c.585C>G	c.(583-585)ctC>ctG	p.L195L	PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	195	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGAGCTGCTCCTGGAGAAGC	0.582																																					p.L195L		.											.	PCDHGC4-72	0			c.C585G						.						35.0	40.0	38.0					5																	140865325		2203	4300	6503	SO:0001819	synonymous_variant	56098	exon1			GCTGCTCCTGGAG	AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.585C>G	5.37:g.140865325C>G		Somatic	61	1		WXS	Illumina HiSeq	Phase_I	78	26	NM_018928	0	0	0	0	0	Q495T2|Q9Y5C3	Silent	SNP	ENST00000306593.1	37	CCDS4262.1																																																																																			.		0.582	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928	
RANBP9	10048	broad.mit.edu;bcgsc.ca	37	6	13622632	13622632	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr6:13622632A>G	ENST00000011619.3	-	14	2210	c.2152T>C	c.(2152-2154)Tcc>Ccc	p.S718P	RANBP9_ENST00000469916.1_5'UTR|AL441883.1_ENST00000600057.1_5'Flank|RANBP9_ENST00000539980.1_Missense_Mutation_p.S489P|NOL7_ENST00000474485.1_Intron	NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	718	Interaction with FMR1.				axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			AATGCGCAGGATCCAATTCCT	0.473																																					p.S718P													.	RANBP9-414	0			c.T2152C						.						126.0	104.0	111.0					6																	13622632		2203	4300	6503	SO:0001583	missense	10048	exon14			CGCAGGATCCAAT	AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.2152T>C	6.37:g.13622632A>G	ENSP00000011619:p.Ser718Pro	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	113	5	NM_005493	0	0	31	31	0	A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Missense_Mutation	SNP	ENST00000011619.3	37	CCDS4529.1	.	.	.	.	.	.	.	.	.	.	A	18.30	3.593002	0.66219	.	.	ENSG00000010017	ENST00000011619;ENST00000539980	T	0.79653	-1.29	6.17	4.99	0.66335	Ran binding protein, CRA domain (1);	0.047828	0.85682	D	0.000000	T	0.70527	0.3234	M	0.63843	1.955	0.80722	D	1	P	0.50710	0.938	B	0.43508	0.422	T	0.71241	-0.4651	10	0.37606	T	0.19	-7.4467	13.5284	0.61607	0.8699:0.1301:0.0:0.0	.	718	Q96S59	RANB9_HUMAN	P	718;489	ENSP00000011619:S718P	ENSP00000011619:S718P	S	-	1	0	RANBP9	13730611	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.101000	0.76997	1.119000	0.41883	0.533000	0.62120	TCC	.		0.473	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1		
PBX2	5089	ucsc.edu	37	6	32155509	32155509	+	Missense_Mutation	SNP	T	T	A	rs202223627		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr6:32155509T>A	ENST00000375050.4	-	5	1055	c.785A>T	c.(784-786)tAt>tTt	p.Y262F	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	262					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Y262F(3)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						GGAGTAGAAATACTCATTTAG	0.517																																					p.Y262F													.	PBX2-91	3	Substitution - Missense(3)	lung(3)	c.A785T						.																																			SO:0001583	missense	5089	exon5			TAGAAATACTCAT		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.785A>T	6.37:g.32155509T>A	ENSP00000364190:p.Tyr262Phe	Somatic	25	0		WXS	Illumina HiSeq		27	5	NM_002586	0	0	63	63	0	A2BFJ2	Missense_Mutation	SNP	ENST00000375050.4	37	CCDS4748.1	.	.	.	.	.	.	.	.	.	.	T	19.51	3.841111	0.71488	.	.	ENSG00000204304	ENST00000375050	D	0.83673	-1.75	4.63	4.63	0.57726	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.201957	0.34435	N	0.003969	T	0.61837	0.2379	N	0.10629	0.01	0.80722	D	1	P;P	0.42337	0.776;0.502	P;P	0.45232	0.474;0.458	T	0.71314	-0.4630	10	0.49607	T	0.09	-0.8351	12.0363	0.53427	0.0:0.0:0.0:1.0	.	262;262	Q7KZE5;P40425	.;PBX2_HUMAN	F	262	ENSP00000364190:Y262F	ENSP00000364190:Y262F	Y	-	2	0	PBX2	32263487	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.505000	0.81655	1.943000	0.56356	0.459000	0.35465	TAT	T|0.999;A|0.001		0.517	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4		
CRIP3	401262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43275360	43275360	+	Silent	SNP	T	T	C	rs568254475		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr6:43275360T>C	ENST00000274990.4	-	4	322	c.318A>G	c.(316-318)caA>caG	p.Q106Q	ZNF318_ENST00000607252.1_5'UTR|CRIP3_ENST00000372569.3_Silent_p.Q106Q			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	106					T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			TTTTCTTGCCTTGGGGGAGGC	0.642													T|||	1	0.000199681	0.0	0.0	5008	,	,		16423	0.0		0.0	False		,,,				2504	0.001				p.Q106Q		.											.	CRIP3-91	0			c.A318G						.						44.0	50.0	48.0					6																	43275360		2203	4300	6503	SO:0001819	synonymous_variant	401262	exon4			CTTGCCTTGGGGG	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.318A>G	6.37:g.43275360T>C		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	121	46	NM_206922	0	0	0	0	0	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Silent	SNP	ENST00000274990.4	37		.	.	.	.	.	.	.	.	.	.	T	3.522	-0.097611	0.07010	.	.	ENSG00000146215	ENST00000416431	.	.	.	5.28	-4.75	0.03239	.	.	.	.	.	T	0.06735	0.0172	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.34054	-0.9844	4	.	.	.	0.0414	3.3614	0.07188	0.1112:0.4248:0.1114:0.3527	.	.	.	.	G	54	.	.	R	-	1	2	CRIP3	43383338	0.138000	0.22547	0.008000	0.14137	0.650000	0.38633	-0.340000	0.07821	-0.788000	0.04504	0.533000	0.62120	AGG	.		0.642	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
OGFRL1	79627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	72011098	72011098	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr6:72011098C>A	ENST00000370435.4	+	7	836	c.702C>A	c.(700-702)caC>caA	p.H234Q	RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000587397.1_RNA|RP11-154D6.1_ENST00000585882.1_RNA|RP11-154D6.1_ENST00000450998.1_RNA|RP11-154D6.1_ENST00000412751.1_RNA|RP11-154D6.1_ENST00000587036.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	234						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						GGTCCCAGCACAACTATTTAA	0.358																																					p.H234Q		.											.	OGFRL1-68	0			c.C702A						.						224.0	259.0	247.0					6																	72011098		2203	4299	6502	SO:0001583	missense	79627	exon7			CCAGCACAACTAT		CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.702C>A	6.37:g.72011098C>A	ENSP00000359464:p.His234Gln	Somatic	782	1		WXS	Illumina HiSeq	Phase_I	745	267	NM_024576	0	0	0	0	0	Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	ENST00000370435.4	37	CCDS34482.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561728	0.65538	.	.	ENSG00000119900	ENST00000370435	T	0.67345	-0.26	5.94	4.16	0.48862	Opioid growth factor receptor (OGFr) conserved domain (1);	0.094242	0.85682	D	0.000000	T	0.74535	0.3729	M	0.83012	2.62	0.46749	D	0.999187	D	0.76494	0.999	D	0.68039	0.955	T	0.78663	-0.2116	10	0.87932	D	0	-12.2653	10.4706	0.44635	0.0:0.741:0.0:0.259	.	234	Q5TC84	OGRL1_HUMAN	Q	234	ENSP00000359464:H234Q	ENSP00000359464:H234Q	H	+	3	2	OGFRL1	72067819	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.730000	0.47335	0.846000	0.35142	0.563000	0.77884	CAC	.		0.358	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041153.2	NM_024576	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152658075	152658075	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr6:152658075C>G	ENST00000367255.5	-	76	13030	c.12429G>C	c.(12427-12429)tgG>tgC	p.W4143C	SYNE1_ENST00000341594.5_Missense_Mutation_p.W4008C|SYNE1_ENST00000265368.4_Missense_Mutation_p.W4143C|SYNE1_ENST00000423061.1_Missense_Mutation_p.W4072C|SYNE1_ENST00000448038.1_Missense_Mutation_p.W4072C	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4143					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCAGGTAAATCCAGAGCTCAG	0.458										HNSCC(10;0.0054)																											p.W4143C		.											.	SYNE1-607	0			c.G12429C						.						109.0	99.0	102.0					6																	152658075		2203	4300	6503	SO:0001583	missense	23345	exon76			GTAAATCCAGAGC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12429G>C	6.37:g.152658075C>G	ENSP00000356224:p.Trp4143Cys	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	73	22	NM_182961	0	0	2	7	5	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309305	0.40895	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.52754	0.74;0.7;0.65;0.7;0.73	5.47	5.47	0.80525	.	0.000000	0.56097	D	0.000036	T	0.50154	0.1599	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.71674	0.996;0.996;0.996;0.998	P;P;P;P	0.59703	0.608;0.608;0.608;0.862	T	0.49513	-0.8932	10	0.44086	T	0.13	.	12.6398	0.56702	0.0:0.9245:0.0:0.0755	.	4143;4143;4143;4072	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	C	4143;4072;4143;4072;4008	ENSP00000356224:W4143C;ENSP00000396024:W4072C;ENSP00000265368:W4143C;ENSP00000390975:W4072C;ENSP00000341887:W4008C	ENSP00000265368:W4143C	W	-	3	0	SYNE1	152699768	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	1.774000	0.38573	2.572000	0.86782	0.655000	0.94253	TGG	.		0.458	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
RNF216	54476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	5781025	5781025	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr7:5781025A>G	ENST00000425013.2	-	4	676	c.452T>C	c.(451-453)cTg>cCg	p.L151P	RNF216_ENST00000389902.3_Missense_Mutation_p.L208P	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	151					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		ATTTGATAACAGCTCTGTCTC	0.458																																					p.L208P		.											.	RNF216-274	0			c.T623C						.						172.0	174.0	174.0					7																	5781025		2203	4300	6503	SO:0001583	missense	54476	exon4			GATAACAGCTCTG	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.452T>C	7.37:g.5781025A>G	ENSP00000404602:p.Leu151Pro	Somatic	328	1		WXS	Illumina HiSeq	Phase_I	350	117	NM_207111	0	0	6	20	14	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	A	17.96	3.515649	0.64634	.	.	ENSG00000011275	ENST00000425013;ENST00000389902	T;T	0.64803	-0.12;0.2	5.97	5.97	0.96955	.	0.000000	0.64402	D	0.000002	T	0.73737	0.3625	L	0.54323	1.7	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.67548	0.952;0.916	T	0.75593	-0.3264	10	0.62326	D	0.03	-11.2668	13.8294	0.63370	1.0:0.0:0.0:0.0	.	151;208	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	P	151;208	ENSP00000404602:L151P;ENSP00000374552:L208P	ENSP00000374550:L151P	L	-	2	0	RNF216	5747551	1.000000	0.71417	0.836000	0.33094	0.819000	0.46315	3.643000	0.54374	2.289000	0.77006	0.459000	0.35465	CTG	.		0.458	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
POMZP3	22932	hgsc.bcm.edu	37	7	76241120	76241120	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr7:76241120G>C	ENST00000310842.4	-	5	1040	c.356C>G	c.(355-357)aCc>aGc	p.T119S	UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA|UPK3B_ENST00000419923.2_Intron|POMZP3_ENST00000275569.4_Intron	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion	119										kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				CAGGTGGCAGGTGATGTATAT	0.512																																					p.T119S		.											.	POMZP3-90	0			c.C356G						.						44.0	48.0	46.0					7																	76241120		2167	4245	6412	SO:0001583	missense	22932	exon5			TGGCAGGTGATGT	U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.356C>G	7.37:g.76241120G>C	ENSP00000309233:p.Thr119Ser	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	55	5	NM_012230	0	0	0	0	0	F6STJ3|Q12903|Q9BWB4	Missense_Mutation	SNP	ENST00000310842.4	37	CCDS43606.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	12.85|12.85	2.062333|2.062333	0.36373|0.36373	.|.	.|.	ENSG00000146707|ENSG00000146707	ENST00000441393|ENST00000310842;ENST00000454397	.|D;D	.|0.81659	.|-1.52;-1.52	0.786|0.786	0.786|0.786	0.18590|0.18590	.|Zona pellucida sperm-binding protein (1);	.|0.000000	.|0.85682	.|U	.|0.000000	D|D	0.83450|0.83450	0.5257|0.5257	M|M	0.78916|0.78916	2.43|2.43	0.38260|0.38260	D|D	0.941854|0.941854	.|D	.|0.52996	.|0.957	.|P	.|0.56563	.|0.801	T|T	0.81636|0.81636	-0.0843|-0.0843	5|10	.|0.35671	.|T	.|0.21	.|.	7.5453|7.5453	0.27764|0.27764	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|119	.|Q6PJE2	.|POZP3_HUMAN	Q|S	43|119;224	.|ENSP00000309233:T119S;ENSP00000405319:T224S	.|ENSP00000309233:T119S	H|T	-|-	3|2	2|0	POMZP3|POMZP3	76079056|76079056	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.653000|0.653000	0.38743|0.38743	2.607000|2.607000	0.46300|0.46300	0.733000|0.733000	0.32492|0.32492	0.372000|0.372000	0.22366|0.22366	CAC|ACC	.		0.512	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341775.1	NM_012230	
CPA5	93979	broad.mit.edu	37	7	129987643	129987643	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr7:129987643G>T	ENST00000485477.1	+	3	1282	c.153G>T	c.(151-153)aaG>aaT	p.K51N	CPA5_ENST00000393213.3_Missense_Mutation_p.K51N|CPA5_ENST00000355388.3_Missense_Mutation_p.K51N|CPA5_ENST00000461828.1_Missense_Mutation_p.K51N|CPA5_ENST00000474905.1_Missense_Mutation_p.K51N|CPA5_ENST00000431780.2_Missense_Mutation_p.K51N|CPA5_ENST00000466363.2_Missense_Mutation_p.K51N			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	51						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					AAGATGAGAAGCAGCTTTCAC	0.582																																					p.K51N													.	CPA5-92	0			c.G153T						.						75.0	70.0	72.0					7																	129987643		2203	4300	6503	SO:0001583	missense	93979	exon4			TGAGAAGCAGCTT	AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.153G>T	7.37:g.129987643G>T	ENSP00000420237:p.Lys51Asn	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	55	3	NM_080385	0	0	0	0	0	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Missense_Mutation	SNP	ENST00000485477.1	37	CCDS5819.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960439	0.34565	.	.	ENSG00000158525	ENST00000355388;ENST00000463587;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	T;T;T;T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.52;2.52;2.52;2.52	5.63	4.74	0.60224	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.806159	0.11253	N	0.583444	T	0.12433	0.0302	L	0.31420	0.93	0.32060	N	0.595808	P;B	0.36909	0.573;0.336	B;B	0.40134	0.32;0.21	T	0.03773	-1.1005	9	.	.	.	.	9.4917	0.38965	0.0927:0.0:0.9073:0.0	.	51;51	G3V0G8;Q8WXQ8	.;CBPA5_HUMAN	N	51	ENSP00000347549:K51N;ENSP00000420060:K51N;ENSP00000418183:K51N;ENSP00000419025:K51N;ENSP00000420237:K51N;ENSP00000393045:K51N;ENSP00000417314:K51N;ENSP00000376907:K51N	.	K	+	3	2	CPA5	129774879	1.000000	0.71417	0.993000	0.49108	0.861000	0.49209	1.701000	0.37825	2.652000	0.90054	0.655000	0.94253	AAG	.		0.582	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441	
OR2A14	135941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	143826220	143826220	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr7:143826220G>T	ENST00000408899.2	+	1	70	c.15G>T	c.(13-15)aaG>aaT	p.K5N		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	5						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					AAGGCAACAAGACATGGATCA	0.498																																					p.K5N		.											.	OR2A14-90	0			c.G15T						.						80.0	77.0	78.0					7																	143826220		2034	4193	6227	SO:0001583	missense	135941	exon1			CAACAAGACATGG		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.15G>T	7.37:g.143826220G>T	ENSP00000386137:p.Lys5Asn	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	53	23	NM_001001659	0	0	0	0	0	Q6IF41|Q8NGT8	Missense_Mutation	SNP	ENST00000408899.2	37	CCDS43672.1	.	.	.	.	.	.	.	.	.	.	G	8.070	0.770134	0.15983	.	.	ENSG00000221938	ENST00000408899	T	0.00348	8.0	4.18	4.18	0.49190	.	.	.	.	.	T	0.00144	0.0004	N	0.04320	-0.23	0.09310	N	1	B	0.23591	0.088	B	0.20184	0.028	T	0.50372	-0.8836	9	0.48119	T	0.1	-2.9556	12.1908	0.54270	0.0:0.0:1.0:0.0	.	5	Q96R47	O2A14_HUMAN	N	5	ENSP00000386137:K5N	ENSP00000386137:K5N	K	+	3	2	OR2A14	143457153	0.000000	0.05858	0.341000	0.25589	0.476000	0.33039	-0.561000	0.05957	2.303000	0.77524	0.561000	0.74099	AAG	.		0.498	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1		
FGFR1	2260	broad.mit.edu	37	8	38314950	38314950	+	Silent	SNP	C	C	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr8:38314950C>T	ENST00000447712.2	-	2	956	c.15G>A	c.(13-15)aaG>aaA	p.K5K	FGFR1_ENST00000326324.6_Silent_p.K5K|FGFR1_ENST00000397103.1_Silent_p.K5K|FGFR1_ENST00000532791.1_Silent_p.K5K|FGFR1_ENST00000356207.5_Silent_p.K5K|FGFR1_ENST00000397108.4_Silent_p.K5K|FGFR1_ENST00000425967.3_Silent_p.K38K|FGFR1_ENST00000341462.5_Silent_p.K5K|FGFR1_ENST00000335922.5_De_novo_Start_InFrame|FGFR1_ENST00000397091.5_Silent_p.K5K|FGFR1_ENST00000397113.2_Silent_p.K5K	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	5					angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	AGAGGAGGCACTTCCAGCTCC	0.577		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														p.K38K	Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	.	FGFR1-1793	0			c.G114A						.						71.0	63.0	66.0					8																	38314950		2203	4300	6503	SO:0001819	synonymous_variant	2260	exon3			GAGGCACTTCCAG	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.15G>A	8.37:g.38314950C>T		Somatic	77	2		WXS	Illumina HiSeq	Phase_I	72	4	NM_001174067	0	0	36	42	6	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Silent	SNP	ENST00000447712.2	37	CCDS6107.2																																																																																			.		0.577	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
LURAP1L	286343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	12821680	12821680	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr9:12821680G>T	ENST00000319264.3	+	2	1303	c.608G>T	c.(607-609)aGt>aTt	p.S203I		NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	206																	GACCAATTCAGTGACAGCTCC	0.507																																					p.S203I		.											.	.	0			c.G608T						.						192.0	171.0	178.0					9																	12821680		2203	4300	6503	SO:0001583	missense	286343	exon2			AATTCAGTGACAG	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.608G>T	9.37:g.12821680G>T	ENSP00000321026:p.Ser203Ile	Somatic	215	1		WXS	Illumina HiSeq	Phase_I	219	87	NM_203403	0	0	20	32	12	Q5VZX7|Q8N923|Q8NCG2	Missense_Mutation	SNP	ENST00000319264.3	37	CCDS6473.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729611	0.48833	.	.	ENSG00000153714	ENST00000319264	T	0.50001	0.76	5.59	5.59	0.84812	.	0.891402	0.09724	N	0.764037	T	0.46425	0.1392	L	0.32530	0.975	0.36995	D	0.894971	B	0.26845	0.161	B	0.27380	0.079	T	0.48328	-0.9045	10	0.87932	D	0	.	19.5985	0.95549	0.0:0.0:1.0:0.0	.	206	Q8IV03	CI150_HUMAN	I	203	ENSP00000321026:S203I	ENSP00000321026:S203I	S	+	2	0	C9orf150	12811680	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.943000	0.40253	2.636000	0.89361	0.563000	0.77884	AGT	.		0.507	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403	
OBP2B	29989	hgsc.bcm.edu	37	9	136083879	136083879	+	Missense_Mutation	SNP	C	C	G	rs28584111		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr9:136083879C>G	ENST00000372034.3	-	2	224	c.183G>C	c.(181-183)aaG>aaC	p.K61N	OBP2B_ENST00000461961.1_Intron|OBP2B_ENST00000372032.2_Intron	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	61					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)	p.K61N(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		TGGCTTCCAACTTCCCACCGC	0.622																																					p.K61N		.											.	OBP2B-68	1	Substitution - Missense(1)	large_intestine(1)	c.G183C						.						124.0	110.0	115.0					9																	136083879		2203	4300	6503	SO:0001583	missense	29989	exon2			TTCCAACTTCCCA	AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.183G>C	9.37:g.136083879C>G	ENSP00000361104:p.Lys61Asn	Somatic	59	1		WXS	Illumina HiSeq	Phase_I	50	3	NM_014581	0	0	0	0	0	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	37	CCDS6961.1	.	.	.	.	.	.	.	.	.	.	G	0.643	-0.812613	0.02798	.	.	ENSG00000171102	ENST00000372034	T	0.08458	3.09	2.31	-0.281	0.12882	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.089000	0.07156	N	0.849966	T	0.02230	0.0069	N	0.01122	-1.005	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.45116	-0.9283	10	0.07813	T	0.8	-15.6209	4.9518	0.14019	0.0:0.4459:0.3286:0.2255	rs28584111	61	Q9NPH6	OBP2B_HUMAN	N	61	ENSP00000361104:K61N	ENSP00000361104:K61N	K	-	3	2	OBP2B	135073700	0.003000	0.15002	0.017000	0.16124	0.019000	0.09904	0.281000	0.18810	-0.129000	0.11620	-0.335000	0.08231	AAG	.		0.622	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
ZXDB	158586	hgsc.bcm.edu	37	X	57618703	57618703	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chrX:57618703G>C	ENST00000374888.1	+	1	435	c.222G>C	c.(220-222)ttG>ttC	p.L74F		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	74					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.L74F(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CAAGCCTGTTGGCGCCGAGGA	0.766																																					p.L74F		.											.	ZXDB-130	1	Substitution - Missense(1)	skin(1)	c.G222C						.																																			SO:0001583	missense	158586	exon1			CCTGTTGGCGCCG	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.222G>C	X.37:g.57618703G>C	ENSP00000364023:p.Leu74Phe	Somatic	14	2		WXS	Illumina HiSeq	Phase_I	14	6	NM_007157	0	0	0	0	0	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	.	.	.	.	.	.	.	.	.	.	.	10.02	1.236808	0.22711	.	.	ENSG00000198455	ENST00000374888	T	0.38560	1.13	2.35	2.35	0.29111	.	0.163913	0.25238	N	0.032116	T	0.37156	0.0993	L	0.29908	0.895	0.28113	N	0.930925	D	0.54964	0.969	P	0.53912	0.737	T	0.10200	-1.0640	10	0.28530	T	0.3	.	7.4225	0.27079	0.0:0.0:1.0:0.0	.	74	P98169	ZXDB_HUMAN	F	74	ENSP00000364023:L74F	ENSP00000364023:L74F	L	+	3	2	ZXDB	57635428	0.372000	0.25064	0.949000	0.38748	0.420000	0.31355	3.802000	0.55553	1.447000	0.47661	0.483000	0.47432	TTG	.		0.766	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
TAF1	6872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	70643918	70643918	+	Splice_Site	SNP	T	T	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chrX:70643918T>C	ENST00000373790.4	+	31	4716		c.e31+2		TAF1_ENST00000449580.1_Splice_Site|TAF1_ENST00000423759.1_Splice_Site|TAF1_ENST00000461764.1_Splice_Site|TAF1_ENST00000276072.3_Splice_Site	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ATACGTAAGGTGAGTGAGTGA	0.373																																					.		.											.	TAF1-900	0			c.4728+2T>C						.						133.0	107.0	116.0					X																	70643918		2203	4300	6503	SO:0001630	splice_region_variant	6872	exon31			GTAAGGTGAGTGA		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.4665+2T>C	X.37:g.70643918T>C		Somatic	73	0		WXS	Illumina HiSeq	Phase_I	65	49	NM_004606	0	0	0	0	0	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Splice_Site	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.255554	0.59321	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000538124;ENST00000276072;ENST00000437147	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8076	0.63243	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TAF1	70560643	1.000000	0.71417	0.992000	0.48379	0.831000	0.47069	7.412000	0.80091	1.704000	0.51252	0.486000	0.48141	.	.		0.373	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	Intron
RLIM	51132	hgsc.bcm.edu	37	X	73811737	73811737	+	Silent	SNP	T	T	A	rs113198776		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chrX:73811737T>A	ENST00000332687.6	-	4	1631	c.1413A>T	c.(1411-1413)tcA>tcT	p.S471S	RLIM_ENST00000349225.2_Silent_p.S471S	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	471	Poly-Ser.|Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						aactggaacttgaactggaac	0.478																																					p.S471S	Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											.	RLIM-228	0			c.A1413T						.						38.0	38.0	38.0					X																	73811737		2203	4300	6503	SO:0001819	synonymous_variant	51132	exon5			GGAACTTGAACTG	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1413A>T	X.37:g.73811737T>A		Somatic	38	1		WXS	Illumina HiSeq	Phase_I	40	3	NM_183353	28	0	18	46	0	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Silent	SNP	ENST00000332687.6	37	CCDS14427.1																																																																																			.		0.478	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RLIM	51132	hgsc.bcm.edu	37	X	73811739	73811739	+	Missense_Mutation	SNP	A	A	G	rs201164156		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chrX:73811739A>G	ENST00000332687.6	-	4	1629	c.1411T>C	c.(1411-1413)Tca>Cca	p.S471P	RLIM_ENST00000349225.2_Missense_Mutation_p.S471P	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	471	Poly-Ser.|Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ctggaacttgaactggaactg	0.483																																					p.S471P	Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											.	RLIM-228	0			c.T1411C						.																																			SO:0001583	missense	51132	exon5			AACTTGAACTGGA	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1411T>C	X.37:g.73811739A>G	ENSP00000328059:p.Ser471Pro	Somatic	36	1		WXS	Illumina HiSeq	Phase_I	40	3	NM_183353	0	0	21	21	0	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.619369	0.00118	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	D;D	0.85258	-1.96;-1.96	1.66	0.0881	0.14453	.	0.638142	0.11946	U	0.514165	T	0.59032	0.2164	N	0.08118	0	0.09310	N	1	P	0.44734	0.842	B	0.29267	0.1	T	0.56607	-0.7951	10	0.34782	T	0.22	-0.2213	3.7245	0.08469	0.5962:0.4038:0.0:0.0	.	471	Q9NVW2	RNF12_HUMAN	P	471	ENSP00000328059:S471P;ENSP00000253571:S471P	ENSP00000328059:S471P	S	-	1	0	RLIM	73728464	0.991000	0.36638	0.012000	0.15200	0.011000	0.07611	0.068000	0.14531	0.675000	0.31264	0.441000	0.28932	TCA	.		0.483	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
TENM1	10178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	123518587	123518587	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chrX:123518587G>C	ENST00000371130.3	-	29	6236	c.6173C>G	c.(6172-6174)aCc>aGc	p.T2058S	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.T2065S	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2058					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AGGCAAAGGGGTTTCATTGAT	0.393																																					p.T2065S		.											.	.	0			c.C6194G						.						125.0	106.0	112.0					X																	123518587		2203	4300	6503	SO:0001583	missense	10178	exon30			AAAGGGGTTTCAT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6173C>G	X.37:g.123518587G>C	ENSP00000360171:p.Thr2058Ser	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	97	81	NM_001163278	0	0	0	0	0	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184284	0.78677	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86097	-2.07;-2.03	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.90992	0.7167	M	0.62723	1.935	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.999	D;D;D	0.70716	0.97;0.918;0.937	D	0.90198	0.4255	10	0.39692	T	0.17	.	18.3227	0.90244	0.0:0.0:1.0:0.0	.	2064;2065;2058	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	S	2058;2065	ENSP00000360171:T2058S;ENSP00000403954:T2065S	ENSP00000360171:T2058S	T	-	2	0	ODZ1	123346268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.964000	0.87933	2.265000	0.75225	0.600000	0.82982	ACC	.		0.393	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
CT55	54967	hgsc.bcm.edu	37	X	134303602	134303602	+	Silent	SNP	A	A	G			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chrX:134303602A>G	ENST00000276241.6	-	2	421	c.195T>C	c.(193-195)acT>acC	p.T65T	CXorf48_ENST00000344129.2_Silent_p.T65T	NM_001031705.2	NP_001026875.1	Q8WUE5	CT55_HUMAN		65										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	5	Acute lymphoblastic leukemia(192;0.000127)					GCACGTTGCCAGTCACAACAT	0.428																																					p.T65T		.											.	CXorf48-130	0			c.T195C						.						121.0	88.0	99.0					X																	134303602		2203	4297	6500	SO:0001819	synonymous_variant	54967	exon2			GTTGCCAGTCACA																												ENST00000276241.6:c.195T>C	X.37:g.134303602A>G		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_017863	0	0	0	0	0	Q9NWY8	Silent	SNP	ENST00000276241.6	37	CCDS35400.1																																																																																			.		0.428	CXorf48-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058404.1		
RAB13	5872	hgsc.bcm.edu	37	1	153954883	153954921	+	Splice_Site	DEL	GACTTGAGCAAGATGTCCCGGGCCAGGGAACTAAAAGCC	GACTTGAGCAAGATGTCCCGGGCCAGGGAACTAAAAGCC	-	rs556345789|rs202131118|rs553808166|rs371012129|rs56791628		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	GACTTGAGCAAGATGTCCCGGGCCAGGGAACTAAAAGCC	GACTTGAGCAAGATGTCCCGGGCCAGGGAACTAAAAGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr1:153954883_153954921delGACTTGAGCAAGATGTCCCGGGCCAGGGAACTAAAAGCC	ENST00000368575.3	-	7	596_633	c.481_518delGGCTTTTAGTTCCCTGGCCCGGGACATCTTGCTCAAGTC	c.(481-519)ggcttttagttccctggcccgggacatcttgctcaagtc>c	p.GF*FPGPGHLAQV161del	RAB13_ENST00000462680.1_5'UTR	NM_002870.2	NP_002861.1	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family	161					cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endosomal transport (GO:0016197)|endothelial cell chemotaxis (GO:0035767)|establishment of protein localization to plasma membrane (GO:0090002)|establishment of Sertoli cell barrier (GO:0097368)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|protein kinase A signaling (GO:0010737)|protein localization to cell leading edge (GO:1902463)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|trans-Golgi network to recycling endosome transport (GO:0044795)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R167L(2)		breast(1)|endometrium(3)|kidney(1)|lung(5)|urinary_tract(1)	11	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCGGCCTCCTGACTTGAGCAAGATGTCCCGGGCCAGGGAACTAAAAGCCTAAAGTGGGG	0.506																																					p.161_173del	Ovarian(138;395 2427 24306 43415)	.											.	RAB13-227	2	Substitution - Missense(2)	lung(2)	c.481_518del						.																																			SO:0001630	splice_region_variant	5872	exon7			.	X75593	CCDS1058.1, CCDS72921.1	1q21.2	2008-02-05			ENSG00000143545	ENSG00000143545		"""RAB, member RAS oncogene"""	9762	protein-coding gene	gene with protein product		602672				8294494	Standard	NM_002870		Approved		uc001fdt.2	P51153	OTTHUMG00000036589	ENST00000368575.3:c.481-1GGCTTTTAGTTCCCTGGCCCGGGACATCTTGCTCAAGTC>-	1.37:g.153954883_153954921delGACTTGAGCAAGATGTCCCGGGCCAGGGAACTAAAAGCC		Somatic	245	0		WXS	Illumina HiSeq	Phase_I	149	30	NM_002870	0	0	0	0	0	A8K6B5|D3DV67|Q5U0A6|Q6GPG6|Q96GU4	Frame_Shift_Del	DEL	ENST00000368575.3	37	CCDS1058.1																																																																																			.		0.506	RAB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088992.1	NM_002870	In_Frame_Del
OTOGL	283310	broad.mit.edu	37	12	80726809	80726813	+	Splice_Site	DEL	ACATC	ACATC	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	ACATC	ACATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr12:80726809_80726813delACATC	ENST00000547103.1	+	37	4317_4320	c.4311_4314delACATC	c.(4309-4314)ccacat>cc	p.PH1437fs	OTOGL_ENST00000458043.2_Frame_Shift_Del_p.DI1449fs			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1437					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						ACTCCATCAGACATCACTGTGTTTG	0.371																																					p.1449_1450del													.	.	0			c.4346_4350del						.																																			SO:0001630	splice_region_variant	283310	exon37			CATCAGACATCAC	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4312-1ACATC>-	12.37:g.80726809_80726813delACATC		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	26	7	NM_173591	0	0	0	0	0	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Frame_Shift_Del	DEL	ENST00000547103.1	37																																																																																				.		0.371	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	Frame_Shift_Del
ERCC5	2073	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	103510748	103510748	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr13:103510748delT	ENST00000355739.4	+	6	2075	c.652delT	c.(652-654)ttafs	p.L218fs	BIVM-ERCC5_ENST00000602836.1_Frame_Shift_Del_p.I644fs|ERCC5_ENST00000535557.1_Frame_Shift_Del_p.L218fs	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	218					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CAGAAGAACATTATTTGAAGC	0.373			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.L672fs		.	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	0			c.2014delT						.						96.0	99.0	98.0					13																	103510748		2203	4300	6503	SO:0001589	frameshift_variant	0	exon14	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	.	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.652delT	13.37:g.103510748delT	ENSP00000347978:p.Leu218fs	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	144	51	NM_001204425	0	0	0	0	0	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Frame_Shift_Del	DEL	ENST00000355739.4	37	CCDS32004.1																																																																																			.		0.373	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
WDR33	55339	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	128484249	128484249	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr2:128484249delT	ENST00000322313.4	-	8	985	c.827delA	c.(826-828)aagfs	p.K276fs		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	276					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CTGCCCAGTCTTGGGATCCCA	0.468																																					p.K276fs		.											.	WDR33-90	0			c.827delA						.						154.0	153.0	153.0					2																	128484249		2203	4300	6503	SO:0001589	frameshift_variant	55339	exon8			.		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.827delA	2.37:g.128484249delT	ENSP00000325377:p.Lys276fs	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	136	38	NM_018383	0	0	0	0	0	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Frame_Shift_Del	DEL	ENST00000322313.4	37	CCDS2150.1																																																																																			.		0.468	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
SMARCB1	6598	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	24167461	24167461	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr22:24167461delA	ENST00000263121.7	+	7	1041	c.845delA	c.(844-846)gacfs	p.D282fs	SMARCB1_ENST00000344921.6_Frame_Shift_Del_p.D291fs|SMARCB1_ENST00000407422.3_Frame_Shift_Del_p.D273fs|SMARCB1_ENST00000407082.3_Frame_Shift_Del_p.D236fs|SMARCB1_ENST00000477836.1_3'UTR	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	282	2 X approximate tandem repeats.				ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(6)|p.L266_*386del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				TTTGAGTGGGACATGTCAGAG	0.537			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.D282fs		.	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	.	SMARCB1-2699	7	Unknown(6)|Deletion - In frame(1)	central_nervous_system(6)|soft_tissue(1)	c.845delA						.						126.0	101.0	110.0					22																	24167461		2203	4300	6503	SO:0001589	frameshift_variant	6598	exon7			.	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.845delA	22.37:g.24167461delA	ENSP00000263121:p.Asp282fs	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	75	57	NM_003073	0	0	0	0	0	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Frame_Shift_Del	DEL	ENST00000263121.7	37	CCDS13817.1																																																																																			.		0.537	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
POLQ	10721	broad.mit.edu	37	3	121207671	121207673	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr3:121207671_121207673delCTT	ENST00000264233.5	-	16	4233_4235	c.4105_4107delAAG	c.(4105-4107)aagdel	p.K1369del		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1369					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TGTGACACTCCTTCTGAAAAGAG	0.448								DNA polymerases (catalytic subunits)																													p.1369_1369del	Pancreas(152;907 1925 26081 31236 36904)												.	POLQ-664	0			c.4105_4107del						.			1,4265		0,1,2132						2.9	0.0			178	0,8254		0,0,4127	no	coding	POLQ	NM_199420.3		0,1,6259	A1A1,A1R,RR		0.0,0.0234,0.0080				1,12519				SO:0001651	inframe_deletion	10721	exon16			ACACTCCTTCTGA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.4105_4107delAAG	3.37:g.121207671_121207673delCTT	ENSP00000264233:p.Lys1369del	Somatic	226	0		WXS	Illumina HiSeq	Phase_I	267	13	NM_199420	0	0	0	0	0	O95160|Q6VMB5	In_Frame_Del	DEL	ENST00000264233.5	37	CCDS33833.1																																																																																			.		0.448	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
SPEF2	79925	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	35771741	35771743	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:35771741_35771743delGAA	ENST00000356031.3	+	27	3986_3988	c.3832_3834delGAA	c.(3832-3834)gaadel	p.E1280del	SPEF2_ENST00000440995.2_In_Frame_Del_p.E1275del|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1280					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GAGGCTTATGGAAGAAGAAAAAG	0.399																																					p.1278_1278del		.											.	SPEF2-26	0			c.3832_3834del						.																																			SO:0001651	inframe_deletion	79925	exon27			.	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3832_3834delGAA	5.37:g.35771747_35771749delGAA	ENSP00000348314:p.Glu1280del	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	58	12	NM_024867	0	0	0	0	0	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	In_Frame_Del	DEL	ENST00000356031.3	37	CCDS43309.1																																																																																			.		0.399	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
IFNA2	3440	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	21385064	21385067	+	Frame_Shift_Del	DEL	GATT	GATT	-			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	GATT	GATT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr9:21385064_21385067delGATT	ENST00000380206.2	-	1	329_332	c.262_265delAATC	c.(262-267)aatctcfs	p.NL88fs		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	88					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		GTGCTGAAGAGATTGAAGATCTGC	0.49																																					p.88_89del		.											.	IFNA2-153	0			c.262_265del						.																																			SO:0001589	frameshift_variant	3440	exon1			.		CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.262_265delAATC	9.37:g.21385064_21385067delGATT	ENSP00000369554:p.Asn88fs	Somatic	216	0		WXS	Illumina HiSeq	Phase_I	215	87	NM_000605	0	0	0	0	0	H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Frame_Shift_Del	DEL	ENST00000380206.2	37	CCDS6506.1																																																																																			.		0.490	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051903.1	NM_000605	
DIDO1	11083	broad.mit.edu	37	20	61537401	61537402	+	Frame_Shift_Ins	INS	-	-	T	rs140153728		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr20:61537401_61537402insT	ENST00000266070.4	-	6	1750_1751	c.1425_1426insA	c.(1423-1428)aaagagfs	p.E476fs	DIDO1_ENST00000395343.1_Frame_Shift_Ins_p.E476fs|DIDO1_ENST00000370371.4_Frame_Shift_Ins_p.E476fs|DIDO1_ENST00000266071.5_Frame_Shift_Ins_p.E476fs|DIDO1_ENST00000354665.4_Frame_Shift_Ins_p.E476fs|DIDO1_ENST00000370366.1_Frame_Shift_Ins_p.E476fs|DIDO1_ENST00000370368.1_Frame_Shift_Ins_p.E476fs|DIDO1_ENST00000395335.2_Frame_Shift_Ins_p.E476fs|DIDO1_ENST00000395340.1_Frame_Shift_Ins_p.E476fs	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	476					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					ACTGTGGTCTCTTTTTTTTCTG	0.49																																					p.E476fs	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												.	DIDO1-96	0			c.1426_1427insA						.																																			SO:0001589	frameshift_variant	11083	exon6			TGGTCTCTTTTTT	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1426dupA	20.37:g.61537409_61537409dupT	ENSP00000266070:p.Glu476fs	Somatic	215	0		WXS	Illumina HiSeq	Phase_I	202	0	NM_080796	0	0	0	0	0	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Frame_Shift_Ins	INS	ENST00000266070.4	37	CCDS33506.1																																																																																			.		0.490	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
SETD2	29072	hgsc.bcm.edu;bcgsc.ca	37	3	47125642	47125643	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr3:47125642_47125643insA	ENST00000409792.3	-	12	5669_5670	c.5627_5628insT	c.(5626-5628)ctafs	p.L1876fs	SETD2_ENST00000492397.1_5'Flank	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1876					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGCGAAACATTAGTTTCTTGGG	0.446			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.L1876fs		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.5628_5629insT						.																																			SO:0001589	frameshift_variant	29072	exon12			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5628dupT	3.37:g.47125643_47125643dupA	ENSP00000386759:p.Leu1876fs	Somatic	288	0		WXS	Illumina HiSeq	Phase_I	334	75	NM_014159	0	0	0	0	0	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Ins	INS	ENST00000409792.3	37	CCDS2749.2																																																																																			.		0.446	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
TRIM41	90933	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	180661231	180661232	+	Frame_Shift_Ins	INS	-	-	C	rs138245799		TCGA-BQ-5876-01A-11D-1589-08	TCGA-BQ-5876-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ffc588e2-0513-4495-b578-d028131a1dc3	a1a3e47d-ca70-49d5-8599-c60c433343f0	g.chr5:180661231_180661232insC	ENST00000315073.5	+	6	2059_2060	c.1349_1350insC	c.(1348-1353)cgccggfs	p.R451fs	TRIM41_ENST00000351937.5_Frame_Shift_Ins_p.R451fs|TRIM41_ENST00000510072.1_3'UTR	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	451	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCCCTGACCGCCGGGGGGTCC	0.698																																					p.R450fs		.											.	TRIM41-226	0			c.1349_1350insC						.																																			SO:0001589	frameshift_variant	90933	exon6			.	AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.1351dupC	5.37:g.180661233_180661233dupC	ENSP00000320869:p.Arg451fs	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	104	38	NM_201627	0	0	0	0	0	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Frame_Shift_Ins	INS	ENST00000315073.5	37	CCDS4466.1																																																																																			.		0.698	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627	
