#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	34180229	34180229	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr1:34180229C>T	ENST00000373381.4	-	21	3540	c.3364G>A	c.(3364-3366)Ggc>Agc	p.G1122S		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1082	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CGCCGTCTGCCCCCCAGGCAC	0.607																																					p.G1082S		.											.	CSMD2-103	0			c.G3244A						.						120.0	136.0	131.0					1																	34180229		2203	4300	6503	SO:0001583	missense	114784	exon21			GTCTGCCCCCCAG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.3364G>A	1.37:g.34180229C>T	ENSP00000362479:p.Gly1122Ser	Somatic	302	0		WXS	Illumina HiSeq	Phase_I	106	71	NM_052896	0	0	0	0	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	C	36	5.810255	0.96975	.	.	ENSG00000121904	ENST00000373381	T	0.24151	1.87	5.85	5.85	0.93711	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.48040	0.1478	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	0.998;1.0	T	0.21075	-1.0256	10	0.46703	T	0.11	.	19.1531	0.93496	0.0:1.0:0.0:0.0	.	1082;1122	Q7Z408;E7EUA6	CSMD2_HUMAN;.	S	1122	ENSP00000362479:G1122S	ENSP00000241312:G1082S	G	-	1	0	CSMD2	33952816	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.818000	0.86416	2.753000	0.94483	0.655000	0.94253	GGC	.		0.607	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
FUBP1	8880	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	78444626	78444626	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr1:78444626G>A	ENST00000370768.2	-	1	144	c.63C>T	c.(61-63)ggC>ggT	p.G21G	FUBP1_ENST00000436586.2_Silent_p.G21G|FUBP1_ENST00000370767.1_Silent_p.G21G	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	21	Gly-rich.				positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						caccaccaccgccgccaccac	0.602			"""F, N"""		oligodendroglioma																																p.G21G		.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1-227	0			c.C63T						.						39.0	46.0	43.0					1																	78444626		2203	4300	6503	SO:0001819	synonymous_variant	8880	exon1			ACCACCGCCGCCA	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.63C>T	1.37:g.78444626G>A		Somatic	90	1		WXS	Illumina HiSeq	Phase_I	42	27	NM_003902	0	0	0	0	0	Q12828	Silent	SNP	ENST00000370768.2	37	CCDS683.1																																																																																			.		0.602	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
ENSA	2029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150601936	150601936	+	Missense_Mutation	SNP	T	T	G	rs148754482		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr1:150601936T>G	ENST00000369014.5	-	1	136	c.11A>C	c.(10-12)aAa>aCa	p.K4T	ENSA_ENST00000369009.3_Missense_Mutation_p.K4T|ENSA_ENST00000513281.1_5'Flank|ENSA_ENST00000503241.1_Missense_Mutation_p.K4T|ENSA_ENST00000361532.5_5'Flank|ENSA_ENST00000356527.5_Missense_Mutation_p.K4T|ENSA_ENST00000354702.3_5'Flank|ENSA_ENST00000369016.4_Missense_Mutation_p.K4T|ENSA_ENST00000271690.8_Missense_Mutation_p.K4T|ENSA_ENST00000361631.5_5'Flank|ENSA_ENST00000503345.1_Missense_Mutation_p.K4T|ENSA_ENST00000339643.5_Missense_Mutation_p.K4T|ENSA_ENST00000362052.7_Missense_Mutation_p.K4T			O43768	ENSA_HUMAN	endosulfine alpha	4					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|regulation of catalytic activity (GO:0050790)|regulation of insulin secretion (GO:0050796)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|transport (GO:0006810)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ion channel inhibitor activity (GO:0008200)|phosphatase inhibitor activity (GO:0019212)|potassium channel inhibitor activity (GO:0019870)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)	4	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;9.85e-23)|all cancers(9;5.06e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.67e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000701)|LUSC - Lung squamous cell carcinoma(543;0.171)			TTCTTCTTGTTTCTGGGACAT	0.662																																					p.K4T	Esophageal Squamous(188;763 2078 3002 3411 26027)	.											.	ENSA-90	0			c.A11C						.						59.0	61.0	60.0					1																	150601936		2203	4300	6503	SO:0001583	missense	2029	exon1			TCTTGTTTCTGGG	X99906	CCDS958.1, CCDS959.1, CCDS960.1, CCDS961.1, CCDS962.1, CCDS963.1, CCDS964.1, CCDS965.1	1q21.3	2010-03-11			ENSG00000143420	ENSG00000143420			3360	protein-coding gene	gene with protein product		603061				9653196	Standard	NM_004436		Approved	MGC4319, MGC8394, MGC78563, ARPP-19e	uc001eve.3	O43768	OTTHUMG00000035004	ENST00000369014.5:c.11A>C	1.37:g.150601936T>G	ENSP00000358010:p.Lys4Thr	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	76	35	NM_207044	1	0	60	122	61	A8K1Z9|E9PB69|Q5T5H2|Q68D48|Q6FHW0|Q6IAM4|Q6NUL2|Q6VUC6|Q6VUC7|Q6VUC8|Q6VUC9|Q6VUD0|Q6VUD1|Q9NRZ0	Missense_Mutation	SNP	ENST00000369014.5	37	CCDS958.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543606	0.65198	.	.	ENSG00000143420	ENST00000369016;ENST00000369014;ENST00000369009;ENST00000339643;ENST00000271690;ENST00000356527;ENST00000502246;ENST00000503345;ENST00000503241;ENST00000362052	T	0.46063	0.88	5.78	3.46	0.39613	.	0.177686	0.48286	D	0.000183	T	0.26702	0.0653	L	0.40543	1.245	0.33054	D	0.533083	D;P;D;P;D	0.76494	0.999;0.728;0.982;0.534;0.99	P;B;P;B;P	0.60012	0.867;0.372;0.628;0.154;0.794	T	0.06679	-1.0813	10	0.16420	T	0.52	.	5.8762	0.18830	0.1492:0.0804:0.0:0.7704	.	4;4;4;4;4	A6NMQ3;O43768-8;E9PB69;O43768;O43768-3	.;.;.;ENSA_HUMAN;.	T	4	ENSP00000358012:K4T	ENSP00000271690:K4T	K	-	2	0	ENSA	148868560	1.000000	0.71417	0.998000	0.56505	0.671000	0.39405	3.104000	0.50306	1.004000	0.39156	-0.710000	0.03640	AAA	T|1.000;C|0.000		0.662	ENSA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000084720.2	NM_207042	
HORMAD1	84072	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150689613	150689613	+	Splice_Site	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr1:150689613C>T	ENST00000361824.2	-	3	284		c.e3+1		HORMAD1_ENST00000322343.7_Splice_Site|HORMAD1_ENST00000476530.1_Splice_Site|HORMAD1_ENST00000368993.2_Splice_Site|HORMAD1_ENST00000368995.4_Splice_Site	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1						blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TATTGTATTACCATCTAGATA	0.294																																					.													.	HORMAD1-92	0			c.178+1G>A						.						59.0	60.0	59.0					1																	150689613		2203	4300	6503	SO:0001630	splice_region_variant	84072	exon4			GTATTACCATCTA	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.178+1G>A	1.37:g.150689613C>T		Somatic	95	0		WXS	Illumina HiSeq	Phase_I	71	25	NM_032132	0	0	0	0	0	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Splice_Site	SNP	ENST00000361824.2	37	CCDS967.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354851	0.82243	.	.	ENSG00000143452	ENST00000368995;ENST00000368993;ENST00000368992;ENST00000540570;ENST00000322343;ENST00000361824;ENST00000368987;ENST00000442853	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8768	0.88827	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HORMAD1	148956237	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.100000	0.76989	2.554000	0.86153	0.460000	0.39030	.	.		0.294	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084722.1	NM_032132	Intron
FMO2	2327	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	171174553	171174553	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr1:171174553C>A	ENST00000209929.7	+	7	1121	c.963C>A	c.(961-963)aaC>aaA	p.N321K	RP1-127D3.4_ENST00000422841.1_RNA|RP1-127D3.4_ENST00000445909.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA|FMO2_ENST00000529935.1_3'UTR|FMO2_ENST00000441535.1_Missense_Mutation_p.N321K			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	320					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGGAGGAGAACATTGATGTCA	0.398																																					p.N321K													.	FMO2-91	0			c.C963A						.						106.0	102.0	104.0					1																	171174553		2203	4300	6503	SO:0001583	missense	2327	exon7			GGAGAACATTGAT	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.963C>A	1.37:g.171174553C>A	ENSP00000209929:p.Asn321Lys	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	52	15	NM_001460	0	0	6	7	1	Q53XR0	Missense_Mutation	SNP	ENST00000209929.7	37	CCDS1293.1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.277366	0.23307	.	.	ENSG00000094963	ENST00000209929;ENST00000441535	T;T	0.52754	0.65;0.65	5.67	3.79	0.43588	.	0.506226	0.24781	N	0.035643	T	0.14830	0.0358	L	0.35644	1.08	0.29886	N	0.82557	B	0.10296	0.003	B	0.18263	0.021	T	0.15122	-1.0448	10	0.26408	T	0.33	-8.1593	5.2666	0.15603	0.0:0.6183:0.1527:0.2289	.	321	Q99518	FMO2_HUMAN	K	321	ENSP00000209929:N321K;ENSP00000405905:N321K	ENSP00000209929:N321K	N	+	3	2	FMO2	169441177	0.004000	0.15560	0.900000	0.35374	0.779000	0.44077	-0.206000	0.09398	0.733000	0.32492	-0.137000	0.14449	AAC	.		0.398	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086216.2	NM_001460	
LAMB3	3914	hgsc.bcm.edu	37	1	209801450	209801450	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr1:209801450C>G	ENST00000356082.4	-	11	1352	c.1218G>C	c.(1216-1218)caG>caC	p.Q406H	LAMB3_ENST00000391911.1_Missense_Mutation_p.Q406H|LAMB3_ENST00000367030.3_Missense_Mutation_p.Q406H	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	406	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		AGCGCTCTCCCTGCACATGCT	0.642											OREG0014217	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q406H		.											.	LAMB3-156	0			c.G1218C						.						64.0	45.0	52.0					1																	209801450		2201	4299	6500	SO:0001583	missense	3914	exon11			CTCTCCCTGCACA	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1218G>C	1.37:g.209801450C>G	ENSP00000348384:p.Gln406His	Somatic	12	0	2185	WXS	Illumina HiSeq	Phase_I	15	3	NM_000228	0	0	17	17	0	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816924	0.32145	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.61980	0.06;0.06;0.06	5.12	0.62	0.17637	EGF-like, laminin (4);EGF-like region, conserved site (1);	0.259562	0.39985	N	0.001204	T	0.43612	0.1255	L	0.41356	1.27	0.41635	D	0.989047	B	0.24768	0.111	B	0.20577	0.03	T	0.19549	-1.0302	10	0.42905	T	0.14	.	2.5948	0.04851	0.1375:0.4366:0.2683:0.1575	.	406	Q13751	LAMB3_HUMAN	H	406	ENSP00000375778:Q406H;ENSP00000348384:Q406H;ENSP00000355997:Q406H	ENSP00000348384:Q406H	Q	-	3	2	LAMB3	207868073	0.981000	0.34729	1.000000	0.80357	0.690000	0.40134	0.128000	0.15810	0.231000	0.21079	0.456000	0.33151	CAG	.		0.642	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228	
BMS1	9790	ucsc.edu	37	10	43315737	43315737	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:43315737G>T	ENST00000374518.5	+	16	2697	c.2634G>T	c.(2632-2634)gaG>gaT	p.E878D		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	878					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTCAGTATGAGGGTTTTCGAC	0.433																																					p.E878D													.	BMS1-93	0			c.G2634T						.						120.0	118.0	118.0					10																	43315737		2203	4300	6503	SO:0001583	missense	9790	exon16			GTATGAGGGTTTT	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2634G>T	10.37:g.43315737G>T	ENSP00000363642:p.Glu878Asp	Somatic	117	0		WXS	Illumina HiSeq		112	6	NM_014753	0	0	84	128	44	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.115516	0.77323	.	.	ENSG00000165733	ENST00000374518	T	0.17854	2.25	5.05	-4.55	0.03441	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.38506	0.1043	M	0.92122	3.275	0.47778	D	0.999516	D	0.53462	0.96	P	0.58077	0.832	T	0.53995	-0.8359	10	0.39692	T	0.17	.	13.1374	0.59417	0.6341:0.0:0.3659:0.0	.	878	Q14692	BMS1_HUMAN	D	878	ENSP00000363642:E878D	ENSP00000363642:E878D	E	+	3	2	BMS1	42635743	0.998000	0.40836	0.969000	0.41365	0.964000	0.63967	0.474000	0.22148	-0.725000	0.04901	-0.396000	0.06452	GAG	.		0.433	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
SLC16A9	220963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	61413807	61413807	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:61413807A>G	ENST00000395348.3	-	5	1613	c.977T>C	c.(976-978)cTt>cCt	p.L326P	SLC16A9_ENST00000395347.1_Missense_Mutation_p.L326P	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	326					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						ATCTTCCATAAGTAATGAAGG	0.363																																					p.L326P		.											.	SLC16A9-93	0			c.T977C						.						55.0	52.0	53.0					10																	61413807		2203	4300	6503	SO:0001583	missense	220963	exon5			TCCATAAGTAATG	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.977T>C	10.37:g.61413807A>G	ENSP00000378757:p.Leu326Pro	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	77	29	NM_194298	0	0	67	140	73	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	37	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.362232	0.61403	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.34472	1.36;1.36	4.73	4.73	0.59995	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.164197	0.56097	D	0.000037	T	0.51534	0.1680	L	0.44542	1.39	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.54186	-0.8331	10	0.66056	D	0.02	.	14.2093	0.65755	1.0:0.0:0.0:0.0	.	326	Q7RTY1	MOT9_HUMAN	P	326	ENSP00000378757:L326P;ENSP00000378756:L326P	ENSP00000378756:L326P	L	-	2	0	SLC16A9	61083813	1.000000	0.71417	0.974000	0.42286	0.984000	0.73092	8.962000	0.93254	1.751000	0.51876	0.482000	0.46254	CTT	.		0.363	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
PDLIM1	9124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	96998413	96998413	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:96998413T>G	ENST00000329399.6	-	6	823	c.715A>C	c.(715-717)Agt>Cgt	p.S239R	PDLIM1_ENST00000477757.1_5'UTR	NM_020992.2	NP_066272.1	O00151	PDLI1_HUMAN	PDZ and LIM domain 1	239					regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|skin(2)	10		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		GCTTTAACACTTCTGAATCCT	0.468																																					p.S239R		.											.	PDLIM1-90	0			c.A715C						.						94.0	84.0	87.0					10																	96998413		2203	4300	6503	SO:0001583	missense	9124	exon6			TAACACTTCTGAA	U90878	CCDS7441.1	10q23.1	2008-07-29	2008-07-29		ENSG00000107438	ENSG00000107438			2067	protein-coding gene	gene with protein product	"""carboxyl terminal LIM domain protein 1"", ""elfin"""	605900	"""PDZ and LIM domain 1 (elfin)"""	CLIM1		10861853	Standard	NM_020992		Approved	CLP-36, hCLIM1, CLP36	uc001kkh.4	O00151	OTTHUMG00000018810	ENST00000329399.6:c.715A>C	10.37:g.96998413T>G	ENSP00000360305:p.Ser239Arg	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	66	26	NM_020992	0	0	54	133	79	B2RBS6|Q5VZH5|Q9BPZ9	Missense_Mutation	SNP	ENST00000329399.6	37	CCDS7441.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.985379	0.93044	.	.	ENSG00000107438	ENST00000329399	T	0.22134	1.97	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.45337	0.1337	M	0.85859	2.78	0.80722	D	1	D	0.61697	0.99	P	0.57101	0.813	T	0.53578	-0.8419	10	0.66056	D	0.02	-13.9009	14.2967	0.66318	0.0:0.0:0.0:1.0	.	239	O00151	PDLI1_HUMAN	R	239	ENSP00000360305:S239R	ENSP00000360305:S239R	S	-	1	0	PDLIM1	96988403	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.927000	0.87577	1.978000	0.57642	0.454000	0.30748	AGT	.		0.468	PDLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049508.1		
DNMBP	23268	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	101646325	101646325	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:101646325G>C	ENST00000324109.4	-	13	3441	c.3350C>G	c.(3349-3351)cCc>cGc	p.P1117R	DNMBP_ENST00000472036.1_5'UTR|DNMBP_ENST00000342239.3_Missense_Mutation_p.P1141R|DNMBP_ENST00000540316.1_Missense_Mutation_p.P53R|DNMBP_ENST00000543621.1_Missense_Mutation_p.P363R	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1117	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CAGCTTATGGGGCCCTGTAAA	0.502																																					p.P1117R		.											.	DNMBP-233	0			c.C3350G						.						116.0	115.0	115.0					10																	101646325		2203	4300	6503	SO:0001583	missense	23268	exon13			TTATGGGGCCCTG	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.3350C>G	10.37:g.101646325G>C	ENSP00000315659:p.Pro1117Arg	Somatic	256	0		WXS	Illumina HiSeq	Phase_I	236	80	NM_015221	0	0	5	6	1	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	37	CCDS7485.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.990069	0.93106	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000540316	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.82	5.82	0.92795	BAR (3);	0.000000	0.48286	D	0.000199	T	0.82019	0.4946	M	0.83483	2.645	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.83050	-0.0153	10	0.62326	D	0.03	-22.7596	19.7034	0.96065	0.0:0.0:1.0:0.0	.	1117;363;1141	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	R	1141;1117;363;363;53	ENSP00000344914:P1141R;ENSP00000315659:P1117R;ENSP00000443657:P363R;ENSP00000443573:P53R	ENSP00000315659:P1117R	P	-	2	0	DNMBP	101636315	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.866000	0.99616	2.756000	0.94617	0.561000	0.74099	CCC	.		0.502	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
SLK	9748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105750528	105750528	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:105750528A>G	ENST00000369755.3	+	2	791	c.246A>G	c.(244-246)atA>atG	p.I82M	SLK_ENST00000335753.4_Missense_Mutation_p.I82M	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	82	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AGATTGACATATTAGCATCTT	0.363																																					p.I82M	NSCLC(111;540 1651 1927 4474 17706)	.											.	SLK-549	0			c.A246G						.						132.0	123.0	126.0					10																	105750528		2203	4300	6503	SO:0001583	missense	9748	exon2			TGACATATTAGCA		CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.246A>G	10.37:g.105750528A>G	ENSP00000358770:p.Ile82Met	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	69	29	NM_014720	0	0	6	7	1	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	ENST00000369755.3	37	CCDS7553.1	.	.	.	.	.	.	.	.	.	.	A	17.81	3.480734	0.63849	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.69435	-0.4;-0.4	6.17	-1.34	0.09143	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	L	0.41961	1.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.64067	-0.6494	10	0.42905	T	0.14	.	7.0526	0.25081	0.3492:0.3447:0.0:0.3061	.	82;82	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	M	82	ENSP00000336824:I82M;ENSP00000358770:I82M	ENSP00000336824:I82M	I	+	3	3	SLK	105740518	0.793000	0.28825	0.997000	0.53966	0.966000	0.64601	-0.030000	0.12308	-0.051000	0.13334	-0.313000	0.08912	ATA	.		0.363	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1	NM_014720	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1247945	1247945	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr11:1247945C>G	ENST00000529681.1	+	4	358	c.300C>G	c.(298-300)aaC>aaG	p.N100K	MUC5B_ENST00000447027.1_Missense_Mutation_p.N100K	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	100	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.			FPGLCN -> LPCLCK (in Ref. 2; AAC67545). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCTTTGCAACTACGTGTTCT	0.632																																					p.N100K		.											.	.	0			c.C300G						.						43.0	45.0	44.0					11																	1247945		2150	4262	6412	SO:0001583	missense	727897	exon4			TTGCAACTACGTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.300C>G	11.37:g.1247945C>G	ENSP00000436812:p.Asn100Lys	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	36	7	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	11.67	1.708565	0.30322	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.58797	0.31;0.31	3.68	0.662	0.17880	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.67515	0.2901	L	0.59912	1.85	0.36644	D	0.876996	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.79784	0.958;0.993;0.993	T	0.70513	-0.4851	9	0.87932	D	0	.	8.7992	0.34898	0.0:0.6325:0.0:0.3675	.	100;756;100	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	K	100;100;100;133	ENSP00000436812:N100K;ENSP00000415793:N100K	ENSP00000343037:N100K	N	+	3	2	MUC5B	1204521	1.000000	0.71417	0.993000	0.49108	0.927000	0.56198	0.972000	0.29409	0.261000	0.21753	0.561000	0.74099	AAC	.		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
PRKRIR	5612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	76063689	76063689	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr11:76063689G>C	ENST00000260045.3	-	5	610	c.505C>G	c.(505-507)Cta>Gta	p.L169V	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	169					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						ATTTCAAATAGAGATTTTAGG	0.413																																					p.L169V		.											.	PRKRIR-93	0			c.C505G						.						44.0	39.0	40.0					11																	76063689		2200	4292	6492	SO:0001583	missense	5612	exon5			CAAATAGAGATTT	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.505C>G	11.37:g.76063689G>C	ENSP00000260045:p.Leu169Val	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	29	21	NM_004705	0	0	2	9	7	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	37	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904821	0.33628	.	.	ENSG00000137492	ENST00000260045	.	.	.	4.99	-0.031	0.13911	.	0.157256	0.45606	D	0.000351	T	0.52948	0.1766	M	0.67953	2.075	0.34998	D	0.755717	P	0.46277	0.875	P	0.50082	0.63	T	0.59306	-0.7479	9	0.23302	T	0.38	.	9.0537	0.36392	0.5611:0.0:0.4389:0.0	.	169	O43422	P52K_HUMAN	V	169	.	ENSP00000260045:L169V	L	-	1	2	PRKRIR	75741337	0.470000	0.25854	0.991000	0.47740	0.952000	0.60782	1.098000	0.31000	0.038000	0.15604	0.586000	0.80456	CTA	.		0.413	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
KMT2D	8085	broad.mit.edu	37	12	49436618	49436618	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr12:49436618C>G	ENST00000301067.7	-	26	5687	c.5688G>C	c.(5686-5688)aaG>aaC	p.K1896N		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1896					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CCAGAACATCCTTGAAGAGCT	0.537																																					p.K1896N													.	MLL2-612	0			c.G5688C						.						90.0	88.0	89.0					12																	49436618		2007	4171	6178	SO:0001583	missense	8085	exon26			AACATCCTTGAAG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.5688G>C	12.37:g.49436618C>G	ENSP00000301067:p.Lys1896Asn	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	61	3	NM_003482	0	0	8	8	0	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.656946	0.29425	.	.	ENSG00000167548	ENST00000301067	D	0.81659	-1.52	5.51	3.69	0.42338	.	0.000000	0.38548	N	0.001657	T	0.79873	0.4521	L	0.34521	1.04	0.28594	N	0.909476	D	0.64830	0.994	P	0.57911	0.829	T	0.73855	-0.3851	10	0.87932	D	0	.	9.1354	0.36870	0.0:0.7627:0.0:0.2373	.	1896	O14686	MLL2_HUMAN	N	1896	ENSP00000301067:K1896N	ENSP00000301067:K1896N	K	-	3	2	MLL2	47722885	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.843000	0.48238	0.697000	0.31718	0.561000	0.74099	AAG	.		0.537	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
MON2	23041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	62959064	62959064	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr12:62959064A>G	ENST00000393632.2	+	27	4471	c.4080A>G	c.(4078-4080)atA>atG	p.I1360M	MON2_ENST00000393629.2_Missense_Mutation_p.I1360M|MON2_ENST00000552738.1_Missense_Mutation_p.I1337M|MON2_ENST00000393630.3_Missense_Mutation_p.I1361M|MON2_ENST00000280379.6_Missense_Mutation_p.I1361M|MON2_ENST00000546600.1_Missense_Mutation_p.I1360M	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1360					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		ATCCAGCTATATTTGACCAGT	0.348																																					p.I1360M		.											.	MON2-514	0			c.A4080G						.						193.0	193.0	193.0					12																	62959064		2203	4300	6503	SO:0001583	missense	23041	exon27			AGCTATATTTGAC		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4080A>G	12.37:g.62959064A>G	ENSP00000377252:p.Ile1360Met	Somatic	227	1		WXS	Illumina HiSeq	Phase_I	199	91	NM_015026	0	0	6	14	8	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.770800	0.49680	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46;-0.46	5.44	3.0	0.34707	.	0.000000	0.85682	D	0.000000	T	0.71358	0.3330	L	0.48642	1.525	0.58432	D	0.999998	D;D;D;P;D	0.76494	0.998;0.998;0.998;0.655;0.999	D;D;D;B;D	0.67900	0.919;0.954;0.954;0.295;0.954	T	0.66921	-0.5801	9	.	.	.	-21.3568	8.7848	0.34814	0.4208:0.4646:0.0:0.1146	.	1360;1337;1360;235;1360	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	M	1360;1361;1361;1360;1337;1360	ENSP00000377252:I1360M;ENSP00000377250:I1361M;ENSP00000280379:I1361M;ENSP00000447407:I1360M;ENSP00000449215:I1337M;ENSP00000377249:I1360M	.	I	+	3	3	MON2	61245331	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.341000	0.43983	0.409000	0.25649	-0.316000	0.08728	ATA	.		0.348	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
EP400	57634	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	132472272	132472272	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr12:132472272T>A	ENST00000333577.4	+	8	2463	c.2354T>A	c.(2353-2355)aTt>aAt	p.I785N	EP400_ENST00000332482.4_Missense_Mutation_p.I712N|EP400_ENST00000389561.2_Missense_Mutation_p.I749N|EP400_ENST00000389562.2_Missense_Mutation_p.I748N|EP400_ENST00000330386.6_Missense_Mutation_p.I749N			Q96L91	EP400_HUMAN	E1A binding protein p400	785					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CATCAGCGCATTGCGGAGCTG	0.577																																					p.I749N													.	EP400-520	0			c.T2246A						.						46.0	44.0	44.0					12																	132472272		2203	4300	6503	SO:0001583	missense	57634	exon7			AGCGCATTGCGGA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.2354T>A	12.37:g.132472272T>A	ENSP00000333602:p.Ile785Asn	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	45	12	NM_015409	0	0	9	9	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	T	8.644	0.896751	0.17686	.	.	ENSG00000183495	ENST00000537902;ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.93712	-3.24;-3.23;-3.23;-3.27;-3.22	5.3	5.3	0.74995	.	0.136379	0.64402	D	0.000007	D	0.96185	0.8756	M	0.73217	2.22	0.26509	N	0.974622	D;D;D;D;P	0.89917	1.0;0.999;1.0;1.0;0.897	D;D;D;D;P	0.91635	0.988;0.974;0.988;0.999;0.822	D	0.91874	0.5510	10	0.66056	D	0.02	.	15.5437	0.76077	0.0:0.0:0.0:1.0	.	749;749;748;785;712	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	N	712;785;749;748;712;749;785;749;749	ENSP00000333602:I785N;ENSP00000374212:I749N;ENSP00000374213:I748N;ENSP00000331737:I712N;ENSP00000330620:I749N	ENSP00000330620:I749N	I	+	2	0	EP400	131038225	1.000000	0.71417	0.004000	0.12327	0.017000	0.09413	7.997000	0.88414	2.131000	0.65755	0.460000	0.39030	ATT	.		0.577	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
EP400	57634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	132472274	132472274	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr12:132472274G>C	ENST00000333577.4	+	8	2465	c.2356G>C	c.(2356-2358)Gcg>Ccg	p.A786P	EP400_ENST00000332482.4_Missense_Mutation_p.A713P|EP400_ENST00000389561.2_Missense_Mutation_p.A750P|EP400_ENST00000389562.2_Missense_Mutation_p.A749P|EP400_ENST00000330386.6_Missense_Mutation_p.A750P			Q96L91	EP400_HUMAN	E1A binding protein p400	786					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TCAGCGCATTGCGGAGCTGAG	0.577																																					p.A750P		.											.	EP400-520	0			c.G2248C						.						46.0	44.0	45.0					12																	132472274		2203	4300	6503	SO:0001583	missense	57634	exon7			CGCATTGCGGAGC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.2356G>C	12.37:g.132472274G>C	ENSP00000333602:p.Ala786Pro	Somatic	82	2		WXS	Illumina HiSeq	Phase_I	47	14	NM_015409	0	0	9	9	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	G	9.373	1.070978	0.20147	.	.	ENSG00000183495	ENST00000537902;ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000423130;ENST00000541296;ENST00000542457	D;D;D;D;D	0.91521	-2.84;-2.84;-2.84;-2.86;-2.84	5.3	4.36	0.52297	.	0.168232	0.52532	D	0.000065	D	0.93867	0.8038	M	0.62723	1.935	0.44042	D	0.99677	D;D;D;D;D	0.69078	0.989;0.989;0.989;0.997;0.989	P;P;P;D;P	0.69479	0.885;0.839;0.885;0.964;0.885	D	0.94054	0.7320	10	0.62326	D	0.03	.	15.8677	0.79076	0.0:0.0:0.8643:0.1357	.	750;750;749;786;713	Q96L91-2;Q96L91-4;Q96L91-5;F8WCN8;Q96L91-3	.;.;.;.;.	P	713;786;750;749;713;750;786;750;750	ENSP00000333602:A786P;ENSP00000374212:A750P;ENSP00000374213:A749P;ENSP00000331737:A713P;ENSP00000330620:A750P	ENSP00000330620:A750P	A	+	1	0	EP400	131038227	1.000000	0.71417	0.760000	0.31359	0.004000	0.04260	5.183000	0.65065	2.637000	0.89404	0.563000	0.77884	GCG	.		0.577	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
LNX2	222484	bcgsc.ca	37	13	28136576	28136576	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr13:28136576G>A	ENST00000316334.3	-	5	1327	c.1198C>T	c.(1198-1200)Ccg>Tcg	p.P400S		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	400	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		GCAAGCTCCGGAGTTCCATAC	0.517																																					p.P400S													.	LNX2-228	0			c.C1198T						.						98.0	101.0	100.0					13																	28136576		2203	4300	6503	SO:0001583	missense	222484	exon5			GCTCCGGAGTTCC	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.1198C>T	13.37:g.28136576G>A	ENSP00000325929:p.Pro400Ser	Somatic	174	0		WXS	Illumina HiSeq	Phase_1	134	54	NM_153371	0	0	3	3	0	Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	ENST00000316334.3	37	CCDS9323.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171568	0.78452	.	.	ENSG00000139517	ENST00000316334	T	0.38240	1.15	5.6	5.6	0.85130	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	L	0.28115	0.83	0.80722	D	1	D	0.54601	0.967	P	0.62014	0.897	T	0.38308	-0.9667	10	0.45353	T	0.12	.	19.6195	0.95650	0.0:0.0:1.0:0.0	.	400	Q8N448	LNX2_HUMAN	S	400	ENSP00000325929:P400S	ENSP00000325929:P400S	P	-	1	0	LNX2	27034576	1.000000	0.71417	0.133000	0.22050	0.651000	0.38670	9.869000	0.99810	2.633000	0.89246	0.561000	0.74099	CCG	.		0.517	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
KBTBD7	84078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	41766948	41766948	+	Silent	SNP	A	A	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr13:41766948A>T	ENST00000379483.3	-	1	1754	c.1446T>A	c.(1444-1446)gtT>gtA	p.V482V		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	482										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		GATAGTTCTGAACCACTATGA	0.433																																					p.V482V		.											.	KBTBD7-91	0			c.T1446A						.						65.0	59.0	61.0					13																	41766948		2203	4300	6503	SO:0001819	synonymous_variant	84078	exon1			GTTCTGAACCACT	AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.1446T>A	13.37:g.41766948A>T		Somatic	57	1		WXS	Illumina HiSeq	Phase_I	47	23	NM_032138	0	0	2	4	2	B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Silent	SNP	ENST00000379483.3	37	CCDS9377.1																																																																																			.		0.433	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044660.1	NM_032138	
LECT1	11061	ucsc.edu	37	13	53313834	53313834	+	Start_Codon_SNP	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr13:53313834C>T	ENST00000377962.3	-	1	81	c.3G>A	c.(1-3)atG>atA	p.M1I	LECT1_ENST00000448904.2_Start_Codon_SNP_p.M1I			O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1	1					cartilage development (GO:0051216)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|proteoglycan metabolic process (GO:0006029)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		AGTTCTCTGTCATGTTTGCGG	0.637																																					p.M1I													.	LECT1-92	0			c.G3A						.						134.0	136.0	135.0					13																	53313834		2203	4300	6503	SO:0001582	initiator_codon_variant	11061	exon1			CTCTGTCATGTTT	AB006000	CCDS9437.1, CCDS45051.1	13q14.3	2012-10-10			ENSG00000136110	ENSG00000136110		"""BRICHOS domain containing"""	17005	protein-coding gene	gene with protein product	"""BRICHOS domain containing 3"""	605147	"""multiple myeloma tumor suppressor 1"""	MYETS1		9731231, 10103018	Standard	XM_006719760		Approved	CHM-I, CHM1, chondromodulin, BRICD3	uc001vhf.2	O75829	OTTHUMG00000016980	ENST00000377962.3:c.3G>A	13.37:g.53313834C>T	ENSP00000367198:p.Met1Ile	Somatic	47	0		WXS	Illumina HiSeq		37	4	NM_007015	0	0	0	0	0	Q5TAM4|Q8TAY6|Q9UM18	Missense_Mutation	SNP	ENST00000377962.3	37	CCDS9437.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380609	0.82792	.	.	ENSG00000136110	ENST00000448904;ENST00000377962	T;T	0.33865	1.39;1.39	4.95	4.95	0.65309	.	0.095579	0.64402	D	0.000003	T	0.62258	0.2413	.	.	.	0.80722	D	1	D;P	0.58268	0.982;0.924	D;P	0.68943	0.961;0.878	T	0.67577	-0.5635	9	0.87932	D	0	.	18.1286	0.89593	0.0:1.0:0.0:0.0	.	1;1	O75829-2;O75829	.;LECT1_HUMAN	I	1	ENSP00000388576:M1I;ENSP00000367198:M1I	ENSP00000367198:M1I	M	-	3	0	LECT1	52211835	1.000000	0.71417	0.888000	0.34837	0.540000	0.34992	6.445000	0.73456	2.440000	0.82611	0.655000	0.94253	ATG	.		0.637	LECT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045110.3		Missense_Mutation
DOCK9	23348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	99540613	99540613	+	Splice_Site	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr13:99540613C>T	ENST00000376460.1	-	17	2058		c.e17+1		DOCK9_ENST00000448493.2_Splice_Site|DOCK9_ENST00000442173.1_Splice_Site|DOCK9_ENST00000339416.2_Splice_Site	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9						blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TTCACACTCACCTTGGCAAAA	0.398																																					.		.											.	DOCK9-90	0			c.1980+1G>A						.						167.0	158.0	161.0					13																	99540613		1931	4118	6049	SO:0001630	splice_region_variant	23348	exon18			CACTCACCTTGGC	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.1977+1G>A	13.37:g.99540613C>T		Somatic	227	0		WXS	Illumina HiSeq	Phase_I	224	24	NM_015296	0	0	0	0	0	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Splice_Site	SNP	ENST00000376460.1	37	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474160	0.84640	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7775	0.96400	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DOCK9	98338614	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.438000	0.80431	2.680000	0.91292	0.655000	0.94253	.	.		0.398	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	Intron
FAM71D	161142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	67688507	67688507	+	3'UTR	SNP	C	C	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr14:67688507C>A	ENST00000556046.1	+	0	1713							Q8N9W8	FA71D_HUMAN	family with sequence similarity 71, member D							cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)	13		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		AGCTTGAGAACTGAATCAAAC	0.353																																					p.T391N		.											.	FAM71D-23	0			c.C1172A						.						87.0	82.0	84.0					14																	67688507		2203	4300	6503	SO:0001624	3_prime_UTR_variant	161142	exon7			TGAGAACTGAATC		CCDS9778.1	14q23.3	2007-11-20	2007-11-20	2007-11-20		ENSG00000172717			20101	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 54"""	C14orf54			Standard	NM_173526		Approved		uc001xja.2	Q8N9W8		ENST00000556046.1:c.*1228C>A	14.37:g.67688507C>A		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	54	11	NM_173526	0	0	0	0	0	Q86VN4	Missense_Mutation	SNP	ENST00000556046.1	37		.	.	.	.	.	.	.	.	.	.	C	6.948	0.544670	0.13312	.	.	ENSG00000172717	ENST00000556117;ENST00000557671	.	.	.	5.95	1.59	0.23543	.	.	.	.	.	T	0.25306	0.0615	N	0.24115	0.695	.	.	.	.	.	.	.	.	.	T	0.25082	-1.0142	4	.	.	.	0.0	2.5085	0.04651	0.3418:0.4102:0.1494:0.0986	.	.	.	.	M	52;49	.	.	L	+	1	2	FAM71D	66758260	1.000000	0.71417	0.283000	0.24790	0.059000	0.15707	0.853000	0.27777	0.750000	0.32877	-0.345000	0.07892	CTG	.		0.353	FAM71D-009	KNOWN	not_organism_supported|basic|appris_candidate	nonsense_mediated_decay	protein_coding	OTTHUMT00000412390.1	NM_173526	
DPF3	8110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	73238479	73238479	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr14:73238479T>G	ENST00000556509.1	-	2	154	c.155A>C	c.(154-156)aAc>aCc	p.N52T	DPF3_ENST00000541685.1_Missense_Mutation_p.N52T|DPF3_ENST00000546183.1_Missense_Mutation_p.N62T	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	52					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GATGTAGCAGTTGTTCTGGGC	0.622																																					p.N52T		.											.	DPF3-1	0			c.A155C						.						87.0	95.0	92.0					14																	73238479		2195	4299	6494	SO:0001583	missense	8110	exon2			TAGCAGTTGTTCT	U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.155A>C	14.37:g.73238479T>G	ENSP00000450518:p.Asn52Thr	Somatic	158	1		WXS	Illumina HiSeq	Phase_I	90	38	NM_012074	0	0	0	0	0	A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Missense_Mutation	SNP	ENST00000556509.1	37		.	.	.	.	.	.	.	.	.	.	t	30	5.056952	0.93846	.	.	ENSG00000205683	ENST00000540281;ENST00000556509;ENST00000398816;ENST00000541685;ENST00000546183	D;T;T	0.91068	-2.78;-0.26;-0.26	5.54	5.54	0.83059	.	.	.	.	.	D	0.94251	0.8154	M	0.64997	1.995	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.991	D;D;D	0.74023	0.97;0.958;0.982	D	0.94833	0.7998	9	0.87932	D	0	.	15.693	0.77469	0.0:0.0:0.0:1.0	.	62;52;52	F5H575;Q92784-2;Q92784	.;.;DPF3_HUMAN	T	52;52;51;52;62	ENSP00000450518:N52T;ENSP00000441640:N52T;ENSP00000444662:N62T	ENSP00000381791:N107T	N	-	2	0	DPF3	72308232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.026000	0.88783	2.116000	0.64780	0.529000	0.55759	AAC	.		0.622	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000413152.2		
PPP4R4	57718	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	94640864	94640864	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr14:94640864T>C	ENST00000304338.3	+	1	216	c.62T>C	c.(61-63)aTg>aCg	p.M21T	PPP4R4_ENST00000555690.1_3'UTR|PPP4R4_ENST00000328839.3_Missense_Mutation_p.M21T	NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	21					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						TTCGGTTACATGGAGGACCTG	0.721																																					p.M21T		.											.	PPP4R4-94	0			c.T62C						.						28.0	29.0	29.0					14																	94640864		2202	4300	6502	SO:0001583	missense	57718	exon1			GTTACATGGAGGA	AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.62T>C	14.37:g.94640864T>C	ENSP00000305924:p.Met21Thr	Somatic	88	1		WXS	Illumina HiSeq	Phase_I	49	11	NM_058237	0	0	0	0	0	Q9BUF8|Q9HCF0	Missense_Mutation	SNP	ENST00000304338.3	37	CCDS9921.1	.	.	.	.	.	.	.	.	.	.	t	13.47	2.247193	0.39697	.	.	ENSG00000119698	ENST00000304338;ENST00000328839	.	.	.	2.86	2.86	0.33363	.	0.144296	0.45606	U	0.000349	T	0.32615	0.0835	N	0.22421	0.69	0.32051	N	0.596886	B;B	0.17667	0.001;0.023	B;B	0.22152	0.009;0.038	T	0.40001	-0.9586	9	0.49607	T	0.09	-9.5223	10.1358	0.42706	0.0:0.0:0.0:1.0	.	21;21	Q6NUP7;Q6NUP7-2	PP4R4_HUMAN;.	T	21	.	ENSP00000305924:M21T	M	+	2	0	PPP4R4	93710617	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.072000	0.50049	1.299000	0.44798	0.324000	0.21423	ATG	.		0.721	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237	
OCA2	4948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	28090200	28090200	+	Splice_Site	SNP	T	T	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:28090200T>A	ENST00000354638.3	-	23	2494		c.e23-2		OCA2_ENST00000353809.5_Splice_Site	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II						cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TCCCGTTACCTAAAGTCAAAA	0.413									Oculocutaneous Albinism																												.		.											.	OCA2-135	0			c.2339-2A>T						.						47.0	47.0	47.0					15																	28090200		2203	4300	6503	SO:0001630	splice_region_variant	4948	exon24	Familial Cancer Database		GTTACCTAAAGTC		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.2339-2A>T	15.37:g.28090200T>A		Somatic	74	1		WXS	Illumina HiSeq	Phase_I	59	21	NM_000275	0	0	0	0	0	Q15211|Q15212|Q96EN1|Q9UMI5	Splice_Site	SNP	ENST00000354638.3	37	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	T	17.14	3.314576	0.60524	.	.	ENSG00000104044	ENST00000354638;ENST00000353809	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.845	0.63461	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	OCA2	25763795	1.000000	0.71417	0.954000	0.39281	0.410000	0.31052	7.093000	0.76937	2.143000	0.66587	0.533000	0.62120	.	.		0.413	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275	Intron
ZNF609	23060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	64966235	64966235	+	Silent	SNP	G	G	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:64966235G>T	ENST00000326648.3	+	4	1310	c.1182G>T	c.(1180-1182)ggG>ggT	p.G394G	RNU6-549P_ENST00000384433.1_RNA|ZNF609_ENST00000559364.1_3'UTR	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	394						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ACAGCAAAGGGACCAGTAACA	0.577																																					p.G394G		.											.	ZNF609-92	0			c.G1182T						.						96.0	97.0	97.0					15																	64966235		2203	4299	6502	SO:0001819	synonymous_variant	23060	exon4			CAAAGGGACCAGT	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.1182G>T	15.37:g.64966235G>T		Somatic	191	0		WXS	Illumina HiSeq	Phase_I	150	55	NM_015042	0	0	7	11	4	Q0D2I2	Silent	SNP	ENST00000326648.3	37	CCDS32270.1																																																																																			.		0.577	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
THSD4	79875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	72063439	72063439	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:72063439G>C	ENST00000355327.3	+	17	2940	c.2806G>C	c.(2806-2808)Gaa>Caa	p.E936Q	THSD4_ENST00000261862.6_Missense_Mutation_p.E936Q|THSD4_ENST00000357769.4_Missense_Mutation_p.E576Q			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	936	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TCGGGTCCGGGAAGTGCGGTG	0.507																																					p.E936Q		.											.	THSD4-92	0			c.G2806C						.						157.0	149.0	151.0					15																	72063439		1899	4126	6025	SO:0001583	missense	79875	exon16			GTCCGGGAAGTGC	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.2806G>C	15.37:g.72063439G>C	ENSP00000347484:p.Glu936Gln	Somatic	172	0		WXS	Illumina HiSeq	Phase_I	143	63	NM_024817	0	0	3	9	6	B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	37	CCDS10238.2	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724411	0.68959	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.50813	0.73;0.73;0.73	5.05	5.05	0.67936	.	.	.	.	.	T	0.56761	0.2007	L	0.28649	0.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.54596	-0.8270	9	0.35671	T	0.21	.	15.9236	0.79592	0.0:0.0:1.0:0.0	.	576;936	B4DR13;Q6ZMP0	.;THSD4_HUMAN	Q	936;936;576	ENSP00000347484:E936Q;ENSP00000261862:E936Q;ENSP00000350413:E576Q	ENSP00000261862:E936Q	E	+	1	0	THSD4	69850493	1.000000	0.71417	1.000000	0.80357	0.252000	0.25951	9.638000	0.98445	2.353000	0.79882	0.557000	0.71058	GAA	.		0.507	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817	
BNC1	646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	83932666	83932666	+	Missense_Mutation	SNP	G	G	A	rs377611889		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:83932666G>A	ENST00000345382.2	-	4	1422	c.1337C>T	c.(1336-1338)aCg>aTg	p.T446M	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.T439M	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	446					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GTCTGGGGACGTCACTGTGAA	0.527																																					p.T446M		.											.	BNC1-93	0			c.C1337T						.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	129.0	118.0	122.0		1337	0.3	0.0	15		122	0,8600		0,0,4300	no	missense	BNC1	NM_001717.3	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	446/995	83932666	1,13005	2203	4300	6503	SO:0001583	missense	646	exon4			GGGGACGTCACTG	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1337C>T	15.37:g.83932666G>A	ENSP00000307041:p.Thr446Met	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	71	27	NM_001717	0	0	3	4	1	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	G	0.574	-0.839807	0.02692	2.27E-4	0.0	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.47869	0.83	4.98	0.334	0.15948	.	0.605786	0.17317	N	0.178658	T	0.32376	0.0827	L	0.39397	1.21	0.09310	N	1	B;B	0.23806	0.008;0.091	B;B	0.16289	0.004;0.015	T	0.16958	-1.0385	10	0.51188	T	0.08	-1.7277	5.5626	0.17152	0.2685:0.4447:0.2868:0.0	.	439;446	F5GY04;Q01954	.;BNC1_HUMAN	M	446;439	ENSP00000307041:T446M	ENSP00000307041:T446M	T	-	2	0	BNC1	81723670	0.001000	0.12720	0.001000	0.08648	0.136000	0.21042	0.733000	0.26087	-0.119000	0.11830	0.655000	0.94253	ACG	.		0.527	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
ADAMTS17	170691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	100871170	100871170	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:100871170G>A	ENST00000268070.4	-	3	645	c.540C>T	c.(538-540)atC>atT	p.I180I		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	180						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		ATTTGCGCCTGATCAGATGTT	0.582																																					p.I180I		.											.	ADAMTS17-228	0			c.C540T						.						129.0	122.0	125.0					15																	100871170		2203	4300	6503	SO:0001819	synonymous_variant	170691	exon3			GCGCCTGATCAGA	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.540C>T	15.37:g.100871170G>A		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	87	47	NM_139057	0	0	0	0	0	Q2I7G4|Q6ZN75	Silent	SNP	ENST00000268070.4	37	CCDS10383.1																																																																																			.		0.582	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
PCSK6	5046	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	101933522	101933522	+	Silent	SNP	G	G	A	rs376652644		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:101933522G>A	ENST00000348070.1	-	9	1100	c.1101C>T	c.(1099-1101)tcC>tcT	p.S367S	PCSK6_ENST00000331826.7_Silent_p.S202S|PCSK6_ENST00000344273.2_Silent_p.S367S|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000358417.3_Silent_p.S367S|PCSK6_ENST00000398181.2_Silent_p.S367S	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	368	Peptidase S8.				determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)	p.S367S(3)|p.S202S(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CGCTGCTGACGGAGATGGTGT	0.597																																					.													.	PCSK6-46	4	Substitution - coding silent(4)	lung(4)	.						.	G	,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	77.0	87.0	83.0		1102,1102,1102,1102,1102,1102,1102,1102	-6.2	0.8	15		83	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PCSK6	NM_002570.3,NM_138319.2,NM_138320.1,NM_138321.1,NM_138322.2,NM_138323.1,NM_138324.1,NM_138325.2	,,,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,	368/970,368/957,368/976,368/963,368/488,368/624,368/653,368/665	101933522	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5046	.			GCTGACGGAGATG		CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.1101C>T	15.37:g.101933522G>A		Somatic	57	1		WXS	Illumina HiSeq	Phase_I	41	18	.	0	0	0	1	1	Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Silent	SNP	ENST00000348070.1	37																																																																																				.		0.597	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_002570	
IRX6	79190	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	55360382	55360382	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr16:55360382G>A	ENST00000290552.7	+	2	1512	c.180G>A	c.(178-180)gcG>gcA	p.A60A	RP11-26L20.3_ENST00000558730.2_RNA|IRX6_ENST00000558315.1_3'UTR	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	60					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TGGGCAGTGCGCGACCGGAGC	0.657																																					p.A60A		.											.	IRX6-174	0			c.G180A						.						26.0	24.0	25.0					16																	55360382		2198	4300	6498	SO:0001819	synonymous_variant	79190	exon2			CAGTGCGCGACCG	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.180G>A	16.37:g.55360382G>A		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	48	28	NM_024335	0	0	4	24	20	B2RN06|Q7Z2K0	Silent	SNP	ENST00000290552.7	37	CCDS32449.1																																																																																			.		0.657	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335	
CDH5	1003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	66413245	66413245	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr16:66413245A>C	ENST00000341529.3	+	2	153	c.5A>C	c.(4-6)cAg>cCg	p.Q2P	CDH5_ENST00000563425.2_Missense_Mutation_p.Q2P	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	2					adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	GGGAAGATGCAGAGGCTCATG	0.572																																					p.Q2P		.											.	CDH5-525	0			c.A5C						.						79.0	83.0	82.0					16																	66413245		2200	4299	6499	SO:0001583	missense	1003	exon2			AGATGCAGAGGCT	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.5A>C	16.37:g.66413245A>C	ENSP00000344115:p.Gln2Pro	Somatic	231	0		WXS	Illumina HiSeq	Phase_I	268	61	NM_001795	0	0	1	1	0	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	ENST00000341529.3	37	CCDS10804.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.791839	0.31685	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.56103	0.48	4.38	2.03	0.26663	.	.	.	.	.	T	0.27169	0.0666	N	0.08118	0	0.42316	D	0.992239	B	0.11235	0.004	B	0.06405	0.002	T	0.04386	-1.0955	9	0.42905	T	0.14	.	4.3874	0.11323	0.6928:0.2005:0.1067:0.0	.	2	P33151	CADH5_HUMAN	P	2	ENSP00000344115:Q2P	ENSP00000344115:Q2P	Q	+	2	0	CDH5	64970746	0.837000	0.29446	0.481000	0.27354	0.805000	0.45488	1.348000	0.33987	0.204000	0.20548	0.379000	0.24179	CAG	.		0.572	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
PLCG2	5336	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	81922847	81922847	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr16:81922847A>T	ENST00000359376.3	+	10	1050	c.836A>T	c.(835-837)gAa>gTa	p.E279V		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	279					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						ACCATGCGTGAAACTGCTGAG	0.463																																					p.E279V													.	PLCG2-892	0			c.A836T						.						183.0	177.0	179.0					16																	81922847		2040	4196	6236	SO:0001583	missense	5336	exon10			TGCGTGAAACTGC		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.836A>T	16.37:g.81922847A>T	ENSP00000352336:p.Glu279Val	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	34	10	NM_002661	0	0	2	3	1	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	37	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	A	18.61	3.660395	0.67586	.	.	ENSG00000197943	ENST00000359376	T	0.33654	1.4	5.09	5.09	0.68999	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);	0.095942	0.64402	D	0.000001	T	0.52821	0.1758	L	0.55990	1.75	0.53005	D	0.999969	P;D	0.64830	0.797;0.994	P;D	0.63192	0.698;0.912	T	0.56019	-0.8048	10	0.72032	D	0.01	.	14.8381	0.70201	1.0:0.0:0.0:0.0	.	146;279	B4E3H3;P16885	.;PLCG2_HUMAN	V	279	ENSP00000352336:E279V	ENSP00000352336:E279V	E	+	2	0	PLCG2	80480348	1.000000	0.71417	0.837000	0.33122	0.578000	0.36192	6.698000	0.74608	2.046000	0.60703	0.460000	0.39030	GAA	.		0.463	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
P2RX5	5026	broad.mit.edu;bcgsc.ca	37	17	3583061	3583061	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:3583061G>A	ENST00000225328.5	-	11	1480	c.1082C>T	c.(1081-1083)tCc>tTc	p.S361F	P2RX5_ENST00000345901.3_Missense_Mutation_p.S337F|P2RX5_ENST00000552276.1_Missense_Mutation_p.S360F|P2RX5_ENST00000435558.1_Missense_Mutation_p.S361F|P2RX5_ENST00000551178.1_Missense_Mutation_p.S336F|P2RX5_ENST00000547178.1_Missense_Mutation_p.S360F|P2RX5_ENST00000552050.1_Missense_Mutation_p.S301F|P2RX5-TAX1BP3_ENST00000550383.1_Missense_Mutation_p.S361F	NM_001204519.1|NM_002561.3	NP_001191448.1|NP_002552.2	Q93086	P2RX5_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 5	361					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transport (GO:0006810)	integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|ion channel activity (GO:0005216)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						GGCCTCCTGGGAACTGTCTTC	0.647																																					p.S361F													.	P2RX5-22	0			c.C1082T						.						42.0	40.0	41.0					17																	3583061		2203	4300	6503	SO:0001583	missense	5026	exon11			TCCTGGGAACTGT	AF016709	CCDS11034.1, CCDS11035.1, CCDS56014.1, CCDS56015.1	17p13.3	2012-01-17			ENSG00000083454	ENSG00000083454		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8536	protein-coding gene	gene with protein product		602836				9414125	Standard	NM_002561		Approved	P2X5	uc002fwi.3	Q93086	OTTHUMG00000090700	ENST00000225328.5:c.1082C>T	17.37:g.3583061G>A	ENSP00000225328:p.Ser361Phe	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	32	10	NM_002561	0	0	0	1	1	G5E981|O43450|O75540|Q308M5|Q59F38|Q8IXW4|Q93087|Q9NZV0	Missense_Mutation	SNP	ENST00000225328.5	37	CCDS11034.1	.	.	.	.	.	.	.	.	.	.	G	6.998	0.554266	0.13374	.	.	ENSG00000083454	ENST00000435558;ENST00000551178;ENST00000547178;ENST00000225328;ENST00000345901;ENST00000552050	T;T;T;T;T;T	0.04502	3.61;3.61;3.61;3.61;3.61;3.61	3.01	0.971	0.19698	.	13.968400	0.00166	N	0.000000	T	0.03564	0.0102	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.30686	0.29;0.246;0.246;0.246;0.29;0.246	B;B;B;B;B;B	0.25614	0.043;0.037;0.037;0.037;0.062;0.037	T	0.34204	-0.9838	10	0.59425	D	0.04	-16.3435	3.5464	0.07829	0.2514:0.2125:0.5361:0.0	.	301;337;360;336;361;361	B4DEG2;G5E981;Q93086-1;Q93086-2;Q93086;Q93086-4	.;.;.;.;P2RX5_HUMAN;.	F	361;336;360;361;337;301	ENSP00000415370:S361F;ENSP00000447545:S336F;ENSP00000448355:S360F;ENSP00000225328:S361F;ENSP00000342161:S337F;ENSP00000450006:S301F	ENSP00000225328:S361F	S	-	2	0	P2RX5	3529810	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.468000	0.22051	0.193000	0.20303	-0.432000	0.05891	TCC	.		0.647	P2RX5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207388.3	NM_002561, NM_175080, NM_175081	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	378	24		WXS	Illumina HiSeq		371	32	NM_145301	0	0	5	24	19	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
SREBF1	6720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	17722461	17722461	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:17722461T>C	ENST00000261646.5	-	5	1118	c.934A>G	c.(934-936)Agc>Ggc	p.S312G	SREBF1_ENST00000395757.1_Missense_Mutation_p.S58G|SREBF1_ENST00000355815.4_Missense_Mutation_p.S342G|SREBF1_ENST00000583732.1_5'UTR|SREBF1_ENST00000338854.5_Missense_Mutation_p.S312G|SREBF1_ENST00000435530.2_Missense_Mutation_p.S312G	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	312	Interaction with LMNA. {ECO:0000250}.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						GGGGCCTTGCTGCCAGCTGCG	0.607																																					p.S342G		.											.	SREBF1-91	0			c.A1024G						.						62.0	60.0	60.0					17																	17722461		2203	4300	6503	SO:0001583	missense	6720	exon6			CCTTGCTGCCAGC	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.934A>G	17.37:g.17722461T>C	ENSP00000261646:p.Ser312Gly	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	83	34	NM_001005291	0	0	13	28	15	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	ENST00000261646.5	37	CCDS11189.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.54|11.54	1.668371|1.668371	0.29604|0.29604	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000395751|ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000418712;ENST00000423161;ENST00000435530	.|T;T;T;T;T	.|0.76578	.|0.66;0.65;0.66;1.02;-1.03	4.41|4.41	0.985|0.985	0.19779|0.19779	.|.	.|0.390138	.|0.18906	.|N	.|0.127893	T|T	0.43809|0.43809	0.1264|0.1264	N|N	0.01091|0.01091	-1.02|-1.02	0.27003|0.27003	N|N	0.964868|0.964868	.|B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0	.|B;B;B;B	.|0.04013	.|0.001;0.001;0.0;0.001	T|T	0.37150|0.37150	-0.9718|-0.9718	5|10	.|0.14656	.|T	.|0.56	-6.3745|-6.3745	8.5495|8.5495	0.33442|0.33442	0.0:0.7314:0.0:0.2686|0.0:0.7314:0.0:0.2686	.|.	.|312;288;312;342	.|B0I4X3;B0I4X4;P36956;P36956-4	.|.;.;SRBP1_HUMAN;.	R|G	319|312;342;312;58;149;238;312	.|ENSP00000345822:S312G;ENSP00000348069:S342G;ENSP00000261646:S312G;ENSP00000379106:S58G;ENSP00000413389:S312G	.|ENSP00000261646:S312G	Q|S	-|-	2|1	0|0	SREBF1|SREBF1	17663186|17663186	0.654000|0.654000	0.27367|0.27367	0.484000|0.484000	0.27391|0.27391	0.781000|0.781000	0.44180|0.44180	1.287000|1.287000	0.33284|0.33284	-0.124000|-0.124000	0.11724|0.11724	0.459000|0.459000	0.35465|0.35465	CAG|AGC	.		0.607	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
AKAP10	11216	bcgsc.ca	37	17	19845195	19845195	+	Silent	SNP	C	C	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:19845195C>G	ENST00000225737.6	-	6	1162	c.1005G>C	c.(1003-1005)gtG>gtC	p.V335V	AKAP10_ENST00000395536.3_Silent_p.V335V	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	335	RGS 1. {ECO:0000255|PROSITE- ProRule:PRU00171}.				blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					AGTTGGGATCCACCTGTCCAT	0.368																																					p.V335V													.	AKAP10-226	0			c.G1005C						.						132.0	101.0	112.0					17																	19845195		2203	4300	6503	SO:0001819	synonymous_variant	11216	exon6			GGGATCCACCTGT	AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.1005G>C	17.37:g.19845195C>G		Somatic	61	0		WXS	Illumina HiSeq	Phase_1	38	4	NM_007202	0	0	15	15	0	B2R650|Q96AJ7	Silent	SNP	ENST00000225737.6	37	CCDS11214.1																																																																																			.		0.368	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132380.2	NM_007202	
KRTAP4-9	100132386	broad.mit.edu	37	17	39262083	39262083	+	Missense_Mutation	SNP	A	A	C	rs75392608	byFrequency	TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:39262083A>C	ENST00000391415.1	+	1	500	c.443A>C	c.(442-444)aAc>aCc	p.N148T		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	148	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						tgccagcccaactgctgccgc	0.667																																					p.N148T													.	.	0			c.A443C						.																																			SO:0001583	missense	100132386	exon1			AGCCCAACTGCTG	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.443A>C	17.37:g.39262083A>C	ENSP00000375234:p.Asn148Thr	Somatic	36	2		WXS	Illumina HiSeq	Phase_I	46	5	NM_001146041	0	0	0	0	0		Missense_Mutation	SNP	ENST00000391415.1	37	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	0.012	-1.682784	0.00745	.	.	ENSG00000212722	ENST00000377734;ENST00000391415;ENST00000333994	T	0.00561	6.59	2.83	-1.44	0.08856	.	8.212230	0.00901	N	0.002346	T	0.00144	0.0004	N	0.00071	-2.275	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47623	-0.9103	10	0.07990	T	0.79	.	2.3835	0.04360	0.1689:0.3761:0.3337:0.1212	.	148	Q9BYQ8	KRA49_HUMAN	T	136;148;139	ENSP00000375234:N148T	ENSP00000334461:N139T	N	+	2	0	KRTAP4-9	36515609	0.000000	0.05858	0.001000	0.08648	0.078000	0.17371	-4.052000	0.00305	-0.458000	0.07023	-1.815000	0.00603	AAC	A|0.500;C|0.500		0.667	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041	
POLG2	11232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	62486981	62486981	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:62486981C>G	ENST00000539111.2	-	4	968	c.901G>C	c.(901-903)Gaa>Caa	p.E301Q		NM_007215.3	NP_009146.2	Q9UHN1	DPOG2_HUMAN	polymerase (DNA directed), gamma 2, accessory subunit	301					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)	extracellular vesicular exosome (GO:0070062)|mitochondrial chromosome (GO:0000262)|mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(4)|skin(2)|stomach(1)|urinary_tract(1)	15	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			CACAGGGTTTCTATTAACTCC	0.408																																					p.E301Q	Colon(3;18 21 435 17652 48887)	.											.	POLG2-227	0			c.G901C						.						118.0	105.0	110.0					17																	62486981		2203	4300	6503	SO:0001583	missense	11232	exon4			GGGTTTCTATTAA	U94703	CCDS32706.1	17q23.3	2012-05-18			ENSG00000256525	ENSG00000256525		"""DNA polymerases"""	9180	protein-coding gene	gene with protein product		604983				9153213	Standard	NM_007215		Approved	MTPOLB, HP55	uc002jei.3	Q9UHN1		ENST00000539111.2:c.901G>C	17.37:g.62486981C>G	ENSP00000442563:p.Glu301Gln	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	81	39	NM_007215	0	0	6	8	2	O00419|Q0IJ81|Q96GW2|Q9UK35|Q9UK94	Missense_Mutation	SNP	ENST00000539111.2	37	CCDS32706.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048199	0.75846	.	.	ENSG00000256525	ENST00000539111	T	0.79554	-1.28	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.88194	0.6371	M	0.81341	2.54	0.58432	D	0.999998	D;D	0.71674	0.998;0.998	P;P	0.55713	0.782;0.782	D	0.88758	0.3255	10	0.51188	T	0.08	-11.7483	19.247	0.93906	0.0:1.0:0.0:0.0	.	301;301	E5KS15;Q9UHN1	.;DPOG2_HUMAN	Q	301	ENSP00000442563:E301Q	ENSP00000442563:E301Q	E	-	1	0	POLG2	59917443	1.000000	0.71417	0.997000	0.53966	0.239000	0.25481	6.697000	0.74603	2.516000	0.84829	0.655000	0.94253	GAA	.		0.408	POLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443820.1	NM_007215	
RNF213	57674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	78293016	78293016	+	Silent	SNP	C	C	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:78293016C>G	ENST00000582970.1	+	17	3071	c.2928C>G	c.(2926-2928)gcC>gcG	p.A976A	CTD-2047H16.2_ENST00000576808.1_RNA|RNF213_ENST00000508628.2_Silent_p.A1025A|RNF213_ENST00000319921.4_Silent_p.A976A|RNF213_ENST00000456466.1_Silent_p.A976A	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	976					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGATCACTGCCTACTGCAATA	0.522																																					p.A976A		.											.	RNF213-577	0			c.C2928G						.						122.0	122.0	122.0					17																	78293016		2203	4300	6503	SO:0001819	synonymous_variant	57674	exon17			CACTGCCTACTGC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.2928C>G	17.37:g.78293016C>G		Somatic	217	0		WXS	Illumina HiSeq	Phase_I	218	79	NM_001256071	0	0	10	15	5	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	CCDS58606.1																																																																																			.		0.522	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
SIRT7	51547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79870325	79870325	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:79870325G>A	ENST00000328666.6	-	10	1232	c.1170C>T	c.(1168-1170)tgC>tgT	p.C390C	PCYT2_ENST00000570391.1_5'Flank|PCYT2_ENST00000538936.2_5'Flank|PCYT2_ENST00000571105.1_5'Flank|PCYT2_ENST00000570388.1_5'Flank|PCYT2_ENST00000331285.3_5'Flank|PCYT2_ENST00000538721.2_5'Flank	NM_016538.2	NP_057622.1	Q9NRC8	SIR7_HUMAN	sirtuin 7	390					histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription on exit from mitosis (GO:0007072)|rRNA transcription (GO:0009303)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleolus organizer region (GO:0005731)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TGCGTTTTGTGCAGCCCCTGC	0.597																																					p.C390C		.											.	SIRT7-204	0			c.C1170T						.						149.0	135.0	140.0					17																	79870325		2203	4299	6502	SO:0001819	synonymous_variant	51547	exon10			TTTTGTGCAGCCC	AF233395	CCDS11792.1	17q25.3	2010-06-25	2010-06-25			ENSG00000187531			14935	protein-coding gene	gene with protein product		606212	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 7"", ""sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)"""			10873683, 16618798	Standard	NM_016538		Approved		uc002kcj.2	Q9NRC8		ENST00000328666.6:c.1170C>T	17.37:g.79870325G>A		Somatic	271	2		WXS	Illumina HiSeq	Phase_I	219	107	NM_016538	0	0	12	29	17	A8K2K0|B3KSU8|Q3MIK4|Q9NSZ6|Q9NUS6	Silent	SNP	ENST00000328666.6	37	CCDS11792.1																																																																																			.		0.597	SIRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439961.1	NM_016538	
USP14	9097	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	163336	163336	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr18:163336T>G	ENST00000261601.7	+	2	136	c.45T>G	c.(43-45)ttT>ttG	p.F15L	USP14_ENST00000400266.3_Missense_Mutation_p.F15L|USP14_ENST00000582707.1_Missense_Mutation_p.F15L|USP14_ENST00000383589.2_Missense_Mutation_p.F15L	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	15	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				AGGAGAAATTTGAAGGTGTAG	0.373																																					p.F15L		.											.	USP14-659	0			c.T45G						.						47.0	46.0	46.0					18																	163336		2203	4300	6503	SO:0001583	missense	9097	exon2			GAAATTTGAAGGT	U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.45T>G	18.37:g.163336T>G	ENSP00000261601:p.Phe15Leu	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	24	17	NM_001037334	0	0	0	4	4	J3QRZ5|Q53XY5	Missense_Mutation	SNP	ENST00000261601.7	37	CCDS32780.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.171691	0.57584	.	.	ENSG00000101557	ENST00000261601;ENST00000383589;ENST00000400266	T;T;T	0.32023	1.47;1.53;1.52	5.34	4.18	0.49190	Ubiquitin supergroup (1);Ubiquitin (1);	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	L	0.56340	1.77	0.80722	D	1	P;B;B	0.36412	0.552;0.187;0.224	B;B;B	0.38500	0.275;0.105;0.275	T	0.04930	-1.0917	10	0.49607	T	0.09	0.9923	7.3687	0.26790	0.0:0.2181:0.0:0.7819	.	15;15;15	B7Z4N8;A6NJA2;P54578	.;.;UBP14_HUMAN	L	15	ENSP00000261601:F15L;ENSP00000373083:F15L;ENSP00000383125:F15L	ENSP00000261601:F15L	F	+	3	2	USP14	153336	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	0.344000	0.19962	0.876000	0.35872	0.528000	0.53228	TTT	.		0.373	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440305.3	NM_005151	
EPS15L1	58513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	16551694	16551694	+	Silent	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:16551694A>G	ENST00000248070.6	-	4	331	c.192T>C	c.(190-192)ggT>ggC	p.G64G	EPS15L1_ENST00000594975.1_Silent_p.G64G|EPS15L1_ENST00000455140.2_Silent_p.G64G|CTD-2013N17.4_ENST00000587343.1_RNA|EPS15L1_ENST00000535753.2_Silent_p.G64G|EPS15L1_ENST00000597937.1_Silent_p.G64G	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	64	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						AGAACCCTTTACCTTCTGGAT	0.527																																					p.G64G		.											.	EPS15L1-95	0			c.T192C						.						270.0	276.0	274.0					19																	16551694		2203	4300	6503	SO:0001819	synonymous_variant	58513	exon4			CCCTTTACCTTCT	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.192T>C	19.37:g.16551694A>G		Somatic	541	1		WXS	Illumina HiSeq	Phase_I	503	186	NM_021235	0	0	9	32	23	A2RRF3|A5PL29|B4DKA3	Silent	SNP	ENST00000248070.6	37	CCDS32944.1																																																																																			.		0.527	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
ELL	8178	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	18557590	18557590	+	Silent	SNP	G	G	A	rs200056265		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:18557590G>A	ENST00000262809.4	-	9	1571	c.1500C>T	c.(1498-1500)ccC>ccT	p.P500P	ELL_ENST00000596124.3_Silent_p.P367P	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	500					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		ACGTGGACGTGGGAACACTGG	0.607			T	MLL	AL								g|||	1	0.000199681	0.0	0.0014	5008	,	,		22196	0.0		0.0	False		,,,				2504	0.0				p.P500P				Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	.	ELL-1082	0			c.C1500T						.						97.0	81.0	87.0					19																	18557590		2203	4300	6503	SO:0001819	synonymous_variant	8178	exon9			GGACGTGGGAACA	U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.1500C>T	19.37:g.18557590G>A		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	37	16	NM_006532	0	0	4	9	5		Silent	SNP	ENST00000262809.4	37	CCDS12380.1																																																																																			G|0.999;A|0.000		0.607	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466362.1	NM_006532	
ZNF708	7562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	21493348	21493348	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:21493348A>G	ENST00000356929.3	-	2	282	c.85T>C	c.(85-87)Tat>Cat	p.Y29H		NM_021269.2	NP_067092.2	P17019	ZN708_HUMAN	zinc finger protein 708	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(2)|stomach(1)	32						ACATTCCTATATAAATTCTGC	0.333																																					p.Y29H		.											.	ZNF708-516	0			c.T85C						.						62.0	66.0	65.0					19																	21493348		2203	4300	6503	SO:0001583	missense	7562	exon2			TCCTATATAAATT	X52339	CCDS32980.1	19p12	2014-02-14	2006-08-22	2005-08-16	ENSG00000182141	ENSG00000182141		"""Zinc fingers, C2H2-type"", ""-"""	12945	protein-coding gene	gene with protein product			"""zinc finger protein 15-like 1 (KOX 8)"", ""zinc finger protein 708"", ""zinc finger protein 708 (KOX8)"""	ZNF15, ZNF15L1		2014798	Standard	NM_021269		Approved	KOX8	uc002npq.1	P17019	OTTHUMG00000182841	ENST00000356929.3:c.85T>C	19.37:g.21493348A>G	ENSP00000349401:p.Tyr29His	Somatic	107	1		WXS	Illumina HiSeq	Phase_I	97	46	NM_021269	0	0	1	1	0	Q6ZMR0	Missense_Mutation	SNP	ENST00000356929.3	37	CCDS32980.1	.	.	.	.	.	.	.	.	.	.	.	6.938	0.542810	0.13250	.	.	ENSG00000182141	ENST00000356929	T	0.07908	3.15	1.22	1.22	0.21188	Krueppel-associated box (4);	.	.	.	.	T	0.30759	0.0775	M	0.93016	3.37	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.08126	-1.0737	9	0.66056	D	0.02	.	4.192	0.10426	1.0:0.0:0.0:0.0	.	29	P17019	ZN708_HUMAN	H	29	ENSP00000349401:Y29H	ENSP00000349401:Y29H	Y	-	1	0	ZNF708	21285188	0.028000	0.19301	0.234000	0.24042	0.233000	0.25261	1.420000	0.34804	0.257000	0.21650	0.254000	0.18369	TAT	.		0.333	ZNF708-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463953.1	NM_021269	
ZNF30	90075	hgsc.bcm.edu;broad.mit.edu	37	19	35434184	35434184	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:35434184G>A	ENST00000601142.1	+	5	551	c.314G>A	c.(313-315)tGt>tAt	p.C105Y	ZNF30_ENST00000426813.2_Missense_Mutation_p.C24Y|ZNF30_ENST00000303586.7_Missense_Mutation_p.C106Y|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000439785.1_Missense_Mutation_p.C106Y|ZNF30_ENST00000595818.1_3'UTR			P17039	ZNF30_HUMAN	zinc finger protein 30	105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		TCTGAAAACTGTCCATCTTTT	0.343																																					p.C106Y		.											.	ZNF30-24	0			c.G317A						.						49.0	47.0	47.0					19																	35434184		1840	4081	5921	SO:0001583	missense	90075	exon5			AAAACTGTCCATC	X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.314G>A	19.37:g.35434184G>A	ENSP00000469954:p.Cys105Tyr	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	44	22	NM_001099438	0	0	2	2	0	A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	ENST00000601142.1	37	CCDS46045.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.858537	0.00065	.	.	ENSG00000168661	ENST00000439785;ENST00000303586;ENST00000426813	T;T	0.08458	3.26;3.09	1.35	0.286	0.15710	.	.	.	.	.	T	0.03959	0.0111	N	0.08118	0	0.09310	N	1	B;B	0.20459	0.045;0.006	B;B	0.22386	0.039;0.001	T	0.41627	-0.9498	9	0.48119	T	0.1	.	3.6691	0.08266	0.2555:0.0:0.7445:0.0	.	106;105	P17039-2;P17039	.;ZNF30_HUMAN	Y	106;105;24	ENSP00000403441:C106Y;ENSP00000416457:C24Y	ENSP00000303889:C105Y	C	+	2	0	ZNF30	40126024	0.001000	0.12720	0.142000	0.22268	0.008000	0.06430	0.505000	0.22642	0.141000	0.18875	-0.357000	0.07601	TGT	.		0.343	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1	NM_194325	
BCAM	4059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	45322619	45322619	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:45322619C>T	ENST00000270233.6	+	12	1512	c.1490C>T	c.(1489-1491)cCc>cTc	p.P497L	BCAM_ENST00000589651.1_Missense_Mutation_p.P497L	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	497	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				GAGCCAATCCCCGGACGGCAG	0.662																																					p.P497L		.											.	BCAM-91	0			c.C1490T						.						59.0	64.0	62.0					19																	45322619		2203	4300	6503	SO:0001583	missense	4059	exon12			CAATCCCCGGACG	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1490C>T	19.37:g.45322619C>T	ENSP00000270233:p.Pro497Leu	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	46	22	NM_001013257	0	0	214	482	268	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	37	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	0.017	-1.487632	0.01018	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.03124	4.04;4.04	4.31	0.796	0.18648	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.02533	0.0077	L	0.28694	0.88	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.49532	-0.8930	9	0.13853	T	0.58	-6.5334	3.4865	0.07622	0.1986:0.5733:0.0:0.2281	.	497	P50895	BCAM_HUMAN	L	497	ENSP00000270233:P497L;ENSP00000375817:P497L	ENSP00000270233:P497L	P	+	2	0	BCAM	50014459	0.003000	0.15002	0.001000	0.08648	0.113000	0.19764	-0.023000	0.12456	0.031000	0.15407	0.543000	0.68304	CCC	.		0.662	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581	
ZNF28	7576	ucsc.edu	37	19	53304673	53304673	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:53304673A>G	ENST00000457749.2	-	4	544	c.425T>C	c.(424-426)tTa>tCa	p.L142S	ZNF28_ENST00000360272.4_Missense_Mutation_p.L89S|ZNF28_ENST00000438150.2_Missense_Mutation_p.L89S|ZNF28_ENST00000594602.1_3'UTR|ZNF28_ENST00000414252.2_Missense_Mutation_p.L89S	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	142					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		ATGAAAGCTTAATCCAAGCTG	0.413																																					p.L142S													.	ZNF28-91	0			c.T425C						.						244.0	229.0	234.0					19																	53304673		2203	4300	6503	SO:0001583	missense	7576	exon4			AAGCTTAATCCAA	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.425T>C	19.37:g.53304673A>G	ENSP00000397693:p.Leu142Ser	Somatic	369	5		WXS	Illumina HiSeq		339	14	NM_006969	0	0	18	27	9	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	37	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	0.014	-1.584717	0.00872	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.10860	2.83;3.0;2.83;2.83;2.9	1.81	-1.78	0.07957	.	.	.	.	.	T	0.03434	0.0099	N	0.02412	-0.56	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45775	-0.9238	9	0.16420	T	0.52	.	7.0768	0.25209	0.7171:0.0:0.2829:0.0	.	142	P17035	ZNF28_HUMAN	S	89;142;89;89;89	ENSP00000412143:L89S;ENSP00000397693:L142S;ENSP00000353410:L89S;ENSP00000444965:L89S;ENSP00000375661:L89S	ENSP00000353410:L89S	L	-	2	0	ZNF28	57996485	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-2.146000	0.01294	-1.272000	0.02427	-1.924000	0.00514	TTA	.		0.413	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
MIR518A2	574491	bcgsc.ca	37	19	54240106	54240106	+	RNA	SNP	C	C	A	rs200729527		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:54240106C>A	ENST00000384966.1	+	0	0				MIR516B1_ENST00000385211.1_RNA|MIR518D_ENST00000385014.1_RNA	NR_030213.1				microRNA 518a-2																		ATATCTCAGGCTGTGACCATC	0.418																																					.													.	.	0			.						.						173.0	148.0	156.0					19																	54240106		1568	3582	5150			574490	.			CTCAGGCTGTGAC			19q13.42	2011-09-12		2008-12-18	ENSG00000207699	ENSG00000207699		"""ncRNAs / Micro RNAs"""	32123	non-coding RNA	RNA, micro				MIRN518A-2, MIRN518A2			Standard	NR_030213		Approved	hsa-mir-518a-2	uc021vaq.1				19.37:g.54240106C>A		Somatic	200	1		WXS	Illumina HiSeq	Phase_1	170	12	.	0	0	1	1	0		RNA	SNP	ENST00000384966.1	37																																																																																				C|0.999;A|0.001		0.418	MIR518A2-201	KNOWN	basic	miRNA	miRNA		NR_030213	
FCAR	2204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55385758	55385758	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:55385758C>T	ENST00000355524.3	+	1	23	c.13C>T	c.(13-15)Cag>Tag	p.Q5*	FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391726.3_Nonsense_Mutation_p.Q5*|FCAR_ENST00000469767.1_Nonsense_Mutation_p.Q5*|FCAR_ENST00000359272.4_Nonsense_Mutation_p.Q5*|FCAR_ENST00000391723.3_Nonsense_Mutation_p.Q5*|FCAR_ENST00000353758.4_Nonsense_Mutation_p.Q5*|FCAR_ENST00000345937.4_Nonsense_Mutation_p.Q5*|FCAR_ENST00000391725.3_Nonsense_Mutation_p.Q5*|FCAR_ENST00000391724.3_Nonsense_Mutation_p.Q5*	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	5					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		GGACCCCAAACAGACCACCCT	0.483																																					p.Q5X		.											.	FCAR-92	0			c.C13T						.						135.0	122.0	127.0					19																	55385758		2203	4300	6503	SO:0001587	stop_gained	2204	exon1			CCCAAACAGACCA	X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.13C>T	19.37:g.55385758C>T	ENSP00000347714:p.Gln5*	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	136	59	NM_133279	0	0	0	0	0	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Nonsense_Mutation	SNP	ENST00000355524.3	37	CCDS12907.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.549835	0.65311	.	.	ENSG00000186431	ENST00000433231;ENST00000391726;ENST00000355524;ENST00000391725;ENST00000345937;ENST00000353758;ENST00000359272;ENST00000391723;ENST00000391724	.	.	.	2.76	1.72	0.24424	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	7.8266	0.29318	0.0:0.2588:0.7412:0.0	.	.	.	.	X	5	.	ENSP00000338257:Q5X	Q	+	1	0	FCAR	60077570	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-0.054000	0.11826	0.725000	0.32318	-0.226000	0.12346	CAG	.		0.483	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000	
ASAP2	8853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	9515020	9515020	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:9515020G>C	ENST00000281419.3	+	17	2033	c.1693G>C	c.(1693-1695)Gct>Cct	p.A565P	ASAP2_ENST00000315273.4_Missense_Mutation_p.A565P	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	565					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						ATTGCTCCAAGCTTATGCTGA	0.473																																					p.A565P		.											.	ASAP2-90	0			c.G1693C						.						100.0	100.0	100.0					2																	9515020		2203	4300	6503	SO:0001583	missense	8853	exon17			CTCCAAGCTTATG	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1693G>C	2.37:g.9515020G>C	ENSP00000281419:p.Ala565Pro	Somatic	191	1		WXS	Illumina HiSeq	Phase_I	158	60	NM_001135191	0	0	5	10	5	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957409	0.73902	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.60040	0.26;0.22	5.27	5.27	0.74061	Ankyrin repeat-containing domain (1);	0.114641	0.64402	D	0.000015	T	0.62258	0.2413	L	0.43923	1.385	0.44754	D	0.997751	D;P	0.67145	0.996;0.938	P;B	0.54544	0.755;0.182	T	0.65286	-0.6205	10	0.66056	D	0.02	.	13.8057	0.63230	0.0:0.0:0.8468:0.1532	.	565;565	O43150-2;O43150	.;ASAP2_HUMAN	P	565	ENSP00000281419:A565P;ENSP00000316404:A565P	ENSP00000281419:A565P	A	+	1	0	ASAP2	9432471	1.000000	0.71417	0.946000	0.38457	0.972000	0.66771	6.520000	0.73773	2.450000	0.82876	0.655000	0.94253	GCT	.		0.473	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
HEATR5B	54497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	37235951	37235951	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:37235951G>A	ENST00000233099.5	-	28	4420	c.4325C>T	c.(4324-4326)tCa>tTa	p.S1442L	HEATR5B_ENST00000354531.2_Missense_Mutation_p.S1442L	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1442						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TTTTGGTTTTGACTCTGCTTC	0.323																																					p.S1442L		.											.	HEATR5B-142	0			c.C4325T						.						275.0	252.0	260.0					2																	37235951		2203	4300	6503	SO:0001583	missense	54497	exon28			GGTTTTGACTCTG	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.4325C>T	2.37:g.37235951G>A	ENSP00000233099:p.Ser1442Leu	Somatic	243	0		WXS	Illumina HiSeq	Phase_I	196	83	NM_019024	0	0	8	10	2	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096063	0.56075	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.48201	0.82;0.82	5.75	4.87	0.63330	Armadillo-like helical (1);Armadillo-type fold (1);	0.421246	0.25753	N	0.028524	T	0.31071	0.0785	L	0.29908	0.895	0.35398	D	0.79138	B;B	0.28933	0.228;0.0	B;B	0.21546	0.035;0.002	T	0.33059	-0.9883	10	0.23891	T	0.37	-16.3124	9.1639	0.37038	0.0727:0.0:0.7809:0.1464	.	1442;1442	Q9P2D3-3;Q9P2D3	.;HTR5B_HUMAN	L	1442	ENSP00000233099:S1442L;ENSP00000346531:S1442L	ENSP00000233099:S1442L	S	-	2	0	HEATR5B	37089455	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.382000	0.66213	2.716000	0.92895	0.655000	0.94253	TCA	.		0.323	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
CLASP1	23332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	122122716	122122716	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:122122716A>C	ENST00000263710.4	-	36	4420	c.4031T>G	c.(4030-4032)tTc>tGc	p.F1344C	CLASP1_ENST00000409078.3_Missense_Mutation_p.F1277C|CLASP1_ENST00000455322.2_Missense_Mutation_p.F1300C|CLASP1_ENST00000541859.1_Missense_Mutation_p.F1061C|CLASP1_ENST00000545861.1_Missense_Mutation_p.F1051C|CLASP1_ENST00000541377.1_Missense_Mutation_p.F1283C|CLASP1_ENST00000397587.3_Missense_Mutation_p.F1284C	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	1344	Interaction with CLIP2. {ECO:0000250}.|Interaction with PHLDB2 and RSN.|Localization to kinetochores.				axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					AATGGTCTTGAAGTGCTCCTC	0.557																																					p.F1344C		.											.	CLASP1-91	0			c.T4031G						.						69.0	75.0	73.0					2																	122122716		2086	4216	6302	SO:0001583	missense	23332	exon35			GTCTTGAAGTGCT	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.4031T>G	2.37:g.122122716A>C	ENSP00000263710:p.Phe1344Cys	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	39	20	NM_015282	0	0	8	17	9	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	37		.	.	.	.	.	.	.	.	.	.	a	27.0	4.794213	0.90453	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.57	5.57	0.84162	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82678	0.5089	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.995;0.999;0.997;0.997	D	0.85278	0.1060	10	0.87932	D	0	-10.7425	16.0196	0.80472	1.0:0.0:0.0:0.0	.	1277;1284;1285;1344	E7EUA5;F5GWS0;A2RU21;Q7Z460	.;.;.;CLAP1_HUMAN	C	1344;1300;1284;1283;1061;1277;1051	ENSP00000263710:F1344C;ENSP00000389372:F1300C;ENSP00000380717:F1284C;ENSP00000441625:F1283C;ENSP00000441770:F1061C;ENSP00000386442:F1277C;ENSP00000438620:F1051C	ENSP00000263710:F1344C	F	-	2	0	CLASP1	121839186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.927000	0.92846	2.249000	0.74217	0.454000	0.30748	TTC	.		0.557	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
NFE2L2	4780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	178098800	178098800	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:178098800T>C	ENST00000397062.3	-	2	799	c.245A>G	c.(244-246)gAa>gGa	p.E82G	NFE2L2_ENST00000464747.1_Missense_Mutation_p.E66G|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E66G|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E66G|NFE2L2_ENST00000423513.1_Missense_Mutation_p.E66G	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	82					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E82G(3)|p.G81_F83delGEF(1)|p.E82V(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TGGGAGAAATTCACCTGTCTC	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.E82G		.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2-90	5	Substitution - Missense(4)|Deletion - In frame(1)	liver(3)|lung(1)|oesophagus(1)	c.A245G						.						137.0	137.0	137.0					2																	178098800		1900	4105	6005	SO:0001583	missense	4780	exon2			AGAAATTCACCTG		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.245A>G	2.37:g.178098800T>C	ENSP00000380252:p.Glu82Gly	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	99	41	NM_006164	0	0	38	61	23	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.048793	0.93740	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T	0.38077	1.57;1.57;1.57;1.16;1.16;1.57	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.66287	0.2774	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.997;0.994;0.998;0.997	T	0.72959	-0.4133	10	0.87932	D	0	.	16.098	0.81144	0.0:0.0:0.0:1.0	.	66;66;66;82	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	G	66;82;66;66;66;66	ENSP00000380253:E66G;ENSP00000380252:E82G;ENSP00000411575:E66G;ENSP00000400073:E66G;ENSP00000412191:E66G;ENSP00000410015:E66G	ENSP00000380252:E82G	E	-	2	0	NFE2L2	177807046	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.503000	0.81632	2.210000	0.71456	0.460000	0.39030	GAA	.		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
TTN	7273	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179550284	179550284	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:179550284G>A	ENST00000591111.1	-	126	31626	c.31402C>T	c.(31402-31404)Cac>Tac	p.H10468Y	TTN_ENST00000589042.1_Missense_Mutation_p.H10785Y|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.H9541Y|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAAATAATGTGCAGCTTTTCT	0.353																																					p.H10785Y													.	TTN-636	0			c.C32353T						.						113.0	108.0	110.0					2																	179550284		1902	4118	6020	SO:0001583	missense	7273	exon128			TAATGTGCAGCTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.31402C>T	2.37:g.179550284G>A	ENSP00000465570:p.His10468Tyr	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	58	22	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	12.49	1.954726	0.34471	.	.	ENSG00000155657	ENST00000342992	T	0.64991	-0.13	5.95	5.08	0.68730	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.51261	0.1664	L	0.38175	1.15	0.34818	D	0.738351	B	0.02656	0.0	B	0.04013	0.001	T	0.59506	-0.7442	9	0.87932	D	0	.	9.3702	0.38250	0.0786:0.1842:0.7373:0.0	.	10468	Q8WZ42	TITIN_HUMAN	Y	9541	ENSP00000343764:H9541Y	ENSP00000343764:H9541Y	H	-	1	0	TTN	179258529	0.671000	0.27521	0.974000	0.42286	0.991000	0.79684	2.340000	0.43974	1.524000	0.49035	0.655000	0.94253	CAC	.		0.353	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FN1	2335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	216289927	216289927	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:216289927A>C	ENST00000359671.1	-	7	1191	c.926T>G	c.(925-927)gTc>gGc	p.V309G	FN1_ENST00000356005.4_Missense_Mutation_p.V309G|FN1_ENST00000354785.4_Missense_Mutation_p.V309G|FN1_ENST00000323926.6_Missense_Mutation_p.V309G|FN1_ENST00000357867.4_Missense_Mutation_p.V309G|FN1_ENST00000432072.2_Missense_Mutation_p.V309G|FN1_ENST00000426059.1_Missense_Mutation_p.V309G|FN1_ENST00000357009.2_Missense_Mutation_p.V309G|FN1_ENST00000336916.4_Missense_Mutation_p.V309G|FN1_ENST00000346544.3_Missense_Mutation_p.V309G|FN1_ENST00000421182.1_Missense_Mutation_p.V309G|FN1_ENST00000345488.5_Missense_Mutation_p.V309G|FN1_ENST00000446046.1_Missense_Mutation_p.V309G|FN1_ENST00000443816.1_Missense_Mutation_p.V309G			P02751	FINC_HUMAN	fibronectin 1	309	Collagen-binding.|Fibronectin type-I 6. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	ACTGTCTGTGACACAGTGGCC	0.557																																					p.V309G		.											.	FN1-584	0			c.T926G						.						138.0	138.0	138.0					2																	216289927		2203	4300	6503	SO:0001583	missense	2335	exon7			TCTGTGACACAGT		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.926T>G	2.37:g.216289927A>C	ENSP00000352696:p.Val309Gly	Somatic	267	1		WXS	Illumina HiSeq	Phase_I	224	90	NM_212476	0	0	34	58	24	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	A	21.6	4.179602	0.78564	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.83	4.69	0.59074	.	0.187265	0.36303	N	0.002672	T	0.52108	0.1714	L	0.36672	1.1	0.80722	D	1	B;D;B;P;B;B;P;D;B;B;P	0.69078	0.055;0.997;0.09;0.891;0.25;0.294;0.593;0.97;0.25;0.25;0.935	B;D;B;P;B;B;B;P;B;B;P	0.80764	0.092;0.994;0.072;0.621;0.092;0.149;0.21;0.839;0.092;0.092;0.736	T	0.54609	-0.8268	10	0.87932	D	0	.	11.3208	0.49421	0.9296:0.0:0.0704:0.0	.	309;309;309;309;309;309;309;309;309;309;309	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	G	309	ENSP00000394423:V309G;ENSP00000323534:V309G;ENSP00000338200:V309G;ENSP00000350534:V309G;ENSP00000346839:V309G;ENSP00000352696:V309G;ENSP00000265312:V309G;ENSP00000273049:V309G;ENSP00000349509:V309G;ENSP00000410422:V309G;ENSP00000415018:V309G;ENSP00000399538:V309G;ENSP00000348285:V309G;ENSP00000398907:V309G	ENSP00000265313:V309G	V	-	2	0	FN1	215998172	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.190000	0.58365	2.231000	0.72958	0.460000	0.39030	GTC	.		0.557	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
GIGYF2	26058	hgsc.bcm.edu	37	2	233712220	233712220	+	Missense_Mutation	SNP	A	A	C	rs527464858	byFrequency	TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:233712220A>C	ENST00000409547.1	+	29	3934	c.3623A>C	c.(3622-3624)cAg>cCg	p.Q1208P	GIGYF2_ENST00000373566.3_Missense_Mutation_p.Q1230P|GIGYF2_ENST00000409196.3_Missense_Mutation_p.Q1202P|GIGYF2_ENST00000409480.1_Missense_Mutation_p.Q1230P|GIGYF2_ENST00000409451.3_Missense_Mutation_p.Q1229P|GIGYF2_ENST00000373563.4_Missense_Mutation_p.Q1208P	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	1208	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		cagcagcagcagctgccacag	0.567																																					p.Q1229P		.											.	GIGYF2-28	0			c.A3686C						.						15.0	17.0	16.0					2																	233712220		2188	4274	6462	SO:0001583	missense	26058	exon29			AGCAGCAGCTGCC	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.3623A>C	2.37:g.233712220A>C	ENSP00000386537:p.Gln1208Pro	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	34	2	NM_001103147	0	0	0	0	0	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	37	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	A	8.906	0.957519	0.18507	.	.	ENSG00000204120	ENST00000373566;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000409196;ENST00000409451	T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2	5.3	4.13	0.48395	.	0.921754	0.09517	N	0.791427	T	0.55673	0.1935	L	0.45137	1.4	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.46345	-0.9198	10	0.59425	D	0.04	-3.325	10.0439	0.42175	0.8304:0.1696:0.0:0.0	.	1229;1208;1202	A6H8W4;Q6Y7W6;E9PBB0	.;PERQ2_HUMAN;.	P	1230;1208;1230;1208;1202;1229	ENSP00000362667:Q1230P;ENSP00000362664:Q1208P;ENSP00000386765:Q1230P;ENSP00000386537:Q1208P;ENSP00000387070:Q1202P;ENSP00000387170:Q1229P	ENSP00000362664:Q1208P	Q	+	2	0	GIGYF2	233420464	1.000000	0.71417	0.990000	0.47175	0.144000	0.21451	4.293000	0.59037	0.828000	0.34709	0.533000	0.62120	CAG	.		0.567	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
BMP7	655	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	55777539	55777539	+	Missense_Mutation	SNP	G	G	A	rs112344257		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr20:55777539G>A	ENST00000395863.3	-	3	1257	c.752C>T	c.(751-753)aCg>aTg	p.T251M	BMP7_ENST00000395864.3_Missense_Mutation_p.T251M|BMP7_ENST00000460817.1_5'UTR|BMP7_ENST00000450594.2_Missense_Mutation_p.T251M	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	251					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			ACCATCCAGCGTCTCCACCGA	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		16001	0.0		0.001	False		,,,				2504	0.0				p.T251M													.	BMP7-187	0			c.C752T						.	G	MET/THR	0,4406		0,0,2203	41.0	36.0	38.0		752	3.7	1.0	20	dbSNP_132	38	2,8598	2.2+/-6.3	0,2,4298	yes	missense	BMP7	NM_001719.2	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	251/432	55777539	2,13004	2203	4300	6503	SO:0001583	missense	655	exon3			TCCAGCGTCTCCA		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.752C>T	20.37:g.55777539G>A	ENSP00000379204:p.Thr251Met	Somatic	41	1		WXS	Illumina HiSeq	Phase_I	22	16	NM_001719	0	0	0	0	0	Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	37	CCDS13455.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	16.92	3.255052	0.59321	0.0	2.33E-4	ENSG00000101144	ENST00000395863;ENST00000395864;ENST00000450594	T;T;T	0.66638	-0.22;-0.22;-0.22	4.78	3.74	0.42951	Transforming growth factor-beta, N-terminal (1);	0.041703	0.85682	D	0.000000	T	0.74336	0.3703	M	0.78916	2.43	0.37592	D	0.920226	D;P;P	0.65815	0.995;0.484;0.846	P;B;B	0.53809	0.735;0.095;0.305	T	0.80286	-0.1446	10	0.54805	T	0.06	.	11.9649	0.53029	0.0:0.4402:0.5598:0.0	.	251;251;251	B1AKZ9;P18075;B1AL00	.;BMP7_HUMAN;.	M	251	ENSP00000379204:T251M;ENSP00000379205:T251M;ENSP00000398687:T251M	ENSP00000379204:T251M	T	-	2	0	BMP7	55210946	0.990000	0.36364	0.967000	0.41034	0.945000	0.59286	2.151000	0.42263	2.369000	0.80426	0.561000	0.74099	ACG	T|0.000;C|0.999		0.612	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079831.2		
BACE2	25825	broad.mit.edu	37	21	42551311	42551311	+	Intron	SNP	A	A	G	rs201045863		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr21:42551311A>G	ENST00000330333.6	+	1	775				PLAC4_ENST00000440221.2_RNA|PLAC4_ENST00000430327.2_RNA|BACE2-IT1_ENST00000433378.1_RNA|BACE2_ENST00000347667.5_Intron|PLAC4_ENST00000536486.1_RNA|BACE2_ENST00000328735.6_Intron|PLAC4_ENST00000414699.1_RNA	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2						membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				gagtgagggtatccagggtga	0.602																																					p.I82T													.	.	0			c.T245C						.						141.0	125.0	130.0					21																	42551311		2189	4261	6450	SO:0001627	intron_variant	191585	exon1			GAGGGTATCCAGG	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.312+10809A>G	21.37:g.42551311A>G		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_182832	0	0	0	0	0	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Missense_Mutation	SNP	ENST00000330333.6	37	CCDS13668.1																																																																																			.		0.602	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
SCN5A	6331	hgsc.bcm.edu;bcgsc.ca	37	3	38645417	38645417	+	Missense_Mutation	SNP	G	G	A	rs199473575		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr3:38645417G>A	ENST00000333535.4	-	12	1825	c.1676C>T	c.(1675-1677)aCa>aTa	p.T559I	SCN5A_ENST00000451551.2_Missense_Mutation_p.T559I|SCN5A_ENST00000413689.1_Missense_Mutation_p.T559I|SCN5A_ENST00000423572.2_Missense_Mutation_p.T559I|SCN5A_ENST00000455624.2_Missense_Mutation_p.T559I|SCN5A_ENST00000414099.2_Missense_Mutation_p.T559I|SCN5A_ENST00000443581.1_Missense_Mutation_p.T559I|SCN5A_ENST00000425664.1_Missense_Mutation_p.T559I|SCN5A_ENST00000450102.2_Missense_Mutation_p.T559I|SCN5A_ENST00000449557.2_Missense_Mutation_p.T559I			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	559					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CAGCAGTGATGTGTGGTGGCT	0.622																																					p.T559I		.											.	SCN5A-98	0			c.C1676T						.						49.0	55.0	53.0					3																	38645417		2086	4212	6298	SO:0001583	missense	6331	exon12			AGTGATGTGTGGT	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1676C>T	3.37:g.38645417G>A	ENSP00000328968:p.Thr559Ile	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	67	35	NM_001160160	0	0	1	1	0	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780662	0.49891	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74	4.27	2.43	0.29744	Domain of unknown function DUF3451 (1);	0.879266	0.09862	N	0.746040	D	0.87014	0.6072	L	0.44542	1.39	0.29849	N	0.828558	B;P;B;B;P;P;P	0.43231	0.259;0.801;0.418;0.259;0.801;0.799;0.763	B;B;B;B;B;B;B	0.43360	0.041;0.417;0.051;0.059;0.192;0.371;0.293	T	0.81636	-0.0843	10	0.72032	D	0.01	.	6.1048	0.20067	0.1921:0.2795:0.5284:0.0	.	559;559;559;559;559;559;559	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	I	559	ENSP00000398962:T559I;ENSP00000398266:T559I;ENSP00000410257:T559I;ENSP00000388797:T559I;ENSP00000397915:T559I;ENSP00000416634:T559I;ENSP00000328968:T559I;ENSP00000399524:T559I;ENSP00000403355:T559I;ENSP00000413996:T559I	ENSP00000328968:T559I	T	-	2	0	SCN5A	38620421	0.911000	0.30947	0.896000	0.35187	0.619000	0.37552	1.714000	0.37961	1.020000	0.39573	-0.224000	0.12420	ACA	.		0.622	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
PDZRN3	23024	broad.mit.edu;bcgsc.ca	37	3	73440201	73440201	+	Missense_Mutation	SNP	C	C	T	rs200273452		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr3:73440201C>T	ENST00000263666.4	-	6	1435	c.1321G>A	c.(1321-1323)Gat>Aat	p.D441N	PDZRN3_ENST00000466348.1_5'UTR|PDZRN3_ENST00000462146.2_Missense_Mutation_p.D98N|PDZRN3_ENST00000535920.1_Missense_Mutation_p.D163N|PDZRN3_ENST00000479530.1_Missense_Mutation_p.D158N|PDZRN3_ENST00000466780.1_Missense_Mutation_p.D98N	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	441	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TCGTCTTCATCGTCCGTCCGG	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		18795	0.0		0.001	False		,,,				2504	0.0				p.D441N													.	PDZRN3-232	0			c.G1321A						.	C	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	271.0	252.0	258.0		1321	5.2	0.6	3		258	3,8597	3.0+/-9.4	0,3,4297	yes	missense	PDZRN3	NM_015009.1	23	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	probably-damaging	441/1067	73440201	4,13002	2203	4300	6503	SO:0001583	missense	23024	exon6			CTTCATCGTCCGT	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1321G>A	3.37:g.73440201C>T	ENSP00000263666:p.Asp441Asn	Somatic	417	0		WXS	Illumina HiSeq	Phase_I	386	15	NM_015009	0	0	3	3	0	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	.	.	.	.	.	.	.	.	.	.	C	33	5.239542	0.95240	2.27E-4	3.49E-4	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909	T;T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75;1.75	5.18	5.18	0.71444	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.44435	0.1293	L	0.41632	1.29	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.993;0.999;0.985;0.997	T	0.31392	-0.9945	10	0.52906	T	0.07	.	18.2949	0.90141	0.0:1.0:0.0:0.0	.	163;158;158;441	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	N	441;163;98;98;158;441;139	ENSP00000263666:D441N;ENSP00000442026:D163N;ENSP00000418168:D98N;ENSP00000418484:D98N;ENSP00000418624:D158N;ENSP00000419250:D139N	ENSP00000263666:D441N	D	-	1	0	PDZRN3	73522891	1.000000	0.71417	0.607000	0.28956	0.911000	0.54048	7.638000	0.83328	2.413000	0.81919	0.655000	0.94253	GAT	.		0.438	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
ATP2C1	27032	broad.mit.edu;bcgsc.ca	37	3	130673864	130673864	+	Silent	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr3:130673864C>T	ENST00000510168.1	+	10	1246	c.696C>T	c.(694-696)gtC>gtT	p.V232V	ATP2C1_ENST00000507488.2_Silent_p.V216V|ATP2C1_ENST00000422190.2_Silent_p.V232V|ATP2C1_ENST00000513801.1_Silent_p.V216V|ATP2C1_ENST00000393221.4_Silent_p.V266V|ATP2C1_ENST00000504381.1_Silent_p.V177V|ATP2C1_ENST00000428331.2_Silent_p.V232V|ATP2C1_ENST00000505330.1_Silent_p.V216V|ATP2C1_ENST00000508532.1_Silent_p.V232V|ATP2C1_ENST00000328560.8_Silent_p.V232V|ATP2C1_ENST00000533801.2_Silent_p.V227V|ATP2C1_ENST00000359644.3_Silent_p.V232V|ATP2C1_ENST00000504948.1_Silent_p.V216V			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	232					actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGGGTGTTGTCATTGGAACAG	0.343									Hailey-Hailey disease																												p.V266V	Esophageal Squamous(99;456 1443 27647 34099 42636)												.	ATP2C1-91	0			c.C798T						.						103.0	103.0	103.0					3																	130673864		2203	4300	6503	SO:0001819	synonymous_variant	27032	exon9	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	TGTTGTCATTGGA	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.696C>T	3.37:g.130673864C>T		Somatic	61	0		WXS	Illumina HiSeq	Phase_I	51	16	NM_001199181	0	0	0	0	0	B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Silent	SNP	ENST00000510168.1	37	CCDS46914.1	.	.	.	.	.	.	.	.	.	.	C	9.223	1.033964	0.19590	.	.	ENSG00000017260	ENST00000504612	.	.	.	5.28	3.48	0.39840	.	.	.	.	.	T	0.54398	0.1856	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50566	-0.8813	4	.	.	.	.	5.561	0.17144	0.0:0.6103:0.1566:0.2331	.	.	.	.	L	186	.	.	S	+	2	0	ATP2C1	132156554	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.926000	0.28804	1.234000	0.43709	0.650000	0.86243	TCA	.		0.343	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356648.2	NM_001001486	
AFAP1	60312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	7857226	7857226	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr4:7857226T>G	ENST00000360265.4	-	3	535	c.301A>C	c.(301-303)Agc>Cgc	p.S101R	AFAP1_ENST00000358461.2_Missense_Mutation_p.S101R|AFAP1_ENST00000382543.3_Missense_Mutation_p.S101R|AFAP1_ENST00000420658.1_Missense_Mutation_p.S101R			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	101	Pro-rich.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						TTTCCGGGGCTCAGCGGCACA	0.562																																					p.S101R		.											.	AFAP1-90	0			c.A301C						.						89.0	76.0	81.0					4																	7857226		2203	4300	6503	SO:0001583	missense	60312	exon4			CGGGGCTCAGCGG	AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.301A>C	4.37:g.7857226T>G	ENSP00000353402:p.Ser101Arg	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	60	26	NM_001134647	0	0	0	2	2	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Missense_Mutation	SNP	ENST00000360265.4	37	CCDS3397.1	.	.	.	.	.	.	.	.	.	.	T	19.26	3.793690	0.70452	.	.	ENSG00000196526	ENST00000360265;ENST00000420658;ENST00000358461;ENST00000382543	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	4.79	4.79	0.61399	.	0.087086	0.85682	D	0.000000	T	0.52403	0.1732	L	0.34521	1.04	0.43326	D	0.995356	D;D	0.67145	0.996;0.99	P;P	0.58577	0.719;0.841	T	0.56347	-0.7994	10	0.66056	D	0.02	-20.9708	13.3262	0.60461	0.0:0.0:0.0:1.0	.	101;101	E9PDT7;Q8N556	.;AFAP1_HUMAN	R	101	ENSP00000353402:S101R;ENSP00000410689:S101R;ENSP00000351245:S101R;ENSP00000371983:S101R	ENSP00000351245:S101R	S	-	1	0	AFAP1	7908126	1.000000	0.71417	0.975000	0.42487	0.988000	0.76386	3.466000	0.53071	1.780000	0.52325	0.459000	0.35465	AGC	.		0.562	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
SMARCAD1	56916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	95191935	95191935	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr4:95191935A>G	ENST00000354268.4	+	11	1611	c.1538A>G	c.(1537-1539)aAa>aGa	p.K513R	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.K513R|SMARCAD1_ENST00000509418.1_Missense_Mutation_p.K83R			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	513	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		TTGGTACATAAACATGGACTT	0.343																																					p.K513R		.											.	SMARCAD1-229	0			c.A1538G						.						198.0	186.0	190.0					4																	95191935		2203	4300	6503	SO:0001583	missense	56916	exon11			TACATAAACATGG	AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.1538A>G	4.37:g.95191935A>G	ENSP00000346217:p.Lys513Arg	Somatic	164	0		WXS	Illumina HiSeq	Phase_I	123	47	NM_001128429	0	0	9	23	14	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	A	17.84	3.488315	0.64074	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19	5.86	5.86	0.93980	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.46442	D	0.000282	D	0.85660	0.5748	N	0.03294	-0.36	0.54753	D	0.999987	B;B	0.32753	0.256;0.383	B;B	0.37091	0.241;0.155	D	0.84661	0.0706	10	0.23302	T	0.38	-27.7438	16.2652	0.82574	1.0:0.0:0.0:0.0	.	513;513	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	R	513;513;513;83	ENSP00000351947:K513R;ENSP00000415576:K513R;ENSP00000346217:K513R;ENSP00000423286:K83R	ENSP00000346217:K513R	K	+	2	0	SMARCAD1	95410958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.861000	0.75478	2.241000	0.73720	0.528000	0.53228	AAA	.		0.343	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
MYO10	4651	ucsc.edu	37	5	16701576	16701576	+	Silent	SNP	G	G	A	rs367952629		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr5:16701576G>A	ENST00000513610.1	-	25	3382	c.2928C>T	c.(2926-2928)tgC>tgT	p.C976C	MYO10_ENST00000274203.9_Silent_p.C333C|MYO10_ENST00000515803.1_Silent_p.C315C|MYO10_ENST00000505695.1_Silent_p.C315C|MYO10_ENST00000512061.1_5'Flank|MYO10_ENST00000427430.2_Silent_p.C333C	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	976					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						GCTTCTCCTCGCATGCGCTCT	0.592																																					p.C976C													.	MYO10-3	0			c.C2928T						.						35.0	39.0	38.0					5																	16701576		2105	4231	6336	SO:0001819	synonymous_variant	4651	exon25			CTCCTCGCATGCG	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.2928C>T	5.37:g.16701576G>A		Somatic	75	0		WXS	Illumina HiSeq		52	5	NM_012334	0	0	27	27	0	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	37	CCDS54834.1																																																																																			.		0.592	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
PDZD2	23037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	32108145	32108145	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr5:32108145G>A	ENST00000438447.1	+	25	8812	c.8424G>A	c.(8422-8424)ctG>ctA	p.L2808L	PDZD2_ENST00000513490.1_3'UTR|PDZD2_ENST00000282493.3_Silent_p.L2808L|CTD-2152M20.2_ENST00000503441.1_RNA			O15018	PDZD2_HUMAN	PDZ domain containing 2	2808	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGAAACCTCTGGTTGGGCTCA	0.388																																					p.L2808L		.											.	PDZD2-563	0			c.G8424A						.						129.0	134.0	133.0					5																	32108145		2203	4300	6503	SO:0001819	synonymous_variant	23037	exon24			ACCTCTGGTTGGG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.8424G>A	5.37:g.32108145G>A		Somatic	125	0		WXS	Illumina HiSeq	Phase_I	125	54	NM_178140	0	0	2	2	0	Q9BXD4	Silent	SNP	ENST00000438447.1	37	CCDS34137.1																																																																																			.		0.388	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
POLK	51426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	74872636	74872636	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr5:74872636A>C	ENST00000241436.4	+	6	744	c.572A>C	c.(571-573)aAt>aCt	p.N191T	POLK_ENST00000506928.1_3'UTR|POLK_ENST00000515295.1_Missense_Mutation_p.N191T|POLK_ENST00000352007.5_Missense_Mutation_p.N191T|POLK_ENST00000508526.1_Missense_Mutation_p.N191T|POLK_ENST00000504026.1_Missense_Mutation_p.N191T|POLK_ENST00000380481.3_Missense_Mutation_p.N101T	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	191	UmuC.				DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		TATGATCCCAATTTTATGGCC	0.328								DNA polymerases (catalytic subunits)																													p.N191T		.											.	POLK-229	0			c.A572C						.						72.0	70.0	71.0					5																	74872636		2203	4299	6502	SO:0001583	missense	51426	exon6			ATCCCAATTTTAT	AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.572A>C	5.37:g.74872636A>C	ENSP00000241436:p.Asn191Thr	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	54	24	NM_016218	0	0	5	11	6	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Missense_Mutation	SNP	ENST00000241436.4	37	CCDS4030.1	.	.	.	.	.	.	.	.	.	.	A	19.74	3.883355	0.72410	.	.	ENSG00000122008	ENST00000241436;ENST00000352007;ENST00000515295;ENST00000504026;ENST00000508526;ENST00000380481	T;T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99;-0.99	5.34	5.34	0.76211	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.296696	0.40064	N	0.001200	T	0.77987	0.4213	L	0.38175	1.15	0.42098	D	0.991328	P;P;P;D	0.53885	0.804;0.607;0.597;0.963	P;P;P;P	0.62740	0.663;0.653;0.624;0.906	T	0.80415	-0.1392	10	0.87932	D	0	-10.8466	11.291	0.49250	0.9266:0.0:0.0734:0.0	.	191;191;191;191	Q9UBT6-3;Q5Q9G5;Q9UBT6-2;Q9UBT6	.;.;.;POLK_HUMAN	T	191;191;191;191;191;101	ENSP00000241436:N191T;ENSP00000342256:N191T;ENSP00000424174:N191T;ENSP00000425075:N191T;ENSP00000426853:N191T;ENSP00000369848:N101T	ENSP00000241436:N191T	N	+	2	0	POLK	74908392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.254000	0.65457	2.018000	0.59344	0.460000	0.39030	AAT	.		0.328	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218	
ZNF608	57507	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	123983889	123983889	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr5:123983889A>T	ENST00000306315.5	-	4	2623	c.2188T>A	c.(2188-2190)Tct>Act	p.S730T	ZNF608_ENST00000504926.1_Missense_Mutation_p.S303T	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	730							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TTCAGTTTAGAGAGGTTTTTG	0.483																																					p.S730T		.											.	ZNF608-229	0			c.T2188A						.						29.0	31.0	30.0					5																	123983889		2203	4300	6503	SO:0001583	missense	57507	exon4			GTTTAGAGAGGTT	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.2188T>A	5.37:g.123983889A>T	ENSP00000307746:p.Ser730Thr	Somatic	40	1		WXS	Illumina HiSeq	Phase_I	47	21	NM_020747	0	0	2	3	1	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	.	.	.	.	.	.	.	.	.	.	A	15.82	2.947262	0.53186	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.49432	0.78;0.78	6.01	4.84	0.62591	.	0.321088	0.35903	N	0.002902	T	0.44307	0.1287	L	0.56769	1.78	0.38018	D	0.934741	P	0.46142	0.873	B	0.39660	0.306	T	0.48937	-0.8990	10	0.35671	T	0.21	-11.9515	13.5264	0.61597	0.8699:0.1301:0.0:0.0	.	730	Q9ULD9	ZN608_HUMAN	T	303;730	ENSP00000427657:S303T;ENSP00000307746:S730T	ENSP00000307746:S730T	S	-	1	0	ZNF608	124011788	0.997000	0.39634	0.945000	0.38365	0.940000	0.58332	3.554000	0.53720	1.074000	0.40909	0.523000	0.50628	TCT	.		0.483	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
MAML1	9794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	179192887	179192887	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr5:179192887G>A	ENST00000292599.3	+	2	1139	c.876G>A	c.(874-876)ttG>ttA	p.L292L	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAACCCCCTTGGCACAGGACA	0.527																																					p.L292L		.											.	MAML1-848	0			c.G876A						.						63.0	71.0	68.0					5																	179192887		2203	4300	6503	SO:0001819	synonymous_variant	9794	exon2			CCCCTTGGCACAG	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.876G>A	5.37:g.179192887G>A		Somatic	164	0		WXS	Illumina HiSeq	Phase_I	146	68	NM_014757	0	0	7	8	1		Silent	SNP	ENST00000292599.3	37	CCDS34315.1																																																																																			.		0.527	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
PRRC2A	7916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31595867	31595867	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr6:31595867C>T	ENST00000376033.2	+	12	1850	c.1616C>T	c.(1615-1617)gCc>gTc	p.A539V	PRRC2A_ENST00000376007.4_Missense_Mutation_p.A539V	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	539	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CCAGCATCAGCCCCAACACCA	0.627																																					p.A539V		.											.	PRRC2A-156	0			c.C1616T						.						127.0	114.0	119.0					6																	31595867		1511	2709	4220	SO:0001583	missense	7916	exon12			CATCAGCCCCAAC	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1616C>T	6.37:g.31595867C>T	ENSP00000365201:p.Ala539Val	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	136	55	NM_004638	0	1	52	89	36	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	C	9.670	1.146580	0.21288	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.08102	3.13;3.13	4.62	0.771	0.18504	.	0.843533	0.10340	N	0.686385	T	0.00967	0.0032	N	0.02011	-0.69	0.24306	N	0.995104	B	0.02656	0.0	B	0.04013	0.001	T	0.48269	-0.9050	10	0.87932	D	0	-0.1078	6.2328	0.20744	0.0:0.5543:0.0:0.4457	.	539	P48634	PRC2A_HUMAN	V	539;528;539;539	ENSP00000365175:A539V;ENSP00000365201:A539V	ENSP00000365175:A539V	A	+	2	0	PRRC2A	31703846	0.098000	0.21812	0.464000	0.27143	0.840000	0.47671	1.319000	0.33655	0.269000	0.21961	0.561000	0.74099	GCC	.		0.627	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
C6orf226	441150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	42858492	42858492	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr6:42858492G>A	ENST00000408925.2	-	1	62	c.35C>T	c.(34-36)cCg>cTg	p.P12L		NM_001008739.1	NP_001008739.1	Q5I0X4	CF226_HUMAN	chromosome 6 open reading frame 226	12										lung(2)	2						GGCAGAGGCCGGGGCCGAGCA	0.672																																					p.P12L		.											.	.	0			c.C35T						.						30.0	39.0	36.0					6																	42858492		1987	4153	6140	SO:0001583	missense	441150	exon1			GAGGCCGGGGCCG	BC051007, BC060325	CCDS43463.1	6p21.1	2009-02-11			ENSG00000221821	ENSG00000221821			34431	protein-coding gene	gene with protein product							Standard	NM_001008739		Approved	LOC441150	uc003osw.3	Q5I0X4	OTTHUMG00000156926	ENST00000408925.2:c.35C>T	6.37:g.42858492G>A	ENSP00000386146:p.Pro12Leu	Somatic	128	1		WXS	Illumina HiSeq	Phase_I	86	30	NM_001008739	0	0	14	29	15		Missense_Mutation	SNP	ENST00000408925.2	37	CCDS43463.1	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062387	0.36373	.	.	ENSG00000221821	ENST00000408925	.	.	.	4.44	3.54	0.40534	.	0.508870	0.15438	N	0.262358	T	0.14056	0.0340	N	0.08118	0	0.09310	N	1	D	0.67145	0.996	P	0.52267	0.694	T	0.05370	-1.0889	9	0.49607	T	0.09	-4.2365	10.0913	0.42449	0.0:0.2039:0.7961:0.0	.	12	Q5I0X4	CF226_HUMAN	L	12	.	ENSP00000386146:P12L	P	-	2	0	C6orf226	42966470	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	-0.029000	0.12329	1.056000	0.40484	0.561000	0.74099	CCG	.		0.672	C6orf226-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346635.1	NM_001008739	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	51917922	51917922	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr6:51917922C>T	ENST00000371117.3	-	21	2367	c.2092G>A	c.(2092-2094)Ggc>Agc	p.G698S	PKHD1_ENST00000340994.4_Missense_Mutation_p.G698S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	698					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TAGAACAGGCCCGTCTCCTGG	0.517																																					p.G698S		.											.	PKHD1-603	0			c.G2092A						.						72.0	73.0	73.0					6																	51917922		2203	4300	6503	SO:0001583	missense	5314	exon21			ACAGGCCCGTCTC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2092G>A	6.37:g.51917922C>T	ENSP00000360158:p.Gly698Ser	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	62	25	NM_170724	0	0	11	14	3	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.511891	0.44660	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.86865	-1.97;-2.18	5.63	3.77	0.43336	.	0.810468	0.11546	N	0.553288	T	0.63141	0.2486	L	0.33485	1.01	0.09310	N	1	B;B	0.20887	0.047;0.049	B;B	0.16289	0.015;0.012	T	0.50734	-0.8793	10	0.13108	T	0.6	.	9.2695	0.37661	0.0:0.7612:0.0:0.2388	.	698;698	P08F94-2;P08F94	.;PKHD1_HUMAN	S	698	ENSP00000360158:G698S;ENSP00000341097:G698S	ENSP00000341097:G698S	G	-	1	0	PKHD1	52025881	0.000000	0.05858	0.012000	0.15200	0.396000	0.30629	0.272000	0.18644	1.462000	0.47948	0.655000	0.94253	GGC	.		0.517	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
CLIP2	7461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73752800	73752800	+	Silent	SNP	A	A	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:73752800A>T	ENST00000395060.1	+	2	144	c.144A>T	c.(142-144)tcA>tcT	p.S48S	CLIP2_ENST00000223398.6_Silent_p.S48S|CLIP2_ENST00000361545.5_Silent_p.S48S			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	48						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						ACAAACAGTCATCTGGACCCT	0.657																																					p.S48S		.											.	CLIP2-93	0			c.A144T						.						21.0	17.0	18.0					7																	73752800		2195	4292	6487	SO:0001819	synonymous_variant	7461	exon3			ACAGTCATCTGGA	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.144A>T	7.37:g.73752800A>T		Somatic	19	0		WXS	Illumina HiSeq	Phase_I	29	18	NM_032421	0	0	8	37	29	O14527|O43611	Silent	SNP	ENST00000395060.1	37	CCDS5569.1																																																																																			.		0.657	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
CHCHD3	54927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	132754922	132754922	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:132754922G>A	ENST00000262570.5	-	2	293	c.149C>T	c.(148-150)tCt>tTt	p.S50F	CHCHD3_ENST00000448878.1_Missense_Mutation_p.S50F|CHCHD3_ENST00000476546.1_Intron|CHCHD3_ENST00000542753.1_Missense_Mutation_p.S50F	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3	50					inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						ATAAGCACCAGAATACCGCTG	0.353																																					p.S50F		.											.	CHCHD3-90	0			c.C149T						.						79.0	69.0	72.0					7																	132754922		2203	4300	6503	SO:0001583	missense	54927	exon2			GCACCAGAATACC	BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231	ENST00000262570.5:c.149C>T	7.37:g.132754922G>A	ENSP00000262570:p.Ser50Phe	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	82	17	NM_017812	0	0	62	99	37		Missense_Mutation	SNP	ENST00000262570.5	37	CCDS5828.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975118	0.34848	.	.	ENSG00000106554	ENST00000262570;ENST00000448878;ENST00000542753	T;T;T	0.46451	0.87;0.87;0.87	6.03	6.03	0.97812	.	0.483083	0.24301	N	0.039727	T	0.55513	0.1925	L	0.43152	1.355	0.23841	N	0.996695	B;D;B	0.65815	0.006;0.995;0.004	B;D;B	0.63283	0.006;0.913;0.007	T	0.51553	-0.8691	10	0.66056	D	0.02	-0.3383	16.0569	0.80812	0.0:0.0:1.0:0.0	.	50;50;50	G3V1K1;C9JRZ6;Q9NX63	.;.;CHCH3_HUMAN	F	50	ENSP00000262570:S50F;ENSP00000389297:S50F;ENSP00000440267:S50F	ENSP00000262570:S50F	S	-	2	0	CHCHD3	132405462	1.000000	0.71417	0.739000	0.30968	0.676000	0.39594	3.255000	0.51484	2.861000	0.98227	0.655000	0.94253	TCT	.		0.353	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338899.1	NM_017812	
EXOC4	60412	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	133692515	133692515	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:133692515A>G	ENST00000253861.4	+	17	2643	c.2614A>G	c.(2614-2616)Agg>Ggg	p.R872G	EXOC4_ENST00000539845.1_Missense_Mutation_p.R771G|EXOC4_ENST00000541309.1_Missense_Mutation_p.R160G|EXOC4_ENST00000545148.1_Missense_Mutation_p.R482G	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	872					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GAAAATGTGTAGGAACATTTT	0.502																																					p.R872G		.											.	EXOC4-159	0			c.A2614G						.						85.0	71.0	76.0					7																	133692515		2203	4300	6503	SO:0001583	missense	60412	exon17			ATGTGTAGGAACA	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.2614A>G	7.37:g.133692515A>G	ENSP00000253861:p.Arg872Gly	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	83	36	NM_021807	0	0	50	62	12	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.958834	0.74016	.	.	ENSG00000131558	ENST00000253861;ENST00000546185;ENST00000539845;ENST00000545148;ENST00000541309	.	.	.	5.45	2.87	0.33458	.	0.000000	0.85682	D	0.000000	T	0.78020	0.4218	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.984;0.998;0.996	T	0.81075	-0.1097	9	0.66056	D	0.02	.	11.6561	0.51320	0.7492:0.2508:0.0:0.0	.	404;482;872	B7Z689;F5GZT1;Q96A65	.;.;EXOC4_HUMAN	G	872;491;771;482;160	.	ENSP00000253861:R872G	R	+	1	2	EXOC4	133343055	0.966000	0.33281	0.990000	0.47175	0.984000	0.73092	1.330000	0.33781	2.078000	0.62432	0.482000	0.46254	AGG	.		0.502	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
KIAA1549	57670	broad.mit.edu;ucsc.edu	37	7	138595898	138595898	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:138595898G>T	ENST00000422774.1	-	4	3187	c.3139C>A	c.(3139-3141)Caa>Aaa	p.Q1047K	KIAA1549_ENST00000242365.4_Missense_Mutation_p.Q997K|KIAA1549_ENST00000440172.1_Missense_Mutation_p.Q1047K			Q9HCM3	K1549_HUMAN	KIAA1549	1047						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						TCACCTGTTTGAACTTGGAAC	0.328			O	BRAF	pilocytic astrocytoma																																p.Q1047K	NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549-369	0			c.C3139A						.						45.0	41.0	42.0					7																	138595898		1855	4102	5957	SO:0001583	missense	57670	exon4			CTGTTTGAACTTG		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3139C>A	7.37:g.138595898G>T	ENSP00000416040:p.Gln1047Lys	Somatic	14	0		WXS	Illumina HiSeq	Phase_I	28	9	NM_020910	0	0	0	0	0	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929538	0.52759	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.18960	2.18;2.18;2.21	5.23	5.23	0.72850	.	0.159296	0.42548	D	0.000698	T	0.18923	0.0454	N	0.11560	0.145	0.53005	D	0.999969	P;P	0.50819	0.939;0.925	P;P	0.53988	0.739;0.621	T	0.01874	-1.1256	10	0.06236	T	0.91	.	17.9688	0.89107	0.0:0.0:1.0:0.0	.	1047;1047	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	K	1047;997;1047	ENSP00000406661:Q1047K;ENSP00000242365:Q997K;ENSP00000416040:Q1047K	ENSP00000242365:Q997K	Q	-	1	0	KIAA1549	138246438	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.450000	0.90340	2.721000	0.93114	0.655000	0.94253	CAA	.		0.328	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
MGAM	8972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	141750617	141750617	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:141750617G>T	ENST00000549489.2	+	24	2853	c.2758G>T	c.(2758-2760)Gtc>Ttc	p.V920F	MGAM_ENST00000475668.2_Missense_Mutation_p.V920F	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	920					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACACAATGGTGTCCCAAGTCA	0.388																																					p.V920F		.											.	MGAM-70	0			c.G2758T						.						105.0	95.0	98.0					7																	141750617		1869	4101	5970	SO:0001583	missense	8972	exon24			AATGGTGTCCCAA	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2758G>T	7.37:g.141750617G>T	ENSP00000447378:p.Val920Phe	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	196	41	NM_004668	0	0	0	0	0	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560136	0.27827	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.89681	-2.55	5.81	0.962	0.19643	.	1.575090	0.03884	N	0.277575	D	0.86464	0.5939	M	0.62266	1.93	0.09310	N	1	B	0.27791	0.189	B	0.18561	0.022	T	0.66296	-0.5959	10	0.24483	T	0.36	.	9.7694	0.40580	0.4125:0.0:0.5875:0.0	.	920	O43451	MGA_HUMAN	F	920;920;797	ENSP00000447378:V920F	ENSP00000316431:V797F	V	+	1	0	MGAM	141397086	0.000000	0.05858	0.000000	0.03702	0.389000	0.30415	0.254000	0.18314	-0.105000	0.12132	-0.336000	0.08194	GTC	.		0.388	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
OR2F1	26211	bcgsc.ca	37	7	143657509	143657509	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:143657509G>T	ENST00000392899.1	+	1	483	c.446G>T	c.(445-447)tGg>tTg	p.W149L	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	149					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					ATCACATCCTGGGTCAGTGGC	0.527																																					p.W149L													.	OR2F1-71	0			c.G446T						.						138.0	116.0	124.0					7																	143657509		2203	4300	6503	SO:0001583	missense	26211	exon1			CATCCTGGGTCAG	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.446G>T	7.37:g.143657509G>T	ENSP00000376633:p.Trp149Leu	Somatic	108	4		WXS	Illumina HiSeq	Phase_1	145	91	NM_012369	0	0	0	0	0	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	ENST00000392899.1	37	CCDS5887.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836523	0.50951	.	.	ENSG00000213215	ENST00000392899	T	0.58210	0.35	5.53	2.74	0.32292	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000128	T	0.63200	0.2491	L	0.43554	1.36	0.37578	D	0.919703	D	0.89917	1.0	D	0.91635	0.999	T	0.67209	-0.5728	10	0.62326	D	0.03	-12.7388	12.892	0.58076	0.0:0.0:0.43:0.57	.	149	Q13607	OR2F1_HUMAN	L	149	ENSP00000376633:W149L	ENSP00000376633:W149L	W	+	2	0	OR2F1	143288442	0.998000	0.40836	0.898000	0.35279	0.599000	0.36880	1.120000	0.31271	0.428000	0.26173	0.655000	0.94253	TGG	.		0.527	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1		
PTPRN2	5799	broad.mit.edu	37	7	157414139	157414139	+	Silent	SNP	G	G	A	rs77143062		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:157414139G>A	ENST00000389418.4	-	15	2268	c.2259C>T	c.(2257-2259)tgC>tgT	p.C753C	PTPRN2_ENST00000409483.1_Silent_p.C715C|PTPRN2_ENST00000389416.4_Silent_p.C736C|PTPRN2_ENST00000389413.3_Silent_p.C724C|PTPRN2_ENST00000404321.2_Silent_p.C776C	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	753	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CCTGGTAGGCGCACAGCGCTT	0.622													g|||	1	0.000199681	0.0008	0.0	5008	,	,		19599	0.0		0.0	False		,,,				2504	0.0				p.C753C													.	PTPRN2-295	0			c.C2259T						.						196.0	182.0	187.0					7																	157414139		2203	4300	6503	SO:0001819	synonymous_variant	5799	exon15			GTAGGCGCACAGC	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.2259C>T	7.37:g.157414139G>A		Somatic	287	0		WXS	Illumina HiSeq	Phase_I	395	15	NM_002847	0	0	0	0	0	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	ENST00000389418.4	37	CCDS5947.1																																																																																			G|0.999;A|0.000		0.622	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1		
LZTS1	11178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	20107305	20107305	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr8:20107305G>A	ENST00000381569.1	-	4	2076	c.1719C>T	c.(1717-1719)gcC>gcT	p.A573A	LZTS1_ENST00000265801.6_Silent_p.A573A|LZTS1_ENST00000522290.1_Silent_p.A514A			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	573					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		AGGGCTCCCCGGCGCTGTCCC	0.632																																					p.A573A		.											.	LZTS1-91	0			c.C1719T						.						83.0	82.0	82.0					8																	20107305		2203	4300	6503	SO:0001819	synonymous_variant	11178	exon3			CTCCCCGGCGCTG	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1719C>T	8.37:g.20107305G>A		Somatic	132	0		WXS	Illumina HiSeq	Phase_I	124	56	NM_021020	0	0	1	1	0	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Silent	SNP	ENST00000381569.1	37	CCDS6015.1																																																																																			.		0.632	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	110451259	110451259	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr8:110451259G>A	ENST00000378402.5	+	32	3998	c.3894G>A	c.(3892-3894)aaG>aaA	p.K1298K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1298	IPT/TIG 6.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTTTGCCCAAGTTGTCTCCTG	0.393										HNSCC(38;0.096)																											p.K1298K		.											.	PKHD1L1-145	0			c.G3894A						.						141.0	137.0	138.0					8																	110451259		1844	4085	5929	SO:0001819	synonymous_variant	93035	exon32			GCCCAAGTTGTCT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3894G>A	8.37:g.110451259G>A		Somatic	249	0		WXS	Illumina HiSeq	Phase_I	212	81	NM_177531	0	0	0	0	0	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1																																																																																			.		0.393	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
RGS3	5998	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	116269730	116269730	+	Missense_Mutation	SNP	C	C	T	rs200633658		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr9:116269730C>T	ENST00000374140.2	+	14	1458	c.1249C>T	c.(1249-1251)Cgg>Tgg	p.R417W	RGS3_ENST00000343817.5_Missense_Mutation_p.R136W|RGS3_ENST00000374136.1_Missense_Mutation_p.R43W|RGS3_ENST00000350696.5_Missense_Mutation_p.R417W|RGS3_ENST00000394646.3_Missense_Mutation_p.R136W|RGS3_ENST00000317613.6_Missense_Mutation_p.R305W	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	417					inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						GGTCCAGGCACGGCCTGAGCA	0.672																																					p.R417W													.	RGS3-227	0			c.C1249T						.						35.0	36.0	36.0					9																	116269730		2203	4300	6503	SO:0001583	missense	5998	exon14			CAGGCACGGCCTG	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.1249C>T	9.37:g.116269730C>T	ENSP00000363255:p.Arg417Trp	Somatic	56	1		WXS	Illumina HiSeq	Phase_I	47	18	NM_144488	0	0	7	16	9	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	ENST00000374140.2	37	CCDS43869.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.258327	0.80246	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000317613;ENST00000343817;ENST00000394646;ENST00000374136	T;T;T;T;T	0.67865	0.63;0.63;1.0;0.12;-0.29	5.18	4.26	0.50523	.	0.118165	0.64402	D	0.000015	T	0.71533	0.3351	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D	0.89917	0.993;1.0;1.0;1.0;1.0;1.0	B;D;D;D;D;D	0.75020	0.446;0.95;0.985;0.965;0.979;0.974	T	0.75150	-0.3419	10	0.87932	D	0	.	13.1591	0.59535	0.1603:0.8397:0.0:0.0	.	136;43;136;307;305;417	B3KUB2;Q5VXC0;P49796-4;B3KWG8;P49796-5;P49796	.;.;.;.;.;RGS3_HUMAN	W	417;417;305;136;136;43	ENSP00000363255:R417W;ENSP00000259406:R417W;ENSP00000312844:R305W;ENSP00000340284:R136W;ENSP00000378141:R136W	ENSP00000312844:R305W	R	+	1	2	RGS3	115309551	0.995000	0.38212	0.928000	0.36995	0.816000	0.46133	3.331000	0.52075	1.463000	0.47967	0.655000	0.94253	CGG	C|0.999;A|0.001		0.672	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790	
NYX	60506	hgsc.bcm.edu	37	X	41333524	41333524	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chrX:41333524G>C	ENST00000342595.2	+	2	1274	c.818G>C	c.(817-819)tGg>tCg	p.W273S	NYX_ENST00000378220.1_Missense_Mutation_p.W273S	NM_022567.2	NP_072089.1	Q9GZU5	NYX_HUMAN	nyctalopin	273					response to stimulus (GO:0050896)|visual perception (GO:0007601)	intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(11)|upper_aerodigestive_tract(1)	17						GCGCGCGCCTGGTTCGCTGAC	0.716																																					p.W273S		.											.	NYX-108	0			c.G818C						.						19.0	19.0	19.0					X																	41333524		2200	4292	6492	SO:0001583	missense	60506	exon2			GCGCCTGGTTCGC	AF254868	CCDS14256.1	Xp11.4	2014-01-28			ENSG00000188937	ENSG00000188937			8082	protein-coding gene	gene with protein product		300278		CSNB1, CSNB4		11062471, 11062472	Standard	NM_022567		Approved	CLRP, CSNB1A	uc004dfh.2	Q9GZU5	OTTHUMG00000021370	ENST00000342595.2:c.818G>C	X.37:g.41333524G>C	ENSP00000340328:p.Trp273Ser	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_022567	0	0	0	0	0	D3DWC0|Q2M1S4|Q5H983|Q9H4J0	Missense_Mutation	SNP	ENST00000342595.2	37	CCDS14256.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159844	0.57368	.	.	ENSG00000188937	ENST00000342595;ENST00000378220	T;T	0.78126	-1.15;-1.15	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.70631	0.3246	N	0.01809	-0.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70539	-0.4844	10	0.08837	T	0.75	.	17.8739	0.88819	0.0:0.0:1.0:0.0	.	273	Q9GZU5	NYX_HUMAN	S	273	ENSP00000340328:W273S;ENSP00000367465:W273S	ENSP00000340328:W273S	W	+	2	0	NYX	41218468	1.000000	0.71417	1.000000	0.80357	0.274000	0.26718	7.190000	0.77755	2.154000	0.67381	0.600000	0.82982	TGG	.		0.716	NYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056256.1	NM_022567	
LNX2	222484	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	28136573	28136575	+	In_Frame_Del	DEL	CCG	CCG	-	rs377695945		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	CCG	CCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr13:28136573_28136575delCCG	ENST00000316334.3	-	5	1328_1330	c.1199_1201delCGG	c.(1198-1203)ccggag>cag	p.400_401PE>Q		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	400	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		GCAGCAAGCTCCGGAGTTCCATA	0.512																																					p.400_401del		.											.	LNX2-228	0			c.1199_1201del						.																																			SO:0001651	inframe_deletion	222484	exon5			.	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.1199_1201delCGG	13.37:g.28136573_28136575delCCG	ENSP00000325929:p.Pro400_Glu401delinsGln	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	143	58	NM_153371	0	0	0	0	0	Q5W0P0|Q6ZMH2|Q96SH4	In_Frame_Del	DEL	ENST00000316334.3	37	CCDS9323.1																																																																																			.		0.512	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
LNX2	222484	hgsc.bcm.edu	37	13	28136573	28136576	+	Frame_Shift_Del	DEL	CCGG	CCGG	-	rs377695945		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	CCGG	CCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr13:28136573_28136576delCCGG	ENST00000316334.3	-	5	1327_1330	c.1198_1201delCCGG	c.(1198-1203)ccggagfs	p.PE400fs		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	400	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		GCAGCAAGCTCCGGAGTTCCATAC	0.51																																					p.400_401del		.											.	LNX2-228	0			c.1198_1201del						.																																			SO:0001589	frameshift_variant	222484	exon5			.	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.1198_1201delCCGG	13.37:g.28136573_28136576delCCGG	ENSP00000325929:p.Pro400fs	Somatic	181	0		WXS	Illumina HiSeq	Phase_I	154	30	NM_153371	0	0	0	0	0	Q5W0P0|Q6ZMH2|Q96SH4	Frame_Shift_Del	DEL	ENST00000316334.3	37	CCDS9323.1																																																																																			.		0.510	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
C15orf43	145645	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	45270783	45270783	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:45270783delA	ENST00000340827.3	+	7	637	c.620delA	c.(619-621)gaafs	p.E207fs		NM_152448.2	NP_689661.1	Q8NHR7	CO043_HUMAN	chromosome 15 open reading frame 43	207										NS(1)|breast(2)|large_intestine(1)|lung(2)|skin(2)	8		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		GTTCAAAATGAAATTAATATG	0.294																																					p.E207fs		.											.	C15orf43-90	0			c.620delA						.						40.0	43.0	42.0					15																	45270783		2193	4282	6475	SO:0001589	frameshift_variant	145645	exon7			.	BC029537	CCDS10115.1	15q21.1	2006-02-03			ENSG00000167014	ENSG00000167014			28520	protein-coding gene	gene with protein product							Standard	NM_152448		Approved	MGC33951	uc001zuk.4	Q8NHR7	OTTHUMG00000131264	ENST00000340827.3:c.620delA	15.37:g.45270783delA	ENSP00000340644:p.Glu207fs	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	44	18	NM_152448	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000340827.3	37	CCDS10115.1																																																																																			.		0.294	C15orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254032.1	NM_152448	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	29490388	29490388	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:29490388delC	ENST00000358273.4	+	4	856	c.473delC	c.(472-474)tctfs	p.S158fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.S158fs|NF1_ENST00000431387.4_Frame_Shift_Del_p.S158fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	158					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGTCGCATTTCTACCAGGTTA	0.368			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.S158fs		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)	c.473delC						.						53.0	52.0	52.0					17																	29490388		2203	4300	6503	SO:0001589	frameshift_variant	4763	exon4	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	.		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.473delC	17.37:g.29490388delC	ENSP00000351015:p.Ser158fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	104	56	NM_001128147	0	0	0	0	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	CCDS42292.1																																																																																			.		0.368	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	29552188	29552189	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:29552188_29552189delAG	ENST00000358273.4	+	17	2304_2305	c.1921_1922delAG	c.(1921-1923)agtfs	p.S641fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.S641fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	641					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGGAAATACCAGTCAAATGTCC	0.406			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.641_641del		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.1921_1922del						.																																			SO:0001589	frameshift_variant	4763	exon17	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	.		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1921_1922delAG	17.37:g.29552188_29552189delAG	ENSP00000351015:p.Ser641fs	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	177	70	NM_000267	0	0	0	0	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	CCDS42292.1																																																																																			.		0.406	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
C19orf45	374877	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	7570473	7570475	+	In_Frame_Del	DEL	CGG	CGG	-	rs568541151		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	CGG	CGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:7570473_7570475delCGG	ENST00000361664.2	+	6	1107_1109	c.966_968delCGG	c.(964-969)cccggc>ccc	p.G323del	CTD-2207O23.12_ENST00000599312.1_5'Flank	NM_198534.2	NP_940936.2	Q8NA69	CS045_HUMAN	chromosome 19 open reading frame 45	323										endometrium(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|stomach(1)	8						GCCCCGGCCCCGGCAGTCTGGAC	0.571																																					p.322_323del		.											.	C19orf45-90	0			c.966_968del						.																																			SO:0001651	inframe_deletion	374877	exon6			.	BC029824	CCDS12179.2	19p13.2	2008-02-05			ENSG00000198723	ENSG00000198723			24745	protein-coding gene	gene with protein product						12477932	Standard	NM_198534		Approved	FLJ35784	uc002mgm.2	Q8NA69	OTTHUMG00000157183	ENST00000361664.2:c.966_968delCGG	19.37:g.7570473_7570475delCGG	ENSP00000355241:p.Gly323del	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	71	25	NM_198534	0	0	0	0	0	Q8N115	In_Frame_Del	DEL	ENST00000361664.2	37	CCDS12179.2																																																																																			.		0.571	C19orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347808.1	NM_198534	
PARD6B	84612	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	49366983	49366991	+	In_Frame_Del	DEL	TCAAAAACT	TCAAAAACT	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	TCAAAAACT	TCAAAAACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr20:49366983_49366991delTCAAAAACT	ENST00000371610.2	+	3	1320_1328	c.1077_1085delTCAAAAACT	c.(1075-1086)gatcaaaaactc>gac	p.QKL360del	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	360					axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						ATGCTCCAGATCAAAAACTCTTAGAAGAA	0.397																																					p.359_362del		.											.	PARD6B-91	0			c.1077_1085del						.																																			SO:0001651	inframe_deletion	84612	exon3			.	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.1077_1085delTCAAAAACT	20.37:g.49366983_49366991delTCAAAAACT	ENSP00000360672:p.Gln360_Leu362del	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	74	22	NM_032521	0	0	0	0	0	A2A2A7|Q9Y510	In_Frame_Del	DEL	ENST00000371610.2	37	CCDS33485.1																																																																																			.		0.397	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521	
BACE2	25825	broad.mit.edu	37	21	42551313	42551313	+	Intron	DEL	C	C	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr21:42551313delC	ENST00000330333.6	+	1	775				PLAC4_ENST00000440221.2_RNA|PLAC4_ENST00000430327.2_RNA|BACE2-IT1_ENST00000433378.1_RNA|BACE2_ENST00000347667.5_Intron|PLAC4_ENST00000536486.1_RNA|BACE2_ENST00000328735.6_Intron|PLAC4_ENST00000414699.1_RNA	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2						membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				gtgagggtatccagggtgagt	0.607																																					p.W81X													.	.	0			c.243delG						.		,,,	108,4120		0,108,2006	139.0	123.0	128.0		,,,	0.2	0.0	21		130	235,7909		2,231,3839	no	frameshift,intron,intron,intron	BACE2,PLAC4	NM_182832.2,NM_138992.1,NM_138991.1,NM_012105.3	,,,	2,339,5845	A1A1,A1R,RR		2.8856,2.5544,2.7724	,,,	,,,	42551313	343,12029	2188	4260	6448	SO:0001627	intron_variant	191585	exon1			GGGTATCCAGGGT	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.312+10811C>-	21.37:g.42551313delC		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_182832	0	0	0	0	0	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Nonsense_Mutation	DEL	ENST00000330333.6	37	CCDS13668.1																																																																																			.		0.607	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
UFSP1	402682	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	100486530	100486530	+	Frame_Shift_Del	DEL	G	G	-	rs372960530		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:100486530delG	ENST00000388761.2	-	1	809	c.363delC	c.(361-363)cccfs	p.P121fs		NM_001015072.3	NP_001015072.2	Q6NVU6	UFSP1_HUMAN	UFM1-specific peptidase 1 (non-functional)	121						extracellular vesicular exosome (GO:0070062)	thiolester hydrolase activity (GO:0016790)|UFM1 hydrolase activity (GO:0071567)			lung(1)|stomach(1)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)					AGAAGGAGTTGGGGTCAAAGG	0.567																																					p.P121fs		.											.	UFSP1-22	0			c.363delC						.						181.0	154.0	163.0					7																	100486530		2203	4300	6503	SO:0001589	frameshift_variant	402682	exon1			.	AF312032	CCDS34710.1	7q22.1	2008-03-25			ENSG00000176125	ENSG00000176125			33821	protein-coding gene	gene with protein product		611481				17182609, 18321862	Standard	NM_001015072		Approved	UFSP	uc003uxc.4	Q6NVU6	OTTHUMG00000159662	ENST00000388761.2:c.363delC	7.37:g.100486530delG	ENSP00000373413:p.Pro121fs	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	197	106	NM_001015072	0	0	0	0	0	A4D2E4|A8K8V2|B6ZDG6|Q9BXP6	Frame_Shift_Del	DEL	ENST00000388761.2	37	CCDS34710.1																																																																																			.		0.567	UFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356751.1	NM_001015072	
PPP2R2A	5520	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	26227846	26227849	+	Frame_Shift_Del	DEL	CACA	CACA	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	CACA	CACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr8:26227846_26227849delCACA	ENST00000380737.3	+	10	1590_1593	c.1261_1264delCACA	c.(1261-1266)cacacafs	p.HT421fs	PPP2R2A_ENST00000315985.7_Frame_Shift_Del_p.HT431fs	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	421					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		GAAAATCCTTCACACAGCCTGGCA	0.426																																					p.431_432del		.											.	PPP2R2A-659	0			c.1291_1294del						.																																			SO:0001589	frameshift_variant	5520	exon10			.	M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.1261_1264delCACA	8.37:g.26227846_26227849delCACA	ENSP00000370113:p.His421fs	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	47	12	NM_001177591	0	0	0	0	0	B2RBU8|B4E1T7|P50409|Q00007	Frame_Shift_Del	DEL	ENST00000380737.3	37	CCDS34867.1																																																																																			.		0.426	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375954.2	NM_002717	
KAT6A	7994	broad.mit.edu	37	8	41798420	41798422	+	In_Frame_Del	DEL	CTC	CTC	-	rs139076845		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr8:41798420_41798422delCTC	ENST00000396930.3	-	16	3520_3522	c.2977_2979delGAG	c.(2977-2979)gagdel	p.E993del	KAT6A_ENST00000265713.2_In_Frame_Del_p.E993del|KAT6A_ENST00000406337.1_In_Frame_Del_p.E993del	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	993	Poly-Glu.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GGCTTTCCGGCTCCTCCTCCTCC	0.567																																					p.993_993del													.	.	0			c.2977_2979del						.																																			SO:0001651	inframe_deletion	7994	exon16			TTCCGGCTCCTCC	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2977_2979delGAG	8.37:g.41798429_41798431delCTC	ENSP00000380136:p.Glu993del	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	185	7	NM_001099412	0	0	0	0	0	Q76L81	In_Frame_Del	DEL	ENST00000396930.3	37	CCDS6124.1																																																																																			.		0.567	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
PORCN	64840	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	48371012	48371012	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chrX:48371012delG	ENST00000326194.6	+	5	634	c.591delG	c.(589-591)ctgfs	p.L197fs	PORCN_ENST00000355092.3_Frame_Shift_Del_p.L197fs|PORCN_ENST00000355961.4_Frame_Shift_Del_p.L197fs|PORCN_ENST00000537758.1_Frame_Shift_Del_p.L197fs|PORCN_ENST00000367574.4_Frame_Shift_Del_p.L126fs|PORCN_ENST00000359882.4_Frame_Shift_Del_p.L197fs|PORCN_ENST00000361988.3_Frame_Shift_Del_p.L197fs	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	197					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCCGGAGCCTGGCACTGGCCC	0.647																																					p.L197fs		.											.	PORCN-133	0			c.591delG						.						54.0	48.0	50.0					X																	48371012		2203	4300	6503	SO:0001589	frameshift_variant	64840	exon5			.	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.591delG	X.37:g.48371012delG	ENSP00000322304:p.Leu197fs	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	11	11	NM_203475	0	0	0	0	0	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Frame_Shift_Del	DEL	ENST00000326194.6	37	CCDS14299.1																																																																																			.		0.647	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356990.1	NM_022825	
ITPKA	3706	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	41794669	41794670	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:41794669_41794670insA	ENST00000260386.5	+	5	1131_1132	c.1078_1079insA	c.(1078-1080)gaafs	p.E360fs		NM_002220.2	NP_002211.1	P23677	IP3KA_HUMAN	inositol-trisphosphate 3-kinase A	360					actin cytoskeleton organization (GO:0030036)|dendritic spine maintenance (GO:0097062)|inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|positive regulation of dendritic spine morphogenesis (GO:0061003)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendritic spine (GO:0043197)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			kidney(1)|lung(3)|skin(1)	5		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;7.63e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TCGCGTCTTTGAAGAGTTTGTG	0.604																																					p.E360fs		.											.	ITPKA-226	0			c.1078_1079insA						.																																			SO:0001589	frameshift_variant	3706	exon5			.	X54938	CCDS10076.1	15q15.1	2011-04-28	2011-04-28		ENSG00000137825	ENSG00000137825	2.7.1.127		6178	protein-coding gene	gene with protein product		147521	"""inositol 1,4,5-trisphosphate 3-kinase A"""			1330886, 2175886	Standard	NM_002220		Approved	IP3KA, IP3-3KA	uc001znz.3	P23677	OTTHUMG00000130343	ENST00000260386.5:c.1080dupA	15.37:g.41794671_41794671dupA	ENSP00000260386:p.Glu360fs	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	80	29	NM_002220	0	0	0	0	0	Q8TAN3	Frame_Shift_Ins	INS	ENST00000260386.5	37	CCDS10076.1																																																																																			.		0.604	ITPKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252695.3	NM_002220	
SLC10A4	201780	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	48490947	48490948	+	Frame_Shift_Ins	INS	-	-	TC			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr4:48490947_48490948insTC	ENST00000273861.4	+	3	1524_1525	c.1305_1306insTC	c.(1306-1308)tctfs	p.S436fs	ZAR1_ENST00000327939.4_5'Flank	NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	436						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						CCGCTCAGACTTCTCTCTAAAT	0.351																																					p.T435fs		.											.	SLC10A4-90	0			c.1305_1306insTC						.																																			SO:0001589	frameshift_variant	201780	exon3			.	BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.1310_1311dupTC	4.37:g.48490952_48490953dupTC	ENSP00000273861:p.Ser436fs	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	67	16	NM_152679	0	0	0	0	0	Q8WUZ2	Frame_Shift_Ins	INS	ENST00000273861.4	37	CCDS3482.1																																																																																			.		0.351	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219926.3	NM_152679	
EPS15L1	58513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	16503123	16503124	+	Missense_Mutation	DNP	GT	GT	AA			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:16503123_16503124GT>AA	ENST00000248070.6	-	19	2233_2234	c.2094_2095AC>TT	c.(2092-2097)ttACct>ttTTct	p.698_699LP>FS	EPS15L1_ENST00000594975.1_Missense_Mutation_p.700_701LP>FS|EPS15L1_ENST00000455140.2_Missense_Mutation_p.698_699LP>FS|EPS15L1_ENST00000535753.2_Missense_Mutation_p.698_699LP>FS	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	698	15 X 3 AA repeats of D-P-F.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						ACCTTCGAAGGTAAGGAAGGGT	0.559																																					p.LP698FS		.											.	EPS15L1	0			c.A2094T						.																																			SO:0001583	missense	58513	exon19			CGAAGGTAAGGAA	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.2094_2095delinsAA	19.37:g.16503123_16503124delinsAA	ENSP00000248070:p.L698_P699delinsFS	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	43.0		0	0	0	0	0	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	DNP	ENST00000248070.6	37	CCDS32944.1																																																																																			.		0.559	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
