#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RERE	473	broad.mit.edu;bcgsc.ca	37	1	8420197	8420197	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr1:8420197G>C	ENST00000337907.3	-	19	4004	c.3370C>G	c.(3370-3372)Ccc>Gcc	p.P1124A	RERE_ENST00000476556.1_Missense_Mutation_p.P570A|RERE_ENST00000400908.2_Missense_Mutation_p.P1124A|RERE_ENST00000400907.2_Intron|RERE_ENST00000377464.1_Missense_Mutation_p.P856A	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	1124					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GCGTGACTGGGGGTGTCCACC	0.682																																					p.P1124A													.	RERE-515	0			c.C3370G						.						8.0	9.0	9.0					1																	8420197		2152	4188	6340	SO:0001583	missense	473	exon19			GACTGGGGGTGTC	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.3370C>G	1.37:g.8420197G>C	ENSP00000338629:p.Pro1124Ala	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	18	5	NM_012102	0	0	0	0	0	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	37	CCDS95.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124291	0.56613	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908	T;T;T;T	0.48836	0.8;0.81;0.99;0.8	5.56	5.56	0.83823	.	.	.	.	.	T	0.59770	0.2218	M	0.62016	1.91	0.80722	D	1	P;P	0.39883	0.693;0.56	P;P	0.49561	0.615;0.615	T	0.58211	-0.7676	9	0.46703	T	0.11	-25.6856	18.0981	0.89497	0.0:0.0:1.0:0.0	.	856;1124	B1AKN3;Q9P2R6	.;RERE_HUMAN	A	1124;856;570;1124	ENSP00000338629:P1124A;ENSP00000366684:P856A;ENSP00000422246:P570A;ENSP00000383700:P1124A	ENSP00000338629:P1124A	P	-	1	0	RERE	8342784	1.000000	0.71417	1.000000	0.80357	0.079000	0.17450	9.718000	0.98758	2.601000	0.87937	0.655000	0.94253	CCC	.		0.682	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
AIM1L	55057	broad.mit.edu	37	1	26671979	26671979	+	5'Flank	SNP	A	A	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr1:26671979A>T	ENST00000308182.5	-	0	0				AIM1L_ENST00000527815.1_5'Flank|RN7SL490P_ENST00000579210.1_RNA			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like								carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		CCTTTTTTTTAGGGGGCAGAA	0.642																																					p.P390P													.	AIM1L-91	0			c.T1170A						.						20.0	24.0	22.0					1																	26671979		1836	4086	5922	SO:0001631	upstream_gene_variant	55057	exon2			TTTTTTAGGGGGC			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490		1.37:g.26671979A>T	Exception_encountered	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	56	4	NM_001039775	0	0	0	0	0	B2RNG3|Q5T137|Q5T150	Silent	SNP	ENST00000308182.5	37		.	.	.	.	.	.	.	.	.	.	A	0.001	-84.298879	0.00000	.	.	ENSG00000176092	ENST00000538018	.	.	.	4.58	-2.23	0.06930	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4944	0.11830	0.4319:0.0:0.4062:0.1619	.	.	.	.	.	-1	.	.	.	-	.	.	AIM1L	26544566	0.023000	0.18921	0.002000	0.10522	0.015000	0.08874	-0.001000	0.12947	-0.247000	0.09597	-0.250000	0.11733	.	.		0.642	AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2	
COL11A1	1301	broad.mit.edu	37	1	103428308	103428308	+	Silent	SNP	G	G	A	rs369136682		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr1:103428308G>A	ENST00000370096.3	-	39	3237	c.2925C>T	c.(2923-2925)acC>acT	p.T975T	COL11A1_ENST00000358392.2_Silent_p.T987T|COL11A1_ENST00000353414.4_Silent_p.T936T|COL11A1_ENST00000512756.1_Silent_p.T859T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	975	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CAGTCTCACCGGTTGGTCCCT	0.438																																					p.T987T													.	COL11A1-586	0			c.C2961T						.	G	,,,	0,4406		0,0,2203	77.0	75.0	75.0		2808,2925,2961,2577	1.8	1.0	1		75	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	COL11A1	NM_001190709.1,NM_001854.3,NM_080629.2,NM_080630.3	,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,	936/1768,975/1807,987/1819,859/1691	103428308	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1301	exon39			CTCACCGGTTGGT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2925C>T	1.37:g.103428308G>A		Somatic	138	0		WXS	Illumina HiSeq	Phase_I	129	4	NM_080629	0	0	0	0	0	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	CCDS778.1																																																																																			.		0.438	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
SLC6A17	388662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110709565	110709565	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr1:110709565G>A	ENST00000331565.4	+	2	499	c.14G>A	c.(13-15)aGc>aAc	p.S5N	RP5-1028L10.1_ENST00000430098.1_RNA|RP5-1028L10.1_ENST00000443008.1_RNA|RP5-1028L10.1_ENST00000418579.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	5					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		CCGAAGAACAGCAAAGTGACC	0.577																																					p.S5N		.											.	SLC6A17-92	0			c.G14A						.						54.0	49.0	51.0					1																	110709565		2203	4300	6503	SO:0001583	missense	388662	exon2			AGAACAGCAAAGT		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.14G>A	1.37:g.110709565G>A	ENSP00000330199:p.Ser5Asn	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	45	11	NM_001010898	0	0	0	0	0	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201454	0.79015	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.75938	-0.98	4.31	4.31	0.51392	.	0.091130	0.64402	D	0.000001	T	0.71921	0.3397	M	0.67397	2.05	0.44834	D	0.997843	P	0.42203	0.773	P	0.46208	0.507	T	0.76203	-0.3045	10	0.51188	T	0.08	.	16.9598	0.86269	0.0:0.0:1.0:0.0	.	5	Q9H1V8	S6A17_HUMAN	N	5	ENSP00000330199:S5N	ENSP00000330199:S5N	S	+	2	0	SLC6A17	110511088	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.350000	0.59392	2.221000	0.72209	0.563000	0.77884	AGC	.		0.577	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
ELF3	1999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201984378	201984378	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr1:201984378G>C	ENST00000359651.3	+	8	4235	c.1043G>C	c.(1042-1044)cGg>cCg	p.R348P	ELF3_ENST00000367283.3_Missense_Mutation_p.R348P|ELF3_ENST00000367284.5_Missense_Mutation_p.R348P|RP11-510N19.5_ENST00000504773.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GTGGATGGCCGGCGACTCGTC	0.557																																					p.R348P		.											.	ELF3-226	0			c.G1043C						.						84.0	86.0	85.0					1																	201984378		2203	4300	6503	SO:0001583	missense	1999	exon9			ATGGCCGGCGACT	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.1043G>C	1.37:g.201984378G>C	ENSP00000352673:p.Arg348Pro	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	69	15	NM_001114309	0	0	0	0	0		Missense_Mutation	SNP	ENST00000359651.3	37	CCDS1419.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878405	0.91740	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044	T;T;T	0.15372	2.43;2.43;2.43	4.61	4.61	0.57282	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.64402	D	0.000001	T	0.48241	0.1489	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.57877	-0.7735	10	0.87932	D	0	.	16.4352	0.83873	0.0:0.0:1.0:0.0	.	348	P78545	ELF3_HUMAN	P	348;348;348;325	ENSP00000352673:R348P;ENSP00000356253:R348P;ENSP00000356252:R348P	ENSP00000311348:R325P	R	+	2	0	ELF3	200251001	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.616000	0.98359	2.421000	0.82119	0.555000	0.69702	CGG	.		0.557	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
CAPN9	10753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	230883264	230883264	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr1:230883264C>G	ENST00000271971.2	+	1	135	c.22C>G	c.(22-24)Cca>Gca	p.P8A	CAPN9_ENST00000354537.1_Missense_Mutation_p.P8A|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000366666.2_Missense_Mutation_p.P8A	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	8					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				CTACCGGGCCCCAGGGCCTCA	0.622																																					p.P8A		.											.	CAPN9-91	0			c.C22G						.						57.0	64.0	62.0					1																	230883264		2203	4300	6503	SO:0001583	missense	10753	exon1			CGGGCCCCAGGGC	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.22C>G	1.37:g.230883264C>G	ENSP00000271971:p.Pro8Ala	Somatic	151	1		WXS	Illumina HiSeq	Phase_I	150	45	NM_006615	0	0	0	0	0	B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	37	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	C	6.007	0.369759	0.11352	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	T;T;T	0.48201	0.82;0.82;0.82	5.29	-0.727	0.11166	.	0.460979	0.25055	N	0.033497	T	0.21427	0.0516	N	0.24115	0.695	0.09310	N	1	B;B;B	0.10296	0.0;0.003;0.002	B;B;B	0.12837	0.001;0.008;0.004	T	0.17961	-1.0352	10	0.07175	T	0.84	.	2.0222	0.03511	0.1248:0.3314:0.123:0.4207	.	8;8;8	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	A	8	ENSP00000271971:P8A;ENSP00000346538:P8A;ENSP00000355626:P8A	ENSP00000271971:P8A	P	+	1	0	CAPN9	228949887	0.006000	0.16342	0.000000	0.03702	0.121000	0.20230	-0.053000	0.11846	-0.465000	0.06953	0.655000	0.94253	CCA	.		0.622	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615	
C10orf54	64115	broad.mit.edu	37	10	73521465	73521465	+	Missense_Mutation	SNP	C	C	T	rs200235042	byFrequency	TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr10:73521465C>T	ENST00000394957.3	-	2	459	c.401G>A	c.(400-402)cGc>cAc	p.R134H	C10orf54_ENST00000481568.2_5'UTR|CDH23_ENST00000224721.6_Intron	NM_022153.1	NP_071436.1	Q9H7M9	GI24_HUMAN	chromosome 10 open reading frame 54	134	Ig-like.				BMP signaling pathway (GO:0030509)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of T cell cytokine production (GO:0002725)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of stem cell differentiation (GO:2000738)|stem cell differentiation (GO:0048863)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	9						GGTCAGGTTGCGCATGGTGAT	0.647													C|||	2	0.000399361	0.0	0.0	5008	,	,		22472	0.002		0.0	False		,,,				2504	0.0				p.R134H													.	C10orf54-515	0			c.G401A						.						73.0	69.0	71.0					10																	73521465		2203	4300	6503	SO:0001583	missense	64115	exon2			AGGTTGCGCATGG	AF193048	CCDS31218.1	10q22.1	2013-11-28			ENSG00000107738	ENSG00000107738		"""Immunoglobulin superfamily / V-set domain containing"""	30085	protein-coding gene	gene with protein product	"""stress induced secreted protein 1"""	615608				12975309	Standard	NM_022153		Approved	SISP1, GI24, B7-H5, B7H5	uc001jsd.3	Q9H7M9	OTTHUMG00000018426	ENST00000394957.3:c.401G>A	10.37:g.73521465C>T	ENSP00000378409:p.Arg134His	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	56	3	NM_022153	0	0	0	0	0	A1L0X9|A4ZYV1|A8MVH5|Q6UXF3|Q8WUG3|Q8WYZ8	Missense_Mutation	SNP	ENST00000394957.3	37	CCDS31218.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.53	2.562276	0.45694	.	.	ENSG00000107738	ENST00000394957;ENST00000263569	T	0.66280	-0.2	5.75	-6.8	0.01709	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.040480	0.07437	N	0.896600	T	0.35128	0.0921	N	0.17674	0.51	0.19300	N	0.999974	B;B	0.18013	0.025;0.002	B;B	0.09377	0.004;0.003	T	0.18461	-1.0336	10	0.48119	T	0.1	-0.7654	0.3776	0.00390	0.3311:0.2135:0.1402:0.3152	.	130;134	Q2TA85;Q9H7M9	.;GI24_HUMAN	H	134;130	ENSP00000378409:R134H	ENSP00000263569:R130H	R	-	2	0	C10orf54	73191471	0.000000	0.05858	0.542000	0.28115	0.970000	0.65996	-1.375000	0.02563	-1.017000	0.03367	0.655000	0.94253	CGC	C|0.999;T|0.000		0.647	C10orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048548.1	NM_022153	
C10orf62	414157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	99349694	99349694	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr10:99349694T>A	ENST00000370640.3	+	1	245	c.40T>A	c.(40-42)Tct>Act	p.S14T	PI4K2A_ENST00000370649.3_Intron|PI4K2A_ENST00000555577.1_Intron|HOGA1_ENST00000370647.4_Intron|HOGA1_ENST00000370646.4_Intron	NM_001009997.2	NP_001009997.2	Q5T681	CJ062_HUMAN	chromosome 10 open reading frame 62	14										endometrium(2)|kidney(1)|lung(1)	4		Colorectal(252;0.162)		Epithelial(162;9.58e-11)|all cancers(201;8.62e-09)		AAAGGAAACCTCTGAGTGTCC	0.502																																					p.S14T		.											.	C10orf62-90	0			c.T40A						.						100.0	100.0	100.0					10																	99349694		2203	4300	6503	SO:0001583	missense	414157	exon1			GAAACCTCTGAGT		CCDS31261.1	10q24.2	2012-05-31			ENSG00000203942	ENSG00000203942			23294	protein-coding gene	gene with protein product							Standard	NM_001009997		Approved	bA548K23.1	uc001koa.3	Q5T681	OTTHUMG00000018858	ENST00000370640.3:c.40T>A	10.37:g.99349694T>A	ENSP00000359674:p.Ser14Thr	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	97	7	NM_001009997	0	0	0	0	0	Q49A70|Q8N3Y6	Missense_Mutation	SNP	ENST00000370640.3	37	CCDS31261.1	.	.	.	.	.	.	.	.	.	.	T	4.766	0.142421	0.09083	.	.	ENSG00000203942	ENST00000370640	T	0.42513	0.97	5.27	-10.5	0.00291	.	3.688920	0.00929	N	0.002686	T	0.15522	0.0374	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.18777	-1.0326	10	0.14656	T	0.56	.	1.8333	0.03134	0.3493:0.094:0.1283:0.4284	.	14	Q5T681	CJ062_HUMAN	T	14	ENSP00000359674:S14T	ENSP00000359674:S14T	S	+	1	0	C10orf62	99339684	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.585000	0.00903	-2.847000	0.00332	-1.294000	0.01345	TCT	.		0.502	C10orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049723.1	NM_001009997	
ST5	6764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	8751785	8751785	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:8751785G>A	ENST00000534127.1	-	6	1437	c.1052C>T	c.(1051-1053)cCc>cTc	p.P351L	ST5_ENST00000313726.6_Missense_Mutation_p.P351L|ST5_ENST00000530438.1_Intron|ST5_ENST00000526757.1_Intron|ST5_ENST00000357665.1_Missense_Mutation_p.P351L	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	351	Pro-rich.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CCTCTCTGGGGGTGGGCCCGC	0.687																																					p.P351L		.											.	ST5-227	0			c.C1052T						.						41.0	47.0	45.0					11																	8751785		2201	4296	6497	SO:0001583	missense	6764	exon6			TCTGGGGGTGGGC	U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.1052C>T	11.37:g.8751785G>A	ENSP00000433528:p.Pro351Leu	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	109	25	NM_005418	0	0	0	0	0	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	ENST00000534127.1	37	CCDS7791.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.487492	0.44249	.	.	ENSG00000166444	ENST00000534127;ENST00000313726;ENST00000357665	T;T;T	0.04809	3.55;3.55;3.55	6.17	5.27	0.74061	.	0.340768	0.28409	N	0.015455	T	0.06325	0.0163	L	0.41236	1.265	0.46798	D	0.999205	B	0.06786	0.001	B	0.06405	0.002	T	0.28808	-1.0032	10	0.33940	T	0.23	-18.7575	15.9068	0.79436	0.0643:0.0:0.9357:0.0	.	351	P78524	ST5_HUMAN	L	351	ENSP00000433528:P351L;ENSP00000319678:P351L;ENSP00000350294:P351L	ENSP00000319678:P351L	P	-	2	0	ST5	8708361	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.667000	0.61561	1.642000	0.50584	-0.123000	0.14984	CCC	.		0.687	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418	
ZNF143	7702	hgsc.bcm.edu;broad.mit.edu	37	11	9519236	9519236	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:9519236A>C	ENST00000396602.2	+	10	975	c.856A>C	c.(856-858)Agt>Cgt	p.S286R	ZNF143_ENST00000299606.2_Missense_Mutation_p.S258R|ZNF143_ENST00000530463.1_Missense_Mutation_p.S285R|ZNF143_ENST00000396597.3_Missense_Mutation_p.S255R|ZNF143_ENST00000396604.1_Missense_Mutation_p.S285R	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	286					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		TGGATTAAAAAGTCACGTCAG	0.318																																					p.S286R		.											.	ZNF143-90	0			c.A856C						.						53.0	55.0	54.0					11																	9519236		2201	4294	6495	SO:0001583	missense	7702	exon10			TTAAAAAGTCACG	U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.856A>C	11.37:g.9519236A>C	ENSP00000379847:p.Ser286Arg	Somatic	93	2		WXS	Illumina HiSeq	Phase_I	79	6	NM_003442	0	0	0	0	0	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Missense_Mutation	SNP	ENST00000396602.2	37	CCDS7799.2	.	.	.	.	.	.	.	.	.	.	A	22.0	4.227654	0.79576	.	.	ENSG00000166478	ENST00000396604;ENST00000396602;ENST00000530463;ENST00000396597;ENST00000299606	T;T;T;T;T	0.11821	2.74;2.74;2.74;2.74;2.74	5.32	5.32	0.75619	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.10551	0.0258	N	0.03967	-0.31	0.80722	D	1	P;P;P	0.48998	0.899;0.918;0.918	P;P;P	0.49387	0.571;0.609;0.609	T	0.41484	-0.9506	10	0.33940	T	0.23	.	15.2911	0.73868	1.0:0.0:0.0:0.0	.	255;285;286	P52747-2;E7ER34;P52747	.;.;ZN143_HUMAN	R	285;286;285;255;258	ENSP00000379849:S285R;ENSP00000379847:S286R;ENSP00000432154:S285R;ENSP00000379843:S255R;ENSP00000299606:S258R	ENSP00000299606:S258R	S	+	1	0	ZNF143	9475812	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.295000	0.96095	2.016000	0.59253	0.528000	0.53228	AGT	.		0.318	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
OR8H3	390152	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	55890388	55890388	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:55890388C>A	ENST00000313472.3	+	1	540	c.540C>A	c.(538-540)gaC>gaA	p.D180E		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					TTTTCTGTGACACTTCCCCAA	0.423																																					p.D180E		.											.	OR8H3-70	0			c.C540A						.						247.0	224.0	232.0					11																	55890388		2201	4296	6497	SO:0001583	missense	390152	exon1			CTGTGACACTTCC	AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.540C>A	11.37:g.55890388C>A	ENSP00000323928:p.Asp180Glu	Somatic	377	1		WXS	Illumina HiSeq	Phase_I	340	19	NM_001005201	0	0	0	0	0	Q6IFB7	Missense_Mutation	SNP	ENST00000313472.3	37	CCDS31519.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.504092	0.26949	.	.	ENSG00000181761	ENST00000313472	T	0.00048	8.82	3.62	0.503	0.16940	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000030	T	0.00271	0.0008	L	0.46885	1.475	0.09310	N	0.99999	D	0.89917	1.0	D	0.97110	1.0	T	0.52147	-0.8614	10	0.59425	D	0.04	.	4.7151	0.12891	0.1409:0.4302:0.0:0.4289	.	180	Q8N146	OR8H3_HUMAN	E	180	ENSP00000323928:D180E	ENSP00000323928:D180E	D	+	3	2	OR8H3	55646964	0.000000	0.05858	0.153000	0.22517	0.346000	0.29079	-2.727000	0.00807	-0.121000	0.11787	0.173000	0.16961	GAC	.		0.423	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201	
AHNAK	79026	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	62290316	62290316	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:62290316C>T	ENST00000378024.4	-	5	11847	c.11573G>A	c.(11572-11574)gGt>gAt	p.G3858D	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3858					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GAATTTGGGACCTTTCAACTT	0.478																																					p.G3858D		.											.	AHNAK-109	0			c.G11573A						.						196.0	202.0	200.0					11																	62290316		2202	4299	6501	SO:0001583	missense	79026	exon5			TTGGGACCTTTCA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.11573G>A	11.37:g.62290316C>T	ENSP00000367263:p.Gly3858Asp	Somatic	422	0		WXS	Illumina HiSeq	Phase_I	412	35	NM_001620	0	0	0	0	0	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	12.21	1.869769	0.33069	.	.	ENSG00000124942	ENST00000378024	T	0.03496	3.91	4.51	4.51	0.55191	.	0.000000	0.42053	D	0.000767	T	0.21227	0.0511	M	0.93594	3.435	0.46678	D	0.999153	D	0.65815	0.995	P	0.61201	0.885	T	0.41106	-0.9527	10	0.15499	T	0.54	.	17.021	0.86433	0.0:1.0:0.0:0.0	.	3858	Q09666	AHNK_HUMAN	D	3858	ENSP00000367263:G3858D	ENSP00000367263:G3858D	G	-	2	0	AHNAK	62046892	0.954000	0.32549	0.066000	0.19879	0.046000	0.14306	4.583000	0.60964	2.350000	0.79820	0.543000	0.68304	GGT	.		0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
TUT1	64852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62346405	62346405	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:62346405T>C	ENST00000476907.1	-	5	1479	c.788A>G	c.(787-789)gAt>gGt	p.D263G	TUT1_ENST00000308436.7_Missense_Mutation_p.D301G|MIR3654_ENST00000496634.2_Missense_Mutation_p.D263G			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	263	Pro-rich.				mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AGGTTGTGAATCTGGAGGGGA	0.627																																					p.D301G		.											.	TUT1-91	0			c.A902G						.						38.0	45.0	43.0					11																	62346405		2202	4299	6501	SO:0001583	missense	64852	exon5			TGTGAATCTGGAG	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.788A>G	11.37:g.62346405T>C	ENSP00000419607:p.Asp263Gly	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	70	19	NM_022830	0	0	0	0	0	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	ENST00000476907.1	37		.	.	.	.	.	.	.	.	.	.	T	10.15	1.271130	0.23221	.	.	ENSG00000149016	ENST00000308436;ENST00000476907;ENST00000278279	T;T	0.40476	1.03;1.05	4.91	2.58	0.30949	.	0.311232	0.25590	N	0.029624	T	0.29256	0.0728	L	0.36672	1.1	0.24619	N	0.993685	B	0.12013	0.005	B	0.12156	0.007	T	0.20940	-1.0260	10	0.54805	T	0.06	1.3697	5.9223	0.19088	0.0:0.2193:0.0:0.7807	.	301	F5H0R1	.	G	301;263;124	ENSP00000308000:D301G;ENSP00000419607:D263G	ENSP00000441670:D263G	D	-	2	0	TUT1	62102981	1.000000	0.71417	0.932000	0.37286	0.144000	0.21451	1.147000	0.31602	0.370000	0.24538	0.460000	0.39030	GAT	.		0.627	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000351319.2	NM_022830	
PC	5091	broad.mit.edu	37	11	66636400	66636400	+	Silent	SNP	C	C	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:66636400C>A	ENST00000393958.2	-	9	1032	c.939G>T	c.(937-939)ctG>ctT	p.L313L	PC_ENST00000393955.2_Silent_p.L313L|PC_ENST00000524491.1_Silent_p.L273L|PC_ENST00000355677.3_Silent_p.L313L|PC_ENST00000393960.1_Silent_p.L313L	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	313	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GCCTGTCCACCAGGAACTCCA	0.647																																					p.L313L													.	PC-228	0			c.G939T						.						94.0	82.0	86.0					11																	66636400		2200	4295	6495	SO:0001819	synonymous_variant	5091	exon9			GTCCACCAGGAAC	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.939G>T	11.37:g.66636400C>A		Somatic	138	0		WXS	Illumina HiSeq	Phase_I	108	4	NM_000920	0	0	0	0	0	B4DN00|Q16705	Silent	SNP	ENST00000393958.2	37	CCDS8152.1																																																																																			.		0.647	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
ARHGEF12	23365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	120336044	120336044	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:120336044G>T	ENST00000397843.2	+	28	2878	c.2712G>T	c.(2710-2712)aaG>aaT	p.K904N	ARHGEF12_ENST00000532993.1_Missense_Mutation_p.K801N|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.K885N	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	904	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GTCAGAAAAAGGATTCTCGAT	0.393			T	MLL	AML																																p.K904N		.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12-661	0			c.G2712T						.						94.0	89.0	91.0					11																	120336044		1863	4111	5974	SO:0001583	missense	23365	exon28			GAAAAAGGATTCT	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.2712G>T	11.37:g.120336044G>T	ENSP00000380942:p.Lys904Asn	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	101	30	NM_015313	0	0	0	0	0	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000713	0.74818	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.70282	-0.47;-0.47;-0.47	5.69	4.78	0.61160	Dbl homology (DH) domain (5);	0.000000	0.51477	D	0.000085	D	0.82577	0.5067	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.998;0.999	D	0.83981	0.0332	10	0.66056	D	0.02	-17.5309	10.7839	0.46395	0.1444:0.0:0.8556:0.0	.	801;885;904	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	N	904;885;801	ENSP00000380942:K904N;ENSP00000349056:K885N;ENSP00000432984:K801N	ENSP00000349056:K885N	K	+	3	2	ARHGEF12	119841254	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.679000	0.46909	1.424000	0.47217	0.650000	0.86243	AAG	.		0.393	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
ESAM	90952	hgsc.bcm.edu	37	11	124623757	124623757	+	Missense_Mutation	SNP	G	G	A	rs200154876		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr11:124623757G>A	ENST00000278927.5	-	7	1087	c.958C>T	c.(958-960)Cgg>Tgg	p.R320W	VSIG2_ENST00000326621.5_5'Flank|VSIG2_ENST00000403470.1_5'Flank|ESAM_ENST00000442070.2_Intron	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	320					blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		TGGGGTGGCCGGAGGGCTCGT	0.662																																					p.R320W		.											.	ESAM-90	0			c.C958T						.						63.0	73.0	70.0					11																	124623757		2201	4299	6500	SO:0001583	missense	90952	exon7			GTGGCCGGAGGGC	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.958C>T	11.37:g.124623757G>A	ENSP00000278927:p.Arg320Trp	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	58	3	NM_138961	0	0	0	0	0	B4DVN8|Q96T50	Missense_Mutation	SNP	ENST00000278927.5	37	CCDS8453.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.718138	0.68844	.	.	ENSG00000149564	ENST00000278927	T	0.33216	1.42	5.28	3.33	0.38152	.	0.221063	0.40222	N	0.001144	T	0.41073	0.1143	L	0.46157	1.445	0.43292	D	0.995272	D	0.76494	0.999	P	0.57720	0.826	T	0.22977	-1.0201	10	0.66056	D	0.02	.	11.5605	0.50774	0.0:0.0:0.5312:0.4688	.	320	Q96AP7	ESAM_HUMAN	W	320	ENSP00000278927:R320W	ENSP00000278927:R320W	R	-	1	2	ESAM	124128967	0.992000	0.36948	0.220000	0.23810	0.918000	0.54935	3.110000	0.50352	0.645000	0.30675	0.655000	0.94253	CGG	G|0.999;C|0.000		0.662	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	NM_138961	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu	37	12	49431830	49431830	+	Silent	SNP	A	A	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr12:49431830A>T	ENST00000301067.7	-	34	9308	c.9309T>A	c.(9307-9309)gcT>gcA	p.A3103A	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3103					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGGCATCAGCAGCAGGGGGAG	0.642																																					p.A3103A		.											.	MLL2-612	0			c.T9309A						.						21.0	22.0	22.0					12																	49431830		1971	4145	6116	SO:0001819	synonymous_variant	8085	exon34			ATCAGCAGCAGGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9309T>A	12.37:g.49431830A>T		Somatic	16	0		WXS	Illumina HiSeq	Phase_I	12	4	NM_003482	0	0	0	0	0	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.642	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
MCRS1	10445	hgsc.bcm.edu	37	12	49956786	49956786	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr12:49956786G>C	ENST00000550165.1	-	9	1069	c.803C>G	c.(802-804)aCa>aGa	p.T268R	MCRS1_ENST00000547182.1_5'UTR|MCRS1_ENST00000357123.4_Missense_Mutation_p.T281R|MCRS1_ENST00000546244.1_Missense_Mutation_p.T77R|MCRS1_ENST00000343810.4_Missense_Mutation_p.T268R			Q96EZ8	MCRS1_HUMAN	microspherule protein 1	268					cellular protein modification process (GO:0006464)|chromatin organization (GO:0006325)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)	23						GGCGTTACCTGTCTGGTCCTC	0.587																																					p.T281R		.											.	MCRS1-289	0			c.C842G						.						45.0	36.0	39.0					12																	49956786		2203	4298	6501	SO:0001583	missense	10445	exon7			TTACCTGTCTGGT	BC011794	CCDS8787.1, CCDS31795.1, CCDS61118.1	12q13.12	2011-07-06				ENSG00000187778		"""INO80 complex subunits"""	6960	protein-coding gene	gene with protein product	"""INO80 complex subunit Q"""	609504				9765390, 9654073	Standard	NM_006337		Approved	ICP22BP, MSP58, P78, MCRS2, INO80Q	uc001rui.1	Q96EZ8		ENST00000550165.1:c.803C>G	12.37:g.49956786G>C	ENSP00000448056:p.Thr268Arg	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_001012300	0	0	0	0	0	O14742|O75497|Q6VN53|Q7Z372	Missense_Mutation	SNP	ENST00000550165.1	37	CCDS8787.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.848843	0.71603	.	.	ENSG00000187778	ENST00000546244;ENST00000343810;ENST00000550165;ENST00000357123;ENST00000553173	.	.	.	5.64	5.64	0.86602	.	0.086145	0.85682	D	0.000000	T	0.66723	0.2818	L	0.47716	1.5	0.53005	D	0.999967	P;P;P	0.51351	0.944;0.642;0.887	P;B;P	0.56042	0.79;0.305;0.668	T	0.68372	-0.5426	9	0.72032	D	0.01	-8.7582	17.2003	0.86904	0.0:0.0:1.0:0.0	.	255;268;281	F8W126;Q96EZ8;Q96EZ8-2	.;MCRS1_HUMAN;.	R	77;268;268;281;255	.	ENSP00000345358:T268R	T	-	2	0	MCRS1	48243053	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.847000	0.69451	2.662000	0.90505	0.555000	0.69702	ACA	.		0.587	MCRS1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405102.1	NM_006337	
ERBB3	2065	hgsc.bcm.edu;broad.mit.edu	37	12	56495577	56495577	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr12:56495577C>T	ENST00000267101.3	+	28	4207	c.3767C>T	c.(3766-3768)cCa>cTa	p.P1256L	PA2G4_ENST00000303305.6_5'Flank|PA2G4_ENST00000552766.1_5'Flank|ERBB3_ENST00000450146.2_Missense_Mutation_p.P613L|RP11-603J24.17_ENST00000548595.1_RNA|ERBB3_ENST00000553131.1_Missense_Mutation_p.P497L|ERBB3_ENST00000415288.2_Missense_Mutation_p.P1197L|ERBB3_ENST00000549832.1_Missense_Mutation_p.P376L|RP11-603J24.9_ENST00000548861.1_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1256					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GGCACAACTCCAGATGAAGAC	0.557																																					p.P1256L		.											.	ERBB3-1403	0			c.C3767T						.						79.0	70.0	73.0					12																	56495577		2203	4300	6503	SO:0001583	missense	2065	exon28			CAACTCCAGATGA	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3767C>T	12.37:g.56495577C>T	ENSP00000267101:p.Pro1256Leu	Somatic	91	1		WXS	Illumina HiSeq	Phase_I	126	9	NM_001982	0	0	0	0	0	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.408715	0.42715	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.78126	-1.01;-0.93;-1.0;-1.15;-0.89	5.82	5.82	0.92795	.	0.000000	0.56097	D	0.000031	T	0.65123	0.2661	N	0.19112	0.55	0.80722	D	1	P;B;B	0.36535	0.557;0.361;0.118	B;B;B	0.33620	0.167;0.081;0.037	T	0.69427	-0.5148	10	0.62326	D	0.03	.	14.3848	0.66938	0.1484:0.8516:0.0:0.0	.	1197;376;1256	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	L	1256;613;1197;379;497;376	ENSP00000267101:P1256L;ENSP00000399178:P613L;ENSP00000408340:P1197L;ENSP00000449129:P497L;ENSP00000448729:P376L	ENSP00000267101:P1256L	P	+	2	0	ERBB3	54781844	0.985000	0.35326	0.997000	0.53966	0.907000	0.53573	3.316000	0.51960	2.752000	0.94435	0.655000	0.94253	CCA	.		0.557	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
MON2	23041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	62972277	62972277	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr12:62972277G>A	ENST00000393632.2	+	31	4958	c.4567G>A	c.(4567-4569)Gat>Aat	p.D1523N	MON2_ENST00000552738.1_Missense_Mutation_p.D1494N|MON2_ENST00000393630.3_Missense_Mutation_p.D1524N|MON2_ENST00000546600.1_Missense_Mutation_p.D1523N|MON2_ENST00000393629.2_Missense_Mutation_p.D1517N|MON2_ENST00000280379.6_Missense_Mutation_p.D1524N	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1523					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TGAAAATATTGATGTCGAGGT	0.284																																					p.D1523N		.											.	MON2-514	0			c.G4567A						.						30.0	30.0	30.0					12																	62972277		2200	4284	6484	SO:0001583	missense	23041	exon31			AATATTGATGTCG		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4567G>A	12.37:g.62972277G>A	ENSP00000377252:p.Asp1523Asn	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	47	9	NM_015026	0	0	0	0	0	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	G	32	5.188128	0.94923	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09;0.09	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.76506	0.3997	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.97110	0.993;0.997;0.982;0.992;1.0	T	0.74993	-0.3474	9	.	.	.	-19.6244	19.7297	0.96177	0.0:0.0:1.0:0.0	.	1517;1494;1523;392;1523	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	N	1523;1524;1524;1523;1494;1517	ENSP00000377252:D1523N;ENSP00000377250:D1524N;ENSP00000280379:D1524N;ENSP00000447407:D1523N;ENSP00000449215:D1494N;ENSP00000377249:D1517N	.	D	+	1	0	MON2	61258544	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.471000	0.97696	2.658000	0.90341	0.650000	0.86243	GAT	.		0.284	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
NAP1L1	4673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	76444427	76444427	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr12:76444427C>T	ENST00000261182.8	-	12	1429	c.943G>A	c.(943-945)Gat>Aat	p.D315N	NAP1L1_ENST00000431879.3_Missense_Mutation_p.D247N|NAP1L1_ENST00000552342.1_Missense_Mutation_p.D326N|NAP1L1_ENST00000547773.1_Missense_Mutation_p.D252N|NAP1L1_ENST00000544816.1_Missense_Mutation_p.D132N|NAP1L1_ENST00000393263.3_Missense_Mutation_p.D315N|NAP1L1_ENST00000547993.1_Missense_Mutation_p.D132N|NAP1L1_ENST00000542344.1_Missense_Mutation_p.D273N|NAP1L1_ENST00000549596.1_Missense_Mutation_p.D315N|NAP1L1_ENST00000535020.2_Missense_Mutation_p.D315N|NAP1L1_ENST00000548044.1_Missense_Mutation_p.D274N	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	315					DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				GCTTCAGCATCATCATCCTAT	0.373																																					p.D315N		.											.	NAP1L1-92	0			c.G943A						.						63.0	60.0	61.0					12																	76444427		2203	4300	6503	SO:0001583	missense	4673	exon12			CAGCATCATCATC		CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.943G>A	12.37:g.76444427C>T	ENSP00000261182:p.Asp315Asn	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	82	27	NM_004537	0	0	0	0	0	B3KNT8	Missense_Mutation	SNP	ENST00000261182.8	37	CCDS9013.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682803	0.88542	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000431879;ENST00000547773;ENST00000544816;ENST00000542344;ENST00000535020;ENST00000549596;ENST00000547993;ENST00000552342;ENST00000548044	T;T;T;T;T;T;T;T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65;1.65	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.45034	0.1322	M	0.68952	2.095	0.80722	D	1	B;B;B;B;B;B;B	0.34226	0.389;0.18;0.389;0.443;0.18;0.162;0.202	B;B;B;B;B;B;B	0.42163	0.274;0.378;0.274;0.196;0.285;0.135;0.196	T	0.40701	-0.9549	10	0.66056	D	0.02	.	19.7712	0.96366	0.0:1.0:0.0:0.0	.	315;273;326;315;247;252;315	F5H4R6;B7Z9C2;F8W0J6;B3KNT8;B3KV44;F8W543;P55209	.;.;.;.;.;.;NP1L1_HUMAN	N	315;309;315;247;252;132;273;315;315;132;326;274	ENSP00000261182:D315N;ENSP00000450236:D309N;ENSP00000376947:D315N;ENSP00000409795:D247N;ENSP00000448167:D252N;ENSP00000437507:D132N;ENSP00000444759:D273N;ENSP00000445008:D315N;ENSP00000447793:D315N;ENSP00000448007:D132N;ENSP00000447196:D326N;ENSP00000449649:D274N	ENSP00000261182:D315N	D	-	1	0	NAP1L1	74730694	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.677000	0.91161	0.585000	0.79938	GAT	.		0.373	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405850.3	NM_139207	
HMGB1	3146	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	31036826	31036826	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr13:31036826G>A	ENST00000405805.1	-	4	1260	c.320C>T	c.(319-321)tCt>tTt	p.S107F	HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000399494.1_Missense_Mutation_p.S107F|HMGB1_ENST00000399489.1_Missense_Mutation_p.S107F|HMGB1_ENST00000326004.4_Missense_Mutation_p.S107F|HMGB1_ENST00000339872.4_Missense_Mutation_p.S107F|HMGB1_ENST00000341423.5_Missense_Mutation_p.S107F			P09429	HMGB1_HUMAN	high mobility group box 1	107					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		GCGATACTCAGAGCAGAAGAG	0.393																																					p.S107F		.											.	HMGB1-227	0			c.C320T						.						45.0	46.0	46.0					13																	31036826		2187	4290	6477	SO:0001583	missense	3146	exon4			TACTCAGAGCAGA	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.320C>T	13.37:g.31036826G>A	ENSP00000384678:p.Ser107Phe	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	99	23	NM_002128	0	0	0	0	0	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	ENST00000405805.1	37	CCDS9335.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868452	0.72065	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399489;ENST00000399494;ENST00000426225;ENST00000326004	D;D;D;D;D;D	0.98150	-4.75;-4.75;-4.75;-4.75;-4.75;-4.75	5.5	3.76	0.43208	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.53938	D	0.000050	D	0.97977	0.9334	M	0.85373	2.75	0.80722	D	1	B;P;B;B	0.37176	0.099;0.586;0.314;0.204	B;P;P;B	0.49047	0.2;0.599;0.498;0.264	D	0.97456	1.0031	10	0.87932	D	0	.	10.4698	0.44629	0.0694:0.0:0.7963:0.1343	.	107;68;107;107	B7Z965;B3KQ05;P09429;Q5T7C4	.;.;HMGB1_HUMAN;.	F	107	ENSP00000384678:S107F;ENSP00000343040:S107F;ENSP00000345347:S107F;ENSP00000382412:S107F;ENSP00000382417:S107F;ENSP00000369904:S107F	ENSP00000369904:S107F	S	-	2	0	HMGB1	29934826	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.536000	0.82023	0.683000	0.31428	-0.148000	0.13756	TCT	.		0.393	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303998.2	NM_002128	
POSTN	10631	bcgsc.ca	37	13	38154768	38154768	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr13:38154768T>C	ENST00000379747.4	-	11	1576	c.1459A>G	c.(1459-1461)Ata>Gta	p.I487V	POSTN_ENST00000379749.4_Missense_Mutation_p.I487V|POSTN_ENST00000379743.4_Missense_Mutation_p.I487V|POSTN_ENST00000541179.1_Missense_Mutation_p.I487V|POSTN_ENST00000541481.1_Missense_Mutation_p.I487V|POSTN_ENST00000379742.4_Missense_Mutation_p.I487V	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	487	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TCGCGGAATATGTGAATCGCA	0.443																																					p.I487V													.	POSTN-516	0			c.A1459G						.						318.0	291.0	300.0					13																	38154768		2203	4300	6503	SO:0001583	missense	10631	exon11			GGAATATGTGAAT	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1459A>G	13.37:g.38154768T>C	ENSP00000369071:p.Ile487Val	Somatic	309	2		WXS	Illumina HiSeq	Phase_1	287	9	NM_006475	0	0	0	0	0	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	T	0.807	-0.753251	0.03041	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	D;D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38;-2.38	5.03	0.973	0.19710	FAS1 domain (6);	0.283388	0.40554	N	0.001070	T	0.75064	0.3799	N	0.16743	0.435	0.26793	N	0.969361	B;B;B;B;B;B;B	0.06786	0.001;0.0;0.0;0.001;0.001;0.0;0.0	B;B;B;B;B;B;B	0.12156	0.007;0.002;0.006;0.002;0.003;0.002;0.006	T	0.57294	-0.7836	10	0.10111	T	0.7	-8.6758	8.6825	0.34218	0.0:0.4161:0.0:0.5839	.	487;487;487;487;487;487;487	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	V	487	ENSP00000437959:I487V;ENSP00000369073:I487V;ENSP00000369071:I487V;ENSP00000369067:I487V;ENSP00000369066:I487V;ENSP00000437953:I487V	ENSP00000369066:I487V	I	-	1	0	POSTN	37052768	0.892000	0.30473	0.999000	0.59377	0.661000	0.39034	0.428000	0.21395	0.324000	0.23333	0.460000	0.39030	ATA	.		0.443	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
ELF1	1997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	41515309	41515309	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr13:41515309G>A	ENST00000239882.3	-	8	1318	c.1004C>T	c.(1003-1005)cCa>cTa	p.P335L	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.P311L	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	335					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TTTTACCCCTGGACTTGAAGA	0.453																																					p.P335L		.											.	ELF1-227	0			c.C1004T						.						131.0	134.0	133.0					13																	41515309		2203	4300	6503	SO:0001583	missense	1997	exon8			ACCCCTGGACTTG	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.1004C>T	13.37:g.41515309G>A	ENSP00000239882:p.Pro335Leu	Somatic	235	0		WXS	Illumina HiSeq	Phase_I	211	46	NM_172373	0	0	0	0	0	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	37	CCDS9374.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460748	0.43736	.	.	ENSG00000120690	ENST00000442101;ENST00000379498;ENST00000239882	T;T	0.55413	0.52;0.52	5.47	5.47	0.80525	.	0.503265	0.21383	N	0.075437	T	0.43612	0.1255	L	0.29908	0.895	0.38663	D	0.952122	B;B	0.25235	0.059;0.121	B;B	0.18263	0.015;0.021	T	0.41752	-0.9491	10	0.54805	T	0.06	.	16.6683	0.85259	0.0:0.1294:0.8706:0.0	.	311;335	E9PDQ9;P32519	.;ELF1_HUMAN	L	311;77;335	ENSP00000405580:P311L;ENSP00000239882:P335L	ENSP00000239882:P335L	P	-	2	0	ELF1	40413309	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	4.056000	0.57448	2.729000	0.93468	0.655000	0.94253	CCA	.		0.453	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373	
GPHN	10243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	67389425	67389425	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr14:67389425G>C	ENST00000315266.5	+	7	1620	c.499G>C	c.(499-501)Gac>Cac	p.D167H	GPHN_ENST00000459628.1_Missense_Mutation_p.D149H|GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000543237.1_Missense_Mutation_p.D180H|GPHN_ENST00000478722.1_Missense_Mutation_p.D167H|GPHN_ENST00000305960.9_Missense_Mutation_p.D136H	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	167	Interaction with GABARAP. {ECO:0000250}.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		TCATGCCATTGACCTTTTACG	0.403			T	MLL	AL																																p.D167H		.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN-228	0			c.G499C						.						187.0	164.0	172.0					14																	67389425		2203	4300	6503	SO:0001583	missense	10243	exon7			GCCATTGACCTTT	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.499G>C	14.37:g.67389425G>C	ENSP00000312771:p.Asp167His	Somatic	255	0		WXS	Illumina HiSeq	Phase_I	221	63	NM_001024218	0	0	0	0	0	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999756	0.74818	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960;ENST00000555456	.	.	.	5.02	4.12	0.48240	Molybdopterin binding (2);	0.000000	0.85682	D	0.000000	T	0.52386	0.1731	N	0.08118	0	0.58432	D	0.999994	B;D;B;D;D	0.89917	0.343;1.0;0.047;0.999;0.999	B;D;B;D;D	0.91635	0.281;0.999;0.052;0.993;0.989	T	0.62946	-0.6746	9	0.87932	D	0	-6.4813	13.7767	0.63057	0.0761:0.0:0.9239:0.0	.	136;180;167;167;149	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	H	167;167;149;180;136;100	.	ENSP00000303019:D136H	D	+	1	0	GPHN	66459178	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.550000	0.98110	2.321000	0.78463	0.655000	0.94253	GAC	.		0.403	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	96761860	96761860	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr14:96761860A>T	ENST00000359933.4	-	35	6070	c.5177T>A	c.(5176-5178)cTt>cAt	p.L1726H	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1726					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TTCTGCAGAAAGACTTGTGAA	0.308																																					p.L1726H		.											.	ATG2B-93	0			c.T5177A						.						55.0	54.0	55.0					14																	96761860		2203	4290	6493	SO:0001583	missense	55102	exon35			GCAGAAAGACTTG	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.5177T>A	14.37:g.96761860A>T	ENSP00000353010:p.Leu1726His	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	112	36	NM_018036	0	0	0	0	0	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	A	26.0	4.697600	0.88830	.	.	ENSG00000066739	ENST00000359933	T	0.13657	2.57	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.40886	0.1135	M	0.80332	2.49	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.31613	-0.9937	10	0.54805	T	0.06	.	15.8864	0.79251	1.0:0.0:0.0:0.0	.	1726	Q96BY7	ATG2B_HUMAN	H	1726	ENSP00000353010:L1726H	ENSP00000261834:L370H	L	-	2	0	ATG2B	95831613	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.539000	0.90637	2.223000	0.72356	0.454000	0.30748	CTT	.		0.308	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
NOMO2	283820	hgsc.bcm.edu	37	16	18532277	18532277	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr16:18532277C>T	ENST00000381474.3	-	19	2148	c.2083G>A	c.(2083-2085)Gtc>Atc	p.V695I	NOMO2_ENST00000330537.6_Missense_Mutation_p.V695I|NOMO2_ENST00000543392.1_Missense_Mutation_p.V528I	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	695						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						GGGCCTAAGACCAAGGCGGGT	0.567																																					p.V695I		.											.	NOMO2-23	0			c.G2083A						.						7.0	8.0	8.0					16																	18532277		1997	4088	6085	SO:0001583	missense	283820	exon19			CTAAGACCAAGGC	AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.2083G>A	16.37:g.18532277C>T	ENSP00000370883:p.Val695Ile	Somatic	271	0		WXS	Illumina HiSeq	Phase_I	337	82	NM_173614	0	0	0	0	0	Q4G177	Missense_Mutation	SNP	ENST00000381474.3	37	CCDS32394.1	.	.	.	.	.	.	.	.	.	.	.	18.89	3.720080	0.68844	.	.	ENSG00000185164	ENST00000330537;ENST00000381474;ENST00000543392	T;T;T	0.04706	3.61;3.59;3.57	3.37	3.37	0.38596	.	0.000000	0.85682	D	0.000000	T	0.10380	0.0254	L	0.47716	1.5	0.80722	D	1	D;D	0.62365	0.991;0.985	P;P	0.57425	0.82;0.643	T	0.37842	-0.9688	10	0.14656	T	0.56	-27.7224	14.2293	0.65879	0.0:1.0:0.0:0.0	.	528;695	Q4G177;Q5JPE7	.;NOMO2_HUMAN	I	695;695;528	ENSP00000331851:V695I;ENSP00000370883:V695I;ENSP00000439970:V528I	ENSP00000331851:V695I	V	-	1	0	NOMO2	18439778	1.000000	0.71417	0.274000	0.24659	0.987000	0.75469	6.873000	0.75541	1.845000	0.53610	0.455000	0.32223	GTC	.		0.567	NOMO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435858.1	NM_001004060	
ITGAX	3687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31371300	31371300	+	Silent	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr16:31371300G>A	ENST00000268296.4	+	7	742	c.621G>A	c.(619-621)agG>agA	p.R207R	ITGAX_ENST00000562522.1_Silent_p.R207R	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	207	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						AGGAATTCAGGCGCAGCTCAA	0.522																																					p.R207R		.											.	ITGAX-229	0			c.G621A						.						103.0	105.0	104.0					16																	31371300		2197	4300	6497	SO:0001819	synonymous_variant	3687	exon7			ATTCAGGCGCAGC	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.621G>A	16.37:g.31371300G>A		Somatic	136	0		WXS	Illumina HiSeq	Phase_I	223	108	NM_000887	0	0	0	0	0	Q8IVA6	Silent	SNP	ENST00000268296.4	37	CCDS10711.1																																																																																			.		0.522	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
TK2	7084	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	66547680	66547680	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr16:66547680T>A	ENST00000451102.2	-	9	1003	c.653A>T	c.(652-654)gAg>gTg	p.E218V	RP11-403P17.5_ENST00000561728.1_Silent_p.G34G|TK2_ENST00000545043.2_Missense_Mutation_p.E193V|TK2_ENST00000299697.7_Missense_Mutation_p.E260V|TK2_ENST00000527800.1_Missense_Mutation_p.E121V|TK2_ENST00000563369.2_Missense_Mutation_p.E121V|TK2_ENST00000564917.1_Missense_Mutation_p.E235V|TK2_ENST00000527284.1_Missense_Mutation_p.E187V|TK2_ENST00000568170.1_5'Flank|TK2_ENST00000417693.3_Missense_Mutation_p.E200V|TK2_ENST00000544898.1_Missense_Mutation_p.E169V|TK2_ENST00000525974.1_Missense_Mutation_p.E121V			O00142	KITM_HUMAN	thymidine kinase 2, mitochondrial	218					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|DNA replication (GO:0006260)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|thymidine kinase activity (GO:0004797)			large_intestine(1)|lung(2)|urinary_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0736)|Epithelial(162;0.237)		GATGAGCCACTCCTCATGGAG	0.537																																					p.E218V													.	TK2-115	0			c.A653T						.						81.0	66.0	71.0					16																	66547680		2201	4300	6501	SO:0001583	missense	7084	exon9			AGCCACTCCTCAT		CCDS10805.1, CCDS10805.2, CCDS54016.1, CCDS54017.1, CCDS54018.1, CCDS61955.1	16q22-q23.1	2012-10-02			ENSG00000166548	ENSG00000166548	2.7.1.21		11831	protein-coding gene	gene with protein product		188250					Standard	NM_004614		Approved		uc002eos.3	O00142	OTTHUMG00000137499	ENST00000451102.2:c.653A>T	16.37:g.66547680T>A	ENSP00000414334:p.Glu218Val	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	87	7	NM_004614	0	0	0	0	0	B4DGJ7|B4DZK7|B7ZAB1|E9PH08|O15238	Missense_Mutation	SNP	ENST00000451102.2	37	CCDS10805.2	.	.	.	.	.	.	.	.	.	.	T	18.75	3.691358	0.68271	.	.	ENSG00000166548	ENST00000299697;ENST00000417693;ENST00000545043;ENST00000451102;ENST00000527800;ENST00000527284;ENST00000544898;ENST00000525974	D;D;D;D;D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41	4.89	4.89	0.63831	.	0.098662	0.64402	D	0.000001	D	0.95095	0.8411	M	0.70595	2.14	0.51482	D	0.999929	D;P;B;D;B	0.56968	0.978;0.922;0.064;0.978;0.185	P;P;B;P;B	0.58577	0.841;0.782;0.209;0.841;0.205	D	0.95195	0.8311	10	0.62326	D	0.03	-31.3551	12.5335	0.56128	0.0:0.0:0.0:1.0	.	260;218;169;260;187	Q8IZR3;O00142;F5GYK4;E5KNQ5;O00142-2	.;KITM_HUMAN;.;.;.	V	260;200;193;218;121;187;169;121	ENSP00000299697:E260V;ENSP00000407469:E200V;ENSP00000438143:E193V;ENSP00000414334:E218V;ENSP00000433770:E121V;ENSP00000435312:E187V;ENSP00000440898:E169V;ENSP00000434594:E121V	ENSP00000299697:E260V	E	-	2	0	TK2	65105181	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.787000	0.69013	2.058000	0.61347	0.528000	0.53228	GAG	.		0.537	TK2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268806.4		
GSE1	23199	hgsc.bcm.edu	37	16	85690103	85690103	+	Missense_Mutation	SNP	G	G	A	rs532185802		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr16:85690103G>A	ENST00000253458.7	+	7	1320	c.1144G>A	c.(1144-1146)Gag>Aag	p.E382K	GSE1_ENST00000393243.1_Missense_Mutation_p.E309K|RN7SL381P_ENST00000577658.1_RNA|GSE1_ENST00000405402.2_Missense_Mutation_p.E278K	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	382																	gaaggagcgcgagcgcgagct	0.706													G|||	1	0.000199681	0.0	0.0	5008	,	,		13649	0.0		0.001	False		,,,				2504	0.0				p.E382K		.											.	.	0			c.G1144A						.						5.0	6.0	6.0					16																	85690103		1947	3842	5789	SO:0001583	missense	23199	exon7			GAGCGCGAGCGCG	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.1144G>A	16.37:g.85690103G>A	ENSP00000253458:p.Glu382Lys	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	6	5	NM_014615	0	0	0	0	0	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	ENST00000253458.7	37	CCDS10952.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853813	0.32791	.	.	ENSG00000131149	ENST00000405402;ENST00000253458;ENST00000393243	T;T;T	0.10477	2.87;2.87;2.87	4.87	4.87	0.63330	.	0.225508	0.44483	D	0.000446	T	0.22205	0.0535	M	0.64404	1.975	0.80722	D	1	D;D	0.69078	0.997;0.99	P;P	0.58454	0.839;0.548	T	0.05194	-1.0900	10	0.07175	T	0.84	-12.1607	16.1523	0.81632	0.0:0.0:1.0:0.0	.	309;382	Q14687-3;Q14687	.;GSE1_HUMAN	K	278;382;309	ENSP00000384839:E278K;ENSP00000253458:E382K;ENSP00000376934:E309K	ENSP00000253458:E382K	E	+	1	0	KIAA0182	84247604	1.000000	0.71417	0.993000	0.49108	0.165000	0.22458	8.347000	0.90062	2.425000	0.82216	0.561000	0.74099	GAG	.		0.706	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615	
SLC13A5	284111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	6606332	6606332	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:6606332T>G	ENST00000433363.2	-	5	906	c.673A>C	c.(673-675)Acc>Ccc	p.T225P	SLC13A5_ENST00000381074.4_Missense_Mutation_p.T182P|SLC13A5_ENST00000293800.6_Missense_Mutation_p.T208P|SLC13A5_ENST00000573648.1_Missense_Mutation_p.T225P	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	225					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						CCCGTCCCGGTCAGGGTGGCG	0.642																																					p.T225P		.											.	SLC13A5-90	0			c.A673C						.						117.0	98.0	105.0					17																	6606332		2203	4300	6503	SO:0001583	missense	284111	exon5			TCCCGGTCAGGGT	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.673A>C	17.37:g.6606332T>G	ENSP00000406220:p.Thr225Pro	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	141	39	NM_001143838	0	0	0	0	0	B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	ENST00000433363.2	37	CCDS11079.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.384652	0.82792	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	T;T	0.11169	2.8;2.8	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.40473	0.1118	M	0.89715	3.055	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.996;0.994;0.994;1.0	D;D;D;D;D	0.97110	0.967;0.945;0.967;0.967;1.0	T	0.48364	-0.9042	10	0.87932	D	0	.	13.806	0.63233	0.0:0.0:0.0:1.0	.	225;182;182;208;225	B7ZLB4;F8W7N2;B7Z4P2;B3KXR0;Q86YT5	.;.;.;.;S13A5_HUMAN	P	225;225;182	ENSP00000406220:T225P;ENSP00000370464:T182P	ENSP00000293800:T225P	T	-	1	0	SLC13A5	6547056	1.000000	0.71417	0.991000	0.47740	0.674000	0.39518	5.844000	0.69430	2.216000	0.71823	0.459000	0.35465	ACC	.		0.642	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2	NM_177550	
PIK3R5	23533	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	8812455	8812455	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:8812455A>G	ENST00000447110.1	-	3	264	c.140T>C	c.(139-141)cTg>cCg	p.L47P	PIK3R5_ENST00000584803.1_Missense_Mutation_p.L47P|PIK3R5_ENST00000581552.1_Missense_Mutation_p.L47P	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	47	Heterodimerization. {ECO:0000250}.			L -> Q (in Ref. 6; AAW63122). {ECO:0000305}.	blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						CCTGCTGACCAGCTCCTGCAG	0.597																																					p.L47P	NSCLC(18;589 615 7696 20311 50332)	.											.	PIK3R5-1146	0			c.T140C						.						29.0	25.0	27.0					17																	8812455		2203	4300	6503	SO:0001583	missense	23533	exon3			CTGACCAGCTCCT	AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.140T>C	17.37:g.8812455A>G	ENSP00000392812:p.Leu47Pro	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	26	4	NM_001142633	0	0	0	0	0	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	37	CCDS11147.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.433132	0.43224	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T;T	0.80123	-1.34;-1.34	5.22	5.22	0.72569	.	0.076071	0.53938	D	0.000052	D	0.83459	0.5259	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.85017	0.0909	10	0.59425	D	0.04	-7.8781	13.6276	0.62176	1.0:0.0:0.0:0.0	.	47	Q8WYR1	PI3R5_HUMAN	P	47	ENSP00000269300:L47P;ENSP00000392812:L47P	ENSP00000269300:L47P	L	-	2	0	PIK3R5	8753180	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.181000	0.77682	2.100000	0.63781	0.528000	0.53228	CTG	.		0.597	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	NM_014308	
KIAA0100	9703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	26948415	26948415	+	Splice_Site	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:26948415A>G	ENST00000528896.2	-	27	5134		c.e27+1		KIAA0100_ENST00000579924.2_5'Flank|KIAA0100_ENST00000544884.1_Splice_Site|KIAA0100_ENST00000389003.3_Splice_Site	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100							extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GGGAGGGCTGACCTGTGGTTG	0.542																																					.		.											.	KIAA0100-93	0			c.5059+2T>C						.						113.0	103.0	106.0					17																	26948415		2203	4300	6503	SO:0001630	splice_region_variant	9703	exon28			GGGCTGACCTGTG	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5059+1T>C	17.37:g.26948415A>G		Somatic	252	0		WXS	Illumina HiSeq	Phase_I	283	62	NM_014680	0	0	0	0	0	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Splice_Site	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	A	19.19	3.779355	0.70107	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4732	0.67531	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0100	23972542	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	8.702000	0.91338	2.211000	0.71520	0.402000	0.26972	.	.		0.542	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	Intron
KRTAP1-1	81851	hgsc.bcm.edu	37	17	39197393	39197393	+	Missense_Mutation	SNP	T	T	C	rs201732142		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:39197393T>C	ENST00000306271.4	-	1	320	c.257A>G	c.(256-258)tAc>tGc	p.Y86C		NM_030967.2	NP_112229.1	Q07627	KRA11_HUMAN	keratin associated protein 1-1	86			Missing (in allele KAP1.7). {ECO:0000269|PubMed:11841537}.			keratin filament (GO:0045095)		p.Y86C(4)		NS(2)|endometrium(2)|kidney(5)|lung(4)|prostate(1)	14		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCTGGTCTGGTAGCAGCTTGG	0.587																																					p.Y86C		.											.	.	4	Substitution - Missense(4)	lung(2)|kidney(1)|endometrium(1)	c.A257G						.						47.0	51.0	49.0					17																	39197393		2010	4190	6200	SO:0001583	missense	81851	exon1			GTCTGGTAGCAGC	AJ406926	CCDS42324.1	17q21.2	2014-06-05			ENSG00000188581	ENSG00000188581		"""Keratin associated proteins"""	16772	protein-coding gene	gene with protein product		608819				11279113	Standard	NM_030967		Approved	KAP1.1B, HB2A, KAP1.1, KAP1.1A	uc002hvw.1	Q07627	OTTHUMG00000133592	ENST00000306271.4:c.257A>G	17.37:g.39197393T>C	ENSP00000305975:p.Tyr86Cys	Somatic	77	2		WXS	Illumina HiSeq	Phase_I	100	11	NM_030967	0	0	0	0	0	A6NC32|Q96S60|Q96S67	Missense_Mutation	SNP	ENST00000306271.4	37	CCDS42324.1	.	.	.	.	.	.	.	.	.	.	T	0.037	-1.304092	0.01353	.	.	ENSG00000188581	ENST00000306271;ENST00000543328	T	0.27557	1.66	4.0	-7.99	0.01131	.	.	.	.	.	T	0.01940	0.0061	N	0.00002	-3.6	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42361	-0.9456	9	0.02654	T	1	.	3.8365	0.08896	0.3382:0.2456:0.3404:0.0759	.	86	Q07627	KRA11_HUMAN	C	86;76	ENSP00000305975:Y86C	ENSP00000305975:Y86C	Y	-	2	0	KRTAP1-1	36450919	0.001000	0.12720	0.000000	0.03702	0.075000	0.17131	-0.958000	0.03857	-1.490000	0.01842	-0.977000	0.02584	TAC	.		0.587	KRTAP1-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257696.1	NM_030967	
MPO	4353	hgsc.bcm.edu	37	17	56356475	56356475	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:56356475T>C	ENST00000225275.3	-	6	955	c.779A>G	c.(778-780)gAc>gGc	p.D260G	MPO_ENST00000340482.3_Missense_Mutation_p.D292G|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	260					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GAGGTCGTGGTCCAACAGCTG	0.657																																					p.D260G		.											.	MPO-156	0			c.A779G						.						56.0	55.0	56.0					17																	56356475		2203	4300	6503	SO:0001583	missense	4353	exon6			TCGTGGTCCAACA		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.779A>G	17.37:g.56356475T>C	ENSP00000225275:p.Asp260Gly	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	27	3	NM_000250	0	0	0	0	0	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.566371	0.86439	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.71103	-0.54;-0.54	5.51	4.4	0.53042	.	0.134476	0.53938	D	0.000044	D	0.85665	0.5749	M	0.91249	3.19	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	D	0.87073	0.2161	10	0.87932	D	0	-44.0613	10.9432	0.47285	0.1403:0.0:0.0:0.8597	.	260	P05164	PERM_HUMAN	G	292;260	ENSP00000344419:D292G;ENSP00000225275:D260G	ENSP00000225275:D260G	D	-	2	0	MPO	53711474	1.000000	0.71417	0.951000	0.38953	0.952000	0.60782	6.177000	0.71961	0.879000	0.35944	0.460000	0.39030	GAC	.		0.657	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1		
NACA2	342538	ucsc.edu	37	17	59668318	59668318	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:59668318C>T	ENST00000521764.1	-	1	245	c.224G>A	c.(223-225)aGg>aAg	p.R75K		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	75	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					CTTCCGTGCCCTCTTTTCACT	0.458																																					p.R75K													.	NACA2-91	0			c.G224A						.						246.0	229.0	234.0					17																	59668318		2203	4300	6503	SO:0001583	missense	342538	exon1			CGTGCCCTCTTTT	BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.224G>A	17.37:g.59668318C>T	ENSP00000427802:p.Arg75Lys	Somatic	390	1		WXS	Illumina HiSeq		532	1	NM_199290	0	0	0	0	0	Q2VIR9	Missense_Mutation	SNP	ENST00000521764.1	37	CCDS11630.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976583	0.34848	.	.	ENSG00000253506	ENST00000521764	T	0.17528	2.27	0.753	-0.748	0.11087	Nascent polypeptide-associated complex NAC (2);	0.072360	0.50627	N	0.000118	T	0.01489	0.0048	N	0.00010	-3.04	0.23577	N	0.997375	B	0.02656	0.0	B	0.01281	0.0	T	0.46076	-0.9217	9	.	.	.	.	4.0866	0.09950	0.0:0.257:0.0:0.743	.	75	Q9H009	NACA2_HUMAN	K	75	ENSP00000427802:R75K	.	R	-	2	0	NACA2	57023100	1.000000	0.71417	0.973000	0.42090	0.773000	0.43773	3.300000	0.51834	-0.188000	0.10499	-0.624000	0.04008	AGG	.		0.458	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255437.2	NM_199290	
HID1	283987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72954436	72954436	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:72954436C>G	ENST00000425042.2	-	11	1455	c.1378G>C	c.(1378-1380)Gac>Cac	p.D460H		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	460					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											ATGAGCAGGTCGGCGTGGGTC	0.667											OREG0024721	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D460H		.											.	.	0			c.G1378C						.						55.0	43.0	47.0					17																	72954436		2203	4300	6503	SO:0001583	missense	283987	exon11			GCAGGTCGGCGTG		CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.1378G>C	17.37:g.72954436C>G	ENSP00000413520:p.Asp460His	Somatic	28	0	1141	WXS	Illumina HiSeq	Phase_I	48	5	NM_030630	0	0	0	0	0	Q8N5L6|Q8TE83|Q9NT34	Missense_Mutation	SNP	ENST00000425042.2	37	CCDS32726.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918325	0.92249	.	.	ENSG00000167861	ENST00000525426;ENST00000425042;ENST00000318565	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.86732	0.6003	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90618	0.4557	9	0.87932	D	0	-29.5566	18.1326	0.89606	0.0:1.0:0.0:0.0	.	460	Q8IV36	CQ028_HUMAN	H	232;460;232	.	ENSP00000317795:D232H	D	-	1	0	C17orf28	70466031	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.550000	0.82173	2.284000	0.76573	0.561000	0.74099	GAC	.		0.667	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390011.2	NM_030630	
ITGB4	3691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	73752809	73752809	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr17:73752809C>T	ENST00000200181.3	+	37	5109	c.4922C>T	c.(4921-4923)cCc>cTc	p.P1641L	ITGB4_ENST00000339591.3_Missense_Mutation_p.P1624L|ITGB4_ENST00000450894.3_Missense_Mutation_p.P1571L|GALK1_ENST00000225614.2_Intron|ITGB4_ENST00000579662.1_Missense_Mutation_p.P1571L|ITGB4_ENST00000449880.2_Missense_Mutation_p.P1624L	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1641					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTGAGCACTCCCAGTGCCCCA	0.667																																					p.P1641L		.											.	ITGB4-227	0			c.C4922T						.						53.0	55.0	54.0					17																	73752809		2203	4299	6502	SO:0001583	missense	3691	exon37			GCACTCCCAGTGC		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.4922C>T	17.37:g.73752809C>T	ENSP00000200181:p.Pro1641Leu	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	124	29	NM_000213	0	0	0	0	0	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	37	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644502	0.47258	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.61627	0.09;0.09;0.09	5.04	5.04	0.67666	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.82802	0.5116	M	0.93978	3.48	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.87598	0.2495	10	0.87932	D	0	.	18.7536	0.91823	0.0:1.0:0.0:0.0	.	1624;1571;1641	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	L	1641;1624;1624	ENSP00000200181:P1641L;ENSP00000344079:P1624L;ENSP00000400217:P1624L	ENSP00000200181:P1641L	P	+	2	0	ITGB4	71264404	1.000000	0.71417	1.000000	0.80357	0.543000	0.35085	7.776000	0.85560	2.518000	0.84900	0.462000	0.41574	CCC	.		0.667	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
GADD45B	4616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	2477582	2477582	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:2477582T>A	ENST00000215631.4	+	4	698	c.466T>A	c.(466-468)Tct>Act	p.S156T		NM_015675.3	NP_056490.2	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	156					activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|lung(1)|ovary(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCTACATCTCTCTTCAGGA	0.552																																					p.S156T		.											.	GADD45B-90	0			c.T466A						.						39.0	40.0	40.0					19																	2477582		2203	4300	6503	SO:0001583	missense	4616	exon4			TACATCTCTCTTC	AF090950	CCDS32868.1	19p13.3	2012-10-02			ENSG00000099860	ENSG00000099860			4096	protein-coding gene	gene with protein product	"""myeloid differentiation primary response"", ""growth arrest and DNA-damage-inducible beta"""	604948		MYD118		1899477, 9827804	Standard	NM_015675		Approved	GADD45BETA, DKFZP566B133	uc002lwb.2	O75293	OTTHUMG00000180434	ENST00000215631.4:c.466T>A	19.37:g.2477582T>A	ENSP00000215631:p.Ser156Thr	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	39	13	NM_015675	0	0	0	0	0	A8KAM2|O75960|Q17R46	Missense_Mutation	SNP	ENST00000215631.4	37	CCDS32868.1	.	.	.	.	.	.	.	.	.	.	T	2.003	-0.428988	0.04701	.	.	ENSG00000099860	ENST00000215631	T	0.40756	1.02	4.66	-0.362	0.12560	.	0.260085	0.37012	N	0.002300	T	0.15522	0.0374	N	0.24115	0.695	0.58432	D	0.999999	B	0.29716	0.255	B	0.21917	0.037	T	0.29971	-0.9994	10	0.02654	T	1	.	1.0667	0.01612	0.1464:0.2718:0.1505:0.4313	.	156	O75293	GA45B_HUMAN	T	156	ENSP00000215631:S156T	ENSP00000215631:S156T	S	+	1	0	GADD45B	2428582	0.000000	0.05858	0.307000	0.25127	0.709000	0.40893	-1.720000	0.01871	-0.128000	0.11641	0.443000	0.29094	TCT	.		0.552	GADD45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451337.1	NM_015675	
S1PR4	8698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	3179456	3179456	+	Silent	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:3179456C>T	ENST00000246115.3	+	1	721	c.666C>T	c.(664-666)ctC>ctT	p.L222L	S1PR4_ENST00000591346.1_3'UTR	NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	222					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13						TCATGGGCCTCTATGGGGCCA	0.672																																					p.L222L	GBM(82;318 1638 33279 49708)	.											.	S1PR4-591	0			c.C666T						.						86.0	93.0	91.0					19																	3179456		2203	4300	6503	SO:0001819	synonymous_variant	8698	exon1			GGGCCTCTATGGG	AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6		9790765	Standard	NM_003775		Approved		uc002lxg.3	O95977		ENST00000246115.3:c.666C>T	19.37:g.3179456C>T		Somatic	245	0		WXS	Illumina HiSeq	Phase_I	263	85	NM_003775	0	0	0	0	0	D6W612	Silent	SNP	ENST00000246115.3	37	CCDS12105.1																																																																																			.		0.672	S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452517.1	NM_003775	
SLC7A10	56301	hgsc.bcm.edu	37	19	33706864	33706864	+	Missense_Mutation	SNP	G	G	C	rs370231027		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:33706864G>C	ENST00000253188.4	-	2	313	c.167C>G	c.(166-168)tCg>tGg	p.S56W	CTD-2540B15.6_ENST00000590492.1_RNA	NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	56					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					GAAGATGCCCGAGCCGATGAT	0.682																																					p.S56W		.											.	SLC7A10-91	0			c.C167G						.						22.0	21.0	21.0					19																	33706864		2200	4297	6497	SO:0001583	missense	56301	exon2			ATGCCCGAGCCGA	AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.167C>G	19.37:g.33706864G>C	ENSP00000253188:p.Ser56Trp	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	18	2	NM_019849	0	0	0	0	0	B2RE84	Missense_Mutation	SNP	ENST00000253188.4	37	CCDS12431.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.630872	0.87660	.	.	ENSG00000130876	ENST00000253188	D	0.91237	-2.81	4.98	4.98	0.66077	Amino acid permease domain (1);	0.063353	0.64402	D	0.000003	D	0.96962	0.9008	H	0.96269	3.795	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98358	1.0547	10	0.87932	D	0	.	17.3072	0.87198	0.0:0.0:1.0:0.0	.	56	Q9NS82	AAA1_HUMAN	W	56	ENSP00000253188:S56W	ENSP00000253188:S56W	S	-	2	0	SLC7A10	38398704	1.000000	0.71417	0.980000	0.43619	0.991000	0.79684	9.869000	0.99810	2.347000	0.79759	0.456000	0.33151	TCG	.		0.682	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849	
BCAM	4059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	45322968	45322968	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:45322968G>T	ENST00000270233.6	+	13	1770	c.1748G>T	c.(1747-1749)cGg>cTg	p.R583L	BCAM_ENST00000589651.1_Missense_Mutation_p.R583L	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	583					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CGCCAGCGGCGGGAGAAGGGG	0.637																																					p.R583L		.											.	BCAM-91	0			c.G1748T						.						14.0	17.0	16.0					19																	45322968		2183	4244	6427	SO:0001583	missense	4059	exon13			AGCGGCGGGAGAA	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1748G>T	19.37:g.45322968G>T	ENSP00000270233:p.Arg583Leu	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	39	18	NM_001013257	0	0	0	0	0	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	37	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	4.697	0.129623	0.08981	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.59772	0.24;0.34	4.08	1.68	0.24146	.	.	.	.	.	T	0.33904	0.0879	N	0.08118	0	0.09310	N	1	B	0.24092	0.097	B	0.15870	0.014	T	0.15521	-1.0434	9	0.30078	T	0.28	-5.8905	10.1318	0.42682	0.0:0.4182:0.5817:0.0	.	583	P50895	BCAM_HUMAN	L	583	ENSP00000270233:R583L;ENSP00000375817:R583L	ENSP00000270233:R583L	R	+	2	0	BCAM	50014808	0.003000	0.15002	0.037000	0.18230	0.042000	0.13812	1.344000	0.33941	0.242000	0.21303	0.531000	0.56144	CGG	.		0.637	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581	
CCDC114	93233	broad.mit.edu	37	19	48800292	48800292	+	Missense_Mutation	SNP	T	T	G	rs190723331		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:48800292T>G	ENST00000315396.7	-	14	2636	c.1954A>C	c.(1954-1956)Acc>Ccc	p.T652P		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	652	Ser-rich.				outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GCAGGGCCGGTGCTGGAGACG	0.682																																					p.T652P													.	CCDC114-91	0			c.A1954C						.						39.0	40.0	40.0					19																	48800292		2203	4299	6502	SO:0001583	missense	93233	exon14			GGCCGGTGCTGGA	BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1954A>C	19.37:g.48800292T>G	ENSP00000318429:p.Thr652Pro	Somatic	77	2		WXS	Illumina HiSeq	Phase_I	83	4	NM_144577	0	0	0	0	0	Q6ZRL4|Q96M06|Q9UFG8	Missense_Mutation	SNP	ENST00000315396.7	37	CCDS12714.2	.	.	.	.	.	.	.	.	.	.	T	2.053	-0.417249	0.04766	.	.	ENSG00000105479	ENST00000315396	T	0.24723	1.84	3.45	-6.89	0.01660	.	.	.	.	.	T	0.07908	0.0198	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44832	-0.9302	9	0.30854	T	0.27	1.9698	11.5423	0.50673	0.0:0.1068:0.6637:0.2295	.	652	Q96M63	CC114_HUMAN	P	652	ENSP00000318429:T652P	ENSP00000318429:T652P	T	-	1	0	CCDC114	53492104	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.767000	0.00782	-3.288000	0.00195	-1.286000	0.01371	ACC	T|0.999;C|0.000		0.682	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343207.1	NM_144577	
HRC	3270	hgsc.bcm.edu	37	19	49657763	49657763	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:49657763T>A	ENST00000252825.4	-	1	918	c.732A>T	c.(730-732)gaA>gaT	p.E244D	HRC_ENST00000595625.1_Missense_Mutation_p.E244D	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	244	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.E244E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		cgtcatcttcttcatGGCCTT	0.522																																					p.E244D	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	1	Substitution - coding silent(1)	lung(1)	c.A732T						.						118.0	85.0	96.0					19																	49657763		2203	4300	6503	SO:0001583	missense	3270	exon1			ATCTTCTTCATGG		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.732A>T	19.37:g.49657763T>A	ENSP00000252825:p.Glu244Asp	Somatic	30	1		WXS	Illumina HiSeq	Phase_I	33	2	NM_002152	0	0	0	0	0	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	t	8.405	0.842850	0.16963	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.06294	3.32	3.24	2.17	0.27698	.	.	.	.	.	T	0.07593	0.0191	L	0.57536	1.79	0.09310	N	0.999998	B	0.28820	0.224	B	0.33846	0.171	T	0.37641	-0.9697	9	0.13853	T	0.58	0.3786	7.0233	0.24926	0.0:0.1288:0.0:0.8712	.	244	P23327	SRCH_HUMAN	D	244;214	ENSP00000252825:E244D	ENSP00000252825:E244D	E	-	3	2	HRC	54349575	0.001000	0.12720	0.040000	0.18447	0.049000	0.14656	0.298000	0.19120	1.251000	0.43983	0.375000	0.23000	GAA	.		0.522	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
FAM161A	84140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	62066806	62066806	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr2:62066806G>A	ENST00000405894.3	-	3	1434	c.1333C>T	c.(1333-1335)Cac>Tac	p.H445Y	FAM161A_ENST00000404929.1_Missense_Mutation_p.H445Y	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	445					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GGAGACTTGTGTTCTGAGAGG	0.408																																					p.H445Y		.											.	FAM161A-136	0			c.C1333T						.						122.0	110.0	114.0					2																	62066806		1874	4103	5977	SO:0001583	missense	84140	exon3			ACTTGTGTTCTGA		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.1333C>T	2.37:g.62066806G>A	ENSP00000385893:p.His445Tyr	Somatic	179	0		WXS	Illumina HiSeq	Phase_I	170	52	NM_032180	0	0	0	0	0	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	37	CCDS42687.2	.	.	.	.	.	.	.	.	.	.	G	7.735	0.700095	0.15106	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.21734	1.99;1.99	5.19	-0.0571	0.13803	.	0.977729	0.08450	N	0.943967	T	0.08980	0.0222	N	0.08118	0	0.09310	N	1	B;B	0.17268	0.003;0.021	B;B	0.17098	0.013;0.017	T	0.36841	-0.9731	10	0.28530	T	0.3	-13.5655	2.5423	0.04729	0.1324:0.2247:0.4122:0.2308	.	445;445	Q3B820;Q3B820-3	F161A_HUMAN;.	Y	445	ENSP00000385158:H445Y;ENSP00000385893:H445Y	ENSP00000385158:H445Y	H	-	1	0	FAM161A	61920310	0.001000	0.12720	0.001000	0.08648	0.044000	0.14063	0.602000	0.24134	-0.235000	0.09767	-0.185000	0.12909	CAC	.		0.408	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180	
LMAN2L	81562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	97373520	97373520	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr2:97373520T>C	ENST00000264963.4	-	7	857	c.835A>G	c.(835-837)Acc>Gcc	p.T279A	LMAN2L_ENST00000534882.1_Missense_Mutation_p.T134A|LMAN2L_ENST00000377079.4_Missense_Mutation_p.T290A|LMAN2L_ENST00000537039.1_Missense_Mutation_p.T141A|LMAN2L_ENST00000426463.2_Missense_Mutation_p.T145A|FER1L5_ENST00000457909.1_RNA	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	279					ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						TCTTCTGGGGTTCTCTCCACT	0.468																																					p.T290A		.											.	LMAN2L-90	0			c.A868G						.						111.0	111.0	111.0					2																	97373520		2203	4300	6503	SO:0001583	missense	81562	exon8			CTGGGGTTCTCTC	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.835A>G	2.37:g.97373520T>C	ENSP00000264963:p.Thr279Ala	Somatic	167	0		WXS	Illumina HiSeq	Phase_I	154	37	NM_001142292	0	0	0	0	0	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Missense_Mutation	SNP	ENST00000264963.4	37	CCDS2023.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.544490	0.65198	.	.	ENSG00000114988	ENST00000264963;ENST00000377079;ENST00000426463;ENST00000537039;ENST00000534882	T;T;T;T;T	0.77358	0.91;0.9;-1.09;-1.04;-1.08	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase, subgroup (1);	0.095537	0.64402	D	0.000001	T	0.69106	0.3074	L	0.46157	1.445	0.51482	D	0.999927	B;B;B;B;B	0.26081	0.141;0.031;0.141;0.004;0.065	B;B;B;B;B	0.20955	0.021;0.023;0.021;0.002;0.032	T	0.64846	-0.6311	10	0.09590	T	0.72	.	14.8095	0.69982	0.0:0.0:0.0:1.0	.	134;152;145;290;279	B4DVH1;B4DI83;B4DSH3;Q9H0V9-2;Q9H0V9	.;.;.;.;LMA2L_HUMAN	A	279;290;145;141;134	ENSP00000264963:T279A;ENSP00000366280:T290A;ENSP00000396391:T145A;ENSP00000441701:T141A;ENSP00000438501:T134A	ENSP00000264963:T279A	T	-	1	0	LMAN2L	96737247	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.930000	0.70104	2.129000	0.65627	0.533000	0.62120	ACC	.		0.468	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	NM_030805	
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	170072853	170072853	+	Silent	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr2:170072853A>G	ENST00000263816.3	-	35	6021	c.5736T>C	c.(5734-5736)acT>acC	p.T1912T		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1912					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAGTAAAGAGAGTTTTCACAG	0.502																																					p.T1912T		.											.	LRP2-175	0			c.T5736C						.						150.0	136.0	141.0					2																	170072853		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon35			AAAGAGAGTTTTC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5736T>C	2.37:g.170072853A>G		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	105	41	NM_004525	0	0	0	0	0	O00711|Q16215	Silent	SNP	ENST00000263816.3	37	CCDS2232.1																																																																																			.		0.502	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
SATB2	23314	hgsc.bcm.edu	37	2	200320598	200320598	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr2:200320598C>G	ENST00000417098.1	-	2	979	c.163G>C	c.(163-165)Gtg>Ctg	p.V55L	SATB2_ENST00000457245.1_Missense_Mutation_p.V55L|SATB2_ENST00000428695.1_Missense_Mutation_p.V55L|SATB2-AS1_ENST00000442967.1_RNA|SATB2-AS1_ENST00000441234.1_RNA|SATB2_ENST00000260926.5_Missense_Mutation_p.V55L|SATB2_ENST00000443023.1_Missense_Mutation_p.V55L	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	55					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTACCTCCCACGGCCTTGGCC	0.706																																					p.V55L	Colon(30;262 767 11040 24421 36230)	.											.	SATB2-91	0			c.G163C						.						2.0	3.0	3.0					2																	200320598		1726	3685	5411	SO:0001583	missense	23314	exon3			CTCCCACGGCCTT	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.163G>C	2.37:g.200320598C>G	ENSP00000401112:p.Val55Leu	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	7	5	NM_015265	0	0	0	0	0	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	C	9.937	1.216494	0.22373	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5	5.76	4.83	0.62350	.	0.188172	0.36519	N	0.002542	T	0.23451	0.0567	N	0.02011	-0.69	0.31777	N	0.631404	B;B	0.20261	0.043;0.012	B;B	0.15870	0.014;0.01	T	0.18241	-1.0343	10	0.21540	T	0.41	-4.8194	9.7471	0.40453	0.0:0.7856:0.1416:0.0728	.	55;55	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	L	55	ENSP00000401112:V55L;ENSP00000388764:V55L;ENSP00000260926:V55L;ENSP00000388581:V55L;ENSP00000405420:V55L	ENSP00000260926:V55L	V	-	1	0	SATB2	200028843	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.018000	0.30002	2.724000	0.93272	0.462000	0.41574	GTG	.		0.706	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265	
PTPRA	5786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	3016279	3016279	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr20:3016279G>T	ENST00000216877.6	+	20	2342	c.1942G>T	c.(1942-1944)Gat>Tat	p.D648Y	PTPRA_ENST00000358719.4_Missense_Mutation_p.D513Y|PTPRA_ENST00000380393.3_Missense_Mutation_p.D657Y|PTPRA_ENST00000356147.3_Missense_Mutation_p.D648Y|PTPRA_ENST00000399903.2_Missense_Mutation_p.D657Y|PTPRA_ENST00000318266.5_Missense_Mutation_p.D648Y|PTPRA_ENST00000425918.2_Missense_Mutation_p.D668Y	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	657	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GTCCTATGGAGATATTACAGT	0.532																																					p.D657Y		.											.	PTPRA-227	0			c.G1969T						.						106.0	94.0	98.0					20																	3016279		2203	4300	6503	SO:0001583	missense	5786	exon25			TATGGAGATATTA		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1942G>T	20.37:g.3016279G>T	ENSP00000216877:p.Asp648Tyr	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	26	12	NM_002836	0	0	0	0	0	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	ENST00000216877.6	37	CCDS13039.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.860550	0.32884	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000542217;ENST00000425918;ENST00000318266;ENST00000356147	D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	5.57	5.57	0.84162	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	U	0.000000	D	0.90597	0.7052	M	0.72353	2.195	0.80722	D	1	P;D;D	0.89917	0.49;1.0;1.0	B;D;D	0.91635	0.143;0.999;0.963	D	0.85912	0.1441	10	0.02654	T	1	.	19.5578	0.95358	0.0:0.0:1.0:0.0	.	668;657;648	B7Z2A4;P18433;P18433-4	.;PTPRA_HUMAN;.	Y	657;648;657;513;267;668;648;648	ENSP00000369756:D657Y;ENSP00000216877:D648Y;ENSP00000382787:D657Y;ENSP00000351559:D513Y;ENSP00000393553:D668Y;ENSP00000314568:D648Y;ENSP00000348468:D648Y	ENSP00000216877:D648Y	D	+	1	0	PTPRA	2964279	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	9.869000	0.99810	2.604000	0.88044	0.563000	0.77884	GAT	.		0.532	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
GFRA4	64096	hgsc.bcm.edu	37	20	3641542	3641542	+	Silent	SNP	G	G	A	rs58634535	byFrequency	TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr20:3641542G>A	ENST00000319242.3	-	2	440	c.441C>T	c.(439-441)ctC>ctT	p.L147L	GFRA4_ENST00000290417.2_Intron			Q9GZZ7	GFRA4_HUMAN	GDNF family receptor alpha 4	147					negative regulation of ossification (GO:0030279)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			large_intestine(1)|lung(2)	3						GAGCCGGAGAGAGGCCCCGTC	0.761													G|||	1080	0.215655	0.2897	0.2075	5008	,	,		6888	0.2163		0.16	False		,,,				2504	0.1779				p.L147L		.											.	GFRA4-90	0			c.C441T						.	G	,	373,1901		10,353,774	1.0	2.0	2.0		,441	1.0	0.0	20	dbSNP_129	2	558,4460		15,528,1966	no	intron,coding-synonymous	GFRA4	NM_022139.3,NM_145762.2	,	25,881,2740	AA,AG,GG		11.12,16.4028,12.7674	,	,147/300	3641542	931,6361	1137	2509	3646	SO:0001819	synonymous_variant	64096	exon2			CGGAGAGAGGCCC	AF253318	CCDS13055.1, CCDS13056.1	20p13-p12	2008-07-16			ENSG00000125861	ENSG00000125861			13821	protein-coding gene	gene with protein product	"""persephin receptor"""					10958791, 15225646	Standard	XM_005260793		Approved		uc002win.3	Q9GZZ7	OTTHUMG00000031748	ENST00000319242.3:c.441C>T	20.37:g.3641542G>A		Somatic	2	2		WXS	Illumina HiSeq	Phase_I	7	7	NM_145762	0	0	0	0	0	Q5JT74|Q9H191|Q9H192	Silent	SNP	ENST00000319242.3	37	CCDS13056.1																																																																																			G|0.788;A|0.212		0.761	GFRA4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077744.1	NM_145762	
FRG1B	284802	broad.mit.edu	37	20	29625905	29625905	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr20:29625905T>C	ENST00000278882.3	+	5	529	c.149T>C	c.(148-150)cTt>cCt	p.L50P	FRG1B_ENST00000439954.2_Missense_Mutation_p.L55P|FRG1B_ENST00000358464.4_Missense_Mutation_p.L50P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	50								p.L50P(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGAAAATATCTTGGTATAAAT	0.333																																					.													.	FRG1B-22	2	Substitution - Missense(2)	kidney(2)	.						.																																			SO:0001583	missense	284802	.			AATATCTTGGTAT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.149T>C	20.37:g.29625905T>C	ENSP00000278882:p.Leu50Pro	Somatic	163	1		WXS	Illumina HiSeq	Phase_I	133	6	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	10.74	1.434729	0.25813	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.56611	0.45	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.67316	0.2880	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68300	-0.5445	9	0.87932	D	0	.	7.3757	0.26827	0.0:0.0:0.0:1.0	.	55	F5H5R5	.	P	50;55;50	ENSP00000408863:L55P	ENSP00000278882:L50P	L	+	2	0	FRG1B	28239566	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	6.623000	0.74238	1.028000	0.39785	0.155000	0.16302	CTT	.		0.333	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
PARD6B	84612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	49366607	49366607	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr20:49366607T>C	ENST00000371610.2	+	3	944	c.701T>C	c.(700-702)aTg>aCg	p.M234T	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	234	Interaction with PARD3 and CDC42. {ECO:0000250}.|PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						GTAACAGACATGATGATTGCA	0.433																																					p.M234T		.											.	PARD6B-91	0			c.T701C						.						124.0	117.0	120.0					20																	49366607		2203	4300	6503	SO:0001583	missense	84612	exon3			CAGACATGATGAT	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.701T>C	20.37:g.49366607T>C	ENSP00000360672:p.Met234Thr	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	156	52	NM_032521	0	0	0	0	0	A2A2A7|Q9Y510	Missense_Mutation	SNP	ENST00000371610.2	37	CCDS33485.1	.	.	.	.	.	.	.	.	.	.	T	18.60	3.659758	0.67586	.	.	ENSG00000124171	ENST00000371610	T	0.27402	1.67	6.02	6.02	0.97574	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.54727	0.1876	M	0.63169	1.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56456	-0.7976	10	0.87932	D	0	-60.5095	16.5446	0.84426	0.0:0.0:0.0:1.0	.	234	Q9BYG5	PAR6B_HUMAN	T	234	ENSP00000360672:M234T	ENSP00000360672:M234T	M	+	2	0	PARD6B	48800014	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	5.917000	0.69989	2.311000	0.77944	0.533000	0.62120	ATG	.		0.433	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521	
KRTAP10-11	386678	broad.mit.edu	37	21	46067216	46067216	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr21:46067216G>A	ENST00000334670.8	+	1	886	c.841G>A	c.(841-843)Gca>Aca	p.A281T	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	281						keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						CTGCCGCCCCGCAAGCTCCCG	0.657																																					p.A281T													.	KRTAP10-11-91	0			c.G841A						.						35.0	44.0	41.0					21																	46067216		2189	4278	6467	SO:0001583	missense	386678	exon1			CGCCCCGCAAGCT	AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.841G>A	21.37:g.46067216G>A	ENSP00000334197:p.Ala281Thr	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	70	4	NM_198692	0	0	0	0	0	A2RRF9	Missense_Mutation	SNP	ENST00000334670.8	37	CCDS42962.1	.	.	.	.	.	.	.	.	.	.	g	1.731	-0.494073	0.04322	.	.	ENSG00000243489	ENST00000334670	T	0.00682	5.86	3.93	-0.303	0.12792	.	.	.	.	.	T	0.00496	0.0016	N	0.14661	0.345	0.09310	N	1	P	0.39250	0.665	B	0.30646	0.118	T	0.51624	-0.8682	9	0.23891	T	0.37	.	7.4188	0.27061	0.5633:0.0:0.4367:0.0	.	281	P60412	KR10B_HUMAN	T	281	ENSP00000334197:A281T	ENSP00000334197:A281T	A	+	1	0	KRTAP10-11	44891644	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.804000	0.04535	-0.119000	0.11830	-0.379000	0.06801	GCA	.		0.657	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128029.1	NM_198692	
EMID1	129080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	29627008	29627008	+	Splice_Site	SNP	G	G	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr22:29627008G>T	ENST00000404820.3	+	6	592		c.e6-1		EMID1_ENST00000484039.1_Splice_Site|EMID1_ENST00000404755.3_Splice_Site|EMID1_ENST00000334018.6_Splice_Site			Q96A84	EMID1_HUMAN	EMI domain containing 1							collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						TTCCTCTTCAGATGACCATGC	0.587																																					.		.											.	EMID1-90	0			c.466-1G>T						.						68.0	65.0	66.0					22																	29627008		2203	4300	6503	SO:0001630	splice_region_variant	129080	exon6			TCTTCAGATGACC	AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.466-1G>T	22.37:g.29627008G>T		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	103	27	NM_133455	0	0	0	0	0	B0QYK6|Q6ICG1|Q86SS7	Splice_Site	SNP	ENST00000404820.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.15|10.15	1.270790|1.270790	0.23221|0.23221	.|.	.|.	ENSG00000186998|ENSG00000186998	ENST00000334018;ENST00000429226;ENST00000404755;ENST00000404820;ENST00000430127|ENST00000433143	.|.	.|.	.|.	4.64|4.64	4.64|4.64	0.57946|0.57946	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64735	.|0.2625	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63537	.|-0.6615	.|4	.|.	.|.	.|.	.|.	13.3293|13.3293	0.60477|0.60477	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|I	-1|1	.|.	.|.	.|R	+|+	.|2	.|0	EMID1|EMID1	27957008|27957008	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.024000|0.024000	0.10985|0.10985	4.969000|4.969000	0.63735|0.63735	2.293000|2.293000	0.77203|0.77203	0.591000|0.591000	0.81541|0.81541	.|AGA	.		0.587	EMID1-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321075.1	NM_133455	Intron
SBF1	6305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	50885659	50885659	+	Missense_Mutation	SNP	G	G	C	rs375012426	byFrequency	TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr22:50885659G>C	ENST00000390679.3	-	40	5700	c.5516C>G	c.(5515-5517)aCg>aGg	p.T1839R	SBF1_ENST00000348911.6_Missense_Mutation_p.T1840R|SBF1_ENST00000380817.3_Missense_Mutation_p.T1865R			O95248	MTMR5_HUMAN	SET binding factor 1	1839	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		AACGCGACGCGTTGTCTTCAC	0.667																																					p.T1865R		.											.	SBF1-90	0			c.C5594G						.						48.0	59.0	55.0					22																	50885659		2096	4202	6298	SO:0001583	missense	6305	exon41			CGACGCGTTGTCT	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.5516C>G	22.37:g.50885659G>C	ENSP00000375097:p.Thr1839Arg	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	56	13	NM_002972	0	0	0	0	0	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.51|17.51	3.408090|3.408090	0.62399|0.62399	.|.	.|.	ENSG00000100241|ENSG00000100241	ENST00000418590|ENST00000380817;ENST00000348911;ENST00000337034;ENST00000390679	.|T;T;T	.|0.12255	.|2.7;2.7;2.7	3.51|3.51	3.51|3.51	0.40186|0.40186	.|Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.26448|0.26448	0.0646|0.0646	L|L	0.31845|0.31845	0.965|0.965	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D;D	.|0.89917	.|0.959;1.0;0.979	.|P;D;D	.|0.91635	.|0.85;0.999;0.913	T|T	0.06058|0.06058	-1.0848|-1.0848	5|10	.|0.66056	.|D	.|0.02	.|.	15.1872|15.1872	0.73012|0.73012	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1839;1865;386	.|O95248;O95248-4;A6PVG7	.|MTMR5_HUMAN;.;.	K|R	386|1865;1840;1875;1839	.|ENSP00000370196:T1865R;ENSP00000252027:T1840R;ENSP00000375097:T1839R	.|ENSP00000336522:T1875R	N|T	-|-	3|2	2|0	SBF1|SBF1	49232525|49232525	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.777000|0.777000	0.43975|0.43975	2.406000|2.406000	0.44557|0.44557	1.989000|1.989000	0.58080|0.58080	0.462000|0.462000	0.41574|0.41574	AAC|ACG	.		0.667	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
GOLGA4	2803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	37340849	37340849	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr3:37340849T>C	ENST00000361924.2	+	9	1447	c.1073T>C	c.(1072-1074)cTt>cCt	p.L358P	GOLGA4_ENST00000435830.2_3'UTR|GOLGA4_ENST00000356847.4_Missense_Mutation_p.L380P|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	358	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						ATTGAACAGCTTGAACAAGAT	0.333																																					p.L380P		.											.	GOLGA4-93	0			c.T1139C						.						44.0	44.0	44.0					3																	37340849		2203	4297	6500	SO:0001583	missense	2803	exon10			AACAGCTTGAACA	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1073T>C	3.37:g.37340849T>C	ENSP00000354486:p.Leu358Pro	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	78	41	NM_001172713	0	0	0	0	0	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	37	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388371	0.82902	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000450863;ENST00000437131	T;T;T;T	0.34072	1.38;1.38;1.38;1.38	5.45	5.45	0.79879	.	0.000000	0.29830	N	0.011099	T	0.61825	0.2378	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.64939	-0.6289	10	0.52906	T	0.07	.	15.519	0.75851	0.0:0.0:0.0:1.0	.	358;380;358	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	P	358;380;363;229	ENSP00000354486:L358P;ENSP00000349305:L380P;ENSP00000387633:L363P;ENSP00000405842:L229P	ENSP00000349305:L380P	L	+	2	0	GOLGA4	37315853	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.923000	0.87546	2.077000	0.62373	0.372000	0.22366	CTT	.		0.333	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
MORC1	27136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	108788509	108788509	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr3:108788509T>A	ENST00000483760.1	-	9	828	c.785A>T	c.(784-786)aAa>aTa	p.K262I	MORC1_ENST00000232603.5_Missense_Mutation_p.K262I					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						GCAAAGATGTTTAGTTTTAAC	0.373																																					p.K262I		.											.	MORC1-98	0			c.A785T						.						113.0	113.0	113.0					3																	108788509		2203	4300	6503	SO:0001583	missense	27136	exon9			AGATGTTTAGTTT	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.785A>T	3.37:g.108788509T>A	ENSP00000417282:p.Lys262Ile	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	156	42	NM_014429	0	0	0	0	0		Missense_Mutation	SNP	ENST00000483760.1	37		.	.	.	.	.	.	.	.	.	.	T	20.8	4.054789	0.75960	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.74106	-0.81;-0.81	4.84	3.68	0.42216	ATPase-like, ATP-binding domain (1);	0.128321	0.35708	N	0.003033	D	0.82365	0.5021	M	0.69185	2.1	0.46298	D	0.998976	D;P	0.89917	1.0;0.892	D;P	0.87578	0.998;0.54	T	0.81984	-0.0682	10	0.62326	D	0.03	-23.3217	8.914	0.35570	0.0:0.0897:0.0:0.9103	.	262;262	E7ERX1;Q86VD1	.;MORC1_HUMAN	I	262	ENSP00000232603:K262I;ENSP00000417282:K262I	ENSP00000232603:K262I	K	-	2	0	MORC1	110271199	1.000000	0.71417	0.933000	0.37362	0.947000	0.59692	3.950000	0.56676	0.972000	0.38314	0.482000	0.46254	AAA	.		0.373	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
PODXL2	50512	broad.mit.edu	37	3	127379564	127379564	+	Silent	SNP	A	A	G	rs368660055		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr3:127379564A>G	ENST00000342480.6	+	3	732	c.693A>G	c.(691-693)tcA>tcG	p.S231S		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	231					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						AGGCCTCATCAGGTGTGGAGG	0.622																																					p.S231S													.	PODXL2-91	0			c.A693G						.						64.0	72.0	69.0					3																	127379564		2203	4300	6503	SO:0001819	synonymous_variant	50512	exon3			CTCATCAGGTGTG	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.693A>G	3.37:g.127379564A>G		Somatic	134	0		WXS	Illumina HiSeq	Phase_I	173	3	NM_015720	0	0	0	0	0	Q6UVY4|Q8WUV6	Silent	SNP	ENST00000342480.6	37	CCDS3044.1																																																																																			.		0.622	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	NM_015720	
TACC3	10460	hgsc.bcm.edu	37	4	1741439	1741439	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr4:1741439C>G	ENST00000313288.4	+	11	2058	c.1952C>G	c.(1951-1953)aCa>aGa	p.T651R		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	651					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			GTAAAGGCGACACAGGAGGAG	0.672																																					p.T651R	Ovarian(120;482 2294 11894 35824)	.											.	TACC3-91	0			c.C1952G						.						83.0	62.0	69.0					4																	1741439		2183	4284	6467	SO:0001583	missense	10460	exon11			AGGCGACACAGGA	AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.1952C>G	4.37:g.1741439C>G	ENSP00000326550:p.Thr651Arg	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	9	2	NM_006342	0	0	0	0	0	Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	ENST00000313288.4	37	CCDS3352.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243156	0.39697	.	.	ENSG00000013810	ENST00000313288	T	0.42900	0.96	4.17	-2.21	0.06973	.	1.447700	0.04587	N	0.396027	T	0.47021	0.1423	L	0.57536	1.79	0.09310	N	1	B;P	0.49696	0.095;0.927	B;P	0.52109	0.099;0.69	T	0.45338	-0.9268	10	0.62326	D	0.03	1.2548	4.1637	0.10296	0.2362:0.2398:0.0:0.5239	.	651;651	Q2NKK4;Q9Y6A5	.;TACC3_HUMAN	R	651	ENSP00000326550:T651R	ENSP00000326550:T651R	T	+	2	0	TACC3	1711237	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	0.085000	0.14912	-0.244000	0.09639	-0.142000	0.14014	ACA	.		0.672	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2		
DAPP1	27071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	100787280	100787280	+	Splice_Site	SNP	T	T	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr4:100787280T>G	ENST00000512369.1	+	8	842		c.e8+2		DAPP1_ENST00000296414.7_Splice_Site	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides						protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		TGGAAATTGGTGAGAATTTTT	0.358																																					.		.											.	DAPP1-93	0			c.774+2T>G						.						81.0	74.0	77.0					4																	100787280		1864	4095	5959	SO:0001630	splice_region_variant	27071	exon8			AATTGGTGAGAAT	AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.774+2T>G	4.37:g.100787280T>G		Somatic	35	1		WXS	Illumina HiSeq	Phase_I	31	8	NM_014395	0	0	0	0	0	Q8TCK5|Q9UHF2	Splice_Site	SNP	ENST00000512369.1	37	CCDS47112.1	.	.	.	.	.	.	.	.	.	.	T	19.66	3.869368	0.72065	.	.	ENSG00000070190	ENST00000296414;ENST00000512369	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6232	0.76824	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DAPP1	101006303	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	6.692000	0.74578	2.326000	0.78906	0.533000	0.62120	.	.		0.358	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363215.1		Intron
SLC30A5	64924	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	68399835	68399835	+	Intron	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:68399835A>G	ENST00000396591.3	+	4	883				SLC30A5_ENST00000502979.1_Missense_Mutation_p.K66R|SLC30A5_ENST00000380860.4_Missense_Mutation_p.K107R	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5						cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TTTAAAGACAAAAAGTTAAAT	0.284																																					p.K107R		.											.	SLC30A5-226	0			c.A320G						.						22.0	23.0	23.0					5																	68399835		2178	4287	6465	SO:0001627	intron_variant	64924	exon4			AAGACAAAAAGTT	AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.274-623A>G	5.37:g.68399835A>G		Somatic	31	0		WXS	Illumina HiSeq	Phase_I	30	10	NM_024055	0	0	0	0	0	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	ENST00000396591.3	37	CCDS3996.1	.	.	.	.	.	.	.	.	.	.	A	12.48	1.950224	0.34377	.	.	ENSG00000145740	ENST00000380860;ENST00000502979	.	.	.	2.74	2.74	0.32292	.	.	.	.	.	T	0.42832	0.1220	.	.	.	0.19300	N	0.99998	P	0.37398	0.593	P	0.45577	0.486	T	0.36696	-0.9737	7	0.87932	D	0	.	7.3651	0.26768	1.0:0.0:0.0:0.0	.	107	Q9BVY8	.	R	107;66	.	ENSP00000370241:K107R	K	+	2	0	SLC30A5	68435591	0.144000	0.22641	0.636000	0.29352	0.015000	0.08874	1.174000	0.31932	1.510000	0.48803	0.459000	0.35465	AAA	.		0.284	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254017.2		
F2RL2	2151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	75913735	75913735	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:75913735A>G	ENST00000296641.4	-	2	1000	c.797T>C	c.(796-798)tTg>tCg	p.L266S	IQGAP2_ENST00000274364.6_Intron|F2RL2_ENST00000504899.1_Missense_Mutation_p.L244S|IQGAP2_ENST00000379730.3_Intron|IQGAP2_ENST00000396234.3_Intron|IQGAP2_ENST00000502745.1_Intron	NM_004101.3	NP_004092.1	O00254	PAR3_HUMAN	coagulation factor II (thrombin) receptor-like 2	266					blood coagulation (GO:0007596)|metabolic process (GO:0008152)|platelet activation (GO:0030168)|response to wounding (GO:0009611)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|thrombin receptor activity (GO:0015057)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(3)	32		all_lung(232;0.000462)|Lung NSC(167;0.00124)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)		AAAGAATGCCAAGGAGATGAA	0.423																																					p.L266S		.											.	F2RL2-228	0			c.T797C						.						76.0	72.0	73.0					5																	75913735		2203	4300	6503	SO:0001583	missense	2151	exon2			AATGCCAAGGAGA	U92971	CCDS4031.1, CCDS58959.1	5q13	2012-08-08			ENSG00000164220	ENSG00000164220		"""GPCR / Class A : Protease activated receptors"""	3539	protein-coding gene	gene with protein product	"""proteinase-activated receptor-3"""	601919				9087410, 9722561	Standard	NM_004101		Approved	PAR3	uc003kem.4	O00254	OTTHUMG00000102119	ENST00000296641.4:c.797T>C	5.37:g.75913735A>G	ENSP00000296641:p.Leu266Ser	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	59	14	NM_004101	0	0	0	0	0	B2R754|B4DQ13|Q52M68|Q7Z3W3	Missense_Mutation	SNP	ENST00000296641.4	37	CCDS4031.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.155954	0.78114	.	.	ENSG00000164220	ENST00000296641;ENST00000504899	T;T	0.70045	-0.45;-0.45	5.3	5.3	0.74995	GPCR, rhodopsin-like superfamily (1);	0.152354	0.43579	D	0.000549	T	0.76695	0.4023	L	0.56340	1.77	0.46678	D	0.999155	D	0.89917	1.0	D	0.80764	0.994	T	0.73272	-0.4035	10	0.22706	T	0.39	-8.0196	15.2748	0.73734	1.0:0.0:0.0:0.0	.	266	O00254	PAR3_HUMAN	S	266;244	ENSP00000296641:L266S;ENSP00000426703:L244S	ENSP00000296641:L266S	L	-	2	0	F2RL2	75949491	1.000000	0.71417	0.860000	0.33809	0.967000	0.64934	8.850000	0.92190	2.006000	0.58801	0.460000	0.39030	TTG	.		0.423	F2RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219958.3		
BHMT	635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	78415082	78415082	+	Splice_Site	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:78415082T>C	ENST00000274353.5	+	3	274	c.167T>C	c.(166-168)gTt>gCt	p.V56A	BHMT_ENST00000524080.1_Intron|DMGDH_ENST00000520388.1_Intron	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	56	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	ACTCTCCCAGTTCGCCAGCTT	0.433																																					p.V56A		.											.	BHMT-91	0			c.T167C						.						92.0	87.0	89.0					5																	78415082		2203	4300	6503	SO:0001630	splice_region_variant	635	exon3			TCCCAGTTCGCCA	BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.167-1T>C	5.37:g.78415082T>C		Somatic	151	0		WXS	Illumina HiSeq	Phase_I	125	41	NM_001713	0	0	0	0	0	Q9UNI9	Missense_Mutation	SNP	ENST00000274353.5	37	CCDS4046.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388243	0.82902	.	.	ENSG00000145692	ENST00000274353	T	0.45276	0.9	5.6	5.6	0.85130	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.73249	0.3563	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.81360	-0.0968	9	.	.	.	.	16.0786	0.80985	0.0:0.0:0.0:1.0	.	56	Q93088	BHMT1_HUMAN	A	56	ENSP00000274353:V56A	.	V	+	2	0	BHMT	78450838	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	7.669000	0.83911	2.254000	0.74563	0.460000	0.39030	GTT	.		0.433	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226961.1	NM_001713	Missense_Mutation
PCDHB3	56132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140481178	140481178	+	Silent	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:140481178T>C	ENST00000231130.2	+	1	945	c.945T>C	c.(943-945)taT>taC	p.Y315Y	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	315	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTAATAGTTATGAAGTCGACA	0.428																																					p.Y315Y		.											.	PCDHB3-92	0			c.T945C						.						54.0	58.0	56.0					5																	140481178		2203	4300	6503	SO:0001819	synonymous_variant	56132	exon1			TAGTTATGAAGTC	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.945T>C	5.37:g.140481178T>C		Somatic	98	0		WXS	Illumina HiSeq	Phase_I	86	32	NM_018937	0	0	0	0	0	B2R8P2	Silent	SNP	ENST00000231130.2	37	CCDS4245.1																																																																																			.		0.428	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
TENM2	57451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	167674296	167674296	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:167674296C>A	ENST00000518659.1	+	27	6391	c.6352C>A	c.(6352-6354)Cgc>Agc	p.R2118S	TENM2_ENST00000403607.2_Missense_Mutation_p.R1942S|TENM2_ENST00000520394.1_Missense_Mutation_p.R1879S|TENM2_ENST00000519204.1_Missense_Mutation_p.R1997S|TENM2_ENST00000545108.1_Missense_Mutation_p.R2117S	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2118					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TGACCTCTACCGCTATGATGA	0.493																																					p.R2109S		.											.	.	0			c.C6325A						.						167.0	167.0	167.0					5																	167674296		2016	4172	6188	SO:0001583	missense	57451	exon27			CTCTACCGCTATG	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6352C>A	5.37:g.167674296C>A	ENSP00000429430:p.Arg2118Ser	Somatic	182	0		WXS	Illumina HiSeq	Phase_I	185	57	NM_001122679	0	0	0	0	0	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	C	18.69	3.678710	0.68042	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89123	-1.99;-1.98;-2.09;-2.44;-2.47	5.44	5.44	0.79542	.	0.103671	0.64402	D	0.000001	D	0.93861	0.8036	M	0.71581	2.175	0.54753	D	0.999989	D;P;D	0.69078	0.974;0.899;0.997	P;B;D	0.75484	0.807;0.44;0.986	D	0.92184	0.5754	10	0.30854	T	0.27	.	19.2461	0.93902	0.0:1.0:0.0:0.0	.	2117;2118;1879	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	S	2118;2117;1997;1879;1942	ENSP00000429430:R2118S;ENSP00000438635:R2117S;ENSP00000428964:R1997S;ENSP00000427874:R1879S;ENSP00000384905:R1942S	ENSP00000384905:R1942S	R	+	1	0	ODZ2	167606874	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.906000	0.56340	2.560000	0.86352	0.561000	0.74099	CGC	.		0.493	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
PFN3	345456	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	176827191	176827191	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr5:176827191T>C	ENST00000358571.2	-	1	446	c.387A>G	c.(385-387)atA>atG	p.I129M	F12_ENST00000514943.1_5'Flank	NM_001029886.2	NP_001025057.1	P60673	PROF3_HUMAN	profilin 3	129					actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	lipid binding (GO:0008289)			lung(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGCCCGCGTATGAGTTCGT	0.706																																					p.I129M		.											.	PFN3-90	0			c.A387G						.						18.0	19.0	19.0					5																	176827191		2099	4229	6328	SO:0001583	missense	345456	exon1			CCCGCGTATGAGT	AC090063	CCDS34301.1	5q35.2	2008-08-26			ENSG00000196570	ENSG00000196570			18627	protein-coding gene	gene with protein product		612812				11867228	Standard	NM_001029886		Approved		uc003mgl.2	P60673	OTTHUMG00000163408	ENST00000358571.2:c.387A>G	5.37:g.176827191T>C	ENSP00000351379:p.Ile129Met	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	52	14	NM_001029886	0	0	0	0	0	A2RUL3	Missense_Mutation	SNP	ENST00000358571.2	37	CCDS34301.1	.	.	.	.	.	.	.	.	.	.	T	11.75	1.732218	0.30684	.	.	ENSG00000196570	ENST00000358571	D	0.85861	-2.04	4.76	2.91	0.33838	.	0.294068	0.29459	N	0.012099	D	0.86167	0.5868	L	0.44542	1.39	0.21652	N	0.999609	D	0.71674	0.998	D	0.79108	0.992	T	0.74847	-0.3525	10	0.39692	T	0.17	.	5.3821	0.16197	0.1086:0.0:0.6881:0.2033	.	129	P60673	PROF3_HUMAN	M	129	ENSP00000351379:I129M	ENSP00000351379:I129M	I	-	3	3	PFN3	176759797	0.015000	0.18098	0.596000	0.28811	0.168000	0.22595	-0.004000	0.12878	0.415000	0.25817	-0.724000	0.03597	ATA	.		0.706	PFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373234.1	NM_001029886	
VARS2	57176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30893383	30893383	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:30893383G>C	ENST00000321897.5	+	27	3480	c.2848G>C	c.(2848-2850)Ggc>Cgc	p.G950R	VARS2_ENST00000416670.2_Missense_Mutation_p.G950R|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000542001.1_Missense_Mutation_p.G810R|VARS2_ENST00000541562.1_Missense_Mutation_p.G980R			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	950					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						GGAGCCCCTGGGCACCCTGGG	0.647																																					p.G980R		.											.	VARS2-26	0			c.G2938C						.						19.0	22.0	21.0					6																	30893383		1493	2701	4194	SO:0001583	missense	57176	exon28			CCCCTGGGCACCC	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.2848G>C	6.37:g.30893383G>C	ENSP00000316092:p.Gly950Arg	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	41	9	NM_001167734	0	0	0	0	0	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	G	5.589	0.293519	0.10567	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.62	3.84	0.44239	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.708730	0.14077	N	0.342996	T	0.13628	0.0330	L	0.44542	1.39	0.30330	N	0.78675	B;B;B;B	0.29988	0.264;0.001;0.002;0.0	B;B;B;B	0.26094	0.066;0.001;0.001;0.0	T	0.15378	-1.0439	10	0.15952	T	0.53	-9.346	8.9906	0.36022	0.1719:0.0:0.8281:0.0	.	388;948;980;950	Q5ST30-2;B7ZL25;F5GXJ0;Q5ST30	.;.;.;SYVM_HUMAN	R	950;950;810;980	ENSP00000316092:G950R;ENSP00000394802:G950R;ENSP00000438200:G810R;ENSP00000441000:G980R	ENSP00000316092:G950R	G	+	1	0	VARS2	31001362	0.997000	0.39634	1.000000	0.80357	0.153000	0.21895	0.990000	0.29642	0.737000	0.32582	-0.140000	0.14226	GGC	.		0.647	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
TTBK1	84630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43226956	43226956	+	Silent	SNP	C	C	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:43226956C>G	ENST00000259750.4	+	11	1280	c.1197C>G	c.(1195-1197)gtC>gtG	p.V399V	TTBK1_ENST00000304139.5_Silent_p.V348V	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	399					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			AGGCTGAAGTCTGGGAGGAGA	0.642																																					p.V399V		.											.	TTBK1-353	0			c.C1197G						.						51.0	58.0	56.0					6																	43226956		2203	4300	6503	SO:0001819	synonymous_variant	84630	exon11			TGAAGTCTGGGAG	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.1197C>G	6.37:g.43226956C>G		Somatic	100	0		WXS	Illumina HiSeq	Phase_I	104	26	NM_032538	0	0	0	0	0	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	37	CCDS34455.1																																																																																			.		0.642	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
GPR110	266977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	46977043	46977043	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:46977043G>A	ENST00000371253.2	-	11	2343	c.2128C>T	c.(2128-2130)Cct>Tct	p.P710S	GPR110_ENST00000283297.5_Missense_Mutation_p.P513S|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	710					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						ATAATGAGAGGGCACCCATAA	0.478																																					p.P710S		.											.	GPR110-71	0			c.C2128T						.						88.0	80.0	83.0					6																	46977043		2203	4300	6503	SO:0001583	missense	266977	exon11			TGAGAGGGCACCC	AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2128C>T	6.37:g.46977043G>A	ENSP00000360299:p.Pro710Ser	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	56	16	NM_153840	0	0	0	0	0	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	ENST00000371253.2	37	CCDS34471.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.576276	0.86645	.	.	ENSG00000153292	ENST00000371253;ENST00000283297	D;D	0.84516	-1.86;-1.86	5.9	5.9	0.94986	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000013	D	0.93572	0.7948	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93726	0.7037	10	0.87932	D	0	-22.4263	20.2789	0.98501	0.0:0.0:1.0:0.0	.	710	Q5T601	GP110_HUMAN	S	710;513	ENSP00000360299:P710S;ENSP00000283297:P513S	ENSP00000283297:P513S	P	-	1	0	GPR110	47085002	1.000000	0.71417	0.995000	0.50966	0.855000	0.48748	9.861000	0.99562	2.788000	0.95919	0.650000	0.86243	CCT	.		0.478	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
AIM1	202	hgsc.bcm.edu	37	6	106960432	106960432	+	Silent	SNP	C	C	G	rs146137130	byFrequency	TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:106960432C>G	ENST00000369066.3	+	1	703	c.216C>G	c.(214-216)tcC>tcG	p.S72S		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GCGTTGCCTCCGCTGCGAGCC	0.677																																					p.S72S		.											.	AIM1-139	0			c.C216G						.						11.0	11.0	11.0					6																	106960432		2153	4219	6372	SO:0001819	synonymous_variant	202	exon1			TGCCTCCGCTGCG	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.216C>G	6.37:g.106960432C>G		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	14	4	NM_001624	0	0	0	0	0	Q6P2P0|Q9BTM3	Silent	SNP	ENST00000369066.3	37	CCDS34506.1																																																																																			C|0.995;A|0.005		0.677	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
TBC1D32	221322	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	121576521	121576521	+	Silent	SNP	T	T	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:121576521T>A	ENST00000398212.2	-	17	2020	c.1971A>T	c.(1969-1971)gtA>gtT	p.V657V	TBC1D32_ENST00000275159.6_Silent_p.V657V	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	657					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										CAGAACCCTCTACTGGAGTAG	0.289																																					p.V657V		.											.	C6orf170-92	0			c.A1971T						.						55.0	55.0	55.0					6																	121576521		1794	4047	5841	SO:0001819	synonymous_variant	221322	exon17			ACCCTCTACTGGA	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.1971A>T	6.37:g.121576521T>A		Somatic	118	0		WXS	Illumina HiSeq	Phase_I	116	43	NM_152730	0	0	0	0	0	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	ENST00000398212.2	37	CCDS43501.1																																																																																			.		0.289	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730	
HIVEP2	3097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	143091819	143091819	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr6:143091819T>C	ENST00000367604.1	-	4	4696	c.4057A>G	c.(4057-4059)Att>Gtt	p.I1353V	HIVEP2_ENST00000367603.2_Missense_Mutation_p.I1353V|HIVEP2_ENST00000012134.2_Missense_Mutation_p.I1353V			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		ATCTGAGAAATGCTTGTGTAC	0.507																																					p.I1353V	Esophageal Squamous(107;843 1510 13293 16805 42198)	.											.	HIVEP2-95	0			c.A4057G						.						81.0	80.0	80.0					6																	143091819		2007	4178	6185	SO:0001583	missense	3097	exon5			GAGAAATGCTTGT	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4057A>G	6.37:g.143091819T>C	ENSP00000356576:p.Ile1353Val	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	96	29	NM_006734	0	0	0	0	0	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	T	9.819	1.185356	0.21870	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02121	4.44;4.44;4.44	6.08	6.08	0.98989	.	0.046170	0.85682	D	0.000000	T	0.01092	0.0036	L	0.38953	1.18	0.46927	D	0.999254	B	0.30236	0.274	B	0.19666	0.026	T	0.62296	-0.6884	10	0.23891	T	0.37	-16.7632	16.6438	0.85155	0.0:0.0:0.0:1.0	.	1353	P31629	ZEP2_HUMAN	V	1353	ENSP00000356576:I1353V;ENSP00000356575:I1353V;ENSP00000012134:I1353V	ENSP00000012134:I1353V	I	-	1	0	HIVEP2	143133512	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.593000	0.61034	2.333000	0.79357	0.533000	0.62120	ATT	.		0.507	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
CADPS2	93664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	122269335	122269335	+	Silent	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr7:122269335A>G	ENST00000449022.2	-	4	853	c.834T>C	c.(832-834)gaT>gaC	p.D278D	CADPS2_ENST00000334010.7_Silent_p.D278D|CADPS2_ENST00000313070.7_Silent_p.D278D|CADPS2_ENST00000412584.2_Silent_p.D278D	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	278					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						GCAGCCGGCCATCAAGTTCCC	0.358																																					p.D278D		.											.	CADPS2-94	0			c.T834C						.						67.0	64.0	65.0					7																	122269335		1866	4095	5961	SO:0001819	synonymous_variant	93664	exon4			CCGGCCATCAAGT		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.834T>C	7.37:g.122269335A>G		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	33	6	NM_001167940	0	0	0	0	0	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Silent	SNP	ENST00000449022.2	37	CCDS55158.1																																																																																			.		0.358	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
NUP205	23165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	135276257	135276257	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr7:135276257T>G	ENST00000285968.6	+	11	1559	c.1533T>G	c.(1531-1533)atT>atG	p.I511M	NUP205_ENST00000440390.2_Intron	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	511					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CTATTTATATTCCTTATTTGA	0.403																																					p.I511M		.											.	NUP205-207	0			c.T1533G						.						122.0	115.0	117.0					7																	135276257		2203	4300	6503	SO:0001583	missense	23165	exon11			TTATATTCCTTAT	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.1533T>G	7.37:g.135276257T>G	ENSP00000285968:p.Ile511Met	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	130	46	NM_015135	0	0	0	0	0	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.806891	0.70797	.	.	ENSG00000155561	ENST00000285968	T	0.32023	1.47	5.96	3.3	0.37823	.	0.043164	0.85682	D	0.000000	T	0.32615	0.0835	L	0.55481	1.735	0.80722	D	1	P	0.51653	0.947	P	0.50231	0.635	T	0.06427	-1.0827	10	0.46703	T	0.11	-10.0959	4.1716	0.10332	0.1437:0.2942:0.0:0.5621	.	511	Q92621	NU205_HUMAN	M	511	ENSP00000285968:I511M	ENSP00000285968:I511M	I	+	3	3	NUP205	134926797	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	0.569000	0.23638	0.394000	0.25230	0.533000	0.62120	ATT	.		0.403	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
RGS20	8601	bcgsc.ca	37	8	54764573	54764573	+	Silent	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr8:54764573T>C	ENST00000297313.3	+	1	206	c.114T>C	c.(112-114)atT>atC	p.I38I	RGS20_ENST00000344277.6_Silent_p.I38I	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	38					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			ATACAGACATTCACCAAATCA	0.458																																					p.I38I													.	RGS20-227	0			c.T114C						.						109.0	110.0	110.0					8																	54764573		2203	4300	6503	SO:0001819	synonymous_variant	8601	exon1			AGACATTCACCAA	AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.114T>C	8.37:g.54764573T>C		Somatic	121	0		WXS	Illumina HiSeq	Phase_1	109	34	NM_170587	0	0	0	0	0	Q96BG9	Silent	SNP	ENST00000297313.3	37	CCDS6155.1																																																																																			.		0.458	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1		
PPAPDC2	403313	hgsc.bcm.edu	37	9	4662477	4662477	+	Silent	SNP	C	C	A	rs369535277		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:4662477C>A	ENST00000381883.2	+	1	180	c.102C>A	c.(100-102)ggC>ggA	p.G34G	SPATA6L_ENST00000381895.5_Intron|SPATA6L_ENST00000223517.5_Intron|SPATA6L_ENST00000475086.1_Intron|SPATA6L_ENST00000381890.5_Intron|SPATA6L_ENST00000454239.2_Intron	NM_203453.3	NP_982278.3	Q8IY26	PPAC2_HUMAN	phosphatidic acid phosphatase type 2 domain containing 2	34						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(2)|lung(1)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.026)		GCGGTGGCGGCGGCAGCAGGT	0.731											OREG0019084	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		11652	0.0		0.001	False		,,,				2504	0.0				p.G34G	Melanoma(187;1057 3809 8526)	.											.	PPAPDC2-90	0			c.C102A						.	C	,	0,2856		0,0,1428	2.0	3.0	3.0		,102	2.9	0.2	9		3	3,6207		0,3,3102	no	intron,coding-synonymous	C9orf68,PPAPDC2	NM_001039395.3,NM_203453.2	,	0,3,4530	AA,AC,CC		0.0483,0.0,0.0331	,	,34/296	4662477	3,9063	1428	3105	4533	SO:0001819	synonymous_variant	403313	exon1			TGGCGGCGGCAGC	AK128369	CCDS34981.1	9p24	2010-04-23			ENSG00000205808	ENSG00000205808			23682	protein-coding gene	gene with protein product	"""polyisoprenoid diphosphate phosphatase type 1"""	611666				16464866	Standard	NM_203453		Approved	FLJ90191, FLJ46512, PDP1	uc003zin.4	Q8IY26	OTTHUMG00000019466	ENST00000381883.2:c.102C>A	9.37:g.4662477C>A		Somatic	4	1	620	WXS	Illumina HiSeq	Phase_I	10	7	NM_203453	0	0	0	0	0	B3KY05|Q5JVJ6|Q8NCK9	Silent	SNP	ENST00000381883.2	37	CCDS34981.1																																																																																			.		0.731	PPAPDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051567.1	NM_203453	
FANCG	2189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35077002	35077002	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:35077002A>G	ENST00000378643.3	-	6	1234	c.743T>C	c.(742-744)gTg>gCg	p.V248A	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	248					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TGCTGTGTACACCTGGACCAA	0.527			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																													p.V248A		.	yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	.	FANCG-724	0			c.T743C						.						90.0	94.0	93.0					9																	35077002		2203	4300	6503	SO:0001583	missense	2189	exon6			GTGTACACCTGGA	AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.743T>C	9.37:g.35077002A>G	ENSP00000367910:p.Val248Ala	Somatic	129	1		WXS	Illumina HiSeq	Phase_I	106	28	NM_004629	0	0	0	0	0		Missense_Mutation	SNP	ENST00000378643.3	37	CCDS6574.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.227799	0.79576	.	.	ENSG00000221829	ENST00000378643;ENST00000543657	T	0.32272	1.46	6.07	6.07	0.98685	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.50292	0.1607	L	0.60455	1.87	0.34793	D	0.735929	D	0.76494	0.999	D	0.69654	0.965	T	0.64179	-0.6468	9	0.72032	D	0.01	-23.4289	13.0206	0.58784	1.0:0.0:0.0:0.0	.	248	O15287	FANCG_HUMAN	A	248	ENSP00000367910:V248A	ENSP00000367910:V248A	V	-	2	0	FANCG	35067002	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.582000	0.60957	2.326000	0.78906	0.533000	0.62120	GTG	.		0.527	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052269.1	NM_004629	
TLE4	7091	broad.mit.edu	37	9	82267584	82267584	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:82267584A>G	ENST00000376552.2	+	7	1485	c.467A>G	c.(466-468)cAg>cGg	p.Q156R	TLE4_ENST00000376537.4_Missense_Mutation_p.Q156R|TLE4_ENST00000376534.4_5'UTR|TLE4_ENST00000455913.1_3'UTR|TLE4_ENST00000376520.4_Missense_Mutation_p.Q156R|TLE4_ENST00000265284.6_Missense_Mutation_p.Q131R|TLE4_ENST00000376544.3_Missense_Mutation_p.Q156R	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	156	Gly/Pro-rich (GP domain).				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TCAGGGCTCCAGCCCCCTGCC	0.537																																					p.Q156R													.	TLE4-524	0			c.A467G						.						89.0	97.0	95.0					9																	82267584		1998	4152	6150	SO:0001583	missense	7091	exon7			GGCTCCAGCCCCC	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.467A>G	9.37:g.82267584A>G	ENSP00000365735:p.Gln156Arg	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	145	4	NM_007005	0	0	0	0	0	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	ENST00000376552.2	37	CCDS43837.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.184277	0.57800	.	.	ENSG00000106829	ENST00000376552;ENST00000376544;ENST00000376520;ENST00000399288;ENST00000435650;ENST00000376537;ENST00000265284;ENST00000425506;ENST00000428713;ENST00000490347	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.83;0.91;0.88;0.91;0.89;0.88;1.47;1.83	6.04	4.89	0.63831	.	0.055536	0.64402	D	0.000001	T	0.53642	0.1809	M	0.79475	2.455	0.80722	D	1	B;B;B;B	0.29571	0.249;0.027;0.042;0.028	B;B;B;B	0.35813	0.211;0.009;0.028;0.082	T	0.52823	-0.8524	10	0.42905	T	0.14	-13.7371	13.4934	0.61408	0.8695:0.1305:0.0:0.0	.	131;156;156;156	F8W6T6;Q04727-2;Q04727-3;Q04727	.;.;.;TLE4_HUMAN	R	156;156;156;170;170;156;131;154;141;26	ENSP00000365735:Q156R;ENSP00000365727:Q156R;ENSP00000365703:Q156R;ENSP00000415423:Q170R;ENSP00000365720:Q156R;ENSP00000265284:Q131R;ENSP00000412567:Q154R;ENSP00000409313:Q141R;ENSP00000417844:Q26R	ENSP00000265284:Q131R	Q	+	2	0	TLE4	81457404	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	5.401000	0.66326	1.079000	0.41038	0.460000	0.39030	CAG	.		0.537	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	
SMC2	10592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	106862707	106862707	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:106862707T>C	ENST00000286398.7	+	7	917	c.629T>C	c.(628-630)tTa>tCa	p.L210S	SMC2_ENST00000374793.3_Missense_Mutation_p.L210S|SMC2_ENST00000303219.8_Missense_Mutation_p.L210S|SMC2_ENST00000374787.3_Missense_Mutation_p.L210S	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	210					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						ATTCAAAAATTAAAAGAGGTA	0.274																																					p.L210S		.											.	SMC2-210	0			c.T629C						.						37.0	45.0	42.0					9																	106862707		2179	4270	6449	SO:0001583	missense	10592	exon7			AAAAATTAAAAGA	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.629T>C	9.37:g.106862707T>C	ENSP00000286398:p.Leu210Ser	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	118	35	NM_006444	0	0	0	0	0	Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	37	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.465044	0.84425	.	.	ENSG00000136824	ENST00000286398;ENST00000440179;ENST00000374793;ENST00000303219;ENST00000536893;ENST00000374787	T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78	5.57	5.57	0.84162	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.44095	0.1277	M	0.93898	3.47	0.52501	D	0.999959	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.57940	-0.7724	10	0.87932	D	0	-5.7921	14.5587	0.68120	0.0:0.0:0.0:1.0	.	210;210;210	A8K984;O95347;Q2KQ72	.;SMC2_HUMAN;.	S	210;65;210;210;210;210	ENSP00000286398:L210S;ENSP00000414999:L65S;ENSP00000363925:L210S;ENSP00000306152:L210S;ENSP00000363919:L210S	ENSP00000286398:L210S	L	+	2	0	SMC2	105902528	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.677000	0.84024	2.109000	0.64355	0.528000	0.53228	TTA	.		0.274	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		
PTGR1	22949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	114359672	114359672	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:114359672T>G	ENST00000407693.2	-	2	293	c.31A>C	c.(31-33)Aag>Cag	p.K11Q	PTGR1_ENST00000538962.1_Missense_Mutation_p.K11Q|PTGR1_ENST00000238248.3_5'UTR|PTGR1_ENST00000309195.5_Missense_Mutation_p.K11Q	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	11					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						ACAAAGTGCTTCTTCAGGGTC	0.403																																					p.K11Q	Ovarian(200;132 2151 7551 19220 46064)	.											.	PTGR1-90	0			c.A31C						.						109.0	95.0	100.0					9																	114359672		2203	4300	6503	SO:0001583	missense	22949	exon2			AGTGCTTCTTCAG	D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.31A>C	9.37:g.114359672T>G	ENSP00000385763:p.Lys11Gln	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	35	15	NM_001146108	0	0	0	0	0	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Missense_Mutation	SNP	ENST00000407693.2	37	CCDS6779.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.483746	0.26598	.	.	ENSG00000106853	ENST00000538962;ENST00000309195;ENST00000407693;ENST00000333580;ENST00000422125;ENST00000374313;ENST00000374308	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	4.62	4.62	0.57501	GroES-like (1);	0.092047	0.85682	D	0.000000	T	0.43656	0.1257	M	0.62154	1.92	0.80722	D	1	B;B;B	0.33171	0.4;0.278;0.077	B;B;B	0.29440	0.102;0.061;0.015	T	0.46665	-0.9175	10	0.48119	T	0.1	2.0981	12.2191	0.54423	0.0:0.0:0.0:1.0	.	11;11;11	F5GY50;B4DPK3;Q14914	.;.;PTGR1_HUMAN	Q	11	ENSP00000440281:K11Q;ENSP00000311572:K11Q;ENSP00000385763:K11Q;ENSP00000395965:K11Q	ENSP00000311572:K11Q	K	-	1	0	PTGR1	113399493	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	2.756000	0.47549	2.020000	0.59435	0.374000	0.22700	AAG	.		0.403	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2		
GAPVD1	26130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	128064468	128064468	+	Missense_Mutation	SNP	C	C	T	rs139510593		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:128064468C>T	ENST00000495955.1	+	5	682	c.392C>T	c.(391-393)aCa>aTa	p.T131I	GAPVD1_ENST00000265956.4_Missense_Mutation_p.T131I|GAPVD1_ENST00000394105.2_Missense_Mutation_p.T131I|GAPVD1_ENST00000394084.1_Missense_Mutation_p.T131I|GAPVD1_ENST00000470056.1_Missense_Mutation_p.T131I|GAPVD1_ENST00000394104.2_Missense_Mutation_p.T131I|GAPVD1_ENST00000312123.9_Missense_Mutation_p.T131I|GAPVD1_ENST00000394083.2_Missense_Mutation_p.T131I|GAPVD1_ENST00000297933.6_Missense_Mutation_p.T131I|RNU6-1020P_ENST00000363684.1_RNA			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	131	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GTTATTTACACAGTTTTTACC	0.388																																					p.T131I		.											.	GAPVD1-93	0			c.C392T						.						144.0	144.0	144.0					9																	128064468		2203	4300	6503	SO:0001583	missense	26130	exon3			TTTACACAGTTTT		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.392C>T	9.37:g.128064468C>T	ENSP00000419063:p.Thr131Ile	Somatic	260	1		WXS	Illumina HiSeq	Phase_I	243	75	NM_015635	0	0	0	0	0	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	37		.	.	.	.	.	.	.	.	.	.	C	18.27	3.585977	0.66105	.	.	ENSG00000165219	ENST00000394084;ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	D;D;D;D;D;D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;-1.5	5.84	5.84	0.93424	Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	D	0.86900	0.6044	L	0.44542	1.39	0.80722	D	1	P;P;P;P;D;B	0.69078	0.649;0.762;0.762;0.762;0.997;0.226	B;B;B;B;D;B	0.78314	0.219;0.391;0.391;0.391;0.991;0.103	D	0.86666	0.1907	10	0.56958	D	0.05	.	19.1433	0.93455	0.0:1.0:0.0:0.0	.	131;131;131;131;131;131	Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6;B0QZ65	GAPD1_HUMAN;.;.;.;.;.	I	131	ENSP00000377646:T131I;ENSP00000419767:T131I;ENSP00000377665:T131I;ENSP00000377664:T131I;ENSP00000265956:T131I;ENSP00000377645:T131I;ENSP00000419063:T131I;ENSP00000418747:T131I;ENSP00000297933:T131I;ENSP00000309582:T131I	ENSP00000265956:T131I	T	+	2	0	GAPVD1	127104289	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.516000	0.67055	2.760000	0.94817	0.655000	0.94253	ACA	C|1.000;G|0.000		0.388	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
DNM1	1759	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131010868	131010868	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:131010868G>A	ENST00000372923.3	+	19	2004	c.1912G>A	c.(1912-1914)Gag>Aag	p.E638K	DNM1_ENST00000475805.1_Missense_Mutation_p.E638K|DNM1_ENST00000393594.3_Missense_Mutation_p.E638K|DNM1_ENST00000486160.1_Missense_Mutation_p.E638K|DNM1_ENST00000341179.7_Missense_Mutation_p.E638K	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	638					endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						GCAGGCCAGCGAGACCGAGGA	0.597																																					.	GBM(113;146 1575 2722 28670 29921)												.	DNM1-228	0			.						.						84.0	71.0	76.0					9																	131010868		2203	4300	6503	SO:0001583	missense	1759	.			GCCAGCGAGACCG	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1912G>A	9.37:g.131010868G>A	ENSP00000362014:p.Glu638Lys	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	84	26	.	0	0	0	0	0	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	ENST00000372923.3	37	CCDS6895.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269545	0.40095	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393594;ENST00000486160;ENST00000543158	D;D;D;D;D	0.92858	-3.12;-3.12;-3.11;-3.12;-3.11	4.67	4.67	0.58626	.	0.211412	0.41605	N	0.000846	T	0.80829	0.4698	N	0.08118	0	0.58432	D	0.999999	B;B;B	0.32382	0.118;0.188;0.368	B;B;B	0.19148	0.011;0.024;0.017	T	0.80139	-0.1507	10	0.10111	T	0.7	-4.3209	17.7725	0.88497	0.0:0.0:1.0:0.0	.	638;638;577	Q05193;Q05193-3;B4DHH5	DYN1_HUMAN;.;.	K	638;638;638;638;638;183	ENSP00000419225:E638K;ENSP00000345680:E638K;ENSP00000362014:E638K;ENSP00000377219:E638K;ENSP00000420045:E638K	ENSP00000345680:E638K	E	+	1	0	DNM1	130050689	1.000000	0.71417	0.972000	0.41901	0.505000	0.33919	5.485000	0.66850	2.439000	0.82584	0.650000	0.86243	GAG	.		0.597	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1	NM_004408	
CERCAM	51148	broad.mit.edu	37	9	131196837	131196837	+	Missense_Mutation	SNP	C	C	T	rs372372318		TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr9:131196837C>T	ENST00000372838.4	+	11	1878	c.1480C>T	c.(1480-1482)Cgc>Tgc	p.R494C	RP11-339B21.10_ENST00000610052.1_RNA|CERCAM_ENST00000372842.1_Missense_Mutation_p.R416C	NM_016174.4	NP_057258.3	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule	494					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|pancreas(2)	20						ACAGCCTCTGCGCCGCATGCT	0.697																																					p.R494C													.	CERCAM-69	0			c.C1480T						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	45.0	46.0	46.0		1480	3.3	0.8	9		46	0,8598		0,0,4299	no	missense	CERCAM	NM_016174.4	180	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	494/596	131196837	1,13003	2203	4299	6502	SO:0001583	missense	51148	exon11			CCTCTGCGCCGCA	AB040935	CCDS6901.2, CCDS69675.1	9q34.13	2008-02-05	2007-10-17	2007-10-17	ENSG00000167123	ENSG00000167123			23723	protein-coding gene	gene with protein product	"""glycosyltransferase 25 domain containing 3"""		"""cerebral cell adhesion molecule"""	CEECAM1		10608765	Standard	NM_016174		Approved	GLT25D3, CerCAM	uc004buz.4	Q5T4B2	OTTHUMG00000020747	ENST00000372838.4:c.1480C>T	9.37:g.131196837C>T	ENSP00000361929:p.Arg494Cys	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	76	3	NM_016174	0	0	0	0	0	A7MD00|C4AMA2|Q0VDF3|Q2VPJ4|Q4KMP2|Q5T4B1|Q8N107|Q96EZ5|Q9P226|Q9UMW5	Missense_Mutation	SNP	ENST00000372838.4	37	CCDS6901.2	.	.	.	.	.	.	.	.	.	.	C	17.14	3.312444	0.60414	2.27E-4	0.0	ENSG00000167123	ENST00000372842;ENST00000372838;ENST00000413863	T;T	0.78481	-1.17;-1.18	5.25	3.27	0.37495	.	0.508491	0.20924	N	0.083222	T	0.67183	0.2866	N	0.25485	0.75	0.22034	N	0.999409	P	0.50272	0.933	P	0.50109	0.631	T	0.60078	-0.7333	10	0.56958	D	0.05	-18.147	1.5153	0.02504	0.1665:0.4399:0.2147:0.1788	.	494	Q5T4B2	GT253_HUMAN	C	416;494;447	ENSP00000361933:R416C;ENSP00000361929:R494C	ENSP00000361929:R494C	R	+	1	0	CERCAM	130236658	0.000000	0.05858	0.795000	0.32087	0.602000	0.36980	0.315000	0.19451	1.118000	0.41863	0.549000	0.68633	CGC	.		0.697	CERCAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054435.2	NM_016174	
EIF2S3	1968	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	24089815	24089815	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chrX:24089815C>T	ENST00000253039.4	+	10	1406	c.1153C>T	c.(1153-1155)Cgc>Tgc	p.R385C		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	385					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						TCTAGGTGTACGCACTGAAGG	0.403																																					p.R385C		.											.	EIF2S3-130	0			c.C1153T						.						37.0	37.0	37.0					X																	24089815		2203	4298	6501	SO:0001583	missense	1968	exon10			GGTGTACGCACTG	L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.1153C>T	X.37:g.24089815C>T	ENSP00000253039:p.Arg385Cys	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	46	30	NM_001415	0	0	0	0	0	B5BTZ4	Missense_Mutation	SNP	ENST00000253039.4	37	CCDS14210.1	.	.	.	.	.	.	.	.	.	.	c	27.8	4.868409	0.91587	.	.	ENSG00000130741	ENST00000253039	T	0.65549	-0.16	4.95	4.95	0.65309	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation initiation factor 2, gamma subunit, C-terminal (1);	0.052313	0.85682	D	0.000000	T	0.78830	0.4345	M	0.91972	3.26	0.80722	D	1	D	0.56746	0.977	P	0.52109	0.69	D	0.85370	0.1113	10	0.87932	D	0	.	17.6111	0.88053	0.0:1.0:0.0:0.0	.	385	P41091	IF2G_HUMAN	C	385	ENSP00000253039:R385C	ENSP00000253039:R385C	R	+	1	0	EIF2S3	23999736	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.363000	0.79516	2.175000	0.68902	0.597000	0.82753	CGC	.		0.403	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056079.1	NM_001415	
KDM6A	7403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	44949021	44949021	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chrX:44949021G>A	ENST00000377967.4	+	25	3623	c.3582G>A	c.(3580-3582)tgG>tgA	p.W1194*	KDM6A_ENST00000536777.1_Nonsense_Mutation_p.W1149*|KDM6A_ENST00000543216.1_Nonsense_Mutation_p.W1115*|KDM6A_ENST00000382899.4_Nonsense_Mutation_p.W1201*	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1194	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.W1194*(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						GTTCTTGGTGGCCCAATCTTG	0.368			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.W1194X	Colon(129;1273 1667 15230 27352 52914)	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A-2748	7	Whole gene deletion(6)|Substitution - Nonsense(1)	oesophagus(2)|breast(2)|pancreas(2)|urinary_tract(1)	c.G3582A						.						115.0	98.0	103.0					X																	44949021		2203	4300	6503	SO:0001587	stop_gained	7403	exon25			TTGGTGGCCCAAT	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3582G>A	X.37:g.44949021G>A	ENSP00000367203:p.Trp1194*	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	37	29	NM_021140	0	0	0	0	0	Q52LL9|Q5JVQ7	Nonsense_Mutation	SNP	ENST00000377967.4	37	CCDS14265.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.566749|7.566749	0.98361|0.98361	.|.	.|.	ENSG00000147050|ENSG00000147050	ENST00000414389;ENST00000433797|ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216	.|.	.|.	.|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.45538|.	0.1347|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.42258|.	-0.9462|.	3|.	.|0.02654	.|T	.|1	-5.5328|-5.5328	17.8727|17.8727	0.88815|0.88815	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	T|X	792;837|891;1194;1149;1201;1115	.|.	.|ENSP00000334340:W891X	A|W	+|+	1|3	0|0	KDM6A|KDM6A	44833965|44833965	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.358000|9.358000	0.97109|0.97109	2.153000|2.153000	0.67306|0.67306	0.468000|0.468000	0.43344|0.43344	GCC|TGG	.		0.368	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
ELF4	2000	hgsc.bcm.edu	37	X	129201251	129201251	+	Silent	SNP	A	A	G			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chrX:129201251A>G	ENST00000308167.5	-	9	1816	c.1437T>C	c.(1435-1437)gcT>gcC	p.A479A	ELF4_ENST00000335997.7_Silent_p.A479A	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						GAATCAGTGGAGCCCCTGGGG	0.642			T	ERG	AML																																p.A479A		.		Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	.	ELF4-659	0			c.T1437C						.						28.0	31.0	30.0					X																	129201251		2202	4298	6500	SO:0001819	synonymous_variant	2000	exon9			CAGTGGAGCCCCT	U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.1437T>C	X.37:g.129201251A>G		Somatic	46	0		WXS	Illumina HiSeq	Phase_I	47	3	NM_001421	0	0	0	0	0		Silent	SNP	ENST00000308167.5	37	CCDS14617.1																																																																																			.		0.642	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058243.1	NM_001421	
IL9R	3581	hgsc.bcm.edu	37	X	155239602	155239602	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chrX:155239602G>A	ENST00000244174.5	+	9	1273	c.1094G>A	c.(1093-1095)cGt>cAt	p.R365H	IL9R_ENST00000424344.3_Missense_Mutation_p.R344H|IL9R_ENST00000540897.1_3'UTR|IL9R_ENST00000369423.2_3'UTR	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	365			R -> H (in dbSNP:rs2228650).		cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GGCCCAGCGCGTCCTTGGAAA	0.662																																					p.R365H		.											.	IL9R-40	0			c.G1094A						.						42.0	70.0	62.0					X																	155239602		1941	4257	6198	SO:0001583	missense	3581	exon9			CAGCGCGTCCTTG	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.1094G>A	X.37:g.155239602G>A	ENSP00000244174:p.Arg365His	Somatic	76	2		WXS	Illumina HiSeq	Phase_I	76	5	NM_002186	0	0	0	0	0	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	130	0.05952380952380952	42	0.08536585365853659	11	0.03038674033149171	50	0.08741258741258741	27	0.03562005277044855	N	0.057	-1.234707	0.01505	.	.	ENSG00000124334	ENST00000244174;ENST00000424344	T;T	0.10099	2.91;2.91	1.44	0.201	0.15186	.	5.140280	0.00520	N	0.000181	T	0.00241	0.0007	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32481	-0.9905	9	0.13470	T	0.59	-9.2578	3.2156	0.06697	0.7419:0.0:0.2581:0.0	.	365	Q01113	IL9R_HUMAN	H	365;344	ENSP00000244174:R365H;ENSP00000388918:R344H	ENSP00000244174:R365H	R	+	2	0	IL9R	154892796	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.579000	0.05834	-0.003000	0.14444	-1.144000	0.01866	CGT	G|1.000;|0.000		0.662	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	
NPS	594857	broad.mit.edu;bcgsc.ca	37	10	129350829	129350829	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr10:129350829delT	ENST00000398023.1	+	3	216	c.196delT	c.(196-198)tttfs	p.F66fs		NM_001030013.1	NP_001025184.1	P0C0P6	NPS_HUMAN	neuropeptide S	66					neuropeptide signaling pathway (GO:0007218)|positive regulation of action potential (GO:0045760)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|visual learning (GO:0008542)	extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|lung(4)	5						GGAGAAGATGTTTGTGAAAAG	0.413																																					p.F66fs													.	NPS-22	0			c.196delT						.						204.0	199.0	201.0					10																	129350829		1843	4101	5944	SO:0001589	frameshift_variant	594857	exon3			AAGATGTTTGTGA	BC148465	CCDS41577.1	10q26.2	2013-02-26			ENSG00000214285	ENSG00000214285		"""Endogenous ligands"""	33940	protein-coding gene	gene with protein product	"""prepro-neuropeptide S"""	609513				18181564, 15312648	Standard	NM_001030013		Approved		uc001ljx.1	P0C0P6		ENST00000398023.1:c.196delT	10.37:g.129350829delT	ENSP00000381105:p.Phe66fs	Somatic	413	0		WXS	Illumina HiSeq	Phase_I	339	47	NM_001030013	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000398023.1	37	CCDS41577.1																																																																																			.		0.413	NPS-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001030013	
HMGB1	3146	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	31036836	31036836	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr13:31036836delG	ENST00000405805.1	-	4	1250	c.310delC	c.(310-312)ctcfs	p.L104fs	HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000399494.1_Frame_Shift_Del_p.L104fs|HMGB1_ENST00000399489.1_Frame_Shift_Del_p.L104fs|HMGB1_ENST00000326004.4_Frame_Shift_Del_p.L104fs|HMGB1_ENST00000339872.4_Frame_Shift_Del_p.L104fs|HMGB1_ENST00000341423.5_Frame_Shift_Del_p.L104fs			P09429	HMGB1_HUMAN	high mobility group box 1	104					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		GAGCAGAAGAGGAAGAAGGCC	0.378																																					p.L104fs		.											.	HMGB1-227	0			c.310delC						.						42.0	43.0	43.0					13																	31036836		2183	4287	6470	SO:0001589	frameshift_variant	3146	exon4			.	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.310delC	13.37:g.31036836delG	ENSP00000384678:p.Leu104fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	82	19	NM_002128	0	0	0	0	0	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Frame_Shift_Del	DEL	ENST00000405805.1	37	CCDS9335.1																																																																																			.		0.378	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303998.2	NM_002128	
ZNF543	125919	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	57839185	57839185	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:57839185delG	ENST00000321545.4	+	4	700	c.355delG	c.(355-357)gggfs	p.G119fs		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	119					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CTCCCAATTAGGGCAATCCAA	0.512																																					p.G119fs		.											.	ZNF543-92	0			c.355delG						.						64.0	67.0	66.0					19																	57839185		2203	4300	6503	SO:0001589	frameshift_variant	125919	exon4			.	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.355delG	19.37:g.57839185delG	ENSP00000322545:p.Gly119fs	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	69	15	NM_213598	0	0	0	0	0	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Frame_Shift_Del	DEL	ENST00000321545.4	37	CCDS33130.1																																																																																			.		0.512	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865	
RGS20	8601	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	54764571	54764572	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr8:54764571_54764572delAT	ENST00000297313.3	+	1	204_205	c.112_113delAT	c.(112-114)attfs	p.I38fs	RGS20_ENST00000344277.6_Frame_Shift_Del_p.I38fs	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	38					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			TAATACAGACATTCACCAAATC	0.455																																					p.38_38del		.											.	RGS20-227	0			c.112_113del						.																																			SO:0001589	frameshift_variant	8601	exon1			.	AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.112_113delAT	8.37:g.54764571_54764572delAT	ENSP00000297313:p.Ile38fs	Somatic	126	0		WXS	Illumina HiSeq	Phase_I	119	38	NM_170587	0	0	0	0	0	Q96BG9	Frame_Shift_Del	DEL	ENST00000297313.3	37	CCDS6155.1																																																																																			.		0.455	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1		
RGS20	8601	hgsc.bcm.edu	37	8	54764571	54764573	+	In_Frame_Del	DEL	ATT	ATT	-			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	ATT	ATT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr8:54764571_54764573delATT	ENST00000297313.3	+	1	204_206	c.112_114delATT	c.(112-114)attdel	p.I38del	RGS20_ENST00000344277.6_In_Frame_Del_p.I38del	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	38					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			TAATACAGACATTCACCAAATCA	0.453																																					p.38_38del		.											.	RGS20-227	0			c.112_114del						.																																			SO:0001651	inframe_deletion	8601	exon1			.	AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.112_114delATT	8.37:g.54764571_54764573delATT	ENSP00000297313:p.Ile38del	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	121	21	NM_170587	0	0	0	0	0	Q96BG9	In_Frame_Del	DEL	ENST00000297313.3	37	CCDS6155.1																																																																																			.		0.453	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1		
ZFP14	57677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36831480	36831481	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:36831480_36831481GC>AT	ENST00000270001.7	-	5	1362_1363	c.1247_1248GC>AT	c.(1246-1248)aGC>aAT	p.S416N		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					CAATATGAATGCTCTGGTGTGA	0.416																																					p.S416N		.											.	ZFP14	0			c.G1247A						.																																			SO:0001583	missense	57677	exon5			TGAATGCTCTGGT	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.1247_1248delinsAT	19.37:g.36831480_36831481delinsAT	ENSP00000270001:p.Ser416Asn	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	53.0		0	0	0	0	0	A7MD23	Missense_Mutation	DNP	ENST00000270001.7	37	CCDS33002.1																																																																																			.		0.416	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917	
FCGBP	8857	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	40395905	40395906	+	Missense_Mutation	DNP	TC	TC	GT			TCGA-BQ-5886-01A-11D-1589-08	TCGA-BQ-5886-11A-01D-1589-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	74be0abf-970a-477d-aa8c-7982e32b739f	9d0a86f4-1735-4a01-8c16-37b05d7bc326	g.chr19:40395905_40395906TC>GT	ENST00000221347.6	-	15	7498_7499	c.7491_7492GA>AC	c.(7489-7494)gaGAac>gaACac	p.N2498H		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2498	VWFD 6. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CAGGCCACGTTCTCCTGCAGGA	0.629																																					p.N2498H		.											.	FCGBP	0			c.G7491A						.																																			SO:0001583	missense	8857	exon15			CACGTTCTCCTGC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.7491_7492delinsGT	19.37:g.40395905_40395906delinsGT	ENSP00000221347:p.Asn2498His	Somatic	397.0	1.0		WXS	Illumina HiSeq	Phase_I	414.0	50.0		0	0	0	0	0	O95784	Missense_Mutation	DNP	ENST00000221347.6	37	CCDS12546.1																																																																																			.		0.629	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
