#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ELTD1	64123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	79386001	79386001	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr1:79386001G>A	ENST00000370742.3	-	10	1391	c.1328C>T	c.(1327-1329)gCc>gTc	p.A443V		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	443					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		AATGCATATGGCAAGACAAAT	0.313																																					p.A443V		.											.	ELTD1-24	0			c.C1328T						.						103.0	97.0	99.0					1																	79386001		1812	4078	5890	SO:0001583	missense	64123	exon10			CATATGGCAAGAC	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1328C>T	1.37:g.79386001G>A	ENSP00000359778:p.Ala443Val	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	135	37	NM_022159	0	0	37	37	0	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768298	0.49680	.	.	ENSG00000162618	ENST00000370742	T	0.41065	1.01	5.0	5.0	0.66597	GPCR, family 2-like (1);	0.175937	0.50627	D	0.000111	T	0.21921	0.0528	L	0.45422	1.42	0.40567	D	0.981269	B	0.10296	0.003	B	0.23018	0.043	T	0.04537	-1.0944	9	.	.	.	.	14.2963	0.66316	0.0:0.1486:0.8513:0.0	.	443	Q9HBW9	ELTD1_HUMAN	V	443	ENSP00000359778:A443V	.	A	-	2	0	ELTD1	79158589	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	5.598000	0.67585	2.469000	0.83416	0.650000	0.86243	GCC	.		0.313	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
LMNA	4000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156105085	156105085	+	Silent	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr1:156105085C>T	ENST00000368300.4	+	5	1130	c.918C>T	c.(916-918)ctC>ctT	p.L306L	LMNA_ENST00000473598.2_Silent_p.L207L|LMNA_ENST00000448611.2_Silent_p.L194L|LMNA_ENST00000392353.3_Silent_p.L225L|LMNA_ENST00000368297.1_Silent_p.L225L|LMNA_ENST00000368301.2_Silent_p.L306L|LMNA_ENST00000347559.2_Silent_p.L306L|LMNA_ENST00000361308.4_Silent_p.L306L|LMNA_ENST00000368299.3_Silent_p.L306L|LMNA_ENST00000496738.1_3'UTR	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	306	Coil 2.|Rod.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					CTGCCCAGCTCAGCCAGCTCC	0.662									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																												p.L306L		.											.	LMNA-228	0			c.C918T						.						25.0	28.0	27.0					1																	156105085		2202	4299	6501	SO:0001819	synonymous_variant	4000	exon5	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	CCAGCTCAGCCAG	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.918C>T	1.37:g.156105085C>T		Somatic	37	0		WXS	Illumina HiSeq	Phase_I	35	10	NM_170707	0	0	212	400	188	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent	SNP	ENST00000368300.4	37	CCDS1129.1																																																																																			.		0.662	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
SUSD4	55061	hgsc.bcm.edu	37	1	223401081	223401081	+	Splice_Site	SNP	C	C	G			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr1:223401081C>G	ENST00000343846.3	-	6	1550		c.e6-1		SUSD4_ENST00000494793.2_Splice_Site|SUSD4_ENST00000484758.2_Splice_Site|SUSD4_ENST00000478605.1_Intron|SUSD4_ENST00000366878.4_Splice_Site|SUSD4_ENST00000454695.2_Splice_Site			Q5VX71	SUSD4_HUMAN	sushi domain containing 4							integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		CACGTTTGCTCTGCATGAGGG	0.577																																					.		.											.	SUSD4-68	0			c.917-1G>C						.						60.0	64.0	63.0					1																	223401081		2148	4258	6406	SO:0001630	splice_region_variant	55061	exon8			TTTGCTCTGCATG	AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.917-1G>C	1.37:g.223401081C>G		Somatic	20	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_017982	0	0	0	0	0	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Splice_Site	SNP	ENST00000343846.3	37	CCDS41471.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236471	0.79800	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000454695	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4353	0.99089	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SUSD4	221467704	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.156000	0.71840	2.836000	0.97738	0.655000	0.94253	.	.		0.577	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982	Intron
ST8SIA6	338596	broad.mit.edu	37	10	17401582	17401582	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr10:17401582T>A	ENST00000377602.4	-	4	382	c.308A>T	c.(307-309)tAc>tTc	p.Y103F		NM_001004470.1	NP_001004470.1	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6	103					carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycolipid biosynthetic process (GO:0009247)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked glycosylation (GO:0006493)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			endometrium(3)|kidney(3)|large_intestine(4)|liver(1)|lung(24)|ovary(1)|skin(1)	37						AATCTGAAGGTAGTCGTTCTC	0.284																																					p.Y103F													.	ST8SIA6-91	0			c.A308T						.						47.0	46.0	47.0					10																	17401582		2203	4297	6500	SO:0001583	missense	338596	exon4			TGAAGGTAGTCGT		CCDS31158.1	10p13	2013-03-01	2005-02-07	2005-02-07	ENSG00000148488	ENSG00000148488		"""Sialyltransferases"""	23317	protein-coding gene	gene with protein product	"""ST8Sia VI"""	610139	"""sialyltransferase 8F (alpha-2, 8-sialyltransferase)"""	SIAT8F		11980897	Standard	XR_242697		Approved		uc001ipd.3	P61647	OTTHUMG00000017748	ENST00000377602.4:c.308A>T	10.37:g.17401582T>A	ENSP00000366827:p.Tyr103Phe	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	41	3	NM_001004470	0	0	0	0	0	B0YJ97|B9EH72|Q5VZH4	Missense_Mutation	SNP	ENST00000377602.4	37	CCDS31158.1	.	.	.	.	.	.	.	.	.	.	T	16.05	3.013208	0.54468	.	.	ENSG00000148488	ENST00000377602	T	0.22945	1.93	5.26	4.1	0.47936	.	0.365154	0.28538	N	0.014993	T	0.23249	0.0562	M	0.63843	1.955	0.38539	D	0.949177	B	0.15473	0.013	B	0.12837	0.008	T	0.08207	-1.0733	10	0.17369	T	0.5	-12.1516	8.235	0.31620	0.1766:0.0:0.0:0.8234	.	103	P61647	SIA8F_HUMAN	F	103	ENSP00000366827:Y103F	ENSP00000366827:Y103F	Y	-	2	0	ST8SIA6	17441588	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	2.641000	0.46587	0.989000	0.38761	0.454000	0.30748	TAC	.		0.284	ST8SIA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047036.1	NM_001004470	
NELL2	4753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	45097517	45097517	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr12:45097517T>C	ENST00000429094.2	-	12	1814	c.1310A>G	c.(1309-1311)tAc>tGc	p.Y437C	NELL2_ENST00000395487.2_Missense_Mutation_p.Y436C|NELL2_ENST00000333837.4_Missense_Mutation_p.Y460C|NELL2_ENST00000549027.1_Missense_Mutation_p.Y436C|NELL2_ENST00000551601.1_Missense_Mutation_p.Y436C|NELL2_ENST00000437801.2_Missense_Mutation_p.Y487C|NELL2_ENST00000452445.2_Missense_Mutation_p.Y437C	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	437	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		ACCTTCACAGTAGGCATTATC	0.403																																					p.Y487C		.											.	NELL2-517	0			c.A1460G						.						97.0	89.0	92.0					12																	45097517		2203	4300	6503	SO:0001583	missense	4753	exon13			TCACAGTAGGCAT	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1310A>G	12.37:g.45097517T>C	ENSP00000390680:p.Tyr437Cys	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	104	32	NM_001145107	0	0	0	0	0	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	CCDS8746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.07|19.07	3.756435|3.756435	0.69648|0.69648	.|.	.|.	ENSG00000184613|ENSG00000184613	ENST00000550313|ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684	.|D;D;T;D;D;D;D	.|0.95622	.|-1.56;-1.56;-0.63;-1.56;-1.56;-2.26;-3.76	5.6|5.6	5.6|5.6	0.85130|0.85130	.|Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97396|0.97396	0.9148|0.9148	M|M	0.77616|0.77616	2.38|2.38	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.999;1.0;1.0	.|D;D;D;D;D;D	.|0.80764	.|0.956;0.984;0.986;0.994;0.968;0.993	D|D	0.97098|0.97098	0.9795|0.9795	5|10	.|0.36615	.|T	.|0.2	-30.8204|-30.8204	15.7975|15.7975	0.78423|0.78423	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|460;487;436;437;437;436	.|B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2	.|.;.;.;.;NELL2_HUMAN;.	A|C	181|436;437;436;437;436;460;487;436	.|ENSP00000378866:Y436C;ENSP00000390680:Y437C;ENSP00000449332:Y436C;ENSP00000394612:Y437C;ENSP00000447927:Y436C;ENSP00000327988:Y460C;ENSP00000416341:Y487C	.|ENSP00000327988:Y460C	T|Y	-|-	1|2	0|0	NELL2|NELL2	43383784|43383784	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.089000|7.089000	0.76909|0.76909	2.135000|2.135000	0.66039|0.66039	0.528000|0.528000	0.53228|0.53228	ACT|TAC	.		0.403	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
PABPC3	5042	ucsc.edu	37	13	25672007	25672007	+	Silent	SNP	A	A	G			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr13:25672007A>G	ENST00000281589.3	+	1	1708	c.1671A>G	c.(1669-1671)ttA>ttG	p.L557L		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	557	PABC. {ECO:0000255|PROSITE- ProRule:PRU00641}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGCAAATGTTAGGTGAACGGC	0.433																																					p.L557L													.	PABPC3-72	0			c.A1671G						.						118.0	107.0	110.0					13																	25672007		2203	4300	6503	SO:0001819	synonymous_variant	5042	exon1			AATGTTAGGTGAA	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1671A>G	13.37:g.25672007A>G		Somatic	156	0		WXS	Illumina HiSeq		90	1	NM_030979	0	0	0	0	0	Q8NHV0|Q9H086	Silent	SNP	ENST00000281589.3	37	CCDS9311.1																																																																																			.		0.433	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
ELMSAN1	91748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	74196477	74196477	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr14:74196477T>C	ENST00000286523.5	-	4	2743	c.1961A>G	c.(1960-1962)tAc>tGc	p.Y654C	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.Y654C	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	654					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										GGGCGGCGTGTAGGGAGGTAG	0.627																																					p.Y654C		.											.	.	0			c.A1961G						.						69.0	63.0	65.0					14																	74196477		2203	4300	6503	SO:0001583	missense	91748	exon4			GGCGTGTAGGGAG	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1961A>G	14.37:g.74196477T>C	ENSP00000286523:p.Tyr654Cys	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	78	23	NM_194278	0	0	52	77	25	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	37	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.429427	0.83776	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.51071	0.72;0.72;0.72;0.74	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000018	T	0.70404	0.3220	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.75608	-0.3259	10	0.87932	D	0	-12.2873	15.1835	0.72978	0.0:0.0:0.0:1.0	.	654;654	A0PJD3;Q6PJG2	.;CN043_HUMAN	C	654	ENSP00000377634:Y654C;ENSP00000286523:Y654C;ENSP00000407767:Y654C;ENSP00000402380:Y654C	ENSP00000286523:Y654C	Y	-	2	0	C14orf43	73266230	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	8.032000	0.88838	1.977000	0.57605	0.391000	0.25812	TAC	.		0.627	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	33905537	33905537	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr15:33905537G>T	ENST00000389232.4	+	19	2388	c.2318G>T	c.(2317-2319)gGg>gTg	p.G773V	RYR3_ENST00000415757.3_Missense_Mutation_p.G773V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	773	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AACACAGACGGGCTCTTCTTC	0.552																																					p.G773V		.											.	RYR3-520	0			c.G2318T						.						50.0	54.0	53.0					15																	33905537		2107	4260	6367	SO:0001583	missense	6263	exon19			CAGACGGGCTCTT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2318G>T	15.37:g.33905537G>T	ENSP00000373884:p.Gly773Val	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	32	18	NM_001243996	0	0	0	0	0	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821891	0.90873	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.70869	-0.52;-0.52	5.4	5.4	0.78164	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.80944	0.4721	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.96	T	0.79305	-0.1858	10	0.45353	T	0.12	.	19.4159	0.94700	0.0:0.0:1.0:0.0	.	773;773	Q15413-2;Q15413	.;RYR3_HUMAN	V	773	ENSP00000373884:G773V;ENSP00000399610:G773V	ENSP00000354735:G773V	G	+	2	0	RYR3	31692829	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.715000	0.84713	2.821000	0.97095	0.650000	0.86243	GGG	.		0.552	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SF3B3	23450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	70595650	70595650	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr16:70595650C>T	ENST00000302516.5	+	17	2462	c.2251C>T	c.(2251-2253)Ccc>Tcc	p.P751S		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	751					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				GGAACAGTGTCCCGAGGGCAT	0.532																																					p.P751S		.											.	SF3B3-91	0			c.C2251T						.						151.0	123.0	133.0					16																	70595650		2198	4300	6498	SO:0001583	missense	23450	exon17			CAGTGTCCCGAGG	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2251C>T	16.37:g.70595650C>T	ENSP00000305790:p.Pro751Ser	Somatic	157	1		WXS	Illumina HiSeq	Phase_I	155	60	NM_012426	0	0	199	302	103	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863326	0.71949	.	.	ENSG00000189091	ENST00000302516	T	0.35605	1.3	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.39253	0.1071	L	0.49256	1.55	0.80722	D	1	B	0.23490	0.086	B	0.23419	0.046	T	0.11767	-1.0574	10	0.48119	T	0.1	-16.0376	20.2982	0.98569	0.0:1.0:0.0:0.0	.	751	Q15393	SF3B3_HUMAN	S	751	ENSP00000305790:P751S	ENSP00000305790:P751S	P	+	1	0	SF3B3	69153151	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.729000	0.84864	2.873000	0.98535	0.563000	0.77884	CCC	.		0.532	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
NUP88	4927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	5314095	5314095	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr17:5314095C>T	ENST00000573584.1	-	4	1117	c.608G>A	c.(607-609)cGt>cAt	p.R203H		NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	203					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						CTGCGGCTCACGTAGTGAGTA	0.388																																					p.R203H		.											.	NUP88-204	0			c.G608A						.						107.0	114.0	112.0					17																	5314095		2203	4300	6503	SO:0001583	missense	4927	exon4			GGCTCACGTAGTG	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.608G>A	17.37:g.5314095C>T	ENSP00000458954:p.Arg203His	Somatic	254	0		WXS	Illumina HiSeq	Phase_I	240	84	NM_002532	0	0	23	39	16	D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	37	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.757883	0.31137	.	.	ENSG00000108559	ENST00000225696;ENST00000543132	.	.	.	5.47	3.46	0.39613	.	0.364516	0.30126	N	0.010346	T	0.36936	0.0985	L	0.44542	1.39	0.28618	N	0.908315	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.08055	0.002;0.002;0.003	T	0.28776	-1.0033	9	0.45353	T	0.12	-6.739	8.1438	0.31100	0.0:0.6984:0.0:0.3016	.	203;72;203	B7Z5I6;B4DP20;Q99567	.;.;NUP88_HUMAN	H	203;72	.	ENSP00000225696:R203H	R	-	2	0	NUP88	5254819	0.997000	0.39634	0.947000	0.38551	0.620000	0.37586	1.229000	0.32600	0.794000	0.33899	0.561000	0.74099	CGT	.		0.388	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532	
MYH3	4621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10554908	10554908	+	Silent	SNP	G	G	A	rs577513442		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr17:10554908G>A	ENST00000583535.1	-	5	513	c.426C>T	c.(424-426)ggC>ggT	p.G142G	MYH3_ENST00000226209.7_Silent_p.G142G	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	142	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TGCCTCGGTAGCCTTCCACCA	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		14358	0.001		0.0	False		,,,				2504	0.0				p.G142G		.											.	MYH3-95	0			c.C426T						.						137.0	137.0	137.0					17																	10554908		2203	4300	6503	SO:0001819	synonymous_variant	4621	exon5			TCGGTAGCCTTCC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.426C>T	17.37:g.10554908G>A		Somatic	243	0		WXS	Illumina HiSeq	Phase_I	232	68	NM_002470	0	0	0	0	0	Q15492	Silent	SNP	ENST00000583535.1	37	CCDS11157.1																																																																																			.		0.557	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
DCAF7	10238	broad.mit.edu;bcgsc.ca	37	17	61628109	61628109	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr17:61628109G>T	ENST00000310827.4	+	1	288	c.71G>T	c.(70-72)tGg>tTg	p.W24L	DCAF7_ENST00000431926.1_Missense_Mutation_p.W24L|DCAF7_ENST00000577702.1_3'UTR|DCAF7_ENST00000415273.2_Missense_Mutation_p.W24L	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7	24					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						GCGATGAACTGGAGTGTGCGG	0.642																																					p.W24L													.	DCAF7-91	0			c.G71T						.						62.0	69.0	67.0					17																	61628109		1996	4163	6159	SO:0001583	missense	10238	exon1			TGAACTGGAGTGT	U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.71G>T	17.37:g.61628109G>T	ENSP00000308344:p.Trp24Leu	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	47	4	NM_005828	0	0	108	108	0	B4E039|D3DU14|O15491|Q9DAE4	Missense_Mutation	SNP	ENST00000310827.4	37		.	.	.	.	.	.	.	.	.	.	G	26.9	4.783717	0.90282	.	.	ENSG00000136485	ENST00000310827;ENST00000431926;ENST00000415273	T;T;T	0.64085	-0.06;-0.08;1.51	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71056	0.3295	M	0.85710	2.77	0.80722	D	1	P;B	0.39094	0.659;0.416	B;B	0.39706	0.307;0.179	T	0.75396	-0.3332	10	0.54805	T	0.06	-17.3123	19.6415	0.95760	0.0:0.0:1.0:0.0	.	24;24	B4E039;P61962	.;DCAF7_HUMAN	L	24	ENSP00000308344:W24L;ENSP00000402312:W24L;ENSP00000403920:W24L	ENSP00000308344:W24L	W	+	2	0	DCAF7	58981841	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.115000	0.94336	2.651000	0.90000	0.561000	0.74099	TGG	.		0.642	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005828	
GH1	2688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	61995168	61995168	+	Silent	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr17:61995168G>T	ENST00000323322.5	-	4	450	c.408C>A	c.(406-408)gtC>gtA	p.V136V	GH1_ENST00000458650.2_Silent_p.V121V|GH1_ENST00000342364.4_Intron|GH1_ENST00000351388.4_Silent_p.V96V|CSHL1_ENST00000392824.4_Intron	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	136			V -> I (in dbSNP:rs5388). {ECO:0000269|PubMed:12655557, ECO:0000269|PubMed:15001589}.		bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						GGAGGTCATAGACGTTGCTGT	0.607																																					p.V136V		.											.	GH1-522	0			c.C408A						.						68.0	68.0	68.0					17																	61995168		2203	4300	6503	SO:0001819	synonymous_variant	2688	exon4			GTCATAGACGTTG	M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.408C>A	17.37:g.61995168G>T		Somatic	128	0		WXS	Illumina HiSeq	Phase_I	131	57	NM_000515	0	0	0	0	0	A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Silent	SNP	ENST00000323322.5	37	CCDS11653.1																																																																																			.		0.607	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417708.1	NM_000515	
RYR1	6261	broad.mit.edu;bcgsc.ca	37	19	38948197	38948197	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr19:38948197G>T	ENST00000359596.3	+	17	1852	c.1852G>T	c.(1852-1854)Gat>Tat	p.D618Y	RYR1_ENST00000355481.4_Missense_Mutation_p.D618Y|RYR1_ENST00000360985.3_Missense_Mutation_p.D618Y			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	618	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTCCAACCAAGATCTTATTAC	0.522																																					p.D618Y													.	RYR1-100	0			c.G1852T						.						341.0	275.0	297.0					19																	38948197		2203	4300	6503	SO:0001583	missense	6261	exon17			AACCAAGATCTTA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1852G>T	19.37:g.38948197G>T	ENSP00000352608:p.Asp618Tyr	Somatic	278	0		WXS	Illumina HiSeq	Phase_I	291	10	NM_001042723	0	0	0	0	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521791	0.44866	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97089	-4.24;-4.24;-4.24	3.76	3.76	0.43208	Intracellular calcium-release channel (1);B30.2/SPRY domain (1);	0.075267	0.49916	U	0.000125	D	0.95912	0.8669	L	0.36672	1.1	0.42899	D	0.99422	D;D	0.64830	0.994;0.98	P;P	0.61722	0.862;0.893	D	0.94764	0.7939	10	0.87932	D	0	.	5.1222	0.14865	0.2768:0.0:0.7232:0.0	.	618;618	P21817-2;P21817	.;RYR1_HUMAN	Y	618	ENSP00000352608:D618Y;ENSP00000347667:D618Y;ENSP00000354254:D618Y	ENSP00000347667:D618Y	D	+	1	0	RYR1	43640037	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.680000	0.54641	2.113000	0.64589	0.555000	0.69702	GAT	.		0.522	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ZNF175	7728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52091521	52091521	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr19:52091521T>C	ENST00000262259.2	+	5	2295	c.1937T>C	c.(1936-1938)cTt>cCt	p.L646P	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	646					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		TATGAATGCCTTGACTGTGGG	0.443																																					p.L646P		.											.	ZNF175-90	0			c.T1937C						.						86.0	84.0	85.0					19																	52091521		2203	4300	6503	SO:0001583	missense	7728	exon5			AATGCCTTGACTG	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1937T>C	19.37:g.52091521T>C	ENSP00000262259:p.Leu646Pro	Somatic	154	0		WXS	Illumina HiSeq	Phase_I	156	50	NM_007147	0	0	3	5	2	A8K9H2	Missense_Mutation	SNP	ENST00000262259.2	37	CCDS12837.1	.	.	.	.	.	.	.	.	.	.	T	1.034	-0.680825	0.03353	.	.	ENSG00000105497	ENST00000262259	T	0.10763	2.84	2.14	-2.05	0.07321	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02418	0.0074	N	0.00707	-1.245	0.09310	N	1	B	0.28324	0.207	B	0.29663	0.105	T	0.37009	-0.9724	9	0.48119	T	0.1	.	0.6964	0.00900	0.1625:0.18:0.2558:0.4017	.	646	Q9Y473	ZN175_HUMAN	P	646	ENSP00000262259:L646P	ENSP00000262259:L646P	L	+	2	0	ZNF175	56783333	0.000000	0.05858	0.066000	0.19879	0.247000	0.25773	-3.014000	0.00646	-0.395000	0.07715	-1.142000	0.01873	CTT	.		0.443	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147	
SLC5A6	8884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27427384	27427384	+	Missense_Mutation	SNP	G	G	A	rs199587675		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:27427384G>A	ENST00000310574.3	-	9	1423	c.950C>T	c.(949-951)gCg>gTg	p.A317V	SLC5A6_ENST00000408041.1_Missense_Mutation_p.A317V|SLC5A6_ENST00000461319.1_5'Flank	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	317					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.A317V(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CTGGTAATACGCGAACATGAC	0.597																																					p.A317V		.											.	SLC5A6-92	1	Substitution - Missense(1)	large_intestine(1)	c.C950T						.						99.0	95.0	96.0					2																	27427384		2203	4300	6503	SO:0001583	missense	8884	exon9			TAATACGCGAACA	AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.950C>T	2.37:g.27427384G>A	ENSP00000310208:p.Ala317Val	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	107	33	NM_021095	0	0	7	14	7	B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	ENST00000310574.3	37	CCDS1740.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.513536	0.27123	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.88586	-2.4;-2.4	4.93	2.04	0.26737	.	0.604283	0.16756	N	0.200821	D	0.85733	0.5765	M	0.67569	2.06	0.39947	D	0.974481	B	0.33345	0.409	B	0.34242	0.178	T	0.82370	-0.0491	10	0.52906	T	0.07	.	7.2906	0.26364	0.1706:0.1441:0.6852:0.0	.	317	Q9Y289	SC5A6_HUMAN	V	317	ENSP00000310208:A317V;ENSP00000384853:A317V	ENSP00000310208:A317V	A	-	2	0	SLC5A6	27280888	0.999000	0.42202	0.226000	0.23910	0.215000	0.24574	3.539000	0.53604	0.585000	0.29608	0.655000	0.94253	GCG	.		0.597	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095	
RAB3GAP1	22930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	135815628	135815628	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:135815628G>A	ENST00000264158.8	+	3	165	c.122G>A	c.(121-123)gGa>gAa	p.G41E	RAB3GAP1_ENST00000425393.1_Missense_Mutation_p.G41E|RAB3GAP1_ENST00000539493.1_5'UTR|RAB3GAP1_ENST00000442034.1_Missense_Mutation_p.G41E	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	41					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		AAACTGATTGGAAACTCTTTG	0.383																																					p.G41E		.											.	RAB3GAP1-92	0			c.G122A						.						91.0	86.0	88.0					2																	135815628		2203	4300	6503	SO:0001583	missense	22930	exon3			TGATTGGAAACTC	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.122G>A	2.37:g.135815628G>A	ENSP00000264158:p.Gly41Glu	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	76	27	NM_001172435	0	0	37	62	25	A6H8Z3|C9J837|Q659F5|Q8TBB4	Missense_Mutation	SNP	ENST00000264158.8	37	CCDS33294.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554169	0.86231	.	.	ENSG00000115839	ENST00000264158;ENST00000442034;ENST00000425393	T;T	0.48201	0.84;0.82	5.62	5.62	0.85841	.	0.174050	0.52532	D	0.000076	T	0.66268	0.2772	M	0.69823	2.125	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.70227	0.927;0.968	T	0.61466	-0.7057	10	0.25751	T	0.34	-20.0075	16.5774	0.84705	0.0:0.0:1.0:0.0	.	41;41	C9J837;Q15042	.;RB3GP_HUMAN	E	41	ENSP00000264158:G41E;ENSP00000411418:G41E	ENSP00000264158:G41E	G	+	2	0	RAB3GAP1	135532098	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.478000	0.81082	2.642000	0.89623	0.655000	0.94253	GGA	.		0.383	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233	
NEB	4703	hgsc.bcm.edu	37	2	152372972	152372972	+	Splice_Site	SNP	C	C	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:152372972C>A	ENST00000172853.10	-	129	17950		c.e129+1		NEB_ENST00000604864.1_Splice_Site|NEB_ENST00000397345.3_Splice_Site|NEB_ENST00000427231.2_Splice_Site|NEB_ENST00000409198.1_Splice_Site|NEB_ENST00000603639.1_Splice_Site			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTTTGACTTACCCCACTCTGC	0.443																																					.		.											.	NEB-145	0			c.22905+1G>T						.						241.0	219.0	226.0					2																	152372972		2014	4177	6191	SO:0001630	splice_region_variant	4703	exon158			GACTTACCCCACT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.17802+1G>T	2.37:g.152372972C>A		Somatic	27	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_001164507	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Splice_Site	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	17.45	3.393102	0.62066	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853;ENST00000434685	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5748	0.95438	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NEB	152081218	1.000000	0.71417	1.000000	0.80357	0.440000	0.31957	7.817000	0.86213	2.622000	0.88805	0.557000	0.71058	.	.		0.443	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	Intron
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179429062	179429062	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:179429062G>T	ENST00000591111.1	-	276	77098	c.76874C>A	c.(76873-76875)gCa>gAa	p.A25625E	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A18326E|TTN_ENST00000460472.2_Missense_Mutation_p.A18201E|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A18393E|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A27266E|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A24698E|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25625	Fibronectin type-III 86. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCATCTCTTGCAGTAATGGC	0.393																																					p.A27266E		.											.	TTN-636	0			c.C81797A						.						106.0	104.0	105.0					2																	179429062		1912	4119	6031	SO:0001583	missense	7273	exon326			TCTCTTGCAGTAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76874C>A	2.37:g.179429062G>T	ENSP00000465570:p.Ala25625Glu	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	135	31	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	15.43	2.830143	0.50845	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	6.07	6.07	0.98685	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79287	0.4420	M	0.89478	3.035	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.81406	-0.0947	9	0.87932	D	0	.	20.6452	0.99591	0.0:0.0:1.0:0.0	.	18201;18326;18393;25625	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	24698;18201;18393;18326;18199	ENSP00000343764:A24698E;ENSP00000434586:A18201E;ENSP00000340554:A18393E;ENSP00000352154:A18326E	ENSP00000340554:A18393E	A	-	2	0	TTN	179137308	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.030000	0.88816	2.885000	0.99019	0.650000	0.86243	GCA	.		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PDCD1	5133	hgsc.bcm.edu	37	2	242794400	242794400	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:242794400A>G	ENST00000334409.5	-	3	611	c.542T>C	c.(541-543)cTg>cCg	p.L181P		NM_005018.2	NP_005009.2	Q15116	PDCD1_HUMAN	programmed cell death 1	181					apoptotic process (GO:0006915)|humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			endometrium(1)|lung(2)|ovary(1)|prostate(3)|skin(1)	8		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0219)		TAGCAGCACCAGGCTGCCCAG	0.701																																					p.L181P		.											.	PDCD1-69	0			c.T542C						.						21.0	25.0	24.0					2																	242794400		2201	4294	6495	SO:0001583	missense	5133	exon3			AGCACCAGGCTGC	AY206416	CCDS33428.1	2q37.3	2014-01-29			ENSG00000188389	ENSG00000188389		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	8760	protein-coding gene	gene with protein product		600244	"""systemic lupus erythematosus susceptibility 2"""	SLEB2		7851902, 12402038	Standard	NM_005018		Approved	CD279, PD1, hSLE1	uc002wcq.4	Q15116	OTTHUMG00000151342	ENST00000334409.5:c.542T>C	2.37:g.242794400A>G	ENSP00000335062:p.Leu181Pro	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	31	2	NM_005018	0	0	0	0	0	O00517|Q8IX89	Missense_Mutation	SNP	ENST00000334409.5	37	CCDS33428.1	.	.	.	.	.	.	.	.	.	.	A	12.14	1.847285	0.32606	.	.	ENSG00000188389	ENST00000334409	T	0.75050	-0.9	3.28	3.28	0.37604	.	0.710921	0.11710	N	0.536986	T	0.66819	0.2828	N	0.04724	-0.175	0.49213	D	0.999765	D	0.71674	0.998	P	0.60117	0.869	T	0.65265	-0.6210	10	0.48119	T	0.1	-8.6103	8.2856	0.31926	1.0:0.0:0.0:0.0	.	181	Q15116	PDCD1_HUMAN	P	181	ENSP00000335062:L181P	ENSP00000335062:L181P	L	-	2	0	PDCD1	242443073	0.531000	0.26338	0.866000	0.34008	0.103000	0.19146	1.255000	0.32909	1.732000	0.51606	0.254000	0.18369	CTG	.		0.701	PDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322313.1	NM_005018	
PTPRA	5786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	2998529	2998529	+	Silent	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr20:2998529C>T	ENST00000216877.6	+	12	1384	c.984C>T	c.(982-984)gtC>gtT	p.V328V	PTPRA_ENST00000399903.2_Silent_p.V337V|PTPRA_ENST00000318266.5_Silent_p.V328V|PTPRA_ENST00000356147.3_Silent_p.V328V|PTPRA_ENST00000358719.4_Silent_p.V193V|PTPRA_ENST00000380393.3_Silent_p.V337V|PTPRA_ENST00000425918.2_Silent_p.V348V	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	337	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CCACCATCGTCATGGTTACCA	0.433																																					p.V337V		.											.	PTPRA-227	0			c.C1011T						.						114.0	105.0	108.0					20																	2998529		2203	4300	6503	SO:0001819	synonymous_variant	5786	exon17			CATCGTCATGGTT		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.984C>T	20.37:g.2998529C>T		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	57	27	NM_002836	0	0	88	181	93	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Silent	SNP	ENST00000216877.6	37	CCDS13039.1																																																																																			.		0.433	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
ASXL1	171023	bcgsc.ca	37	20	31024236	31024236	+	Nonsense_Mutation	SNP	G	G	T	rs372409311		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr20:31024236G>T	ENST00000375687.4	+	13	4145	c.3721G>T	c.(3721-3723)Gaa>Taa	p.E1241*	ASXL1_ENST00000306058.5_Nonsense_Mutation_p.E1236*	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1241					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CTTTAGTTGTGAAGATCAGAA	0.453			"""F, N, Mis"""		"""MDS, CMML"""																																p.E1241X				Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1-2057	0			c.G3721T						.						89.0	89.0	89.0					20																	31024236		2203	4300	6503	SO:0001587	stop_gained	171023	exon12			AGTTGTGAAGATC	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3721G>T	20.37:g.31024236G>T	ENSP00000364839:p.Glu1241*	Somatic	109	0		WXS	Illumina HiSeq	Phase_1	137	6	NM_015338	0	0	77	78	1	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Nonsense_Mutation	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	G	41	9.093882	0.99064	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	.	.	.	4.56	4.56	0.56223	.	0.356029	0.29775	N	0.011234	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-3.7842	11.2047	0.48762	0.0858:0.0:0.9142:0.0	.	.	.	.	X	1241;1241;1241;1162;1236	.	ENSP00000305119:E1236X	E	+	1	0	ASXL1	30487897	1.000000	0.71417	0.798000	0.32154	0.307000	0.27823	3.450000	0.52957	2.826000	0.97356	0.561000	0.74099	GAA	.		0.453	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
R3HDML	140902	hgsc.bcm.edu	37	20	42969909	42969909	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr20:42969909A>G	ENST00000217043.2	+	2	507	c.335A>G	c.(334-336)cAg>cGg	p.Q112R		NM_178491.2	NP_848586.1	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like	112	SCP.					extracellular region (GO:0005576)	peptidase inhibitor activity (GO:0030414)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)	21		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			GGGCCTTCACAGCTGATGAGA	0.557																																					p.Q112R		.											.	R3HDML-90	0			c.A335G						.						69.0	65.0	66.0					20																	42969909		2203	4300	6503	SO:0001583	missense	140902	exon2			CTTCACAGCTGAT	BC107048	CCDS13329.1	20q13.12	2007-04-26	2005-09-02		ENSG00000101074	ENSG00000101074			16249	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing-like"""				Standard	NM_178491		Approved	dJ881L22.3	uc002xls.2	Q9H3Y0	OTTHUMG00000032524	ENST00000217043.2:c.335A>G	20.37:g.42969909A>G	ENSP00000217043:p.Gln112Arg	Somatic	85	1		WXS	Illumina HiSeq	Phase_I	76	4	NM_178491	0	0	0	0	0		Missense_Mutation	SNP	ENST00000217043.2	37	CCDS13329.1	.	.	.	.	.	.	.	.	.	.	A	14.69	2.610007	0.46527	.	.	ENSG00000101074	ENST00000217043	T	0.09073	3.02	5.71	3.38	0.38709	CAP domain (3);	0.127041	0.53938	D	0.000046	T	0.08133	0.0203	N	0.21194	0.64	0.41211	D	0.986442	P	0.47191	0.891	P	0.48598	0.583	T	0.29971	-0.9994	10	0.10636	T	0.68	.	12.3952	0.55380	0.7421:0.2579:0.0:0.0	.	112	Q9H3Y0	CRSPL_HUMAN	R	112	ENSP00000217043:Q112R	ENSP00000217043:Q112R	Q	+	2	0	R3HDML	42403323	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.367000	0.66127	0.389000	0.25086	0.533000	0.62120	CAG	.		0.557	R3HDML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079344.1	NM_178491	
SCO2	9997	broad.mit.edu	37	22	50962803	50962803	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr22:50962803C>G	ENST00000543927.1	-	2	244	c.38G>C	c.(37-39)aGg>aCg	p.R13T	CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000395693.3_Missense_Mutation_p.R13T|SCO2_ENST00000535425.1_Missense_Mutation_p.R13T|SCO2_ENST00000252785.3_Missense_Mutation_p.R13T	NM_001169109.1	NP_001162580.1	O43819	SCO2_HUMAN	SCO2 cytochrome c oxidase assembly protein	13					cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|eye development (GO:0001654)|in utero embryonic development (GO:0001701)|muscle system process (GO:0003012)|oxidation-reduction process (GO:0055114)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			endometrium(1)|lung(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTGAGAGAGCCTGTGCCAAGC	0.627																																					p.R13T													.	SCO2-226	0			c.G38C						.						20.0	22.0	22.0					22																	50962803		2199	4291	6490	SO:0001583	missense	9997	exon2			GAGAGCCTGTGCC	AL021683	CCDS14095.1	22q13.33	2014-01-30	2012-10-15		ENSG00000130489	ENSG00000130489		"""Mitochondrial respiratory chain complex assembly factors"""	10604	protein-coding gene	gene with protein product		604272	"""SCO (cytochrome oxidase deficient, yeast) homolog 2"", ""SCO cytochrome oxidase deficient homolog 2 (yeast)"", ""myopia 6"""	MYP6		10218584, 16091356, 23643385	Standard	NM_005138		Approved	SCO1L	uc003bma.3	O43819	OTTHUMG00000150251	ENST00000543927.1:c.38G>C	22.37:g.50962803C>G	ENSP00000444433:p.Arg13Thr	Somatic	62	1		WXS	Illumina HiSeq	Phase_I	66	3	NM_001169111	0	0	67	69	2	Q3T1B5|Q9UK87	Missense_Mutation	SNP	ENST00000543927.1	37	CCDS14095.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.277703	0.40294	.	.	ENSG00000130489	ENST00000395693;ENST00000543927;ENST00000535425;ENST00000252785;ENST00000439934;ENST00000423348	D;D;D;D;T;T	0.84589	-1.87;-1.87;-1.87;-1.87;-0.76;-0.76	3.58	2.55	0.30701	.	0.842278	0.09589	N	0.781814	T	0.73024	0.3534	L	0.27053	0.805	0.27181	N	0.960674	P	0.38195	0.622	B	0.36666	0.23	T	0.60772	-0.7197	10	0.17832	T	0.49	-1.3951	6.2448	0.20811	0.0:0.8594:0.0:0.1406	.	13	O43819	SCO2_HUMAN	T	13	ENSP00000379046:R13T;ENSP00000444433:R13T;ENSP00000444242:R13T;ENSP00000252785:R13T;ENSP00000415642:R13T;ENSP00000403570:R13T	ENSP00000252785:R13T	R	-	2	0	SCO2	49309669	0.005000	0.15991	0.532000	0.27989	0.049000	0.14656	1.115000	0.31209	1.062000	0.40625	0.655000	0.94253	AGG	.		0.627	SCO2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317091.1	NM_005138	
ITIH1	3697	hgsc.bcm.edu;broad.mit.edu	37	3	52813483	52813483	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr3:52813483A>G	ENST00000273283.2	+	5	470	c.446A>G	c.(445-447)cAc>cGc	p.H149R	ITIH1_ENST00000537050.1_5'Flank|ITIH1_ENST00000542827.1_Missense_Mutation_p.H149R|ITIH1_ENST00000540715.1_Missense_Mutation_p.H7R	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	149	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TTCACCATCCACCTCACCGTC	0.493																																					p.H149R		.											.	ITIH1-93	0			c.A446G						.						148.0	134.0	139.0					3																	52813483		2203	4300	6503	SO:0001583	missense	3697	exon5			CCATCCACCTCAC		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.446A>G	3.37:g.52813483A>G	ENSP00000273283:p.His149Arg	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	99	5	NM_002215	0	0	0	0	0	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	A	18.00	3.526324	0.64860	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715	T;T;T	0.20738	2.05;2.05;4.85	5.48	4.38	0.52667	Vault protein inter-alpha-trypsin (2);Vault protein inter-alpha-trypsin, metazoa (1);	0.227351	0.47093	D	0.000253	T	0.28764	0.0713	M	0.63428	1.95	0.80722	D	1	P	0.34699	0.464	B	0.42692	0.395	T	0.07635	-1.0762	10	0.59425	D	0.04	-23.1872	10.4273	0.44387	0.5985:0.4015:0.0:0.0	.	149	P19827	ITIH1_HUMAN	R	149;149;7	ENSP00000442584:H149R;ENSP00000273283:H149R;ENSP00000443973:H7R	ENSP00000273283:H149R	H	+	2	0	ITIH1	52788523	1.000000	0.71417	0.906000	0.35671	0.663000	0.39108	4.658000	0.61497	2.094000	0.63399	0.459000	0.35465	CAC	.		0.493	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
U2SURP	23350	hgsc.bcm.edu	37	3	142747194	142747194	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr3:142747194A>C	ENST00000473835.2	+	15	1482	c.1392A>C	c.(1390-1392)gaA>gaC	p.E464D	U2SURP_ENST00000397933.2_Missense_Mutation_p.E55D|U2SURP_ENST00000493598.2_Missense_Mutation_p.E463D	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing	464					RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						TCTTATTTGAAAACCAGACAC	0.284																																					p.E464D		.											.	U2SURP-71	0			c.A1392C						.						63.0	59.0	60.0					3																	142747194		1795	4056	5851	SO:0001583	missense	23350	exon15			ATTTGAAAACCAG	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323	ENST00000473835.2:c.1392A>C	3.37:g.142747194A>C	ENSP00000418563:p.Glu464Asp	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_001080415	0	0	0	0	0	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	Missense_Mutation	SNP	ENST00000473835.2	37	CCDS46928.1	.	.	.	.	.	.	.	.	.	.	A	6.794	0.515419	0.12944	.	.	ENSG00000163714	ENST00000473835;ENST00000319822;ENST00000397933;ENST00000493598;ENST00000480029	T;T;T;T	0.38401	1.14;1.14;1.14;1.14	5.88	5.88	0.94601	SWAP/Surp (3);	0.000000	0.85682	D	0.000000	T	0.12817	0.0311	N	0.01576	-0.805	0.58432	D	0.999999	B;B;B	0.22080	0.052;0.052;0.064	B;B;B	0.23852	0.049;0.013;0.023	T	0.20840	-1.0263	10	0.02654	T	1	-22.1851	11.3358	0.49503	0.9297:0.0:0.0703:0.0	.	463;55;464	O15042-2;O15042-3;O15042	.;.;SR140_HUMAN	D	464;464;55;463;31	ENSP00000418563:E464D;ENSP00000381027:E55D;ENSP00000422011:E463D;ENSP00000417441:E31D	ENSP00000322376:E464D	E	+	3	2	U2SURP	144229884	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.367000	0.52350	2.243000	0.73865	0.533000	0.62120	GAA	.		0.284	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354603.2	NM_001080415	
CP	1356	hgsc.bcm.edu;broad.mit.edu	37	3	148916162	148916162	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr3:148916162C>A	ENST00000264613.6	-	9	1967	c.1705G>T	c.(1705-1707)Ggg>Tgg	p.G569W	CP_ENST00000462336.1_5'UTR	NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	569	F5/8 type A 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	ACCTGTCTCCCATTTGCATGT	0.348																																					p.G569W		.											.	CP-515	0			c.G1705T						.						94.0	88.0	90.0					3																	148916162		2203	4300	6503	SO:0001583	missense	1356	exon9			GTCTCCCATTTGC	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.1705G>T	3.37:g.148916162C>A	ENSP00000264613:p.Gly569Trp	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	93	15	NM_000096	0	0	0	0	0	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	37	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.264268	0.80358	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.98926	-5.24;-5.24	5.46	5.46	0.80206	Cupredoxin (2);	0.052731	0.85682	D	0.000000	D	0.99426	0.9797	H	0.95294	3.65	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98548	1.0635	10	0.87932	D	0	-24.5002	17.4968	0.87719	0.0:1.0:0.0:0.0	.	569;569;569;569	A5PL27;A8K5A4;P00450;Q1L857	.;.;CERU_HUMAN;.	W	569;352	ENSP00000264613:G569W;ENSP00000420545:G352W	ENSP00000264613:G569W	G	-	1	0	CP	150398852	0.114000	0.22134	1.000000	0.80357	0.965000	0.64279	1.720000	0.38022	2.573000	0.86826	0.650000	0.86243	GGG	.		0.348	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
ECT2	1894	hgsc.bcm.edu	37	3	172520417	172520417	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr3:172520417A>G	ENST00000392692.3	+	19	2095	c.1919A>G	c.(1918-1920)gAg>gGg	p.E640G	ECT2_ENST00000417960.1_Missense_Mutation_p.E608G|ECT2_ENST00000441497.2_Missense_Mutation_p.E609G|ECT2_ENST00000232458.5_Missense_Mutation_p.E609G|ECT2_ENST00000427830.1_Missense_Mutation_p.E609G|ECT2_ENST00000540509.1_Missense_Mutation_p.E640G	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	640	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			CATATTAATGAGGATAAGAGA	0.269																																					p.E640G		.											.	ECT2-724	0			c.A1919G						.						44.0	48.0	47.0					3																	172520417		2188	4283	6471	SO:0001583	missense	1894	exon19			TTAATGAGGATAA	AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.1919A>G	3.37:g.172520417A>G	ENSP00000376457:p.Glu640Gly	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	59	3	NM_001258315	0	0	0	0	0	Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	ENST00000392692.3	37	CCDS58860.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.712870	0.89112	.	.	ENSG00000114346	ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000441497;ENST00000540509	T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25	5.38	5.38	0.77491	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.090181	0.85682	D	0.000000	T	0.71728	0.3374	H	0.96175	3.78	0.80722	D	1	P;D;D;D;D	0.67145	0.929;0.966;0.996;0.983;0.991	P;D;D;D;D	0.72075	0.732;0.948;0.976;0.959;0.915	T	0.82123	-0.0613	10	0.87932	D	0	-6.4325	15.3834	0.74679	1.0:0.0:0.0:0.0	.	640;85;640;609;608	Q9H8V3;Q96SJ9;Q9H8V3-3;G5E9L8;Q9H8V3-2	ECT2_HUMAN;.;.;.;.	G	609;640;609;608;609;640	ENSP00000232458:E609G;ENSP00000376457:E640G;ENSP00000401910:E609G;ENSP00000415876:E608G;ENSP00000412259:E609G;ENSP00000443160:E640G	ENSP00000232458:E609G	E	+	2	0	ECT2	174003111	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.825000	0.92029	2.036000	0.60181	0.533000	0.62120	GAG	.		0.269	ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	NM_018098	
FYTTD1	84248	broad.mit.edu;bcgsc.ca	37	3	197501076	197501076	+	Silent	SNP	T	T	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr3:197501076T>C	ENST00000241502.4	+	6	873	c.651T>C	c.(649-651)acT>acC	p.T217T	FYTTD1_ENST00000415708.2_Silent_p.T191T|FYTTD1_ENST00000428395.2_Silent_p.T126T|FYTTD1_ENST00000424384.2_Silent_p.T150T	NM_032288.6	NP_115664.2	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1	217					mRNA export from nucleus (GO:0006406)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		CAAAGAGAACTCGTCAGTAAG	0.378																																					p.T217T													.	FYTTD1-90	0			c.T651C						.						171.0	168.0	169.0					3																	197501076		2203	4300	6503	SO:0001819	synonymous_variant	84248	exon6			GAGAACTCGTCAG	AJ344094	CCDS3329.1, CCDS43196.1, CCDS43196.2	3q29	2011-03-03			ENSG00000122068	ENSG00000122068			25407	protein-coding gene	gene with protein product	"""UAP56-interacting factor"""					19836239	Standard	NM_001011537		Approved	DKFZp761B1514, UIF	uc003fyi.2	Q96QD9	OTTHUMG00000155453	ENST00000241502.4:c.651T>C	3.37:g.197501076T>C		Somatic	142	0		WXS	Illumina HiSeq	Phase_I	127	5	NM_032288	0	0	0	0	0	A8MY74|B2RCB2|B7Z3R4|B7Z7V1|B7Z8I0|B7ZAJ3|C9J7P6|C9JNG6|C9JTH3|C9JY50|Q96SL9|Q9BQI8	Silent	SNP	ENST00000241502.4	37	CCDS3329.1																																																																																			.		0.378	FYTTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340185.3	NM_032288	
ADH4	127	bcgsc.ca	37	4	100052684	100052684	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr4:100052684G>T	ENST00000265512.7	-	6	888	c.814C>A	c.(814-816)Ctt>Att	p.L272I	RP11-696N14.1_ENST00000500358.2_RNA|ADH4_ENST00000423445.1_Missense_Mutation_p.L291I|ADH4_ENST00000505590.1_Missense_Mutation_p.L291I|ADH4_ENST00000508393.1_Missense_Mutation_p.L291I	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	272					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		GCACAGTCAAGGGCAAAATCC	0.418																																					p.L272I													.	ADH4-228	0			c.C814A						.						117.0	116.0	116.0					4																	100052684		2203	4300	6503	SO:0001583	missense	127	exon6			AGTCAAGGGCAAA	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.814C>A	4.37:g.100052684G>T	ENSP00000265512:p.Leu272Ile	Somatic	104	0		WXS	Illumina HiSeq	Phase_1	96	5	NM_000670	0	0	2	2	0	A8K470|B4DIE7|C9J4A9|Q8TCD7	Missense_Mutation	SNP	ENST00000265512.7	37	CCDS34032.1	.	.	.	.	.	.	.	.	.	.	G	5.819	0.335351	0.11013	.	.	ENSG00000198099	ENST00000508393;ENST00000265512;ENST00000423445;ENST00000505590	T;T;T;T	0.09817	2.94;2.94;2.94;2.94	4.39	-8.79	0.00820	Alcohol dehydrogenase, C-terminal (1);	0.732597	0.12061	N	0.503188	T	0.04907	0.0132	N	0.17631	0.505	0.24104	N	0.995862	B;B	0.02656	0.0;0.0	B;B	0.16722	0.016;0.01	T	0.31833	-0.9929	10	0.59425	D	0.04	0.0764	5.4296	0.16446	0.4364:0.0:0.2042:0.3594	.	291;272	P08319-2;P08319	.;ADH4_HUMAN	I	291;272;291;291	ENSP00000424630:L291I;ENSP00000265512:L272I;ENSP00000397939:L291I;ENSP00000425416:L291I	ENSP00000265512:L272I	L	-	1	0	ADH4	100271707	0.067000	0.21026	0.009000	0.14445	0.005000	0.04900	-0.609000	0.05635	-2.142000	0.00804	-0.912000	0.02778	CTT	.		0.418	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670	
PRSS12	8492	hgsc.bcm.edu	37	4	119273492	119273492	+	Silent	SNP	A	A	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr4:119273492A>T	ENST00000296498.3	-	1	666	c.384T>A	c.(382-384)gcT>gcA	p.A128A		NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	128	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						CTCGCAGCTGAGCCCAGCTCG	0.706																																					p.A128A		.											.	PRSS12-91	0			c.T384A						.						9.0	10.0	10.0					4																	119273492		2194	4283	6477	SO:0001819	synonymous_variant	8492	exon1			CAGCTGAGCCCAG	AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.384T>A	4.37:g.119273492A>T		Somatic	3	0		WXS	Illumina HiSeq	Phase_I	8	4	NM_003619	0	0	0	0	0	Q9UP16	Silent	SNP	ENST00000296498.3	37	CCDS3709.1																																																																																			.		0.706	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256516.2		
SLC12A7	10723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1094290	1094290	+	Silent	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr5:1094290C>T	ENST00000264930.5	-	2	241	c.198G>A	c.(196-198)ggG>ggA	p.G66G		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	66					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CCATGTTCTTCCCTTCAAAGA	0.468																																					p.G66G		.											.	SLC12A7-138	0			c.G198A						.						128.0	120.0	123.0					5																	1094290		2203	4300	6503	SO:0001819	synonymous_variant	10723	exon2			GTTCTTCCCTTCA	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.198G>A	5.37:g.1094290C>T		Somatic	171	0		WXS	Illumina HiSeq	Phase_I	87	49	NM_006598	0	0	3	23	20	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	ENST00000264930.5	37	CCDS34129.1																																																																																			.		0.468	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
SPOCK1	6695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	136314458	136314458	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr5:136314458C>T	ENST00000394945.1	-	11	1374	c.1205G>A	c.(1204-1206)cGg>cAg	p.R402Q	SPOCK1_ENST00000282223.7_Missense_Mutation_p.R402Q|SPOCK1_ENST00000509978.1_5'Flank	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	402					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCCCAGCTCCCGTTCATATTC	0.517																																					p.R402Q		.											.	SPOCK1-91	0			c.G1205A						.						152.0	131.0	138.0					5																	136314458		2203	4300	6503	SO:0001583	missense	6695	exon11			AGCTCCCGTTCAT	AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.1205G>A	5.37:g.136314458C>T	ENSP00000378401:p.Arg402Gln	Somatic	194	2		WXS	Illumina HiSeq	Phase_I	101	62	NM_004598	0	0	49	267	218	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	ENST00000394945.1	37	CCDS4191.1	.	.	.	.	.	.	.	.	.	.	C	9.870	1.198629	0.22121	.	.	ENSG00000152377	ENST00000394945;ENST00000282223	T;T	0.43294	0.95;0.95	5.16	0.792	0.18625	.	0.370343	0.27622	N	0.018560	T	0.18002	0.0432	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.13442	-1.0509	10	0.28530	T	0.3	.	5.6023	0.17361	0.0:0.4801:0.1521:0.3678	.	402	Q08629	TICN1_HUMAN	Q	402	ENSP00000378401:R402Q;ENSP00000282223:R402Q	ENSP00000282223:R402Q	R	-	2	0	SPOCK1	136342357	0.125000	0.22332	0.376000	0.26042	0.889000	0.51656	-0.031000	0.12287	0.202000	0.20498	0.557000	0.71058	CGG	.		0.517	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1	NM_004598	
PCDHA12	56137	hgsc.bcm.edu	37	5	140257068	140257068	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr5:140257068G>C	ENST00000398631.2	+	1	2011	c.2011G>C	c.(2011-2013)Gag>Cag	p.E671Q	PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	671	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCGCTGGTGGAGAACGGCCA	0.667																																					p.E671Q	Pancreas(113;759 1672 13322 24104 50104)	.											.	.	0			c.G2011C						.						49.0	54.0	52.0					5																	140257068		2203	4299	6502	SO:0001583	missense	56137	exon1			CTGGTGGAGAACG	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.2011G>C	5.37:g.140257068G>C	ENSP00000381628:p.Glu671Gln	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	38	2	NM_018903	0	0	8	8	0	O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342860	0.24339	.	.	ENSG00000251664	ENST00000398631	T	0.51574	0.7	4.81	3.94	0.45596	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.59362	0.2188	M	0.78456	2.415	0.09310	N	1	D;D	0.58620	0.982;0.983	P;P	0.53722	0.733;0.714	T	0.53208	-0.8471	9	0.87932	D	0	.	8.6707	0.34147	0.1783:0.0:0.8217:0.0	.	671;671	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	Q	671	ENSP00000381628:E671Q	ENSP00000381628:E671Q	E	+	1	0	PCDHA12	140237252	1.000000	0.71417	0.084000	0.20598	0.073000	0.16967	8.767000	0.91732	1.014000	0.39417	0.561000	0.74099	GAG	.		0.667	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
NYAP1	222950	broad.mit.edu;bcgsc.ca	37	7	100086267	100086267	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr7:100086267C>T	ENST00000300179.2	+	4	1082	c.923C>T	c.(922-924)cCg>cTg	p.P308L	NYAP1_ENST00000423930.1_Missense_Mutation_p.P308L|NYAP1_ENST00000454988.1_Missense_Mutation_p.P251L	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	308	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												TCAGCCCTCCCGAGCCGGAGG	0.697																																					p.P308L													.	.	0			c.C923T						.						49.0	52.0	51.0					7																	100086267		2203	4295	6498	SO:0001583	missense	222950	exon4			CCCTCCCGAGCCG	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.923C>T	7.37:g.100086267C>T	ENSP00000300179:p.Pro308Leu	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	148	6	NM_173564	0	0	0	0	0	Q6U9Y3|Q8N1V0	Missense_Mutation	SNP	ENST00000300179.2	37	CCDS5696.1	.	.	.	.	.	.	.	.	.	.	C	3.964	-0.009763	0.07727	.	.	ENSG00000166924	ENST00000300179;ENST00000423930;ENST00000454988	T;T;T	0.41758	0.99;0.99;0.99	4.66	2.56	0.30785	.	0.313567	0.23234	N	0.050440	T	0.23210	0.0561	L	0.36672	1.1	0.46396	D	0.999022	P;P	0.40332	0.661;0.713	B;B	0.24541	0.054;0.047	T	0.07443	-1.0772	10	0.66056	D	0.02	-3.7091	5.9193	0.19073	0.2826:0.543:0.1744:0.0	.	251;308	C9JS30;Q6ZVC0	.;CG051_HUMAN	L	308;308;251	ENSP00000300179:P308L;ENSP00000411861:P308L;ENSP00000394424:P251L	ENSP00000300179:P308L	P	+	2	0	C7orf51	99924203	0.003000	0.15002	0.900000	0.35374	0.035000	0.12851	0.636000	0.24644	0.934000	0.37316	0.407000	0.27541	CCG	.		0.697	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
POP1	10940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	99142345	99142345	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr8:99142345C>T	ENST00000401707.2	+	5	707	c.626C>T	c.(625-627)gCc>gTc	p.A209V	POP1_ENST00000349693.3_Missense_Mutation_p.A209V	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	209					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)	p.A209V(1)		autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			ATCTGGCACGCCAAGCGGTTT	0.488																																					p.A209V		.											.	POP1-154	1	Substitution - Missense(1)	lung(1)	c.C626T						.						75.0	72.0	73.0					8																	99142345		2203	4300	6503	SO:0001583	missense	10940	exon5			GGCACGCCAAGCG	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.626C>T	8.37:g.99142345C>T	ENSP00000385787:p.Ala209Val	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	115	45	NM_001145860	0	0	3	5	2	A8K5W9|Q15037	Missense_Mutation	SNP	ENST00000401707.2	37	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	C	36	5.647996	0.96714	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.61980	0.06;0.06	5.81	5.81	0.92471	Ribonuclease P/MRP, subunit POP1 (1);	0.139825	0.47093	D	0.000247	T	0.76905	0.4053	M	0.66378	2.025	0.80722	D	1	D	0.56287	0.975	D	0.65323	0.934	T	0.75004	-0.3470	9	.	.	.	-3.0517	17.8794	0.88835	0.0:1.0:0.0:0.0	.	209	Q99575	POP1_HUMAN	V	209	ENSP00000385787:A209V;ENSP00000339529:A209V	.	A	+	2	0	POP1	99211521	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.731000	0.84895	2.746000	0.94184	0.591000	0.81541	GCC	.		0.488	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
PUF60	22827	broad.mit.edu	37	8	144898885	144898885	+	Silent	SNP	G	G	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr8:144898885G>A	ENST00000526683.1	-	12	2040	c.1485C>T	c.(1483-1485)cgC>cgT	p.R495R	PUF60_ENST00000453551.2_Silent_p.R452R|PUF60_ENST00000349157.6_Silent_p.R478R|SCRIB_ENST00000377533.3_5'Flank|PUF60_ENST00000313352.7_Silent_p.R435R|PUF60_ENST00000524570.1_5'Flank|SCRIB_ENST00000356994.2_5'Flank|SCRIB_ENST00000320476.3_5'Flank|PUF60_ENST00000456095.2_Silent_p.R466R|PUF60_ENST00000527197.1_Silent_p.R449R	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	495	Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.|RRM 3; atypical. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			AGATGATGACGCGGTTCACGG	0.522																																					p.R495R													.	.	0			c.C1485T						.						269.0	288.0	282.0					8																	144898885		2120	4219	6339	SO:0001819	synonymous_variant	22827	exon12			GATGACGCGGTTC	AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.1485C>T	8.37:g.144898885G>A		Somatic	286	0		WXS	Illumina HiSeq	Phase_I	247	7	NM_078480	0	0	227	238	11	A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Silent	SNP	ENST00000526683.1	37	CCDS47934.1																																																																																			.		0.522	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382222.1	NM_014281	
C9orf66	157983	hgsc.bcm.edu	37	9	215109	215109	+	Silent	SNP	G	G	T			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr9:215109G>T	ENST00000382387.2	-	1	784	c.288C>A	c.(286-288)ctC>ctA	p.L96L	DOCK8_ENST00000453981.1_Intron|DOCK8_ENST00000432829.2_Intron	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	96										central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TGCAGGGGCCGAGGCCGGACG	0.751																																					p.L96L		.											.	C9orf66-514	0			c.C288A						.						2.0	2.0	2.0					9																	215109		1347	3061	4408	SO:0001819	synonymous_variant	157983	exon1			GGGGCCGAGGCCG	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.288C>A	9.37:g.215109G>T		Somatic	4	2		WXS	Illumina HiSeq	Phase_I	6	6	NM_152569	0	0	0	0	0	Q96NB0	Silent	SNP	ENST00000382387.2	37	CCDS6439.1																																																																																			.		0.751	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
SSX1	6756	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	48123289	48123289	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chrX:48123289G>A	ENST00000376919.3	+	6	539	c.403G>A	c.(403-405)Gat>Aat	p.D135N		NM_001278691.1|NM_005635.2	NP_001265620.1|NP_005626.1	Q16384	SSX1_HUMAN	synovial sarcoma, X breakpoint 1	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|transcription corepressor activity (GO:0003714)		SS18/SSX1(1169)|SS18L1/SSX1(2)	endometrium(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9						CCCACAAAACGATGGGAAACA	0.423			T	SS18	synovial sarcoma																																p.D135N	Esophageal Squamous(175;994 1982 2214 6527 18857)	.		Dom	yes		X	Xp11.23-p11.22	6756	"""synovial sarcoma, X breakpoint 1"""		M	.	SSX1-522	0			c.G403A						.						153.0	141.0	145.0					X																	48123289		2203	4299	6502	SO:0001583	missense	6756	exon6			CAAAACGATGGGA	BC001003	CCDS14290.1	Xp11.23	2009-03-12			ENSG00000126752	ENSG00000126752			11335	protein-coding gene	gene with protein product	"""cancer/testis antigen family 5, member 1"""	312820				7655467	Standard	NM_005635		Approved	CT5.1	uc004djb.1	Q16384	OTTHUMG00000021488	ENST00000376919.3:c.403G>A	X.37:g.48123289G>A	ENSP00000366118:p.Asp135Asn	Somatic	334	0		WXS	Illumina HiSeq	Phase_I	345	19	NM_005635	0	0	0	0	0	A3KN76|Q08AJ2|Q5JQ64	Missense_Mutation	SNP	ENST00000376919.3	37	CCDS14290.1	.	.	.	.	.	.	.	.	.	.	N	0.021	-1.430282	0.01117	.	.	ENSG00000126752	ENST00000376919	T	0.07327	3.2	2.1	1.21	0.21127	.	1.694760	0.03640	N	0.239416	T	0.04318	0.0119	L	0.38175	1.15	0.09310	N	1	P	0.47545	0.897	B	0.29524	0.103	T	0.32903	-0.9889	10	0.02654	T	1	.	4.011	0.09623	0.2273:0.0:0.7727:0.0	.	135	Q16384	SSX1_HUMAN	N	135	ENSP00000366118:D135N	ENSP00000366118:D135N	D	+	1	0	SSX1	48008233	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.159000	0.10056	0.336000	0.23639	0.380000	0.24917	GAT	.		0.423	SSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056485.1	NM_005635	
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	109694572	109694572	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chrX:109694572T>C	ENST00000465301.2	+	3	973	c.727T>C	c.(727-729)Tcc>Ccc	p.S243P	RGAG1_ENST00000540313.1_Missense_Mutation_p.S243P	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	243										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CGAAGCAATGTCCAAAGTGCT	0.478																																					p.S243P		.											.	RGAG1-132	0			c.T727C						.						117.0	106.0	110.0					X																	109694572		2203	4300	6503	SO:0001583	missense	57529	exon3			GCAATGTCCAAAG	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.727T>C	X.37:g.109694572T>C	ENSP00000419786:p.Ser243Pro	Somatic	195	2		WXS	Illumina HiSeq	Phase_I	180	55	NM_020769	0	0	0	0	0	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	T	16.51	3.142250	0.57044	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.59772	0.24;0.24	4.02	4.02	0.46733	.	0.000000	0.35805	N	0.002961	T	0.55257	0.1909	N	0.19112	0.55	0.37148	D	0.902013	D	0.89917	1.0	D	0.85130	0.997	T	0.59026	-0.7531	9	.	.	.	-7.523	5.2635	0.15586	0.0:0.127:0.0:0.873	.	243	Q8NET4	RGAG1_HUMAN	P	243	ENSP00000419786:S243P;ENSP00000441452:S243P	.	S	+	1	0	RGAG1	109581228	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.808000	0.38912	1.792000	0.52537	0.486000	0.48141	TCC	.		0.478	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
USP26	83844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	132160221	132160221	+	Silent	SNP	A	A	C			TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chrX:132160221A>C	ENST00000511190.1	-	6	2497	c.2028T>G	c.(2026-2028)ccT>ccG	p.P676P	USP26_ENST00000370832.1_Silent_p.P676P|USP26_ENST00000406273.1_Silent_p.P676P	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	676	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					GGCTGCTGGCAGGTTTACCTC	0.428																																					p.P676P	NSCLC(104;342 1621 36940 47097 52632)	.											.	USP26-661	0			c.T2028G						.						83.0	79.0	81.0					X																	132160221		2203	4299	6502	SO:0001819	synonymous_variant	83844	exon1			GCTGGCAGGTTTA	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2028T>G	X.37:g.132160221A>C		Somatic	215	0		WXS	Illumina HiSeq	Phase_I	196	41	NM_031907	0	0	0	0	0	B9WRT6|Q5H9H4	Silent	SNP	ENST00000511190.1	37	CCDS14635.1																																																																																			.		0.428	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907	
NLGN4Y	22829	hgsc.bcm.edu	37	Y	16952767	16952767	+	3'UTR	SNP	C	C	T	rs373089425		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chrY:16952767C>T	ENST00000476359.1	+	0	2621							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.A692A(1)		large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						ACATCTTAGCCTTTGCGGCGC	0.502																																					p.A692A		.											.	.	1	Substitution - coding silent(1)	prostate(1)	c.C2076T						.	C	,	0,571		0,571	53.0	72.0	66.0		1572,2076	-3.8	0.0	Y		66	1,1871		1,1871	no	coding-synonymous,coding-synonymous	NLGN4Y	NM_001206850.1,NM_014893.4	,	1,2442	T,C		0.0534,0.0,0.0409	,	524/649,692/817	16952767	1,2442	974	2291	3265	SO:0001624	3_prime_UTR_variant	22829	exon6			CTTAGCCTTTGCG		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*2618C>T	Y.37:g.16952767C>T		Somatic	2	1		WXS	Illumina HiSeq	Phase_I	5	4	NM_014893	0	0	0	0	0	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Silent	SNP	ENST00000476359.1	37																																																																																				.		0.502	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893	
LSM14A	26065	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	34710448	34710449	+	Frame_Shift_Del	DEL	AG	AG	-	rs372366966		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr19:34710448_34710449delAG	ENST00000433627.5	+	7	1009_1010	c.934_935delAG	c.(934-936)agafs	p.R312fs	LSM14A_ENST00000540746.2_Frame_Shift_Del_p.R271fs|LSM14A_ENST00000544216.3_Frame_Shift_Del_p.R312fs	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	312	DFDF. {ECO:0000255|PROSITE- ProRule:PRU00845}.				cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.R312K(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					AGAGATTGACAGAGAGTTTCAT	0.327																																					p.312_312del		.											.	LSM14A-91	1	Substitution - Missense(1)	large_intestine(1)	c.934_935del						.																																			SO:0001589	frameshift_variant	26065	exon7			.	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.934_935delAG	19.37:g.34710452_34710453delAG	ENSP00000413964:p.Arg312fs	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	142	59	NM_001114093	0	0	0	0	0	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Frame_Shift_Del	DEL	ENST00000433627.5	37	CCDS46040.1																																																																																			.		0.327	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
ACTR1B	10120	broad.mit.edu;bcgsc.ca	37	2	98275011	98275014	+	Frame_Shift_Del	DEL	GAGT	GAGT	-	rs200965492		TCGA-BQ-5879-01A-11D-1589-08	TCGA-BQ-5879-11A-01D-1589-08	GAGT	GAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c4bbd9ac-1407-4318-a83b-19f1b5b92604	23e170f1-858d-4c25-95c7-ef04b3ffa05a	g.chr2:98275011_98275014delGAGT	ENST00000289228.5	-	6	749_752	c.533_536delACTC	c.(532-537)cactccfs	p.HS178fs		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	178					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)			endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						CCGCATGATGGAGTGAGGCATGGC	0.603																																					p.178_179del													.	ACTR1B-91	0			c.533_536del						.																																			SO:0001589	frameshift_variant	10120	exon6			ATGATGGAGTGAG	X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.533_536delACTC	2.37:g.98275011_98275014delGAGT	ENSP00000289228:p.His178fs	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	67	10	NM_005735	0	0	0	0	0	D3DVH2|Q53SK5|Q9BRB7	Frame_Shift_Del	DEL	ENST00000289228.5	37	CCDS2033.1																																																																																			.		0.603	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735	
