#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGRN	375790	hgsc.bcm.edu	37	1	984366	984366	+	Silent	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:984366C>T	ENST00000379370.2	+	24	4275	c.4225C>T	c.(4225-4227)Ctg>Ttg	p.L1409L		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1409	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TCAGGGGCTGCTGCTGTACAA	0.706																																					p.L1409L		.											.	AGRN-136	0			c.C4225T						.						8.0	8.0	8.0					1																	984366		2162	4262	6424	SO:0001819	synonymous_variant	375790	exon24			GGGCTGCTGCTGT	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.4225C>T	1.37:g.984366C>T		Somatic	6	2		WXS	Illumina HiSeq	Phase_I	12	11	NM_198576	0	0	19	36	17	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Silent	SNP	ENST00000379370.2	37	CCDS30551.1																																																																																			.		0.706	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27106982	27106982	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:27106982T>C	ENST00000324856.7	+	20	6964	c.6593T>C	c.(6592-6594)tTc>tCc	p.F2198S	ARID1A_ENST00000540690.1_Missense_Mutation_p.F526S|ARID1A_ENST00000374152.2_Missense_Mutation_p.F1815S|ARID1A_ENST00000457599.2_Missense_Mutation_p.F1981S	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2198					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTCCTGGGCTTCCTAGAGGAC	0.607			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.F2198S		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A-584	0			c.T6593C						.						72.0	69.0	70.0					1																	27106982		2203	4300	6503	SO:0001583	missense	8289	exon20			TGGGCTTCCTAGA	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6593T>C	1.37:g.27106982T>C	ENSP00000320485:p.Phe2198Ser	Somatic	96	1		WXS	Illumina HiSeq	Phase_I	108	14	NM_006015	0	0	15	18	3	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.149005	0.57151	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.01	5.01	0.66863	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.71753	0.3377	M	0.85542	2.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	T	0.77464	-0.2578	10	0.87932	D	0	-7.6982	15.1629	0.72798	0.0:0.0:0.0:1.0	.	1815;2198;1981	O14497-3;O14497;O14497-2	.;ARI1A_HUMAN;.	S	2198;1981;1815;526	ENSP00000320485:F2198S;ENSP00000387636:F1981S;ENSP00000363267:F1815S;ENSP00000442437:F526S	ENSP00000320485:F2198S	F	+	2	0	ARID1A	26979569	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.627000	0.83176	2.236000	0.73375	0.482000	0.46254	TTC	.		0.607	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	39775962	39775962	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:39775962C>A	ENST00000372915.3	+	24	3064	c.2977C>A	c.(2977-2979)Ctt>Att	p.L993I	MACF1_ENST00000564288.1_Missense_Mutation_p.L988I|MACF1_ENST00000361689.2_Missense_Mutation_p.L993I|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000317713.7_Missense_Mutation_p.L993I|MACF1_ENST00000567887.1_Missense_Mutation_p.L1025I|MACF1_ENST00000545844.1_Missense_Mutation_p.L993I|MACF1_ENST00000539005.1_Missense_Mutation_p.L993I			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	993					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TATGAAGAACCTTCAGGCCCA	0.463																																					p.L993I		.											.	MACF1-165	0			c.C2977A						.						114.0	94.0	101.0					1																	39775962		2203	4300	6503	SO:0001583	missense	23499	exon26			AAGAACCTTCAGG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.2977C>A	1.37:g.39775962C>A	ENSP00000362006:p.Leu993Ile	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	53	12	NM_012090	0	0	1	1	0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.013512|4.013512	0.75161|0.75161	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262|ENST00000372925	D;D;D;D;D;D;D|.	0.95035|.	-1.71;-1.73;-1.71;-1.74;-1.62;-3.08;-3.59|.	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	.|.	.|.	.|.	.|.	T|T	0.77987|0.77987	0.4213|0.4213	M|M	0.87456|0.87456	2.885|2.885	0.80722|0.80722	D|D	1|1	P;D;D|.	0.89917|.	0.524;0.997;1.0|.	B;P;D|.	0.78314|.	0.3;0.839;0.991|.	T|T	0.80953|0.80953	-0.1152|-0.1152	9|5	0.72032|.	D|.	0.01|.	.|.	12.1581|12.1581	0.54089|0.54089	0.0:0.9218:0.0:0.0782|0.0:0.9218:0.0:0.0782	.|.	993;993;958|.	F8W8Q1;Q9UPN3-2;Q9UPN3-3|.	.;.;.|.	I|H	993;993;993;993;993;951;1142|126	ENSP00000439537:L993I;ENSP00000362006:L993I;ENSP00000354573:L993I;ENSP00000313438:L993I;ENSP00000444364:L993I;ENSP00000435070:L951I;ENSP00000437059:L1142I|.	ENSP00000313438:L993I|.	L|P	+|+	1|2	0|0	MACF1|MACF1	39548549|39548549	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.721000|0.721000	0.41392|0.41392	3.237000|3.237000	0.51344|0.51344	2.430000|2.430000	0.82344|0.82344	0.655000|0.655000	0.94253|0.94253	CTT|CCT	.		0.463	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
HIVEP3	59269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	41976755	41976755	+	Silent	SNP	G	G	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:41976755G>C	ENST00000372583.1	-	9	7473	c.6588C>G	c.(6586-6588)ccC>ccG	p.P2196P	HIVEP3_ENST00000429157.2_Silent_p.P2195P|HIVEP3_ENST00000372584.1_Silent_p.P2195P|HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000247584.5_Silent_p.P2196P	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2196					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TCCCACCGATGGGAATCAAGG	0.667																																					p.P2196P		.											.	HIVEP3-157	0			c.C6588G						.						101.0	103.0	102.0					1																	41976755		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon9			ACCGATGGGAATC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.6588C>G	1.37:g.41976755G>C		Somatic	149	0		WXS	Illumina HiSeq	Phase_I	122	22	NM_024503	0	0	1	1	0	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	CCDS463.1																																																																																			.		0.667	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
HECTD3	79654	hgsc.bcm.edu	37	1	45476719	45476719	+	Silent	SNP	G	G	A	rs375165079		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:45476719G>A	ENST00000372172.4	-	1	282	c.211C>T	c.(211-213)Ctg>Ttg	p.L71L	UROD_ENST00000246337.4_5'Flank|HECTD3_ENST00000372168.3_5'Flank	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	71					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					CGCAGCCCCAGGCCCTCTGCC	0.736													G|||	1	0.000199681	0.0	0.0	5008	,	,		10970	0.0		0.001	False		,,,				2504	0.0				p.L71L		.											.	HECTD3-658	0			c.C211T						.	G		0,2960		0,0,1480	2.0	3.0	3.0		211	2.6	1.0	1		3	4,6714		0,4,3355	no	coding-synonymous	HECTD3	NM_024602.5		0,4,4835	AA,AG,GG		0.0595,0.0,0.0413		71/862	45476719	4,9674	1480	3359	4839	SO:0001819	synonymous_variant	79654	exon1			GCCCCAGGCCCTC	BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.211C>T	1.37:g.45476719G>A		Somatic	5	1		WXS	Illumina HiSeq	Phase_I	2	2	NM_024602	0	0	0	0	0	B3KPV7|B3KRH4|Q5T448|Q9H783	Silent	SNP	ENST00000372172.4	37	CCDS41318.1																																																																																			.		0.736	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023734.1	NM_024602	
NTNG1	22854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	107937850	107937850	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:107937850C>A	ENST00000370068.1	+	4	1808	c.962C>A	c.(961-963)aCt>aAt	p.T321N	NTNG1_ENST00000370066.1_Missense_Mutation_p.T321N|NTNG1_ENST00000370071.2_Missense_Mutation_p.T321N|NTNG1_ENST00000370072.3_Missense_Mutation_p.T321N|NTNG1_ENST00000370073.2_Missense_Mutation_p.T321N|NTNG1_ENST00000370065.1_Missense_Mutation_p.T321N|NTNG1_ENST00000370074.4_Missense_Mutation_p.T321N|NTNG1_ENST00000370067.1_Missense_Mutation_p.T321N|NTNG1_ENST00000370061.3_Missense_Mutation_p.T321N|NTNG1_ENST00000370070.2_Missense_Mutation_p.T321N|NTNG1_ENST00000542803.1_Missense_Mutation_p.T321N			Q9Y2I2	NTNG1_HUMAN	netrin G1	321	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		GAGCACAACACTACAGGTCCA	0.493																																					p.T321N		.											.	NTNG1-140	0			c.C962A						.						203.0	192.0	196.0					1																	107937850		2203	4300	6503	SO:0001583	missense	22854	exon4			ACAACACTACAGG	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.962C>A	1.37:g.107937850C>A	ENSP00000359085:p.Thr321Asn	Somatic	203	0		WXS	Illumina HiSeq	Phase_I	199	35	NM_001113228	0	0	0	0	0	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	C	32	5.127060	0.94429	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370064;ENST00000370062;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	5.8	5.8	0.92144	EGF-like, laminin (3);EGF-like region, conserved site (1);	0.000000	0.64402	D	0.000006	D	0.87366	0.6159	H	0.98487	4.245	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;0.98;1.0	D;D;D;D;D	0.91635	0.997;0.994;0.999;0.912;0.998	D	0.91580	0.5278	10	0.87932	D	0	.	20.0637	0.97700	0.0:1.0:0.0:0.0	.	321;321;321;321;321	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	N	321;321;321;321;321;321;321;321;82;82;321;321;321;321;321;321	ENSP00000359090:T321N;ENSP00000359088:T321N;ENSP00000440561:T321N;ENSP00000359078:T321N;ENSP00000359089:T321N;ENSP00000359087:T321N;ENSP00000359091:T321N;ENSP00000359085:T321N;ENSP00000359084:T321N;ENSP00000359083:T321N;ENSP00000359082:T321N	ENSP00000294649:T321N	T	+	2	0	NTNG1	107739373	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	7.818000	0.86416	2.751000	0.94390	0.650000	0.86243	ACT	.		0.493	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917	
IGSF3	3321	hgsc.bcm.edu;broad.mit.edu	37	1	117131439	117131439	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:117131439C>T	ENST00000369486.3	-	8	3082	c.2317G>A	c.(2317-2319)Gag>Aag	p.E773K	IGSF3_ENST00000369483.1_Missense_Mutation_p.E793K|IGSF3_ENST00000318837.6_Missense_Mutation_p.E793K	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	773	Ig-like C2-type 6.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TCGCTGACCTCGGCTCTCTGG	0.627																																					p.E793K		.											.	IGSF3-92	0			c.G2377A						.						29.0	29.0	29.0					1																	117131439		2201	4295	6496	SO:0001583	missense	3321	exon9			TGACCTCGGCTCT	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2317G>A	1.37:g.117131439C>T	ENSP00000358498:p.Glu773Lys	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	56	12	NM_001542	0	0	1	1	0	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152472	0.57259	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.64438	-0.1;-0.1;-0.1	3.98	3.01	0.34805	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.410465	0.24846	N	0.035140	T	0.43634	0.1256	M	0.66939	2.045	0.49483	D	0.999798	P;P;P	0.45212	0.604;0.853;0.656	B;B;B	0.38106	0.073;0.265;0.12	T	0.50285	-0.8846	10	0.41790	T	0.15	-28.9037	10.5216	0.44922	0.0:0.6523:0.3476:0.0	.	793;773;793	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	K	773;793;793	ENSP00000358498:E773K;ENSP00000358495:E793K;ENSP00000321184:E793K	ENSP00000321184:E793K	E	-	1	0	IGSF3	116932962	0.956000	0.32656	0.994000	0.49952	0.981000	0.71138	2.102000	0.41796	2.050000	0.60909	0.462000	0.41574	GAG	.		0.627	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
SELL	6402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169677647	169677647	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:169677647C>T	ENST00000236147.4	-	3	582	c.422G>A	c.(421-423)tGc>tAc	p.C141Y	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	128	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					GATCTCCACGCAGTCCTCCTT	0.488																																					p.C141Y		.											.	SELL-90	0			c.G422A						.						99.0	98.0	98.0					1																	169677647		2057	4216	6273	SO:0001583	missense	6402	exon3			TCCACGCAGTCCT	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.422G>A	1.37:g.169677647C>T	ENSP00000236147:p.Cys141Tyr	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	86	23	NM_000655	0	0	1	1	0	B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	ENST00000236147.4	37	CCDS53427.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592012	0.86953	.	.	ENSG00000188404	ENST00000236147	T	0.61980	0.06	5.71	5.71	0.89125	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.56097	D	0.000024	D	0.84279	0.5437	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88376	0.2998	10	0.87932	D	0	-22.4594	18.4088	0.90543	0.0:1.0:0.0:0.0	.	141;128	Q8WW79;P14151	.;LYAM1_HUMAN	Y	141	ENSP00000236147:C141Y	ENSP00000236147:C141Y	C	-	2	0	SELL	167944271	1.000000	0.71417	0.997000	0.53966	0.938000	0.57974	7.487000	0.81328	2.698000	0.92095	0.650000	0.86243	TGC	.		0.488	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655	
FMN2	56776	hgsc.bcm.edu	37	1	240371469	240371469	+	Silent	SNP	C	C	T	rs199920451		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr1:240371469C>T	ENST00000319653.9	+	5	3587	c.3357C>T	c.(3355-3357)ccC>ccT	p.P1119P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1119	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.P1262P(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CGGGCATACCCCCTCCTCCCC	0.716																																					p.P1119P		.											.	FMN2-145	1	Substitution - coding silent(1)	prostate(1)	c.C3357T						.						8.0	10.0	9.0					1																	240371469		2095	4131	6226	SO:0001819	synonymous_variant	56776	exon5			CATACCCCCTCCT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3357C>T	1.37:g.240371469C>T		Somatic	19	2		WXS	Illumina HiSeq	Phase_I	31	3	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			C|0.999;T|0.001		0.716	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	16918967	16918967	+	Missense_Mutation	SNP	G	G	A	rs143741363		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr10:16918967G>A	ENST00000377833.4	-	57	9100	c.9035C>T	c.(9034-9036)cCg>cTg	p.P3012L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3012	CUB 22. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAGCAGAACCGGCCCAGCGAT	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		17695	0.001		0.0	False		,,,				2504	0.0				p.P3012L		.											.	CUBN-166	0			c.C9035T						.	G	LEU/PRO	2,4404	4.2+/-10.8	0,2,2201	124.0	108.0	114.0		9035	5.8	0.3	10	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	no	missense	CUBN	NM_001081.3	98	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	probably-damaging	3012/3624	16918967	3,13003	2203	4300	6503	SO:0001583	missense	8029	exon57			AGAACCGGCCCAG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9035C>T	10.37:g.16918967G>A	ENSP00000367064:p.Pro3012Leu	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	119	18	NM_001081	0	0	21	41	20	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015130	0.75161	4.54E-4	1.16E-4	ENSG00000107611	ENST00000377833	T	0.16897	2.31	5.8	5.8	0.92144	CUB (5);	0.000000	0.46758	D	0.000275	T	0.22781	0.0550	L	0.48362	1.52	0.80722	D	1	D	0.55800	0.973	P	0.44897	0.463	T	0.00402	-1.1762	10	0.54805	T	0.06	.	18.8345	0.92155	0.0:0.0:1.0:0.0	.	3012	O60494	CUBN_HUMAN	L	3012	ENSP00000367064:P3012L	ENSP00000367064:P3012L	P	-	2	0	CUBN	16958973	1.000000	0.71417	0.339000	0.25562	0.006000	0.05464	7.336000	0.79245	2.735000	0.93741	0.655000	0.94253	CCG	G|1.000;A|0.000		0.483	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
ACADSB	36	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	124793900	124793900	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr10:124793900C>T	ENST00000358776.4	+	2	85	c.71C>T	c.(70-72)tCt>tTt	p.S24F	ACADSB_ENST00000496730.2_3'UTR|ACADSB_ENST00000368869.4_5'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	24					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	ACTTGTTTGTCTTCTTGGAAG	0.363																																					p.S24F		.											.	ACADSB-92	0			c.C71T						.						143.0	141.0	142.0					10																	124793900		2203	4300	6503	SO:0001583	missense	36	exon2			GTTTGTCTTCTTG	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.71C>T	10.37:g.124793900C>T	ENSP00000357873:p.Ser24Phe	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	168	37	NM_001609	0	0	1	2	1	B4DQ51|Q5SQN6|Q96CX7	Missense_Mutation	SNP	ENST00000358776.4	37	CCDS7634.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.85|16.85	3.235388|3.235388	0.58886|0.58886	.|.	.|.	ENSG00000196177|ENSG00000196177	ENST00000411816|ENST00000358776	.|D	.|0.97430	.|-4.38	4.95|4.95	4.02|4.02	0.46733|0.46733	.|.	.|0.689788	.|0.14097	.|N	.|0.341677	D|D	0.93792|0.93792	0.8015|0.8015	L|L	0.27053|0.27053	0.805|0.805	0.26364|0.26364	N|N	0.976999|0.976999	.|P	.|0.45283	.|0.855	.|B	.|0.41510	.|0.359	D|D	0.87882|0.87882	0.2678|0.2678	5|10	.|0.49607	.|T	.|0.09	.|.	12.9162|12.9162	0.58207|0.58207	0.0:0.6883:0.3117:0.0|0.0:0.6883:0.3117:0.0	.|.	.|24	.|P45954	.|ACDSB_HUMAN	F|F	30|24	.|ENSP00000357873:S24F	.|ENSP00000357873:S24F	L|S	+|+	1|2	0|0	ACADSB|ACADSB	124783890|124783890	0.776000|0.776000	0.28616|0.28616	0.955000|0.955000	0.39395|0.39395	0.812000|0.812000	0.45895|0.45895	1.477000|1.477000	0.35431|0.35431	1.167000|1.167000	0.42706|0.42706	0.591000|0.591000	0.81541|0.81541	CTT|TCT	.		0.363	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1	NM_001609	
MUC2	4583	hgsc.bcm.edu	37	11	1092643	1092643	+	Missense_Mutation	SNP	A	A	C	rs149562922		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:1092643A>C	ENST00000441003.2	+	30	4489	c.4462A>C	c.(4462-4464)Aca>Cca	p.T1488P	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1489P|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4223	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caGCCCTCCAACAaccaccac	0.627																																					p.T1488P		.											.	MUC2-90	0			c.A4462C						.						302.0	443.0	394.0					11																	1092643		1680	3118	4798	SO:0001583	missense	4583	exon30			CCTCCAACAACCA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4462A>C	11.37:g.1092643A>C	ENSP00000415183:p.Thr1488Pro	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	9	4	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	-	3.842	-0.033557	0.07543	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15952	2.41;2.38	1.28	1.28	0.21552	.	0.642730	0.11935	U	0.515356	T	0.27063	0.0663	.	.	.	0.09310	N	0.999998	D	0.64830	0.994	P	0.62885	0.908	T	0.12344	-1.0551	9	0.30078	T	0.28	.	6.6385	0.22897	1.0:0.0:0.0:0.0	.	1488	E7EUV1	.	P	1488;1489	ENSP00000415183:T1488P;ENSP00000351956:T1489P	ENSP00000351956:T1489P	T	+	1	0	MUC2	1082643	0.000000	0.05858	0.005000	0.12908	0.000000	0.00434	-2.044000	0.01411	0.654000	0.30846	0.000000	0.15137	ACA	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1092795	1092795	+	Silent	SNP	T	T	A	rs12786761		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:1092795T>A	ENST00000441003.2	+	30	4641	c.4614T>A	c.(4612-4614)acT>acA	p.T1538T	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Silent_p.T1539T|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caaccaccactcccatcacca	0.627																																					p.T1538T		.											.	MUC2-90	0			c.T4614A						.						126.0	251.0	206.0					11																	1092795		1606	2836	4442	SO:0001819	synonymous_variant	4583	exon30			CACCACTCCCATC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4614T>A	11.37:g.1092795T>A		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	11	9	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1092813	1092813	+	Silent	SNP	C	C	T	rs12577898|rs199900755		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:1092813C>T	ENST00000441003.2	+	30	4659	c.4632C>T	c.(4630-4632)acC>acT	p.T1544T	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Silent_p.T1545T|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccaccaccacGGTGACCC	0.637																																					p.T1544T		.											.	MUC2-90	0			c.C4632T						.						47.0	95.0	78.0					11																	1092813		1759	3190	4949	SO:0001819	synonymous_variant	4583	exon30			CACCACCACGGTG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4632C>T	11.37:g.1092813C>T		Somatic	2	1		WXS	Illumina HiSeq	Phase_I	27	6	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1093410	1093410	+	Silent	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:1093410C>A	ENST00000441003.2	+	30	5256	c.5229C>A	c.(5227-5229)acC>acA	p.T1743T	MUC2_ENST00000333592.6_Silent_p.T31T|MUC2_ENST00000359061.5_Silent_p.T1710T|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1743T(1)|p.T1710T(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	agaccccaaccacgacaccca	0.642																																					p.T1743T		.											.	MUC2-90	2	Substitution - coding silent(2)	prostate(2)	c.C5229A						.						209.0	243.0	231.0					11																	1093410		2021	3936	5957	SO:0001819	synonymous_variant	4583	exon30			CCCAACCACGACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5229C>A	11.37:g.1093410C>A		Somatic	4	0		WXS	Illumina HiSeq	Phase_I	62	12	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR8J3	81168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55904466	55904466	+	Silent	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:55904466C>T	ENST00000301529.1	-	1	728	c.729G>A	c.(727-729)tcG>tcA	p.S243S		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S243S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					CTATCATATGCGAAGCGCAGG	0.403																																					p.S243S		.											.	OR8J3-70	1	Substitution - coding silent(1)	endometrium(1)	c.G729A						.						122.0	113.0	116.0					11																	55904466		2201	4296	6497	SO:0001819	synonymous_variant	81168	exon1			CATATGCGAAGCG		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.729G>A	11.37:g.55904466C>T		Somatic	119	1		WXS	Illumina HiSeq	Phase_I	117	25	NM_001004064	0	0	0	0	0	Q6IFB6|Q96RC2	Silent	SNP	ENST00000301529.1	37	CCDS31520.1																																																																																			.		0.403	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064	
DPAGT1	1798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	118971040	118971040	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:118971040C>T	ENST00000409993.2	-	6	2126	c.575G>A	c.(574-576)gGc>gAc	p.G192D	DPAGT1_ENST00000432443.2_Missense_Mutation_p.G85D|DPAGT1_ENST00000445653.1_5'Flank|DPAGT1_ENST00000354202.4_Missense_Mutation_p.G192D			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	192			G -> S (in CMSTA2). {ECO:0000269|PubMed:22742743}.		cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		AGCCTCTAGGCCGTTAATTCC	0.507											OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G192D		.											.	DPAGT1-221	0			c.G575A						.						107.0	104.0	105.0					11																	118971040		2200	4295	6495	SO:0001583	missense	1798	exon4			TCTAGGCCGTTAA	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.575G>A	11.37:g.118971040C>T	ENSP00000386597:p.Gly192Asp	Somatic	153	0	1492	WXS	Illumina HiSeq	Phase_I	166	28	NM_001382	0	0	8	12	4	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	ENST00000409993.2	37	CCDS8411.1	.	.	.	.	.	.	.	.	.	.	C	34	5.350440	0.95830	.	.	ENSG00000172269	ENST00000409993;ENST00000354202;ENST00000432443	D;D;D	0.98914	-5.23;-5.23;-5.23	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.99554	0.9840	H	0.98487	4.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97880	1.0291	10	0.87932	D	0	-21.1374	18.6978	0.91607	0.0:1.0:0.0:0.0	.	85;192	E7EW40;Q9H3H5	.;GPT_HUMAN	D	192;192;85	ENSP00000386597:G192D;ENSP00000346142:G192D;ENSP00000404036:G85D	ENSP00000346142:G192D	G	-	2	0	DPAGT1	118476250	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.652000	0.90054	0.655000	0.94253	GGC	.		0.507	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	NM_001382	
DGKA	1606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56346149	56346149	+	Missense_Mutation	SNP	C	C	G	rs546159503		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:56346149C>G	ENST00000331886.5	+	20	2131	c.1677C>G	c.(1675-1677)ttC>ttG	p.F559L	DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000394147.1_Missense_Mutation_p.F559L|DGKA_ENST00000551156.1_Missense_Mutation_p.F559L	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	559					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	TATGGTACTTCGAATTTGCCA	0.478																																					p.F559L		.											.	DGKA-255	0			c.C1677G						.						163.0	139.0	147.0					12																	56346149		2203	4300	6503	SO:0001583	missense	1606	exon20			GTACTTCGAATTT	AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.1677C>G	12.37:g.56346149C>G	ENSP00000328405:p.Phe559Leu	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	172	57	NM_201554	0	0	3	4	1	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	ENST00000331886.5	37	CCDS8896.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404771	0.42613	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156;ENST00000552903	T;T;T;T;T	0.39229	1.09;1.67;1.09;1.09;1.67	5.02	-9.21	0.00678	Diacylglycerol kinase, accessory domain (2);	0.053094	0.85682	N	0.000000	T	0.34600	0.0903	L	0.43923	1.385	0.45914	D	0.998757	B;B	0.29378	0.01;0.243	B;B	0.42214	0.054;0.38	T	0.43294	-0.9400	10	0.49607	T	0.09	.	11.684	0.51474	0.0:0.1096:0.2082:0.6822	.	478;559	G3V4E1;P23743	.;DGKA_HUMAN	L	559;478;559;559;169	ENSP00000328405:F559L;ENSP00000451743:F478L;ENSP00000377703:F559L;ENSP00000450359:F559L;ENSP00000451518:F169L	ENSP00000328405:F559L	F	+	3	2	DGKA	54632416	0.169000	0.23002	0.857000	0.33713	0.979000	0.70002	-0.687000	0.05156	-1.471000	0.01886	-0.339000	0.08088	TTC	.		0.478	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1		
PHLDA1	22822	hgsc.bcm.edu	37	12	76424647	76424647	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:76424647A>G	ENST00000266671.5	-	1	3065	c.875T>C	c.(874-876)gTc>gCc	p.V292A	PHLDA1_ENST00000602540.1_Missense_Mutation_p.V151A|RP11-290L1.2_ENST00000547721.1_RNA|RP11-290L1.3_ENST00000552367.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	292					apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				CGTGGATTTGACCGCCAGGAT	0.657																																					p.V292A		.											.	PHLDA1-90	0			c.T875C						.						55.0	50.0	52.0					12																	76424647		2203	4300	6503	SO:0001583	missense	22822	exon1			GATTTGACCGCCA	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.875T>C	12.37:g.76424647A>G	ENSP00000266671:p.Val292Ala	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_007350	0	0	10	10	0	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	ENST00000266671.5	37	CCDS31861.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.583687	0.86748	.	.	ENSG00000139289	ENST00000266671;ENST00000421361	T	0.78126	-1.15	4.73	4.73	0.59995	.	0.000000	0.64402	D	0.000002	T	0.77818	0.4187	L	0.46157	1.445	0.48901	D	0.99972	P	0.40970	0.734	P	0.46510	0.519	T	0.80953	-0.1152	10	0.87932	D	0	-20.3063	14.3863	0.66947	1.0:0.0:0.0:0.0	.	292	Q8WV24	PHLA1_HUMAN	A	292;151	ENSP00000266671:V292A	ENSP00000266671:V292A	V	-	2	0	PHLDA1	74710914	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.851000	0.69481	1.995000	0.58328	0.459000	0.35465	GTC	.		0.657	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350	
FGD6	55785	broad.mit.edu	37	12	95479666	95479666	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:95479666C>A	ENST00000343958.4	-	19	4220	c.3997G>T	c.(3997-3999)Gat>Tat	p.D1333Y	FGD6_ENST00000546711.1_Missense_Mutation_p.D1333Y	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1333	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						ATAGAAGAATCCTCTGTGTTT	0.333																																					p.D1333Y													.	FGD6-137	0			c.G3997T						.						103.0	115.0	111.0					12																	95479666		2202	4299	6501	SO:0001583	missense	55785	exon19			AAGAATCCTCTGT	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.3997G>T	12.37:g.95479666C>A	ENSP00000344446:p.Asp1333Tyr	Somatic	260	0		WXS	Illumina HiSeq	Phase_I	253	4	NM_018351	0	0	1	1	0	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	CCDS31878.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.66|19.66	3.869742|3.869742	0.72065|0.72065	.|.	.|.	ENSG00000180263|ENSG00000180263	ENST00000343958;ENST00000546711|ENST00000548069	T;T|.	0.71579|.	2.59;-0.58|.	5.54|5.54	5.54|5.54	0.83059|0.83059	Pleckstrin homology-type (1);Pleckstrin homology domain (1);|.	0.000000|.	0.47852|.	D|.	0.000202|.	T|T	0.70727|0.70727	0.3257|0.3257	L|L	0.51422|0.51422	1.61|1.61	0.58432|0.58432	D|D	0.999992|0.999992	D;D|.	0.89917|.	0.998;1.0|.	D;D|.	0.76071|.	0.964;0.987|.	T|T	0.66630|0.66630	-0.5875|-0.5875	10|5	0.87932|.	D|.	0|.	-22.0153|-22.0153	19.4712|19.4712	0.94963|0.94963	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1333;1333|.	Q6ZV73-2;Q6ZV73|.	.;FGD6_HUMAN|.	Y|S	1333|76	ENSP00000344446:D1333Y;ENSP00000450342:D1333Y|.	ENSP00000344446:D1333Y|.	D|R	-|-	1|3	0|2	FGD6|FGD6	94003797|94003797	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.596000|4.596000	0.61055|0.61055	2.597000|2.597000	0.87782|0.87782	0.561000|0.561000	0.74099|0.74099	GAT|AGG	.		0.333	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	
WSCD2	9671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	108589975	108589975	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:108589975G>C	ENST00000332082.4	+	3	1184	c.366G>C	c.(364-366)gaG>gaC	p.E122D	WSCD2_ENST00000549903.1_Missense_Mutation_p.E122D|WSCD2_ENST00000261400.3_Missense_Mutation_p.E122D|WSCD2_ENST00000547525.1_Missense_Mutation_p.E122D			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	122						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TTGTCCGGGAGAAGGAGGAAG	0.562																																					p.E122D		.											.	WSCD2-136	0			c.G366C						.						31.0	33.0	32.0					12																	108589975		1980	4147	6127	SO:0001583	missense	9671	exon2			CCGGGAGAAGGAG		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.366G>C	12.37:g.108589975G>C	ENSP00000331933:p.Glu122Asp	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	59	22	NM_014653	0	0	0	0	0	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	G	9.938	1.216827	0.22373	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.32023	1.48;1.47;1.48;1.47	5.07	5.07	0.68467	.	0.333232	0.34386	N	0.004017	T	0.22551	0.0544	L	0.28740	0.885	0.40278	D	0.978364	B	0.09022	0.002	B	0.06405	0.002	T	0.06110	-1.0845	10	0.15066	T	0.55	-14.9021	14.9014	0.70681	0.0:0.1436:0.8564:0.0	.	122	Q2TBF2	WSCD2_HUMAN	D	122	ENSP00000448047:E122D;ENSP00000261400:E122D;ENSP00000331933:E122D;ENSP00000447272:E122D	ENSP00000261400:E122D	E	+	3	2	WSCD2	107114105	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	2.741000	0.47426	2.617000	0.88574	0.655000	0.94253	GAG	.		0.562	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
VPS37B	79720	broad.mit.edu	37	12	123351888	123351888	+	Silent	SNP	T	T	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:123351888T>G	ENST00000267202.2	-	4	1014	c.633A>C	c.(631-633)ccA>ccC	p.P211P	RP11-463O12.3_ENST00000537827.2_lincRNA	NM_024667.2	NP_078943.1	Q9H9H4	VP37B_HUMAN	vacuolar protein sorting 37 homolog B (S. cerevisiae)	211	Pro-rich.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)				breast(1)|central_nervous_system(1)|large_intestine(1)|skin(1)|urinary_tract(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.08e-05)|Epithelial(86;0.000197)|BRCA - Breast invasive adenocarcinoma(302;0.205)		GCACCGGGGGTGGTGGGGGGG	0.716																																					p.P211P													.	VPS37B-90	0			c.A633C						.						8.0	10.0	10.0					12																	123351888		2099	4111	6210	SO:0001819	synonymous_variant	79720	exon4			CGGGGGTGGTGGG	AK022812	CCDS9239.1	12q24.31	2008-02-05	2006-04-04		ENSG00000139722	ENSG00000139722			25754	protein-coding gene	gene with protein product		610037	"""vacuolar protein sorting 37B (yeast)"""			15218037	Standard	NM_024667		Approved	FLJ12750	uc001udl.3	Q9H9H4	OTTHUMG00000168767	ENST00000267202.2:c.633A>C	12.37:g.123351888T>G		Somatic	22	3		WXS	Illumina HiSeq	Phase_I	30	4	NM_024667	0	0	1	1	0		Silent	SNP	ENST00000267202.2	37	CCDS9239.1																																																																																			.		0.716	VPS37B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400946.1	NM_024667	
ZC3H13	23091	broad.mit.edu;ucsc.edu	37	13	46549686	46549686	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr13:46549686C>A	ENST00000242848.4	-	12	2548	c.2200G>T	c.(2200-2202)Gat>Tat	p.D734Y	ZC3H13_ENST00000282007.3_Missense_Mutation_p.D734Y			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	734	Arg/Glu-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		cgctctcGATCGTGGTCTCGG	0.498																																					p.D734Y	Esophageal Squamous(187;747 2077 11056 31291 44172)												.	ZC3H13-92	0			c.G2200T						.						137.0	118.0	125.0					13																	46549686		2199	4292	6491	SO:0001583	missense	23091	exon12			CTCGATCGTGGTC	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.2200G>T	13.37:g.46549686C>A	ENSP00000242848:p.Asp734Tyr	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	17	3	NM_015070	0	0	9	16	7	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	C	11.81	1.748494	0.30955	.	.	ENSG00000123200	ENST00000242848;ENST00000282007	T;T	0.37584	2.19;1.19	5.19	5.19	0.71726	.	0.000000	0.56097	D	0.000028	T	0.54287	0.1849	.	.	.	0.80722	D	1	P;D	0.63046	0.91;0.992	P;P	0.61397	0.578;0.888	T	0.47005	-0.9150	9	0.30854	T	0.27	.	17.6464	0.88149	0.0:1.0:0.0:0.0	.	734;734	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	Y	734	ENSP00000242848:D734Y;ENSP00000282007:D734Y	ENSP00000242848:D734Y	D	-	1	0	ZC3H13	45447687	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.314000	0.65804	2.567000	0.86603	0.557000	0.71058	GAT	.		0.498	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
SOX1	6656	hgsc.bcm.edu	37	13	112722435	112722435	+	Missense_Mutation	SNP	A	A	G	rs554658976|rs577675384	byFrequency	TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr13:112722435A>G	ENST00000330949.1	+	1	523	c.463A>G	c.(463-465)Atg>Gtg	p.M155V		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	155					chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		ggcTGTGGCCATGGGCGTGGG	0.791																																					p.M155V		.											.	SOX1-468	0			c.A463G						.						2.0	2.0	2.0					13																	112722435		1223	2659	3882	SO:0001583	missense	6656	exon1			GTGGCCATGGGCG		CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.463A>G	13.37:g.112722435A>G	ENSP00000330218:p.Met155Val	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	4	3	NM_005986	0	0	0	0	0	Q5W0Q1	Missense_Mutation	SNP	ENST00000330949.1	37	CCDS9523.1	.	.	.	.	.	.	.	.	.	.	A	4.148	0.025808	0.08054	.	.	ENSG00000182968	ENST00000330949	T	0.37058	1.22	2.55	-1.05	0.10036	.	0.625334	0.14156	U	0.337708	T	0.10852	0.0265	N	0.02775	-0.495	0.21416	N	0.999691	B	0.16802	0.019	B	0.15052	0.012	T	0.19095	-1.0316	10	0.22706	T	0.39	.	0.6394	0.00808	0.2264:0.214:0.3477:0.2119	.	155	O00570	SOX1_HUMAN	V	155	ENSP00000330218:M155V	ENSP00000330218:M155V	M	+	1	0	SOX1	111770436	0.043000	0.20138	0.997000	0.53966	0.788000	0.44548	0.826000	0.27407	-0.260000	0.09418	-0.731000	0.03576	ATG	.		0.791	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045817.3	NM_005986	
RDH11	51109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	68157017	68157017	+	Silent	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr14:68157017G>A	ENST00000381346.4	-	5	686	c.576C>T	c.(574-576)ggC>ggT	p.G192G	RP11-1012A1.4_ENST00000554493.1_5'Flank|RDH11_ENST00000428130.2_Intron|RP11-1012A1.4_ENST00000553306.1_Missense_Mutation_p.A23V|RDH11_ENST00000553384.1_Silent_p.G179G	NM_001252650.1|NM_016026.3	NP_001239579.1|NP_057110.3	Q8TC12	RDH11_HUMAN	retinol dehydrogenase 11 (all-trans/9-cis/11-cis)	192					adaptation of rhodopsin mediated signaling (GO:0016062)|phototransduction, visible light (GO:0007603)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|photoreceptor inner segment (GO:0001917)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)	12				all cancers(60;0.00047)|OV - Ovarian serous cystadenocarcinoma(108;0.00206)|BRCA - Breast invasive adenocarcinoma(234;0.00924)	Vitamin A(DB00162)	AGAATTTCTCGCCCTGCAGGT	0.517																																					p.G192G		.											.	RDH11-91	0			c.C576T						.						186.0	159.0	168.0					14																	68157017		2203	4300	6503	SO:0001819	synonymous_variant	51109	exon5			TTTCTCGCCCTGC	AF151840	CCDS32104.1, CCDS58326.1	14q24.1	2013-10-15	2006-05-09		ENSG00000072042	ENSG00000072042	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	17964	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 1"", ""androgen-regulated short-chain dehydrogenase/reductase 1"""	607849	"""retinol dehydrogenase 11 (all-trans and 9-cis)"""			12226107, 8018917, 19027726	Standard	NM_016026		Approved	MDT1, SDR7C1, ARSDR1	uc001xjv.4	Q8TC12	OTTHUMG00000171196	ENST00000381346.4:c.576C>T	14.37:g.68157017G>A		Somatic	110	0		WXS	Illumina HiSeq	Phase_I	90	26	NM_016026	0	0	7	27	20	A6NDK3|A8K062|B2RB26|B4DDW0|Q0QD40|Q6IAH5|Q9NRW0|Q9Y391	Silent	SNP	ENST00000381346.4	37	CCDS32104.1	.	.	.	.	.	.	.	.	.	.	G	9.466	1.094486	0.20471	.	.	ENSG00000258466	ENST00000557564	.	.	.	5.67	-11.3	0.00108	.	.	.	.	.	T	0.33440	0.0863	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41124	-0.9526	4	.	.	.	.	3.1001	0.06323	0.2592:0.1913:0.4203:0.1292	.	.	.	.	V	23	.	.	A	-	2	0	RP11-1012A1.4	67226770	0.000000	0.05858	0.230000	0.23976	0.971000	0.66376	-1.633000	0.02022	-2.268000	0.00685	-0.150000	0.13652	GCG	.		0.517	RDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412257.3		
RFX7	64864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	56387238	56387238	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr15:56387238C>G	ENST00000559447.2	-	9	2668	c.2397G>C	c.(2395-2397)caG>caC	p.Q799H	RFX7_ENST00000422057.1_Missense_Mutation_p.Q799H|RFX7_ENST00000317318.6_Missense_Mutation_p.Q896H|RFX7_ENST00000423270.1_Missense_Mutation_p.Q896H			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	799					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TTGACATTTGCTGCTCCATAA	0.418																																					p.Q896H		.											.	RFX7-90	0			c.G2688C						.						105.0	103.0	103.0					15																	56387238		1983	4164	6147	SO:0001583	missense	64864	exon9			CATTTGCTGCTCC			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.2397G>C	15.37:g.56387238C>G	ENSP00000453281:p.Gln799His	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	81	15	NM_022841	0	0	2	2	0	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	37		.	.	.	.	.	.	.	.	.	.	C	12.40	1.925982	0.34002	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.53423	0.62;0.62;0.62	5.57	4.46	0.54185	.	0.069338	0.51477	D	0.000090	T	0.33614	0.0869	N	0.14661	0.345	0.38957	D	0.95847	P;P	0.49961	0.855;0.93	B;P	0.44732	0.359;0.459	T	0.34304	-0.9834	10	0.87932	D	0	-7.1862	10.8605	0.46823	0.0:0.8402:0.0:0.1598	.	799;799	Q2KHR2;C9JU50	RFX7_HUMAN;.	H	799;896;896	ENSP00000387504:Q799H;ENSP00000313299:Q896H;ENSP00000397644:Q896H	ENSP00000313299:Q896H	Q	-	3	2	RFX7	54174530	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.596000	0.24044	2.602000	0.87976	0.514000	0.50259	CAG	.		0.418	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
HERC1	8925	hgsc.bcm.edu	37	15	63947971	63947971	+	Missense_Mutation	SNP	T	T	C	rs202195874		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr15:63947971T>C	ENST00000443617.2	-	50	10141	c.10054A>G	c.(10054-10056)Aac>Gac	p.N3352D		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3352					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TTATCATAGTTAGGTCTTAGT	0.368																																					p.N3352D		.											.	HERC1-666	0			c.A10054G						.	T	ASP/ASN	0,3672		0,0,1836	61.0	54.0	56.0		10054	5.1	1.0	15		56	5,8169		0,5,4082	yes	missense	HERC1	NM_003922.3	23	0,5,5918	CC,CT,TT		0.0612,0.0,0.0422	benign	3352/4862	63947971	5,11841	1836	4087	5923	SO:0001583	missense	8925	exon50			CATAGTTAGGTCT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.10054A>G	15.37:g.63947971T>C	ENSP00000390158:p.Asn3352Asp	Somatic	8	1		WXS	Illumina HiSeq	Phase_I	11	7	NM_003922	0	0	2	2	0	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	11.69	1.715248	0.30413	0.0	6.12E-4	ENSG00000103657	ENST00000443617	T	0.24538	1.85	5.06	5.06	0.68205	.	0.202896	0.41396	D	0.000882	T	0.16085	0.0387	N	0.14661	0.345	0.43145	D	0.994906	B	0.26002	0.139	B	0.24006	0.05	T	0.09228	-1.0684	10	0.21014	T	0.42	.	15.1223	0.72453	0.0:0.0:0.0:1.0	.	3352	Q15751	HERC1_HUMAN	D	3352	ENSP00000390158:N3352D	ENSP00000390158:N3352D	N	-	1	0	HERC1	61735024	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.922000	0.63404	2.040000	0.60383	0.533000	0.62120	AAC	.		0.368	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
RPGRIP1L	23322	broad.mit.edu	37	16	53730090	53730090	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr16:53730090G>A	ENST00000379925.3	-	3	253	c.203C>T	c.(202-204)gCc>gTc	p.A68V	RPGRIP1L_ENST00000568653.3_Missense_Mutation_p.A68V|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.A68V|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.A68V|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.A68V|RPGRIP1L_ENST00000566096.1_Missense_Mutation_p.A68V	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	68					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CTGCTTGCGGGCATGCTGTTT	0.373																																					p.A68V													.	RPGRIP1L-91	0			c.C203T						.						129.0	132.0	131.0					16																	53730090		2198	4300	6498	SO:0001583	missense	23322	exon3			TTGCGGGCATGCT		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.203C>T	16.37:g.53730090G>A	ENSP00000369257:p.Ala68Val	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	253	5	NM_001127897	0	0	2	2	0	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960376	0.92791	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	D;D	0.82893	-1.66;-1.66	5.73	5.73	0.89815	.	0.121316	0.56097	D	0.000032	D	0.90466	0.7014	M	0.68952	2.095	0.44798	D	0.9978	D;D;D;D	0.76494	0.97;0.97;0.998;0.999	P;P;D;D	0.72075	0.78;0.78;0.948;0.976	D	0.89417	0.3707	10	0.46703	T	0.11	-8.6039	19.8956	0.96956	0.0:0.0:1.0:0.0	.	68;68;68;68	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	V	68	ENSP00000369257:A68V;ENSP00000262135:A68V	ENSP00000262135:A68V	A	-	2	0	RPGRIP1L	52287591	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.063000	0.71162	2.708000	0.92522	0.563000	0.77884	GCC	.		0.373	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
CES1	1066	hgsc.bcm.edu	37	16	55866949	55866949	+	Missense_Mutation	SNP	T	T	C	rs114788146	byFrequency	TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr16:55866949T>C	ENST00000361503.4	-	1	149	c.19A>G	c.(19-21)Atc>Gtc	p.I7V	CES1_ENST00000422046.2_Missense_Mutation_p.I7V|CES1_ENST00000360526.3_Missense_Mutation_p.I7V			P23141	EST1_HUMAN	carboxylesterase 1	7				RAFI -> PALV (in Ref. 3; BAA04650, 8; BAC87749/BAC87751, 9; BAF83312/BAF84898 and 11; AAH12418). {ECO:0000305}.	epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	GTGGCCAGGATAAAGGCACGG	0.602													.|||	194	0.038738	0.0234	0.0259	5008	,	,		14138	0.0556		0.0348	False		,,,				2504	0.0552				p.I7V	NSCLC(162;1801 2756 42904 52896)	.											.	CES1-68	0			c.A19G						.																																			SO:0001583	missense	1066	exon1			CCAGGATAAAGGC	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.19A>G	16.37:g.55866949T>C	ENSP00000355193:p.Ile7Val	Somatic	51	1		WXS	Illumina HiSeq	Phase_I	53	5	NM_001025195	0	0	1	1	0	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	ENST00000361503.4	37	CCDS45488.1	.	.	.	.	.	.	.	.	.	.	.	0.011	-1.740567	0.00675	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046	T;T;T	0.66638	-0.22;-0.22;-0.22	3.81	-3.67	0.04476	Carboxylesterase, type B (1);	1.757160	0.03836	N	0.269883	T	0.26048	0.0635	N	0.01086	-1.025	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.36672	-0.9738	10	0.02654	T	1	.	0.8085	0.01089	0.2777:0.2688:0.2726:0.1809	.	7;7;7	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	V	7	ENSP00000353720:I7V;ENSP00000355193:I7V;ENSP00000390492:I7V	ENSP00000353720:I7V	I	-	1	0	CES1	54424450	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.671000	0.01954	-0.669000	0.05289	-2.067000	0.00394	ATC	T|1.000;C|0.000		0.602	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	
DNAH2	146754	broad.mit.edu	37	17	7696416	7696416	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr17:7696416C>T	ENST00000572933.1	+	48	8922	c.7462C>T	c.(7462-7464)Ccc>Tcc	p.P2488S	DNAH2_ENST00000389173.2_Missense_Mutation_p.P2488S			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2488	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTAAATATGCCCGCTAAGGA	0.522																																					p.P2488S													.	DNAH2-102	0			c.C7462T						.						123.0	107.0	113.0					17																	7696416		2203	4300	6503	SO:0001583	missense	146754	exon47			AATATGCCCGCTA	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.7462C>T	17.37:g.7696416C>T	ENSP00000458355:p.Pro2488Ser	Somatic	78	2		WXS	Illumina HiSeq	Phase_I	116	4	NM_020877	0	0	0	0	0	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830320	0.71258	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.63417	-0.04	4.39	3.41	0.39046	ATPase, AAA+ type, core (1);	0.204155	0.41823	N	0.000820	T	0.80088	0.4559	H	0.95187	3.635	0.80722	D	1	B	0.31077	0.307	P	0.46718	0.525	T	0.82246	-0.0552	10	0.72032	D	0.01	.	11.2081	0.48782	0.0:0.9077:0.0:0.0922	.	2488	Q9P225	DYH2_HUMAN	S	2488	ENSP00000373825:P2488S	ENSP00000353818:P2488S	P	+	1	0	DNAH2	7637141	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.293000	0.78740	1.070000	0.40811	0.632000	0.83419	CCC	.		0.522	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	80041413	80041413	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr17:80041413A>C	ENST00000306749.2	-	31	5539	c.5321T>G	c.(5320-5322)cTt>cGt	p.L1774R	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1774	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GTTCTGAGAAAGGTCGAATTT	0.637																																					p.L1774R	Colon(59;314 1043 11189 28578 32273)	.											.	FASN-90	0			c.T5321G						.						54.0	53.0	54.0					17																	80041413		2199	4298	6497	SO:0001583	missense	2194	exon31			TGAGAAAGGTCGA	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5321T>G	17.37:g.80041413A>C	ENSP00000304592:p.Leu1774Arg	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	100	11	NM_004104	0	0	4	6	2	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	A	15.48	2.846071	0.51164	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.04083	3.71	4.77	3.69	0.42338	Alcohol dehydrogenase, C-terminal (1);Polyketide synthase, enoylreductase (1);NAD(P)-binding domain (1);	0.076785	0.56097	D	0.000039	T	0.24236	0.0587	M	0.90252	3.1	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.01127	-1.1443	10	0.87932	D	0	-12.1836	9.8571	0.41092	0.9181:0.0:0.0819:0.0	.	1774	P49327	FAS_HUMAN	R	1774;739	ENSP00000304592:L1774R	ENSP00000304592:L1774R	L	-	2	0	FASN	77634702	1.000000	0.71417	0.518000	0.27811	0.128000	0.20619	8.901000	0.92560	0.675000	0.31264	0.459000	0.35465	CTT	.		0.637	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
LAMA1	284217	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	18	7025998	7025998	+	Silent	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr18:7025998A>G	ENST00000389658.3	-	17	2475	c.2382T>C	c.(2380-2382)ccT>ccC	p.P794P		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	794	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTATGGTGAGAGGGCAGGCGC	0.622																																					p.P794P		.											.	LAMA1-149	0			c.T2382C						.						51.0	42.0	45.0					18																	7025998		2203	4300	6503	SO:0001819	synonymous_variant	284217	exon17			GGTGAGAGGGCAG	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2382T>C	18.37:g.7025998A>G		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	21	4	NM_005559	0	0	0	0	0		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																			.		0.622	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ZNF236	7776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	74622686	74622686	+	Silent	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr18:74622686C>T	ENST00000253159.8	+	16	2916	c.2718C>T	c.(2716-2718)agC>agT	p.S906S	ZNF236_ENST00000320610.9_Silent_p.S908S	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	906					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		AGGATTCCAGCACACTTGAGT	0.493																																					p.S906S		.											.	ZNF236-94	0			c.C2718T						.						73.0	72.0	72.0					18																	74622686		2000	4185	6185	SO:0001819	synonymous_variant	7776	exon16			TTCCAGCACACTT	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.2718C>T	18.37:g.74622686C>T		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	132	29	NM_007345	0	0	0	0	0	B2RTX9|Q9UL37	Silent	SNP	ENST00000253159.8	37	CCDS42447.1																																																																																			.		0.493	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
ZNF266	10781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9524367	9524367	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr19:9524367T>G	ENST00000592904.1	-	5	3310	c.1234A>C	c.(1234-1236)Aaa>Caa	p.K412Q	ZNF266_ENST00000590306.1_Missense_Mutation_p.K412Q|ZNF266_ENST00000588221.1_Missense_Mutation_p.K412Q|ZNF266_ENST00000361451.2_Missense_Mutation_p.K412Q|ZNF266_ENST00000592292.1_Missense_Mutation_p.K412Q|ZNF266_ENST00000588933.1_Missense_Mutation_p.K412Q|ZNF266_ENST00000361151.1_Missense_Mutation_p.K412Q			Q14584	ZN266_HUMAN	zinc finger protein 266	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						TTCCCACATTTGACACATTCA	0.433																																					p.K412Q		.											.	ZNF266-91	0			c.A1234C						.						72.0	72.0	72.0					19																	9524367		2203	4300	6503	SO:0001583	missense	10781	exon11			CACATTTGACACA	X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.1234A>C	19.37:g.9524367T>G	ENSP00000466714:p.Lys412Gln	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	75	22	NM_001271314	0	0	3	4	1	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Missense_Mutation	SNP	ENST00000592904.1	37	CCDS12213.1	.	.	.	.	.	.	.	.	.	.	T	13.51	2.259791	0.39995	.	.	ENSG00000174652	ENST00000361451;ENST00000361151	T;T	0.07444	3.19;3.19	2.76	-5.41	0.02648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02533	0.0077	N	0.03029	-0.43	0.09310	N	1	B	0.22604	0.072	B	0.17098	0.017	T	0.45848	-0.9233	9	0.21014	T	0.42	.	5.5147	0.16900	0.0:0.411:0.2893:0.2997	.	412	Q14584	ZN266_HUMAN	Q	412	ENSP00000354680:K412Q;ENSP00000355047:K412Q	ENSP00000355047:K412Q	K	-	1	0	ZNF266	9385367	0.000000	0.05858	0.000000	0.03702	0.998000	0.95712	-1.671000	0.01954	-1.372000	0.02137	0.454000	0.30748	AAA	.		0.433	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1		
ZNF561	93134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9721627	9721627	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr19:9721627G>A	ENST00000302851.3	-	6	1073	c.710C>T	c.(709-711)tCt>tTt	p.S237F	ZNF561_ENST00000495503.1_5'UTR|ZNF561_ENST00000326044.5_3'UTR|ZNF561_ENST00000354661.4_Missense_Mutation_p.S101F|ZNF561_ENST00000424629.1_Missense_Mutation_p.S168F	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561	237					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						TAGGTGTGAAGAAGCTGTGAC	0.373																																					p.S237F		.											.	ZNF561-91	0			c.C710T						.						65.0	63.0	63.0					19																	9721627		2203	4300	6503	SO:0001583	missense	93134	exon6			TGTGAAGAAGCTG	AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.710C>T	19.37:g.9721627G>A	ENSP00000303915:p.Ser237Phe	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	113	24	NM_152289	0	0	1	1	0	B4E2Q8|Q6PJS0	Missense_Mutation	SNP	ENST00000302851.3	37	CCDS12216.2	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655669	0.29425	.	.	ENSG00000171469	ENST00000424629;ENST00000302851;ENST00000354661;ENST00000444611	T;T;T;T	0.29917	1.55;1.55;1.55;2.36	1.1	1.1	0.20463	.	.	.	.	.	T	0.48223	0.1488	M	0.77486	2.375	0.09310	N	1	D	0.61697	0.99	D	0.71656	0.974	T	0.22312	-1.0220	9	0.37606	T	0.19	.	5.1359	0.14934	0.0:0.3792:0.6208:0.0	.	237	Q8N587	ZN561_HUMAN	F	168;237;101;243	ENSP00000393074:S168F;ENSP00000303915:S237F;ENSP00000346687:S101F;ENSP00000392013:S243F	ENSP00000303915:S237F	S	-	2	0	ZNF561	9582627	0.019000	0.18553	0.002000	0.10522	0.033000	0.12548	2.273000	0.43381	0.905000	0.36596	0.298000	0.19748	TCT	.		0.373	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347272.2	NM_152289	
MYO9B	4650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	17311587	17311587	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr19:17311587G>T	ENST00000594824.1	+	26	4659	c.4512G>T	c.(4510-4512)caG>caT	p.Q1504H	MYO9B_ENST00000397274.2_Missense_Mutation_p.Q1504H|MYO9B_ENST00000595618.1_Missense_Mutation_p.Q1504H			Q13459	MYO9B_HUMAN	myosin IXB	1504	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TGTTCCGCCAGATCACCAACG	0.577																																					p.Q1504H		.											.	MYO9B-67	0			c.G4512T						.						127.0	138.0	135.0					19																	17311587		2113	4228	6341	SO:0001583	missense	4650	exon26			CCGCCAGATCACC		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.4512G>T	19.37:g.17311587G>T	ENSP00000471367:p.Gln1504His	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	96	25	NM_001130065	0	0	9	9	0	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	G	12.57	1.977073	0.34848	.	.	ENSG00000099331	ENST00000397274	D	0.84223	-1.82	4.75	2.43	0.29744	.	0.446964	0.20636	N	0.088489	T	0.68137	0.2968	N	0.08118	0	0.29597	N	0.848014	P;P;P;P	0.37708	0.472;0.606;0.472;0.472	B;B;B;B	0.37422	0.116;0.249;0.116;0.126	T	0.65508	-0.6151	10	0.44086	T	0.13	.	7.4385	0.27169	0.2708:0.0:0.7292:0.0	.	1504;1504;1504;1510	Q13459;Q13459-2;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.;.	H	1504	ENSP00000380444:Q1504H	ENSP00000380444:Q1504H	Q	+	3	2	MYO9B	17172587	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	1.332000	0.33805	1.006000	0.39211	0.491000	0.48974	CAG	.		0.577	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
CAD	790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27459639	27459639	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr2:27459639C>A	ENST00000403525.1	+	26	4292	c.4148C>A	c.(4147-4149)gCc>gAc	p.A1383D	CAD_ENST00000264705.4_Missense_Mutation_p.A1446D			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCGGGCCAGCCCCTCCTTTG	0.537																																					p.A1446D		.											.	CAD-295	0			c.C4337A						.						121.0	117.0	118.0					2																	27459639		2203	4300	6503	SO:0001583	missense	790	exon27			GGCCAGCCCCTCC	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4148C>A	2.37:g.27459639C>A	ENSP00000384510:p.Ala1383Asp	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	189	42	NM_004341	0	0	4	7	3	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.962670|3.962670	0.74016|0.74016	.|.	.|.	ENSG00000084774|ENSG00000084774	ENST00000264705;ENST00000403525|ENST00000458503	D;D|.	0.86694|.	-2.16;-2.16|.	5.58|5.58	5.58|5.58	0.84498|0.84498	Methylglyoxal synthase-like domain (1);|.	0.092996|.	0.85682|.	D|.	0.000000|.	T|T	0.69931|0.69931	0.3166|0.3166	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	P;D|.	0.71674|.	0.919;0.998|.	P;D|.	0.80764|.	0.587;0.994|.	T|T	0.66064|0.66064	-0.6016|-0.6016	10|5	0.12103|.	T|.	0.63|.	-6.9253|-6.9253	18.128|18.128	0.89592|0.89592	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1383;1446|.	F8VPD4;P27708|.	.;PYR1_HUMAN|.	D|T	1446;1383|98	ENSP00000264705:A1446D;ENSP00000384510:A1383D|.	ENSP00000264705:A1446D|.	A|P	+|+	2|1	0|0	CAD|CAD	27313143|27313143	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.966000|0.966000	0.64601|0.64601	4.299000|4.299000	0.59073|0.59073	2.622000|2.622000	0.88805|0.88805	0.561000|0.561000	0.74099|0.74099	GCC|CCC	.		0.537	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
VWA3B	200403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	98744846	98744846	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr2:98744846G>T	ENST00000477737.1	+	6	1051	c.847G>T	c.(847-849)Gat>Tat	p.D283Y	VWA3B_ENST00000435344.1_Missense_Mutation_p.D283Y|VWA3B_ENST00000451075.2_Missense_Mutation_p.D133Y	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	283										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTTTCTAAAGGATCTGAGTGC	0.527																																					p.D283Y		.											.	VWA3B-139	0			c.G847T						.						96.0	96.0	96.0					2																	98744846		2002	4172	6174	SO:0001583	missense	200403	exon6			CTAAAGGATCTGA	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.847G>T	2.37:g.98744846G>T	ENSP00000417955:p.Asp283Tyr	Somatic	78	1		WXS	Illumina HiSeq	Phase_I	74	15	NM_144992	0	0	0	0	0	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598190	0.66332	.	.	ENSG00000168658	ENST00000435344;ENST00000477737;ENST00000451075	T;T;T	0.15718	7.36;7.36;2.4	5.24	3.39	0.38822	.	0.502898	0.19634	N	0.109604	T	0.36413	0.0966	M	0.65975	2.015	0.26308	N	0.977864	D;D;D	0.76494	0.991;0.999;0.998	P;D;D	0.71656	0.844;0.974;0.946	T	0.07083	-1.0791	10	0.87932	D	0	.	10.7231	0.46052	0.0773:0.1356:0.7872:0.0	.	133;283;283	B7Z7Q7;Q502W6;Q502W6-8	.;VWA3B_HUMAN;.	Y	283;283;133	ENSP00000401959:D283Y;ENSP00000417955:D283Y;ENSP00000389463:D133Y	ENSP00000411168:D283Y	D	+	1	0	VWA3B	98111278	1.000000	0.71417	0.950000	0.38849	0.861000	0.49209	2.541000	0.45735	1.324000	0.45282	-0.175000	0.13238	GAT	.		0.527	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
BUB1	699	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	111399713	111399713	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr2:111399713G>A	ENST00000302759.6	-	20	2564	c.2446C>T	c.(2446-2448)Cag>Tag	p.Q816*	BUB1_ENST00000478175.1_5'UTR|BUB1_ENST00000535254.1_Nonsense_Mutation_p.Q796*|BUB1_ENST00000409311.1_Nonsense_Mutation_p.Q816*	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		ACAAATTTCTGTTTATTTTTA	0.358																																					p.Q816X													.	BUB1-1060	0			c.C2446T						.						74.0	72.0	73.0					2																	111399713		2203	4300	6503	SO:0001587	stop_gained	699	exon20			ATTTCTGTTTATT	AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.2446C>T	2.37:g.111399713G>A	ENSP00000302530:p.Gln816*	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	43	5	NM_004336	0	0	1	1	0	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Nonsense_Mutation	SNP	ENST00000302759.6	37	CCDS33273.1	.	.	.	.	.	.	.	.	.	.	G	38	7.285827	0.98186	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759;ENST00000541432	.	.	.	5.32	4.43	0.53597	.	0.181589	0.49305	D	0.000155	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-8.3351	14.7158	0.69269	0.0:0.1458:0.8542:0.0	.	.	.	.	X	796;816;816;816	.	ENSP00000302530:Q816X	Q	-	1	0	BUB1	111116185	1.000000	0.71417	0.989000	0.46669	0.988000	0.76386	2.831000	0.48144	1.223000	0.43536	0.563000	0.77884	CAG	.		0.358	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331925.1	NM_004336	
THSD7B	80731	broad.mit.edu	37	2	138208579	138208579	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr2:138208579G>T	ENST00000409968.1	+	15	3302	c.3124G>T	c.(3124-3126)Gat>Tat	p.D1042Y	THSD7B_ENST00000272643.3_Missense_Mutation_p.D1042Y|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Missense_Mutation_p.D1011Y			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1042	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TCCCAAACTGGATCTCAAGAA	0.368																																					.													.	THSD7B-75	0			.						.						55.0	51.0	52.0					2																	138208579		1859	4100	5959	SO:0001583	missense	80731	.			AAACTGGATCTCA			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3124G>T	2.37:g.138208579G>T	ENSP00000387145:p.Asp1042Tyr	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	19	4	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	G	25.7	4.666848	0.88251	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.60672	0.58;0.17;0.17	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.80417	0.4619	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81609	-0.0855	10	0.62326	D	0.03	.	20.2191	0.98319	0.0:0.0:1.0:0.0	.	1011	C9JKN6	.	Y	1042;1042;1011	ENSP00000387145:D1042Y;ENSP00000272643:D1042Y;ENSP00000413841:D1011Y	ENSP00000272643:D1042Y	D	+	1	0	THSD7B	137925049	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.780000	0.95670	0.655000	0.94253	GAT	.		0.368	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
PECR	55825	ucsc.edu	37	2	216908665	216908665	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr2:216908665C>A	ENST00000265322.7	-	7	862	c.788G>T	c.(787-789)gGg>gTg	p.G263V		NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	263					fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	ACTCCGGCCCCCATCCACATC	0.507																																					p.G263V													.	PECR-90	0			c.G788T						.						69.0	65.0	66.0					2																	216908665		2203	4300	6503	SO:0001583	missense	55825	exon7			CGGCCCCCATCCA	AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.788G>T	2.37:g.216908665C>A	ENSP00000265322:p.Gly263Val	Somatic	36	0		WXS	Illumina HiSeq		43	5	NM_018441	0	0	15	15	0	B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	Missense_Mutation	SNP	ENST00000265322.7	37	CCDS33375.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803695	0.70682	.	.	ENSG00000115425	ENST00000265322	T	0.44083	0.93	5.55	5.55	0.83447	NAD(P)-binding domain (1);	0.049612	0.85682	D	0.000000	T	0.77665	0.4164	H	0.98866	4.355	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.991	D	0.85601	0.1252	10	0.87932	D	0	.	12.6996	0.57024	0.0:0.8343:0.1657:0.0	.	263;117	Q9BY49;Q9BY49-2	PECR_HUMAN;.	V	263	ENSP00000265322:G263V	ENSP00000265322:G263V	G	-	2	0	PECR	216616910	0.985000	0.35326	1.000000	0.80357	0.866000	0.49608	2.467000	0.45093	2.607000	0.88179	0.591000	0.81541	GGG	.		0.507	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337277.1	NM_018441	
TTI1	9675	hgsc.bcm.edu;broad.mit.edu	37	20	36612011	36612011	+	Silent	SNP	T	T	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr20:36612011T>A	ENST00000373448.2	-	9	3355	c.3117A>T	c.(3115-3117)ccA>ccT	p.P1039P	TTI1_ENST00000373447.3_Silent_p.P1039P|TTI1_ENST00000449821.1_Silent_p.P1039P	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	1039					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						AGGTGGAGTCTGGGTCCACCT	0.617																																					p.P1039P		.											.	TTI1-94	0			c.A3117T						.						63.0	49.0	54.0					20																	36612011		2203	4300	6503	SO:0001819	synonymous_variant	9675	exon9			GGAGTCTGGGTCC	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.3117A>T	20.37:g.36612011T>A		Somatic	36	0		WXS	Illumina HiSeq	Phase_I	50	5	NM_014657	0	0	8	17	9	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Silent	SNP	ENST00000373448.2	37	CCDS13300.1																																																																																			.		0.617	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
EMILIN3	90187	broad.mit.edu	37	20	39993715	39993715	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr20:39993715G>A	ENST00000332312.3	-	2	442	c.250C>T	c.(250-252)Cgg>Tgg	p.R84W		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	84	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				CTACACTGCCGGTATTCAGCC	0.577																																					p.R84W													.	EMILIN3-91	0			c.C250T						.						206.0	159.0	175.0					20																	39993715		2203	4300	6503	SO:0001583	missense	90187	exon2			ACTGCCGGTATTC	AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.250C>T	20.37:g.39993715G>A	ENSP00000332806:p.Arg84Trp	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	120	4	NM_052846	0	0	0	0	0	Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	ENST00000332312.3	37	CCDS13316.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.476057	0.84640	.	.	ENSG00000183798	ENST00000332312	T	0.44482	0.92	4.48	4.48	0.54585	EMI domain (2);	0.374349	0.27311	N	0.019942	T	0.56292	0.1975	L	0.44542	1.39	0.41724	D	0.989522	D	0.89917	1.0	D	0.73708	0.981	T	0.54655	-0.8261	9	.	.	.	-20.5859	17.3473	0.87313	0.0:0.0:1.0:0.0	.	84	Q9NT22	EMIL3_HUMAN	W	84	ENSP00000332806:R84W	.	R	-	1	2	EMILIN3	39427129	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.645000	0.91049	2.308000	0.77769	0.655000	0.94253	CGG	.		0.577	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106876.2	XM_029741	
PREX1	57580	ucsc.edu;bcgsc.ca	37	20	47271873	47271873	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr20:47271873G>A	ENST00000371941.3	-	19	2186	c.2164C>T	c.(2164-2166)Cag>Tag	p.Q722*	PREX1_ENST00000396220.1_Nonsense_Mutation_p.Q722*	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	722					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CCACGAATCTGGAAGCACAGT	0.552																																					p.Q722X													.	PREX1-231	0			c.C2164T						.						132.0	93.0	106.0					20																	47271873		2203	4300	6503	SO:0001587	stop_gained	57580	exon19			GAATCTGGAAGCA	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2164C>T	20.37:g.47271873G>A	ENSP00000361009:p.Gln722*	Somatic	16	0		WXS	Illumina HiSeq		19	4	NM_020820	0	0	1	1	0	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Nonsense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	40	8.093210	0.98651	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	.	.	.	4.85	4.85	0.62838	.	0.000000	0.52532	U	0.000074	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.991	0.89169	0.0:0.0:1.0:0.0	.	.	.	.	X	722	.	ENSP00000361009:Q722X	Q	-	1	0	PREX1	46705280	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	4.759000	0.62227	2.228000	0.72767	0.655000	0.94253	CAG	.		0.552	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
KCNQ2	3785	broad.mit.edu	37	20	62073832	62073832	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr20:62073832A>G	ENST00000359125.2	-	5	917	c.743T>C	c.(742-744)tTc>tCc	p.F248S	KCNQ2_ENST00000344425.5_Missense_Mutation_p.F248S|KCNQ2_ENST00000370224.1_Missense_Mutation_p.F248S|KCNQ2_ENST00000354587.3_Missense_Mutation_p.F248S|KCNQ2_ENST00000360480.3_Missense_Mutation_p.F248S|KCNQ2_ENST00000359689.1_Missense_Mutation_p.F248S|KCNQ2_ENST00000344462.4_Missense_Mutation_p.F248S|KCNQ2_ENST00000357249.2_Missense_Mutation_p.F248S	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	248					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GTACACCAGGAACGAGGCCAG	0.567																																					p.F248S													.	KCNQ2-92	0			c.T743C						.						335.0	261.0	286.0					20																	62073832		2203	4300	6503	SO:0001583	missense	3785	exon5			ACCAGGAACGAGG	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.743T>C	20.37:g.62073832A>G	ENSP00000352035:p.Phe248Ser	Somatic	232	0		WXS	Illumina HiSeq	Phase_I	272	5	NM_172106	0	0	0	0	0	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.022082	0.54576	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222;ENST00000370221;ENST00000344425	D;D;D;D;D;D;D;D;D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98	3.25	3.25	0.37280	Ion transport (1);	0.150137	0.45126	D	0.000395	D	0.95050	0.8397	N	0.21097	0.63	0.58432	D	0.999996	B;B;B;B;B;B	0.26445	0.149;0.012;0.004;0.004;0.006;0.004	B;B;B;B;B;B	0.29267	0.1;0.042;0.009;0.009;0.009;0.027	D	0.93475	0.6822	10	0.87932	D	0	-3.9255	11.9223	0.52799	1.0:0.0:0.0:0.0	.	248;248;248;248;248;248	B4DEP4;Q53Y30;O43526-3;O43526-2;O43526-4;O43526	.;.;.;.;.;KCNQ2_HUMAN	S	248	ENSP00000349789:F248S;ENSP00000352035:F248S;ENSP00000359246:F248S;ENSP00000346601:F248S;ENSP00000352718:F248S;ENSP00000399612:F248S;ENSP00000353668:F248S;ENSP00000339611:F248S;ENSP00000359244:F248S;ENSP00000359242:F248S;ENSP00000359241:F248S;ENSP00000345523:F248S	ENSP00000345523:F248S	F	-	2	0	KCNQ2	61544276	1.000000	0.71417	0.988000	0.46212	0.896000	0.52359	9.073000	0.93992	1.259000	0.44117	0.254000	0.18369	TTC	.		0.567	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
BAGE2	85319	hgsc.bcm.edu;broad.mit.edu	37	21	11097627	11097627	+	RNA	SNP	G	G	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr21:11097627G>C	ENST00000470054.1	-	0	242							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gagcagctgggcagacaatgc	0.557																																					p.A12G		.											.	.	0			c.C35G						.						61.0	79.0	73.0					21																	11097627		1445	2599	4044			85318	exon2			AGCTGGGCAGACA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11097627G>C		Somatic	66	2		WXS	Illumina HiSeq	Phase_I	84	8	NM_182481	0	0	0	0	0	A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	37																																																																																				.		0.557	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
UMODL1	89766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	43505425	43505425	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr21:43505425C>T	ENST00000408910.2	+	4	506	c.506C>T	c.(505-507)tCc>tTc	p.S169F	UMODL1_ENST00000400427.1_Missense_Mutation_p.S97F|UMODL1_ENST00000400424.2_Missense_Mutation_p.S97F|UMODL1_ENST00000408989.2_Missense_Mutation_p.S169F	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	169					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CCTGTGGGCTCCTGGTACAAC	0.537																																					p.S169F	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	.											.	UMODL1-93	0			c.C506T						.						113.0	117.0	116.0					21																	43505425		1912	4141	6053	SO:0001583	missense	89766	exon4			TGGGCTCCTGGTA		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.506C>T	21.37:g.43505425C>T	ENSP00000386147:p.Ser169Phe	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	181	34	NM_173568	0	0	0	0	0	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	C	8.956	0.969471	0.18659	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910;ENST00000380462;ENST00000400417;ENST00000423139	T;T;T;T	0.72394	-0.65;-0.63;-0.65;-0.63	3.02	-6.05	0.02172	.	0.899723	0.09081	N	0.851345	T	0.29423	0.0733	N	0.00823	-1.155	0.20703	N	0.999862	B;B	0.20261	0.043;0.0	B;B	0.15052	0.012;0.0	T	0.18178	-1.0345	10	0.32370	T	0.25	-0.4883	1.9738	0.03412	0.1682:0.5079:0.1126:0.2114	.	169;169	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	F	97;97;169;169;15;15;4	ENSP00000383279:S97F;ENSP00000383276:S97F;ENSP00000386126:S169F;ENSP00000386147:S169F	ENSP00000369829:S15F	S	+	2	0	UMODL1	42378494	0.020000	0.18652	0.030000	0.17652	0.492000	0.33523	-1.121000	0.03270	-1.577000	0.01650	-0.253000	0.11424	TCC	.		0.537	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
MYO18B	84700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	26400727	26400727	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr22:26400727C>T	ENST00000407587.2	+	42	6548	c.6379C>T	c.(6379-6381)Cag>Tag	p.Q2127*	MYO18B_ENST00000536101.1_Nonsense_Mutation_p.Q2126*|MYO18B_ENST00000335473.7_Nonsense_Mutation_p.Q2126*			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2126						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GGGCAGCCTGCAGTCCTGGTT	0.532																																					p.Q2126X		.											.	MYO18B-142	0			c.C6376T						.						79.0	83.0	81.0					22																	26400727		2115	4248	6363	SO:0001587	stop_gained	84700	exon42			AGCCTGCAGTCCT	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6379C>T	22.37:g.26400727C>T	ENSP00000386096:p.Gln2127*	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	102	13	NM_032608	0	0	0	0	0	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Nonsense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	C	48	14.649130	0.99804	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	.	.	.	4.33	3.25	0.37280	.	1.244550	0.05893	N	0.628605	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	8.5131	0.33229	0.2492:0.7508:0.0:0.0	.	.	.	.	X	2126;2126;2127	.	ENSP00000334563:Q2126X	Q	+	1	0	MYO18B	24730727	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.482000	0.45224	2.246000	0.74042	0.650000	0.86243	CAG	.		0.532	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
MKL1	57591	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	40814880	40814880	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr22:40814880C>T	ENST00000355630.3	-	12	2152	c.1562G>A	c.(1561-1563)cGc>cAc	p.R521H	MKL1_ENST00000407029.1_Missense_Mutation_p.R521H|MKL1_ENST00000396617.3_Missense_Mutation_p.R521H|MKL1_ENST00000402042.1_Missense_Mutation_p.R471H	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	521					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GTCCTTGTCGCGCCCCTCTAG	0.682			T	RBM15	acute megakaryocytic leukemia																																p.R521H		.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1-948	0			c.G1562A						.						28.0	33.0	31.0					22																	40814880		2203	4297	6500	SO:0001583	missense	57591	exon12			TTGTCGCGCCCCT	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.1562G>A	22.37:g.40814880C>T	ENSP00000347847:p.Arg521His	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	98	21	NM_020831	0	0	2	2	0	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.039005	0.35989	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.44482	0.93;0.92;0.93;0.93	4.89	3.86	0.44501	.	0.428770	0.23016	N	0.052902	T	0.30230	0.0758	N	0.04959	-0.14	0.09310	N	0.999999	D;D;D	0.67145	0.968;0.996;0.993	B;P;P	0.53185	0.374;0.72;0.609	T	0.05852	-1.0860	10	0.45353	T	0.12	-4.7852	8.2012	0.31426	0.1863:0.7301:0.0:0.0835	.	471;521;521	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	H	521;521;471;521	ENSP00000347847:R521H;ENSP00000379861:R521H;ENSP00000385584:R471H;ENSP00000385835:R521H	ENSP00000347847:R521H	R	-	2	0	MKL1	39144826	0.227000	0.23707	0.758000	0.31321	0.866000	0.49608	0.691000	0.25467	1.165000	0.42670	0.591000	0.81541	CGC	.		0.682	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52398951	52398951	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr3:52398951A>G	ENST00000420323.2	+	34	5695	c.5434A>G	c.(5434-5436)Atc>Gtc	p.I1812V		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1812					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTTTCCCACCATCAAGGAGGA	0.612																																					p.I1812V		.											.	DNAH1-67	0			c.A5434G						.						86.0	89.0	88.0					3																	52398951		2137	4249	6386	SO:0001583	missense	25981	exon34			CCCACCATCAAGG	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5434A>G	3.37:g.52398951A>G	ENSP00000401514:p.Ile1812Val	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	100	30	NM_015512	0	0	0	0	0	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	A	4.931	0.172935	0.09391	.	.	ENSG00000114841	ENST00000420323	T	0.37411	1.2	4.49	4.49	0.54785	.	0.143268	0.31358	N	0.007794	T	0.17704	0.0425	N	0.10945	0.07	0.46774	D	0.999194	B	0.12013	0.005	B	0.09377	0.004	T	0.08597	-1.0714	10	0.02654	T	1	.	13.8185	0.63306	1.0:0.0:0.0:0.0	.	1812	C9JXH6	.	V	1812	ENSP00000401514:I1812V	ENSP00000401514:I1812V	I	+	1	0	DNAH1	52373991	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	5.138000	0.64795	1.682000	0.51000	0.383000	0.25322	ATC	.		0.612	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
SLMAP	7871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	57898917	57898917	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr3:57898917G>T	ENST00000428312.1	+	19	2096	c.2002G>T	c.(2002-2004)Gca>Tca	p.A668S	SLMAP_ENST00000295952.3_Missense_Mutation_p.A651S|SLMAP_ENST00000494088.1_Missense_Mutation_p.A161S|SLMAP_ENST00000442599.2_Missense_Mutation_p.A136S|SLMAP_ENST00000295951.3_Missense_Mutation_p.A651S|SLMAP_ENST00000495364.1_Missense_Mutation_p.A202S|SLMAP_ENST00000449503.2_Missense_Mutation_p.A630S|SLMAP_ENST00000416870.1_Missense_Mutation_p.A161S			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	668					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		GGAATGGAATGCATTGGAAAC	0.338																																					p.A651S		.											.	SLMAP-90	0			c.G1951T						.						78.0	79.0	79.0					3																	57898917		2203	4300	6503	SO:0001583	missense	7871	exon18			TGGAATGCATTGG	AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.2002G>T	3.37:g.57898917G>T	ENSP00000398661:p.Ala668Ser	Somatic	107	1		WXS	Illumina HiSeq	Phase_I	98	18	NM_007159	0	0	4	5	1	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Missense_Mutation	SNP	ENST00000428312.1	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	8.475|8.475|8.475	0.858490|0.858490|0.858490	0.17178|0.17178|0.17178	.|.|.	.|.|.	ENSG00000163681|ENSG00000163681|ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000416870;ENST00000428312;ENST00000449503;ENST00000537224;ENST00000442599;ENST00000495364;ENST00000494088|ENST00000416658;ENST00000438794|ENST00000417128	T;T;T;T;T;T;T;D|.|.	0.82526|.|.	-1.05;-1.05;-1.05;1.64;1.64;1.51;-1.05;-1.62|.|.	6.06|6.06|6.06	3.31|3.31|3.31	0.37934|0.37934|0.37934	.|.|.	0.597033|.|.	0.18857|.|.	N|.|.	0.129230|.|.	T|T|T	0.08802|0.08802|0.08802	0.0218|0.0218|0.0218	N|N|N	0.01048|0.01048|0.01048	-1.04|-1.04|-1.04	0.22571|0.22571|0.22571	N|N|N	0.99897|0.99897|0.99897	B;B;B;B;B;B;B;B|.|.	0.15719|.|.	0.001;0.013;0.006;0.014;0.01;0.0;0.0;0.003|.|.	B;B;B;B;B;B;B;B|.|.	0.17979|.|.	0.002;0.02;0.007;0.019;0.009;0.001;0.001;0.002|.|.	T|T|T	0.30149|0.30149|0.30149	-0.9988|-0.9988|-0.9988	10|5|5	0.07990|.|.	T|.|.	0.79|.|.	-0.555|-0.555|-0.555	6.3828|6.3828|6.3828	0.21544|0.21544|0.21544	0.2:0.0:0.6678:0.1323|0.2:0.0:0.6678:0.1323|0.2:0.0:0.6678:0.1323	.|.|.	161;136;202;161;262;630;668;651|.|.	B7Z863;C9JPE6;Q14BN4-5;Q14BN4-8;Q14BN4-4;Q14BN4-2;Q14BN4;Q14BN4-3|.|.	.;.;.;.;.;.;SLMAP_HUMAN;.|.|.	S|F|I	651;651;161;668;630;262;136;202;161|275;205|251	ENSP00000295951:A651S;ENSP00000295952:A651S;ENSP00000412342:A161S;ENSP00000398661:A668S;ENSP00000412945:A630S;ENSP00000388978:A136S;ENSP00000419543:A202S;ENSP00000418218:A161S|.|.	ENSP00000295951:A651S|.|.	A|C|M	+|+|+	1|2|3	0|0|0	SLMAP|SLMAP|SLMAP	57873957|57873957|57873957	0.533000|0.533000|0.533000	0.26354|0.26354|0.26354	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.948000|0.948000|0.948000	0.59901|0.59901|0.59901	1.039000|1.039000|1.039000	0.30266|0.30266|0.30266	0.881000|0.881000|0.881000	0.35993|0.35993|0.35993	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GCA|TGC|ATG	.		0.338	SLMAP-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351584.1	NM_007159	
GXYLT2	727936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	72957696	72957696	+	Missense_Mutation	SNP	G	G	A	rs142024018		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr3:72957696G>A	ENST00000389617.4	+	2	615	c.454G>A	c.(454-456)Gag>Aag	p.E152K		NM_001080393.1	NP_001073862.1	A0PJZ3	GXLT2_HUMAN	glucoside xylosyltransferase 2	152					O-glycan processing (GO:0016266)	integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	18						TCTGAAGCCCGAGTTTGATAA	0.418													G|||	1	0.000199681	0.0	0.0	5008	,	,		20488	0.0		0.001	False		,,,				2504	0.0				p.E152K		.											.	.	0			c.G454A						.						67.0	68.0	68.0					3																	72957696		1933	4133	6066	SO:0001583	missense	727936	exon2			AAGCCCGAGTTTG	AC098481	CCDS46870.1	3p13	2013-02-22	2009-11-17	2009-11-17	ENSG00000172986	ENSG00000172986		"""Glycosyltransferase family 8 domain containing"""	33383	protein-coding gene	gene with protein product		613322	"""glycosyltransferase 8 domain containing 4"""	GLT8D4		19940119	Standard	NM_001080393		Approved		uc003dpg.3	A0PJZ3	OTTHUMG00000158815	ENST00000389617.4:c.454G>A	3.37:g.72957696G>A	ENSP00000374268:p.Glu152Lys	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	50	11	NM_001080393	0	0	0	0	0		Missense_Mutation	SNP	ENST00000389617.4	37	CCDS46870.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	8.743	0.919451	0.17982	.	.	ENSG00000172986	ENST00000389617;ENST00000498315	T;T	0.49139	0.79;1.79	5.71	5.71	0.89125	.	0.170913	0.51477	D	0.000086	T	0.31670	0.0804	L	0.28115	0.83	0.49582	D	0.999804	P	0.35628	0.513	B	0.26416	0.069	T	0.22661	-1.0210	10	0.06099	T	0.92	.	19.8442	0.96702	0.0:0.0:1.0:0.0	.	152	A0PJZ3	GXLT2_HUMAN	K	152;26	ENSP00000374268:E152K;ENSP00000417239:E26K	ENSP00000374268:E152K	E	+	1	0	GXYLT2	73040386	1.000000	0.71417	0.959000	0.39883	0.811000	0.45836	4.503000	0.60407	2.696000	0.92011	0.655000	0.94253	GAG	G|0.999;A|0.000		0.418	GXYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352318.1	NM_001080393	
COL6A5	256076	broad.mit.edu	37	3	130174495	130174495	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr3:130174495G>A	ENST00000432398.2	+	37	7269	c.6775G>A	c.(6775-6777)Gca>Aca	p.A2259T	COL6A5_ENST00000265379.6_Missense_Mutation_p.A2259T	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2259	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TGCAGAAATTGCAAGTCTCAC	0.308																																					p.A2259T													.	.	0			c.G6775A						.						42.0	41.0	41.0					3																	130174495		1805	4070	5875	SO:0001583	missense	256076	exon37			GAAATTGCAAGTC	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.6775G>A	3.37:g.130174495G>A	ENSP00000390895:p.Ala2259Thr	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	54	4	NM_153264	0	0	0	0	0	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.865|6.865	0.528920|0.528920	0.13127|0.13127	.|.	.|.	ENSG00000172752|ENSG00000172752	ENST00000432398;ENST00000265379;ENST00000373157;ENST00000512482|ENST00000512836	D;D;T;T|.	0.90563|.	-2.56;-2.69;-1.08;-1.12|.	4.38|4.38	-0.972|-0.972	0.10300|0.10300	.|.	1.433800|.	0.04946|.	N|.	0.459465|.	T|T	0.27313|0.27313	0.0670|0.0670	L|L	0.48642|0.48642	1.525|1.525	0.09310|0.09310	N|N	1|1	B;B|.	0.16603|.	0.01;0.018|.	B;B|.	0.16722|.	0.007;0.016|.	T|T	0.29212|0.29212	-1.0019|-1.0019	10|5	0.15066|.	T|.	0.55|.	.|.	0.7455|0.7455	0.00981|0.00981	0.2971:0.1642:0.3706:0.1681|0.2971:0.1642:0.3706:0.1681	.|.	2259;2259|.	A8TX70;A8TX70-2|.	CO6A5_HUMAN;.|.	T|Y	2259;2259;202;94|510	ENSP00000390895:A2259T;ENSP00000265379:A2259T;ENSP00000362250:A202T;ENSP00000424968:A94T|.	ENSP00000265379:A2259T|.	A|C	+|+	1|2	0|0	COL6A5|COL6A5	131657185|131657185	0.009000|0.009000	0.17119|0.17119	0.085000|0.085000	0.20634|0.20634	0.012000|0.012000	0.07955|0.07955	-0.299000|-0.299000	0.08254|0.08254	-0.077000|-0.077000	0.12752|0.12752	0.650000|0.650000	0.86243|0.86243	GCA|TGC	.		0.308	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
HTT	3064	broad.mit.edu	37	4	3124641	3124641	+	Silent	SNP	T	T	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr4:3124641T>C	ENST00000355072.5	+	10	1444	c.1299T>C	c.(1297-1299)ccT>ccC	p.P433P		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	433					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CATGCAGCCCTGTCCTTTCAA	0.348																																					p.P433P													.	HTT-281	0			c.T1299C						.						116.0	117.0	117.0					4																	3124641		1853	4089	5942	SO:0001819	synonymous_variant	3064	exon10			CAGCCCTGTCCTT	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.1299T>C	4.37:g.3124641T>C		Somatic	201	0		WXS	Illumina HiSeq	Phase_I	163	3	NM_002111	0	0	1	1	0	Q9UQB7	Silent	SNP	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.348	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
NFXL1	152518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	47901107	47901107	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr4:47901107G>A	ENST00000507489.1	-	7	1033	c.857C>T	c.(856-858)aCa>aTa	p.T286I	NFXL1_ENST00000381538.3_Missense_Mutation_p.T286I|NFXL1_ENST00000329043.3_Missense_Mutation_p.T286I	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	286						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						ACAAGTAGTTGTGACCATCTT	0.388																																					p.T286I		.											.	NFXL1-524	0			c.C857T						.						85.0	79.0	81.0					4																	47901107		2203	4300	6503	SO:0001583	missense	152518	exon7			GTAGTTGTGACCA	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.857C>T	4.37:g.47901107G>A	ENSP00000422037:p.Thr286Ile	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	54	10	NM_152995	0	0	0	0	0	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	37	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	G	11.50	1.656404	0.29425	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.42131	0.98;0.98;0.98	4.85	4.85	0.62838	.	0.275863	0.32918	N	0.005484	T	0.46151	0.1378	M	0.62723	1.935	0.43126	D	0.994855	P	0.36683	0.565	B	0.37888	0.26	T	0.53201	-0.8472	10	0.56958	D	0.05	-8.3899	17.9625	0.89090	0.0:0.0:1.0:0.0	.	286	Q6ZNB6	NFXL1_HUMAN	I	286	ENSP00000370949:T286I;ENSP00000422037:T286I;ENSP00000333113:T286I	ENSP00000333113:T286I	T	-	2	0	NFXL1	47595864	1.000000	0.71417	1.000000	0.80357	0.283000	0.27025	5.916000	0.69981	2.215000	0.71742	0.655000	0.94253	ACA	.		0.388	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
SLC4A4	8671	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	72429512	72429512	+	Silent	SNP	T	T	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr4:72429512T>A	ENST00000264485.5	+	24	3219	c.3102T>A	c.(3100-3102)tcT>tcA	p.S1034S	SLC4A4_ENST00000340595.3_Silent_p.S990S|SLC4A4_ENST00000425175.1_Intron|SLC4A4_ENST00000351898.6_Silent_p.S950S	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	1034					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TTTCACAGTCTGACTGCCCAT	0.363																																					p.S1034S		.											.	SLC4A4-95	0			c.T3102A						.						124.0	135.0	131.0					4																	72429512		2203	4300	6503	SO:0001819	synonymous_variant	8671	exon24			ACAGTCTGACTGC	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.3102T>A	4.37:g.72429512T>A		Somatic	199	0		WXS	Illumina HiSeq	Phase_I	195	35	NM_001098484	0	0	0	0	0	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	37	CCDS43236.1																																																																																			.		0.363	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
TBCK	93627	broad.mit.edu	37	4	107163639	107163639	+	Silent	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr4:107163639G>A	ENST00000273980.5	-	13	1605	c.1158C>T	c.(1156-1158)tgC>tgT	p.C386C	TBCK_ENST00000394708.2_Silent_p.C386C|TBCK_ENST00000361687.4_Silent_p.C323C|TBCK_ENST00000432496.2_Silent_p.C386C|TBCK_ENST00000394706.3_Silent_p.C347C					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						TTCTTAGCTGGCATAACGACA	0.343																																					p.C386C													.	TBCK-336	0			c.C1158T						.						76.0	72.0	73.0					4																	107163639		2203	4300	6503	SO:0001819	synonymous_variant	93627	exon12			TAGCTGGCATAAC		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1158C>T	4.37:g.107163639G>A		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	87	3	NM_001163436	0	0	0	0	0		Silent	SNP	ENST00000273980.5	37	CCDS54788.1																																																																																			.		0.343	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
SLC26A8	116369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	35949921	35949921	+	Silent	SNP	C	C	T	rs547194034		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr6:35949921C>T	ENST00000490799.1	-	8	1355	c.1002G>A	c.(1000-1002)acG>acA	p.T334T	SLC26A8_ENST00000394602.2_Silent_p.T229T|SLC26A8_ENST00000355574.2_Silent_p.T334T	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						TGTCAATAAGCGTCTGGCTGG	0.423													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20134	0.0		0.0	False		,,,				2504	0.0				p.T334T		.											.	SLC26A8-92	0			c.G1002A						.						123.0	113.0	116.0					6																	35949921		2203	4300	6503	SO:0001819	synonymous_variant	116369	exon8			AATAAGCGTCTGG	AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.1002G>A	6.37:g.35949921C>T		Somatic	146	0		WXS	Illumina HiSeq	Phase_I	125	19	NM_052961	0	0	0	0	0		Silent	SNP	ENST00000490799.1	37	CCDS4813.1																																																																																			.		0.423	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2		
MB21D1	115004	hgsc.bcm.edu	37	6	74161604	74161604	+	Missense_Mutation	SNP	C	C	T	rs141133909	byFrequency	TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr6:74161604C>T	ENST00000370315.3	-	1	395	c.301G>A	c.(301-303)Ggg>Agg	p.G101R	MB21D1_ENST00000370318.1_Missense_Mutation_p.G101R	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	101					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						CCCTCTGCCCCAGGGGCGCTG	0.736													C|||	34	0.00678914	0.0015	0.013	5008	,	,		13030	0.0		0.0179	False		,,,				2504	0.0051				p.G101R		.											.	MB21D1-90	0			c.G301A						.	C	ARG/GLY	8,3082		0,8,1537	2.0	3.0	2.0		301	-5.3	0.0	6	dbSNP_134	2	100,6482		0,100,3191	no	missense	MB21D1	NM_138441.2	125	0,108,4728	TT,TC,CC		1.5193,0.2589,1.1166	probably-damaging	101/523	74161604	108,9564	1545	3291	4836	SO:0001583	missense	115004	exon1			CTGCCCCAGGGGC	BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.301G>A	6.37:g.74161604C>T	ENSP00000359339:p.Gly101Arg	Somatic	2	1		WXS	Illumina HiSeq	Phase_I	3	3	NM_138441	0	0	0	0	0	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Missense_Mutation	SNP	ENST00000370315.3	37	CCDS4978.1	28	0.01282051282051282	10	0.02032520325203252	6	0.016574585635359115	1	0.0017482517482517483	11	0.014511873350923483	C	7.159	0.585275	0.13749	0.002589	0.015193	ENSG00000164430	ENST00000370318;ENST00000370315;ENST00000296913	T;T	0.30182	1.54;1.94	2.63	-5.26	0.02772	.	.	.	.	.	T	0.07324	0.0185	L	0.40543	1.245	0.09310	N	1	P	0.50617	0.937	B	0.39706	0.307	T	0.04693	-1.0933	9	0.52906	T	0.07	18.0729	5.7516	0.18150	0.3087:0.3523:0.339:0.0	.	101	Q8N884	M21D1_HUMAN	R	101	ENSP00000359342:G101R;ENSP00000359339:G101R	ENSP00000296913:G101R	G	-	1	0	MB21D1	74218325	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.086000	0.14935	-1.736000	0.01352	0.491000	0.48974	GGG	C|0.987;T|0.013		0.736	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041221.5	NM_138441	
RBAK	57786	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	5104736	5104736	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:5104736A>T	ENST00000353796.3	+	6	1973	c.1649A>T	c.(1648-1650)gAg>gTg	p.E550V	RBAK_ENST00000396912.1_Missense_Mutation_p.E550V|RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK-RBAKDN_ENST00000407184.1_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	550	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TTATTCAATGAGTTGTCATAC	0.393																																					p.E550V		.											.	RBAK-653	0			c.A1649T						.						63.0	63.0	63.0					7																	5104736		2203	4299	6502	SO:0001583	missense	57786	exon6			TCAATGAGTTGTC	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.1649A>T	7.37:g.5104736A>T	ENSP00000275423:p.Glu550Val	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	107	35	NM_001204456	0	0	0	0	0	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	37	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	A	13.27	2.187436	0.38609	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.14516	2.5;2.5	3.76	3.76	0.43208	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.572849	0.15837	N	0.242235	T	0.15003	0.0362	L	0.33753	1.03	0.26673	N	0.971686	P	0.42123	0.771	P	0.46885	0.53	T	0.13872	-1.0493	8	.	.	.	.	11.0559	0.47918	1.0:0.0:0.0:0.0	.	550	Q9NYW8	RBAK_HUMAN	V	550	ENSP00000275423:E550V;ENSP00000380120:E550V	.	E	+	2	0	RBAK	5071262	0.000000	0.05858	0.706000	0.30403	0.897000	0.52465	0.042000	0.13949	1.931000	0.55961	0.454000	0.30748	GAG	.		0.393	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
SP4	6671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	21468915	21468915	+	Silent	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:21468915G>A	ENST00000222584.3	+	3	350	c.132G>A	c.(130-132)caG>caA	p.Q44Q		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	44					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						AGGACTCTCAGCCCTCTCCTC	0.483																																					p.Q44Q		.											.	SP4-95	0			c.G132A						.						34.0	37.0	36.0					7																	21468915		2201	4300	6501	SO:0001819	synonymous_variant	6671	exon3			CTCTCAGCCCTCT		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.132G>A	7.37:g.21468915G>A		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	71	9	NM_003112	0	0	0	0	0	O60402|Q32M52	Silent	SNP	ENST00000222584.3	37	CCDS5373.1																																																																																			.		0.483	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
SAMD9L	219285	broad.mit.edu	37	7	92761639	92761639	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:92761639A>G	ENST00000318238.4	-	5	4862	c.3646T>C	c.(3646-3648)Ttt>Ctt	p.F1216L	SAMD9L_ENST00000437805.1_Missense_Mutation_p.F1216L|SAMD9L_ENST00000411955.1_Missense_Mutation_p.F1216L	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1216					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TTGTGGAAAAAGGGAGTGAGC	0.378																																					p.F1216L													.	SAMD9L-94	0			c.T3646C						.						105.0	100.0	101.0					7																	92761639		2203	4299	6502	SO:0001583	missense	219285	exon5			GGAAAAAGGGAGT	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3646T>C	7.37:g.92761639A>G	ENSP00000326247:p.Phe1216Leu	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	211	3	NM_152703	0	0	4	4	0	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	A	0.131	-1.113678	0.01799	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.20598	2.06;2.06;2.06	4.77	0.449	0.16619	.	0.919380	0.09292	N	0.822145	T	0.06735	0.0172	N	0.02202	-0.64	0.09310	N	0.99999	B	0.02656	0.0	B	0.04013	0.001	T	0.38329	-0.9666	10	0.05721	T	0.95	-0.1325	7.8979	0.29717	0.6565:0.0:0.3435:0.0	.	1216	Q8IVG5	SAM9L_HUMAN	L	1216	ENSP00000326247:F1216L;ENSP00000405760:F1216L;ENSP00000408796:F1216L	ENSP00000326247:F1216L	F	-	1	0	SAMD9L	92599575	0.000000	0.05858	0.218000	0.23776	0.607000	0.37147	0.079000	0.14782	-0.005000	0.14395	0.383000	0.25322	TTT	.		0.378	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703	
CCDC132	55610	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	92932848	92932848	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:92932848A>G	ENST00000305866.5	+	17	1566	c.1438A>G	c.(1438-1440)Atc>Gtc	p.I480V	CCDC132_ENST00000535481.1_Missense_Mutation_p.I200V|CCDC132_ENST00000544910.1_Missense_Mutation_p.I450V|CCDC132_ENST00000317751.6_Missense_Mutation_p.I211V|CCDC132_ENST00000541136.1_Missense_Mutation_p.I291V	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	480						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AAATTTCAGCATCTTGCAACT	0.308																																					p.I480V		.											.	CCDC132-90	0			c.A1438G						.						138.0	134.0	135.0					7																	92932848		1818	4077	5895	SO:0001583	missense	55610	exon17			TTCAGCATCTTGC	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1438A>G	7.37:g.92932848A>G	ENSP00000307666:p.Ile480Val	Somatic	210	0		WXS	Illumina HiSeq	Phase_I	254	48	NM_017667	0	0	1	2	1	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	A	11.98	1.801621	0.31869	.	.	ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481;ENST00000317751	T	0.39229	1.09	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.44829	0.1312	L	0.27053	0.805	0.80722	D	1	P;P;P	0.38863	0.518;0.65;0.518	P;P;P	0.54140	0.558;0.743;0.558	T	0.19257	-1.0311	10	0.14252	T	0.57	-8.589	15.0541	0.71897	1.0:0.0:0.0:0.0	.	200;450;480	B4DS55;F5H5U7;Q96JG6	.;.;CC132_HUMAN	V	480;450;291;200;211	ENSP00000325582:I211V	ENSP00000307666:I480V	I	+	1	0	CCDC132	92770784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.051000	0.93849	2.200000	0.70718	0.460000	0.39030	ATC	.		0.308	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
SH2B2	10603	broad.mit.edu	37	7	101943829	101943829	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:101943829G>A	ENST00000536178.1	+	2	169	c.124G>A	c.(124-126)Gaa>Aaa	p.E42K	SH2B2_ENST00000306803.8_5'Flank			O14492	SH2B2_HUMAN	SH2B adaptor protein 2	0					actin cytoskeleton organization (GO:0030036)|antigen receptor-mediated signaling pathway (GO:0050851)|B-1 B cell homeostasis (GO:0001922)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cytokine-mediated signaling pathway (GO:0019221)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|regulation of JAK-STAT cascade (GO:0046425)|regulation of metabolic process (GO:0019222)|regulation of Ras protein signal transduction (GO:0046578)|signal transduction (GO:0007165)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stress fiber (GO:0001725)	JAK pathway signal transduction adaptor activity (GO:0008269)|SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9						CGATGGGACGGAAGCCATGAA	0.701																																					.													.	.	0			.						.						9.0	11.0	10.0					7																	101943829		1767	3673	5440	SO:0001583	missense	10603	.			GGGACGGAAGCCA	AB000520		7q22.1	2013-02-14			ENSG00000160999	ENSG00000160999		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	17381	protein-coding gene	gene with protein product	"""adaptor protein with pleckstrin homology and src"""	605300				9233773	Standard	XM_005276976		Approved	APS	uc011kko.2	O14492	OTTHUMG00000150652	ENST00000536178.1:c.124G>A	7.37:g.101943829G>A	ENSP00000440273:p.Glu42Lys	Somatic	47	1		WXS	Illumina HiSeq	Phase_I	55	13	.	0	0	0	0	0	A6ND74	Missense_Mutation	SNP	ENST00000536178.1	37		.	.	.	.	.	.	.	.	.	.	G	13.40	2.225853	0.39300	.	.	ENSG00000160999	ENST00000536178	T	0.42513	0.97	3.51	1.35	0.21983	.	.	.	.	.	T	0.19805	0.0476	N	0.08118	0	.	.	.	.	.	.	.	.	.	T	0.27157	-1.0082	6	0.22706	T	0.39	.	5.0789	0.14646	0.1359:0.0:0.6453:0.2188	.	.	.	.	K	42	ENSP00000440273:E42K	ENSP00000440273:E42K	E	+	1	0	SH2B2	101730549	1.000000	0.71417	0.991000	0.47740	0.922000	0.55478	3.601000	0.54059	0.642000	0.30620	0.462000	0.41574	GAA	.		0.701	SH2B2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_020979	
AKR1B1	231	broad.mit.edu	37	7	134133231	134133231	+	Silent	SNP	T	T	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:134133231T>C	ENST00000285930.4	-	6	646	c.567A>G	c.(565-567)ccA>ccG	p.P189P	AKR1B1_ENST00000489022.1_5'Flank	NM_001628.2	NP_001619.1	P15121	ALDR_HUMAN	aldo-keto reductase family 1, member B1 (aldose reductase)	189					C21-steroid hormone biosynthetic process (GO:0006700)|carbohydrate metabolic process (GO:0005975)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)|glyceraldehyde oxidoreductase activity (GO:0043795)			kidney(1)|large_intestine(5)|lung(2)|ovary(3)|prostate(1)|skin(2)	14					Sulindac(DB00605)	GAGTGAGATATGGGTGGCACT	0.532																																					p.P189P													.	AKR1B1-93	0			c.A567G						.						103.0	96.0	98.0					7																	134133231		2203	4300	6503	SO:0001819	synonymous_variant	231	exon6			GAGATATGGGTGG	J04795	CCDS5831.1	7q35	2010-04-08			ENSG00000085662	ENSG00000085662	1.1.1.21	"""Aldo-keto reductases"""	381	protein-coding gene	gene with protein product		103880		ALDR1		1901827	Standard	NM_001628		Approved	AR	uc003vrp.1	P15121	OTTHUMG00000155322	ENST00000285930.4:c.567A>G	7.37:g.134133231T>C		Somatic	33	0		WXS	Illumina HiSeq	Phase_I	37	7	NM_001628	0	1	124	223	98	B2R8N3|Q5U031|Q6FGA4|Q6ICP2|Q9BS21|Q9UCI9	Silent	SNP	ENST00000285930.4	37	CCDS5831.1																																																																																			.		0.532	AKR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339448.2	NM_001628	
GPR124	25960	hgsc.bcm.edu	37	8	37698794	37698794	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr8:37698794A>G	ENST00000412232.2	+	19	2951	c.2938A>G	c.(2938-2940)Agg>Ggg	p.R980G	GPR124_ENST00000315215.7_Missense_Mutation_p.R763G	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	980					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CACCAGGCTCAGGGGCAGCGG	0.692																																					p.R980G		.											.	GPR124-157	0			c.A2938G						.						23.0	28.0	26.0					8																	37698794		2202	4299	6501	SO:0001583	missense	25960	exon19			AGGCTCAGGGGCA	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2938A>G	8.37:g.37698794A>G	ENSP00000406367:p.Arg980Gly	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	51	3	NM_032777	0	0	3	3	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	A	9.090	1.001376	0.19121	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.57752	0.38;0.49	4.96	-0.371	0.12525	.	0.390573	0.26297	N	0.025188	T	0.31167	0.0788	N	0.24115	0.695	0.26959	N	0.965857	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20107	-1.0285	10	0.15066	T	0.55	-29.167	9.6756	0.40039	0.1983:0.6935:0.1082:0.0	.	763;980	Q96PE1-2;Q96PE1	.;GP124_HUMAN	G	973;763;980	ENSP00000323508:R763G;ENSP00000406367:R980G	ENSP00000323508:R763G	R	+	1	2	GPR124	37817952	1.000000	0.71417	0.998000	0.56505	0.812000	0.45895	2.462000	0.45049	-0.059000	0.13154	-0.213000	0.12676	AGG	.		0.692	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
PREX2	80243	broad.mit.edu;bcgsc.ca	37	8	69046477	69046477	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr8:69046477T>C	ENST00000288368.4	+	32	4227	c.3950T>C	c.(3949-3951)cTt>cCt	p.L1317P		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1317					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GCAGGTGTTCTTTTTCACTTT	0.458																																					p.L1317P													.	PREX2-390	0			c.T3950C						.						112.0	95.0	101.0					8																	69046477		2203	4300	6503	SO:0001583	missense	80243	exon32			GTGTTCTTTTTCA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3950T>C	8.37:g.69046477T>C	ENSP00000288368:p.Leu1317Pro	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	115	6	NM_024870	0	0	1	1	0	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.303488	0.81136	.	.	ENSG00000046889	ENST00000288368	T	0.49432	0.78	5.58	5.58	0.84498	.	0.152410	0.44902	D	0.000414	T	0.70351	0.3214	M	0.80982	2.52	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.75297	-0.3367	10	0.87932	D	0	.	15.7584	0.78054	0.0:0.0:0.0:1.0	.	1317	Q70Z35	PREX2_HUMAN	P	1317	ENSP00000288368:L1317P	ENSP00000288368:L1317P	L	+	2	0	PREX2	69209031	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.698000	0.84413	2.135000	0.66039	0.533000	0.62120	CTT	.		0.458	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
FAM135B	51059	broad.mit.edu	37	8	139164987	139164987	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr8:139164987C>G	ENST00000395297.1	-	13	1901	c.1731G>C	c.(1729-1731)gaG>gaC	p.E577D		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	577										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AGCTCCTACTCTCATGCTGAG	0.483										HNSCC(54;0.14)																											p.E577D													.	FAM135B-31	0			c.G1731C						.						136.0	130.0	132.0					8																	139164987		1895	4120	6015	SO:0001583	missense	51059	exon13			CCTACTCTCATGC	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1731G>C	8.37:g.139164987C>G	ENSP00000378710:p.Glu577Asp	Somatic	198	0		WXS	Illumina HiSeq	Phase_I	263	6	NM_015912	0	0	0	0	0	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	10.74	1.436809	0.25900	.	.	ENSG00000147724	ENST00000395297	T	0.23754	1.89	5.45	0.776	0.18532	.	0.348795	0.30593	N	0.009285	T	0.37571	0.1008	M	0.63428	1.95	0.09310	N	1	D;D;D	0.65815	0.995;0.986;0.976	D;P;P	0.64237	0.923;0.783;0.53	T	0.22521	-1.0214	10	0.24483	T	0.36	-8.3513	8.5303	0.33331	0.0:0.5159:0.0:0.4841	.	577;577;577	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	D	577	ENSP00000378710:E577D	ENSP00000276737:E577D	E	-	3	2	FAM135B	139234169	0.006000	0.16342	0.000000	0.03702	0.010000	0.07245	-0.007000	0.12810	-0.072000	0.12864	-0.768000	0.03414	GAG	.		0.483	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
UBE2R2	54926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	33900238	33900238	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr9:33900238T>A	ENST00000263228.3	+	3	522	c.331T>A	c.(331-333)Tct>Act	p.S111T		NM_017811.3	NP_060281.2	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme E2R 2	111					protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		AGAACTGCCTTCTGAAAGGTG	0.383																																					p.S111T		.											.	UBE2R2-226	0			c.T331A						.						152.0	143.0	146.0					9																	33900238		2203	4300	6503	SO:0001583	missense	54926	exon3			CTGCCTTCTGAAA	AK000426	CCDS6546.1	9p11.2	2008-02-05			ENSG00000107341	ENSG00000107341		"""Ubiquitin-conjugating enzymes E2"""	19907	protein-coding gene	gene with protein product		612506				12037680	Standard	XM_005251496		Approved	UBC3B, CDC34B, FLJ20419, MGC10481	uc003ztm.3	Q712K3	OTTHUMG00000019797	ENST00000263228.3:c.331T>A	9.37:g.33900238T>A	ENSP00000263228:p.Ser111Thr	Somatic	134	2		WXS	Illumina HiSeq	Phase_I	150	36	NM_017811	0	0	20	33	13	D3DRL5|Q9NX64	Missense_Mutation	SNP	ENST00000263228.3	37	CCDS6546.1	.	.	.	.	.	.	.	.	.	.	T	29.3	4.990741	0.93106	.	.	ENSG00000107341	ENST00000263228	T	0.37752	1.18	5.61	5.61	0.85477	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	L	0.38733	1.17	0.80722	D	1	D	0.60575	0.988	P	0.59221	0.854	T	0.38564	-0.9655	10	0.48119	T	0.1	-6.062	15.45	0.75265	0.0:0.0:0.0:1.0	.	111	Q712K3	UB2R2_HUMAN	T	111	ENSP00000263228:S111T	ENSP00000263228:S111T	S	+	1	0	UBE2R2	33890238	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.569000	0.82380	2.127000	0.65507	0.455000	0.32223	TCT	.		0.383	UBE2R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052118.1	NM_017811	
GBA2	57704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35751270	35751270	+	5'Flank	SNP	G	G	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr9:35751270G>A	ENST00000378103.3	-	0	0				MSMP_ENST00000414286.1_5'Flank|RGP1_ENST00000456972.2_Silent_p.Q205Q|GBA2_ENST00000378094.4_5'Flank|RGP1_ENST00000378078.4_Silent_p.Q165Q|GBA2_ENST00000545786.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TAGGCCTTCAGGATGTCCGGT	0.498																																					p.Q165Q		.											.	RGP1-23	0			c.G495A						.						226.0	221.0	222.0					9																	35751270		1947	4138	6085	SO:0001631	upstream_gene_variant	9827	exon6			CCTTCAGGATGTC	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		9.37:g.35751270G>A	Exception_encountered	Somatic	404	0		WXS	Illumina HiSeq	Phase_I	410	87	NM_001080496	0	0	0	0	0	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Silent	SNP	ENST00000378103.3	37	CCDS6589.1																																																																																			.		0.498	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
NUP214	8021	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	134020018	134020018	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr9:134020018G>T	ENST00000359428.5	+	12	1790	c.1646G>T	c.(1645-1647)gGa>gTa	p.G549V	RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000415391.2_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.G549V|NUP214_ENST00000451030.1_Missense_Mutation_p.G549V|RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	549	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TTCTCCTTTGGATCATCTGGT	0.537			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.G549V	Pancreas(4;24 48 25510 30394 32571)	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214-1131	0			c.G1646T						.						82.0	78.0	79.0					9																	134020018		2203	4300	6503	SO:0001583	missense	8021	exon12			CCTTTGGATCATC	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.1646G>T	9.37:g.134020018G>T	ENSP00000352400:p.Gly549Val	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	107	24	NM_005085	0	0	0	0	0	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.184253|4.184253	0.78677|0.78677	.|.	.|.	ENSG00000126883|ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899|ENST00000530863	T;T;T|.	0.40756|.	1.24;1.02;1.25|.	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	0.000000|.	0.42172|.	D|.	0.000758|.	T|T	0.45935|0.45935	0.1367|0.1367	N|N	0.08118|0.08118	0|0	0.58432|0.58432	D|D	0.999998|0.999998	D;D|.	0.63046|.	0.992;0.992|.	P;P|.	0.59357|.	0.856;0.856|.	T|T	0.41034|0.41034	-0.9531|-0.9531	10|5	0.51188|.	T|.	0.08|.	-8.3011|-8.3011	17.3793|17.3793	0.87400|0.87400	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	549;549|.	P35658-4;P35658|.	.;NU214_HUMAN|.	V|C	549;549;549;549;142|124	ENSP00000352400:G549V;ENSP00000396576:G549V;ENSP00000405014:G549V|.	ENSP00000352400:G549V|.	G|W	+|+	2|3	0|0	NUP214|NUP214	133009839|133009839	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.875000|0.875000	0.50365|0.50365	5.666000|5.666000	0.68059|0.68059	2.778000|2.778000	0.95560|0.95560	0.655000|0.655000	0.94253|0.94253	GGA|TGG	.		0.537	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
CLCN4	1183	broad.mit.edu	37	X	10162970	10162970	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chrX:10162970C>G	ENST00000380833.4	+	5	655	c.264C>G	c.(262-264)atC>atG	p.I88M	CLCN4_ENST00000380829.1_Missense_Mutation_p.I88M|CLCN4_ENST00000421085.2_5'UTR	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	88					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CTGGGGTCATCGATCTCGCCG	0.572																																					p.I88M	Melanoma(74;1050 1296 1576 30544 38374)												.	CLCN4-134	0			c.C264G						.						134.0	102.0	113.0					X																	10162970		2203	4300	6503	SO:0001583	missense	1183	exon5			GGTCATCGATCTC	X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.264C>G	X.37:g.10162970C>G	ENSP00000370213:p.Ile88Met	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	85	3	NM_001830	0	0	1	1	0	A1L3U1|B7Z5Z4|Q9UBU1	Missense_Mutation	SNP	ENST00000380833.4	37	CCDS14137.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.637149	0.47049	.	.	ENSG00000073464	ENST00000380833;ENST00000380829;ENST00000454850	D;D;D	0.93076	-3.16;-3.16;-3.16	4.84	-4.86	0.03132	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.95567	0.8559	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.92175	0.5747	10	0.87932	D	0	-28.7158	5.9732	0.19363	0.3863:0.154:0.0:0.4597	.	88	P51793	CLCN4_HUMAN	M	88	ENSP00000370213:I88M;ENSP00000370209:I88M;ENSP00000403064:I88M	ENSP00000370209:I88M	I	+	3	3	CLCN4	10122970	0.372000	0.25064	0.280000	0.24747	0.576000	0.36127	-0.275000	0.08525	-1.006000	0.03412	-0.374000	0.07098	ATC	.		0.572	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055730.1		
MAOB	4129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	43702915	43702915	+	Splice_Site	SNP	C	C	G			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chrX:43702915C>G	ENST00000378069.4	-	2	289		c.e2+1		MAOB_ENST00000536181.1_Splice_Site|MAOB_ENST00000487544.1_Splice_Site|MAOB_ENST00000538942.1_Splice_Site	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B						negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	TAATGCCTTACCCTAAGAGTG	0.478																																					.		.											.	MAOB-555	0			c.141+1G>C						.						83.0	67.0	73.0					X																	43702915		2203	4300	6503	SO:0001630	splice_region_variant	4129	exon3			GCCTTACCCTAAG		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.141+1G>C	X.37:g.43702915C>G		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	30	14	NM_000898	0	0	0	0	0	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Splice_Site	SNP	ENST00000378069.4	37	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440115	0.83993	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5321	0.90996	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAOB	43587859	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.391000	0.66266	2.318000	0.78349	0.600000	0.82982	.	.		0.478	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	Intron
SMC1A	8243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	53407985	53407985	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chrX:53407985A>T	ENST00000322213.4	-	23	3588	c.3461T>A	c.(3460-3462)gTc>gAc	p.V1154D	SMC1A_ENST00000469129.1_5'Flank	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	1154	Ala/Asp-rich (DA-box).				DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						CTCATCCAGGACGAAGAAGGG	0.632																																					p.V1154D		.											.	SMC1A-232	0			c.T3461A						.						69.0	60.0	63.0					X																	53407985		2203	4300	6503	SO:0001583	missense	8243	exon23			TCCAGGACGAAGA	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.3461T>A	X.37:g.53407985A>T	ENSP00000323421:p.Val1154Asp	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	67	27	NM_006306	0	0	1	6	5	O14995|Q16351|Q2M228	Missense_Mutation	SNP	ENST00000322213.4	37	CCDS14352.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.943345	0.73672	.	.	ENSG00000072501	ENST00000322213	D	0.92099	-2.97	5.29	5.29	0.74685	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.96901	0.8988	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97755	1.0217	10	0.87932	D	0	.	13.4304	0.61051	1.0:0.0:0.0:0.0	.	1154	Q14683	SMC1A_HUMAN	D	1154	ENSP00000323421:V1154D	ENSP00000323421:V1154D	V	-	2	0	SMC1A	53424710	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.113000	0.94321	1.882000	0.54519	0.481000	0.45027	GTC	.		0.632	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
PRB4	5545	broad.mit.edu;bcgsc.ca	37	12	11461597	11461597	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:11461597delC	ENST00000535904.1	-	3	353	c.320delG	c.(319-321)ggafs	p.G107fs	PRB4_ENST00000279575.1_Frame_Shift_Del_p.G107fs|PRB4_ENST00000445719.2_Frame_Shift_Del_p.G107fs			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	128	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGACTGGTTTCCTCCTTGTGG	0.612										HNSCC(22;0.051)																											p.G107fs													.	PRB4-91	0			c.320delG						.						190.0	200.0	197.0					12																	11461597		2203	4299	6502	SO:0001589	frameshift_variant	5545	exon3			TGGTTTCCTCCTT		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.320delG	12.37:g.11461597delC	ENSP00000442834:p.Gly107fs	Somatic	589	0		WXS	Illumina HiSeq	Phase_I	731	106	NM_001261399	0	0	0	0	0	A1L439|O00600|P02813|P10161|P10162|P81489	Frame_Shift_Del	DEL	ENST00000535904.1	37	CCDS8641.1																																																																																			.		0.612	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	49443557	49443558	+	Frame_Shift_Del	DEL	AT	AT	-	rs201794205		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr12:49443557_49443558delAT	ENST00000301067.7	-	11	3812_3813	c.3813_3814delAT	c.(3811-3816)ctattgfs	p.LL1271fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1271					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GCATCGCACAATAGTGAGTCAT	0.609																																					p.1271_1272del		.											.	MLL2-612	0			c.3813_3814del						.																																			SO:0001589	frameshift_variant	8085	exon11			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.3813_3814delAT	12.37:g.49443557_49443558delAT	ENSP00000301067:p.Leu1271fs	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	158	24	NM_003482	0	0	0	0	0	O14687	Frame_Shift_Del	DEL	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.609	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
MGAT2	4247	broad.mit.edu	37	14	50089217	50089220	+	Frame_Shift_Del	DEL	CTAA	CTAA	-	rs563513161	byFrequency	TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	CTAA	CTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr14:50089217_50089220delCTAA	ENST00000305386.2	+	1	1729_1732	c.1231_1234delCTAA	c.(1231-1236)ctaactfs	p.LT411fs	RP11-649E7.5_ENST00000555043.1_RNA|RPL36AL_ENST00000298289.6_5'Flank	NM_002408.3	NP_002399.1	Q10469	MGAT2_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	411					cellular protein metabolic process (GO:0044267)|oligosaccharide biosynthetic process (GO:0009312)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0008455)|carbohydrate binding (GO:0030246)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)	11	all_epithelial(31;0.0021)|Breast(41;0.0124)					TCCAGAAACTCTAACTATCAGTGA	0.392																																					p.411_412del													.	MGAT2-90	0			c.1231_1234del						.			13,4251		6,1,2125						2.3	1.0			53	36,8218		18,0,4109	no	frameshift	MGAT2	NM_002408.3		24,1,6234	A1A1,A1R,RR		0.4362,0.3049,0.3914				49,12469				SO:0001589	frameshift_variant	4247	exon1			GAAACTCTAACTA	U15128	CCDS9690.1	14q21	2013-02-25			ENSG00000168282	ENSG00000168282	2.4.1.143	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7045	protein-coding gene	gene with protein product		602616				7635144	Standard	NM_002408		Approved	GNT-II	uc001wwr.3	Q10469	OTTHUMG00000140271	ENST00000305386.2:c.1231_1234delCTAA	14.37:g.50089217_50089220delCTAA	ENSP00000307423:p.Leu411fs	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	100	8	NM_002408	0	0	0	0	0	B3KPC5|B3KQM0	Frame_Shift_Del	DEL	ENST00000305386.2	37	CCDS9690.1																																																																																			.		0.392	MGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276807.1	NM_002408	
CYFIP1	23191	broad.mit.edu	37	15	22929873	22929873	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr15:22929873delA	ENST00000313077.7	+	6	672	c.547delA	c.(547-549)aacfs	p.N183fs	CYFIP1_ENST00000560848.1_Frame_Shift_Del_p.N183fs	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CAGTGTGAAGAACGACCACTC	0.572																																					p.N183fs													.	CYFIP1-99	0			c.547delA						.						128.0	96.0	107.0					15																	22929873		2203	4300	6503	SO:0001589	frameshift_variant	23191	exon6			GTGAAGAACGACC	D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.547delA	15.37:g.22929873delA	ENSP00000324549:p.Asn183fs	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	49	8	NM_014608	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000313077.7	37	CCDS10009.1																																																																																			.		0.572	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
ACAA1	30	broad.mit.edu;bcgsc.ca	37	3	38167081	38167092	+	In_Frame_Del	DEL	TGAGCAGCGTGA	TGAGCAGCGTGA	-	rs138308587		TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	TGAGCAGCGTGA	TGAGCAGCGTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr3:38167081_38167092delTGAGCAGCGTGA	ENST00000333167.8	-	11	1335_1346	c.1163_1174delTCACGCTGCTCA	c.(1162-1176)atcacgctgctcaat>aat	p.ITLL388del	ACAA1_ENST00000301810.7_In_Frame_Del_p.ITLL295del|ACAA1_ENST00000450296.1_In_Frame_Del_p.ITLL347del|ACAA1_ENST00000480865.1_5'UTR|Y_RNA_ENST00000365095.1_RNA	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1	388					alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		TTCAGCTCATTGAGCAGCGTGATGACCTGTCG	0.618																																					p.388_392del													.	ACAA1-91	0			c.1163_1174del						.																																			SO:0001651	inframe_deletion	30	exon11			GCTCATTGAGCAG	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087	ENST00000333167.8:c.1163_1174delTCACGCTGCTCA	3.37:g.38167081_38167092delTGAGCAGCGTGA	ENSP00000333664:p.Ile388_Leu391del	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	90	12	NM_001607	0	0	0	0	0	G5E935|Q96CA6	In_Frame_Del	DEL	ENST00000333167.8	37	CCDS2673.1																																																																																			.		0.618	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
GBE1	2632	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	81698998	81698998	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr3:81698998delA	ENST00000429644.2	-	4	1147	c.504delT	c.(502-504)ggtfs	p.G168fs	GBE1_ENST00000489715.1_Frame_Shift_Del_p.G127fs	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	168					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		TCACATTATCACCTTCACGAA	0.348									Glycogen Storage Disease, type IV																												p.G168fs		.											.	GBE1-25	0			c.504delT						.						102.0	101.0	101.0					3																	81698998		1874	4119	5993	SO:0001589	frameshift_variant	2632	exon4	Familial Cancer Database	Andersen Disease, Brancher deficiency	.		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.504delT	3.37:g.81698998delA	ENSP00000410833:p.Gly168fs	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	60	11	NM_000158	0	0	0	0	0	B3KWV3|Q96EN0	Frame_Shift_Del	DEL	ENST00000429644.2	37	CCDS54612.1																																																																																			.		0.348	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352760.2		
PSD2	84249	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	139193812	139193812	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr5:139193812delG	ENST00000274710.3	+	4	1084	c.879delG	c.(877-879)gagfs	p.E293fs		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	293	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCTCGGAGGGGTTGGAGC	0.632																																					p.E293fs		.											.	PSD2-91	0			c.879delG						.						89.0	81.0	84.0					5																	139193812		2203	4300	6503	SO:0001589	frameshift_variant	84249	exon4			.	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.879delG	5.37:g.139193812delG	ENSP00000274710:p.Glu293fs	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	170	27	NM_032289	0	0	0	0	0	D3DQD3|Q8N3J8	Frame_Shift_Del	DEL	ENST00000274710.3	37	CCDS4216.1																																																																																			.		0.632	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
STAG3	10734	broad.mit.edu;bcgsc.ca	37	7	99779767	99779767	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr7:99779767delT	ENST00000426455.1	+	3	578	c.171delT	c.(169-171)aatfs	p.N57fs	STAG3_ENST00000394018.2_Frame_Shift_Del_p.N57fs|STAG3_ENST00000317296.5_Frame_Shift_Del_p.N57fs	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	57					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACAGCTTGAATCGCAATGTGA	0.438																																					p.N57fs													.	STAG3-543	0			c.171delT						.						122.0	112.0	115.0					7																	99779767		2203	4300	6503	SO:0001589	frameshift_variant	10734	exon3			CTTGAATCGCAAT	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.171delT	7.37:g.99779767delT	ENSP00000400359:p.Asn57fs	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	67	10	NM_012447	0	0	0	0	0	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Frame_Shift_Del	DEL	ENST00000426455.1	37	CCDS34703.1																																																																																			.		0.438	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447	
LGR4	55366	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	27390335	27390336	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5880-01A-11D-1589-08	TCGA-BQ-5880-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fc77da41-c3ab-470a-9835-cd90efad8943	0e3be903-bd00-42d6-8510-f71f823a5f29	g.chr11:27390335_27390336insA	ENST00000379214.4	-	18	2377_2378	c.1934_1935insT	c.(1933-1935)ttafs	p.L645fs	LGR4_ENST00000389858.4_Frame_Shift_Ins_p.L621fs	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	645					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						CTTTTGCAGATAAGCTTCTTTC	0.431																																					p.L645fs		.											.	LGR4-91	0			c.1935_1936insT						.																																			SO:0001589	frameshift_variant	55366	exon18			.	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.1935dupT	11.37:g.27390337_27390337dupA	ENSP00000368516:p.Leu645fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	112	21	NM_018490	0	0	0	0	0	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Frame_Shift_Ins	INS	ENST00000379214.4	37	CCDS31449.1																																																																																			.		0.431	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	
