#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EMC1	23065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	19545821	19545821	+	Silent	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr1:19545821C>T	ENST00000477853.1	-	23	3000	c.2958G>A	c.(2956-2958)aaG>aaA	p.K986K	EMC1_ENST00000375208.3_Silent_p.K964K|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375199.3_Silent_p.K985K|EMC1_ENST00000480380.1_5'UTR	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	986						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											GATTCAGGAGCTTCACCTGTG	0.502																																					p.K986K		.											.	.	0			c.G2958A						.						76.0	71.0	72.0					1																	19545821		2203	4300	6503	SO:0001819	synonymous_variant	23065	exon23			CAGGAGCTTCACC		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.2958G>A	1.37:g.19545821C>T		Somatic	75	0		WXS	Illumina HiSeq	Phase_I	75	4	NM_015047	0	0	69	80	11	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Silent	SNP	ENST00000477853.1	37	CCDS190.1	.	.	.	.	.	.	.	.	.	.	C	9.326	1.059255	0.19987	.	.	ENSG00000127463	ENST00000375197	.	.	.	6.06	-0.986	0.10252	.	.	.	.	.	T	0.58977	0.2160	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56153	-0.8026	4	.	.	.	.	12.1403	0.53994	0.0:0.5935:0.0:0.4065	.	.	.	.	T	611	.	.	A	-	1	0	KIAA0090	19418408	0.934000	0.31675	0.995000	0.50966	0.993000	0.82548	0.012000	0.13287	-0.119000	0.11830	-0.312000	0.09012	GCT	.		0.502	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047	
MSH4	4438	broad.mit.edu	37	1	76282197	76282197	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr1:76282197A>C	ENST00000263187.3	+	6	1059	c.955A>C	c.(955-957)Aac>Cac	p.N319H		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	319					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						ATCAGCCCAAAACCTTGAATT	0.284								Mismatch excision repair (MMR)																													p.N319H													.	MSH4-660	0			c.A955C						.						59.0	61.0	60.0					1																	76282197		2203	4300	6503	SO:0001583	missense	4438	exon6			GCCCAAAACCTTG	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.955A>C	1.37:g.76282197A>C	ENSP00000263187:p.Asn319His	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	72	3	NM_002440	0	0	0	0	0	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	ENST00000263187.3	37	CCDS670.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.413507	0.42817	.	.	ENSG00000057468	ENST00000263187	D	0.93604	-3.25	5.44	5.44	0.79542	DNA mismatch repair protein MutS, connector (1);DNA mismatch repair protein MutS, core (2);	0.098954	0.64402	D	0.000003	D	0.90679	0.7076	M	0.76002	2.32	0.44352	D	0.997241	B	0.22276	0.067	B	0.25759	0.063	D	0.90061	0.4156	10	0.87932	D	0	-14.4209	15.5023	0.75709	1.0:0.0:0.0:0.0	.	319	O15457	MSH4_HUMAN	H	319	ENSP00000263187:N319H	ENSP00000263187:N319H	N	+	1	0	MSH4	76054785	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.970000	0.76099	2.080000	0.62538	0.533000	0.62120	AAC	.		0.284	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	
ZNF687	57592	bcgsc.ca	37	1	151260133	151260133	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr1:151260133G>A	ENST00000368879.2	+	2	1464	c.1366G>A	c.(1366-1368)Gca>Aca	p.A456T		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	456					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TGACGGGCGGGCAGGGCTGGG	0.632																																					p.A456T													.	ZNF687-92	0			c.G1366A						.						42.0	50.0	47.0					1																	151260133		2203	4300	6503	SO:0001583	missense	57592	exon2			GGGCGGGCAGGGC		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.1366G>A	1.37:g.151260133G>A	ENSP00000357874:p.Ala456Thr	Somatic	70	0		WXS	Illumina HiSeq	Phase_1	86	5	NM_020832	0	0	24	24	0	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Missense_Mutation	SNP	ENST00000368879.2	37		.	.	.	.	.	.	.	.	.	.	G	7.725	0.698029	0.15106	.	.	ENSG00000143373	ENST00000336715;ENST00000324048;ENST00000368879	T;T;T	0.00856	5.61;5.61;5.95	5.16	-1.35	0.09114	.	1.827670	0.03593	N	0.232244	T	0.00271	0.0008	L	0.27053	0.805	0.18873	N	0.999988	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.08055	0.001;0.001;0.003	T	0.45425	-0.9262	10	0.22109	T	0.4	.	2.5477	0.04741	0.2143:0.3408:0.3288:0.1161	.	456;456;456	Q8N1G0-2;Q8N1G0;F8WCX2	.;ZN687_HUMAN;.	T	456	ENSP00000336620:A456T;ENSP00000319829:A456T;ENSP00000357874:A456T	ENSP00000319829:A456T	A	+	1	0	ZNF687	149526757	0.228000	0.23718	0.033000	0.17914	0.952000	0.60782	0.703000	0.25646	-0.424000	0.07382	0.561000	0.74099	GCA	.		0.632	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
AQP10	89872	broad.mit.edu	37	1	154294468	154294468	+	Silent	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr1:154294468C>T	ENST00000324978.3	+	2	205	c.165C>T	c.(163-165)ttC>ttT	p.F55F	AQP10_ENST00000355197.4_Intron|AQP10_ENST00000484864.1_Silent_p.F55F	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	55					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AAGGCAACTTCTTCACCATGT	0.577																																					p.F55F													.	AQP10-90	0			c.C165T						.						71.0	60.0	64.0					1																	154294468		2202	4279	6481	SO:0001819	synonymous_variant	89872	exon2			CAACTTCTTCACC	AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.165C>T	1.37:g.154294468C>T		Somatic	73	0		WXS	Illumina HiSeq	Phase_I	93	3	NM_080429	0	0	0	0	0	Q5VYD3|Q5VYD4|Q8NG70	Silent	SNP	ENST00000324978.3	37	CCDS1065.1																																																																																			.		0.577	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	NM_080429	
TDRD1	56165	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	115978231	115978231	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr10:115978231A>T	ENST00000369280.1	+	18	2842	c.2382A>T	c.(2380-2382)aaA>aaT	p.K794N	TDRD1_ENST00000369282.1_Missense_Mutation_p.K794N|TDRD1_ENST00000251864.2_Missense_Mutation_p.K794N|TDRD1_ENST00000369281.2_Intron|TDRD1_ENST00000422662.1_Missense_Mutation_p.K398N			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	794	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GACATGTTAAAGTACATTTTG	0.373																																					p.K794N		.											.	TDRD1-90	0			c.A2382T						.						202.0	183.0	190.0					10																	115978231		2203	4300	6503	SO:0001583	missense	56165	exon18			TGTTAAAGTACAT	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.2382A>T	10.37:g.115978231A>T	ENSP00000358286:p.Lys794Asn	Somatic	196	0		WXS	Illumina HiSeq	Phase_I	195	13	NM_198795	0	0	0	0	0	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	37		.	.	.	.	.	.	.	.	.	.	A	16.91	3.252942	0.59212	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000422662;ENST00000369280	T;T;T;T	0.10192	2.9;2.9;2.9;2.9	5.93	4.8	0.61643	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.542996	0.21329	N	0.076323	T	0.28466	0.0704	M	0.63843	1.955	0.38193	D	0.939969	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.95;0.998;0.999	T	0.03981	-1.0987	10	0.62326	D	0.03	-24.3657	10.4344	0.44426	0.9269:0.0:0.0731:0.0	.	398;794;794	Q9BXT4-4;Q9BXT4;Q9BXT4-3	.;TDRD1_HUMAN;.	N	794;794;398;794	ENSP00000358288:K794N;ENSP00000251864:K794N;ENSP00000402794:K398N;ENSP00000358286:K794N	ENSP00000251864:K794N	K	+	3	2	TDRD1	115968221	0.923000	0.31300	0.942000	0.38095	0.647000	0.38526	1.723000	0.38053	1.082000	0.41137	0.533000	0.62120	AAA	.		0.373	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
MMP21	118856	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	127459092	127459092	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr10:127459092C>T	ENST00000368808.3	-	5	1047	c.1048G>A	c.(1048-1050)Gtg>Atg	p.V350M		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	350					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	CTCACCATCACCTCTCCATAT	0.413																																					p.V350M		.											.	MMP21-228	0			c.G1048A						.						191.0	172.0	178.0					10																	127459092		2203	4300	6503	SO:0001583	missense	118856	exon5			CCATCACCTCTCC	AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.1048G>A	10.37:g.127459092C>T	ENSP00000357798:p.Val350Met	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	148	8	NM_147191	0	0	0	0	0	Q5VZP9|Q8NG02	Missense_Mutation	SNP	ENST00000368808.3	37	CCDS7647.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.165493	0.38217	.	.	ENSG00000154485	ENST00000368808	T	0.20332	2.08	5.62	-0.228	0.13098	Hemopexin/matrixin (2);	0.651830	0.14795	N	0.297980	T	0.12987	0.0315	N	0.22421	0.69	0.09310	N	1	B	0.19935	0.04	B	0.15484	0.013	T	0.21793	-1.0235	10	0.59425	D	0.04	-28.7392	9.267	0.37647	0.0:0.2518:0.5805:0.1677	.	350	Q8N119	MMP21_HUMAN	M	350	ENSP00000357798:V350M	ENSP00000357798:V350M	V	-	1	0	MMP21	127449082	0.001000	0.12720	0.000000	0.03702	0.638000	0.38207	-0.056000	0.11787	-0.027000	0.13873	-0.150000	0.13652	GTG	.		0.413	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050928.1		
AP2A2	161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	984672	984672	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr11:984672C>T	ENST00000448903.2	+	7	874	c.733C>T	c.(733-735)Cag>Tag	p.Q245*	AP2A2_ENST00000534328.1_Nonsense_Mutation_p.Q245*|AP2A2_ENST00000332231.5_Nonsense_Mutation_p.Q245*	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	245					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		CACAGATCTCCAGGATTACAC	0.582																																					p.Q245X		.											.	AP2A2-90	0			c.C733T						.						160.0	173.0	169.0					11																	984672		2066	4224	6290	SO:0001587	stop_gained	161	exon7			GATCTCCAGGATT	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.733C>T	11.37:g.984672C>T	ENSP00000413234:p.Gln245*	Somatic	257	1		WXS	Illumina HiSeq	Phase_I	271	20	NM_012305	0	0	187	193	6	O75403|Q53ET1|Q96SI8	Nonsense_Mutation	SNP	ENST00000448903.2	37	CCDS44512.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.907592	0.92107	.	.	ENSG00000183020	ENST00000525796;ENST00000534328;ENST00000417081;ENST00000448903;ENST00000332231;ENST00000448757;ENST00000329626	.	.	.	3.84	3.84	0.44239	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-45.2751	16.1239	0.81380	0.0:1.0:0.0:0.0	.	.	.	.	X	85;245;245;245;245;245;118	.	ENSP00000328024:Q118X	Q	+	1	0	AP2A2	974672	1.000000	0.71417	0.912000	0.35992	0.283000	0.27025	7.675000	0.84002	1.870000	0.54199	0.591000	0.81541	CAG	.		0.582	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385431.2	NM_012305	
SYT9	143425	broad.mit.edu	37	11	7334870	7334870	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr11:7334870C>T	ENST00000318881.6	+	3	979	c.742C>T	c.(742-744)Ccc>Tcc	p.P248S	SYT9_ENST00000396716.2_Missense_Mutation_p.P216S	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	248	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		TGTCAATTTGCCCGCCAAGGA	0.413																																					p.P248S													.	SYT9-155	0			c.C742T						.						116.0	117.0	116.0					11																	7334870		2201	4296	6497	SO:0001583	missense	143425	exon3			AATTTGCCCGCCA	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.742C>T	11.37:g.7334870C>T	ENSP00000324419:p.Pro248Ser	Somatic	162	1		WXS	Illumina HiSeq	Phase_I	160	4	NM_175733	0	0	5	5	0		Missense_Mutation	SNP	ENST00000318881.6	37	CCDS7778.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.576914	0.86645	.	.	ENSG00000170743	ENST00000396716;ENST00000318881	T;T	0.70986	-0.53;-0.53	5.87	5.87	0.94306	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.64402	D	0.000001	D	0.83695	0.5310	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.84279	0.0493	10	0.87932	D	0	.	18.0718	0.89410	0.0:1.0:0.0:0.0	.	248	Q86SS6	SYT9_HUMAN	S	216;248	ENSP00000379944:P216S;ENSP00000324419:P248S	ENSP00000324419:P248S	P	+	1	0	SYT9	7291446	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	CCC	.		0.413	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733	
STX5	6811	bcgsc.ca	37	11	62592562	62592562	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr11:62592562C>A	ENST00000294179.3	-	8	778	c.625G>T	c.(625-627)Gag>Tag	p.E209*	STX5_ENST00000541317.1_Nonsense_Mutation_p.E113*|STX5_ENST00000377897.4_Nonsense_Mutation_p.E209*|STX5_ENST00000394690.1_Nonsense_Mutation_p.E155*	NM_001244666.1|NM_003164.4	NP_001231595.1|NP_003155.2	Q13190	STX5_HUMAN	syntaxin 5	209					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle targeting (GO:0006903)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|SNARE complex (GO:0031201)	protein N-terminus binding (GO:0047485)|SNAP receptor activity (GO:0005484)			breast(2)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	18						GAGAACTGCTCTCTCCGGCTC	0.562																																					p.E209X													.	STX5-154	0			c.G625T						.						45.0	52.0	50.0					11																	62592562		2201	4299	6500	SO:0001587	stop_gained	6811	exon8			ACTGCTCTCTCCG	U26648	CCDS8038.2, CCDS58140.1	11q12.3	2008-02-05	2006-04-25	2006-04-25	ENSG00000162236	ENSG00000162236			11440	protein-coding gene	gene with protein product		603189	"""syntaxin 5A"""	STX5A		9188044, 11959998	Standard	NM_003164		Approved	SED5	uc001nvh.3	Q13190	OTTHUMG00000143864	ENST00000294179.3:c.625G>T	11.37:g.62592562C>A	ENSP00000294179:p.Glu209*	Somatic	87	0		WXS	Illumina HiSeq	Phase_1	76	5	NM_003164	0	0	76	76	0	B2R8T2|F8W8Q9|Q5U0D4|Q7Z3T6|Q9BUG1	Nonsense_Mutation	SNP	ENST00000294179.3	37	CCDS8038.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.551595|5.551595	0.96501|0.96501	.|.	.|.	ENSG00000162236|ENSG00000162236	ENST00000431400|ENST00000377897;ENST00000294179;ENST00000394690;ENST00000541317	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.045290|0.045290	0.85682|0.85682	D|D	0.000000|0.000000	T|.	0.69305|.	0.3096|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.66834|.	-0.5823|.	4|.	.|0.29301	.|T	.|0.29	-1.1359|-1.1359	16.7371|16.7371	0.85449|0.85449	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	63|209;209;155;113	.|.	.|ENSP00000294179:E209X	E|E	-|-	3|1	2|0	STX5|STX5	62349138|62349138	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	7.260000|7.260000	0.78391|0.78391	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GAG|GAG	.		0.562	STX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290113.1	NM_003164	
ARHGAP20	57569	broad.mit.edu	37	11	110450663	110450663	+	Missense_Mutation	SNP	C	C	T	rs202001398		TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr11:110450663C>T	ENST00000260283.4	-	16	3291	c.3007G>A	c.(3007-3009)Ggt>Agt	p.G1003S	ARHGAP20_ENST00000528829.1_Missense_Mutation_p.G967S|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.G546S|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.G980S|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.G967S|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.G977S|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.G977S	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	1003					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.G1003S(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GATGAGGGACCGGGCATTCCG	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		20149	0.001		0.0	False		,,,				2504	0.0				p.G1003S													.	ARHGAP20-230	1	Substitution - Missense(1)	large_intestine(1)	c.G3007A						.						62.0	61.0	61.0					11																	110450663		2201	4298	6499	SO:0001583	missense	57569	exon16			AGGGACCGGGCAT	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.3007G>A	11.37:g.110450663C>T	ENSP00000260283:p.Gly1003Ser	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	101	4	NM_020809	0	0	1	1	0	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	0.893	-0.724850	0.03158	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.07908	3.15;3.15;3.18;3.15;3.15;3.15;3.15	5.9	0.311	0.15831	.	0.363057	0.27181	N	0.020541	T	0.05547	0.0146	L	0.36672	1.1	0.09310	N	1	B;B;B	0.22346	0.004;0.041;0.068	B;B;B	0.17722	0.003;0.009;0.019	T	0.39057	-0.9632	10	0.23302	T	0.38	.	5.9856	0.19432	0.1254:0.4172:0.0:0.4573	.	977;1003;980	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	S	1003;977;546;980;967;977;967	ENSP00000260283:G1003S;ENSP00000349660:G977S;ENSP00000437905:G546S;ENSP00000432076:G980S;ENSP00000436319:G967S;ENSP00000436522:G977S;ENSP00000431399:G967S	ENSP00000260283:G1003S	G	-	1	0	ARHGAP20	109955873	0.000000	0.05858	0.038000	0.18304	0.136000	0.21042	-0.447000	0.06828	0.056000	0.16144	-0.809000	0.03173	GGT	C|0.999;T|0.000		0.507	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
DCPS	28960	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	126201299	126201299	+	Splice_Site	SNP	G	G	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr11:126201299G>T	ENST00000263579.4	+	3	705		c.e3-1		DCPS_ENST00000530860.1_3'UTR	NM_014026.3	NP_054745.1	Q96C86	DCPS_HUMAN	decapping enzyme, scavenger						cellular response to menadione (GO:0036245)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA metabolic process (GO:0016071)|negative regulation of programmed cell death (GO:0043069)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	m7G(5')pppN diphosphatase activity (GO:0050072)|RNA 7-methylguanosine cap binding (GO:0000340)			endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		TATCATTGCAGATGTAAAGAC	0.567																																					.		.											.	DCPS-90	0			c.377-1G>T						.						137.0	131.0	133.0					11																	126201299		2201	4298	6499	SO:0001630	splice_region_variant	28960	exon3			ATTGCAGATGTAA	AF077201	CCDS8473.1	11q24	2008-02-05			ENSG00000110063	ENSG00000110063			29812	protein-coding gene	gene with protein product		610534				12198172, 14523240	Standard	NM_014026		Approved	HSPC015, HINT-5, HSL1	uc001qdp.3	Q96C86	OTTHUMG00000165829	ENST00000263579.4:c.377-1G>T	11.37:g.126201299G>T		Somatic	191	0		WXS	Illumina HiSeq	Phase_I	200	12	NM_014026	0	0	1	1	0	Q8NHL8|Q9Y2S5	Splice_Site	SNP	ENST00000263579.4	37	CCDS8473.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584618	0.46110	.	.	ENSG00000110063	ENST00000263579	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9226	0.92530	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DCPS	125706509	1.000000	0.71417	0.996000	0.52242	0.450000	0.32258	8.744000	0.91596	2.778000	0.95560	0.655000	0.94253	.	.		0.567	DCPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386455.1	NM_014026	Intron
PRDM10	56980	broad.mit.edu	37	11	129814751	129814751	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr11:129814751C>T	ENST00000360871.3	-	6	908	c.677G>A	c.(676-678)cGc>cAc	p.R226H	PRDM10_ENST00000358825.5_Missense_Mutation_p.R226H|PRDM10_ENST00000528746.1_Missense_Mutation_p.R200H|PRDM10_ENST00000526082.1_Missense_Mutation_p.R140H|PRDM10_ENST00000304538.6_Missense_Mutation_p.R140H|PRDM10_ENST00000423662.2_Missense_Mutation_p.R140H	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	226	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CTTGGGGATGCGCCGCTTGGA	0.627																																					p.R226H													.	PRDM10-91	0			c.G677A						.						55.0	59.0	58.0					11																	129814751		2201	4297	6498	SO:0001583	missense	56980	exon6			GGGATGCGCCGCT	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.677G>A	11.37:g.129814751C>T	ENSP00000354118:p.Arg226His	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	114	4	NM_020228	0	0	1	1	0	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668188	0.88348	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082	T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86	5.25	5.25	0.73442	.	0.066838	0.64402	D	0.000016	T	0.67915	0.2944	M	0.64404	1.975	0.53688	D	0.999973	D;D;D;D;D;D;D	0.89917	1.0;0.965;1.0;0.99;1.0;1.0;1.0	D;B;D;B;D;D;D	0.79784	0.983;0.21;0.989;0.328;0.993;0.989;0.989	T	0.69953	-0.5005	10	0.72032	D	0.01	-17.5432	19.2892	0.94092	0.0:1.0:0.0:0.0	.	140;226;226;226;140;140;140	B7ZL72;Q9NQV6-4;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;.;PRD10_HUMAN;.;.;.	H	226;140;226;140;200;140	ENSP00000351686:R226H;ENSP00000302669:R140H;ENSP00000354118:R226H;ENSP00000398431:R140H;ENSP00000431262:R200H;ENSP00000432237:R140H	ENSP00000302669:R140H	R	-	2	0	PRDM10	129319961	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.445000	0.80570	2.627000	0.88993	0.644000	0.83932	CGC	.		0.627	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	.	KRAS-92875	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	40	13	NM_004985	0	0	13	29	16	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	.		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
OR10AD1	121275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	48596939	48596939	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr12:48596939A>G	ENST00000310248.2	-	1	231	c.137T>C	c.(136-138)aTc>aCc	p.I46T		NM_001004134.1	NP_001004134.1	Q8NGE0	O10AD_HUMAN	olfactory receptor, family 10, subfamily AD, member 1	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|urinary_tract(1)	9						GGTGATAAAGATGATGAGGCC	0.542																																					p.I46T		.											.	OR10AD1-69	0			c.T137C						.						96.0	81.0	86.0					12																	48596939		2203	4300	6503	SO:0001583	missense	121275	exon1			ATAAAGATGATGA		CCDS31787.1	12q13.11	2013-09-24	2002-11-13	2002-11-15	ENSG00000172640	ENSG00000172640		"""GPCR / Class A : Olfactory receptors"""	14819	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily AD, member 1 pseudogene"""	OR10AD1P			Standard	NM_001004134		Approved		uc001rrl.1	Q8NGE0	OTTHUMG00000168027	ENST00000310248.2:c.137T>C	12.37:g.48596939A>G	ENSP00000308689:p.Ile46Thr	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	53	5	NM_001004134	0	0	0	0	0	B9EGT9|Q6IFA8	Missense_Mutation	SNP	ENST00000310248.2	37	CCDS31787.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.762337	0.49468	.	.	ENSG00000172640	ENST00000310248	T	0.00531	6.76	4.97	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	0.189939	0.25929	N	0.027383	T	0.01061	0.0035	M	0.79475	2.455	0.33098	D	0.53878	D	0.59357	0.985	P	0.50537	0.643	T	0.47586	-0.9106	10	0.72032	D	0.01	-30.4283	12.9182	0.58216	1.0:0.0:0.0:0.0	.	46	Q8NGE0	O10AD_HUMAN	T	46	ENSP00000308689:I46T	ENSP00000308689:I46T	I	-	2	0	OR10AD1	46883206	0.910000	0.30920	1.000000	0.80357	0.519000	0.34347	6.493000	0.73658	2.213000	0.71641	0.533000	0.62120	ATC	.		0.542	OR10AD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397577.1		
ATP5B	506	ucsc.edu	37	12	57036240	57036240	+	Splice_Site	SNP	A	A	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr12:57036240A>G	ENST00000262030.3	-	7	1125		c.e7+1		ATP5B_ENST00000550162.1_Splice_Site|ATP5B_ENST00000552919.1_Splice_Site|SNORD59A_ENST00000384304.1_RNA	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide						angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AATTTTTCTTACCTGTACAGA	0.478																																					.													.	ATP5B-91	0			c.1074+2T>C						.						75.0	78.0	77.0					12																	57036240		2203	4300	6503	SO:0001630	splice_region_variant	506	exon8			TTTCTTACCTGTA	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1074+1T>C	12.37:g.57036240A>G		Somatic	79	0		WXS	Illumina HiSeq		95	1	NM_001686	0	0	0	0	0	A8K4X0|Q14283	Splice_Site	SNP	ENST00000262030.3	37	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.204126	0.79127	.	.	ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020;ENST00000552959;ENST00000551570	.	.	.	6.01	6.01	0.97437	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5038	0.75722	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP5B	55322507	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	7.275000	0.78548	2.306000	0.77630	0.496000	0.49642	.	.		0.478	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	Intron
STON2	85439	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	81862455	81862455	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr14:81862455C>G	ENST00000267540.2	-	2	356	c.156G>C	c.(154-156)gaG>gaC	p.E52D	STON2_ENST00000555447.1_Missense_Mutation_p.E52D	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	52					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		CCACATGGTTCTCCCCGGAGG	0.577																																					p.E52D		.											.	STON2-95	0			c.G156C						.						71.0	64.0	66.0					14																	81862455		2203	4300	6503	SO:0001583	missense	85439	exon4			ATGGTTCTCCCCG	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.156G>C	14.37:g.81862455C>G	ENSP00000267540:p.Glu52Asp	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	82	7	NM_001256430	0	0	4	4	0	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	CCDS9875.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.938177	0.52972	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.54866	0.55;0.55	5.8	1.95	0.26073	Stonin-2, N-terminal (1);	0.362161	0.29040	N	0.013335	T	0.44456	0.1294	L	0.59436	1.845	0.23309	N	0.997936	P;B;P	0.35714	0.517;0.334;0.461	B;B;B	0.36504	0.226;0.122;0.145	T	0.43702	-0.9375	10	0.87932	D	0	-12.0903	5.4312	0.16454	0.0:0.4999:0.2873:0.2127	.	52;52;52	Q8WXE9;Q17R23;G3V2T7	STON2_HUMAN;.;.	D	52;64;52	ENSP00000450857:E52D;ENSP00000267540:E52D	ENSP00000267540:E52D	E	-	3	2	STON2	80932208	0.910000	0.30920	0.991000	0.47740	0.836000	0.47400	-0.309000	0.08145	0.801000	0.34066	-0.179000	0.13096	GAG	.		0.577	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
MFAP1	4236	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	44109600	44109600	+	Silent	SNP	T	T	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr15:44109600T>G	ENST00000267812.3	-	2	358	c.126A>C	c.(124-126)ggA>ggC	p.G42G		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	42					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		CTGGCCTTTTTCCGGACACAT	0.433																																					p.G42G		.											.	MFAP1-226	0			c.A126C						.						128.0	118.0	121.0					15																	44109600		2198	4298	6496	SO:0001819	synonymous_variant	4236	exon2			CCTTTTTCCGGAC		CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.126A>C	15.37:g.44109600T>G		Somatic	184	0		WXS	Illumina HiSeq	Phase_I	214	12	NM_005926	0	0	53	58	5	Q86TG6	Silent	SNP	ENST00000267812.3	37	CCDS10105.1																																																																																			.		0.433	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133491.2	NM_005926	
AURKB	9212	broad.mit.edu	37	17	8108544	8108544	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr17:8108544C>T	ENST00000585124.1	-	8	944	c.851G>A	c.(850-852)cGc>cAc	p.R284H	AURKB_ENST00000535053.1_3'UTR|AURKB_ENST00000316199.6_Missense_Mutation_p.R285H|AURKB_ENST00000534871.1_Missense_Mutation_p.R243H|AURKB_ENST00000578549.1_Missense_Mutation_p.R252H	NM_004217.3	NP_004208.2	Q96GD4	AURKB_HUMAN	aurora kinase B	284	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				abscission (GO:0009838)|aging (GO:0007568)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|cleavage furrow formation (GO:0036089)|cytokinesis checkpoint (GO:0031565)|histone H3-S28 phosphorylation (GO:0043988)|histone modification (GO:0016570)|mitotic cell cycle (GO:0000278)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytokinesis (GO:0032467)|protein autophosphorylation (GO:0046777)|protein localization to kinetochore (GO:0034501)|protein phosphorylation (GO:0006468)|regulation of chromosome segregation (GO:0051983)|spindle checkpoint (GO:0031577)|spindle midzone assembly involved in mitosis (GO:0051256)|spindle stabilization (GO:0043146)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|central_nervous_system(1)|lung(2)	4						CTTGACGATGCGGCGATAGGT	0.592																																					p.R284H	NSCLC(134;1161 2470 43664 51568)												.	AURKB-1508	0			c.G851A						.						99.0	73.0	82.0					17																	8108544		2203	4300	6503	SO:0001583	missense	9212	exon8			ACGATGCGGCGAT	AF004022	CCDS11134.1, CCDS58514.1, CCDS67162.1	17p13.1	2013-01-17	2003-07-21	2003-07-23	ENSG00000178999	ENSG00000178999		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11390	protein-coding gene	gene with protein product	"""aurora-B"", ""aurora-1"", ""protein phosphatase 1, regulatory subunit 48"""	604970	"""serine/threonine kinase 12"""	STK12		9858806	Standard	NM_001256834		Approved	Aik2, IPL1, AurB, AIM-1, ARK2, STK5, PPP1R48	uc002gkm.4	Q96GD4	OTTHUMG00000108189	ENST00000585124.1:c.851G>A	17.37:g.8108544C>T	ENSP00000463999:p.Arg284His	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	31	3	NM_004217	0	0	0	0	0	B4DNM4|C7G533|C7G534|C7G535|D3DTR4|J9JID1|O14630|O60446|O95083|Q96DV5|Q9UQ46	Missense_Mutation	SNP	ENST00000585124.1	37	CCDS11134.1	.	.	.	.	.	.	.	.	.	.	C	34	5.356147	0.95854	.	.	ENSG00000178999	ENST00000316199;ENST00000534871	T;T	0.66815	-0.23;-0.23	5.33	5.33	0.75918	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.71660	0.3366	L	0.47016	1.485	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.54100	0.742;0.742	T	0.74523	-0.3637	10	0.87932	D	0	-19.9451	16.5723	0.84622	0.0:1.0:0.0:0.0	.	284;284	C7G533;Q96GD4	.;AURKB_HUMAN	H	284;243	ENSP00000313950:R284H;ENSP00000443869:R243H	ENSP00000313950:R284H	R	-	2	0	AURKB	8049269	0.376000	0.25098	0.991000	0.47740	0.910000	0.53928	3.226000	0.51254	2.787000	0.95880	0.650000	0.86243	CGC	.		0.592	AURKB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000226995.2	NM_004217	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	465	64		WXS	Illumina HiSeq		643	96	NM_145301	0	0	15	85	70	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
QRICH2	84074	hgsc.bcm.edu	37	17	74288532	74288532	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr17:74288532C>T	ENST00000262765.5	-	4	1957	c.1778G>A	c.(1777-1779)cGt>cAt	p.R593H		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	593	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						GACCAAACCACGCTGATCTGC	0.537																																					p.R593H		.											.	QRICH2-94	0			c.G1778A						.						165.0	136.0	146.0					17																	74288532		2203	4300	6503	SO:0001583	missense	84074	exon4			AAACCACGCTGAT	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1778G>A	17.37:g.74288532C>T	ENSP00000262765:p.Arg593His	Somatic	74	2		WXS	Illumina HiSeq	Phase_I	68	6	NM_032134	0	0	0	1	1	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	C	7.632	0.679114	0.14907	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.22743	1.94	4.41	-8.82	0.00810	.	.	.	.	.	T	0.17408	0.0418	L	0.40543	1.245	0.09310	N	1	D;P	0.69078	0.997;0.945	P;B	0.54499	0.754;0.36	T	0.02009	-1.1230	9	0.23891	T	0.37	0.8777	2.711	0.05174	0.132:0.3548:0.2026:0.3106	.	593;593	B5MD94;Q9H0J4	.;QRIC2_HUMAN	H	593	ENSP00000262765:R593H	ENSP00000262765:R593H	R	-	2	0	QRICH2	71800127	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-14.214000	0.00000	-2.005000	0.00959	-0.798000	0.03219	CGT	C|1.000;T|0.000		0.537	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
QRICH2	84074	hgsc.bcm.edu	37	17	74288538	74288538	+	Missense_Mutation	SNP	T	T	A	rs142871405		TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr17:74288538T>A	ENST00000262765.5	-	4	1951	c.1772A>T	c.(1771-1773)gAt>gTt	p.D591V		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	591	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						ACCACGCTGATCTGCACCAGG	0.542																																					p.D591V		.											.	QRICH2-94	0			c.A1772T						.						168.0	139.0	149.0					17																	74288538		2203	4300	6503	SO:0001583	missense	84074	exon4			CGCTGATCTGCAC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1772A>T	17.37:g.74288538T>A	ENSP00000262765:p.Asp591Val	Somatic	70	1		WXS	Illumina HiSeq	Phase_I	73	5	NM_032134	0	0	0	0	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	T	0.110	-1.140197	0.01728	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.09350	2.99	5.05	-10.1	0.00402	.	.	.	.	.	T	0.06005	0.0156	L	0.36672	1.1	0.09310	N	1	B;B	0.21147	0.001;0.052	B;B	0.15052	0.001;0.012	T	0.15521	-1.0434	9	0.25751	T	0.34	-0.0073	5.5216	0.16936	0.4711:0.3571:0.0862:0.0856	.	591;591	B5MD94;Q9H0J4	.;QRIC2_HUMAN	V	591	ENSP00000262765:D591V	ENSP00000262765:D591V	D	-	2	0	QRICH2	71800133	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-12.362000	0.00002	-4.878000	0.00028	-5.321000	0.00001	GAT	T|1.000;C|0.000		0.542	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
RBBP8	5932	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	20573491	20573491	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr18:20573491C>G	ENST00000399722.2	+	11	2052	c.1701C>G	c.(1699-1701)tgC>tgG	p.C567W	RBBP8_ENST00000399725.2_Missense_Mutation_p.C567W|RBBP8_ENST00000327155.5_Missense_Mutation_p.C567W|RBBP8_ENST00000360790.5_Missense_Mutation_p.C567W	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	567					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			TGAATAAATGCTCTCCAGACA	0.438								Homologous recombination																													p.C567W		.											.	RBBP8-659	0			c.C1701G						.						42.0	43.0	43.0					18																	20573491		2203	4300	6503	SO:0001583	missense	5932	exon11			TAAATGCTCTCCA	AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.1701C>G	18.37:g.20573491C>G	ENSP00000382628:p.Cys567Trp	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	87	5	NM_203292	0	0	88	93	5	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	ENST00000399722.2	37	CCDS11875.1	.	.	.	.	.	.	.	.	.	.	C	8.135	0.783853	0.16189	.	.	ENSG00000101773	ENST00000327155;ENST00000399725;ENST00000399722;ENST00000399721;ENST00000360790	T;T;T;T;T	0.30182	1.56;1.54;1.56;1.56;1.56	5.47	-1.84	0.07809	.	0.955160	0.08781	N	0.894641	T	0.13713	0.0332	N	0.08118	0	0.80722	D	1	B;B;B	0.26845	0.161;0.161;0.05	B;B;B	0.27262	0.078;0.078;0.078	T	0.11348	-1.0591	10	0.42905	T	0.14	2.5577	4.5073	0.11894	0.398:0.2625:0.0:0.3395	.	567;567;567	E7ETY1;A6NKN2;Q99708	.;.;COM1_HUMAN	W	567	ENSP00000323050:C567W;ENSP00000382630:C567W;ENSP00000382628:C567W;ENSP00000382627:C567W;ENSP00000354024:C567W	ENSP00000323050:C567W	C	+	3	2	RBBP8	18827489	0.237000	0.23815	0.580000	0.28601	0.726000	0.41606	-0.151000	0.10175	-0.215000	0.10063	-0.150000	0.13652	TGC	.		0.438	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	NM_203291	
ACSBG2	81616	broad.mit.edu	37	19	6147661	6147661	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr19:6147661G>A	ENST00000586696.1	+	3	548	c.272G>A	c.(271-273)cGg>cAg	p.R91Q	ACSBG2_ENST00000588485.1_5'UTR|ACSBG2_ENST00000252669.5_Missense_Mutation_p.R91Q|ACSBG2_ENST00000588304.1_Missense_Mutation_p.R41Q|ACSBG2_ENST00000591403.1_Missense_Mutation_p.R91Q			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	91					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAGGCTTGTCGGAAGGCTGCA	0.408																																					p.R91Q													.	ACSBG2-23	0			c.G272A						.						108.0	113.0	112.0					19																	6147661		2203	4300	6503	SO:0001583	missense	81616	exon3			CTTGTCGGAAGGC		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.272G>A	19.37:g.6147661G>A	ENSP00000465589:p.Arg91Gln	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	166	4	NM_030924	0	0	0	0	0	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	37	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.751591	0.49257	.	.	ENSG00000130377	ENST00000252669	T	0.41758	0.99	5.79	4.76	0.60689	AMP-dependent synthetase/ligase (1);	0.359807	0.20545	N	0.090240	T	0.62648	0.2445	M	0.78285	2.405	0.46774	D	0.999191	B;D	0.64830	0.325;0.994	B;D	0.64776	0.228;0.929	T	0.65236	-0.6217	10	0.52906	T	0.07	-45.6197	12.9332	0.58299	0.0782:0.0:0.9218:0.0	.	91;91	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	Q	91	ENSP00000252669:R91Q	ENSP00000252669:R91Q	R	+	2	0	ACSBG2	6098661	1.000000	0.71417	0.795000	0.32087	0.079000	0.17450	5.538000	0.67193	1.462000	0.47948	-0.126000	0.14955	CGG	.		0.408	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
ZFP30	22835	broad.mit.edu	37	19	38126264	38126264	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr19:38126264C>T	ENST00000351218.2	-	6	1735	c.1178G>A	c.(1177-1179)cGt>cAt	p.R393H	ZFP30_ENST00000514101.2_Missense_Mutation_p.R393H|ZFP30_ENST00000392144.1_Missense_Mutation_p.R393H|ZFP30_ENST00000589018.1_Intron	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCTGAGTAACGACGAAAGAA	0.408																																					p.R393H													.	ZFP30-90	0			c.G1178A						.						69.0	72.0	71.0					19																	38126264		2203	4300	6503	SO:0001583	missense	22835	exon6			GAGTAACGACGAA	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1178G>A	19.37:g.38126264C>T	ENSP00000343581:p.Arg393His	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	106	5	NM_014898	0	0	3	3	0	Q58EY8	Missense_Mutation	SNP	ENST00000351218.2	37	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	C	8.628	0.893085	0.17613	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	T;T;T	0.36340	1.26;1.26;1.26	3.9	2.86	0.33363	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35262	N	0.003340	T	0.34716	0.0907	L	0.27975	0.815	0.23851	N	0.996661	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.33059	-0.9883	10	0.11485	T	0.65	.	3.6934	0.08354	0.0:0.5686:0.2232:0.2082	.	393;393	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	H	393;393;393;308	ENSP00000343581:R393H;ENSP00000422930:R393H;ENSP00000375988:R393H	ENSP00000343581:R393H	R	-	2	0	ZFP30	42818104	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-0.122000	0.10627	2.175000	0.68902	0.591000	0.81541	CGT	.		0.408	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898	
KIF3C	3797	broad.mit.edu;bcgsc.ca	37	2	26203576	26203576	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr2:26203576G>A	ENST00000264712.3	-	1	1790	c.1211C>T	c.(1210-1212)cCc>cTc	p.P404L	KIF3C_ENST00000405914.1_Missense_Mutation_p.P404L	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	404					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTCCTCCGGGGCCGCTTCCC	0.652																																					p.P404L													.	KIF3C-94	0			c.C1211T						.						46.0	48.0	47.0					2																	26203576		2203	4300	6503	SO:0001583	missense	3797	exon1			CTCCGGGGCCGCT		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1211C>T	2.37:g.26203576G>A	ENSP00000264712:p.Pro404Leu	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	109	5	NM_002254	0	0	6	6	0	O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	ENST00000264712.3	37	CCDS1719.1	.	.	.	.	.	.	.	.	.	.	G	8.691	0.907521	0.17833	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	T;T	0.73258	-0.73;-0.73	5.0	4.04	0.47022	Kinesin, motor domain (1);	0.465840	0.23937	N	0.043100	T	0.46580	0.1400	N	0.12182	0.205	0.40162	D	0.977078	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34453	-0.9828	10	0.27082	T	0.32	.	4.7743	0.13171	0.2331:0.0:0.7669:0.0	.	404;404	B7ZM25;O14782	.;KIF3C_HUMAN	L	404;210;404	ENSP00000264712:P404L;ENSP00000385030:P404L	ENSP00000264712:P404L	P	-	2	0	KIF3C	26057080	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	2.612000	0.46343	1.249000	0.43950	0.655000	0.94253	CCC	.		0.652	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1		
VWA3B	200403	broad.mit.edu	37	2	98736133	98736133	+	Missense_Mutation	SNP	G	G	A	rs200875707		TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr2:98736133G>A	ENST00000477737.1	+	4	653	c.449G>A	c.(448-450)gGc>gAc	p.G150D	VWA3B_ENST00000451075.2_Intron|VWA3B_ENST00000435344.1_Missense_Mutation_p.G150D	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	150										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GATTTTGGCGGCATTCTGGAG	0.522																																					p.G150D													.	VWA3B-139	0			c.G449A						.						192.0	187.0	189.0					2																	98736133		1991	4149	6140	SO:0001583	missense	200403	exon4			TTGGCGGCATTCT	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.449G>A	2.37:g.98736133G>A	ENSP00000417955:p.Gly150Asp	Somatic	319	0		WXS	Illumina HiSeq	Phase_I	388	7	NM_144992	0	0	0	0	0	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	1.464	-0.561569	0.03939	.	.	ENSG00000168658	ENST00000435344;ENST00000477737	T;T	0.35973	1.28;1.28	6.02	-3.25	0.05079	.	1.332560	0.04551	N	0.389819	T	0.19967	0.0480	N	0.17474	0.49	0.09310	N	1	B;B	0.13145	0.007;0.001	B;B	0.13407	0.009;0.002	T	0.17501	-1.0367	10	0.32370	T	0.25	.	4.4567	0.11647	0.553:0.1139:0.2439:0.0893	.	150;150	Q502W6;Q502W6-8	VWA3B_HUMAN;.	D	150	ENSP00000401959:G150D;ENSP00000417955:G150D	ENSP00000411168:G150D	G	+	2	0	VWA3B	98102565	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	0.140000	0.16056	-0.462000	0.06984	-0.150000	0.13652	GGC	G|0.999;C|0.001		0.522	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
SMPD4	55627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	130931124	130931124	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr2:130931124C>T	ENST00000409031.1	-	4	1497	c.349G>A	c.(349-351)Gtg>Atg	p.V117M	SMPD4_ENST00000452225.2_Intron|SMPD4_ENST00000473720.1_Intron|SMPD4_ENST00000351288.6_Missense_Mutation_p.V117M|SMPD4_ENST00000453750.1_Intron|SMPD4_ENST00000339679.7_Missense_Mutation_p.C29Y|SMPD4_ENST00000426662.2_Intron|SMPD4_ENST00000443958.2_Intron|SMPD4_ENST00000431183.2_Intron	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	78					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	CTGTACTCCACAGGATTCACG	0.542																																					p.V117M		.											.	SMPD4-90	0			c.G349A						.						59.0	54.0	56.0					2																	130931124		2203	4300	6503	SO:0001583	missense	55627	exon4			ACTCCACAGGATT	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.349G>A	2.37:g.130931124C>T	ENSP00000386531:p.Val117Met	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	50	7	NM_017751	0	0	24	33	9	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	37	CCDS42751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.864|0.864	-0.734336|-0.734336	0.03111|0.03111	.|.	.|.	ENSG00000136699|ENSG00000136699	ENST00000339679|ENST00000351288;ENST00000409031;ENST00000441135	.|.	.|.	.|.	3.74|3.74	0.579|0.579	0.17397|0.17397	.|.	.|0.842482	.|0.10004	.|N	.|0.728107	T|T	0.30230|0.30230	0.0758|0.0758	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	B|B;B	0.02656|0.15719	0.0|0.014;0.007	B|B;B	0.01281|0.17098	0.0|0.017;0.008	T|T	0.27640|0.27640	-1.0068|-1.0068	8|9	0.22109|0.36615	T|T	0.4|0.2	.|.	3.3119|3.3119	0.07020|0.07020	0.0:0.4028:0.2084:0.3888|0.0:0.4028:0.2084:0.3888	.|.	29|78;117	B4E0T5|Q9NXE4;B1PBA3	.|NSMA3_HUMAN;.	Y|M	29|117;117;78	.|.	ENSP00000339721:C29Y|ENSP00000259217:V117M	C|V	-|-	2|1	0|0	SMPD4|SMPD4	130647594|130647594	0.367000|0.367000	0.25023|0.25023	0.045000|0.045000	0.18777|0.18777	0.188000|0.188000	0.23474|0.23474	1.298000|1.298000	0.33412|0.33412	0.248000|0.248000	0.21435|0.21435	0.455000|0.455000	0.32223|0.32223	TGT|GTG	.		0.542	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	NM_017751	
THSD7B	80731	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	137852688	137852688	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr2:137852688C>T	ENST00000409968.1	+	4	1374	c.1196C>T	c.(1195-1197)cCc>cTc	p.P399L	THSD7B_ENST00000413152.2_Missense_Mutation_p.P368L|THSD7B_ENST00000272643.3_Missense_Mutation_p.P399L|THSD7B_ENST00000543459.1_Missense_Mutation_p.P258L			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	399	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CAGCAATGTCCCAGGTATTAC	0.418																																					.													.	THSD7B-75	0			.						.						74.0	82.0	79.0					2																	137852688		1962	4159	6121	SO:0001583	missense	80731	.			AATGTCCCAGGTA			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1196C>T	2.37:g.137852688C>T	ENSP00000387145:p.Pro399Leu	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	70	7	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	C	18.53	3.644315	0.67244	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152;ENST00000543459	T;T;T;T	0.60040	0.22;0.22;0.22;1.83	5.84	4.96	0.65561	.	0.047672	0.85682	D	0.000000	T	0.68769	0.3037	M	0.63843	1.955	0.80722	D	1	D;P	0.55385	0.971;0.929	P;P	0.57468	0.821;0.821	T	0.68307	-0.5443	10	0.35671	T	0.21	.	15.9247	0.79606	0.1365:0.8635:0.0:0.0	.	399;368	Q9C0I4;C9JKN6	THS7B_HUMAN;.	L	399;399;368;258	ENSP00000387145:P399L;ENSP00000272643:P399L;ENSP00000413841:P368L;ENSP00000443370:P258L	ENSP00000272643:P399L	P	+	2	0	THSD7B	137569158	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	5.698000	0.68302	1.446000	0.47643	0.650000	0.86243	CCC	.		0.418	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
PER2	8864	hgsc.bcm.edu	37	2	239162113	239162113	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr2:239162113G>C	ENST00000254657.3	-	19	2830	c.2551C>G	c.(2551-2553)Cca>Gca	p.P851A	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	851	Pro-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TAAGCTGCTGGCACTGGGGCG	0.692																																					p.P851A		.											.	PER2-154	0			c.C2551G						.						22.0	22.0	22.0					2																	239162113		2203	4300	6503	SO:0001583	missense	8864	exon19			CTGCTGGCACTGG	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2551C>G	2.37:g.239162113G>C	ENSP00000254657:p.Pro851Ala	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_022817	0	0	9	9	0	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	G	6.080	0.383145	0.11524	.	.	ENSG00000132326	ENST00000254657	T	0.12147	2.71	3.66	2.77	0.32553	.	0.344461	0.21397	U	0.075216	T	0.16041	0.0386	M	0.76574	2.34	0.80722	D	1	B;B	0.14012	0.009;0.009	B;B	0.12156	0.007;0.007	T	0.03175	-1.1064	10	0.27082	T	0.32	-5.6874	9.3435	0.38093	0.1134:0.0:0.8866:0.0	.	851;851	B4DH14;O15055	.;PER2_HUMAN	A	851	ENSP00000254657:P851A	ENSP00000254657:P851A	P	-	1	0	PER2	238826852	1.000000	0.71417	0.174000	0.22961	0.062000	0.15995	4.714000	0.61902	0.829000	0.34733	0.491000	0.48974	CCA	.		0.692	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
ARFGEF2	10564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47632919	47632919	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr20:47632919G>A	ENST00000371917.4	+	31	4282	c.4282G>A	c.(4282-4284)Gta>Ata	p.V1428I		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1428					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TCTTTCTGATGTATTTGCACA	0.353																																					p.V1428I	Esophageal Squamous(176;1738 1974 26285 33069 35354)	.											.	ARFGEF2-358	0			c.G4282A						.						208.0	185.0	193.0					20																	47632919		2203	4300	6503	SO:0001583	missense	10564	exon31			TCTGATGTATTTG	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.4282G>A	20.37:g.47632919G>A	ENSP00000360985:p.Val1428Ile	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	147	43	NM_006420	0	0	21	51	30	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	37	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	G	7.760	0.705132	0.15172	.	.	ENSG00000124198	ENST00000371917	T	0.38722	1.12	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.054023	0.64402	D	0.000002	T	0.11580	0.0282	N	0.00841	-1.15	0.43069	D	0.994705	B	0.02656	0.0	B	0.01281	0.0	T	0.33189	-0.9878	10	0.02654	T	1	.	7.2277	0.26024	0.206:0.0:0.794:0.0	.	1428	Q9Y6D5	BIG2_HUMAN	I	1428	ENSP00000360985:V1428I	ENSP00000360985:V1428I	V	+	1	0	ARFGEF2	47066326	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	5.353000	0.66034	2.587000	0.87381	0.591000	0.81541	GTA	.		0.353	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
CLIC6	54102	hgsc.bcm.edu	37	21	36042941	36042941	+	Silent	SNP	C	C	T	rs367854236	byFrequency	TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr21:36042941C>T	ENST00000360731.3	+	1	1254	c.1254C>T	c.(1252-1254)gcC>gcT	p.A418A	CLIC6_ENST00000349499.2_Silent_p.A418A			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	418						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						ACCACCTGGCCGAGGAGGGCC	0.766													C|||	4	0.000798722	0.003	0.0	5008	,	,		9996	0.0		0.0	False		,,,				2504	0.0				p.A418A		.											.	CLIC6-91	0			c.C1254T						.	C		3,3783		0,3,1890	4.0	7.0	6.0		1254	-5.6	0.2	21		6	0,7312		0,0,3656	no	coding-synonymous	CLIC6	NM_053277.1		0,3,5546	TT,TC,CC		0.0,0.0792,0.027		418/687	36042941	3,11095	1893	3656	5549	SO:0001819	synonymous_variant	54102	exon1			CCTGGCCGAGGAG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.1254C>T	21.37:g.36042941C>T		Somatic	5	2		WXS	Illumina HiSeq	Phase_I	12	8	NM_053277	0	0	0	5	5	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				.		0.766	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
MMP11	4320	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	24123480	24123480	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr22:24123480G>A	ENST00000215743.3	+	6	1011	c.959G>A	c.(958-960)cGt>cAt	p.R320H		NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	320					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	TGGCGCCTCCGTGGGGGCCAG	0.672																																					p.R320H		.											.	MMP11-291	0			c.G959A						.						41.0	43.0	43.0					22																	24123480		2203	4300	6503	SO:0001583	missense	4320	exon6			GCCTCCGTGGGGG		CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.959G>A	22.37:g.24123480G>A	ENSP00000215743:p.Arg320His	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	77	21	NM_005940	0	0	18	20	2	Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	ENST00000215743.3	37	CCDS13816.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546617	0.86022	.	.	ENSG00000099953	ENST00000215743	T	0.02421	4.3	4.73	4.73	0.59995	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.08891	0.0220	L	0.41124	1.26	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.18840	-1.0324	10	0.38643	T	0.18	.	12.7499	0.57302	0.0822:0.0:0.9178:0.0	.	320	P24347	MMP11_HUMAN	H	320	ENSP00000215743:R320H	ENSP00000215743:R320H	R	+	2	0	MMP11	22453480	0.998000	0.40836	0.968000	0.41197	0.986000	0.74619	8.987000	0.93497	2.649000	0.89929	0.650000	0.86243	CGT	.		0.672	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319891.2	NM_005940	
MEI1	150365	hgsc.bcm.edu	37	22	42189857	42189857	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr22:42189857T>C	ENST00000401548.3	+	27	3410	c.3370T>C	c.(3370-3372)Tgt>Cgt	p.C1124R	MEI1_ENST00000476893.1_3'UTR|MEI1_ENST00000400107.1_Missense_Mutation_p.C457R|MEI1_ENST00000300398.4_Missense_Mutation_p.C132R	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GTCCCAGGCCTGTGTTGGCTG	0.458																																					p.C1124R		.											.	MEI1-70	0			c.T3370C						.						41.0	41.0	41.0					22																	42189857		1863	4101	5964	SO:0001583	missense	150365	exon27			CAGGCCTGTGTTG	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.3370T>C	22.37:g.42189857T>C	ENSP00000384115:p.Cys1124Arg	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_152513	0	0	0	0	0		Missense_Mutation	SNP	ENST00000401548.3	37	CCDS46718.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.162039	0.78226	.	.	ENSG00000167077	ENST00000401548;ENST00000400107;ENST00000300398;ENST00000419798;ENST00000403492	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.66	4.6	0.57074	.	0.342116	0.31010	N	0.008427	T	0.73946	0.3652	L	0.54323	1.7	0.48975	D	0.999734	D;D;D;D;D;D	0.65815	0.993;0.967;0.985;0.985;0.995;0.993	D;P;P;P;P;P	0.65010	0.931;0.6;0.838;0.838;0.838;0.865	T	0.75895	-0.3156	10	0.72032	D	0.01	-18.1438	9.3129	0.37917	0.0:0.0:0.2784:0.7216	.	138;457;234;367;492;1124	B7Z735;Q5TIA1-3;E9PB79;Q5TIA1-5;Q5TIA1-2;Q5TIA1	.;.;.;.;.;MEI1_HUMAN	R	1124;457;132;234;132	ENSP00000384115:C1124R;ENSP00000382978:C457R;ENSP00000300398:C132R;ENSP00000385298:C132R	ENSP00000300398:C132R	C	+	1	0	MEI1	40519803	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	2.126000	0.42026	2.153000	0.67306	0.459000	0.35465	TGT	.		0.458	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000074937.3	NM_152513	
ENTPD3	956	hgsc.bcm.edu;broad.mit.edu	37	3	40465427	40465427	+	Silent	SNP	T	T	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr3:40465427T>A	ENST00000301825.3	+	10	1444	c.1326T>A	c.(1324-1326)acT>acA	p.T442T	ENTPD3-AS1_ENST00000425156.1_RNA|ENTPD3_ENST00000456402.1_Silent_p.T442T|ENTPD3-AS1_ENST00000439293.1_RNA|ENTPD3-AS1_ENST00000452768.1_RNA|ENTPD3_ENST00000445129.1_Silent_p.T442T	NM_001248.2	NP_001239.2	O75355	ENTP3_HUMAN	ectonucleoside triphosphate diphosphohydrolase 3	442					nucleoside diphosphate catabolic process (GO:0009134)|nucleoside triphosphate catabolic process (GO:0009143)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				KIRC - Kidney renal clear cell carcinoma(284;0.0605)|Kidney(284;0.0758)		CAGAGGAGACTTGGCCCCAAA	0.408																																					p.T442T		.											.	ENTPD3-91	0			c.T1326A						.						118.0	109.0	112.0					3																	40465427		2203	4300	6503	SO:0001819	synonymous_variant	956	exon10			GGAGACTTGGCCC	AF039917	CCDS2691.1, CCDS74919.1	3p21.3	2004-02-26			ENSG00000168032	ENSG00000168032			3365	protein-coding gene	gene with protein product		603161		CD39L3		9676430	Standard	XM_005265605		Approved	NTPDase-3, HB6	uc003ckd.4	O75355	OTTHUMG00000131390	ENST00000301825.3:c.1326T>A	3.37:g.40465427T>A		Somatic	141	0		WXS	Illumina HiSeq	Phase_I	179	9	NM_001248	0	0	1	1	0	B2R8D0|G5E9N0|O60495|Q8N6K2	Silent	SNP	ENST00000301825.3	37	CCDS2691.1																																																																																			.		0.408	ENTPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254179.2	NM_001248	
LTF	4057	broad.mit.edu	37	3	46492033	46492033	+	Silent	SNP	A	A	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr3:46492033A>G	ENST00000231751.4	-	7	1129	c.834T>C	c.(832-834)agT>agC	p.S278S	LTF_ENST00000426532.2_Silent_p.S234S|LTF_ENST00000417439.1_Silent_p.S278S	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	278	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		TGCCATTCACACTTCGTGCCA	0.567																																					p.S278S													.	LTF-703	0			c.T834C						.						99.0	86.0	90.0					3																	46492033		2203	4296	6499	SO:0001819	synonymous_variant	4057	exon7			ATTCACACTTCGT		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.834T>C	3.37:g.46492033A>G		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	77	5	NM_002343	0	0	57	63	6	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Silent	SNP	ENST00000231751.4	37	CCDS33747.1																																																																																			.		0.567	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343	
ZIC4	84107	hgsc.bcm.edu	37	3	147109013	147109013	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr3:147109013C>A	ENST00000383075.3	-	4	1221	c.709G>T	c.(709-711)Gag>Tag	p.E237*	ZIC4_ENST00000425731.3_Nonsense_Mutation_p.E275*|ZIC4_ENST00000491672.1_Nonsense_Mutation_p.E31*|ZIC4_ENST00000525172.2_Nonsense_Mutation_p.E287*|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000473123.1_Nonsense_Mutation_p.E237*|ZIC4_ENST00000484399.1_Nonsense_Mutation_p.E237*	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	237						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CCCTCGAACTCGCATCTGAAG	0.617																																					p.E287X		.											.	ZIC4-91	0			c.G859T						.						26.0	28.0	28.0					3																	147109013		2202	4299	6501	SO:0001587	stop_gained	84107	exon4			CGAACTCGCATCT	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.709G>T	3.37:g.147109013C>A	ENSP00000372553:p.Glu237*	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_001168378	0	0	0	0	0	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Nonsense_Mutation	SNP	ENST00000383075.3	37	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	C	37	6.016150	0.97205	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672	.	.	.	4.83	4.83	0.62350	.	0.000000	0.46758	D	0.000280	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	18.2835	0.90105	0.0:1.0:0.0:0.0	.	.	.	.	X	237;275;287;237;237;31	.	ENSP00000372553:E237X	E	-	1	0	ZIC4	148591703	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.901000	0.69861	2.381000	0.81170	0.462000	0.41574	GAG	.		0.617	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1		
IDUA	3425	hgsc.bcm.edu	37	4	980971	980971	+	Missense_Mutation	SNP	T	T	G	rs10794537	byFrequency	TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr4:980971T>G	ENST00000247933.4	+	1	187	c.99T>G	c.(97-99)caT>caG	p.H33Q	IDUA_ENST00000453894.1_Missense_Mutation_p.H33Q|SLC26A1_ENST00000398520.2_Intron	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	33			H -> Q (in dbSNP:rs10794537). {ECO:0000269|PubMed:1362562, ECO:0000269|PubMed:1505961, ECO:0000269|PubMed:1946389, ECO:0000269|PubMed:21394825}.		carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACCTGGTGCATGTGGACGCGG	0.801													G|||	4467	0.891973	0.9826	0.8386	5008	,	,		8604	0.8472		0.8042	False		,,,				2504	0.9438				p.H33Q		.											.	IDUA-91	0			c.T99G						.						1.0	1.0	1.0					4																	980971		552	1375	1927	SO:0001583	missense	3425	exon1			GGTGCATGTGGAC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.99T>G	4.37:g.980971T>G	ENSP00000247933:p.His33Gln	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	2	2	NM_000203	0	0	0	11	11	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	1801|1801	0.8246336996336996|0.8246336996336996	464|464	0.943089430894309|0.943089430894309	294|294	0.8121546961325967|0.8121546961325967	448|448	0.7832167832167832|0.7832167832167832	595|595	0.7849604221635884|0.7849604221635884	G|G	3.726|3.726	-0.056533|-0.056533	0.07362|0.07362	.|.	.|.	ENSG00000127415|ENSG00000127415	ENST00000504568|ENST00000247933;ENST00000453894;ENST00000502910	.|D;D;D	.|0.93247	.|-3.18;-3.19;-3.03	3.62|3.62	-0.897|-0.897	0.10553|0.10553	.|.	.|0.728933	.|0.12190	.|N	.|0.491278	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.36817|0.36817	-0.9732|-0.9732	4|9	.|0.10111	.|T	.|0.7	.|.	1.2904|1.2904	0.02059|0.02059	0.1461:0.2669:0.3485:0.2385|0.1461:0.2669:0.3485:0.2385	rs10794537|rs10794537	.|33;33	.|B3KWK6;P35475	.|.;IDUA_HUMAN	G|Q	33|33	.|ENSP00000247933:H33Q;ENSP00000396458:H33Q;ENSP00000422952:H33Q	.|ENSP00000247933:H33Q	C|H	+|+	1|3	0|2	IDUA|IDUA	970971|970971	0.000000|0.000000	0.05858|0.05858	0.992000|0.992000	0.48379|0.48379	0.012000|0.012000	0.07955|0.07955	-2.547000|-2.547000	0.00931|0.00931	-0.253000|-0.253000	0.09514|0.09514	-1.482000|-1.482000	0.00985|0.00985	TGT|CAT	T|0.175;G|0.825		0.801	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
CENPC	1060	hgsc.bcm.edu	37	4	68338326	68338326	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr4:68338326T>A	ENST00000273853.6	-	19	3079	c.2829A>T	c.(2827-2829)agA>agT	p.R943S		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	943	MIF2 homology domain III.				chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										TGATCTTTCATCTTTTTATCT	0.249																																					p.R943S		.											.	CENPC1-205	0			c.A2829T						.						25.0	23.0	24.0					4																	68338326		1675	3879	5554	SO:0001583	missense	1060	exon19			CTTTCATCTTTTT	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2829A>T	4.37:g.68338326T>A	ENSP00000273853:p.Arg943Ser	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	9	8	NM_001812	0	0	1	2	1	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	37	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126153	0.56721	.	.	ENSG00000145241	ENST00000273853	.	.	.	3.59	-2.03	0.07365	.	0.474882	0.18938	N	0.127023	T	0.15478	0.0373	N	0.12182	0.205	0.27738	N	0.944564	B	0.19445	0.036	B	0.12837	0.008	T	0.07693	-1.0759	9	0.72032	D	0.01	.	3.7757	0.08659	0.5677:0.1197:0.0:0.3126	.	943	Q03188	CENPC_HUMAN	S	943	.	ENSP00000273853:R943S	R	-	3	2	CENPC1	68020921	0.998000	0.40836	0.995000	0.50966	0.790000	0.44656	0.133000	0.15912	-0.350000	0.08262	0.402000	0.26972	AGA	.		0.249	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	123264653	123264653	+	Silent	SNP	C	C	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr4:123264653C>G	ENST00000264501.4	+	73	12814	c.12441C>G	c.(12439-12441)ggC>ggG	p.G4147G	KIAA1109_ENST00000388738.3_Silent_p.G4147G			Q2LD37	K1109_HUMAN	KIAA1109	4147	Ser-rich.				regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GTTCATCTGGCTTGAGCTTCA	0.478																																					p.G4147G		.											.	KIAA1109-80	0			c.C12441G						.						121.0	111.0	114.0					4																	123264653		1972	4163	6135	SO:0001819	synonymous_variant	84162	exon71			ATCTGGCTTGAGC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.12441C>G	4.37:g.123264653C>G		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	91	7	NM_015312	0	0	25	27	2	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.957|8.957	0.969706|0.969706	0.18659|0.18659	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000442707	.|.	.|.	.|.	5.78|5.78	-3.62|-3.62	0.04543|0.04543	.|.	.|.	.|.	.|.	.|.	T|T	0.40767|0.40767	0.1130|0.1130	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.37337|0.37337	-0.9710|-0.9710	4|4	.|.	.|.	.|.	.|.	4.0748|4.0748	0.09899|0.09899	0.0995:0.2869:0.4148:0.1987|0.0995:0.2869:0.4148:0.1987	.|.	.|.	.|.	.|.	G|V	523|93	.|.	.|.	A|L	+|+	2|1	0|0	KIAA1109|KIAA1109	123484103|123484103	0.019000|0.019000	0.18553|0.18553	0.092000|0.092000	0.20876|0.20876	0.981000|0.981000	0.71138|0.71138	-0.715000|-0.715000	0.04997|0.04997	-0.295000|-0.295000	0.08960|0.08960	0.591000|0.591000	0.81541|0.81541	GCT|CTT	.		0.478	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
TPPP	11076	hgsc.bcm.edu	37	5	678087	678087	+	Missense_Mutation	SNP	C	C	T	rs570878136	byFrequency	TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr5:678087C>T	ENST00000360578.5	-	2	210	c.89G>A	c.(88-90)aGg>aAg	p.R30K	CTD-2589H19.6_ENST00000607068.1_RNA	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	30	Mediates interaction with LIMK1.				microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.R30K(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		CAGCGACAGCCTCTTGGCTGC	0.677													C|||	15	0.00299521	0.0061	0.0	5008	,	,		16462	0.0069		0.0	False		,,,				2504	0.0				p.R30K		.											.	TPPP-90	1	Substitution - Missense(1)	prostate(1)	c.G89A						.						14.0	17.0	16.0					5																	678087		2199	4295	6494	SO:0001583	missense	11076	exon2			GACAGCCTCTTGG	AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.89G>A	5.37:g.678087C>T	ENSP00000353785:p.Arg30Lys	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	18	2	NM_007030	0	0	4	4	0		Missense_Mutation	SNP	ENST00000360578.5	37	CCDS3856.1	.	.	.	.	.	.	.	.	.	.	c	14.67	2.605282	0.46423	.	.	ENSG00000171368	ENST00000360578	T	0.45276	0.9	5.23	5.23	0.72850	.	0.149935	0.44902	D	0.000407	T	0.29588	0.0738	L	0.29908	0.895	0.44635	D	0.997618	B	0.15141	0.012	B	0.13407	0.009	T	0.11867	-1.0570	10	0.05436	T	0.98	-54.1656	16.5545	0.84482	0.0:1.0:0.0:0.0	.	30	O94811	TPPP_HUMAN	K	30	ENSP00000353785:R30K	ENSP00000353785:R30K	R	-	2	0	TPPP	731087	1.000000	0.71417	0.998000	0.56505	0.405000	0.30901	4.081000	0.57627	2.437000	0.82529	0.491000	0.48974	AGG	.		0.677	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253645.3	NM_007030	
MAST4	375449	broad.mit.edu	37	5	66432487	66432487	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr5:66432487G>A	ENST00000403625.2	+	19	2784	c.2489G>A	c.(2488-2490)gGa>gAa	p.G830E	MAST4_ENST00000404260.3_Missense_Mutation_p.G833E|MAST4_ENST00000261569.7_Missense_Mutation_p.G636E|MAST4_ENST00000403666.1_Missense_Mutation_p.G641E|MAST4_ENST00000405643.1_Missense_Mutation_p.G651E	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	833	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		GAGAGGCTGGGAACAGGTTAG	0.453																																					p.G830E													.	MAST4-647	0			c.G2489A						.						43.0	42.0	42.0					5																	66432487		1851	4099	5950	SO:0001583	missense	375449	exon19			GGCTGGGAACAGG	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2489G>A	5.37:g.66432487G>A	ENSP00000385727:p.Gly830Glu	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	16	3	NM_001164664	0	0	0	0	0	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	G	34	5.313789	0.95655	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64875	0.2638	M	0.93808	3.46	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.998	T	0.73649	-0.3916	10	0.87932	D	0	-20.4931	20.0784	0.97758	0.0:0.0:1.0:0.0	.	651;833;636;641	E7EWQ5;O15021;O15021-2;O15021-3	.;MAST4_HUMAN;.;.	E	833;830;641;651;651;636;636	ENSP00000385048:G833E;ENSP00000385727:G830E;ENSP00000384313:G641E;ENSP00000384099:G651E;ENSP00000261569:G636E	ENSP00000261569:G636E	G	+	2	0	MAST4	66468243	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.756000	0.98918	2.736000	0.93811	0.655000	0.94253	GGA	.		0.453	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
GPR98	84059	broad.mit.edu	37	5	90136585	90136585	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr5:90136585A>G	ENST00000405460.2	+	78	16898	c.16802A>G	c.(16801-16803)gAc>gGc	p.D5601G	GPR98_ENST00000425867.2_Missense_Mutation_p.D1262G	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5601					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTCCTTTTTGACCCAAAAGGT	0.458																																					p.D5601G													.	GPR98-103	0			c.A16802G						.						149.0	145.0	146.0					5																	90136585		1880	4129	6009	SO:0001583	missense	84059	exon78			TTTTTGACCCAAA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.16802A>G	5.37:g.90136585A>G	ENSP00000384582:p.Asp5601Gly	Somatic	233	0		WXS	Illumina HiSeq	Phase_I	220	3	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	14.15	2.449278	0.43531	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.27557	1.66;1.66	6.16	3.76	0.43208	.	0.279017	0.45606	N	0.000341	T	0.26085	0.0636	M	0.62723	1.935	0.37331	D	0.909999	P;B;P	0.40794	0.61;0.003;0.729	B;B;B	0.35770	0.104;0.002;0.21	T	0.12811	-1.0533	9	.	.	.	.	6.9375	0.24474	0.7429:0.1272:0.1299:0.0	.	1262;5601;1262	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	G	5601;5601;1262	ENSP00000384582:D5601G;ENSP00000392618:D1262G	.	D	+	2	0	GPR98	90172341	0.984000	0.35163	0.988000	0.46212	0.993000	0.82548	1.951000	0.40333	0.548000	0.28955	0.528000	0.53228	GAC	.		0.458	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
PCDHA9	9752	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140229899	140229899	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr5:140229899C>T	ENST00000532602.1	+	1	2852	c.1819C>T	c.(1819-1821)Ctt>Ttt	p.L607F	PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.L607F	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	607	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACGCGTGGCTTTCATACGA	0.672																																					p.L607F	Melanoma(55;1800 1972 14909)	.											.	PCDHA9-138	0			c.C1819T						.						64.0	70.0	68.0					5																	140229899		2196	4268	6464	SO:0001583	missense	9752	exon1			GCGTGGCTTTCAT	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1819C>T	5.37:g.140229899C>T	ENSP00000436042:p.Leu607Phe	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	110	9	NM_031857	0	0	1	1	0	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.518012	0.44763	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.53640	0.61;0.61	3.36	3.36	0.38483	Cadherin (4);Cadherin-like (1);	0.000000	0.26156	U	0.026019	T	0.70544	0.3236	M	0.89478	3.035	0.28601	N	0.909177	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	T	0.66756	-0.5843	10	0.87932	D	0	.	11.3375	0.49513	0.0:0.8154:0.1846:0.0	.	607;607	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	F	607	ENSP00000436042:L607F;ENSP00000367362:L607F	ENSP00000367362:L607F	L	+	1	0	PCDHA9	140210083	0.962000	0.33011	1.000000	0.80357	0.276000	0.26787	0.080000	0.14802	1.839000	0.53478	0.313000	0.20887	CTT	.		0.672	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
MICB	4277	broad.mit.edu	37	6	31473399	31473399	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr6:31473399C>T	ENST00000252229.6	+	2	155	c.76C>T	c.(76-78)Cac>Tac	p.H26Y	MICB_ENST00000538442.1_5'UTR|MICB_ENST00000399150.3_Missense_Mutation_p.H26Y	NM_005931.3	NP_005922.2			MHC class I polypeptide-related sequence B											NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	13						CCCAGAGCCCCACAGTCTTCG	0.522																																					p.H26Y													.	MICB-90	0			c.C76T						.						80.0	82.0	81.0					6																	31473399		1254	2547	3801	SO:0001583	missense	4277	exon2			GAGCCCCACAGTC		CCDS43449.1, CCDS75422.1, CCDS75423.1	6p21.3	2013-01-11			ENSG00000204516	ENSG00000204516		"""Immunoglobulin superfamily / C1-set domain containing"""	7091	protein-coding gene	gene with protein product		602436				8022771	Standard	NM_005931		Approved	PERB11.2	uc003ntn.4	Q29980	OTTHUMG00000031074	ENST00000252229.6:c.76C>T	6.37:g.31473399C>T	ENSP00000252229:p.His26Tyr	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	88	3	NM_005931	0	0	0	0	0		Missense_Mutation	SNP	ENST00000252229.6	37	CCDS43449.1	.	.	.	.	.	.	.	.	.	.	N	12.80	2.046132	0.36085	.	.	ENSG00000204516	ENST00000399150;ENST00000252229	T;T	0.10099	2.91;2.91	2.68	1.79	0.24919	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.416002	0.17505	U	0.171837	T	0.22044	0.0531	M	0.92923	3.36	0.09310	N	0.999995	D;D	0.89917	0.998;1.0	D;D	0.87578	0.997;0.998	T	0.04281	-1.0963	10	0.87932	D	0	.	5.4307	0.16452	0.0:0.8319:0.0:0.168	.	26;26	A2AC57;Q29980	.;MICB_HUMAN	Y	26	ENSP00000382103:H26Y;ENSP00000252229:H26Y	ENSP00000252229:H26Y	H	+	1	0	MICB	31581378	0.001000	0.12720	0.001000	0.08648	0.053000	0.15095	1.117000	0.31234	0.462000	0.27095	0.305000	0.20034	CAC	.		0.522	MICB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076102.3	NM_005931	
SAMD9L	219285	broad.mit.edu;bcgsc.ca	37	7	92763422	92763422	+	Silent	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr7:92763422G>A	ENST00000318238.4	-	5	3079	c.1863C>T	c.(1861-1863)atC>atT	p.I621I	SAMD9L_ENST00000411955.1_Silent_p.I621I|SAMD9L_ENST00000437805.1_Silent_p.I621I	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	621					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TTAGTTTAAGGATAGTGCTGT	0.383																																					p.I621I													.	SAMD9L-94	0			c.C1863T						.						102.0	104.0	104.0					7																	92763422		2203	4300	6503	SO:0001819	synonymous_variant	219285	exon5			TTTAAGGATAGTG	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.1863C>T	7.37:g.92763422G>A		Somatic	268	0		WXS	Illumina HiSeq	Phase_I	314	10	NM_152703	0	0	4	4	0	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Silent	SNP	ENST00000318238.4	37	CCDS34681.1																																																																																			.		0.383	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703	
CFTR	1080	broad.mit.edu	37	7	117235098	117235098	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr7:117235098A>G	ENST00000003084.6	+	15	2737	c.2605A>G	c.(2605-2607)Att>Gtt	p.I869V	CFTR_ENST00000454343.1_Missense_Mutation_p.I808V	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	869	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GTGCTTAGTAATTTTTCTGGC	0.333									Cystic Fibrosis																												p.I869V													.	CFTR-518	0			c.A2605G						.						123.0	115.0	118.0					7																	117235098		2203	4300	6503	SO:0001583	missense	1080	exon15	Familial Cancer Database	CF	TTAGTAATTTTTC	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.2605A>G	7.37:g.117235098A>G	ENSP00000003084:p.Ile869Val	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	133	4	NM_000492	0	0	21	25	4	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	A	4.036	0.004297	0.07866	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.94537	-3.45;-3.45;-3.45	5.58	-7.53	0.01336	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.336013	0.35436	N	0.003211	D	0.85557	0.5724	N	0.21373	0.66	0.21105	N	0.999783	B	0.06786	0.001	B	0.12156	0.007	T	0.66838	-0.5822	10	0.07813	T	0.8	-3.3811	16.9272	0.86179	0.4584:0.0:0.5416:0.0	.	869	P13569	CFTR_HUMAN	V	869;808;839	ENSP00000003084:I869V;ENSP00000403677:I808V;ENSP00000389119:I839V	ENSP00000003084:I869V	I	+	1	0	CFTR	117022334	0.001000	0.12720	0.001000	0.08648	0.622000	0.37654	-0.007000	0.12810	-1.600000	0.01603	0.482000	0.46254	ATT	.		0.333	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
SLC4A2	6522	hgsc.bcm.edu	37	7	150763663	150763663	+	Missense_Mutation	SNP	G	G	C	rs201747636	byFrequency	TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr7:150763663G>C	ENST00000485713.1	+	6	1678	c.638G>C	c.(637-639)gGt>gCt	p.G213A	SLC4A2_ENST00000310317.5_Missense_Mutation_p.G131A|SLC4A2_ENST00000413384.2_Missense_Mutation_p.G213A|SLC4A2_ENST00000392826.2_Missense_Mutation_p.G204A|SLC4A2_ENST00000461735.1_Missense_Mutation_p.G199A	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	213	Pro-rich.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACTGCAGGGGGTGACGACGGG	0.697													G|||	10	0.00199681	0.0076	0.0	5008	,	,		13416	0.0		0.0	False		,,,				2504	0.0				p.G213A		.											.	SLC4A2-90	0			c.G638C						.						7.0	8.0	8.0					7																	150763663		1967	3832	5799	SO:0001583	missense	6522	exon6			CAGGGGGTGACGA		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.638G>C	7.37:g.150763663G>C	ENSP00000419412:p.Gly213Ala	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	4	2	NM_003040	0	0	0	18	18	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	37	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	G	4.212	0.038073	0.08148	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.74842	-0.86;-0.86;-0.88;-0.85;-0.85	5.01	5.01	0.66863	.	0.393001	0.25777	N	0.028380	T	0.53222	0.1783	N	0.12182	0.205	0.25695	N	0.985641	P;P;P	0.45044	0.849;0.849;0.765	B;B;B	0.39465	0.3;0.3;0.157	T	0.48647	-0.9017	10	0.08837	T	0.75	.	13.7564	0.62940	0.0:0.0:1.0:0.0	.	204;199;213	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	A	213;213;131;204;199	ENSP00000419412:G213A;ENSP00000405600:G213A;ENSP00000311402:G131A;ENSP00000376571:G204A;ENSP00000419164:G199A	ENSP00000311402:G131A	G	+	2	0	SLC4A2	150394596	0.735000	0.28153	0.465000	0.27155	0.473000	0.32948	0.923000	0.28757	2.615000	0.88500	0.558000	0.71614	GGT	.		0.697	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
TMEM2	23670	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	74300679	74300679	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr9:74300679G>C	ENST00000377044.4	-	23	4474	c.3935C>G	c.(3934-3936)cCa>cGa	p.P1312R	TMEM2_ENST00000377066.5_Missense_Mutation_p.P1249R|TMEM2_ENST00000396272.3_Missense_Mutation_p.P305R	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1312					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		AAGATGAGCTGGTTTGGCTAA	0.373																																					p.P1312R		.											.	TMEM2-92	0			c.C3935G						.						115.0	107.0	110.0					9																	74300679		2203	4300	6503	SO:0001583	missense	23670	exon23			TGAGCTGGTTTGG		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3935C>G	9.37:g.74300679G>C	ENSP00000366243:p.Pro1312Arg	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	106	8	NM_013390	0	0	30	32	2	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553987	0.65425	.	.	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000396272	T;T;T	0.73469	-0.75;-0.68;2.49	5.78	5.78	0.91487	.	0.109175	0.64402	D	0.000005	T	0.78842	0.4347	M	0.61703	1.905	0.48087	D	0.999587	P;P	0.47604	0.836;0.898	B;P	0.47299	0.342;0.543	T	0.79548	-0.1758	10	0.52906	T	0.07	.	19.6126	0.95616	0.0:0.0:1.0:0.0	.	1312;1249	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	R	1312;1249;305	ENSP00000366243:P1312R;ENSP00000366266:P1249R;ENSP00000379569:P305R	ENSP00000366243:P1312R	P	-	2	0	TMEM2	73490499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.685000	0.74543	2.730000	0.93505	0.650000	0.86243	CCA	.		0.373	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
CORO2A	7464	broad.mit.edu	37	9	100899870	100899870	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr9:100899870C>A	ENST00000343933.5	-	3	559	c.302G>T	c.(301-303)tGt>tTt	p.C101F	CORO2A_ENST00000375077.4_Missense_Mutation_p.C101F	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	101					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)			endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				ATCTTCAGAACAGGAGGCGAT	0.542																																					p.C101F													.	CORO2A-230	0			c.G302T						.						134.0	132.0	133.0					9																	100899870		2203	4300	6503	SO:0001583	missense	7464	exon3			TCAGAACAGGAGG	U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.302G>T	9.37:g.100899870C>A	ENSP00000343746:p.Cys101Phe	Somatic	243	0		WXS	Illumina HiSeq	Phase_I	222	4	NM_003389	0	0	13	13	0	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	ENST00000343933.5	37	CCDS6735.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.418670	0.62622	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.61274	0.12;0.12	4.58	3.67	0.42095	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.092083	0.85682	D	0.000000	T	0.73659	0.3615	M	0.76574	2.34	0.80722	D	1	P	0.52577	0.954	D	0.67900	0.954	T	0.77550	-0.2546	10	0.72032	D	0.01	-0.9345	13.889	0.63726	0.0:0.8456:0.1544:0.0	.	101	Q92828	COR2A_HUMAN	F	101	ENSP00000343746:C101F;ENSP00000364218:C101F	ENSP00000343746:C101F	C	-	2	0	CORO2A	99939691	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	5.740000	0.68629	1.254000	0.44035	0.561000	0.74099	TGT	.		0.542	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053357.1	NM_003389	
CNGA2	1260	broad.mit.edu	37	X	150911739	150911739	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chrX:150911739G>A	ENST00000329903.4	+	6	797	c.764G>A	c.(763-765)cGc>cAc	p.R255H		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	255					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.R255H(1)		breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					CACTTTGCCCGCATGTTTGAG	0.527																																					p.R255H													.	CNGA2-193	1	Substitution - Missense(1)	endometrium(1)	c.G764A						.						179.0	137.0	151.0					X																	150911739		2203	4300	6503	SO:0001583	missense	1260	exon7			TTGCCCGCATGTT	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.764G>A	X.37:g.150911739G>A	ENSP00000328478:p.Arg255His	Somatic	177	0		WXS	Illumina HiSeq	Phase_I	206	5	NM_005140	0	0	0	0	0	A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260930	0.80246	.	.	ENSG00000183862	ENST00000329903	D	0.99519	-6.07	5.49	5.49	0.81192	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99739	0.9897	H	0.98005	4.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97103	0.9799	10	0.87932	D	0	.	15.6554	0.77129	0.0:0.0:1.0:0.0	.	255	Q16280	CNGA2_HUMAN	H	255	ENSP00000328478:R255H	ENSP00000328478:R255H	R	+	2	0	CNGA2	150662395	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.644000	0.83416	2.293000	0.77203	0.600000	0.82982	CGC	.		0.527	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
NLGN4Y	22829	hgsc.bcm.edu	37	Y	16952767	16952767	+	3'UTR	SNP	C	C	T	rs373089425		TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chrY:16952767C>T	ENST00000476359.1	+	0	2621							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.A692A(1)		large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						ACATCTTAGCCTTTGCGGCGC	0.502																																					p.A692A		.											.	.	1	Substitution - coding silent(1)	prostate(1)	c.C2076T						.	C	,	0,571		0,571	53.0	72.0	66.0		1572,2076	-3.8	0.0	Y		66	1,1871		1,1871	no	coding-synonymous,coding-synonymous	NLGN4Y	NM_001206850.1,NM_014893.4	,	1,2442	T,C		0.0534,0.0,0.0409	,	524/649,692/817	16952767	1,2442	974	2291	3265	SO:0001624	3_prime_UTR_variant	22829	exon6			CTTAGCCTTTGCG		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*2618C>T	Y.37:g.16952767C>T		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	5	5	NM_014893	0	0	0	0	0	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Silent	SNP	ENST00000476359.1	37																																																																																				.		0.502	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893	
CERS3	204219	broad.mit.edu;bcgsc.ca	37	15	101013174	101013174	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr15:101013174delC	ENST00000394113.1	-	11	1383	c.693delG	c.(691-693)gggfs	p.G231fs	CERS3_ENST00000538112.2_Frame_Shift_Del_p.G231fs|CERS3_ENST00000560944.1_Intron|CERS3_ENST00000284382.4_Frame_Shift_Del_p.G231fs			Q8IU89	CERS3_HUMAN	ceramide synthase 3	231	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										TCACGAGGGTCCCACTGCGAA	0.433																																					p.G231fs													.	.	0			c.693delG						.						118.0	101.0	107.0					15																	101013174		2203	4300	6503	SO:0001589	frameshift_variant	204219	exon10			GAGGGTCCCACTG		CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.693delG	15.37:g.101013174delC	ENSP00000377672:p.Gly231fs	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	124	17	NM_178842	0	0	0	0	0	Q8NE64|Q8NEN6	Frame_Shift_Del	DEL	ENST00000394113.1	37	CCDS10384.1																																																																																			.		0.433	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842	
CYB5D2	124936	bcgsc.ca	37	17	4058011	4058021	+	Frame_Shift_Del	DEL	CCCGGCACTGA	CCCGGCACTGA	-	rs367926129		TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	CCCGGCACTGA	CCCGGCACTGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr17:4058011_4058021delCCCGGCACTGA	ENST00000301391.3	+	3	935_945	c.435_445delCCCGGCACTGA	c.(433-447)accccggcactgaccfs	p.TPALT145fs	CYB5D2_ENST00000575251.1_Frame_Shift_Del_p.TPALT33fs|CYB5D2_ENST00000573984.1_Frame_Shift_Del_p.TPALT33fs|CYB5D2_ENST00000575411.2_3'UTR	NM_144611.3	NP_653212.1	Q8WUJ1	NEUFC_HUMAN	cytochrome b5 domain containing 2	145					nervous system development (GO:0007399)	extracellular region (GO:0005576)	heme binding (GO:0020037)			breast(1)|large_intestine(3)|liver(2)|ovary(1)	7						GGCTGCCCACCCCGGCACTGACCCAGGTAGA	0.592																																					p.145_149del													.	CYB5D2-155	0			c.435_445del						.																																			SO:0001589	frameshift_variant	124936	exon3			GCCCACCCCGGCA	AK172844	CCDS11044.1, CCDS58501.1	17p13.2	2006-03-10							28471	protein-coding gene	gene with protein product							Standard	NM_144611		Approved	MGC32124	uc002fxm.4	Q8WUJ1		ENST00000301391.3:c.435_445delCCCGGCACTGA	17.37:g.4058011_4058021delCCCGGCACTGA	ENSP00000301391:p.Thr145fs	Somatic	80	0		WXS	Illumina HiSeq	Phase_1	77	3	NM_144611	0	0	0	0	0	B2R7R6|D3DTJ9|I3L1K2	Frame_Shift_Del	DEL	ENST00000301391.3	37	CCDS11044.1																																																																																			.		0.592	CYB5D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438698.1	NM_144611	
ADCY8	114	broad.mit.edu;bcgsc.ca	37	8	131916171	131916174	+	Frame_Shift_Del	DEL	TAAG	TAAG	-			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	TAAG	TAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr8:131916171_131916174delTAAG	ENST00000286355.5	-	7	3847_3850	c.1755_1758delCTTA	c.(1753-1758)tacttafs	p.YL585fs	ADCY8_ENST00000377928.3_Frame_Shift_Del_p.YL585fs	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	585					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCTGCTTAATTAAGTAAGTTTCGA	0.49										HNSCC(32;0.087)																											p.585_586del													.	ADCY8-157	0			c.1755_1758del						.																																			SO:0001589	frameshift_variant	114	exon7			CTTAATTAAGTAA	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1755_1758delCTTA	8.37:g.131916175_131916178delTAAG	ENSP00000286355:p.Tyr585fs	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	205	22	NM_001115	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000286355.5	37	CCDS6363.1																																																																																			.		0.490	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
XBP1	7494	broad.mit.edu	37	22	29196498	29196499	+	In_Frame_Ins	INS	-	-	GCC	rs528996789	byFrequency	TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr22:29196498_29196499insGCC	ENST00000216037.6	-	1	86_87	c.14_15insGGC	c.(13-15)gca>gcGGCa	p.5_5A>AA	XBP1_ENST00000405219.3_5'Flank|CTA-292E10.6_ENST00000451486.1_RNA|CTA-292E10.6_ENST00000458080.1_RNA|CTA-292E10.6_ENST00000418292.1_RNA|CTA-292E10.6_ENST00000585003.1_RNA|XBP1_ENST00000344347.5_In_Frame_Ins_p.5_5A>AA|XBP1_ENST00000403532.3_In_Frame_Ins_p.5_5A>AA	NM_001079539.1|NM_005080.3	NP_001073007.1|NP_005071.2	P17861	XBP1_HUMAN	X-box binding protein 1	5					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial cell maturation involved in salivary gland development (GO:0060691)|exocrine pancreas development (GO:0031017)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|serotonin secretion, neurotransmission (GO:0060096)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(1)|lung(1)	5						TCGGCGCGGCTGCCACCACCAC	0.762																																					p.A5delinsAA													.	XBP1-290	0			c.15_16insGGC						.		,	24,1974		9,6,984					,	1.1	1.0			2	13,4915		3,7,2454	no	coding,coding	XBP1	NM_005080.3,NM_001079539.1	,	12,13,3438	A1A1,A1R,RR		0.2638,1.2012,0.5342	,	,		37,6889				SO:0001652	inframe_insertion	7494	exon1			CGCGGCTGCCACC	M31627	CCDS13847.1	22q12.1	2013-01-10			ENSG00000100219	ENSG00000100219		"""basic leucine zipper proteins"""	12801	protein-coding gene	gene with protein product		194355		XBP2		1718857, 2196176	Standard	NM_001079539		Approved		uc003aec.3	P17861	OTTHUMG00000151094	ENST00000216037.6:c.12_14dupGGC	22.37:g.29196499_29196501dupGCC	ENSP00000216037:p.Ala7dup	Somatic	4	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_001079539	0	0	0	0	0	Q8WYK6|Q969P1|Q96BD7	In_Frame_Ins	INS	ENST00000216037.6	37	CCDS13847.1																																																																																			.		0.762	XBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321274.1	NM_005080	
AR	367	hgsc.bcm.edu	37	X	66765195	66765196	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chrX:66765195_66765196GC>AG	ENST00000374690.3	+	1	731_732	c.207_208GC>AG	c.(205-210)caGCag>caAGag	p.Q70E	AR_ENST00000396044.3_Missense_Mutation_p.Q70E|AR_ENST00000504326.1_Missense_Mutation_p.Q70E|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	70	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	agcagcagcagcagcagcagca	0.678									Androgen Insensitivity Syndrome																												p.Q70E		.											.	AR	0			c.C208G						.																																			SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	CAGCAGCAGCAGC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	Exception_encountered	X.37:g.66765195_66765196delinsAG	ENSP00000363822:p.Gln70Glu	Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	4.0		0	0	0	0	0	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	DNP	ENST00000374690.3	37	CCDS14387.1																																																																																			.		0.678	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
CLCNKA	1187	ucsc.edu	37	1	16356252	16356253	+	Missense_Mutation	DNP	CA	CA	TG	rs201976704|rs200828311		TCGA-BQ-5883-01A-11D-1589-08	TCGA-BQ-5883-11A-01D-1589-08	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	6c69acfc-a1cb-443f-b402-13ee50da93b7	517cb40d-9cef-49ff-a7ce-5b9c539c2b09	g.chr1:16356252_16356253CA>TG	ENST00000331433.4	+	13	1273_1274	c.1254_1255CA>TG	c.(1252-1257)acCAtc>acTGtc	p.I419V	CLCNKA_ENST00000375692.1_Missense_Mutation_p.I419V|CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000439316.2_Missense_Mutation_p.I376V|CLCNKA_ENST00000420078.1_Missense_Mutation_p.I419V			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	419					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	TGGCCACCACCATCCCCATGCC	0.589																																					p.I419V													.	CLCNKA-91	0			c.A1255G						.																																			SO:0001583	missense	1187	exon13			ACCACCATCCCCA		CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	Exception_encountered	1.37:g.16356252_16356253delinsTG	ENSP00000332771:p.Ile419Val	Somatic	250	3		WXS	Illumina HiSeq		253	2	NM_004070	0	0	0	0	0	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	DNP	ENST00000331433.4	37	CCDS167.1																																																																																			A|0.999;G|0.001		0.589	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1		
