#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1orf86	199990	broad.mit.edu	37	1	2125303	2125303	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr1:2125303G>A	ENST00000378546.4	-	3	269	c.245C>T	c.(244-246)cCc>cTc	p.P82L	C1orf86_ENST00000487186.1_5'UTR|C1orf86_ENST00000378545.3_Missense_Mutation_p.P185L|C1orf86_ENST00000400919.3_5'UTR	NM_182533.2	NP_872339	Q6NZ36	FAP20_HUMAN	chromosome 1 open reading frame 86	82					cellular response to DNA damage stimulus (GO:0006974)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	cell junction (GO:0030054)|chromosome (GO:0005694)|Fanconi anaemia nuclear complex (GO:0043240)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)			central_nervous_system(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		AAAGGTCTTGGGTCCGACAGT	0.672																																					p.P82L													.	C1orf86-90	0			c.C245T						.						48.0	58.0	55.0					1																	2125303		2202	4300	6502	SO:0001583	missense	199990	exon3			GTCTTGGGTCCGA	AK126870	CCDS38.2, CCDS57965.1, CCDS72686.1, CCDS72687.1	1p36.33	2013-05-22			ENSG00000162585	ENSG00000162585			26428	protein-coding gene	gene with protein product		615183				14702039	Standard	NM_182533		Approved	FLJ31031, FAAP20	uc031pkt.1	Q6NZ36	OTTHUMG00000001404	ENST00000378546.4:c.245C>T	1.37:g.2125303G>A	ENSP00000367808:p.Pro82Leu	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	91	3	NM_001256946	0	0	212	223	11	A6PW39|A6PW40|A6PW41|A8MQT6|F2Z2L4|Q6ZT64|Q71M24|Q96ND7	Missense_Mutation	SNP	ENST00000378546.4	37	CCDS38.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.405|9.405	1.079136|1.079136	0.20227|0.20227	.|.	.|.	ENSG00000162585|ENSG00000162585	ENST00000400918;ENST00000378546;ENST00000378545|ENST00000378543;ENST00000420515	T;T;T|T	0.50001|0.37411	0.91;0.84;0.76|1.2	3.75|3.75	0.437|0.437	0.16555|0.16555	.|.	2.940440|2.940440	0.01281|0.01281	N|N	0.009732|0.009732	T|T	0.36413|0.36413	0.0966|0.0966	L|L	0.40543|0.40543	1.245|1.245	0.09310|0.09310	N|N	1|1	B|P	0.33103|0.50819	0.397|0.939	B|P	0.31547|0.47941	0.132|0.562	T|T	0.20672|0.20672	-1.0268|-1.0268	10|10	0.72032|0.87932	D|D	0.01|0	-0.007|-0.007	3.4021|3.4021	0.07327|0.07327	0.1055:0.3392:0.4118:0.1435|0.1055:0.3392:0.4118:0.1435	.|.	82|78	Q6NZ36|Q6ZRT9	CA086_HUMAN|.	L|S	82;82;185|37;82	ENSP00000383709:P82L;ENSP00000367808:P82L;ENSP00000367807:P185L|ENSP00000409721:P82S	ENSP00000367807:P185L|ENSP00000367804:P37S	P|P	-|-	2|1	0|0	C1orf86|C1orf86	2115163|2115163	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.051000|0.051000	0.14879|0.14879	0.217000|0.217000	0.17603|0.17603	0.278000|0.278000	0.22164|0.22164	0.462000|0.462000	0.41574|0.41574	CCC|CCA	.		0.672	C1orf86-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316541.1	NM_182533	
ACOT7	11332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	6399500	6399500	+	Silent	SNP	G	G	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr1:6399500G>T	ENST00000377855.2	-	3	587	c.441C>A	c.(439-441)atC>atA	p.I147I	ACOT7_ENST00000361521.4_Silent_p.I137I|ACOT7_ENST00000377845.3_Silent_p.I117I|ACOT7_ENST00000377842.3_Silent_p.I96I|ACOT7_ENST00000541130.1_Silent_p.I117I|ACOT7_ENST00000545482.1_Silent_p.I32I|ACOT7_ENST00000608083.1_Silent_p.I105I	NM_181864.2	NP_863654.1	O00154	BACH_HUMAN	acyl-CoA thioesterase 7	147	Acyl coenzyme A hydrolase 1.				coenzyme A biosynthetic process (GO:0015937)|fatty acid catabolic process (GO:0009062)|long-chain fatty-acyl-CoA catabolic process (GO:0036116)|medium-chain fatty acid biosynthetic process (GO:0051792)|medium-chain fatty-acyl-CoA catabolic process (GO:0036114)|palmitic acid biosynthetic process (GO:1900535)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)	carboxylic ester hydrolase activity (GO:0052689)|fatty-acyl-CoA binding (GO:0000062)|long-chain fatty acyl-CoA binding (GO:0036042)|palmitoyl-CoA hydrolase activity (GO:0016290)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	16	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		TACCTGTGAGGATGTTTTCGG	0.597																																					p.I147I	GBM(74;673 1226 4974 11850 13190)	.											.	ACOT7-514	0			c.C441A						.						96.0	73.0	81.0					1																	6399500		2203	4300	6503	SO:0001819	synonymous_variant	11332	exon3			TGTGAGGATGTTT	AB074417	CCDS65.1, CCDS66.1, CCDS67.1, CCDS30573.1	1p36	2008-08-14			ENSG00000097021	ENSG00000097021		"""Acyl CoA thioesterases"""	24157	protein-coding gene	gene with protein product	"""brain acyl CoA hydrolase"""	602587				10578051, 16103133, 16940157	Standard	XM_005263427		Approved	BACH, ACH1, ACT, CTE-II, LACH1, MGC1126, hBACH	uc001amt.3	O00154	OTTHUMG00000001295	ENST00000377855.2:c.441C>A	1.37:g.6399500G>T		Somatic	86	1		WXS	Illumina HiSeq	Phase_I	78	18	NM_181864	0	0	0	0	0	A8K0K7|A8K232|A8K6B8|A8K837|B3KQ12|O43703|Q53Y78|Q5JYL2|Q5JYL3|Q5JYL4|Q5JYL5|Q5JYL6|Q5TGR4|Q9UJM9|Q9Y539|Q9Y540	Silent	SNP	ENST00000377855.2	37	CCDS65.1																																																																																			.		0.597	ACOT7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003773.1	NM_007274	
HES2	54626	hgsc.bcm.edu	37	1	6479040	6479040	+	Missense_Mutation	SNP	G	G	A	rs2235687	byFrequency	TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr1:6479040G>A	ENST00000377834.4	-	4	513	c.415C>T	c.(415-417)Ccg>Tcg	p.P139S	HES2_ENST00000487437.1_3'UTR|HES2_ENST00000489730.1_3'UTR|HES2_ENST00000377836.4_Intron|HES2_ENST00000471190.1_5'Flank|HES2_ENST00000377837.1_Intron	NM_019089.4	NP_061962.2	Q9Y543	HES2_HUMAN	hes family bHLH transcription factor 2	139	Pro-rich.		P -> S (in dbSNP:rs2235687).		negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|transcription factor binding (GO:0008134)			lung(1)|ovary(1)	2	Ovarian(185;0.0634)|all_lung(157;0.154)	all_cancers(23;1.05e-30)|all_epithelial(116;1.37e-17)|all_hematologic(16;1.81e-05)|all_lung(118;2.27e-05)|Acute lymphoblastic leukemia(12;4.98e-05)|Lung NSC(185;9.97e-05)|Colorectal(325;0.0002)|all_neural(13;0.000531)|Renal(390;0.00188)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.02e-35)|GBM - Glioblastoma multiforme(13;1.75e-28)|Colorectal(212;6.1e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000888)|BRCA - Breast invasive adenocarcinoma(365;0.00106)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		ggggcagACGGGCCACTGGAA	0.791													.|||	391	0.0780751	0.1384	0.0346	5008	,	,		9585	0.13		0.0239	False		,,,				2504	0.0297				p.P139S		.											.	HES2-650	0			c.C415T						.						1.0	1.0	1.0					1																	6479040		770	1901	2671	SO:0001583	missense	54626	exon4			CAGACGGGCCACT	AL031848	CCDS30574.1	1p36.31	2013-10-17	2013-10-17		ENSG00000069812	ENSG00000069812		"""Basic helix-loop-helix proteins"""	16005	protein-coding gene	gene with protein product		609970	"""hairy and enhancer of split 2 (Drosophila)"""			15254753	Standard	NM_019089		Approved	bHLHb40	uc001amx.3	Q9Y543	OTTHUMG00000000752	ENST00000377834.4:c.415C>T	1.37:g.6479040G>A	ENSP00000367065:p.Pro139Ser	Somatic	1	0		WXS	Illumina HiSeq	Phase_I	5	4	NM_019089	0	0	0	0	0	A2RTZ9|Q96EN4|Q9Y542	Missense_Mutation	SNP	ENST00000377834.4	37	CCDS30574.1	182	0.08333333333333333	56	0.11382113821138211	12	0.03314917127071823	94	0.16433566433566432	20	0.026385224274406333	G	12.21	1.869614	0.33069	.	.	ENSG00000069812	ENST00000377834	T	0.58797	0.31	3.36	0.264	0.15607	.	3.233610	0.00892	N	0.002254	T	0.00144	0.0004	N	0.08118	0	0.58432	P	4.000000000004E-6	B	0.14438	0.01	B	0.06405	0.002	T	0.03933	-1.0991	9	0.27785	T	0.31	-9.2319	6.1626	0.20372	0.3543:0.0:0.6457:0.0	rs2235687	139	Q9Y543	HES2_HUMAN	S	139	ENSP00000367065:P139S	ENSP00000367065:P139S	P	-	1	0	HES2	6401627	0.013000	0.17824	0.000000	0.03702	0.036000	0.12997	0.444000	0.21661	0.071000	0.16664	0.462000	0.41574	CCG	G|0.916;A|0.084		0.791	HES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001881.1	NM_019089	
SSX2IP	117178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	85124036	85124036	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr1:85124036A>T	ENST00000342203.3	-	9	1306	c.1043T>A	c.(1042-1044)aTt>aAt	p.I348N	SSX2IP_ENST00000605755.1_Missense_Mutation_p.I321N|SSX2IP_ENST00000370612.4_Missense_Mutation_p.I348N|SSX2IP_ENST00000603677.1_Intron|SSX2IP_ENST00000437941.2_Missense_Mutation_p.I321N	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	348					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		ACTTTTCAAAATTCTCCACTG	0.408																																					p.I348N		.											.	SSX2IP-92	0			c.T1043A						.						152.0	139.0	143.0					1																	85124036		2203	4300	6503	SO:0001583	missense	117178	exon9			TTCAAAATTCTCC		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.1043T>A	1.37:g.85124036A>T	ENSP00000340279:p.Ile348Asn	Somatic	87	1		WXS	Illumina HiSeq	Phase_I	92	27	NM_001166293	0	0	0	1	1	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	ENST00000342203.3	37	CCDS699.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.583160	0.28268	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000544699;ENST00000370612	T;T	0.43688	0.94;0.94	5.81	5.81	0.92471	.	0.216387	0.50627	D	0.000111	T	0.30293	0.0760	L	0.57536	1.79	0.44117	D	0.996895	B;B;B	0.20887	0.049;0.012;0.012	B;B;B	0.20384	0.029;0.013;0.013	T	0.19257	-1.0311	10	0.72032	D	0.01	-1.5242	16.1637	0.81739	1.0:0.0:0.0:0.0	.	344;348;321	F5H549;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	N	348;321;344;348	ENSP00000340279:I348N;ENSP00000412781:I321N	ENSP00000340279:I348N	I	-	2	0	SSX2IP	84896624	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.209000	0.58493	2.216000	0.71823	0.533000	0.62120	ATT	.		0.408	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021	
MYBPHL	343263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	109839700	109839700	+	Missense_Mutation	SNP	G	G	C	rs200935635		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr1:109839700G>C	ENST00000357155.1	-	4	591	c.542C>G	c.(541-543)aCg>aGg	p.T181R	MYBPHL_ENST00000477962.1_Intron	NM_001010985.2|NM_001265613.1	NP_001010985.2|NP_001252542.1	A2RUH7	MBPHL_HUMAN	myosin binding protein H-like	181	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.									central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(2)	14		all_lung(203;0.00519)|all_epithelial(167;0.00575)|Lung NSC(277;0.00822)		Colorectal(144;0.0306)|Lung(183;0.0681)|COAD - Colon adenocarcinoma(174;0.117)|Epithelial(280;0.197)|all cancers(265;0.225)		CTTCTGCACCGTGTATCCCAG	0.577																																					p.T181R		.											.	MYBPHL-92	0			c.C542G						.						169.0	169.0	169.0					1																	109839700		2203	4300	6503	SO:0001583	missense	343263	exon4			TGCACCGTGTATC	AK129834	CCDS30793.1	1p13	2013-02-11			ENSG00000221986	ENSG00000221986		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	30434	protein-coding gene	gene with protein product							Standard	NM_001010985		Approved		uc001dxk.1	A2RUH7	OTTHUMG00000012002	ENST00000357155.1:c.542C>G	1.37:g.109839700G>C	ENSP00000349678:p.Thr181Arg	Somatic	217	2		WXS	Illumina HiSeq	Phase_I	183	64	NM_001010985	0	0	0	0	0	B7ZME5|Q5T2Z7	Missense_Mutation	SNP	ENST00000357155.1	37	CCDS30793.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769751	0.69992	.	.	ENSG00000221986	ENST00000357155	D	0.87729	-2.29	4.15	3.24	0.37175	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	D	0.88945	0.6575	M	0.66560	2.04	0.45930	D	0.99876	D;D	0.89917	1.0;0.967	D;P	0.87578	0.998;0.858	D	0.87804	0.2627	9	0.40728	T	0.16	.	10.551	0.45087	0.0964:0.0:0.9036:0.0	.	158;181	B7ZME5;A2RUH7	.;MBPHL_HUMAN	R	181	ENSP00000349678:T181R	ENSP00000349678:T181R	T	-	2	0	MYBPHL	109641223	0.999000	0.42202	0.964000	0.40570	0.995000	0.86356	2.769000	0.47654	1.355000	0.45865	0.561000	0.74099	ACG	G|0.999;A|0.001		0.577	MYBPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033197.1	NM_001010985	
SMG5	23381	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156236156	156236156	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr1:156236156T>C	ENST00000361813.5	-	12	1415	c.1271A>G	c.(1270-1272)aAg>aGg	p.K424R	SMG5_ENST00000368267.5_Intron|SMG5_ENST00000489907.2_5'UTR	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	424					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CACAGGTTCCTTGGACTCTGG	0.582																																					p.K424R		.											.	SMG5-231	0			c.A1271G						.						40.0	42.0	41.0					1																	156236156		2203	4300	6503	SO:0001583	missense	23381	exon12			GGTTCCTTGGACT	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.1271A>G	1.37:g.156236156T>C	ENSP00000355261:p.Lys424Arg	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	89	31	NM_015327	0	0	3	5	2	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	T	9.820	1.185549	0.21870	.	.	ENSG00000198952	ENST00000361813	T	0.29142	1.58	5.28	1.67	0.24075	.	0.436632	0.25777	N	0.028378	T	0.04048	0.0113	N	0.12182	0.205	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.33266	-0.9875	10	0.09843	T	0.71	-8.5258	5.1542	0.15027	0.0:0.2355:0.1441:0.6204	.	424	Q9UPR3	SMG5_HUMAN	R	424	ENSP00000355261:K424R	ENSP00000355261:K424R	K	-	2	0	SMG5	154502780	1.000000	0.71417	0.364000	0.25888	0.638000	0.38207	0.547000	0.23299	0.030000	0.15379	0.460000	0.39030	AAG	.		0.582	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
MUC2	4583	hgsc.bcm.edu	37	11	1092795	1092795	+	Silent	SNP	T	T	A	rs12786761		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:1092795T>A	ENST00000441003.2	+	30	4641	c.4614T>A	c.(4612-4614)acT>acA	p.T1538T	MUC2_ENST00000359061.5_Silent_p.T1539T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caaccaccactcccatcacca	0.627																																					p.T1538T		.											.	MUC2-90	0			c.T4614A						.						126.0	251.0	206.0					11																	1092795		1606	2836	4442	SO:0001819	synonymous_variant	4583	exon30			CACCACTCCCATC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4614T>A	11.37:g.1092795T>A		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	15	8	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1092813	1092813	+	Silent	SNP	C	C	T	rs12577898|rs199900755		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:1092813C>T	ENST00000441003.2	+	30	4659	c.4632C>T	c.(4630-4632)acC>acT	p.T1544T	MUC2_ENST00000359061.5_Silent_p.T1545T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccaccaccacGGTGACCC	0.637																																					p.T1544T		.											.	MUC2-90	0			c.C4632T						.						47.0	95.0	78.0					11																	1092813		1759	3190	4949	SO:0001819	synonymous_variant	4583	exon30			CACCACCACGGTG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4632C>T	11.37:g.1092813C>T		Somatic	1	0		WXS	Illumina HiSeq	Phase_I	32	9	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1092948	1092948	+	Silent	SNP	C	C	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:1092948C>G	ENST00000441003.2	+	30	4794	c.4767C>G	c.(4765-4767)acC>acG	p.T1589T	MUC2_ENST00000359061.5_Silent_p.T1590T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1590T(2)|p.T1589T(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tcaccaccaccactacggtga	0.627																																					p.T1589T		.											.	MUC2-90	4	Substitution - coding silent(4)	endometrium(2)|kidney(2)	c.C4767G						.																																			SO:0001819	synonymous_variant	4583	exon30			CACCACCACTACG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4767C>G	11.37:g.1092948C>G		Somatic	4	0		WXS	Illumina HiSeq	Phase_I	60	5	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1093368	1093368	+	Silent	SNP	G	G	A	rs111440994		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:1093368G>A	ENST00000441003.2	+	30	5214	c.5187G>A	c.(5185-5187)acG>acA	p.T1729T	MUC2_ENST00000359061.5_Silent_p.T1696T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.T17T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1696T(3)|p.T1729T(3)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccactacggtgaccccaa	0.647																																					p.T1729T		.											.	MUC2-90	6	Substitution - coding silent(6)	prostate(6)	c.G5187A						.						175.0	224.0	207.0					11																	1093368		1971	3826	5797	SO:0001819	synonymous_variant	4583	exon30			CACTACGGTGACC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5187G>A	11.37:g.1093368G>A		Somatic	5	0		WXS	Illumina HiSeq	Phase_I	65	7	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1093392	1093392	+	Silent	SNP	C	C	T	rs55912427		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:1093392C>T	ENST00000441003.2	+	30	5238	c.5211C>T	c.(5209-5211)acC>acT	p.T1737T	MUC2_ENST00000359061.5_Silent_p.T1704T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.T25T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caacacccaccggcacacaga	0.647																																					p.T1737T		.											.	MUC2-90	0			c.C5211T						.						163.0	215.0	197.0					11																	1093392		1996	3874	5870	SO:0001819	synonymous_variant	4583	exon30			ACCCACCGGCACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5211C>T	11.37:g.1093392C>T		Somatic	6	1		WXS	Illumina HiSeq	Phase_I	75	4	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
INTS5	80789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62417117	62417117	+	Silent	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:62417117A>G	ENST00000330574.2	-	2	487	c.435T>C	c.(433-435)agT>agC	p.S145S		NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	145					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						TGGACCATGCACTAATCACAG	0.572																																					p.S145S		.											.	INTS5-92	0			c.T435C						.						108.0	107.0	107.0					11																	62417117		2202	4299	6501	SO:0001819	synonymous_variant	80789	exon2			CCATGCACTAATC	AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.435T>C	11.37:g.62417117A>G		Somatic	126	0		WXS	Illumina HiSeq	Phase_I	111	44	NM_030628	0	0	1	3	2	Q8N6W5|Q9C0G5	Silent	SNP	ENST00000330574.2	37	CCDS8027.1																																																																																			.		0.572	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395327.1	NM_030628	
ARAP1	116985	hgsc.bcm.edu;broad.mit.edu	37	11	72423355	72423355	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:72423355A>G	ENST00000393609.3	-	7	1110	c.908T>C	c.(907-909)tTg>tCg	p.L303S	ARAP1_ENST00000393605.3_Missense_Mutation_p.L63S|ARAP1_ENST00000359373.5_Missense_Mutation_p.L303S|ARAP1_ENST00000426523.1_Missense_Mutation_p.L58S|ARAP1_ENST00000334211.8_Missense_Mutation_p.L58S|ARAP1_ENST00000455638.2_Missense_Mutation_p.L303S|ARAP1_ENST00000429686.1_Missense_Mutation_p.L58S	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	303					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GGGCAAGGACAAGCTCAGGCT	0.672																																					p.L303S	Ovarian(102;1198 1520 13195 17913 37529)	.											.	ARAP1-91	0			c.T908C						.						28.0	28.0	28.0					11																	72423355		2200	4293	6493	SO:0001583	missense	116985	exon7			AAGGACAAGCTCA	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.908T>C	11.37:g.72423355A>G	ENSP00000377233:p.Leu303Ser	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	23	6	NM_001040118	0	0	2	2	0	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	37	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	A	0.304	-0.971901	0.02215	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000340247	T;T;T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58;2.58;2.58	4.44	2.14	0.27477	.	0.724250	0.11919	N	0.516857	T	0.05135	0.0137	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.43621	-0.9380	10	0.07990	T	0.79	.	8.6422	0.33983	0.16:0.0:0.84:0.0	.	58;58;303;303;63	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	S	303;303;63;58;303;58;58;92	ENSP00000352332:L303S;ENSP00000390461:L303S;ENSP00000377230:L63S;ENSP00000335506:L58S;ENSP00000377233:L303S;ENSP00000392264:L58S;ENSP00000403127:L58S	ENSP00000335506:L58S	L	-	2	0	ARAP1	72101003	0.145000	0.22656	0.008000	0.14137	0.081000	0.17604	0.839000	0.27586	0.330000	0.23485	0.459000	0.35465	TTG	.		0.672	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
PGR	5241	broad.mit.edu	37	11	100933334	100933334	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:100933334G>A	ENST00000325455.5	-	4	3509	c.2056C>T	c.(2056-2058)Cca>Tca	p.P686S	PGR_ENST00000534013.1_Missense_Mutation_p.P92S|PGR_ENST00000263463.5_Intron	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	686	Steroid-binding.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	TTGATCAGTGGTGGAATCAAC	0.458																																					p.P686S	Pancreas(124;2271 2354 21954 22882)												.	PGR-652	0			c.C2056T						.						257.0	231.0	240.0					11																	100933334		2203	4300	6503	SO:0001583	missense	5241	exon4			TCAGTGGTGGAAT	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2056C>T	11.37:g.100933334G>A	ENSP00000325120:p.Pro686Ser	Somatic	253	0		WXS	Illumina HiSeq	Phase_I	258	6	NM_000926	0	0	0	0	0	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.713456	0.30413	.	.	ENSG00000082175	ENST00000325455;ENST00000534013	T;T	0.34859	1.34;1.34	5.86	-2.06	0.07298	Nuclear hormone receptor, ligand-binding (1);	0.307621	0.36101	N	0.002795	T	0.20373	0.0490	L	0.52126	1.63	0.80722	D	1	B;B	0.17667	0.023;0.001	B;B	0.19666	0.026;0.001	T	0.20840	-1.0263	10	0.10636	T	0.68	.	0.9072	0.01287	0.3248:0.1098:0.3401:0.2254	.	686;67	P06401;A7LQ08	PRGR_HUMAN;.	S	686;92	ENSP00000325120:P686S;ENSP00000436561:P92S	ENSP00000325120:P686S	P	-	1	0	PGR	100438544	0.996000	0.38824	0.097000	0.21041	0.737000	0.42083	1.371000	0.34250	-0.722000	0.04922	-0.182000	0.12963	CCA	.		0.458	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
ZW10	9183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	113628545	113628545	+	Missense_Mutation	SNP	G	G	A	rs377079908		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr11:113628545G>A	ENST00000200135.3	-	7	908	c.764C>T	c.(763-765)cCg>cTg	p.P255L		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	255	Interaction with RINT1.				ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		AGATGCCAGCGGCCTAAGGAT	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18410	0.0		0.0	False		,,,				2504	0.0				p.P255L		.											.	ZW10-228	0			c.C764T						.	G	LEU/PRO	0,4402		0,0,2201	66.0	69.0	68.0		764	5.5	1.0	11		68	1,8591	1.2+/-3.3	0,1,4295	no	missense	ZW10	NM_004724.3	98	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	255/780	113628545	1,12993	2201	4296	6497	SO:0001583	missense	9183	exon7			GCCAGCGGCCTAA	U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.764C>T	11.37:g.113628545G>A	ENSP00000200135:p.Pro255Leu	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	65	19	NM_004724	0	0	1	1	0	A1A528	Missense_Mutation	SNP	ENST00000200135.3	37	CCDS8363.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921357	0.73213	0.0	1.16E-4	ENSG00000086827	ENST00000200135	T	0.64438	-0.1	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.62392	0.2424	L	0.53249	1.67	0.80722	D	1	P	0.43857	0.819	B	0.41374	0.355	T	0.68330	-0.5437	10	0.87932	D	0	-10.4182	18.3058	0.90180	0.0:0.0:1.0:0.0	.	255	O43264	ZW10_HUMAN	L	255	ENSP00000200135:P255L	ENSP00000200135:P255L	P	-	2	0	ZW10	113133755	1.000000	0.71417	0.999000	0.59377	0.869000	0.49853	8.079000	0.89508	2.571000	0.86741	0.650000	0.86243	CCG	.		0.403	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398700.1	NM_004724	
H3F3C	440093	ucsc.edu	37	12	31944972	31944972	+	Silent	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr12:31944972A>G	ENST00000340398.3	-	1	203	c.129T>C	c.(127-129)ccT>ccC	p.P43P		NM_001013699.2	NP_001013721.2	Q6NXT2	H3C_HUMAN	H3 histone, family 3C	43					positive regulation of cell growth (GO:0030307)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	nucleosomal DNA binding (GO:0031492)	p.P43P(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	18						CCACGGTCCCAGGCCTGTAGC	0.617										HNSCC(67;0.2)																											p.P43P													.	H3F3C-68	1	Substitution - coding silent(1)	lung(1)	c.T129C						.						62.0	60.0	61.0					12																	31944972		2203	4300	6503	SO:0001819	synonymous_variant	440093	exon1			GGTCCCAGGCCTG	BC066906	CCDS31769.1	12p11.21	2012-02-15			ENSG00000188375	ENSG00000188375		"""Histones / Replication-independent"""	33164	protein-coding gene	gene with protein product						21274551	Standard	NM_001013699		Approved	H3.5	uc001rkr.3	Q6NXT2	OTTHUMG00000157811	ENST00000340398.3:c.129T>C	12.37:g.31944972A>G		Somatic	75	0		WXS	Illumina HiSeq		80	1	NM_001013699	0	0	0	668	668	E9P281	Silent	SNP	ENST00000340398.3	37	CCDS31769.1																																																																																			.		0.617	H3F3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349653.1	NM_001013699	
SKA3	221150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	21732196	21732196	+	Silent	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr13:21732196A>G	ENST00000314759.5	-	7	1108	c.984T>C	c.(982-984)acT>acC	p.T328T	SKA3_ENST00000400018.3_Silent_p.T328T	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3	328					chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)				breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						AAACCAACGAAGTACGATCTT	0.333																																					p.T328T		.											.	SKA3-90	0			c.T984C						.						111.0	119.0	116.0					13																	21732196		2203	4300	6503	SO:0001819	synonymous_variant	221150	exon7			CAACGAAGTACGA	AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.984T>C	13.37:g.21732196A>G		Somatic	174	1		WXS	Illumina HiSeq	Phase_I	182	40	NM_145061	0	0	0	0	0	A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Silent	SNP	ENST00000314759.5	37	CCDS31946.1																																																																																			.		0.333	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1	NM_145061	
ITGBL1	9358	ucsc.edu;bcgsc.ca	37	13	102235670	102235670	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr13:102235670G>C	ENST00000376180.3	+	6	1051	c.832G>C	c.(832-834)Gct>Cct	p.A278P	ITGBL1_ENST00000376162.3_Missense_Mutation_p.A185P|ITGBL1_ENST00000545560.2_Missense_Mutation_p.A137P	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	278	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)				breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGACTGTAGAGCTGTCTATGA	0.473																																					p.A278P													.	ITGBL1-92	0			c.G832C						.						247.0	236.0	240.0					13																	102235670		2203	4300	6503	SO:0001583	missense	9358	exon6			TGTAGAGCTGTCT	AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.832G>C	13.37:g.102235670G>C	ENSP00000365351:p.Ala278Pro	Somatic	242	2		WXS	Illumina HiSeq		246	83	NM_004791	0	0	1	1	0	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Missense_Mutation	SNP	ENST00000376180.3	37	CCDS9499.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174126	0.38413	.	.	ENSG00000198542	ENST00000376180;ENST00000537118;ENST00000539955;ENST00000545560;ENST00000376162	D;T;D	0.84944	-1.92;-0.97;-1.71	5.11	0.959	0.19624	Epidermal growth factor-like (1);	0.309269	0.39210	N	0.001434	D	0.85961	0.5819	L	0.51422	1.61	0.54753	D	0.999981	D;P	0.65815	0.995;0.589	D;P	0.79784	0.993;0.632	T	0.80266	-0.1454	10	0.27785	T	0.31	.	4.8497	0.13531	0.0715:0.12:0.4414:0.3671	.	137;278	B3KTP1;O95965	.;ITGBL_HUMAN	P	278;186;137;137;185	ENSP00000365351:A278P;ENSP00000439903:A137P;ENSP00000365332:A185P	ENSP00000365332:A185P	A	+	1	0	ITGBL1	101033671	1.000000	0.71417	0.240000	0.24138	0.005000	0.04900	2.055000	0.41345	0.220000	0.20860	-0.218000	0.12543	GCT	.		0.473	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	
AKAP6	9472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	33204952	33204952	+	Missense_Mutation	SNP	T	T	A	rs201928179		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr14:33204952T>A	ENST00000280979.4	+	11	3406	c.3236T>A	c.(3235-3237)cTg>cAg	p.L1079Q	AKAP6_ENST00000557272.1_Missense_Mutation_p.L1079Q	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1079					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AGTGGAAGCCTGGTAAGGCAG	0.488																																					p.L1079Q	Melanoma(49;821 1200 7288 13647 42351)	.											.	AKAP6-733	0			c.T3236A						.						70.0	72.0	71.0					14																	33204952		2203	4300	6503	SO:0001583	missense	9472	exon11			GAAGCCTGGTAAG	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3236T>A	14.37:g.33204952T>A	ENSP00000280979:p.Leu1079Gln	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	77	26	NM_004274	0	0	0	0	0	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.981383	0.74474	.	.	ENSG00000151320	ENST00000280979;ENST00000557272	T;T	0.22539	3.18;1.95	5.7	4.54	0.55810	.	0.118007	0.37809	N	0.001926	T	0.26629	0.0651	N	0.14661	0.345	0.44000	D	0.996707	D	0.71674	0.998	D	0.63488	0.915	T	0.07385	-1.0775	10	0.62326	D	0.03	-5.2892	12.8687	0.57953	0.0:0.0:0.1363:0.8637	.	1079	Q13023	AKAP6_HUMAN	Q	1079	ENSP00000280979:L1079Q;ENSP00000451247:L1079Q	ENSP00000280979:L1079Q	L	+	2	0	AKAP6	32274703	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.041000	0.76558	0.961000	0.38030	0.477000	0.44152	CTG	T|0.999;C|0.000		0.488	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
DAAM1	23002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	59791109	59791109	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr14:59791109T>A	ENST00000395125.1	+	7	949	c.926T>A	c.(925-927)cTg>cAg	p.L309Q	DAAM1_ENST00000360909.3_Missense_Mutation_p.L309Q|DAAM1_ENST00000351081.1_Missense_Mutation_p.L309Q	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	309	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TATGAATTTCTGATGTTAGGA	0.308																																					p.L309Q		.											.	DAAM1-227	0			c.T926A						.						87.0	91.0	90.0					14																	59791109		2203	4300	6503	SO:0001583	missense	23002	exon8			AATTTCTGATGTT	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.926T>A	14.37:g.59791109T>A	ENSP00000378557:p.Leu309Gln	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	117	35	NM_001270520	0	0	0	0	0	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	37	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.330005	0.60743	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	D;D;D	0.84516	-1.86;-1.86;-1.86	5.17	4.01	0.46588	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88377	0.6420	M	0.80508	2.5	0.80722	D	1	P;P	0.45634	0.835;0.863	P;P	0.49140	0.466;0.601	D	0.88524	0.3098	10	0.62326	D	0.03	.	12.2246	0.54453	0.0:0.0:0.1426:0.8574	.	309;309	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	Q	309	ENSP00000354162:L309Q;ENSP00000247170:L309Q;ENSP00000378557:L309Q	ENSP00000247170:L309Q	L	+	2	0	DAAM1	58860862	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.841000	0.86834	0.965000	0.38133	0.533000	0.62120	CTG	.		0.308	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
MGA	23269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42005411	42005411	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr15:42005411T>A	ENST00000570161.1	+	8	3147	c.3147T>A	c.(3145-3147)aaT>aaA	p.N1049K	MGA_ENST00000545763.1_Missense_Mutation_p.N1049K|MGA_ENST00000566586.1_Missense_Mutation_p.N1049K|MGA_ENST00000219905.7_Missense_Mutation_p.N1049K|MGA_ENST00000389936.4_Missense_Mutation_p.N1049K			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTGCAACAATGACTTCTGTC	0.463																																					p.N1049K		.											.	MGA-522	0			c.T3147A						.						156.0	153.0	154.0					15																	42005411		1992	4139	6131	SO:0001583	missense	23269	exon9			CAACAATGACTTC	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.3147T>A	15.37:g.42005411T>A	ENSP00000457035:p.Asn1049Lys	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	117	32	NM_001080541	0	0	0	0	0	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	T	15.20	2.762234	0.49468	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.16457	2.34;2.34;2.34	5.75	3.24	0.37175	.	0.270326	0.40144	N	0.001172	T	0.15739	0.0379	N	0.14661	0.345	0.36995	D	0.894984	P;P	0.50272	0.933;0.533	P;B	0.56865	0.808;0.305	T	0.15983	-1.0418	10	0.44086	T	0.13	.	4.9526	0.14023	0.1341:0.1556:0.0:0.7103	.	1049;1049	F5H7K2;E7ENI0	.;.	K	1049	ENSP00000219905:N1049K;ENSP00000374586:N1049K;ENSP00000442467:N1049K	ENSP00000219905:N1049K	N	+	3	2	MGA	39792703	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	0.237000	0.17985	0.882000	0.36016	0.533000	0.62120	AAT	.		0.463	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
VPS13C	54832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	62167108	62167108	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr15:62167108T>A	ENST00000261517.5	-	77	10454	c.10381A>T	c.(10381-10383)Att>Ttt	p.I3461F	VPS13C_ENST00000249837.3_Missense_Mutation_p.I3418F|VPS13C_ENST00000395898.3_Missense_Mutation_p.I3418F|VPS13C_ENST00000558919.1_5'Flank|VPS13C_ENST00000395896.4_Missense_Mutation_p.I3461F	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						CTCACTCCAATCACTAACCCC	0.303																																					p.I3461F		.											.	VPS13C-92	0			c.A10381T						.						104.0	104.0	104.0					15																	62167108		2203	4300	6503	SO:0001583	missense	54832	exon77			CTCCAATCACTAA	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.10381A>T	15.37:g.62167108T>A	ENSP00000261517:p.Ile3461Phe	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	173	60	NM_020821	0	0	0	0	0		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.404605	0.83230	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.43294	0.95;0.95;1.12	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.56108	0.1963	L	0.40543	1.245	0.80722	D	1	D;D;D;D	0.69078	0.978;0.995;0.997;0.997	D;D;D;D	0.71656	0.923;0.962;0.974;0.92	T	0.56511	-0.7967	10	0.54805	T	0.06	.	16.1946	0.82018	0.0:0.0:0.0:1.0	.	3418;3461;3418;3461	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	F	3418;3461;3461;3461	ENSP00000249837:I3418F;ENSP00000261517:I3461F;ENSP00000379233:I3461F	ENSP00000249837:I3418F	I	-	1	0	VPS13C	59954400	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.402000	0.59722	2.228000	0.72767	0.528000	0.53228	ATT	.		0.303	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
PRR25	388199	hgsc.bcm.edu	37	16	863367	863367	+	Nonsense_Mutation	SNP	C	C	T	rs367751056|rs371962006|rs138733834	byFrequency	TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr16:863367C>T	ENST00000301698.1	+	3	715	c.715C>T	c.(715-717)Cga>Tga	p.R239*		NM_001013638.1	NP_001013660.1	Q96S07	PRR25_HUMAN	proline rich 25	239										large_intestine(1)|lung(1)|skin(1)	3						GACGCCGGACCGACACGGCCT	0.711													-|||	5	0.000998403	0.0	0.0	5008	,	,		12233	0.0		0.0	False		,,,				2504	0.0051				p.R239X		.											.	PRR25-135	0			c.C715T						.	-	stop/ARG	0,3270		0,0,1635	10.0	18.0	16.0		715	-0.3	0.0	16		16	7,8213		0,7,4103	no	stop-gained	PRR25	NM_001013638.1		0,7,5738	TT,TC,CC		0.0852,0.0,0.0609		239/403	863367	7,11483	1635	4110	5745	SO:0001587	stop_gained	388199	exon3			CCGGACCGACACG	BC156145	CCDS45372.1	16p13.3	2009-09-11			ENSG00000167945	ENSG00000167945			37230	protein-coding gene	gene with protein product						11157797	Standard	NM_001013638		Approved	gs64	uc010uut.2	Q96S07		ENST00000301698.1:c.715C>T	16.37:g.863367C>T	ENSP00000301698:p.Arg239*	Somatic	5	1		WXS	Illumina HiSeq	Phase_I	12	6	NM_001013638	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000301698.1	37	CCDS45372.1	.	.	.	.	.	.	.	.	.	.	-	7.788	0.710968	0.15239	0.0	8.52E-4	ENSG00000167945	ENST00000301698	.	.	.	0.13	-0.261	0.12963	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	239	.	ENSP00000301698:R239X	R	+	1	2	PRR25	803368	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.233000	0.01204	-2.944000	0.00296	-2.980000	0.00080	CGA	.		0.711	PRR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440563.1	NM_001013638	
ZZEF1	23140	broad.mit.edu	37	17	3977517	3977517	+	Silent	SNP	C	C	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr17:3977517C>T	ENST00000381638.2	-	24	3736	c.3612G>A	c.(3610-3612)ctG>ctA	p.L1204L	ZZEF1_ENST00000574474.1_5'Flank	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1204							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GCTGTAAATCCAGCCCCCAAG	0.577																																					p.L1204L													.	ZZEF1-93	0			c.G3612A						.						173.0	165.0	167.0					17																	3977517		2203	4300	6503	SO:0001819	synonymous_variant	23140	exon24			TAAATCCAGCCCC	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.3612G>A	17.37:g.3977517C>T		Somatic	301	0		WXS	Illumina HiSeq	Phase_I	364	6	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	ENST00000381638.2	37	CCDS11043.1																																																																																			.		0.577	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	G	rs121912666		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr17:7578190T>G	ENST00000269305.4	-	6	848	c.659A>C	c.(658-660)tAt>tCt	p.Y220S	TP53_ENST00000420246.2_Missense_Mutation_p.Y220S|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.Y220S|TP53_ENST00000455263.2_Missense_Mutation_p.Y220S|TP53_ENST00000445888.2_Missense_Mutation_p.Y220S|TP53_ENST00000359597.4_Missense_Mutation_p.Y220S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y220S	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	c.A659C	GRCh37	CM015378|CM951227	TP53	M	rs121912666	.						102.0	94.0	97.0					17																	7578190		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGCTCATAGGGCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>C	17.37:g.7578190T>G	ENSP00000269305:p.Tyr220Ser	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	61	9	NM_000546	0	0	4	4	0	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.447753	0.84101	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99833	-7.03;-7.03;-7.03;-7.03;-7.03;-7.03;-7.03;-7.03	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	A	1	D;D;D;D;D;D;D	0.89917	1.0;0.994;0.997;1.0;0.995;0.968;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.921;0.963;1.0;0.977;0.926;1.0	D	0.96735	0.9542	9	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220S;ENSP00000352610:Y220S;ENSP00000269305:Y220S;ENSP00000398846:Y220S;ENSP00000391127:Y220S;ENSP00000391478:Y220S;ENSP00000425104:Y88S;ENSP00000423862:Y127S	ENSP00000269305:Y220S	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT	.		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SLC47A1	55244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	19451346	19451346	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr17:19451346A>G	ENST00000270570.4	+	4	441	c.355A>G	c.(355-357)Agt>Ggt	p.S119G	SLC47A1_ENST00000584348.1_3'UTR|SLC47A1_ENST00000395585.1_Missense_Mutation_p.S119G|SLC47A1_ENST00000542886.1_Missense_Mutation_p.S119G|SLC47A1_ENST00000457293.1_Missense_Mutation_p.S119G|SLC47A1_ENST00000436810.2_Missense_Mutation_p.S96G|SLC47A1_ENST00000575023.1_Missense_Mutation_p.S119G|SLC47A1_ENST00000571335.1_5'UTR	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	119					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	CCTGCAGCGGAGTGCGCTCGT	0.612																																					p.S119G		.											.	SLC47A1-90	0			c.A355G						.						144.0	120.0	128.0					17																	19451346		2203	4300	6503	SO:0001583	missense	55244	exon4			CAGCGGAGTGCGC		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.355A>G	17.37:g.19451346A>G	ENSP00000270570:p.Ser119Gly	Somatic	72	1		WXS	Illumina HiSeq	Phase_I	110	59	NM_018242	0	0	7	18	11	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	37	CCDS11209.1	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.623256	0.00820	.	.	ENSG00000142494	ENST00000436810;ENST00000270570;ENST00000457293;ENST00000542886;ENST00000395585	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62	4.99	2.98	0.34508	.	0.272209	0.40385	N	0.001106	T	0.09512	0.0234	N	0.01751	-0.74	0.09310	N	1	B;B;B;B	0.09022	0.001;0.002;0.001;0.0	B;B;B;B	0.09377	0.002;0.004;0.004;0.002	T	0.37079	-0.9721	10	0.02654	T	1	-24.9116	9.8375	0.40977	0.1719:0.0:0.8281:0.0	.	96;119;119;119	E7EX57;B4DYV3;Q96FL8;Q96FL8-3	.;.;S47A1_HUMAN;.	G	96;119;119;119;119	ENSP00000407155:S96G;ENSP00000270570:S119G;ENSP00000415586:S119G;ENSP00000440435:S119G;ENSP00000378951:S119G	ENSP00000270570:S119G	S	+	1	0	SLC47A1	19391938	0.956000	0.32656	0.005000	0.12908	0.001000	0.01503	5.014000	0.64029	0.494000	0.27859	-0.464000	0.05259	AGT	.		0.612	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	NM_018242	
CHAD	1101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48546019	48546019	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr17:48546019C>A	ENST00000508540.1	-	1	308	c.156G>T	c.(154-156)aaG>aaT	p.K52N	ACSF2_ENST00000541920.1_Intron|ACSF2_ENST00000427954.2_Intron|ACSF2_ENST00000300441.4_Intron|CHAD_ENST00000258969.4_Missense_Mutation_p.K52N|ACSF2_ENST00000502667.1_Intron|ACSF2_ENST00000506085.1_Intron|ACSF2_ENST00000504392.1_Intron	NM_001267.2	NP_001258.2	O15335	CHAD_HUMAN	chondroadherin	52	LRRNT.				bone development (GO:0060348)|cartilage condensation (GO:0001502)|negative regulation of bone trabecula formation (GO:1900155)	proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(2)|ovary(2)	15	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GCAGCTTGGTCTTCTCTGACA	0.622																																					p.K52N		.											.	CHAD-92	0			c.G156T						.						92.0	77.0	82.0					17																	48546019		2203	4300	6503	SO:0001583	missense	1101	exon1			CTTGGTCTTCTCT	U96767	CCDS11568.1	17q21.33	2008-02-05			ENSG00000136457	ENSG00000136457		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1909	protein-coding gene	gene with protein product	"""chondroadherin proteoglycan"""	602178				9344663	Standard	NM_001267		Approved	SLRR4A	uc010dbr.3	O15335	OTTHUMG00000162129	ENST00000508540.1:c.156G>T	17.37:g.48546019C>A	ENSP00000423812:p.Lys52Asn	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	86	17	NM_001267	0	0	0	1	1	A8K812|Q6GTU0|Q96RJ5	Missense_Mutation	SNP	ENST00000508540.1	37	CCDS11568.1	.	.	.	.	.	.	.	.	.	.	C	9.129	1.010904	0.19277	.	.	ENSG00000136457	ENST00000508540;ENST00000258969	T;T	0.04015	3.73;3.73	4.31	2.29	0.28610	Leucine-rich repeat-containing N-terminal (1);	0.490348	0.23123	N	0.051679	T	0.01835	0.0058	N	0.04018	-0.295	0.28724	N	0.902844	B	0.17465	0.022	B	0.14578	0.011	T	0.45086	-0.9285	10	0.09084	T	0.74	.	4.7213	0.12920	0.1537:0.601:0.0:0.2453	.	52	O15335	CHAD_HUMAN	N	52	ENSP00000423812:K52N;ENSP00000258969:K52N	ENSP00000258969:K52N	K	-	3	2	CHAD	45901018	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	1.268000	0.33062	0.442000	0.26555	0.462000	0.41574	AAG	.		0.622	CHAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367447.3	NM_001267	
TSHZ3	57616	hgsc.bcm.edu	37	19	31770237	31770237	+	Silent	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr19:31770237A>G	ENST00000240587.4	-	2	789	c.462T>C	c.(460-462)agT>agC	p.S154S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	154	Ser-rich.				in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					tgctgctgctactgctgctgc	0.607																																					p.S154S		.											.	TSHZ3-232	0			c.T462C						.						39.0	44.0	42.0					19																	31770237		2184	4294	6478	SO:0001819	synonymous_variant	57616	exon2			GCTGCTACTGCTG	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.462T>C	19.37:g.31770237A>G		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	20	3	NM_020856	7	5	3	7274	7259	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																			.		0.607	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
CAPNS1	826	hgsc.bcm.edu	37	19	36631958	36631958	+	Silent	SNP	C	C	G	rs567500165		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr19:36631958C>G	ENST00000246533.3	+	2	643	c.45C>G	c.(43-45)ggC>ggG	p.G15G	CAPNS1_ENST00000589146.1_Silent_p.G15G|CAPNS1_ENST00000588780.1_Silent_p.G15G|CAPNS1_ENST00000587718.1_Silent_p.G15G|CAPNS1_ENST00000588815.1_Silent_p.G15G|CAPNS1_ENST00000590874.1_Silent_p.G15G	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	15	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcgggggaggcg	0.736													C|||	1	0.000199681	0.0	0.0	5008	,	,		3971	0.001		0.0	False		,,,				2504	0.0				p.G15G	Esophageal Squamous(129;1541 1691 5780 18353 34150)	.											.	CAPNS1-90	0			c.C45G						.						6.0	7.0	7.0					19																	36631958		1958	3947	5905	SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGGGGA	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.45C>G	19.37:g.36631958C>G		Somatic	9	0		WXS	Illumina HiSeq	Phase_I	13	2	NM_001749	0	0	0	0	0	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																			.		0.736	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457411.2		
LILRB4	11006	broad.mit.edu	37	19	55175654	55175654	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr19:55175654A>C	ENST00000391736.1	+	6	688	c.373A>C	c.(373-375)Acc>Ccc	p.T125P	LILRB4_ENST00000391734.3_Missense_Mutation_p.T125P|LILRB4_ENST00000430952.2_Missense_Mutation_p.T125P|LILRB4_ENST00000391733.3_Missense_Mutation_p.T125P|LILRB4_ENST00000270452.2_Missense_Mutation_p.T125P	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	125	Ig-like C2-type 2.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		CAGTAAACCCACCCTTTCAGC	0.572																																					p.T125P													.	LILRB4-93	0			c.A373C						.						92.0	95.0	94.0					19																	55175654		2203	4300	6503	SO:0001583	missense	11006	exon4			AAACCCACCCTTT	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.373A>C	19.37:g.55175654A>C	ENSP00000375616:p.Thr125Pro	Somatic	110	12		WXS	Illumina HiSeq	Phase_I	119	10	NM_006847	0	0	9	10	1	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	A	12.51	1.959220	0.34565	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.03124	4.04;4.04;4.04;4.04;4.04;4.04	2.72	-3.96	0.04106	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.11495	0.0280	M	0.83012	2.62	0.09310	N	1	D;D;D;P;P	0.58268	0.967;0.982;0.978;0.94;0.952	P;P;P;P;P	0.57152	0.814;0.8;0.699;0.653;0.765	T	0.02813	-1.1107	9	0.87932	D	0	.	7.4436	0.27198	0.2671:0.0:0.0:0.7329	.	125;125;125;125;125	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	P	125	ENSP00000375616:T125P;ENSP00000270452:T125P;ENSP00000408995:T125P;ENSP00000375614:T125P;ENSP00000375613:T125P;ENSP00000401962:T125P	ENSP00000270452:T125P	T	+	1	0	LILRB4	59867466	0.000000	0.05858	0.033000	0.17914	0.008000	0.06430	-2.611000	0.00885	-0.668000	0.05296	0.329000	0.21502	ACC	.		0.572	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
ZNF628	89887	hgsc.bcm.edu	37	19	55993790	55993790	+	Silent	SNP	A	A	G	rs7254184	byFrequency	TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr19:55993790A>G	ENST00000598519.1	+	3	1783	c.1230A>G	c.(1228-1230)gaA>gaG	p.E410E	NAT14_ENST00000205194.4_5'Flank|NAT14_ENST00000587400.1_5'Flank|ZNF628_ENST00000391718.2_Silent_p.E406E|NAT14_ENST00000591590.1_5'Flank			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	410					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		GCCACGTGGAAGAggccgcgg	0.786													N|||	3011	0.601238	0.5847	0.6254	5008	,	,		4864	0.3274		0.7306	False		,,,				2504	0.7556				p.E410E		.											.	ZNF628-22	0			c.A1230G						.						1.0	1.0	1.0					19																	55993790		599	1269	1868	SO:0001819	synonymous_variant	89887	exon3			CGTGGAAGAGGCC	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.1230A>G	19.37:g.55993790A>G		Somatic	1	1		WXS	Illumina HiSeq	Phase_I	3	3	NM_033113	0	0	0	0	0	Q86X34	Silent	SNP	ENST00000598519.1	37	CCDS33116.3																																																																																			A|0.440;G|0.560		0.786	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
POMC	5443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	25387619	25387619	+	Missense_Mutation	SNP	C	C	T	rs146551109		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:25387619C>T	ENST00000405623.1	-	2	478	c.23G>A	c.(22-24)cGc>cAc	p.R8H	POMC_ENST00000264708.3_Missense_Mutation_p.R8H|POMC_ENST00000380794.1_Missense_Mutation_p.R8H|POMC_ENST00000395826.2_Missense_Mutation_p.R8H			P01189	COLI_HUMAN	proopiomelanocortin	8					cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)	p.R8H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	GGCCCCCGAGCGGCTGCAGCA	0.612																																					p.R8H	Colon(110;1515 1566 8452 10082 43216)	.											.	POMC-91	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G23A						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	41.0	44.0	43.0		23,23	3.8	0.0	2	dbSNP_134	43	0,8598		0,0,4299	no	missense,missense	POMC	NM_000939.2,NM_001035256.1	29,29	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	8/268,8/268	25387619	1,13003	2203	4299	6502	SO:0001583	missense	5443	exon3			CCCGAGCGGCTGC		CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.23G>A	2.37:g.25387619C>T	ENSP00000384092:p.Arg8His	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	98	27	NM_001035256	0	0	0	0	0	P78442|Q53T23|Q9UD39|Q9UD40	Missense_Mutation	SNP	ENST00000405623.1	37	CCDS1717.1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.485311	0.26598	2.27E-4	0.0	ENSG00000115138	ENST00000380794;ENST00000405623;ENST00000264708;ENST00000395826;ENST00000449220	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	5.64	3.82	0.43975	.	0.809526	0.10655	N	0.649411	T	0.64800	0.2631	L	0.33485	1.01	0.09310	N	1	D	0.60575	0.988	B	0.43916	0.436	T	0.52011	-0.8632	10	0.15952	T	0.53	-24.4143	4.8248	0.13410	0.1512:0.6107:0.0:0.2382	.	8	P01189	COLI_HUMAN	H	8	ENSP00000370171:R8H;ENSP00000384092:R8H;ENSP00000264708:R8H;ENSP00000379170:R8H;ENSP00000387993:R8H	ENSP00000264708:R8H	R	-	2	0	POMC	25241123	0.278000	0.24230	0.019000	0.16419	0.096000	0.18686	0.717000	0.25851	1.381000	0.46364	0.462000	0.41574	CGC	C|1.000;T|0.000		0.612	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	NM_001035256	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32656054	32656054	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:32656054A>C	ENST00000421745.2	+	12	3278	c.3144A>C	c.(3142-3144)gaA>gaC	p.E1048D		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1048					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GCTGGGTAGAAGTTCAACAAG	0.483																																					p.E1048D	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6-233	0			c.A3144C						.						92.0	80.0	84.0					2																	32656054		2203	4300	6503	SO:0001583	missense	57448	exon12			GGTAGAAGTTCAA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.3144A>C	2.37:g.32656054A>C	ENSP00000393596:p.Glu1048Asp	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	63	20	NM_016252	0	0	0	0	0	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	17.67	3.447198	0.63178	.	.	ENSG00000115760	ENST00000421745	D	0.84070	-1.8	5.62	0.657	0.17850	.	0.000000	0.85682	D	0.000000	D	0.83894	0.5353	L	0.36672	1.1	0.45541	D	0.998494	D	0.58970	0.984	D	0.68192	0.956	T	0.81510	-0.0900	10	0.87932	D	0	.	9.7011	0.40187	0.6633:0.0:0.3367:0.0	.	1048	Q9NR09	BIRC6_HUMAN	D	1048	ENSP00000393596:E1048D	ENSP00000393596:E1048D	E	+	3	2	BIRC6	32509558	1.000000	0.71417	0.985000	0.45067	0.974000	0.67602	1.623000	0.37008	-0.105000	0.12132	0.533000	0.62120	GAA	.		0.483	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
NFE2L2	4780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	178098956	178098956	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:178098956A>C	ENST00000397062.3	-	2	643	c.89T>G	c.(88-90)cTt>cGt	p.L30R	NFE2L2_ENST00000464747.1_Missense_Mutation_p.L14R|NFE2L2_ENST00000423513.1_Missense_Mutation_p.L14R|NFE2L2_ENST00000397063.4_Missense_Mutation_p.L14R|NFE2L2_ENST00000446151.2_Missense_Mutation_p.L14R	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	30					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L30R(2)|p.L30H(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTTACTCCAAGATCTATATC	0.363			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.L30R		.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2-90	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.T89G						.						68.0	61.0	63.0					2																	178098956		1839	4101	5940	SO:0001583	missense	4780	exon2			ACTCCAAGATCTA		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.89T>G	2.37:g.178098956A>C	ENSP00000380252:p.Leu30Arg	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	66	7	NM_006164	0	0	1	1	0	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	A	19.55	3.849301	0.71603	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.69931	0.3166	M	0.86953	2.85	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.998	T	0.76061	-0.3097	10	0.87932	D	0	.	16.098	0.81144	1.0:0.0:0.0:0.0	.	14;14;14;30	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	R	14;30;14;14;14;14;14	ENSP00000380253:L14R;ENSP00000380252:L30R;ENSP00000411575:L14R;ENSP00000391590:L14R;ENSP00000400073:L14R;ENSP00000412191:L14R;ENSP00000410015:L14R	ENSP00000380252:L30R	L	-	2	0	NFE2L2	177807202	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.962000	0.93254	2.210000	0.71456	0.460000	0.39030	CTT	.		0.363	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
AGPS	8540	hgsc.bcm.edu;broad.mit.edu	37	2	178301498	178301498	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:178301498T>G	ENST00000264167.4	+	4	594	c.448T>G	c.(448-450)Tta>Gta	p.L150V	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	150					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			CTAGGCATCCTTAAATCCTAG	0.303																																					p.L150V		.											.	AGPS-92	0			c.T448G						.						71.0	74.0	73.0					2																	178301498		2202	4292	6494	SO:0001583	missense	8540	exon4			GCATCCTTAAATC	Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.448T>G	2.37:g.178301498T>G	ENSP00000264167:p.Leu150Val	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	115	7	NM_003659	0	0	0	0	0	A5D8U9|Q2TU35	Missense_Mutation	SNP	ENST00000264167.4	37	CCDS2275.1	.	.	.	.	.	.	.	.	.	.	T	9.464	1.093816	0.20471	.	.	ENSG00000018510	ENST00000264167;ENST00000536686	D	0.97575	-4.44	5.62	1.71	0.24356	.	0.148425	0.46758	D	0.000266	D	0.93979	0.8072	M	0.65975	2.015	0.80722	D	1	B	0.20887	0.049	B	0.14578	0.011	D	0.86266	0.1658	10	0.22109	T	0.4	.	6.0179	0.19613	0.2548:0.0693:0.0:0.6759	.	150	O00116	ADAS_HUMAN	V	150;20	ENSP00000264167:L150V	ENSP00000264167:L150V	L	+	1	2	AGPS	178009744	0.994000	0.37717	0.991000	0.47740	0.999000	0.98932	1.525000	0.35953	0.036000	0.15547	0.533000	0.62120	TTA	.		0.303	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255730.2		
SSFA2	6744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	182786760	182786760	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:182786760G>C	ENST00000431877.2	+	16	3475	c.3296G>C	c.(3295-3297)gGa>gCa	p.G1099A	SSFA2_ENST00000467172.2_3'UTR|SSFA2_ENST00000320370.7_Missense_Mutation_p.G1099A|SSFA2_ENST00000409001.1_Missense_Mutation_p.G1077A|SSFA2_ENST00000428267.2_Missense_Mutation_p.G924A|SSFA2_ENST00000409136.1_Missense_Mutation_p.G608A	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	1099						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			ATTCCTCCTGGAGAAAGCTCA	0.438																																					p.G1099A		.											.	SSFA2-153	0			c.G3296C						.						86.0	89.0	88.0					2																	182786760		2203	4300	6503	SO:0001583	missense	6744	exon16			CTCCTGGAGAAAG	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.3296G>C	2.37:g.182786760G>C	ENSP00000388731:p.Gly1099Ala	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	134	30	NM_001130445	0	0	3	7	4	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	ENST00000431877.2	37	CCDS46467.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536228	0.27475	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136;ENST00000451836	T;T;T;T;T	0.13420	2.84;2.59;2.81;2.81;2.6	5.81	3.98	0.46160	.	0.255590	0.34156	N	0.004205	T	0.09512	0.0234	L	0.31120	0.905	0.33216	D	0.554017	B;B;B;B;B	0.20261	0.043;0.043;0.043;0.043;0.043	B;B;B;B;B	0.19148	0.024;0.024;0.024;0.024;0.024	T	0.10847	-1.0612	10	0.29301	T	0.29	-16.5272	8.2067	0.31458	0.1663:0.1882:0.6455:0.0	.	924;608;1077;1099;1099	E7END2;E7EUL7;E9PHV5;P28290;P28290-3	.;.;.;SSFA2_HUMAN;.	A	1099;1099;1077;924;608;44	ENSP00000388731:G1099A;ENSP00000314669:G1099A;ENSP00000387319:G1077A;ENSP00000409867:G924A;ENSP00000386916:G608A	ENSP00000314669:G1099A	G	+	2	0	SSFA2	182495005	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.480000	0.45206	1.461000	0.47929	0.563000	0.77884	GGA	.		0.438	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	
ZFAND2B	130617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220072989	220072989	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:220072989T>G	ENST00000289528.5	+	5	641	c.446T>G	c.(445-447)aTc>aGc	p.I149S	ZFAND2B_ENST00000444522.2_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409097.1_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409217.1_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409594.1_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409336.1_Missense_Mutation_p.I149S|ZFAND2B_ENST00000409206.1_Missense_Mutation_p.I149S	NM_001270998.1|NM_001270999.1|NM_138802.2	NP_001257927.1|NP_001257928.1|NP_620157.1	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	149						endoplasmic reticulum (GO:0005783)	zinc ion binding (GO:0008270)	p.I149T(1)		endometrium(2)|kidney(4)|lung(4)|upper_aerodigestive_tract(1)	11		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTGCTGCCATCTCCAGAGCA	0.532																																					p.I149S		.											.	ZFAND2B-68	1	Substitution - Missense(1)	kidney(1)	c.T446G						.						75.0	62.0	66.0					2																	220072989		2203	4300	6503	SO:0001583	missense	130617	exon5			CTGCCATCTCCAG	AK074571	CCDS2435.1, CCDS74656.1	2q35	2010-04-23	2005-08-22		ENSG00000158552	ENSG00000158552		"""Zinc fingers, AN1-type domain containing"""	25206	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein-like"""	613474	"""zinc finger, AN1-type 2B"""			18467495	Standard	NM_138802		Approved	AIRAPL	uc002vka.4	Q8WV99	OTTHUMG00000133135	ENST00000289528.5:c.446T>G	2.37:g.220072989T>G	ENSP00000289528:p.Ile149Ser	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	54	18	NM_138802	0	0	0	0	0	Q8NB98	Missense_Mutation	SNP	ENST00000289528.5	37	CCDS2435.1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.088523	0.55968	.	.	ENSG00000158552	ENST00000409206;ENST00000409594;ENST00000289528;ENST00000422255;ENST00000409097;ENST00000409336;ENST00000409217;ENST00000444522	T;T;T;T;T;T;T;T	0.44881	0.96;0.96;0.92;0.92;0.91;0.92;0.92;0.91	5.32	5.32	0.75619	Zinc finger, AN1-type (1);	0.400654	0.26646	N	0.023223	T	0.48241	0.1489	L	0.54323	1.7	0.40724	D	0.982682	D;B;B	0.57571	0.98;0.329;0.069	P;B;B	0.51550	0.673;0.116;0.053	T	0.52230	-0.8603	10	0.59425	D	0.04	-15.7601	11.5973	0.50981	0.0:0.0:0.0:1.0	.	40;149;149	B3KQB0;Q8WV99;B4DEN4	.;ZFN2B_HUMAN;.	S	149	ENSP00000386824:I149S;ENSP00000386399:I149S;ENSP00000289528:I149S;ENSP00000409931:I149S;ENSP00000387179:I149S;ENSP00000386898:I149S;ENSP00000386370:I149S;ENSP00000411334:I149S	ENSP00000289528:I149S	I	+	2	0	ZFAND2B	219781233	0.998000	0.40836	1.000000	0.80357	0.961000	0.63080	3.720000	0.54933	2.233000	0.73108	0.533000	0.62120	ATC	.		0.532	ZFAND2B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256824.2	NM_138802	
UGT1A3	54659	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	234637943	234637943	+	Silent	SNP	G	G	A	rs374045195		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:234637943G>A	ENST00000482026.1	+	1	190	c.171G>A	c.(169-171)caG>caA	p.Q57Q	UGT1A5_ENST00000373414.3_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000609767.1_Silent_p.Q57Q|UGT1A6_ENST00000305139.6_Intron|UGT1A6_ENST00000480628.1_Intron			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	57					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)			breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	GAGGCCACCAGGCAGTGGTCC	0.552																																					p.Q57Q		.											.	UGT1A3-24	0			c.G171A						.	G	,,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	78.0	79.0	78.0		,,,,,,171,,	-2.3	0.0	2		78	0,8600		0,0,4300	no	intron,intron,intron,intron,intron,intron,coding-synonymous,intron,intron	UGT1A10,UGT1A8,UGT1A7,UGT1A6,UGT1A5,UGT1A9,UGT1A4,UGT1A3	NM_001072.3,NM_007120.2,NM_019075.2,NM_019076.4,NM_019077.2,NM_019078.1,NM_019093.2,NM_021027.2,NM_205862.1	,,,,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,,	,,,,,,57/535,,	234637943	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54659	exon1			CCACCAGGCAGTG	M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.171G>A	2.37:g.234637943G>A		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	76	21	NM_019093	0	0	0	0	0	B8K287	Silent	SNP	ENST00000482026.1	37	CCDS2509.1																																																																																			.		0.552	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130983.1	NM_019093	
ASB1	51665	broad.mit.edu	37	2	239344354	239344354	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr2:239344354G>A	ENST00000264607.4	+	3	441	c.194G>A	c.(193-195)cGc>cAc	p.R65H	ASB1_ENST00000469885.1_3'UTR|ASB1_ENST00000409297.1_Intron	NM_001040445.1	NP_001035535.1	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box containing 1	65					intracellular signal transduction (GO:0035556)|male genitalia development (GO:0030539)|negative regulation of cytokine biosynthetic process (GO:0042036)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				breast(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		TCCTGCAGCCGCATCAACGAG	0.652																																					p.R65H													.	ASB1-226	0			c.G194A						.						29.0	26.0	27.0					2																	239344354		2203	4300	6503	SO:0001583	missense	51665	exon3			GCAGCCGCATCAA	AF156777	CCDS33416.1	2q37	2013-01-10	2011-01-25		ENSG00000065802	ENSG00000065802		"""Ankyrin repeat domain containing"""	16011	protein-coding gene	gene with protein product		605758	"""ankyrin repeat and SOCS box-containing 1"""				Standard	XR_241235		Approved	ASB-1	uc002vyg.3	Q9Y576	OTTHUMG00000152866	ENST00000264607.4:c.194G>A	2.37:g.239344354G>A	ENSP00000264607:p.Arg65His	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	39	3	NM_001040445	0	0	0	0	0	A6NL50|Q4ZG29|Q9ULS4	Missense_Mutation	SNP	ENST00000264607.4	37	CCDS33416.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559986	0.65538	.	.	ENSG00000065802	ENST00000264607	T	0.53206	0.63	5.48	5.48	0.80851	Ankyrin repeat-containing domain (3);	0.051919	0.85682	D	0.000000	T	0.60843	0.2300	L	0.46885	1.475	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	T	0.51379	-0.8713	10	0.15066	T	0.55	-34.7392	19.3512	0.94387	0.0:0.0:1.0:0.0	.	65	Q9Y576	ASB1_HUMAN	H	65	ENSP00000264607:R65H	ENSP00000264607:R65H	R	+	2	0	ASB1	239009093	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	8.925000	0.92832	2.581000	0.87130	0.650000	0.86243	CGC	.		0.652	ASB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328294.1	NM_001040445	
RBPJL	11317	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	43940944	43940944	+	Silent	SNP	C	C	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr20:43940944C>T	ENST00000343694.3	+	6	600	c.528C>T	c.(526-528)cgC>cgT	p.R176R	RBPJL_ENST00000372743.1_Silent_p.R176R|RBPJL_ENST00000372741.3_Silent_p.R176R	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	176					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				tggtgctgcgCGGGGGCCGGG	0.602																																					p.R176R		.											.	RBPJL-227	0			c.C528T						.						28.0	31.0	30.0					20																	43940944		2203	4300	6503	SO:0001819	synonymous_variant	11317	exon6			GCTGCGCGGGGGC	AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.528C>T	20.37:g.43940944C>T		Somatic	39	1		WXS	Illumina HiSeq	Phase_I	44	14	NM_014276	0	0	0	0	0	O95723|Q5QPU9|Q5QPV0|Q9ULV9	Silent	SNP	ENST00000343694.3	37	CCDS13349.1																																																																																			.		0.602	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080391.1	NM_014276	
BRWD1	54014	bcgsc.ca	37	21	40608669	40608669	+	Missense_Mutation	SNP	C	C	T	rs370519269		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr21:40608669C>T	ENST00000333229.2	-	23	2945	c.2618G>A	c.(2617-2619)gGc>gAc	p.G873D	BRWD1_ENST00000380800.3_Missense_Mutation_p.G873D|BRWD1_ENST00000342449.3_Missense_Mutation_p.G873D	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	873					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CAAATTGATGCCCGCATCAGC	0.403																																					p.G873D	Melanoma(170;988 1986 4794 16843 39731)												.	BRWD1-94	0			c.G2618A						.						109.0	104.0	106.0					21																	40608669		2203	4300	6503	SO:0001583	missense	54014	exon23			TTGATGCCCGCAT	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.2618G>A	21.37:g.40608669C>T	ENSP00000330753:p.Gly873Asp	Somatic	64	0		WXS	Illumina HiSeq	Phase_1	68	5	NM_018963	0	0	0	0	0	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.871459	0.91587	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.69040	-0.37;-0.37;-0.37	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000001	D	0.84866	0.5567	M	0.86420	2.815	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	D	0.87449	0.2400	10	0.87932	D	0	-5.9368	18.9924	0.92798	0.0:1.0:0.0:0.0	.	540;873;873	Q5R2U6;Q9NSI6-2;Q9NSI6	.;.;BRWD1_HUMAN	D	873	ENSP00000330753:G873D;ENSP00000344333:G873D;ENSP00000370178:G873D	ENSP00000330753:G873D	G	-	2	0	BRWD1	39530539	1.000000	0.71417	0.995000	0.50966	0.677000	0.39632	7.321000	0.79088	2.498000	0.84270	0.650000	0.86243	GGC	.		0.403	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
TOP3B	8940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	22327036	22327036	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr22:22327036G>T	ENST00000398793.2	-	4	691	c.257C>A	c.(256-258)cCc>cAc	p.P86H	TOP3B_ENST00000413067.2_5'UTR|TOP3B_ENST00000357179.5_Missense_Mutation_p.P86H	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	86	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		CTTCTCCGTGGGAGCTTGGCT	0.562											OREG0026347	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P86H		.											.	TOP3B-538	0			c.C257A						.						155.0	123.0	134.0					22																	22327036		2203	4300	6503	SO:0001583	missense	8940	exon4			TCCGTGGGAGCTT	AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.257C>A	22.37:g.22327036G>T	ENSP00000381773:p.Pro86His	Somatic	65	0	755	WXS	Illumina HiSeq	Phase_I	69	29	NM_003935	0	0	0	2	2	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	ENST00000398793.2	37	CCDS13797.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372315	0.82573	.	.	ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000449517;ENST00000424393;ENST00000437929;ENST00000430142	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	5.0	3.97	0.46021	DNA topoisomerase, type IA, core domain (1);Toprim domain (2);	0.052237	0.85682	D	0.000000	T	0.47563	0.1452	H	0.94620	3.56	0.80722	D	1	P	0.41848	0.763	P	0.48030	0.564	T	0.65166	-0.6234	10	0.87932	D	0	-8.5874	15.6079	0.76689	0.0:0.1378:0.8622:0.0	.	86	O95985	TOP3B_HUMAN	H	86	ENSP00000349705:P86H;ENSP00000381773:P86H;ENSP00000390977:P86H;ENSP00000402622:P86H;ENSP00000414538:P86H	ENSP00000349705:P86H	P	-	2	0	TOP3B	20657036	1.000000	0.71417	0.432000	0.26747	0.906000	0.53458	9.361000	0.97122	1.317000	0.45149	0.563000	0.77884	CCC	.		0.562	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1	NM_003935	
CABIN1	23523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24483456	24483456	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr22:24483456C>A	ENST00000398319.2	+	23	3700	c.3315C>A	c.(3313-3315)gaC>gaA	p.D1105E	CABIN1_ENST00000263119.5_Missense_Mutation_p.D1105E|CABIN1_ENST00000405822.2_Missense_Mutation_p.D1055E	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1105					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GCATTCAGGACAAGCTGAACT	0.547																																					p.D1105E		.											.	CABIN1-94	0			c.C3315A						.						70.0	64.0	66.0					22																	24483456		2203	4300	6503	SO:0001583	missense	23523	exon23			TCAGGACAAGCTG	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3315C>A	22.37:g.24483456C>A	ENSP00000381364:p.Asp1105Glu	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	61	15	NM_001199281	0	0	0	1	1	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.149010	0.57151	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.75477	-0.94;-0.94;-0.94	5.1	1.91	0.25777	Tetratricopeptide-like helical (1);	0.055118	0.64402	D	0.000001	T	0.54111	0.1838	L	0.27053	0.805	0.80722	D	1	P;P	0.40619	0.724;0.603	B;B	0.34452	0.183;0.089	T	0.42899	-0.9424	10	0.23302	T	0.38	.	9.3964	0.38406	0.0:0.7705:0.0:0.2295	.	1055;1105	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	E	1105;1055;1105	ENSP00000263119:D1105E;ENSP00000384694:D1055E;ENSP00000381364:D1105E	ENSP00000263119:D1105E	D	+	3	2	CABIN1	22813456	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.242000	0.32755	0.299000	0.22661	0.650000	0.86243	GAC	.		0.547	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
TOP2B	7155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	25651158	25651158	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr3:25651158A>C	ENST00000264331.4	-	29	3831	c.3832T>G	c.(3832-3834)Ttc>Gtc	p.F1278V	TOP2B_ENST00000475717.1_5'Flank|TOP2B_ENST00000435706.2_Missense_Mutation_p.F1273V|TOP2B_ENST00000542520.1_Missense_Mutation_p.F130V|TOP2B_ENST00000540199.1_Missense_Mutation_p.F130V	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	1278					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GCTCCACTGAATTCTTCATCA	0.393																																					p.F1273V		.											.	TOP2B-273	0			c.T3817G						.						66.0	56.0	59.0					3																	25651158		1855	4094	5949	SO:0001583	missense	7155	exon29			CACTGAATTCTTC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.3832T>G	3.37:g.25651158A>C	ENSP00000264331:p.Phe1278Val	Somatic	10	0		WXS	Illumina HiSeq	Phase_I	13	4	NM_001068	0	0	8	10	2	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	37		.	.	.	.	.	.	.	.	.	.	A	12.12	1.841924	0.32513	.	.	ENSG00000077097	ENST00000542520;ENST00000435706;ENST00000264331;ENST00000540199	T;T;T;T	0.42131	0.98;1.02;1.02;0.98	5.72	4.56	0.56223	.	0.376224	0.33650	N	0.004681	T	0.27205	0.0667	N	0.19112	0.55	0.48341	D	0.99963	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.04400	-1.0954	10	0.25106	T	0.35	-0.2287	11.3624	0.49651	0.9285:0.0:0.0715:0.0	.	1278;1273	Q02880;Q02880-2	TOP2B_HUMAN;.	V	130;1273;1278;130	ENSP00000446023:F130V;ENSP00000396704:F1273V;ENSP00000264331:F1278V;ENSP00000437352:F130V	ENSP00000264331:F1278V	F	-	1	0	TOP2B	25626162	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.672000	0.54583	1.001000	0.39076	0.477000	0.44152	TTC	.		0.393	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
TCAIM	285343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	44438258	44438258	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr3:44438258C>T	ENST00000342649.4	+	8	1244	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TCAIM_ENST00000417237.1_Missense_Mutation_p.R273C	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	273						mitochondrion (GO:0005739)		p.R273G(1)									ATTTACAGACCGTTCTGGCAT	0.408																																					p.R273C		.											.	.	1	Substitution - Missense(1)	lung(1)	c.C817T						.						135.0	124.0	128.0					3																	44438258		2203	4300	6503	SO:0001583	missense	285343	exon8			ACAGACCGTTCTG		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.817C>T	3.37:g.44438258C>T	ENSP00000341539:p.Arg273Cys	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	128	55	NM_173826	0	0	1	1	0	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	ENST00000342649.4	37	CCDS2712.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396479	0.62177	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.48201	0.82;0.82	5.6	3.8	0.43715	.	0.255107	0.43747	N	0.000534	T	0.56046	0.1959	L	0.51422	1.61	0.46396	D	0.999026	D	0.89917	1.0	P	0.60682	0.878	T	0.56007	-0.8050	10	0.66056	D	0.02	.	9.6854	0.40096	0.0:0.6626:0.267:0.0703	.	273	Q8N3R3	CC023_HUMAN	C	273	ENSP00000402581:R273C;ENSP00000341539:R273C	ENSP00000341539:R273C	R	+	1	0	C3orf23	44413262	1.000000	0.71417	0.930000	0.37139	0.684000	0.39900	2.565000	0.45939	0.718000	0.32166	0.655000	0.94253	CGT	.		0.408	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256655.2	NM_173826	
CCDC58	131076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	122102042	122102042	+	Silent	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr3:122102042A>G	ENST00000291458.5	-	1	36	c.30T>C	c.(28-30)tgT>tgC	p.C10C	CCDC58_ENST00000479899.1_5'UTR|CCDC58_ENST00000497726.1_Silent_p.C10C|FAM162A_ENST00000232125.5_5'Flank|FAM162A_ENST00000469967.1_5'Flank|FAM162A_ENST00000477892.1_5'Flank	NM_001017928.2	NP_001017928.1	Q4VC31	CCD58_HUMAN	coiled-coil domain containing 58	10						mitochondrion (GO:0005739)				large_intestine(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.148)		CGAACTCCTCACAGTTCACAC	0.602																																					p.C10C		.											.	CCDC58-90	0			c.T30C						.						83.0	73.0	76.0					3																	122102042		2203	4300	6503	SO:0001819	synonymous_variant	131076	exon1			CTCCTCACAGTTC	AK090592	CCDS33838.1	3q21.1	2006-01-17			ENSG00000160124	ENSG00000160124			31136	protein-coding gene	gene with protein product							Standard	XM_005247108		Approved	FLJ33273	uc003eey.3	Q4VC31	OTTHUMG00000159490	ENST00000291458.5:c.30T>C	3.37:g.122102042A>G		Somatic	96	0		WXS	Illumina HiSeq	Phase_I	125	14	NM_001017928	0	0	36	38	2	Q32LY6	Silent	SNP	ENST00000291458.5	37	CCDS33838.1																																																																																			.		0.602	CCDC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355754.1	NM_001017928	
PIK3CB	5291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	138409857	138409857	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr3:138409857A>G	ENST00000477593.1	-	14	2094	c.2021T>C	c.(2020-2022)cTa>cCa	p.L674P	PIK3CB_ENST00000289153.2_Missense_Mutation_p.L674P|PIK3CB_ENST00000544716.1_Missense_Mutation_p.L120P			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	674	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	ATGCCAAAATAGAAACTGCCC	0.353																																					p.L674P		.											.	PIK3CB-1311	0			c.T2021C						.						135.0	140.0	138.0					3																	138409857		2203	4300	6503	SO:0001583	missense	5291	exon13			CAAAATAGAAACT		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.2021T>C	3.37:g.138409857A>G	ENSP00000418143:p.Leu674Pro	Somatic	188	0		WXS	Illumina HiSeq	Phase_I	269	63	NM_006219	0	0	3	3	0	D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	37	CCDS3104.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.8|21.8	4.204435|4.204435	0.79127|0.79127	.|.	.|.	ENSG00000051382|ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153|ENST00000493568	T;T;T|.	0.77358|.	-1.09;-1.09;-1.09|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86142|0.86142	0.5862|0.5862	M|M	0.93420|0.93420	3.415|3.415	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.998;0.997;1.0|.	D|D	0.89873|0.89873	0.4024|0.4024	10|5	0.87932|.	D|.	0|.	-9.4984|-9.4984	15.8807|15.8807	0.79201|0.79201	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	674;261;120|.	P42338;B4DZI3;Q68DL0|.	PK3CB_HUMAN;.;.|.	P|H	674;120;674|306	ENSP00000418143:L674P;ENSP00000438259:L120P;ENSP00000289153:L674P|.	ENSP00000289153:L674P|.	L|Y	-|-	2|1	0|0	PIK3CB|PIK3CB	139892547|139892547	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.983000|0.983000	0.72400|0.72400	9.339000|9.339000	0.96797|0.96797	2.151000|2.151000	0.67156|0.67156	0.533000|0.533000	0.62120|0.62120	CTA|TAT	.		0.353	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358019.1		
PDE6B	5158	hgsc.bcm.edu;broad.mit.edu	37	4	619837	619837	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr4:619837A>C	ENST00000496514.1	+	1	443	c.422A>C	c.(421-423)cAc>cCc	p.H141P	PDE6B_ENST00000255622.6_Missense_Mutation_p.H141P			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	141	GAF 1.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GTCGTGGGCCACGTGGCTCAG	0.642																																					p.H141P	GBM(71;463 1194 9848 25922 46834)	.											.	PDE6B-90	0			c.A422C						.						22.0	16.0	18.0					4																	619837		2193	4298	6491	SO:0001583	missense	5158	exon1			TGGGCCACGTGGC	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.422A>C	4.37:g.619837A>C	ENSP00000420295:p.His141Pro	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	9	5	NM_001145291	0	0	0	0	0	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	A	19.70	3.877195	0.72294	.	.	ENSG00000133256	ENST00000255622;ENST00000496514	T;T	0.67523	-0.27;-0.27	4.88	4.88	0.63580	GAF (2);	0.103854	0.64402	D	0.000005	T	0.81418	0.4818	M	0.91406	3.205	0.80722	D	1	D;D	0.55385	0.971;0.964	P;P	0.56865	0.808;0.709	D	0.84544	0.0640	10	0.49607	T	0.09	.	12.4206	0.55518	1.0:0.0:0.0:0.0	.	141;141	P35913;P35913-2	PDE6B_HUMAN;.	P	141	ENSP00000255622:H141P;ENSP00000420295:H141P	ENSP00000255622:H141P	H	+	2	0	PDE6B	609837	0.663000	0.27448	1.000000	0.80357	0.862000	0.49288	5.590000	0.67530	1.845000	0.53610	0.459000	0.35465	CAC	.		0.642	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
JMY	133746	hgsc.bcm.edu	37	5	78610479	78610479	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr5:78610479C>A	ENST00000396137.4	+	9	2926	c.2464C>A	c.(2464-2466)Cca>Aca	p.P822T	JMY_ENST00000412001.1_Intron	NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	822	Pro-rich.				'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		ccctcccccaccaccaccacc	0.542																																					p.P822T		.											.	JMY-227	0			c.C2464A						.																																			SO:0001583	missense	133746	exon9			CCCCCACCACCAC	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.2464C>A	5.37:g.78610479C>A	ENSP00000379441:p.Pro822Thr	Somatic	27	1		WXS	Illumina HiSeq	Phase_I	29	3	NM_152405	0	0	1	1	0	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	37	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	C	11.44	1.639613	0.29157	.	.	ENSG00000152409	ENST00000396137	D	0.89681	-2.55	4.69	3.8	0.43715	.	0.692508	0.13482	N	0.384606	D	0.93400	0.7895	M	0.70275	2.135	0.45837	D	0.998707	D	0.89917	1.0	D	0.91635	0.999	D	0.90329	0.4350	10	0.29301	T	0.29	.	14.3113	0.66416	0.0:0.8498:0.1502:0.0	.	822	Q8N9B5	JMY_HUMAN	T	822	ENSP00000379441:P822T	ENSP00000379441:P822T	P	+	1	0	JMY	78646235	1.000000	0.71417	0.009000	0.14445	0.106000	0.19336	4.961000	0.63681	0.930000	0.37217	0.650000	0.86243	CCA	.		0.542	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405	
CMYA5	202333	hgsc.bcm.edu	37	5	79032748	79032748	+	Silent	SNP	T	T	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr5:79032748T>C	ENST00000446378.2	+	2	8191	c.8160T>C	c.(8158-8160)acT>acC	p.T2720T		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2720					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGGAGAAAACTAAGACTTTCC	0.378																																					p.T2720T		.											.	CMYA5-77	0			c.T8160C						.						41.0	41.0	41.0					5																	79032748		1825	4074	5899	SO:0001819	synonymous_variant	202333	exon2			GAAAACTAAGACT	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.8160T>C	5.37:g.79032748T>C		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	26	3	NM_153610	0	0	0	0	0	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	37	CCDS47238.1																																																																																			.		0.378	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
CYFIP2	26999	broad.mit.edu	37	5	156819902	156819902	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr5:156819902C>T	ENST00000521420.1	+	30	3669	c.3578C>T	c.(3577-3579)gCc>gTc	p.A1193V	CYFIP2_ENST00000435847.2_Missense_Mutation_p.A918V|CYFIP2_ENST00000541131.1_Missense_Mutation_p.A1144V|CYFIP2_ENST00000442283.2_3'UTR|CYFIP2_ENST00000318218.6_Missense_Mutation_p.A1244V|CYFIP2_ENST00000377576.3_Missense_Mutation_p.A1219V|CYFIP2_ENST00000522463.1_Missense_Mutation_p.A1023V|CYFIP2_ENST00000347377.6_Missense_Mutation_p.A1219V					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAGGTTTTTGCCATCCTGAAC	0.517																																					p.A1219V													.	CYFIP2-22	0			c.C3656T						.						107.0	113.0	111.0					5																	156819902		2134	4256	6390	SO:0001583	missense	26999	exon31			TTTTTGCCATCCT	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.3578C>T	5.37:g.156819902C>T	ENSP00000430904:p.Ala1193Val	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	115	4	NM_001037332	0	0	112	112	0		Missense_Mutation	SNP	ENST00000521420.1	37		.	.	.	.	.	.	.	.	.	.	C	24.6	4.550606	0.86127	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86;1.86;1.86	5.38	5.38	0.77491	.	0.102104	0.64402	D	0.000002	T	0.51176	0.1659	M	0.66939	2.045	0.80722	D	1	B;B;B;P;B;D	0.53885	0.072;0.086;0.018;0.565;0.046;0.963	B;B;B;B;B;D	0.67231	0.045;0.145;0.049;0.305;0.055;0.95	T	0.48364	-0.9042	10	0.59425	D	0.04	-30.2542	19.5107	0.95140	0.0:1.0:0.0:0.0	.	1083;1023;1193;1219;1219;1244	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	V	1244;1023;1193;1219;1219;1144;918	ENSP00000325817:A1244V;ENSP00000428009:A1023V;ENSP00000430904:A1193V;ENSP00000313567:A1219V;ENSP00000366799:A1219V;ENSP00000444645:A1144V;ENSP00000403793:A918V	ENSP00000325817:A1244V	A	+	2	0	CYFIP2	156752480	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.679000	0.91253	0.655000	0.94253	GCC	.		0.517	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332	
ZBED9	114821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	28543371	28543371	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr6:28543371C>A	ENST00000452236.2	-	3	1728	c.1111G>T	c.(1111-1113)Gtt>Ttt	p.V371F	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						CTTGAACTAACTTCCTTAATT	0.343																																					p.V371F		.											.	SCAND3-91	0			c.G1111T						.						122.0	124.0	124.0					6																	28543371		2203	4300	6503	SO:0001583	missense	114821	exon3			AACTAACTTCCTT																												ENST00000452236.2:c.1111G>T	6.37:g.28543371C>A	ENSP00000395259:p.Val371Phe	Somatic	195	0		WXS	Illumina HiSeq	Phase_I	199	63	NM_052923	0	0	0	0	0		Missense_Mutation	SNP	ENST00000452236.2	37	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.208100	0.58343	.	.	ENSG00000232040	ENST00000452236	T	0.01474	4.85	3.45	2.58	0.30949	Integrase, catalytic core (1);Ribonuclease H-like (1);	.	.	.	.	T	0.01320	0.0043	L	0.29908	0.895	0.27530	N	0.951136	D	0.69078	0.997	D	0.63488	0.915	T	0.54337	-0.8309	9	0.23891	T	0.37	.	6.9505	0.24542	0.0:0.8705:0.0:0.1295	.	371	Q6R2W3	SCND3_HUMAN	F	371	ENSP00000395259:V371F	ENSP00000395259:V371F	V	-	1	0	SCAND3	28651350	0.993000	0.37304	0.998000	0.56505	0.998000	0.95712	0.080000	0.14802	0.789000	0.33779	0.655000	0.94253	GTT	.		0.343	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
ZNF451	26036	hgsc.bcm.edu	37	6	56989646	56989646	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr6:56989646A>G	ENST00000370706.4	+	4	545	c.301A>G	c.(301-303)Aga>Gga	p.R101G	RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.R101G|ZNF451_ENST00000357489.3_Missense_Mutation_p.R101G|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	101					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AGAGAAGAATAGAGCATTCAG	0.299																																					p.R101G		.											.	ZNF451-93	0			c.A301G						.						43.0	41.0	41.0					6																	56989646		2203	4299	6502	SO:0001583	missense	26036	exon4			AAGAATAGAGCAT	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.301A>G	6.37:g.56989646A>G	ENSP00000359740:p.Arg101Gly	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_001031623	0	0	0	0	0	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.396743	0.62177	.	.	ENSG00000112200	ENST00000510483;ENST00000370706;ENST00000357489;ENST00000491832	T;T;T;T	0.06449	3.3;3.3;3.3;3.3	5.37	5.37	0.77165	.	0.109018	0.64402	D	0.000012	T	0.03220	0.0094	L	0.36672	1.1	0.80722	D	1	P;P;P;P	0.41848	0.763;0.561;0.736;0.561	B;B;B;B	0.36845	0.234;0.157;0.159;0.157	T	0.41680	-0.9495	10	0.72032	D	0.01	-15.9926	15.3546	0.74418	1.0:0.0:0.0:0.0	.	101;101;101;101	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	G	73;101;101;101	ENSP00000427558:R73G;ENSP00000359740:R101G;ENSP00000350083:R101G;ENSP00000421645:R101G	ENSP00000350083:R101G	R	+	1	2	ZNF451	57097605	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	6.483000	0.73617	2.153000	0.67306	0.533000	0.62120	AGA	.		0.299	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555	
INTS1	26173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	1535858	1535858	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr7:1535858T>C	ENST00000404767.3	-	12	1730	c.1645A>G	c.(1645-1647)Atg>Gtg	p.M549V	INTS1_ENST00000389470.4_Missense_Mutation_p.M677V	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	549					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CCCAGCATCATGGACACGGCC	0.632																																					p.M549V		.											.	.	0			c.A1645G						.						84.0	95.0	91.0					7																	1535858		2106	4225	6331	SO:0001583	missense	26173	exon12			GCATCATGGACAC	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.1645A>G	7.37:g.1535858T>C	ENSP00000385722:p.Met549Val	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	136	35	NM_001080453	0	0	5	6	1	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	37	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	T	18.94	3.730230	0.69074	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.47528	0.84;0.85	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.48021	0.1477	L	0.52011	1.625	0.80722	D	1	P	0.39044	0.656	B	0.42361	0.385	T	0.47509	-0.9112	10	0.41790	T	0.15	.	14.7485	0.69508	0.0:0.0:0.0:1.0	.	549	Q8N201	INT1_HUMAN	V	549;677	ENSP00000385722:M549V;ENSP00000374121:M677V	ENSP00000374121:M677V	M	-	1	0	INTS1	1502384	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.866000	0.87056	1.897000	0.54924	0.533000	0.62120	ATG	.		0.632	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1		
PTPRZ1	5803	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	121668665	121668665	+	Missense_Mutation	SNP	C	C	A	rs368834797		TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr7:121668665C>A	ENST00000393386.2	+	14	5459	c.5048C>A	c.(5047-5049)tCc>tAc	p.S1683Y	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.S823Y	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1683					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AGAGTTATATCCACACCTCCA	0.383																																					p.S1683Y		.											.	PTPRZ1-699	0			c.C5048A						.						184.0	155.0	165.0					7																	121668665		2203	4300	6503	SO:0001583	missense	5803	exon14			TTATATCCACACC	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5048C>A	7.37:g.121668665C>A	ENSP00000377047:p.Ser1683Tyr	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	173	11	NM_002851	0	0	0	0	0	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480370	0.84747	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.79141	0.76;-1.24	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000002	D	0.84880	0.5570	L	0.46157	1.445	0.53688	D	0.999977	D;D;P	0.67145	0.996;0.97;0.95	D;P;P	0.65874	0.939;0.682;0.736	D	0.84173	0.0435	10	0.51188	T	0.08	.	20.0637	0.97700	0.0:1.0:0.0:0.0	.	822;823;1683	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	Y	1683;823	ENSP00000377047:S1683Y;ENSP00000410000:S823Y	ENSP00000377047:S1683Y	S	+	2	0	PTPRZ1	121455901	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.356000	0.79445	2.751000	0.94390	0.650000	0.86243	TCC	.		0.383	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
CNTNAP2	26047	broad.mit.edu	37	7	147183114	147183114	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr7:147183114T>G	ENST00000361727.3	+	11	2274	c.1758T>G	c.(1756-1758)agT>agG	p.S586R		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	586	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.S586R(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAGGATACAGTGGGGCCACCT	0.468										HNSCC(39;0.1)																											p.S586R													.	CNTNAP2-100	1	Substitution - Missense(1)	urinary_tract(1)	c.T1758G						.						106.0	97.0	100.0					7																	147183114		2203	4300	6503	SO:0001583	missense	26047	exon11			ATACAGTGGGGCC	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1758T>G	7.37:g.147183114T>G	ENSP00000354778:p.Ser586Arg	Somatic	62	9		WXS	Illumina HiSeq	Phase_I	106	14	NM_014141	0	0	0	0	0	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	T	13.96	2.391690	0.42410	.	.	ENSG00000174469	ENST00000361727	D	0.93488	-3.23	5.89	-2.21	0.06973	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.228496	0.35495	N	0.003176	D	0.87912	0.6297	L	0.52011	1.625	0.80722	D	1	P	0.34864	0.473	B	0.41135	0.348	T	0.75693	-0.3229	10	0.16896	T	0.51	.	3.7588	0.08596	0.1095:0.441:0.1104:0.3392	.	586	Q9UHC6	CNTP2_HUMAN	R	586	ENSP00000354778:S586R	ENSP00000354778:S586R	S	+	3	2	CNTNAP2	146814047	0.060000	0.20803	0.985000	0.45067	0.964000	0.63967	-0.689000	0.05144	-0.263000	0.09378	-0.899000	0.02877	AGT	.		0.468	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
SPIDR	23514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	48308957	48308957	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr8:48308957G>C	ENST00000297423.4	+	6	931	c.547G>C	c.(547-549)Gag>Cag	p.E183Q	SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Missense_Mutation_p.E113Q|SPIDR_ENST00000518074.1_Missense_Mutation_p.E123Q	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	183	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											AGAAATTTTAGAGTATTCATC	0.313																																					p.E183Q		.											.	KIAA0146-68	0			c.G547C						.						40.0	39.0	39.0					8																	48308957		1801	4064	5865	SO:0001583	missense	23514	exon6			ATTTTAGAGTATT	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.547G>C	8.37:g.48308957G>C	ENSP00000297423:p.Glu183Gln	Somatic	62	1		WXS	Illumina HiSeq	Phase_I	64	22	NM_001080394	0	0	0	0	0	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	ENST00000297423.4	37	CCDS43737.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.132560	0.56828	.	.	ENSG00000164808	ENST00000297423;ENST00000518074;ENST00000541342	.	.	.	5.7	4.83	0.62350	.	0.082508	0.50627	D	0.000116	T	0.68577	0.3016	M	0.66939	2.045	0.32160	N	0.583101	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.77004	0.989;0.989;0.989;0.989	T	0.76460	-0.2951	9	0.72032	D	0.01	.	11.6736	0.51417	0.0828:0.0:0.9172:0.0	.	123;113;183;183	B4E0Y6;B4DFV2;B4DEV5;Q14159	.;.;.;K0146_HUMAN	Q	183;123;113	.	ENSP00000297423:E183Q	E	+	1	0	KIAA0146	48471510	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.069000	0.64370	1.414000	0.47017	0.655000	0.94253	GAG	.		0.313	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
FER1L6	654463	ucsc.edu;bcgsc.ca	37	8	125074167	125074167	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr8:125074167T>A	ENST00000522917.1	+	25	3428	c.3222T>A	c.(3220-3222)agT>agA	p.S1074R	FER1L6_ENST00000399018.1_Missense_Mutation_p.S1074R|FER1L6-AS2_ENST00000601180.1_RNA|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1074	C2 4. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TTGGGAGGAGTACCCTTGTGG	0.542																																					p.S1074R													.	FER1L6-100	0			c.T3222A						.						101.0	104.0	103.0					8																	125074167		2015	4219	6234	SO:0001583	missense	654463	exon25			GAGGAGTACCCTT	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3222T>A	8.37:g.125074167T>A	ENSP00000428280:p.Ser1074Arg	Somatic	165	2		WXS	Illumina HiSeq		141	46	NM_001039112	0	0	0	0	0		Missense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	T	19.83	3.900796	0.72754	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.84944	-1.92;-1.92	5.51	4.63	0.57726	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	D	0.84986	0.5594	L	0.33668	1.02	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.80308	-0.1437	10	0.10902	T	0.67	-11.0157	9.245	0.37520	0.0:0.7852:0.0:0.2148	.	1074	Q2WGJ9	FR1L6_HUMAN	R	1074	ENSP00000428280:S1074R;ENSP00000381982:S1074R	ENSP00000381982:S1074R	S	+	3	2	FER1L6	125143348	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	1.585000	0.36600	1.426000	0.47256	-0.242000	0.12053	AGT	.		0.542	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
SVEP1	79987	hgsc.bcm.edu	37	9	113259109	113259109	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr9:113259109T>C	ENST00000401783.2	-	8	2122	c.1786A>G	c.(1786-1788)Aac>Gac	p.N596D	SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000302728.8_Missense_Mutation_p.N596D|SVEP1_ENST00000374469.1_Missense_Mutation_p.N573D|SVEP1_ENST00000374461.1_Missense_Mutation_p.N573D	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	596	HYR 1. {ECO:0000255|PROSITE- ProRule:PRU00113}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCACCAGAGTTGTCTTTAGCT	0.398																																					p.N596D		.											.	SVEP1-75	0			c.A1786G						.						115.0	107.0	109.0					9																	113259109		1881	4083	5964	SO:0001583	missense	79987	exon8			CAGAGTTGTCTTT	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1786A>G	9.37:g.113259109T>C	ENSP00000384917:p.Asn596Asp	Somatic	4	0		WXS	Illumina HiSeq	Phase_I	12	4	NM_153366	0	0	0	0	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.505631	0.85282	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.71	5.71	0.89125	Hyalin (2);	0.000000	0.85682	D	0.000000	T	0.59088	0.2168	M	0.90759	3.145	0.38327	D	0.943687	D;D;D	0.89917	0.999;1.0;0.996	D;D;D	0.87578	0.995;0.998;0.99	T	0.71155	-0.4675	10	0.72032	D	0.01	.	14.9529	0.71088	0.0:0.0:0.0:1.0	.	596;596;596	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	D	596;573;596;573	ENSP00000384917:N596D;ENSP00000363593:N573D;ENSP00000304118:N596D;ENSP00000363585:N573D	ENSP00000304118:N596D	N	-	1	0	SVEP1	112298930	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.259000	0.72494	2.181000	0.69327	0.477000	0.44152	AAC	.		0.398	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
DDX53	168400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	23019108	23019108	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chrX:23019108G>A	ENST00000327968.5	+	1	1022	c.934G>A	c.(934-936)Gtg>Atg	p.V312M	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	312	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						GGCTCTTCACGTGGAAGCTGA	0.408													G|||	1	0.000264901	0.0008	0.0	3775	,	,		16112	0.0		0.0	False		,,,				2504	0.0				p.V312M		.											.	DDX53-228	0			c.G934A						.						74.0	73.0	73.0					X																	23019108		2203	4300	6503	SO:0001583	missense	168400	exon1			CTTCACGTGGAAG	AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.934G>A	X.37:g.23019108G>A	ENSP00000368667:p.Val312Met	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	64	36	NM_182699	0	0	0	0	0	Q0D2N2|Q6NVV4	Missense_Mutation	SNP	ENST00000327968.5	37	CCDS35214.1	.	.	.	.	.	.	.	.	.	.	G	9.356	1.066739	0.20067	.	.	ENSG00000184735	ENST00000327968	T	0.05139	3.49	4.3	1.28	0.21552	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.300009	0.31370	N	0.007767	T	0.24586	0.0596	M	0.91920	3.255	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.02877	-1.1099	10	0.87932	D	0	-6.7638	4.8973	0.13757	0.2269:0.1801:0.593:0.0	.	312	Q86TM3	DDX53_HUMAN	M	312	ENSP00000368667:V312M	ENSP00000368667:V312M	V	+	1	0	DDX53	22929029	1.000000	0.71417	0.029000	0.17559	0.023000	0.10783	2.224000	0.42945	0.759000	0.33084	0.600000	0.82982	GTG	.		0.408	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
ZNF559	84527	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9452840	9452840	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr19:9452840delA	ENST00000393883.2	+	6	1361	c.713delA	c.(712-714)gaafs	p.E238fs	ZNF559_ENST00000603380.1_Frame_Shift_Del_p.E238fs|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000587557.1_Frame_Shift_Del_p.E302fs|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000586255.1_Intron|ZNF177_ENST00000446085.4_Intron|CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF177_ENST00000602856.1_Intron|ZNF559_ENST00000592896.1_3'UTR|ZNF559_ENST00000317221.7_3'UTR|ZNF559_ENST00000538743.1_Frame_Shift_Del_p.E158fs	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	238					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						CAAGATGGAGAAAAATTCTAT	0.363																																					p.E302fs		.											.	ZNF559-91	0			c.905delA						.						77.0	79.0	79.0					19																	9452840		2201	4300	6501	SO:0001589	frameshift_variant	84527	exon6			.	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.713delA	19.37:g.9452840delA	ENSP00000377461:p.Glu238fs	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	110	38	NM_001202406	0	0	0	0	0	K7EMG6	Frame_Shift_Del	DEL	ENST00000393883.2	37	CCDS12211.1																																																																																			.		0.363	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
ABHD16A	7920	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31655645	31655646	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BQ-5881-01A-11D-1589-08	TCGA-BQ-5881-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	759af132-b471-4ceb-b72a-3c665d2fd20c	6cd411c9-9521-4a49-9caf-2b2652a4c0e4	g.chr6:31655645_31655646insG	ENST00000395952.3	-	17	1564_1565	c.1402_1403insC	c.(1402-1404)cgafs	p.R468fs	XXbac-BPG32J3.20_ENST00000461287.1_3'UTR|ABHD16A_ENST00000440843.2_Frame_Shift_Ins_p.R435fs|ABHD16A_ENST00000375842.4_Frame_Shift_Ins_p.R249fs|ABHD16A_ENST00000471644.1_5'UTR	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	468						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						CCTCACCACTCGAAGACCCTCC	0.594																																					p.R468fs		.											.	ABHD16A-91	0			c.1403_1404insC						.																																			SO:0001589	frameshift_variant	7920	exon17			.	AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.1403dupC	6.37:g.31655646_31655646dupG	ENSP00000379282:p.Arg468fs	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	118	21	NM_021160	0	0	0	0	0	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Frame_Shift_Ins	INS	ENST00000395952.3	37	CCDS4713.1																																																																																			.		0.594	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076342.4		
