#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIAA1522	57648	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	33236795	33236795	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr1:33236795C>A	ENST00000373480.1	+	6	1941	c.1838C>A	c.(1837-1839)cCa>cAa	p.P613Q	KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000401073.2_Missense_Mutation_p.P672Q|KIAA1522_ENST00000373481.3_Missense_Mutation_p.P624Q	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	613	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CCCTTCTCCCCACCTCCCTCC	0.647																																					p.P672Q		.											.	KIAA1522-90	0			c.C2015A						.						58.0	64.0	62.0					1																	33236795		1901	4107	6008	SO:0001583	missense	57648	exon6			TCTCCCCACCTCC	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.1838C>A	1.37:g.33236795C>A	ENSP00000362579:p.Pro613Gln	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	141	46	NM_020888	0	0	3	13	10	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.057475	0.36277	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.18502	2.21;2.21;2.24	4.07	4.07	0.47477	.	0.000000	0.56097	D	0.000038	T	0.33673	0.0871	L	0.56769	1.78	0.38739	D	0.95385	D;D;D	0.76494	0.99;0.99;0.999	P;P;D	0.67548	0.901;0.901;0.952	T	0.16217	-1.0410	10	0.59425	D	0.04	-5.8801	11.0055	0.47631	0.0:0.9058:0.0:0.0942	.	624;613;672	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	Q	672;624;613	ENSP00000383851:P672Q;ENSP00000362580:P624Q;ENSP00000362579:P613Q	ENSP00000362579:P613Q	P	+	2	0	KIAA1522	33009382	0.814000	0.29104	0.958000	0.39756	0.821000	0.46438	3.744000	0.55112	1.954000	0.56735	0.563000	0.77884	CCA	.		0.647	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
SLC5A9	200010	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	48708165	48708165	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr1:48708165C>T	ENST00000438567.2	+	13	1766	c.1714C>T	c.(1714-1716)Ctc>Ttc	p.L572F	SLC5A9_ENST00000533824.1_Missense_Mutation_p.L593F|SLC5A9_ENST00000236495.5_Missense_Mutation_p.L597F|SLC5A9_ENST00000471020.1_3'UTR	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	572					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						GAACTGCCCCCTCTCTGAGCT	0.597																																					p.L597F		.											.	SLC5A9-93	0			c.C1789T						.						73.0	73.0	73.0					1																	48708165		2203	4300	6503	SO:0001583	missense	200010	exon14			TGCCCCCTCTCTG	BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.1714C>T	1.37:g.48708165C>T	ENSP00000401730:p.Leu572Phe	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	162	9	NM_001135181	0	0	0	0	0	B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Missense_Mutation	SNP	ENST00000438567.2	37	CCDS30709.2	.	.	.	.	.	.	.	.	.	.	C	2.600	-0.293103	0.05568	.	.	ENSG00000117834	ENST00000533824;ENST00000438567;ENST00000236495	T;T;T	0.63255	-0.03;-0.03;-0.03	4.42	2.25	0.28309	.	2.354250	0.01631	N	0.023545	T	0.51381	0.1671	L	0.29908	0.895	0.09310	N	1	B;B;B	0.25521	0.128;0.023;0.112	B;B;B	0.29716	0.04;0.058;0.106	T	0.35649	-0.9780	10	0.44086	T	0.13	.	2.3723	0.04333	0.2782:0.4525:0.1682:0.1011	.	593;572;597	E9PJ08;Q2M3M2;E9PAK4	.;SC5A9_HUMAN;.	F	593;572;597	ENSP00000431900:L593F;ENSP00000401730:L572F;ENSP00000236495:L597F	ENSP00000236495:L597F	L	+	1	0	SLC5A9	48480752	0.000000	0.05858	0.002000	0.10522	0.032000	0.12392	-2.295000	0.01143	0.283000	0.22279	0.655000	0.94253	CTC	.		0.597	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022061.3	XM_117174	
CTH	1491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	70895506	70895506	+	Silent	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr1:70895506T>C	ENST00000370938.3	+	6	762	c.618T>C	c.(616-618)tcT>tcC	p.S206S	CTH_ENST00000411986.2_Silent_p.S174S|CTH_ENST00000346806.2_Silent_p.S162S|CTH_ENST00000464926.1_3'UTR	NM_001902.5	NP_001893.2	Q96IQ7	VSIG2_HUMAN	cystathionine gamma-lyase	0	Ig-like C2-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						CTGATATTTCTATGTATTCTG	0.353																																					p.S206S		.											.	CTH-91	0			c.T618C						.						103.0	97.0	99.0					1																	70895506		2203	4300	6503	SO:0001819	synonymous_variant	1491	exon6			TATTTCTATGTAT	BC015807	CCDS650.1, CCDS651.1, CCDS53333.1	1p31.1	2014-06-24	2014-06-24		ENSG00000116761	ENSG00000116761	4.4.1.1		2501	protein-coding gene	gene with protein product		607657	"""cystathionase (cystathionine gamma-lyase)"""			1339280	Standard	NM_001902		Approved		uc001dfd.3	P32929	OTTHUMG00000009352	ENST00000370938.3:c.618T>C	1.37:g.70895506T>C		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	79	26	NM_001902	0	0	1	2	1	O95791|Q9NX42	Silent	SNP	ENST00000370938.3	37	CCDS650.1																																																																																			.		0.353	CTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025918.1	NM_001902	
ABCA4	24	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94528186	94528186	+	Silent	SNP	A	A	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr1:94528186A>T	ENST00000370225.3	-	13	1970	c.1884T>A	c.(1882-1884)gcT>gcA	p.A628A	ABCA4_ENST00000535735.1_Silent_p.A628A	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	628					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TTCCAACTGGAGCCTCCGCCT	0.572																																					p.A628A		.											.	ABCA4-162	0			c.T1884A						.						76.0	74.0	75.0					1																	94528186		2203	4300	6503	SO:0001819	synonymous_variant	24	exon13			AACTGGAGCCTCC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1884T>A	1.37:g.94528186A>T		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	59	16	NM_000350	0	0	0	0	0	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																			.		0.572	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
SEMA6C	10500	hgsc.bcm.edu	37	1	151112138	151112138	+	Silent	SNP	T	T	C	rs200312578		TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr1:151112138T>C	ENST00000341697.3	-	5	1964	c.273A>G	c.(271-273)gaA>gaG	p.E91E				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	91	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCCCCTCCCCTTCTTCTTCGG	0.582																																					p.E91E		.											.	SEMA6C-92	0			c.A273G						.						55.0	53.0	54.0					1																	151112138		2203	4300	6503	SO:0001819	synonymous_variant	10500	exon5			CTCCCCTTCTTCT	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.273A>G	1.37:g.151112138T>C		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	62	4	NM_001178061	0	0	0	0	0	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Silent	SNP	ENST00000341697.3	37	CCDS984.1																																																																																			T|0.999;G|0.001		0.582	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	216373415	216373415	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr1:216373415G>A	ENST00000307340.3	-	17	3751	c.3365C>T	c.(3364-3366)tCc>tTc	p.S1122F	USH2A_ENST00000366942.3_Missense_Mutation_p.S1122F|RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.S1122F	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1122	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AATGTAATAGGAATATTTGGT	0.363										HNSCC(13;0.011)																											p.S1122F		.											.	USH2A-115	0			c.C3365T						.						66.0	66.0	66.0					1																	216373415		2203	4300	6503	SO:0001583	missense	7399	exon17			TAATAGGAATATT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3365C>T	1.37:g.216373415G>A	ENSP00000305941:p.Ser1122Phe	Somatic	88	1		WXS	Illumina HiSeq	Phase_I	90	31	NM_007123	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.353632	0.61293	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	D;T;T	0.85258	-1.96;0.55;0.32	6.02	5.06	0.68205	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.162301	0.29093	N	0.013179	D	0.92704	0.7681	M	0.84683	2.71	0.52099	D	0.999947	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.956	D	0.92488	0.5998	10	0.49607	T	0.09	.	16.7932	0.85595	0.0:0.1285:0.8715:0.0	.	1122;1122	O75445-2;O75445	.;USH2A_HUMAN	F	1122	ENSP00000305941:S1122F;ENSP00000355910:S1122F;ENSP00000355909:S1122F	ENSP00000305941:S1122F	S	-	2	0	USH2A	214440038	1.000000	0.71417	0.982000	0.44146	0.319000	0.28217	4.663000	0.61532	2.865000	0.98341	0.655000	0.94253	TCC	.		0.363	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
CDHR1	92211	broad.mit.edu	37	10	85968003	85968003	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr10:85968003T>C	ENST00000372117.3	+	11	1140	c.1037T>C	c.(1036-1038)cTc>cCc	p.L346P	CDHR1_ENST00000440770.2_Missense_Mutation_p.L105P|CDHR1_ENST00000332904.3_Missense_Mutation_p.L346P	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	346	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						ATTGTGGACCTCAACAACCAC	0.602																																					p.L346P													.	CDHR1-91	0			c.T1037C						.						70.0	69.0	69.0					10																	85968003		2203	4300	6503	SO:0001583	missense	92211	exon11			TGGACCTCAACAA	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1037T>C	10.37:g.85968003T>C	ENSP00000361189:p.Leu346Pro	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	84	3	NM_001171971	0	0	2	2	0	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	37	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.569476	0.86439	.	.	ENSG00000148600	ENST00000332904;ENST00000372117;ENST00000440770	T;T;T	0.61392	0.11;0.11;0.48	5.57	5.57	0.84162	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.79082	0.4386	M	0.86651	2.83	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.994;0.999	T	0.83148	-0.0105	10	0.87932	D	0	-16.2388	14.7116	0.69238	0.0:0.0:0.0:1.0	.	105;346;346	E7EN47;Q96JP9-2;Q96JP9	.;.;CDHR1_HUMAN	P	346;346;105	ENSP00000331063:L346P;ENSP00000361189:L346P;ENSP00000415980:L105P	ENSP00000331063:L346P	L	+	2	0	CDHR1	85957983	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.698000	0.84413	2.127000	0.65507	0.402000	0.26972	CTC	.		0.602	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
OR4C15	81309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55322355	55322355	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr11:55322355G>C	ENST00000314644.2	+	1	573	c.573G>C	c.(571-573)agG>agC	p.R191S		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TCATGAACAGGAGGCTCTGTG	0.498										HNSCC(20;0.049)																											p.R191S		.											.	OR4C15-70	0			c.G573C						.						103.0	99.0	100.0					11																	55322355		2201	4296	6497	SO:0001583	missense	81309	exon1			GAACAGGAGGCTC	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.573G>C	11.37:g.55322355G>C	ENSP00000324958:p.Arg191Ser	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	175	53	NM_001001920	0	0	0	0	0	Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.328725	0.24167	.	.	ENSG00000181939	ENST00000314644	T	0.01347	4.99	5.12	1.75	0.24633	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02083	0.0065	L	0.56769	1.78	0.09310	N	1	B	0.30584	0.286	B	0.32677	0.15	T	0.42068	-0.9473	9	0.87932	D	0	.	4.8871	0.13708	0.2199:0.3168:0.4633:0.0	.	137	Q8NGM1	OR4CF_HUMAN	S	191	ENSP00000324958:R191S	ENSP00000324958:R191S	R	+	3	2	OR4C15	55078931	0.000000	0.05858	0.500000	0.27589	0.181000	0.23173	-1.112000	0.03299	0.549000	0.28973	0.385000	0.25706	AGG	.		0.498	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920	
TPI1	7167	broad.mit.edu;bcgsc.ca	37	12	6976722	6976722	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr12:6976722T>C	ENST00000229270.4	+	1	440	c.103T>C	c.(103-105)Tcc>Ccc	p.S35P	TPI1_ENST00000535434.1_5'Flank|TPI1_ENST00000488464.2_5'Flank|TPI1_ENST00000396705.5_5'UTR	NM_001159287.1	NP_001152759.1	P60174	TPIS_HUMAN	triosephosphate isomerase 1	35					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glyceraldehyde-3-phosphate metabolic process (GO:0019682)|glycolytic process (GO:0006096)|multicellular organismal development (GO:0007275)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	triose-phosphate isomerase activity (GO:0004807)			endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|skin(2)	19						GCGCCTCGGCTCCAGCGCCAT	0.647																																					p.S35P													.	TPI1-226	0			c.T103C						.						12.0	16.0	15.0					12																	6976722		2193	4295	6488	SO:0001583	missense	7167	exon1			CTCGGCTCCAGCG		CCDS8566.1, CCDS53740.1, CCDS58206.1	12p13.31	2012-10-02			ENSG00000111669	ENSG00000111669	5.3.1.1		12009	protein-coding gene	gene with protein product		190450					Standard	NM_000365		Approved		uc001qrk.4	P60174	OTTHUMG00000133767	ENST00000229270.4:c.103T>C	12.37:g.6976722T>C	ENSP00000229270:p.Ser35Pro	Somatic	28	1		WXS	Illumina HiSeq	Phase_I	34	16	NM_001159287	0	0	36	63	27	B7Z5D8|D3DUS9|P00938|Q6FHP9|Q6IS07|Q8WWD0|Q96AG5	Missense_Mutation	SNP	ENST00000229270.4	37	CCDS53740.1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.729886	0.30684	.	.	ENSG00000111669	ENST00000229270	.	.	.	5.22	-10.4	0.00318	.	.	.	.	.	T	0.16557	0.0398	N	0.19112	0.55	0.09310	N	0.999996	.	.	.	.	.	.	T	0.18085	-1.0348	6	0.34782	T	0.22	.	3.3033	0.06990	0.285:0.4093:0.0715:0.2342	.	.	.	.	P	35	.	ENSP00000229270:S35P	S	+	1	0	TPI1	6846983	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-3.323000	0.00512	-2.335000	0.00629	-0.538000	0.04264	TCC	.		0.647	TPI1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258252.1	NM_000365	
LRIG3	121227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	59283874	59283874	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr12:59283874T>A	ENST00000320743.3	-	5	849	c.563A>T	c.(562-564)gAc>gTc	p.D188V	LRIG3_ENST00000379141.4_Missense_Mutation_p.D128V	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	188					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			GGCCAAATTGTCAAAATACCC	0.413			T	ROS1	NSCLC																																p.D188V		.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3-229	0			c.A563T						.						247.0	238.0	241.0					12																	59283874		2203	4300	6503	SO:0001583	missense	121227	exon5			AAATTGTCAAAAT	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.563A>T	12.37:g.59283874T>A	ENSP00000326759:p.Asp188Val	Somatic	253	0		WXS	Illumina HiSeq	Phase_I	257	80	NM_153377	0	0	0	0	0	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	37	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	T	15.87	2.961782	0.53400	.	.	ENSG00000139263	ENST00000379141;ENST00000320743;ENST00000552267	T;T;T	0.57273	0.41;0.41;0.41	5.55	5.55	0.83447	.	0.000000	0.39020	N	0.001494	T	0.52041	0.1710	L	0.39692	1.235	0.80722	D	1	P;P	0.50528	0.593;0.936	B;P	0.48304	0.406;0.573	T	0.49312	-0.8953	9	.	.	.	.	15.6961	0.77499	0.0:0.0:0.0:1.0	.	128;188	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	V	128;188;95	ENSP00000368436:D128V;ENSP00000326759:D188V;ENSP00000449109:D95V	.	D	-	2	0	LRIG3	57570141	1.000000	0.71417	0.997000	0.53966	0.322000	0.28314	4.225000	0.58600	2.110000	0.64415	0.460000	0.39030	GAC	.		0.413	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
SLC7A1	6541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	30096467	30096467	+	Silent	SNP	C	C	T	rs150705194		TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr13:30096467C>T	ENST00000380752.5	-	8	1562	c.1176G>A	c.(1174-1176)tcG>tcA	p.S392S	SLC7A1_ENST00000473577.1_5'Flank	NM_003045.4	NP_003036.1	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 1	392					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)	p.S392S(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|stomach(1)|urinary_tract(2)	24		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CAACGGCACCCGAGGCTAATG	0.458																																					p.S392S		.											.	SLC7A1-90	1	Substitution - coding silent(1)	lung(1)	c.G1176A						.	C		0,4406		0,0,2203	286.0	260.0	269.0		1176	-9.8	0.7	13	dbSNP_134	269	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC7A1	NM_003045.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		392/630	30096467	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6541	exon8			GGCACCCGAGGCT	AF078107	CCDS9333.1	13q12.3	2013-05-22			ENSG00000139514	ENSG00000139514		"""Solute carriers"""	11057	protein-coding gene	gene with protein product	"""ecotropic retroviral receptor"", ""amino acid transporter, cationic 1"""	104615		ERR, ATRC1		1348489	Standard	NM_003045		Approved	CAT-1, HCAT1, REC1L	uc001uso.3	P30825	OTTHUMG00000016658	ENST00000380752.5:c.1176G>A	13.37:g.30096467C>T		Somatic	249	0		WXS	Illumina HiSeq	Phase_I	254	65	NM_003045	0	0	0	0	0	Q5JR50	Silent	SNP	ENST00000380752.5	37	CCDS9333.1																																																																																			C|1.000;T|0.000		0.458	SLC7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044337.2	NM_003045	
GPC6	10082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	94482740	94482740	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr13:94482740C>G	ENST00000377047.4	+	3	1268	c.653C>G	c.(652-654)gCc>gGc	p.A218G	GPC6-AS2_ENST00000445540.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	218					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TTCATTGCTGCCAGGACCTTT	0.498																																					p.A218G		.											.	GPC6-90	0			c.C653G						.						50.0	49.0	49.0					13																	94482740		2203	4300	6503	SO:0001583	missense	10082	exon3			TTGCTGCCAGGAC	AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.653C>G	13.37:g.94482740C>G	ENSP00000366246:p.Ala218Gly	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	53	18	NM_005708	0	0	0	7	7	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	C	32	5.161612	0.94727	.	.	ENSG00000183098	ENST00000377047	T	0.57907	0.37	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.77377	0.4121	M	0.87097	2.86	0.53688	D	0.999974	D;D	0.89917	1.0;0.999	D;D	0.81914	0.983;0.995	T	0.78288	-0.2262	10	0.46703	T	0.11	.	19.8022	0.96513	0.0:1.0:0.0:0.0	.	218;218	B4E2M1;Q9Y625	.;GPC6_HUMAN	G	218	ENSP00000366246:A218G	ENSP00000366246:A218G	A	+	2	0	GPC6	93280741	1.000000	0.71417	0.932000	0.37286	0.943000	0.58893	7.442000	0.80503	2.771000	0.95319	0.644000	0.83932	GCC	.		0.498	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	
RAP2A	5911	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	98086836	98086836	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr13:98086836G>A	ENST00000245304.4	+	1	361	c.112G>A	c.(112-114)Gac>Aac	p.D38N		NM_021033.6	NP_066361.1	P10114	RAP2A_HUMAN	RAP2A, member of RAS oncogene family	38					actin cytoskeleton reorganization (GO:0031532)|cellular protein localization (GO:0034613)|establishment of protein localization (GO:0045184)|negative regulation of cell migration (GO:0030336)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of dendrite morphogenesis (GO:0048814)|regulation of JNK cascade (GO:0046328)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.166)			CACCATCGAGGACTTCTACCG	0.627																																					p.D38N		.											.	RAP2A-1271	0			c.G112A						.						114.0	107.0	109.0					13																	98086836		2203	4300	6503	SO:0001583	missense	5911	exon1			ATCGAGGACTTCT	AF205602	CCDS9485.1	13q34	2014-05-09			ENSG00000125249	ENSG00000125249			9861	protein-coding gene	gene with protein product		179540		RAP2			Standard	NM_021033		Approved	K-REV	uc001vnd.3	P10114	OTTHUMG00000017240	ENST00000245304.4:c.112G>A	13.37:g.98086836G>A	ENSP00000245304:p.Asp38Asn	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	174	57	NM_021033	0	0	1	1	0	B2RCJ1|Q5JSC1|Q5JSC2	Missense_Mutation	SNP	ENST00000245304.4	37	CCDS9485.1	.	.	.	.	.	.	.	.	.	.	G	34	5.299548	0.95574	.	.	ENSG00000125249	ENST00000245304	D	0.83335	-1.71	2.95	2.95	0.34219	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.89111	0.6622	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90284	0.4317	10	0.66056	D	0.02	.	13.9659	0.64209	0.0:0.0:1.0:0.0	.	38	P10114	RAP2A_HUMAN	N	38	ENSP00000245304:D38N	ENSP00000245304:D38N	D	+	1	0	RAP2A	96884837	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.055000	0.93873	1.673000	0.50895	0.484000	0.47621	GAC	.		0.627	RAP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045528.4		
GPR18	2841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	99907879	99907879	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr13:99907879G>A	ENST00000340807.3	-	3	804	c.248C>T	c.(247-249)gCa>gTa	p.A83V	UBAC2_ENST00000403766.3_Intron|GPR18_ENST00000397470.2_Missense_Mutation_p.A83V|GPR18_ENST00000397473.2_Missense_Mutation_p.A83V|UBAC2_ENST00000376440.2_Intron			Q14330	GPR18_HUMAN	G protein-coupled receptor 18	83					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)	10	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Glycine(DB00145)	TTCATCTTTTGCATAATAAAA	0.383																																					p.A83V		.											.	GPR18-90	0			c.C248T						.						71.0	71.0	71.0					13																	99907879		2203	4300	6503	SO:0001583	missense	2841	exon2			TCTTTTGCATAAT	L42324	CCDS9491.1	13q32	2014-01-30			ENSG00000125245	ENSG00000125245		"""GPCR / Class A : Orphans"""	4472	protein-coding gene	gene with protein product		602042				9205118	Standard	NM_005292		Approved		uc010afv.3	Q14330	OTTHUMG00000017266	ENST00000340807.3:c.248C>T	13.37:g.99907879G>A	ENSP00000343428:p.Ala83Val	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	69	18	NM_001098200	0	0	0	0	0	Q6GTM3|Q96HI6|Q9H2L2	Missense_Mutation	SNP	ENST00000340807.3	37	CCDS9491.1	.	.	.	.	.	.	.	.	.	.	G	5.690	0.311943	0.10789	.	.	ENSG00000125245	ENST00000397473;ENST00000397470;ENST00000340807;ENST00000416594	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	6.07	1.18	0.20946	GPCR, rhodopsin-like superfamily (1);	0.322518	0.32328	N	0.006250	T	0.23054	0.0557	L	0.34521	1.04	0.09310	N	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.18555	-1.0333	9	.	.	.	-5.3997	8.9019	0.35499	0.2064:0.3912:0.4024:0.0	.	83	Q14330	GPR18_HUMAN	V	83	ENSP00000380613:A83V;ENSP00000380610:A83V;ENSP00000343428:A83V;ENSP00000401611:A83V	.	A	-	2	0	GPR18	98705880	0.888000	0.30383	0.430000	0.26722	0.894000	0.52154	0.767000	0.26575	0.138000	0.18790	-0.137000	0.14449	GCA	.		0.383	GPR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045585.1		
OR4K2	390431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20345257	20345257	+	Silent	SNP	C	C	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr14:20345257C>A	ENST00000298642.2	+	1	867	c.831C>A	c.(829-831)atC>atA	p.I277I		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTATACCATCTTTACTCCCA	0.368																																					p.I277I		.											.	OR4K2-72	0			c.C831A						.						125.0	129.0	128.0					14																	20345257		2203	4300	6503	SO:0001819	synonymous_variant	390431	exon1			TACCATCTTTACT		CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.831C>A	14.37:g.20345257C>A		Somatic	188	1		WXS	Illumina HiSeq	Phase_I	151	32	NM_001005501	0	0	0	0	0	B2RNK8|Q6IFA5	Silent	SNP	ENST00000298642.2	37	CCDS32023.1																																																																																			.		0.368	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409864.1		
SNX6	58533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	35062276	35062276	+	Silent	SNP	A	A	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr14:35062276A>T	ENST00000362031.4	-	8	759	c.729T>A	c.(727-729)tcT>tcA	p.S243S	SNX6_ENST00000355110.5_Silent_p.S119S|SNX6_ENST00000396534.3_Silent_p.S115S|SNX6_ENST00000396526.3_Silent_p.S115S	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	231					intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		TCATTCTATCAGATTTAGCAG	0.299																																					p.S243S		.											.	SNX6-226	0			c.T729A						.						73.0	71.0	72.0					14																	35062276		2203	4299	6502	SO:0001819	synonymous_variant	58533	exon8			TCTATCAGATTTA	AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.729T>A	14.37:g.35062276A>T		Somatic	96	0		WXS	Illumina HiSeq	Phase_I	61	18	NM_152233	0	0	9	20	11	C0H5W9|Q9Y449	Silent	SNP	ENST00000362031.4	37	CCDS41942.1																																																																																			.		0.299	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276642.3		
CLEC14A	161198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	38724316	38724316	+	Silent	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr14:38724316C>T	ENST00000342213.2	-	1	1258	c.912G>A	c.(910-912)agG>agA	p.R304R		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	304						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		CCGGCGGGCGCCTGGTGGGCA	0.657																																					p.R304R		.											.	CLEC14A-94	0			c.G912A						.						44.0	48.0	47.0					14																	38724316		2198	4289	6487	SO:0001819	synonymous_variant	161198	exon1			CGGGCGCCTGGTG		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.912G>A	14.37:g.38724316C>T		Somatic	135	0		WXS	Illumina HiSeq	Phase_I	139	50	NM_175060	0	0	0	0	0	Q695G9|Q6PWT6|Q8N5V5	Silent	SNP	ENST00000342213.2	37	CCDS9667.1																																																																																			.		0.657	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060	
PRPF39	55015	hgsc.bcm.edu	37	14	45565377	45565377	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr14:45565377G>C	ENST00000355765.6	+	3	566	c.396G>C	c.(394-396)tgG>tgC	p.W132C		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	132					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						ATGGTTACTGGAAAAAGTATG	0.368																																					p.W132C		.											.	PRPF39-70	0			c.G396C						.						50.0	46.0	47.0					14																	45565377		1879	4114	5993	SO:0001583	missense	55015	exon3			TTACTGGAAAAAG	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.396G>C	14.37:g.45565377G>C	ENSP00000348010:p.Trp132Cys	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	19	2	NM_017922	0	0	1	1	0	Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	ENST00000355765.6	37	CCDS9682.2	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668567	0.67814	.	.	ENSG00000185246	ENST00000355765;ENST00000553605	T;T	0.63417	-0.04;-0.04	5.87	5.87	0.94306	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.81659	0.4869	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82894	-0.0231	9	0.87932	D	0	-23.913	19.7885	0.96447	0.0:0.0:1.0:0.0	.	132	Q86UA1	PRP39_HUMAN	C	132;122	ENSP00000348010:W132C;ENSP00000452428:W122C	ENSP00000348010:W132C	W	+	3	0	PRPF39	44635127	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.779000	0.95612	0.591000	0.81541	TGG	.		0.368	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		
FERMT2	10979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	53386065	53386065	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr14:53386065T>A	ENST00000395631.2	-	3	383	c.167A>T	c.(166-168)aAa>aTa	p.K56I	FERMT2_ENST00000343279.4_Missense_Mutation_p.K56I|FERMT2_ENST00000399304.3_Missense_Mutation_p.K56I|FERMT2_ENST00000341590.3_Missense_Mutation_p.K56I|FERMT2_ENST00000553373.1_Missense_Mutation_p.K56I			Q96AC1	FERM2_HUMAN	fermitin family member 2	56	Interaction with membranes containing phosphatidylinositol phosphate.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)		ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					AGACCAATCTTTTTTTACATC	0.333																																					p.K56I		.											.	FERMT2-68	0			c.A167T						.						73.0	72.0	73.0					14																	53386065		2203	4300	6503	SO:0001583	missense	10979	exon3			CAATCTTTTTTTA	Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.167A>T	14.37:g.53386065T>A	ENSP00000378993:p.Lys56Ile	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	99	27	NM_001135000	0	0	0	0	0	B5TJY2|Q14840|Q86TY7	Missense_Mutation	SNP	ENST00000395631.2	37	CCDS9713.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.478457	0.84747	.	.	ENSG00000073712	ENST00000395631;ENST00000341590;ENST00000343279;ENST00000553373;ENST00000399304;ENST00000555692;ENST00000554712	T;T;T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75;2.75;2.75	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.22513	0.0543	M	0.62723	1.935	0.80722	D	1	P;B;B	0.35542	0.508;0.375;0.078	P;B;B	0.45998	0.5;0.248;0.042	T	0.00621	-1.1640	10	0.42905	T	0.14	.	16.1966	0.82029	0.0:0.0:0.0:1.0	.	56;56;56	Q96AC1-2;Q96AC1;B5TJY2	.;FERM2_HUMAN;.	I	56;56;56;56;56;12;56	ENSP00000378993:K56I;ENSP00000340391:K56I;ENSP00000342858:K56I;ENSP00000451084:K56I;ENSP00000382243:K56I;ENSP00000452472:K12I;ENSP00000450506:K56I	ENSP00000340391:K56I	K	-	2	0	FERMT2	52455815	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.291000	0.72719	2.232000	0.73038	0.528000	0.53228	AAA	.		0.333	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832	
DYNC1H1	1778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102466716	102466716	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr14:102466716G>A	ENST00000360184.4	+	18	4218	c.4054G>A	c.(4054-4056)Gtt>Att	p.V1352I		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1352	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GCAACCCTGGGTTTCAGTACA	0.428																																					p.V1352I		.											.	DYNC1H1-98	0			c.G4054A						.						115.0	116.0	116.0					14																	102466716		2203	4300	6503	SO:0001583	missense	1778	exon18			CCCTGGGTTTCAG	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.4054G>A	14.37:g.102466716G>A	ENSP00000348965:p.Val1352Ile	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	87	28	NM_001376	0	0	5	6	1	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089051	0.55968	.	.	ENSG00000197102	ENST00000360184	T	0.28666	1.6	5.64	5.64	0.86602	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	T	0.18635	0.0447	N	0.03983	-0.305	0.80722	D	1	B	0.29646	0.253	B	0.33960	0.173	T	0.14755	-1.0461	10	0.16896	T	0.51	.	20.0769	0.97748	0.0:0.0:1.0:0.0	.	1352	Q14204	DYHC1_HUMAN	I	1352	ENSP00000348965:V1352I	ENSP00000348965:V1352I	V	+	1	0	DYNC1H1	101536469	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	8.001000	0.88508	2.820000	0.97059	0.650000	0.86243	GTT	.		0.428	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
DYNC1H1	1778	broad.mit.edu	37	14	102483738	102483738	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr14:102483738T>C	ENST00000360184.4	+	40	8238	c.8074T>C	c.(8074-8076)Ttt>Ctt	p.F2692L		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2692	AAA 3. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GCACGGAGGCTTTTACCGTAC	0.502																																					p.F2692L													.	DYNC1H1-98	0			c.T8074C						.						138.0	128.0	132.0					14																	102483738		2203	4300	6503	SO:0001583	missense	1778	exon40			GGAGGCTTTTACC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8074T>C	14.37:g.102483738T>C	ENSP00000348965:p.Phe2692Leu	Somatic	163	1		WXS	Illumina HiSeq	Phase_I	150	4	NM_001376	0	0	8	8	0	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	T	30	5.050108	0.93740	.	.	ENSG00000197102	ENST00000360184	T	0.35421	1.31	5.19	5.19	0.71726	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.70482	0.3229	H	0.95260	3.645	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78484	-0.2186	10	0.42905	T	0.14	.	15.0566	0.71917	0.0:0.0:0.0:1.0	.	2692	Q14204	DYHC1_HUMAN	L	2692	ENSP00000348965:F2692L	ENSP00000348965:F2692L	F	+	1	0	DYNC1H1	101553491	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.849000	0.86908	1.965000	0.57142	0.459000	0.35465	TTT	.		0.502	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
ATP10A	57194	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	25924510	25924510	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr15:25924510G>A	ENST00000356865.6	-	21	4589	c.4478C>T	c.(4477-4479)gCa>gTa	p.A1493V		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1493					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CCTTGAAGATGCTCCTATAAG	0.423																																					p.A1493V		.											.	ATP10A-139	0			c.C4478T						.						57.0	61.0	60.0					15																	25924510		2203	4300	6503	SO:0001583	missense	57194	exon21			GAAGATGCTCCTA	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4478C>T	15.37:g.25924510G>A	ENSP00000349325:p.Ala1493Val	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	100	25	NM_024490	0	0	0	0	0	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386201	0.42308	.	.	ENSG00000206190	ENST00000356865	T	0.10477	2.87	4.74	3.76	0.43208	.	10.878000	0.00166	N	0.000006	T	0.07954	0.0199	N	0.08118	0	0.09310	N	1	B	0.30482	0.281	B	0.22601	0.04	T	0.16129	-1.0413	10	0.46703	T	0.11	-3.4971	12.1728	0.54167	0.0:0.0:0.7797:0.2203	.	1493	O60312	AT10A_HUMAN	V	1493	ENSP00000349325:A1493V	ENSP00000349325:A1493V	A	-	2	0	ATP10A	23475603	0.618000	0.27051	0.010000	0.14722	0.250000	0.25880	1.852000	0.39348	2.475000	0.83589	0.655000	0.94253	GCA	.		0.423	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
SYNM	23336	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	99670274	99670274	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr15:99670274A>T	ENST00000560674.1	+	4	1320	c.851A>T	c.(850-852)aAg>aTg	p.K284M	SYNM_ENST00000336292.6_Missense_Mutation_p.K569M|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000328642.7_Missense_Mutation_p.K569M			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	570	Coil 2.|Interaction with DMD and UTRN.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						CCGAAGGAGAAGAGCGTGCGA	0.502																																					.	Pancreas(125;1071 1762 21750 40003 40381)												.	SYNM-26	0			.						.						66.0	70.0	69.0					15																	99670274		2050	4195	6245	SO:0001583	missense	23336	.			AGGAGAAGAGCGT	AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.851A>T	15.37:g.99670274A>T	ENSP00000453040:p.Lys284Met	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	52	12	.	0	0	0	0	0	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	ENST00000560674.1	37		.	.	.	.	.	.	.	.	.	.	A	17.17	3.320236	0.60634	.	.	ENSG00000182253	ENST00000336292;ENST00000328642	T;T	0.36699	1.24;1.24	5.87	-4.15	0.03881	.	.	.	.	.	T	0.44829	0.1312	.	.	.	0.09310	N	1	D;D	0.69078	0.997;0.993	P;P	0.55667	0.781;0.628	T	0.49890	-0.8891	8	0.87932	D	0	.	10.5138	0.44876	0.4351:0.1047:0.4602:0.0	.	570;569	O15061;C9JIE4	SYNEM_HUMAN;.	M	569	ENSP00000336775:K569M;ENSP00000330469:K569M	ENSP00000330469:K569M	K	+	2	0	SYNM	97487797	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.071000	0.11505	-0.642000	0.05480	-0.290000	0.09829	AAG	.		0.502	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000415698.2	NM_145728	
ZNF598	90850	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	2052644	2052644	+	Silent	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr16:2052644C>T	ENST00000563630.1	-	4	632	c.390G>A	c.(388-390)ggG>ggA	p.G130G	ZNF598_ENST00000431526.1_Silent_p.G185G|ZNF598_ENST00000562103.1_Silent_p.G130G			Q86UK7	ZN598_HUMAN	zinc finger protein 598	185							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						AGAGCGGGTGCCCACGGTGCG	0.602																																					p.G185G		.											.	ZNF598-432	0			c.G555A						.						50.0	58.0	55.0					16																	2052644		2169	4266	6435	SO:0001819	synonymous_variant	90850	exon6			CGGGTGCCCACGG	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.390G>A	16.37:g.2052644C>T		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	50	10	NM_178167	0	0	4	5	1	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Silent	SNP	ENST00000563630.1	37																																																																																				.		0.602	ZNF598-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000434439.1	NM_178167	
CLUAP1	23059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3554721	3554721	+	Splice_Site	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr16:3554721T>C	ENST00000576634.1	+	2	168	c.24T>C	c.(22-24)aaT>aaC	p.N8N	CLUAP1_ENST00000341633.5_Splice_Site_p.N8N|LA16c-306E5.3_ENST00000574423.2_RNA|CLUAP1_ENST00000571025.1_Splice_Site_p.N8N|CLUAP1_ENST00000417763.2_5'UTR	NM_015041.2	NP_055856.1	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1	8					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cilium (GO:0005929)|intracellular membrane-bounded organelle (GO:0043231)|intraciliary transport particle B (GO:0030992)|nucleus (GO:0005634)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(2)	16						CTTGGACAGATTTCACAGAGA	0.383																																					p.N8N		.											.	CLUAP1-137	0			c.T24C						.						106.0	103.0	104.0					16																	3554721		2197	4300	6497	SO:0001630	splice_region_variant	23059	exon2			GACAGATTTCACA	BC017070	CCDS32381.1, CCDS45398.1	16p13.3	2014-07-18				ENSG00000103351		"""Intraflagellar transport homologs"""	19009	protein-coding gene	gene with protein product	"""flagellar associated protein 22, qilin-like protein, homolog (Chlamydomonas)"", ""cilia and flagella associated protein 22"""					15480429, 9734811, 19253336	Standard	NM_015041		Approved	FLJ13297, KIAA0643, FAP22, CFAP22	uc002cvk.2	Q96AJ1		ENST00000576634.1:c.23-1T>C	16.37:g.3554721T>C		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	105	21	NM_015041	0	0	0	0	0	O75138|Q65ZA3|Q9H8R4|Q9H8T1	Silent	SNP	ENST00000576634.1	37	CCDS32381.1																																																																																			.		0.383	CLUAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437883.2	NM_024793	Silent
RRN3	54700	ucsc.edu	37	16	15188060	15188060	+	Missense_Mutation	SNP	G	G	A	rs201504364		TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr16:15188060G>A	ENST00000198767.6	-	1	114	c.31C>T	c.(31-33)Ccg>Tcg	p.P11S	PDXDC1_ENST00000535621.2_Intron|RP11-72I8.1_ENST00000569858.1_RNA|RRN3_ENST00000563559.1_Missense_Mutation_p.P11S|RRN3_ENST00000564131.1_Missense_Mutation_p.P11S|RRN3_ENST00000327307.7_5'Flank|RRN3_ENST00000429751.2_Missense_Mutation_p.P11S	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	11					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P11S(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						GCATCTCCCGGCAAACGCGTG	0.637																																					p.P11S													.	RRN3-91	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C31T						.						15.0	14.0	14.0					16																	15188060		2193	4294	6487	SO:0001583	missense	54700	exon1			CTCCCGGCAAACG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.31C>T	16.37:g.15188060G>A	ENSP00000198767:p.Pro11Ser	Somatic	12	0		WXS	Illumina HiSeq		35	8	NM_018427	0	0	6	6	0	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	10.34	1.323150	0.24080	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.46819	1.02;0.86	3.13	0.948	0.19561	.	.	.	.	.	T	0.19485	0.0468	N	0.08118	0	0.09310	N	0.999994	B;B;B	0.10296	0.0;0.003;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.26538	-1.0100	9	0.06494	T	0.89	.	3.8332	0.08883	0.1556:0.2546:0.5898:0.0	.	11;11;11	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	S	11	ENSP00000198767:P11S;ENSP00000402027:P11S	ENSP00000198767:P11S	P	-	1	0	RRN3	15095561	0.001000	0.12720	0.003000	0.11579	0.038000	0.13279	0.733000	0.26087	0.121000	0.18284	0.305000	0.20034	CCG	G|0.997;A|0.003		0.637	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
RRN3	54700	ucsc.edu	37	16	15188066	15188066	+	Missense_Mutation	SNP	G	G	A	rs200006712		TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr16:15188066G>A	ENST00000198767.6	-	1	108	c.25C>T	c.(25-27)Cgt>Tgt	p.R9C	PDXDC1_ENST00000535621.2_Intron|RP11-72I8.1_ENST00000569858.1_RNA|RRN3_ENST00000563559.1_Missense_Mutation_p.R9C|RRN3_ENST00000564131.1_Missense_Mutation_p.R9C|RRN3_ENST00000327307.7_5'Flank|RRN3_ENST00000429751.2_Missense_Mutation_p.R9C	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	9					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R9C(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CCCGGCAAACGCGTGTGAAGC	0.642																																					p.R9C													.	RRN3-91	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C25T						.						15.0	13.0	14.0					16																	15188066		2194	4290	6484	SO:0001583	missense	54700	exon1			GCAAACGCGTGTG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.25C>T	16.37:g.15188066G>A	ENSP00000198767:p.Arg9Cys	Somatic	12	0		WXS	Illumina HiSeq		37	8	NM_018427	0	0	5	5	0	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	18.86	3.712820	0.68730	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.59906	0.68;0.23	3.13	3.13	0.36017	.	.	.	.	.	T	0.59032	0.2164	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77557	0.988;0.99;0.982	T	0.62627	-0.6814	9	0.87932	D	0	.	9.8894	0.41281	0.0:0.0:1.0:0.0	.	9;9;9	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	C	9	ENSP00000198767:R9C;ENSP00000402027:R9C	ENSP00000198767:R9C	R	-	1	0	RRN3	15095567	1.000000	0.71417	0.965000	0.40720	0.035000	0.12851	2.717000	0.47227	1.752000	0.51891	0.305000	0.20034	CGT	G|0.997;A|0.003		0.642	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
SPG7	6687	broad.mit.edu	37	16	89613084	89613084	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr16:89613084G>T	ENST00000268704.2	+	11	1483	c.1468G>T	c.(1468-1470)Gag>Tag	p.E490*		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	490					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GGAGATTTTTGAGCAGCACCT	0.582																																					p.E490X													.	SPG7-226	0			c.G1468T						.						89.0	93.0	91.0					16																	89613084		2198	4300	6498	SO:0001587	stop_gained	6687	exon11			ATTTTTGAGCAGC	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1468G>T	16.37:g.89613084G>T	ENSP00000268704:p.Glu490*	Somatic	146	16		WXS	Illumina HiSeq	Phase_I	173	33	NM_003119	0	0	16	16	0	O75756|Q2TB70|Q58F00|Q96IB0	Nonsense_Mutation	SNP	ENST00000268704.2	37	CCDS10977.1	.	.	.	.	.	.	.	.	.	.	G	41	8.594842	0.98877	.	.	ENSG00000197912	ENST00000268704	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	19.2181	0.93786	0.0:0.0:1.0:0.0	.	.	.	.	X	490	.	ENSP00000268704:E490X	E	+	1	0	SPG7	88140585	1.000000	0.71417	0.989000	0.46669	0.932000	0.56968	9.610000	0.98337	2.563000	0.86464	0.561000	0.74099	GAG	.		0.582	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119	
TIAF1	9220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27400954	27400954	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr17:27400954C>G	ENST00000359450.6	-	1	4921	c.264G>C	c.(262-264)agG>agC	p.R88S	MYO18A_ENST00000354329.4_3'UTR|MYO18A_ENST00000531253.1_3'UTR|MYO18A_ENST00000527372.1_3'UTR|MYO18A_ENST00000533112.1_3'UTR|TIAF1_ENST00000408971.2_Missense_Mutation_p.R88S|MYO18A_ENST00000529578.1_5'UTR	NM_004740.3	NP_004731.2	O95411	TIAF1_HUMAN	TGFB1-induced anti-apoptotic factor 1	88					apoptotic process (GO:0006915)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of apoptotic process (GO:0043066)	nucleus (GO:0005634)				kidney(1)|lung(1)|urinary_tract(1)	3	Lung NSC(42;0.015)		Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TTGGATCAGCCCTGAACTGCT	0.532																																					p.R88S		.											.	TIAF1-68	0			c.G264C						.						166.0	140.0	149.0					17																	27400954		2203	4300	6503	SO:0001583	missense	9220	exon1			ATCAGCCCTGAAC	AF105277	CCDS32599.1	17q11.2	2006-08-07				ENSG00000221995			11803	protein-coding gene	gene with protein product		609517				9918798	Standard	NM_004740		Approved		uc002hdv.1	O95411		ENST00000359450.6:c.264G>C	17.37:g.27400954C>G	ENSP00000352424:p.Arg88Ser	Somatic	206	0		WXS	Illumina HiSeq	Phase_I	251	129	NM_004740	0	0	6	23	17	A2RRE2|Q6PEG2	Missense_Mutation	SNP	ENST00000359450.6	37	CCDS32599.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.152934	0.38021	.	.	ENSG00000221995	ENST00000408971;ENST00000511177	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	T	0.22666	0.0547	N	0.08118	0	0.23577	N	0.997377	P	0.35363	0.497	B	0.31016	0.123	T	0.26985	-1.0087	8	0.87932	D	0	.	16.3692	0.83347	0.0:1.0:0.0:0.0	.	88	O95411	TIAF1_HUMAN	S	88	.	ENSP00000386130:R88S	R	-	3	2	TIAF1	24425080	0.786000	0.28738	0.969000	0.41365	0.843000	0.47879	3.603000	0.54074	2.894000	0.99253	0.655000	0.94253	AGG	.		0.532	TIAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372394.2	NM_004740	
TMEM101	84336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42089524	42089524	+	Silent	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr17:42089524C>T	ENST00000589334.1	-	5	861	c.546G>A	c.(544-546)ctG>ctA	p.L182L	TMEM101_ENST00000206380.3_Silent_p.L182L|TMEM101_ENST00000542039.1_Silent_p.L124L			Q96IK0	TM101_HUMAN	transmembrane protein 101	182					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GCACGAAGAACAGCTGGATCA	0.587																																					p.L182L		.											.	TMEM101-91	0			c.G546A						.						112.0	95.0	100.0					17																	42089524		2203	4300	6503	SO:0001819	synonymous_variant	84336	exon4			GAAGAACAGCTGG	AK172826	CCDS11474.1	17q21.31	2005-12-16							28653	protein-coding gene	gene with protein product						12761501	Standard	NM_032376		Approved	MGC4251, FLJ23987	uc002ieu.3	Q96IK0		ENST00000589334.1:c.546G>A	17.37:g.42089524C>T		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	122	27	NM_032376	0	0	20	27	7	B2R9N6	Silent	SNP	ENST00000589334.1	37	CCDS11474.1																																																																																			.		0.587	TMEM101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457665.1	NM_032376	
TOB1	10140	broad.mit.edu	37	17	48941062	48941062	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr17:48941062T>C	ENST00000268957.3	-	3	745	c.317A>G	c.(316-318)aAg>aGg	p.K106R	TOB1_ENST00000499247.2_Missense_Mutation_p.K106R|TOB1-AS1_ENST00000416263.3_RNA|TOB1_ENST00000509385.1_5'UTR	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	106					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			CACTGGTCCCTTTTCACCAAT	0.418											OREG0024576	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K106R	NSCLC(144;643 1919 24513 29423 40686)												.	TOB1-226	0			c.A317G						.						140.0	128.0	132.0					17																	48941062		2203	4300	6503	SO:0001583	missense	10140	exon2			GGTCCCTTTTCAC	D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.317A>G	17.37:g.48941062T>C	ENSP00000268957:p.Lys106Arg	Somatic	135	0	958	WXS	Illumina HiSeq	Phase_I	150	3	NM_005749	0	0	46	46	0	B2R9T0|D3DTY3|Q4KMQ0	Missense_Mutation	SNP	ENST00000268957.3	37	CCDS11576.1	.	.	.	.	.	.	.	.	.	.	T	15.57	2.874040	0.51695	.	.	ENSG00000141232	ENST00000499247;ENST00000268957	T;T	0.52526	0.66;0.66	5.69	4.61	0.57282	Anti-proliferative protein (3);	0.046027	0.85682	N	0.000000	T	0.55497	0.1924	L	0.55017	1.72	0.80722	D	1	P	0.51449	0.945	P	0.54856	0.762	T	0.55457	-0.8138	10	0.52906	T	0.07	.	11.5893	0.50938	0.0:0.0696:0.0:0.9304	.	106	P50616	TOB1_HUMAN	R	106	ENSP00000427695:K106R;ENSP00000268957:K106R	ENSP00000268957:K106R	K	-	2	0	TOB1	46296061	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.698000	0.84413	0.984000	0.38629	-0.256000	0.11100	AAG	.		0.418	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1		
BZRAP1	9256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	56386306	56386306	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr17:56386306G>T	ENST00000343736.4	-	22	4490	c.4327C>A	c.(4327-4329)Ctg>Atg	p.L1443M	BZRAP1_ENST00000355701.3_Missense_Mutation_p.L1443M|BZRAP1_ENST00000268893.6_Missense_Mutation_p.L1383M			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1443						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GTGGGGCCCAGTCGTCCAGAG	0.692																																					p.L1443M		.											.	BZRAP1-229	0			c.C4327A						.						27.0	34.0	32.0					17																	56386306		2173	4260	6433	SO:0001583	missense	9256	exon22			GGCCCAGTCGTCC	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4327C>A	17.37:g.56386306G>T	ENSP00000345824:p.Leu1443Met	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	149	36	NM_004758	0	0	0	1	1	O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	37	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	G	7.586	0.669756	0.14776	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.04758	3.56;3.56;3.56	5.31	2.94	0.34122	.	0.632124	0.16677	N	0.204129	T	0.02888	0.0086	N	0.08118	0	0.09310	N	1	B;B;B	0.31519	0.327;0.106;0.064	B;B;B	0.28232	0.087;0.015;0.006	T	0.42899	-0.9424	10	0.72032	D	0.01	.	10.1566	0.42827	0.1877:0.0:0.8123:0.0	.	1443;1383;1443	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	M	1443;1443;1383	ENSP00000347929:L1443M;ENSP00000345824:L1443M;ENSP00000268893:L1383M	ENSP00000268893:L1383M	L	-	1	2	BZRAP1	53741305	1.000000	0.71417	0.155000	0.22561	0.518000	0.34316	2.879000	0.48522	1.233000	0.43693	0.563000	0.77884	CTG	.		0.692	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758	
KCNH6	81033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	61623123	61623123	+	Silent	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr17:61623123C>T	ENST00000583023.1	+	14	2856	c.2845C>T	c.(2845-2847)Cta>Tta	p.L949L	KCNH6_ENST00000581784.1_Silent_p.L860L|KCNH6_ENST00000314672.5_Silent_p.L913L|KCNH6_ENST00000456941.2_Silent_p.L860L	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	949					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.L949V(1)|p.L949I(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AGCCTCACCTCTACATCCCCT	0.587																																					p.L949L		.											.	KCNH6-91	2	Substitution - Missense(2)	urinary_tract(1)|lung(1)	c.C2845T						.						122.0	113.0	116.0					17																	61623123		2203	4300	6503	SO:0001819	synonymous_variant	81033	exon14			TCACCTCTACATC	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2845C>T	17.37:g.61623123C>T		Somatic	126	0		WXS	Illumina HiSeq	Phase_I	169	33	NM_030779	0	0	0	0	0	Q9BRD7	Silent	SNP	ENST00000583023.1	37	CCDS11638.1																																																																																			.		0.587	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
EVPL	2125	broad.mit.edu;bcgsc.ca	37	17	74004559	74004559	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr17:74004559C>T	ENST00000301607.3	-	22	4980	c.4727G>A	c.(4726-4728)cGg>cAg	p.R1576Q	TEN1-CDK3_ENST00000567351.1_RNA|EVPL_ENST00000586740.1_Missense_Mutation_p.R1598Q	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1576	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						GGACTCCTCCCGGGACCAGGT	0.731																																					p.R1576Q													.	EVPL-93	0			c.G4727A						.						9.0	10.0	10.0					17																	74004559		2188	4252	6440	SO:0001583	missense	2125	exon22			TCCTCCCGGGACC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.4727G>A	17.37:g.74004559C>T	ENSP00000301607:p.Arg1576Gln	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	29	9	NM_001988	0	0	5	6	1	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897717	0.33535	.	.	ENSG00000167880	ENST00000301607	T	0.65549	-0.16	5.08	3.03	0.35002	.	0.067167	0.64402	D	0.000020	T	0.42291	0.1196	L	0.46741	1.465	0.23787	N	0.996842	B;P	0.37663	0.152;0.604	B;B	0.21546	0.019;0.035	T	0.25606	-1.0127	10	0.10902	T	0.67	-50.0018	8.6707	0.34147	0.0:0.7001:0.0:0.2999	.	1598;1576	B7ZLH8;Q92817	.;EVPL_HUMAN	Q	1576	ENSP00000301607:R1576Q	ENSP00000301607:R1576Q	R	-	2	0	EVPL	71516154	0.004000	0.15560	0.998000	0.56505	0.943000	0.58893	0.201000	0.17276	1.126000	0.42016	0.561000	0.74099	CGG	.		0.731	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
ANKRD12	23253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	9257291	9257291	+	Silent	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr18:9257291T>C	ENST00000262126.4	+	9	4266	c.4026T>C	c.(4024-4026)acT>acC	p.T1342T	ANKRD12_ENST00000400020.3_Silent_p.T1319T|ANKRD12_ENST00000383440.2_Silent_p.T1319T|RP11-888D10.4_ENST00000609701.1_RNA	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1342						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CAGGAGATACTAGTCCTTCTC	0.398																																					p.T1342T		.											.	ANKRD12-92	0			c.T4026C						.						122.0	117.0	119.0					18																	9257291		2203	4300	6503	SO:0001819	synonymous_variant	23253	exon9			AGATACTAGTCCT	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.4026T>C	18.37:g.9257291T>C		Somatic	132	0		WXS	Illumina HiSeq	Phase_I	120	43	NM_015208	0	0	1	3	2	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	37	CCDS11843.1																																																																																			.		0.398	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ASXL3	80816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	31263418	31263418	+	Silent	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr18:31263418A>G	ENST00000269197.5	+	8	765	c.765A>G	c.(763-765)ggA>ggG	p.G255G		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AAACCCCAGGATCTATTCTTG	0.418																																					p.G255G		.											.	ASXL3-49	0			c.A765G						.						109.0	106.0	107.0					18																	31263418		1872	4099	5971	SO:0001819	synonymous_variant	80816	exon8			CCCAGGATCTATT	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.765A>G	18.37:g.31263418A>G		Somatic	53	0		WXS	Illumina HiSeq	Phase_I	54	14	NM_030632	0	0	0	0	0	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	37	CCDS45847.1																																																																																			.		0.418	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
ELAC1	55520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	48513160	48513160	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr18:48513160G>C	ENST00000269466.3	+	4	904	c.797G>C	c.(796-798)tGc>tCc	p.C266S	RP11-729L2.2_ENST00000590722.2_Intron|RP11-729L2.2_ENST00000588256.1_Intron|SMAD4_ENST00000452201.2_Intron|ELAC1_ENST00000588577.1_3'UTR	NM_018696.2	NP_061166.1	Q9H777	RNZ1_HUMAN	elaC ribonuclease Z 1	266					tRNA 3'-trailer cleavage (GO:0042779)	cytosol (GO:0005829)|nucleus (GO:0005634)	endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(4)|prostate(1)	6		Colorectal(6;0.0269)|all_epithelial(6;0.0729)		Colorectal(21;0.000943)|COAD - Colon adenocarcinoma(17;0.0398)|READ - Rectum adenocarcinoma(32;0.0894)|STAD - Stomach adenocarcinoma(97;0.18)		GTAAAACTGTGCTTTGAAGCA	0.478																																					p.C266S		.											.	ELAC1-90	0			c.G797C						.						96.0	85.0	89.0					18																	48513160		2203	4300	6503	SO:0001583	missense	55520	exon4			AACTGTGCTTTGA	AB029151	CCDS11949.1	18q21	2013-05-24	2013-05-24		ENSG00000141642	ENSG00000141642	3.1.26.11		14197	protein-coding gene	gene with protein product	"""tRNA Z (short form)"", ""RNaseZ(S)"""	608079	"""elaC (E. coli) homolog 1"", ""elaC homolog 1 (E. coli)"""			12711671, 21559454	Standard	NM_018696		Approved	D29	uc002lez.3	Q9H777	OTTHUMG00000132695	ENST00000269466.3:c.797G>C	18.37:g.48513160G>C	ENSP00000269466:p.Cys266Ser	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	48	14	NM_018696	0	0	2	5	3	Q9NS99	Missense_Mutation	SNP	ENST00000269466.3	37	CCDS11949.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725203	0.68959	.	.	ENSG00000141642	ENST00000269466	T	0.76060	-0.99	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.70430	0.3223	L	0.28458	0.855	0.80722	D	1	P	0.37423	0.594	B	0.42959	0.403	T	0.69300	-0.5181	10	0.37606	T	0.19	.	18.233	0.89939	0.0:0.0:1.0:0.0	.	266	Q9H777	RNZ1_HUMAN	S	266	ENSP00000269466:C266S	ENSP00000269466:C266S	C	+	2	0	ELAC1	46767158	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	8.916000	0.92745	2.597000	0.87782	0.655000	0.94253	TGC	.		0.478	ELAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255992.2		
ALPK2	115701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	56196435	56196435	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr18:56196435A>G	ENST00000361673.3	-	6	5602	c.5389T>C	c.(5389-5391)Ttc>Ctc	p.F1797L		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1797	Ig-like 2.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TGTTCAGGGAACATCTCAGCT	0.358																																					p.F1797L		.											.	ALPK2-765	0			c.T5389C						.						110.0	106.0	107.0					18																	56196435		2203	4300	6503	SO:0001583	missense	115701	exon6			CAGGGAACATCTC	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.5389T>C	18.37:g.56196435A>G	ENSP00000354991:p.Phe1797Leu	Somatic	123	1		WXS	Illumina HiSeq	Phase_I	104	29	NM_052947	0	0	1	3	2	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252838	0.80135	.	.	ENSG00000198796	ENST00000361673	T	0.48836	0.8	5.59	3.13	0.36017	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.296760	0.29876	N	0.010963	T	0.58308	0.2113	M	0.69823	2.125	0.25484	N	0.98771	P;P	0.52692	0.944;0.955	P;P	0.58660	0.672;0.843	T	0.49781	-0.8903	10	0.39692	T	0.17	-2.3325	8.3914	0.32531	0.7302:0.1421:0.0:0.1278	.	1792;1797	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	L	1797	ENSP00000354991:F1797L	ENSP00000354991:F1797L	F	-	1	0	ALPK2	54347415	1.000000	0.71417	0.966000	0.40874	0.996000	0.88848	3.205000	0.51090	0.367000	0.24454	0.533000	0.62120	TTC	.		0.358	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
PLIN4	729359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4512468	4512468	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr19:4512468C>T	ENST00000301286.3	-	3	1461	c.1462G>A	c.(1462-1464)Gtg>Atg	p.V488M		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	488	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						CCAGTGGACACAGCATCTTTA	0.612																																					p.V488M		.											.	PLIN4-68	0			c.G1462A						.						114.0	124.0	121.0					19																	4512468		2000	4164	6164	SO:0001583	missense	729359	exon3			TGGACACAGCATC	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1462G>A	19.37:g.4512468C>T	ENSP00000301286:p.Val488Met	Somatic	210	1		WXS	Illumina HiSeq	Phase_I	216	58	NM_001080400	0	0	0	0	0	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947310	0.34377	.	.	ENSG00000167676	ENST00000301286	T	0.08984	3.03	5.38	2.07	0.26955	.	0.452377	0.18308	N	0.145193	T	0.07143	0.0181	L	0.49640	1.575	0.09310	N	1	P	0.38922	0.651	B	0.34138	0.176	T	0.29212	-1.0019	10	0.31617	T	0.26	-12.8615	6.9595	0.24590	0.0:0.6938:0.1441:0.1621	.	488	Q96Q06	PLIN4_HUMAN	M	488	ENSP00000301286:V488M	ENSP00000301286:V488M	V	-	1	0	PLIN4	4463468	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-2.519000	0.00952	0.261000	0.21753	0.549000	0.68633	GTG	.		0.612	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
ALKBH7	84266	hgsc.bcm.edu	37	19	6372879	6372879	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr19:6372879C>G	ENST00000245812.3	+	1	436	c.48C>G	c.(46-48)agC>agG	p.S16R	ALKBH7_ENST00000599849.1_5'Flank|ALKBH7_ENST00000596657.1_5'Flank	NM_032306.3	NP_115682.1	Q9BT30	ALKB7_HUMAN	alkB, alkylation repair homolog 7 (E. coli)	16					cellular response to DNA damage stimulus (GO:0006974)|fatty acid metabolic process (GO:0006631)|regulation of lipid storage (GO:0010883)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)	mitochondrial matrix (GO:0005759)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						CAGGGCCCAGCTGGGTGCGAG	0.726																																					p.S16R		.											.	ALKBH7-90	0			c.C48G						.						3.0	4.0	4.0					19																	6372879		1984	3943	5927	SO:0001583	missense	84266	exon1			GCCCAGCTGGGTG	AY427650	CCDS12163.1	19p13.3	2008-02-05	2006-02-09	2006-02-09		ENSG00000125652		"""Alkylation repair homologs"""	21306	protein-coding gene	gene with protein product		613305	"""spermatogenesis associated 11"""	SPATA11		12477932	Standard	NM_032306		Approved	MGC10974	uc002meo.2	Q9BT30		ENST00000245812.3:c.48C>G	19.37:g.6372879C>G	ENSP00000245812:p.Ser16Arg	Somatic	5	1		WXS	Illumina HiSeq	Phase_I	7	4	NM_032306	0	0	2	5	3	B2R4U9|Q53FF3	Missense_Mutation	SNP	ENST00000245812.3	37	CCDS12163.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.630154	0.46944	.	.	ENSG00000125652	ENST00000245812	T	0.44083	0.93	4.66	4.66	0.58398	.	1.191050	0.05873	N	0.624947	T	0.28928	0.0718	N	0.08118	0	0.31191	N	0.700926	B	0.14438	0.01	B	0.19666	0.026	T	0.03773	-1.1005	10	0.15499	T	0.54	-20.7838	15.3108	0.74031	0.0:1.0:0.0:0.0	.	16	Q9BT30	ALKB7_HUMAN	R	16	ENSP00000245812:S16R	ENSP00000245812:S16R	S	+	3	2	ALKBH7	6323879	0.139000	0.22563	0.954000	0.39281	0.224000	0.24922	0.980000	0.29513	2.529000	0.85273	0.305000	0.20034	AGC	.		0.726	ALKBH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453036.1	NM_032306	
ZNF763	284390	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12089881	12089881	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr19:12089881T>C	ENST00000358987.3	+	4	1269	c.1142T>C	c.(1141-1143)tTt>tCt	p.F381S	ZNF763_ENST00000590798.1_Missense_Mutation_p.F401S|ZNF763_ENST00000343949.5_Missense_Mutation_p.F384S|ZNF763_ENST00000545530.1_Missense_Mutation_p.F259S|ZNF763_ENST00000538752.1_Missense_Mutation_p.F401S			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	381					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						TCTTATAAGTTTTCAAACACA	0.398																																					p.F384S		.											.	ZNF763-90	0			c.T1151C						.						67.0	73.0	71.0					19																	12089881		2180	4294	6474	SO:0001583	missense	284390	exon4			ATAAGTTTTCAAA	AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.1142T>C	19.37:g.12089881T>C	ENSP00000402017:p.Phe381Ser	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	143	55	NM_001012753	0	0	0	0	0	B3KRU3|B4DRE7	Missense_Mutation	SNP	ENST00000358987.3	37		.	.	.	.	.	.	.	.	.	.	t	0	-2.724828	0.00091	.	.	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000545530;ENST00000358987	T;T;T;T	0.06068	3.45;3.44;3.35;3.45	0.855	-1.71	0.08133	.	.	.	.	.	T	0.01254	0.0041	N	0.00060	-2.34	0.09310	N	1	B;P;B	0.35774	0.018;0.519;0.018	B;P;B	0.45449	0.004;0.481;0.004	T	0.22695	-1.0209	9	0.02654	T	1	.	2.0667	0.03604	0.2548:0.2103:0.0:0.5349	.	401;381;384	F5H0A9;Q0D2J5;Q0D2J5-2	.;ZN763_HUMAN;.	S	401;384;259;381	ENSP00000438117:F401S;ENSP00000369774:F384S;ENSP00000446166:F259S;ENSP00000402017:F381S	ENSP00000369774:F384S	F	+	2	0	ZNF763	11950881	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	0.148000	0.16224	-1.202000	0.02655	0.155000	0.16302	TTT	.		0.398	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000344158.1	NM_001012753	
ZSWIM4	65249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	13915960	13915960	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr19:13915960A>G	ENST00000254323.2	+	3	899	c.710A>G	c.(709-711)aAt>aGt	p.N237S	ZSWIM4_ENST00000440752.2_5'UTR	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	237							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			AACTTGGTGAATGGTAAGGGC	0.607											OREG0025298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N237S		.											.	ZSWIM4-90	0			c.A710G						.						35.0	34.0	34.0					19																	13915960		2203	4299	6502	SO:0001583	missense	65249	exon3			TGGTGAATGGTAA	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.710A>G	19.37:g.13915960A>G	ENSP00000254323:p.Asn237Ser	Somatic	73	0	691	WXS	Illumina HiSeq	Phase_I	64	17	NM_023072	0	0	0	0	0		Missense_Mutation	SNP	ENST00000254323.2	37	CCDS32924.1	.	.	.	.	.	.	.	.	.	.	A	7.710	0.695019	0.15039	.	.	ENSG00000132003	ENST00000254323	T	0.21191	2.02	4.81	4.81	0.61882	.	0.093972	0.43747	D	0.000522	T	0.10337	0.0253	N	0.05441	-0.05	0.80722	D	1	B	0.16802	0.019	B	0.18561	0.022	T	0.14144	-1.0483	10	0.10377	T	0.69	-33.1503	12.3201	0.54979	1.0:0.0:0.0:0.0	.	237	Q9H7M6	ZSWM4_HUMAN	S	237	ENSP00000254323:N237S	ENSP00000254323:N237S	N	+	2	0	ZSWIM4	13776960	1.000000	0.71417	0.941000	0.38009	0.192000	0.23643	8.632000	0.90995	1.806000	0.52798	0.459000	0.35465	AAT	.		0.607	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342	
JAK3	3718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	17946018	17946018	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr19:17946018T>C	ENST00000527670.1	-	14	1950	c.1921A>G	c.(1921-1923)Aaa>Gaa	p.K641E	JAK3_ENST00000534444.1_Missense_Mutation_p.K641E|JAK3_ENST00000458235.1_Missense_Mutation_p.K641E			P52333	JAK3_HUMAN	Janus kinase 3	641	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	GGCAGGCCTTTGTCCTCCTAA	0.577		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.K641E		.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	JAK3-2418	0			c.A1921G						.						24.0	27.0	26.0					19																	17946018		2203	4300	6503	SO:0001583	missense	3718	exon15			GGCCTTTGTCCTC	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1921A>G	19.37:g.17946018T>C	ENSP00000432511:p.Lys641Glu	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	50	13	NM_000215	0	0	0	0	0	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	T	18.16	3.561092	0.65538	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	D;D;D	0.83837	-1.77;-1.77;-1.77	5.32	5.32	0.75619	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.244952	0.39985	N	0.001215	D	0.88998	0.6590	M	0.67569	2.06	0.45439	D	0.998412	D;P	0.65815	0.995;0.931	D;P	0.66497	0.944;0.816	D	0.90111	0.4192	10	0.87932	D	0	-10.7087	13.227	0.59921	0.0:0.0:0.0:1.0	.	641;641	P52333-2;P52333	.;JAK3_HUMAN	E	641	ENSP00000391676:K641E;ENSP00000432511:K641E;ENSP00000436421:K641E	ENSP00000391676:K641E	K	-	1	0	JAK3	17807018	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	5.606000	0.67641	2.009000	0.58944	0.454000	0.30748	AAA	.		0.577	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
ZNF626	199777	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	20808028	20808028	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr19:20808028G>A	ENST00000601440.1	-	4	801	c.655C>T	c.(655-657)Cat>Tat	p.H219Y	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	219					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						ATTTTCTTATGTCTAGTAAGG	0.383																																					p.H219Y													.	ZNF626-515	0			c.C655T						.						49.0	52.0	51.0					19																	20808028		2149	4275	6424	SO:0001583	missense	199777	exon4			TCTTATGTCTAGT	BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.655C>T	19.37:g.20808028G>A	ENSP00000469958:p.His219Tyr	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	48	11	NM_001076675	0	0	1	1	0	Q8N8T4|Q96QM1	Missense_Mutation	SNP	ENST00000601440.1	37	CCDS42535.1	.	.	.	.	.	.	.	.	.	.	N	8.924	0.961677	0.18583	.	.	ENSG00000188171	ENST00000392298;ENST00000453075;ENST00000305570	T	0.67523	-0.27	0.798	-0.604	0.11626	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.75273	0.3827	H	0.96015	3.755	0.58432	D	0.999998	P	0.40534	0.72	P	0.45071	0.468	T	0.73959	-0.3818	9	0.66056	D	0.02	.	4.4901	0.11810	0.3214:0.0:0.6786:0.0	.	219	Q68DY1	ZN626_HUMAN	Y	219;143;219	ENSP00000445201:H219Y	ENSP00000445201:H219Y	H	-	1	0	ZNF626	20599868	0.997000	0.39634	0.298000	0.25002	0.296000	0.27459	3.378000	0.52432	0.162000	0.19483	0.165000	0.16767	CAT	.		0.383	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447845.2	NM_145297	
ZNF787	126208	hgsc.bcm.edu	37	19	56599455	56599455	+	Missense_Mutation	SNP	C	C	G	rs202243737	byFrequency	TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr19:56599455C>G	ENST00000270459.3	-	3	1204	c.1086G>C	c.(1084-1086)gaG>gaC	p.E362D		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	362					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		CGTCGTCGTCCTCCTCCTCCC	0.786													c|||	31	0.0061901	0.0174	0.0086	5008	,	,		3491	0.0		0.002	False		,,,				2504	0.0				p.E362D		.											.	ZNF787-69	0			c.G1086C						.						5.0	6.0	6.0					19																	56599455		1716	3706	5422	SO:0001583	missense	126208	exon3			GTCGTCCTCCTCC	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1086G>C	19.37:g.56599455C>G	ENSP00000270459:p.Glu362Asp	Somatic	11	0		WXS	Illumina HiSeq	Phase_I	26	14	NM_001002836	0	0	0	0	0	O00455	Missense_Mutation	SNP	ENST00000270459.3	37	CCDS42634.1	.	.	.	.	.	.	.	.	.	.	c	2.272	-0.366767	0.05069	.	.	ENSG00000142409	ENST00000270459	T	0.06687	3.27	1.38	0.235	0.15431	.	.	.	.	.	T	0.02688	0.0081	N	0.02539	-0.55	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.48222	-0.9054	9	0.15066	T	0.55	-9.261	5.3742	0.16156	0.0:0.4529:0.5471:0.0	.	362	Q6DD87	ZN787_HUMAN	D	362	ENSP00000270459:E362D	ENSP00000270459:E362D	E	-	3	2	ZNF787	61291267	0.001000	0.12720	0.020000	0.16555	0.393000	0.30537	-0.022000	0.12480	0.167000	0.19631	0.494000	0.49563	GAG	C|0.996;G|0.004		0.786	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
HTR2B	3357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	231988374	231988374	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr2:231988374C>A	ENST00000258400.3	-	2	617	c.105G>T	c.(103-105)caG>caT	p.Q35H	PSMD1_ENST00000409643.1_Intron|PSMD1_ENST00000308696.6_Intron|PSMD1_ENST00000373635.4_Intron	NM_000867.4	NP_000858.3	P41595	5HT2B_HUMAN	5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled	35					activation of phospholipase C activity (GO:0007202)|behavior (GO:0007610)|calcium-mediated signaling (GO:0019722)|cardiac muscle hypertrophy (GO:0003300)|cellular calcium ion homeostasis (GO:0006874)|cellular response to temperature stimulus (GO:0071502)|cGMP biosynthetic process (GO:0006182)|embryonic morphogenesis (GO:0048598)|ERK1 and ERK2 cascade (GO:0070371)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|heart morphogenesis (GO:0003007)|intestine smooth muscle contraction (GO:0014827)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell death (GO:0060548)|neural crest cell differentiation (GO:0014033)|neural crest cell migration (GO:0001755)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphorylation (GO:0016310)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	drug binding (GO:0008144)|G-protein alpha-subunit binding (GO:0001965)|Ras GTPase activator activity (GO:0005099)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	11		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;4.48e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0141)	Amoxapine(DB00543)|Apomorphine(DB00714)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Dihydroergotamine(DB00320)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Lisuride(DB00589)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Ropinirole(DB00268)|Triflupromazine(DB00508)|Yohimbine(DB01392)	TTGATTCTGTCTGTAATCCAG	0.418																																					p.Q35H	Ovarian(155;1331 1891 12853 14038 34991)	.											.	HTR2B-90	0			c.G105T						.						192.0	179.0	183.0					2																	231988374		2203	4300	6503	SO:0001583	missense	3357	exon2			TTCTGTCTGTAAT		CCDS2483.1	2q36.3-q37.1	2012-08-08	2012-02-03		ENSG00000135914	ENSG00000135914		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5294	protein-coding gene	gene with protein product		601122	"""5-hydroxytryptamine (serotonin) receptor 2B"""			8143856	Standard	NM_000867		Approved	5-HT(2B), 5-HT2B	uc002vro.3	P41595	OTTHUMG00000133222	ENST00000258400.3:c.105G>T	2.37:g.231988374C>A	ENSP00000258400:p.Gln35His	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	144	48	NM_000867	0	0	0	0	0	B2R9D5|Q53TI1|Q62221|Q6P523	Missense_Mutation	SNP	ENST00000258400.3	37	CCDS2483.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121899	0.37436	.	.	ENSG00000135914	ENST00000258400	T	0.36878	1.23	5.52	1.53	0.23141	.	0.500549	0.19422	N	0.114664	T	0.27349	0.0671	L	0.44542	1.39	0.23144	N	0.998224	B	0.33379	0.41	B	0.35510	0.204	T	0.14504	-1.0470	10	0.22706	T	0.39	.	8.4754	0.33009	0.0:0.4476:0.4023:0.1501	.	35	P41595	5HT2B_HUMAN	H	35	ENSP00000258400:Q35H	ENSP00000258400:Q35H	Q	-	3	2	HTR2B	231696618	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	1.887000	0.39698	0.297000	0.22615	-0.237000	0.12165	CAG	.		0.418	HTR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256957.2	NM_000867	
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	238283616	238283616	+	Missense_Mutation	SNP	C	C	T	rs78427077		TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr2:238283616C>T	ENST00000295550.4	-	8	3570	c.3118G>A	c.(3118-3120)Gtc>Atc	p.V1040I	COL6A3_ENST00000347401.3_Missense_Mutation_p.V839I|COL6A3_ENST00000392003.2_Missense_Mutation_p.V633I|COL6A3_ENST00000353578.4_Missense_Mutation_p.V834I|COL6A3_ENST00000392004.3_Missense_Mutation_p.V834I|COL6A3_ENST00000346358.4_Missense_Mutation_p.V840I|COL6A3_ENST00000472056.1_Missense_Mutation_p.V433I|COL6A3_ENST00000409809.1_Missense_Mutation_p.V834I	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1040	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCGCTCCTGACGCCCTCAGAG	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		19525	0.0		0.001	False		,,,				2504	0.0				p.V1040I		.											.	COL6A3-526	0			c.G3118A						.	C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	46.0	49.0	48.0		3118,1897,2500,1297,2500	5.3	0.5	2	dbSNP_132	48	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense,missense,missense,missense	COL6A3	NM_004369.3,NM_057164.4,NM_057165.4,NM_057166.4,NM_057167.3	29,29,29,29,29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1040/3178,633/1037,834/1238,433/2571,834/2972	238283616	3,13003	2203	4300	6503	SO:0001583	missense	1293	exon8			TCCTGACGCCCTC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3118G>A	2.37:g.238283616C>T	ENSP00000295550:p.Val1040Ile	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	76	24	NM_004369	0	0	1	1	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	12.29	1.894058	0.33442	0.0	3.49E-4	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	T;T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	5.33	5.33	0.75918	von Willebrand factor, type A (3);	0.000000	0.49305	D	0.000154	T	0.79776	0.4504	N	0.16743	0.435	0.46981	D	0.99927	D;D;P;D;D	0.76494	0.998;0.98;0.892;0.999;0.964	D;P;P;P;P	0.66351	0.943;0.709;0.678;0.906;0.489	T	0.77550	-0.2546	10	0.28530	T	0.3	.	13.6833	0.62499	0.0:0.9262:0.0:0.0738	.	433;633;834;834;1040	E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;CO6A3_HUMAN	I	1040;839;834;433;834;840;834;633	ENSP00000295550:V1040I;ENSP00000315609:V839I;ENSP00000315873:V834I;ENSP00000418285:V433I;ENSP00000386844:V834I;ENSP00000295546:V840I;ENSP00000375861:V834I;ENSP00000375860:V633I	ENSP00000295550:V1040I	V	-	1	0	COL6A3	237948355	0.743000	0.28239	0.491000	0.27477	0.042000	0.13812	1.589000	0.36644	2.652000	0.90054	0.655000	0.94253	GTC	C|1.000;T|0.000		0.567	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
GDF5	8200	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	34025518	34025518	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr20:34025518C>T	ENST00000374372.1	-	3	694	c.191G>A	c.(190-192)aGc>aAc	p.S64N	GDF5_ENST00000374369.3_Missense_Mutation_p.S64N			P43026	GDF5_HUMAN	growth differentiation factor 5	64					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			CCCACCATAGCTGTGACCCCC	0.647																																					p.S64N													.	GDF5-226	0			c.G191A						.						24.0	24.0	24.0					20																	34025518		2203	4300	6503	SO:0001583	missense	8200	exon1			CCATAGCTGTGAC	X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.191G>A	20.37:g.34025518C>T	ENSP00000363492:p.Ser64Asn	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	22	7	NM_000557	0	0	0	0	0	E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	37	CCDS13254.1	.	.	.	.	.	.	.	.	.	.	C	8.655	0.899147	0.17686	.	.	ENSG00000125965	ENST00000374369;ENST00000374372	T;T	0.32023	1.47;1.47	4.28	3.3	0.37823	.	0.974769	0.08453	N	0.943691	T	0.22166	0.0534	N	0.14661	0.345	0.22401	N	0.999132	B;B	0.19583	0.037;0.037	B;B	0.18871	0.023;0.014	T	0.26395	-1.0104	10	0.46703	T	0.11	.	13.148	0.59474	0.1613:0.8387:0.0:0.0	.	64;64	F1T0J1;P43026	.;GDF5_HUMAN	N	64	ENSP00000363489:S64N;ENSP00000363492:S64N	ENSP00000363489:S64N	S	-	2	0	GDF5	33488932	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	2.064000	0.41432	0.937000	0.37394	0.313000	0.20887	AGC	.		0.647	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
SALL4	57167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	50405586	50405586	+	Silent	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr20:50405586G>A	ENST00000217086.4	-	3	2667	c.2556C>T	c.(2554-2556)tcC>tcT	p.S852S	SALL4_ENST00000395997.3_Silent_p.S415S|SALL4_ENST00000371539.3_Silent_p.S75S|SALL4_ENST00000483130.1_5'Flank	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	852					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCATCCCTGGGGACAATGTCG	0.577																																					p.S852S		.											.	SALL4-92	0			c.C2556T						.						57.0	54.0	55.0					20																	50405586		2203	4300	6503	SO:0001819	synonymous_variant	57167	exon3			CCCTGGGGACAAT	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2556C>T	20.37:g.50405586G>A		Somatic	73	0		WXS	Illumina HiSeq	Phase_I	59	19	NM_020436	0	0	0	0	0	A2A2D8|Q540H3|Q6Y8G6	Silent	SNP	ENST00000217086.4	37	CCDS13438.1																																																																																			.		0.577	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
KRTAP13-1	140258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	31768620	31768620	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr21:31768620G>T	ENST00000355459.2	+	1	229	c.216G>T	c.(214-216)gaG>gaT	p.E72D		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	72	5 X 10 AA approximate repeats.					intermediate filament (GO:0005882)				endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CCTATGTGGAGTCCAGCCCCT	0.602																																					p.E72D		.											.	KRTAP13-1-91	0			c.G216T						.						60.0	61.0	61.0					21																	31768620		2203	4300	6503	SO:0001583	missense	140258	exon1			TGTGGAGTCCAGC	AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.216G>T	21.37:g.31768620G>T	ENSP00000347635:p.Glu72Asp	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	83	26	NM_181599	0	0	0	0	0	Q14D20|Q3LI79	Missense_Mutation	SNP	ENST00000355459.2	37	CCDS13590.2	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890413	0.33348	.	.	ENSG00000198390	ENST00000355459	T	0.03982	3.74	4.51	0.568	0.17333	.	1.594350	0.04748	N	0.423995	T	0.09158	0.0226	M	0.68317	2.08	0.09310	N	1	P	0.46784	0.884	P	0.48334	0.574	T	0.32079	-0.9920	10	0.20046	T	0.44	.	3.3017	0.06985	0.2615:0.0:0.4305:0.308	.	72	Q8IUC0	KR131_HUMAN	D	72	ENSP00000347635:E72D	ENSP00000347635:E72D	E	+	3	2	KRTAP13-1	30690491	0.000000	0.05858	0.002000	0.10522	0.045000	0.14185	0.172000	0.16704	0.089000	0.17243	0.557000	0.71058	GAG	.		0.602	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128252.3		
NDUFV3	4731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	44317078	44317078	+	Silent	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr21:44317078T>C	ENST00000340344.4	+	2	156	c.90T>C	c.(88-90)tcT>tcC	p.S30S	NDUFV3_ENST00000354250.2_Silent_p.S30S|NDUFV3_ENST00000460259.1_3'UTR	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa	30					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		GACTTGCTTCTACGGTTTCTT	0.413																																					p.S30S		.											.	NDUFV3-92	0			c.T90C						.						87.0	86.0	86.0					21																	44317078		2203	4300	6503	SO:0001819	synonymous_variant	4731	exon2			TGCTTCTACGGTT		CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.90T>C	21.37:g.44317078T>C		Somatic	121	0		WXS	Illumina HiSeq	Phase_I	94	27	NM_001001503	0	0	7	14	7	A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Silent	SNP	ENST00000340344.4	37	CCDS33573.1																																																																																			.		0.413	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195448.2		
PPM1F	9647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	22287929	22287929	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr22:22287929A>G	ENST00000263212.5	-	5	686	c.581T>C	c.(580-582)tTt>tCt	p.F194S	PPM1F_ENST00000538191.1_Missense_Mutation_p.F90S|PPM1F_ENST00000407142.1_Missense_Mutation_p.F26S|PPM1F_ENST00000397495.4_Missense_Mutation_p.F194S	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	194					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		AAACACAGCAAAGTAGGCGCG	0.667																																					p.F194S		.											.	PPM1F-292	0			c.T581C						.						61.0	52.0	55.0					22																	22287929		2203	4300	6503	SO:0001583	missense	9647	exon5			ACAGCAAAGTAGG	D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.581T>C	22.37:g.22287929A>G	ENSP00000263212:p.Phe194Ser	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	57	25	NM_014634	0	0	0	1	1	A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	ENST00000263212.5	37	CCDS13796.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.789526	0.50102	.	.	ENSG00000100034	ENST00000263212;ENST00000407142;ENST00000406981;ENST00000538191;ENST00000397495;ENST00000445205	T;T;T;T;T	0.12465	2.68;2.68;2.68;2.68;2.68	4.95	4.95	0.65309	Protein phosphatase 2C-like (5);	0.052935	0.85682	D	0.000000	T	0.46678	0.1405	M	0.92555	3.32	0.48040	D	0.999577	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.995;0.995	T	0.60131	-0.7323	10	0.87932	D	0	-0.6926	14.4382	0.67296	1.0:0.0:0.0:0.0	.	90;194;194	B7Z2C3;A8MX49;P49593	.;.;PPM1F_HUMAN	S	194;26;26;90;194;26	ENSP00000263212:F194S;ENSP00000384930:F26S;ENSP00000439915:F90S;ENSP00000380632:F194S;ENSP00000392372:F26S	ENSP00000263212:F194S	F	-	2	0	PPM1F	20617929	1.000000	0.71417	0.992000	0.48379	0.088000	0.18126	3.605000	0.54088	2.077000	0.62373	0.454000	0.30748	TTT	.		0.667	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320267.2	NM_014634	
SFI1	9814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	31924806	31924806	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr22:31924806C>T	ENST00000400288.2	+	3	328	c.223C>T	c.(223-225)Cat>Tat	p.H75Y	SFI1_ENST00000414585.1_Intron|SFI1_ENST00000432498.1_Missense_Mutation_p.H75Y|SFI1_ENST00000443326.1_Intron|SFI1_ENST00000540643.1_Missense_Mutation_p.H75Y|SFI1_ENST00000443011.1_Intron|SFI1_ENST00000400289.1_Intron	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	75					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						TCGTGGCACACATACTTGTAC	0.483																																					p.H75Y		.											.	SFI1-90	0			c.C223T						.						121.0	114.0	116.0					22																	31924806		1992	4175	6167	SO:0001583	missense	9814	exon3			GGCACACATACTT	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.223C>T	22.37:g.31924806C>T	ENSP00000383145:p.His75Tyr	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	130	41	NM_001007467	0	0	0	2	2	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	C	6.278	0.419420	0.11928	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000421060;ENST00000444859;ENST00000400288;ENST00000450787	T;T;T;T;T	0.32515	3.32;3.02;1.45;3.33;2.1	4.26	-0.0926	0.13656	.	0.718935	0.12712	N	0.445472	T	0.12135	0.0295	N	0.08118	0	0.09310	N	1	B;B;B;B	0.22746	0.005;0.012;0.004;0.074	B;B;B;B	0.23018	0.004;0.009;0.006;0.043	T	0.36335	-0.9752	10	0.10377	T	0.69	.	6.4426	0.21859	0.0:0.5881:0.0:0.4119	.	75;75;75;75	A8K8P3-9;A8K8P3-2;A8K8P3;A8K8P3-5	.;.;SFI1_HUMAN;.	Y	75;75;75;75;75;26	ENSP00000402679:H75Y;ENSP00000443025:H75Y;ENSP00000411793:H75Y;ENSP00000383145:H75Y;ENSP00000389364:H26Y	ENSP00000383145:H75Y	H	+	1	0	SFI1	30254806	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	0.236000	0.17967	0.079000	0.16929	-0.237000	0.12165	CAT	.		0.483	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
APOL1	8542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	36661665	36661665	+	Silent	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr22:36661665C>T	ENST00000397278.3	+	6	1012	c.783C>T	c.(781-783)aaC>aaT	p.N261N	APOL1_ENST00000426053.1_Silent_p.N243N|APOL1_ENST00000319136.4_Silent_p.N277N|APOL1_ENST00000347595.7_Silent_p.N140N|APOL1_ENST00000397279.4_Silent_p.N261N|APOL1_ENST00000422706.1_Silent_p.N261N	NM_003661.3	NP_003652.2	O14791	APOL1_HUMAN	apolipoprotein L, 1	261					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cholesterol metabolic process (GO:0008203)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|intrinsic component of membrane (GO:0031224)|very-low-density lipoprotein particle (GO:0034361)	chloride channel activity (GO:0005254)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	14						TGGGTGAGAACATATCCAACT	0.498																																					p.N277N		.											.	APOL1-221	0			c.C831T						.						123.0	114.0	117.0					22																	36661665		2203	4300	6503	SO:0001819	synonymous_variant	8542	exon7			TGAGAACATATCC	AF019225	CCDS13925.1, CCDS13926.1, CCDS46702.1	22q13.1	2014-09-17			ENSG00000100342	ENSG00000100342		"""Apolipoproteins"""	618	protein-coding gene	gene with protein product		603743		APOL		9325276, 11374903, 16020735	Standard	NM_003661		Approved		uc011amp.2	O14791	OTTHUMG00000030427	ENST00000397278.3:c.783C>T	22.37:g.36661665C>T		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	60	18	NM_145343	0	0	64	126	62	A5PLQ4|B4DU12|E9PF24|O60804|Q5R3P7|Q5R3P8|Q96AB8|Q96PM4|Q9BQ03	Silent	SNP	ENST00000397278.3	37	CCDS13926.1																																																																																			.		0.498	APOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319100.4	NM_145343	
TNRC6B	23112	hgsc.bcm.edu;broad.mit.edu	37	22	40669533	40669533	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr22:40669533A>G	ENST00000454349.2	+	7	3281	c.3070A>G	c.(3070-3072)Act>Gct	p.T1024A	TNRC6B_ENST00000335727.9_Missense_Mutation_p.T971A|TNRC6B_ENST00000301923.9_Missense_Mutation_p.T277A|TNRC6B_ENST00000402203.1_Missense_Mutation_p.T277A	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1024					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						CTGGAACACCACTGGCTCTCA	0.562																																					p.T1024A		.											.	TNRC6B-22	0			c.A3070G						.						36.0	42.0	40.0					22																	40669533		2031	4171	6202	SO:0001583	missense	23112	exon7			AACACCACTGGCT	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.3070A>G	22.37:g.40669533A>G	ENSP00000401946:p.Thr1024Ala	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	13	5	NM_001162501	0	0	0	1	1	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	G	4.088	0.014360	0.07959	.	.	ENSG00000100354	ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	6.04	0.445	0.16597	.	0.270973	0.41938	N	0.000787	T	0.10680	0.0261	N	0.00583	-1.355	0.20196	N	0.99993	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.004;0.002;0.001;0.002	T	0.38866	-0.9641	10	0.02654	T	1	0.077	12.1291	0.53932	0.2991:0.0:0.7009:0.0	.	1024;971;971;277	Q9UPQ9;A8MYY3;Q9UPQ9-1;Q9UPQ9-2	TNR6B_HUMAN;.;.;.	A	277;277;1024;971;971	ENSP00000306759:T277A;ENSP00000384795:T277A;ENSP00000401946:T1024A;ENSP00000338371:T971A	ENSP00000306759:T277A	T	+	1	0	TNRC6B	38999479	0.894000	0.30519	0.636000	0.29352	0.958000	0.62258	0.742000	0.26216	-0.246000	0.09611	-0.929000	0.02709	ACT	.		0.562	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
CRTAP	10491	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	33156008	33156008	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:33156008C>T	ENST00000320954.6	+	1	538	c.439C>T	c.(439-441)Ccc>Tcc	p.P147S	CRTAP_ENST00000449224.1_Missense_Mutation_p.P147S	NM_006371.4	NP_006362.1	O75718	CRTAP_HUMAN	cartilage associated protein	147					chaperone-mediated protein folding (GO:0061077)|extracellular matrix organization (GO:0030198)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation to 3-hydroxy-L-proline (GO:0018400)|protein stabilization (GO:0050821)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|macromolecular complex (GO:0032991)|proteinaceous extracellular matrix (GO:0005578)	protein complex binding (GO:0032403)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9						GCGCCGCGAGCCCTACAAGTT	0.726																																					p.P147S		.											.	CRTAP-90	0			c.C439T						.						7.0	8.0	8.0					3																	33156008		1469	3247	4716	SO:0001583	missense	10491	exon1			CGCGAGCCCTACA	AJ006470	CCDS2657.1	3p22	2014-09-17			ENSG00000170275	ENSG00000170275			2379	protein-coding gene	gene with protein product	"""leprecan-like 3"""	605497				9217321, 10429950	Standard	NM_006371		Approved	CASP, LEPREL3	uc003cfl.4	O75718	OTTHUMG00000130746	ENST00000320954.6:c.439C>T	3.37:g.33156008C>T	ENSP00000323696:p.Pro147Ser	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	42	14	NM_006371	0	0	18	53	35	B2RBL6	Missense_Mutation	SNP	ENST00000320954.6	37	CCDS2657.1	.	.	.	.	.	.	.	.	.	.	C	32	5.124174	0.94429	.	.	ENSG00000170275	ENST00000320954;ENST00000509775;ENST00000539684;ENST00000449224;ENST00000423366	T;T	0.78003	-1.14;-1.14	4.31	4.31	0.51392	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.89698	0.6790	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.91955	0.5574	10	0.87932	D	0	-10.8094	16.9301	0.86188	0.0:1.0:0.0:0.0	.	147;147	C9JP16;O75718	.;CRTAP_HUMAN	S	147;147;134;147;147	ENSP00000323696:P147S;ENSP00000409997:P147S	ENSP00000323696:P147S	P	+	1	0	CRTAP	33131012	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.262000	0.78410	2.398000	0.81561	0.467000	0.42956	CCC	.		0.726	CRTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253246.3		
PTH1R	5745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	46939563	46939563	+	Splice_Site	SNP	G	G	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:46939563G>T	ENST00000313049.5	+	5	627		c.e5-1		PTH1R_ENST00000449590.1_Splice_Site|PTH1R_ENST00000490109.1_Splice_Site|PTH1R_ENST00000418619.1_Splice_Site|PTH1R_ENST00000430002.2_Splice_Site			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	TGGACCTGCAGGCCATGCCTA	0.617																																					.		.											.	PTH1R-522	0			c.425-1G>T						.						102.0	103.0	103.0					3																	46939563		2203	4300	6503	SO:0001630	splice_region_variant	5745	exon7			CCTGCAGGCCATG		CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.425-1G>T	3.37:g.46939563G>T		Somatic	125	1		WXS	Illumina HiSeq	Phase_I	183	40	NM_000316	0	0	0	3	3	Q2M1U3	Splice_Site	SNP	ENST00000313049.5	37	CCDS2747.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279080	0.80692	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000427125;ENST00000430002;ENST00000313049;ENST00000313063	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7448	0.62868	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTH1R	46914567	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	9.835000	0.99442	2.379000	0.81126	0.462000	0.41574	.	.		0.617	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257481.1	NM_000316	Intron
ATP2C1	27032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	130686204	130686204	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:130686204A>G	ENST00000510168.1	+	16	1799	c.1249A>G	c.(1249-1251)Aga>Gga	p.R417G	ATP2C1_ENST00000422190.2_Missense_Mutation_p.R417G|ATP2C1_ENST00000513801.1_Missense_Mutation_p.R401G|ATP2C1_ENST00000393221.4_Missense_Mutation_p.R451G|ATP2C1_ENST00000533801.2_Missense_Mutation_p.R412G|ATP2C1_ENST00000504381.1_Missense_Mutation_p.R362G|ATP2C1_ENST00000428331.2_Missense_Mutation_p.R417G|ATP2C1_ENST00000505330.1_Missense_Mutation_p.R401G|ATP2C1_ENST00000508532.1_Missense_Mutation_p.R417G|ATP2C1_ENST00000328560.8_Missense_Mutation_p.R417G|ATP2C1_ENST00000359644.3_Missense_Mutation_p.R417G|ATP2C1_ENST00000507488.2_Missense_Mutation_p.R401G|ATP2C1_ENST00000504948.1_Missense_Mutation_p.R401G			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	417					actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TGCTGTAATTAGAAACAATAC	0.383									Hailey-Hailey disease																												p.R451G	Esophageal Squamous(99;456 1443 27647 34099 42636)	.											.	ATP2C1-91	0			c.A1351G						.						114.0	117.0	116.0					3																	130686204		2203	4300	6503	SO:0001583	missense	27032	exon15	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	GTAATTAGAAACA	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.1249A>G	3.37:g.130686204A>G	ENSP00000427461:p.Arg417Gly	Somatic	96	1		WXS	Illumina HiSeq	Phase_I	132	33	NM_001199181	0	0	30	36	6	B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Missense_Mutation	SNP	ENST00000510168.1	37	CCDS46914.1	.	.	.	.	.	.	.	.	.	.	A	12.80	2.047442	0.36085	.	.	ENSG00000017260	ENST00000505330;ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000510168;ENST00000508532;ENST00000504948;ENST00000513801;ENST00000328560;ENST00000428331;ENST00000359644;ENST00000422190;ENST00000347421	D;D;D;D;D;D;D;D;D;D;D;D;D	0.92965	-3.01;-3.06;-3.02;-3.02;-3.08;-3.01;-3.01;-3.01;-3.02;-3.14;-3.01;-3.02;-3.02	5.59	4.4	0.53042	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.046259	0.85682	D	0.000000	T	0.79644	0.4481	N	0.01686	-0.76	0.53688	D	0.999978	B;B;B;B;B;B;B	0.18013	0.02;0.025;0.007;0.02;0.007;0.007;0.009	B;B;B;B;B;B;B	0.18263	0.012;0.021;0.021;0.012;0.021;0.007;0.012	T	0.72940	-0.4139	10	0.39692	T	0.17	.	12.0367	0.53429	0.7275:0.2725:0.0:0.0	.	451;412;451;417;451;417;417	G3XAH8;B4DSW3;B4E2Q0;P98194-5;B7Z3X9;P98194-2;P98194	.;.;.;.;.;.;AT2C1_HUMAN	G	401;362;401;451;412;417;417;401;401;417;417;417;417;416	ENSP00000423774:R401G;ENSP00000425320:R362G;ENSP00000421326:R401G;ENSP00000376914:R451G;ENSP00000432956:R412G;ENSP00000427461:R417G;ENSP00000424783:R417G;ENSP00000423330:R401G;ENSP00000422872:R401G;ENSP00000329664:R417G;ENSP00000395809:R417G;ENSP00000352665:R417G;ENSP00000402677:R417G	ENSP00000329664:R417G	R	+	1	2	ATP2C1	132168894	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.143000	0.50608	0.919000	0.36945	0.477000	0.44152	AGA	.		0.383	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356648.2	NM_001001486	
DZIP1L	199221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	137805834	137805834	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:137805834A>G	ENST00000327532.2	-	7	1393	c.1031T>C	c.(1030-1032)cTg>cCg	p.L344P	DZIP1L_ENST00000488595.1_5'UTR|DZIP1L_ENST00000469243.1_Missense_Mutation_p.L344P	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	344					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						CTCTTCATGCAGTTCCTTCAC	0.423																																					p.L344P		.											.	DZIP1L-92	0			c.T1031C						.						227.0	199.0	209.0					3																	137805834		2203	4300	6503	SO:0001583	missense	199221	exon8			TCATGCAGTTCCT	AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.1031T>C	3.37:g.137805834A>G	ENSP00000332148:p.Leu344Pro	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	133	31	NM_001170538	0	0	0	0	0	C9JUG5|Q96M38	Missense_Mutation	SNP	ENST00000327532.2	37	CCDS3096.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.607713	0.28623	.	.	ENSG00000158163	ENST00000327532;ENST00000469243;ENST00000536706	T;T	0.50277	0.75;0.75	5.1	3.92	0.45320	.	0.353745	0.21368	N	0.075699	T	0.61788	0.2375	M	0.65975	2.015	0.44136	D	0.996925	D;D	0.89917	0.999;1.0	D;D	0.73380	0.974;0.98	T	0.58934	-0.7548	10	0.42905	T	0.14	-4.3459	8.3577	0.32340	0.8247:0.0:0.0:0.1753	.	344;344	Q8IYY4-2;Q8IYY4	.;DZI1L_HUMAN	P	344	ENSP00000332148:L344P;ENSP00000419486:L344P	ENSP00000332148:L344P	L	-	2	0	DZIP1L	139288524	0.829000	0.29322	0.156000	0.22583	0.039000	0.13416	4.330000	0.59266	0.859000	0.35456	-0.333000	0.08304	CTG	.		0.423	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357548.1	NM_173543	
EIF4G1	1981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	184041746	184041746	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:184041746T>C	ENST00000346169.2	+	16	2724	c.2453T>C	c.(2452-2454)aTg>aCg	p.M818T	SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000434061.2_Missense_Mutation_p.M623T|EIF4G1_ENST00000382330.3_Missense_Mutation_p.M825T|EIF4G1_ENST00000424196.1_Missense_Mutation_p.M825T|EIF4G1_ENST00000411531.1_Missense_Mutation_p.M779T|EIF4G1_ENST00000342981.4_Missense_Mutation_p.M819T|EIF4G1_ENST00000392537.2_Missense_Mutation_p.M731T|EIF4G1_ENST00000441154.1_Missense_Mutation_p.M655T|EIF4G1_ENST00000352767.3_Missense_Mutation_p.M825T|EIF4G1_ENST00000427845.1_Missense_Mutation_p.M732T|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000414031.1_Missense_Mutation_p.M778T|EIF4G1_ENST00000435046.2_Missense_Mutation_p.M622T|EIF4G1_ENST00000350481.5_Missense_Mutation_p.M654T|EIF4G1_ENST00000319274.6_Missense_Mutation_p.M818T	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	818	eIF3/EIF4A-binding.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TATGCCAACATGTGCCGCTGC	0.517																																					p.M825T		.											.	EIF4G1-344	0			c.T2474C						.						66.0	63.0	64.0					3																	184041746		2203	4300	6503	SO:0001583	missense	1981	exon17			CCAACATGTGCCG	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.2453T>C	3.37:g.184041746T>C	ENSP00000316879:p.Met818Thr	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	124	33	NM_001194946	0	0	26	40	14	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	T	18.37	3.609064	0.66558	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87;1.87	5.92	5.92	0.95590	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.038518	0.85682	D	0.000000	T	0.52517	0.1739	M	0.86805	2.84	0.80722	D	1	P;P;P;P	0.49862	0.929;0.929;0.929;0.929	P;P;P;P	0.56216	0.794;0.794;0.794;0.794	T	0.60692	-0.7213	10	0.87932	D	0	-18.7766	16.3634	0.83296	0.0:0.0:0.0:1.0	.	825;819;818;825	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	T	818;778;731;819;826;825;759;654;825;732;819;818;825;779;654;655;623;622	ENSP00000316879:M818T;ENSP00000391935:M778T;ENSP00000376320:M731T;ENSP00000391412:M819T;ENSP00000413159:M826T;ENSP00000371767:M825T;ENSP00000403269:M759T;ENSP00000317600:M654T;ENSP00000338020:M825T;ENSP00000407682:M732T;ENSP00000343450:M819T;ENSP00000323737:M818T;ENSP00000416255:M825T;ENSP00000395974:M779T;ENSP00000398145:M654T;ENSP00000399858:M655T;ENSP00000411826:M623T;ENSP00000404754:M622T	ENSP00000323737:M818T	M	+	2	0	EIF4G1	185524440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.270000	0.75569	0.459000	0.35465	ATG	.		0.517	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
HGFAC	3083	ucsc.edu	37	4	3444828	3444828	+	Missense_Mutation	SNP	G	G	A	rs554424799		TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr4:3444828G>A	ENST00000382774.3	+	3	465	c.350G>A	c.(349-351)cGc>cAc	p.R117H	HGFAC_ENST00000511533.1_Missense_Mutation_p.R117H	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	117	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TACGGGGGCCGCATGCTGCAT	0.721													G|||	1	0.000199681	0.0	0.0	5008	,	,		14389	0.001		0.0	False		,,,				2504	0.0				p.R117H													.	HGFAC-514	0			c.G350A						.						17.0	22.0	20.0					4																	3444828		2193	4289	6482	SO:0001583	missense	3083	exon3			GGGGCCGCATGCT	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.350G>A	4.37:g.3444828G>A	ENSP00000372224:p.Arg117His	Somatic	27	0		WXS	Illumina HiSeq		39	4	NM_001528	0	0	0	0	0	Q14726|Q2M1W7|Q53X47	Missense_Mutation	SNP	ENST00000382774.3	37	CCDS3369.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.313041	0.23908	.	.	ENSG00000109758	ENST00000382774;ENST00000511533	T;T	0.50548	0.74;0.74	3.16	2.17	0.27698	Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);	0.000000	0.64402	U	0.000005	T	0.36635	0.0974	L	0.52759	1.655	0.31138	N	0.706937	B;B	0.30973	0.302;0.139	B;B	0.29598	0.063;0.104	T	0.46925	-0.9156	10	0.59425	D	0.04	.	6.6572	0.22994	0.0:0.0:0.7172:0.2828	.	117;117	D6RAR4;Q04756	.;HGFA_HUMAN	H	117	ENSP00000372224:R117H;ENSP00000421801:R117H	ENSP00000372224:R117H	R	+	2	0	HGFAC	3414626	0.997000	0.39634	0.988000	0.46212	0.213000	0.24496	1.277000	0.33167	1.709000	0.51313	0.306000	0.20318	CGC	.		0.721	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
LAP3	51056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	17590497	17590497	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr4:17590497G>A	ENST00000226299.4	+	7	1034	c.760G>A	c.(760-762)Gga>Aga	p.G254R	LAP3_ENST00000606142.1_Missense_Mutation_p.G223R|AC006160.5_ENST00000511010.1_RNA|LAP3_ENST00000503467.1_3'UTR	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	254					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						TGTGGCCAAAGGATCTGACGA	0.453																																					p.G254R		.											.	LAP3-90	0			c.G760A						.						110.0	108.0	108.0					4																	17590497		2203	4300	6503	SO:0001583	missense	51056	exon7			GCCAAAGGATCTG	AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.760G>A	4.37:g.17590497G>A	ENSP00000226299:p.Gly254Arg	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	134	50	NM_015907	0	0	11	27	16	B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Missense_Mutation	SNP	ENST00000226299.4	37	CCDS3422.1	.	.	.	.	.	.	.	.	.	.	G	31	5.103254	0.94245	.	.	ENSG00000002549	ENST00000226299;ENST00000513105	T;T	0.58506	0.44;0.33	5.12	5.12	0.69794	Peptidase M17, leucyl aminopeptidase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87390	0.6165	H	0.99415	4.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93090	0.6499	10	0.87932	D	0	-22.9866	18.9237	0.92536	0.0:0.0:1.0:0.0	.	254	P28838	AMPL_HUMAN	R	254;88	ENSP00000226299:G254R;ENSP00000424724:G88R	ENSP00000226299:G254R	G	+	1	0	LAP3	17199595	1.000000	0.71417	0.994000	0.49952	0.922000	0.55478	9.673000	0.98631	2.534000	0.85438	0.557000	0.71058	GGA	.		0.453	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1		
TMEM156	80008	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	38990526	38990526	+	Silent	SNP	G	G	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr4:38990526G>T	ENST00000381938.3	-	4	791	c.684C>A	c.(682-684)atC>atA	p.I228I		NM_024943.1	NP_079219.1	Q8N614	TM156_HUMAN	transmembrane protein 156	228						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						TAGTGAGGATGATCAAAAATA	0.353																																					p.I228I		.											.	TMEM156-91	0			c.C684A						.						120.0	122.0	122.0					4																	38990526		2203	4300	6503	SO:0001819	synonymous_variant	80008	exon4			GAGGATGATCAAA	AK026888	CCDS3448.1	4p14	2008-02-05			ENSG00000121895	ENSG00000121895			26260	protein-coding gene	gene with protein product						12477932	Standard	NM_024943		Approved	FLJ23235	uc003gto.3	Q8N614	OTTHUMG00000128582	ENST00000381938.3:c.684C>A	4.37:g.38990526G>T		Somatic	160	1		WXS	Illumina HiSeq	Phase_I	121	31	NM_024943	0	0	0	0	0	Q9H5N9	Silent	SNP	ENST00000381938.3	37	CCDS3448.1																																																																																			.		0.353	TMEM156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250435.3	NM_024943	
PRKG2	5593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	82074809	82074809	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr4:82074809C>A	ENST00000395578.1	-	7	1095	c.979G>T	c.(979-981)Gca>Tca	p.A327S	PRKG2_ENST00000264399.1_Missense_Mutation_p.A327S|PRKG2_ENST00000509169.1_5'UTR|PRKG2_ENST00000545647.1_5'UTR|PRKG2_ENST00000418486.2_Missense_Mutation_p.A327S			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	327					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						TTTCCTTTTGCCAAAATGAAA	0.328																																					p.A327S		.											.	PRKG2-524	0			c.G979T						.						76.0	73.0	74.0					4																	82074809		2203	4300	6503	SO:0001583	missense	5593	exon6			CTTTTGCCAAAAT	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.979G>T	4.37:g.82074809C>A	ENSP00000378945:p.Ala327Ser	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	55	10	NM_006259	0	0	0	0	0	B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	C	6.115	0.389407	0.11581	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	D;D;D	0.92699	-3.09;-3.09;-3.09	6.08	6.08	0.98989	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.049240	0.85682	D	0.000000	D	0.84701	0.5530	L	0.28192	0.835	0.80722	D	1	B;B	0.10296	0.003;0.002	B;B	0.16289	0.015;0.01	T	0.77000	-0.2750	10	0.02654	T	1	-21.5253	14.3009	0.66352	0.1487:0.8513:0.0:0.0	.	327;327	E7EPE6;Q13237	.;KGP2_HUMAN	S	327	ENSP00000378945:A327S;ENSP00000264399:A327S;ENSP00000389038:A327S	ENSP00000264399:A327S	A	-	1	0	PRKG2	82293833	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.691000	0.61738	2.894000	0.99253	0.591000	0.81541	GCA	.		0.328	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
OSTC	58505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	109571838	109571838	+	Silent	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr4:109571838C>T	ENST00000361564.4	+	1	99	c.27C>T	c.(25-27)ttC>ttT	p.F9F	OSTC_ENST00000512478.2_Silent_p.F9F|OSTC_ENST00000505745.1_3'UTR|RNU6-431P_ENST00000383874.1_RNA	NM_021227.3	NP_067050.1	Q9NRP0	OSTC_HUMAN	oligosaccharyltransferase complex subunit (non-catalytic)	9			F -> L (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|oligosaccharyltransferase complex (GO:0008250)		p.F9L(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)	6						GTGTCCCGTTCTTAGTGCTCG	0.597																																					p.F9F		.											.	OSTC-131	1	Substitution - Missense(1)	breast(1)	c.C27T						.						74.0	73.0	74.0					4																	109571838		2203	4300	6503	SO:0001819	synonymous_variant	58505	exon1			CCCGTTCTTAGTG	AF201937	CCDS3681.1, CCDS58921.1, CCDS75177.1	4q25	2013-03-06	2013-03-06		ENSG00000198856	ENSG00000198856			24448	protein-coding gene	gene with protein product	"""DC2 protein"""		"""oligosaccharyltransferase complex subunit"""			15835887	Standard	NM_021227		Approved	DC2	uc031sgt.1	Q9NRP0	OTTHUMG00000161031	ENST00000361564.4:c.27C>T	4.37:g.109571838C>T		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	131	42	NM_001267818	0	0	27	37	10	A8MYS2|B2R5H1|D6RH22|Q9P075|Q9P1R4	Silent	SNP	ENST00000361564.4	37	CCDS3681.1																																																																																			.		0.597	OSTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363485.1	NM_021227	
NDUFS6	4726	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	1801592	1801592	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr5:1801592C>A	ENST00000274137.5	+	1	79	c.61C>A	c.(61-63)Ctg>Atg	p.L21M	NDUFS6_ENST00000510329.1_3'UTR|MRPL36_ENST00000505059.2_5'Flank|MRPL36_ENST00000505818.1_5'Flank|MRPL36_ENST00000508987.1_5'Flank|NDUFS6_ENST00000469176.1_Missense_Mutation_p.L21M|MRPL36_ENST00000382647.7_5'Flank	NM_004553.4	NP_004544.1	O75380	NDUS6_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)	21					cardiovascular system development (GO:0072358)|cellular metabolic process (GO:0044237)|fatty acid metabolic process (GO:0006631)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrion morphogenesis (GO:0070584)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|muscle contraction (GO:0006936)|reproductive system development (GO:0061458)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	7						GGCGCGGAGCCTGCCCCTGGG	0.701																																					p.L21M		.											.	NDUFS6-226	0			c.C61A						.						13.0	16.0	15.0					5																	1801592		2169	4256	6425	SO:0001583	missense	4726	exon1			CGGAGCCTGCCCC	BC038664	CCDS3866.1	5p15.33	2011-07-04	2002-08-29		ENSG00000145494	ENSG00000145494	1.6.99.3, 1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7713	protein-coding gene	gene with protein product	"""complex I 13kDa subunit A"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 6, mitochondrial"""	603848	"""NADH dehydrogenase (ubiquinone) Fe-S protein 6 (13kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004553		Approved	CI-13kA	uc003jcy.3	O75380	OTTHUMG00000090372	ENST00000274137.5:c.61C>A	5.37:g.1801592C>A	ENSP00000274137:p.Leu21Met	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	44	21	NM_004553	0	0	21	37	16		Missense_Mutation	SNP	ENST00000274137.5	37	CCDS3866.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.733559	0.30684	.	.	ENSG00000145494	ENST00000274137;ENST00000469176	T	0.77750	-1.12	4.23	0.315	0.15852	.	1.107710	0.06942	N	0.813089	T	0.72676	0.3490	M	0.75447	2.3	0.09310	N	1	P	0.34837	0.472	B	0.33295	0.161	T	0.57676	-0.7770	10	0.33940	T	0.23	-2.3227	3.9905	0.09535	0.0:0.3596:0.377:0.2635	.	21	O75380	NDUS6_HUMAN	M	21	ENSP00000274137:L21M	ENSP00000274137:L21M	L	+	1	2	NDUFS6	1854592	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.256000	0.18351	0.156000	0.19299	-0.171000	0.13296	CTG	.		0.701	NDUFS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206744.2	NM_004553	
JAKMIP2	9832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	147010974	147010974	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr5:147010974A>G	ENST00000265272.5	-	14	2343		c.e14+1		JAKMIP2_ENST00000507386.1_Splice_Site|JAKMIP2_ENST00000333010.6_Splice_Site	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2							Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATATCTGCCTACCTTAACACC	0.388																																					.		.											.	JAKMIP2-154	0			c.1812+2T>C						.						83.0	77.0	79.0					5																	147010974		2203	4300	6503	SO:0001630	splice_region_variant	9832	exon14			CTGCCTACCTTAA	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.1875+1T>C	5.37:g.147010974A>G		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	53	13	NM_001270934	0	0	0	0	0	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Splice_Site	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293161	0.80914	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2698	0.66145	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	JAKMIP2	146991167	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.337000	0.90036	1.904000	0.55121	0.533000	0.62120	.	.		0.388	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	Intron
C6orf195	154386	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	2623684	2623684	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr6:2623684C>A	ENST00000296847.3	-	3	896	c.373G>T	c.(373-375)Gaa>Taa	p.E125*		NM_152554.2	NP_689767.2	Q96MT4	CF195_HUMAN	chromosome 6 open reading frame 195	125										cervix(1)|endometrium(1)|lung(2)|skin(1)	5	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				CAGAAAGCTTCATTGCTAATC	0.493																																					p.E125X		.											.	C6orf195-90	0			c.G373T						.						65.0	67.0	67.0					6																	2623684		1977	4166	6143	SO:0001587	stop_gained	154386	exon3			AAGCTTCATTGCT	AK056496	CCDS43416.1	6p25.2	2008-10-21			ENSG00000164385	ENSG00000164385			21600	protein-coding gene	gene with protein product							Standard	NM_152554		Approved	FLJ31934, bA145H9.2	uc003mtw.2	Q96MT4	OTTHUMG00000014122	ENST00000296847.3:c.373G>T	6.37:g.2623684C>A	ENSP00000296847:p.Glu125*	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	75	27	NM_152554	0	0	0	0	0	Q3SY08|Q3SY09|Q3SY10|Q5TAW4	Nonsense_Mutation	SNP	ENST00000296847.3	37	CCDS43416.1	.	.	.	.	.	.	.	.	.	.	C	36	5.801906	0.96960	.	.	ENSG00000164385	ENST00000296847	.	.	.	4.52	0.877	0.19145	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.3228	0.07056	0.192:0.5359:0.0:0.2721	.	.	.	.	X	125	.	ENSP00000296847:E125X	E	-	1	0	C6orf195	2568683	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	0.349000	0.20055	0.064000	0.16427	-0.136000	0.14681	GAA	.		0.493	C6orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039633.1	NM_152554	
C6orf223	221416	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	43970795	43970795	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr6:43970795C>T	ENST00000336600.5	+	4	681	c.661C>T	c.(661-663)Cgc>Tgc	p.R221C	C6orf223_ENST00000448947.2_3'UTR|RP5-1120P11.1_ENST00000607590.1_RNA|RP5-1120P11.1_ENST00000422059.1_RNA|C6orf223_ENST00000439969.2_3'UTR|C6orf223_ENST00000442114.2_Missense_Mutation_p.R201C	NM_001171992.1|NM_153246.4	NP_001165463.1|NP_694978.2	Q8N319	CF223_HUMAN	chromosome 6 open reading frame 223	221										central_nervous_system(1)|lung(2)|pancreas(1)|prostate(1)|urinary_tract(1)	6	all_cancers(18;2.28e-07)|all_epithelial(2;1.62e-08)|Lung NSC(15;0.000172)|all_lung(25;0.000533)|Hepatocellular(11;0.00309)|Ovarian(13;0.0437)		all cancers(41;0.00141)|Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.217)			ACGGCTAATGCGCTCTAATTA	0.637																																					p.R221C		.											.	C6orf223-68	0			c.C661T						.						25.0	31.0	29.0					6																	43970795		2202	4295	6497	SO:0001583	missense	221416	exon4			CTAATGCGCTCTA	BC032706	CCDS34459.1, CCDS55016.1	6p21.1	2012-09-05			ENSG00000181577	ENSG00000181577			28692	protein-coding gene	gene with protein product						12477932	Standard	NM_153246		Approved	MGC45491	uc003own.3	Q8N319	OTTHUMG00000014753	ENST00000336600.5:c.661C>T	6.37:g.43970795C>T	ENSP00000426159:p.Arg221Cys	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	88	37	NM_153246	0	0	0	0	0	E9PB59|Q8N575	Missense_Mutation	SNP	ENST00000336600.5	37	CCDS34459.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.973119	0.34848	.	.	ENSG00000181577	ENST00000336600	T	0.40756	1.02	3.26	2.39	0.29439	.	0.205916	0.24638	N	0.036836	T	0.08133	0.0203	N	0.08118	0	0.80722	D	1	P	0.36599	0.56	B	0.27262	0.078	T	0.08722	-1.0708	10	0.87932	D	0	.	6.5098	0.22216	0.0:0.865:0.0:0.135	.	221	Q8N319	CF223_HUMAN	C	221	ENSP00000426159:R221C	ENSP00000426159:R221C	R	+	1	0	C6orf223	44078773	0.337000	0.24766	1.000000	0.80357	0.994000	0.84299	0.280000	0.18790	0.963000	0.38082	0.491000	0.48974	CGC	.		0.637	C6orf223-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040702.3	NM_153246	
RUNX2	860	hgsc.bcm.edu	37	6	45390466	45390466	+	Silent	SNP	A	A	G	rs575896136	byFrequency	TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr6:45390466A>G	ENST00000371438.1	+	2	553	c.195A>G	c.(193-195)caA>caG	p.Q65Q	RUNX2_ENST00000541979.1_Silent_p.Q133Q|RUNX2_ENST00000465038.2_Silent_p.Q65Q|RUNX2_ENST00000352853.5_Silent_p.Q133Q|RUNX2_ENST00000371436.6_Silent_p.Q65Q|RUNX2_ENST00000371432.3_Silent_p.Q51Q|RUNX2_ENST00000359524.5_Silent_p.Q51Q|RUNX2_ENST00000576263.1_Silent_p.Q65Q|RP1-244F24.1_ENST00000606796.1_RNA	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	65	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcaacagcagcagc	0.731													A|||	8	0.00159744	0.0023	0.0	5008	,	,		7675	0.002		0.0	False		,,,				2504	0.0031				p.Q65Q		.											.	RUNX2-417	0			c.A195G						.						10.0	15.0	14.0					6																	45390466		1452	3071	4523	SO:0001819	synonymous_variant	860	exon3			GCAGCAACAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.195A>G	6.37:g.45390466A>G		Somatic	43	0		WXS	Illumina HiSeq	Phase_I	67	4	NM_001024630	0	0	33	2812	2779	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	37	CCDS43467.2																																																																																			.		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
KIAA1919	91749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	111587895	111587895	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr6:111587895A>T	ENST00000368847.4	+	4	1483	c.1130A>T	c.(1129-1131)cAa>cTa	p.Q377L		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	377					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		GGAATTCTTCAAGGAAAATAC	0.403																																					p.Q377L		.											.	KIAA1919-93	0			c.A1130T						.						111.0	115.0	114.0					6																	111587895		2203	4300	6503	SO:0001583	missense	91749	exon4			TTCTTCAAGGAAA	BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.1130A>T	6.37:g.111587895A>T	ENSP00000357840:p.Gln377Leu	Somatic	205	0		WXS	Illumina HiSeq	Phase_I	220	67	NM_153369	0	0	0	1	1	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	ENST00000368847.4	37	CCDS5090.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.496996	0.01001	.	.	ENSG00000173214	ENST00000368847	T	0.78481	-1.18	5.92	5.92	0.95590	Major facilitator superfamily domain, general substrate transporter (1);	0.239924	0.43110	D	0.000612	T	0.54367	0.1854	L	0.49640	1.575	0.36102	D	0.844223	B	0.28378	0.209	B	0.25987	0.065	T	0.57522	-0.7797	10	0.02654	T	1	-15.1619	16.3615	0.83270	1.0:0.0:0.0:0.0	.	377	Q5TF39	NAGT1_HUMAN	L	377	ENSP00000357840:Q377L	ENSP00000357840:Q377L	Q	+	2	0	KIAA1919	111694588	0.984000	0.35163	0.981000	0.43875	0.149000	0.21700	3.380000	0.52448	2.264000	0.75181	0.450000	0.29827	CAA	.		0.403	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041827.1	NM_153369	
MLLT4	4301	ucsc.edu;bcgsc.ca	37	6	168276027	168276027	+	Silent	SNP	A	A	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr6:168276027A>C	ENST00000447894.2	+	5	591	c.591A>C	c.(589-591)cgA>cgC	p.R197R	MLLT4_ENST00000392108.3_Silent_p.R197R|MLLT4_ENST00000366806.2_Silent_p.R197R|MLLT4_ENST00000351017.4_Silent_p.R197R|MLLT4_ENST00000392112.1_Silent_p.R196R|MLLT4_ENST00000400822.3_Silent_p.R196R|MLLT4_ENST00000344191.4_Silent_p.R197R			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	197					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AAAATTCTCGACTGGCTGCTG	0.368			T	MLL	AL																																p.R197R				Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4-685	0			c.A591C						.						111.0	123.0	119.0					6																	168276027		2203	4295	6498	SO:0001819	synonymous_variant	4301	exon5			TTCTCGACTGGCT	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.591A>C	6.37:g.168276027A>C		Somatic	259	2		WXS	Illumina HiSeq		275	87	NM_001040000	0	0	0	0	0	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Silent	SNP	ENST00000447894.2	37																																																																																				.		0.368	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
THBS2	7058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	169622311	169622311	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr6:169622311G>T	ENST00000366787.3	-	20	3503	c.3254C>A	c.(3253-3255)aCg>aAg	p.T1085K	THBS2_ENST00000488355.1_5'UTR|XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	1085	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.T1085M(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CGTGTTCCCCGTGTGCCACAG	0.662																																					p.T1085K	Esophageal Squamous(91;219 1934 18562 44706)	.											.	THBS2-95	1	Substitution - Missense(1)	endometrium(1)	c.C3254A						.						58.0	58.0	58.0					6																	169622311		2203	4300	6503	SO:0001583	missense	7058	exon20			TTCCCCGTGTGCC		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.3254C>A	6.37:g.169622311G>T	ENSP00000355751:p.Thr1085Lys	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	102	25	NM_003247	0	0	23	33	10	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290586	0.59976	.	.	ENSG00000186340	ENST00000366787;ENST00000392099	D	0.91996	-2.95	4.21	4.21	0.49690	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.42172	U	0.000748	D	0.94453	0.8215	M	0.66939	2.045	0.58432	D	0.999992	D	0.89917	1.0	D	0.72075	0.976	D	0.95110	0.8237	10	0.66056	D	0.02	-24.5393	16.5686	0.84605	0.0:0.0:1.0:0.0	.	1085	P35442	TSP2_HUMAN	K	1085;343	ENSP00000355751:T1085K	ENSP00000355751:T1085K	T	-	2	0	THBS2	169364236	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	9.166000	0.94766	1.887000	0.54652	0.297000	0.19635	ACG	.		0.662	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
CCM2	83605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	45104062	45104062	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr7:45104062A>G	ENST00000258781.6	+	4	438	c.289A>G	c.(289-291)Aga>Gga	p.R97G	CCM2_ENST00000381112.3_Splice_Site_p.R118G|CCM2_ENST00000461377.1_3'UTR|CCM2_ENST00000474617.1_Splice_Site_p.R91G|CCM2_ENST00000475551.1_Splice_Site_p.R91G|CCM2_ENST00000541586.1_Splice_Site_p.R39G|CCM2_ENST00000544363.1_Splice_Site_p.R97G	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2	97	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						TTCCTTCCAGAGAGCCCACCA	0.567																																					p.R118G		.											.	CCM2-90	0			c.A352G						.						43.0	37.0	39.0					7																	45104062		2203	4300	6503	SO:0001630	splice_region_variant	83605	exon4			TTCCAGAGAGCCC	BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.289-1A>G	7.37:g.45104062A>G		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	75	11	NM_001029835	0	0	0	0	0	A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Missense_Mutation	SNP	ENST00000258781.6	37	CCDS5500.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.058731	0.55325	.	.	ENSG00000136280	ENST00000258781;ENST00000541586;ENST00000544363;ENST00000475551;ENST00000381112;ENST00000474617	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.32	4.24	0.50183	Phosphotyrosine interaction domain (1);	0.051158	0.85682	D	0.000000	T	0.55130	0.1901	M	0.67953	2.075	0.48901	D	0.999727	B;P;P;P;P;P	0.49559	0.118;0.923;0.925;0.873;0.617;0.873	B;P;P;B;B;P	0.52159	0.075;0.578;0.691;0.385;0.173;0.461	T	0.54476	-0.8288	9	.	.	.	-18.4128	10.5848	0.45275	0.7713:0.2287:0.0:0.0	.	90;60;118;97;39;97	B7Z5A6;B7Z8D5;E9PDJ3;F5H0E1;F5H551;Q9BSQ5	.;.;.;.;.;CCM2_HUMAN	G	97;39;97;91;118;91	ENSP00000258781:R97G;ENSP00000444725:R39G;ENSP00000438035:R97G;ENSP00000417180:R91G;ENSP00000370503:R118G;ENSP00000419474:R91G	.	R	+	1	2	CCM2	45070587	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.295000	0.51794	0.976000	0.38417	0.533000	0.62120	AGA	.		0.567	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251348.1	NM_031443	Missense_Mutation
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	82532016	82532016	+	Silent	SNP	A	A	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr7:82532016A>G	ENST00000333891.9	-	9	13816	c.13479T>C	c.(13477-13479)ccT>ccC	p.P4493P	PCLO_ENST00000423517.2_Silent_p.P4493P	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCCTTGCGTGAGGAAAGATGT	0.299																																					p.P4493P		.											.	PCLO-29	0			c.T13479C						.						198.0	180.0	186.0					7																	82532016		1833	4089	5922	SO:0001819	synonymous_variant	27445	exon9			TGCGTGAGGAAAG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13479T>C	7.37:g.82532016A>G		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	111	63	NM_014510	0	0	0	0	0		Silent	SNP	ENST00000333891.9	37	CCDS47630.1																																																																																			.		0.299	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
AGFG2	3268	hgsc.bcm.edu;broad.mit.edu	37	7	100160553	100160553	+	Silent	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr7:100160553C>T	ENST00000300176.4	+	9	1277	c.1155C>T	c.(1153-1155)ccC>ccT	p.P385P	AGFG2_ENST00000474713.1_Intron|AGFG2_ENST00000262935.4_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	385	Pro-rich.				regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CGTTCCAGCCCAATGGCTTGG	0.602																																					p.P385P		.											.	AGFG2-90	0			c.C1155T						.						70.0	59.0	63.0					7																	100160553		2203	4300	6503	SO:0001819	synonymous_variant	3268	exon9			CCAGCCCAATGGC	AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.1155C>T	7.37:g.100160553C>T		Somatic	27	0		WXS	Illumina HiSeq	Phase_I	36	7	NM_006076	0	0	12	17	5	O75429|Q96AB9|Q96GL4	Silent	SNP	ENST00000300176.4	37	CCDS5697.1	.	.	.	.	.	.	.	.	.	.	C	9.342	1.063180	0.19987	.	.	ENSG00000106351	ENST00000429987	T	0.47869	0.83	4.67	4.67	0.58626	.	0.466449	0.22090	N	0.064764	T	0.55986	0.1955	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52749	-0.8534	6	.	.	.	-18.2459	13.1309	0.59382	0.0:1.0:0.0:0.0	.	.	.	.	L	127	ENSP00000388594:P127L	.	P	+	2	0	AGFG2	99998489	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	1.481000	0.35476	2.469000	0.83416	0.549000	0.68633	CCA	.		0.602	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342769.1	NM_006076	
CHCHD3	54927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	132523165	132523165	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr7:132523165T>G	ENST00000262570.5	-	6	662	c.518A>C	c.(517-519)aAg>aCg	p.K173T	CHCHD3_ENST00000476546.1_5'UTR|AC009518.8_ENST00000453078.1_RNA|CHCHD3_ENST00000448878.1_Missense_Mutation_p.K178T	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3	173					inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						TTACTTGAACTTTGCTTCCAC	0.333																																					p.K173T		.											.	CHCHD3-90	0			c.A518C						.						73.0	73.0	73.0					7																	132523165		2203	4300	6503	SO:0001583	missense	54927	exon6			TTGAACTTTGCTT	BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231	ENST00000262570.5:c.518A>C	7.37:g.132523165T>G	ENSP00000262570:p.Lys173Thr	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	75	39	NM_017812	0	0	0	0	0		Missense_Mutation	SNP	ENST00000262570.5	37	CCDS5828.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.346334	0.61073	.	.	ENSG00000106554	ENST00000262570;ENST00000448878	T;T	0.45668	0.89;0.89	5.97	5.97	0.96955	.	0.165073	0.51477	D	0.000084	T	0.48390	0.1497	L	0.33137	0.985	0.80722	D	1	D;B	0.76494	0.999;0.294	D;B	0.72982	0.979;0.21	T	0.44065	-0.9352	10	0.30078	T	0.28	-29.5969	8.416	0.32672	0.0:0.1479:0.0:0.8521	.	178;173	C9JRZ6;Q9NX63	.;CHCH3_HUMAN	T	173;178	ENSP00000262570:K173T;ENSP00000389297:K178T	ENSP00000262570:K173T	K	-	2	0	CHCHD3	132173705	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.637000	0.46553	2.288000	0.76882	0.533000	0.62120	AAG	.		0.333	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338899.1	NM_017812	
TRPV6	55503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	142569741	142569741	+	Splice_Site	SNP	C	C	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr7:142569741C>A	ENST00000359396.3	-	15	2142	c.1897G>T	c.(1897-1899)Gtg>Ttg	p.V633L		NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	633					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CTGTCTTCCACCCTGTGGAAT	0.557																																					p.V633L		.											.	TRPV6-92	0			c.G1897T						.						99.0	90.0	93.0					7																	142569741		2203	4300	6503	SO:0001630	splice_region_variant	55503	exon15			CTTCCACCCTGTG	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1896-1G>T	7.37:g.142569741C>A		Somatic	114	1		WXS	Illumina HiSeq	Phase_I	145	30	NM_018646	0	0	0	0	0	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	ENST00000359396.3	37	CCDS5874.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513934	0.64522	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	T	0.80304	-1.36	5.55	5.55	0.83447	.	0.067016	0.64402	D	0.000013	T	0.82121	0.4968	M	0.81942	2.565	0.49582	D	0.999807	P	0.40431	0.717	B	0.42827	0.399	T	0.81455	-0.0925	10	0.35671	T	0.21	-16.8766	11.8306	0.52293	0.0:0.9113:0.0:0.0887	.	633	Q9H1D0	TRPV6_HUMAN	L	633;465	ENSP00000352358:V633L	ENSP00000310825:V465L	V	-	1	0	TRPV6	142279863	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	2.661000	0.46758	2.622000	0.88805	0.561000	0.74099	GTG	.		0.557	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347662.1	NM_014274	Missense_Mutation
NUB1	51667	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	151064971	151064971	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr7:151064971C>A	ENST00000355851.4	+	10	1089	c.1012C>A	c.(1012-1014)Ctg>Atg	p.L338M	NUB1_ENST00000566856.1_Missense_Mutation_p.L338M|NUB1_ENST00000568733.1_Missense_Mutation_p.L362M|NUB1_ENST00000413040.2_Missense_Mutation_p.L362M	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1	338					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AGAGAAGGTACTGTTTCTAAG	0.323											OREG0018452	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L362M													.	NUB1-226	0			c.C1084A						.						64.0	59.0	61.0					7																	151064971		1821	4091	5912	SO:0001583	missense	51667	exon10			AAGGTACTGTTTC	AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.1012C>A	7.37:g.151064971C>A	ENSP00000348110:p.Leu338Met	Somatic	26	0	1737	WXS	Illumina HiSeq	Phase_I	25	6	NM_016118	0	0	15	19	4	O95422|Q75MR9|Q8IX22|Q9BXR2	Missense_Mutation	SNP	ENST00000355851.4	37		.	.	.	.	.	.	.	.	.	.	C	12.24	1.879981	0.33162	.	.	ENSG00000013374	ENST00000413040;ENST00000355851	T	0.65178	-0.14	5.63	-2.94	0.05581	.	0.000000	0.64402	D	0.000002	T	0.76695	0.4023	M	0.83312	2.635	0.45035	D	0.998055	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.79045	-0.1964	10	0.87932	D	0	-17.937	14.0566	0.64774	0.0:0.6335:0.0:0.3665	.	338;338	Q9Y5A7;Q9Y5A7-2	NUB1_HUMAN;.	M	338	ENSP00000348110:L338M	ENSP00000348110:L338M	L	+	1	2	NUB1	150695904	0.146000	0.22672	0.438000	0.26821	0.058000	0.15608	0.185000	0.16958	-0.450000	0.07107	-0.345000	0.07892	CTG	.		0.323	NUB1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_016118	
KCNV1	27012	hgsc.bcm.edu	37	8	110986410	110986410	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr8:110986410C>A	ENST00000524391.1	-	2	1240	c.208G>T	c.(208-210)Gtg>Ttg	p.V70L	RP11-696P8.2_ENST00000530667.1_RNA|KCNV1_ENST00000297404.1_Missense_Mutation_p.V70L			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	70					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			GCCACCACCACGGCCAGCTTG	0.692																																					p.V70L		.											.	KCNV1-226	0			c.G208T						.						14.0	13.0	13.0					8																	110986410		2190	4286	6476	SO:0001583	missense	27012	exon1			CCACCACGGCCAG	AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.208G>T	8.37:g.110986410C>A	ENSP00000435954:p.Val70Leu	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	15	8	NM_014379	0	0	0	1	1	Q9UHJ4	Missense_Mutation	SNP	ENST00000524391.1	37	CCDS6314.1	.	.	.	.	.	.	.	.	.	.	C	9.543	1.113775	0.20795	.	.	ENSG00000164794	ENST00000524391;ENST00000297404	T;T	0.76448	-1.02;-1.02	4.95	4.07	0.47477	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.406801	0.24251	N	0.040174	T	0.56659	0.2000	N	0.02225	-0.63	0.33369	D	0.573278	B	0.26195	0.144	B	0.30646	0.118	T	0.64816	-0.6318	10	0.45353	T	0.12	.	12.8935	0.58084	0.0:0.8369:0.1631:0.0	.	70	Q6PIU1	KCNV1_HUMAN	L	70	ENSP00000435954:V70L;ENSP00000297404:V70L	ENSP00000297404:V70L	V	-	1	0	KCNV1	111055586	0.764000	0.28473	0.999000	0.59377	0.995000	0.86356	1.510000	0.35790	1.285000	0.44548	0.655000	0.94253	GTG	.		0.692	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385525.1	NM_014379	
ASTN2	23245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	119202962	119202962	+	Silent	SNP	G	G	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr9:119202962G>T	ENST00000313400.4	-	22	3808	c.3708C>A	c.(3706-3708)gtC>gtA	p.V1236V	ASTN2_ENST00000288520.5_Silent_p.V337V|ASTN2_ENST00000341734.4_Silent_p.V288V|ASTN2_ENST00000361209.2_Silent_p.V1185V|ASTN2_ENST00000361477.3_Silent_p.V288V|ASTN2_ENST00000373996.3_Silent_p.V1232V			O75129	ASTN2_HUMAN	astrotactin 2	1236					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						AGTGGTGCTGGACTCGGAACA	0.502																																					p.V1185V		.											.	ASTN2-161	0			c.C3555A						.						169.0	135.0	147.0					9																	119202962		2203	4300	6503	SO:0001819	synonymous_variant	23245	exon21			GTGCTGGACTCGG	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3708C>A	9.37:g.119202962G>T		Somatic	121	1		WXS	Illumina HiSeq	Phase_I	133	50	NM_014010	0	0	4	5	1	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	G	9.467	1.094720	0.20471	.	.	ENSG00000148219	ENST00000417725	.	.	.	5.91	0.931	0.19460	.	.	.	.	.	T	0.50582	0.1624	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33394	-0.9870	4	.	.	.	-31.4992	4.5533	0.12124	0.2258:0.0983:0.5759:0.0999	.	.	.	.	Y	18	.	.	S	-	2	0	ASTN2	118242783	0.999000	0.42202	0.996000	0.52242	0.985000	0.73830	0.491000	0.22419	-0.072000	0.12864	-0.795000	0.03280	TCC	.		0.502	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
PTRH1	138428	ucsc.edu	37	9	130476385	130476385	+	Silent	SNP	C	C	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr9:130476385C>T	ENST00000419060.1	-	6	2095	c.639G>A	c.(637-639)ggG>ggA	p.G213G	TTC16_ENST00000373289.3_5'Flank|C9orf117_ENST00000464092.1_3'UTR|TTC16_ENST00000393748.4_5'Flank|C9orf117_ENST00000373293.5_Intron|PTRH1_ENST00000423807.1_3'UTR|PTRH1_ENST00000543175.1_Silent_p.G213G|PTRH1_ENST00000429848.1_5'Flank			Q86Y79	PTH_HUMAN	peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)	213						mitochondrion (GO:0005739)	aminoacyl-tRNA hydrolase activity (GO:0004045)|poly(A) RNA binding (GO:0044822)			NS(1)	1						AGTGTCACGGCCCCAGTGAGG	0.612																																					p.G213G													.	PTRH1-90	0			c.G639A						.						28.0	28.0	28.0					9																	130476385		2202	4299	6501	SO:0001819	synonymous_variant	138428	exon5			TCACGGCCCCAGT	AK090922	CCDS35147.1	9q34.11	2006-02-13	2006-02-13	2006-02-13	ENSG00000187024	ENSG00000187024			27039	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 115"""	C9orf115			Standard	NM_001002913		Approved	PTH1	uc004bro.3	Q86Y79	OTTHUMG00000020710	ENST00000419060.1:c.639G>A	9.37:g.130476385C>T		Somatic	29	0		WXS	Illumina HiSeq		21	1	NM_001002913	0	0	11	16	5		Silent	SNP	ENST00000419060.1	37	CCDS35147.1																																																																																			.		0.612	PTRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054219.4	NM_001002913	
GOLGA2	2801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131028577	131028577	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr9:131028577G>A	ENST00000421699.2	-	8	601	c.589C>T	c.(589-591)Cag>Tag	p.Q197*	GOLGA2_ENST00000609374.1_Nonsense_Mutation_p.Q185*	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	197					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						TCTTCCAACTGATCCGTAATT	0.498																																					p.Q197X		.											.	GOLGA2-91	0			c.C589T						.						133.0	126.0	128.0					9																	131028577		2203	4300	6503	SO:0001587	stop_gained	2801	exon8			CCAACTGATCCGT	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.589C>T	9.37:g.131028577G>A	ENSP00000416097:p.Gln197*	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	107	39	NM_004486	0	0	0	0	0	Q6GRM9|Q9BRB0|Q9NYF9	Nonsense_Mutation	SNP	ENST00000421699.2	37	CCDS6896.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	18.14|18.14	3.556608|3.556608	0.65425|0.65425	.|.	.|.	ENSG00000167110|ENSG00000167110	ENST00000421699;ENST00000450617|ENST00000458730	.|.	.|.	.|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.76227	.|0.3958	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74842	.|-0.3527	.|3	0.45353|.	T|.	0.12|.	.|.	19.4623|19.4623	0.94922|0.94922	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	197;224|129	.|.	ENSP00000416097:Q197X|.	Q|S	-|-	1|2	0|0	GOLGA2|GOLGA2	130068398|130068398	1.000000|1.000000	0.71417|0.71417	0.612000|0.612000	0.29024|0.29024	0.034000|0.034000	0.12701|0.12701	6.353000|6.353000	0.73032|0.73032	2.663000|2.663000	0.90544|0.90544	0.558000|0.558000	0.71614|0.71614	CAG|TCA	.		0.498	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486	
UBAC1	10422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	138839743	138839743	+	Silent	SNP	T	T	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr9:138839743T>C	ENST00000371756.3	-	4	559	c.342A>G	c.(340-342)caA>caG	p.Q114Q	UBAC1_ENST00000465873.1_5'Flank	NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	114					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		CTTTCTGGTCTTGTTTTTTCT	0.517																																					p.Q114Q	NSCLC(78;973 1398 27381 29552 42415)	.											.	UBAC1-92	0			c.A342G						.						82.0	81.0	81.0					9																	138839743		2203	4300	6503	SO:0001819	synonymous_variant	10422	exon4			CTGGTCTTGTTTT	AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.342A>G	9.37:g.138839743T>C		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	34	15	NM_016172	0	0	0	0	0	O75500|Q9UMW7	Silent	SNP	ENST00000371756.3	37	CCDS35177.1																																																																																			.		0.517	UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055034.1	NM_016172	
NOTCH1	4851	ucsc.edu	37	9	139418248	139418248	+	Silent	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr9:139418248G>A	ENST00000277541.6	-	3	399	c.324C>T	c.(322-324)acC>acT	p.T108T	NOTCH1_ENST00000491649.1_5'UTR	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	108	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GGCAGGGGTTGGTGAGGCAGG	0.682			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.T108T				Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.C324T						.						18.0	30.0	26.0					9																	139418248		2137	4242	6379	SO:0001819	synonymous_variant	4851	exon3			GGGGTTGGTGAGG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.324C>T	9.37:g.139418248G>A		Somatic	38	0		WXS	Illumina HiSeq		42	4	NM_017617	0	0	0	0	0	Q59ED8|Q5SXM3	Silent	SNP	ENST00000277541.6	37	CCDS43905.1																																																																																			.		0.682	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
GLUD2	2747	ucsc.edu	37	X	120182805	120182805	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chrX:120182805T>A	ENST00000328078.1	+	1	1344	c.1267T>A	c.(1267-1269)Ttg>Atg	p.L423M		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	423					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						GAGAAACATTTTGGTTATTCC	0.443																																					p.L423M													.	GLUD2-131	0			c.T1267A						.						176.0	165.0	169.0					X																	120182805		2203	4300	6503	SO:0001583	missense	2747	exon1			AACATTTTGGTTA	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1267T>A	X.37:g.120182805T>A	ENSP00000327589:p.Leu423Met	Somatic	121	0		WXS	Illumina HiSeq		124	2	NM_012084	0	0	0	79	79	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	T	0.044	-1.271952	0.01421	.	.	ENSG00000182890	ENST00000328078	D	0.95885	-3.84	1.61	-3.22	0.05125	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.075950	0.85682	N	0.000000	D	0.93271	0.7856	M	0.80183	2.485	0.24288	N	0.995174	B	0.31893	0.345	B	0.42653	0.394	D	0.84648	0.0699	10	0.25751	T	0.34	.	0.3029	0.00275	0.3391:0.1736:0.1374:0.3499	.	423	P49448	DHE4_HUMAN	M	423	ENSP00000327589:L423M	ENSP00000327589:L423M	L	+	1	2	GLUD2	120010486	1.000000	0.71417	0.003000	0.11579	0.167000	0.22549	0.715000	0.25822	-1.738000	0.01348	-1.616000	0.00795	TTG	.		0.443	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
RPL10	6134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	153627911	153627911	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chrX:153627911G>A	ENST00000369817.2	+	5	742	c.166G>A	c.(166-168)Gaa>Aaa	p.E56K	SNORA70_ENST00000384436.1_RNA|RPL10_ENST00000406022.2_Missense_Mutation_p.E5K|RPL10_ENST00000424325.2_Missense_Mutation_p.E56K			P27635	RL10_HUMAN	ribosomal protein L10	56					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGTGTCAGATGAATATGAGCA	0.507																																					p.E56K		.											.	RPL10-130	0			c.G166A						.						112.0	110.0	111.0					X																	153627911		2203	4300	6503	SO:0001583	missense	6134	exon4			TCAGATGAATATG	AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.166G>A	X.37:g.153627911G>A	ENSP00000358832:p.Glu56Lys	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	89	50	NM_001256577	0	1	187	1065	877	A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Missense_Mutation	SNP	ENST00000369817.2	37	CCDS14746.1	.	.	.	.	.	.	.	.	.	.	G	35	5.435565	0.96150	.	.	ENSG00000147403	ENST00000369817;ENST00000424325;ENST00000436473;ENST00000344746;ENST00000458500;ENST00000406022;ENST00000451365	T;T;T;T	0.79940	-0.98;-0.98;-0.98;-1.32	4.77	4.77	0.60923	Ribosomal protein L10e/L16 (2);	0.150767	0.42420	U	0.000704	D	0.92616	0.7654	H	0.96720	3.87	0.80722	D	1	P;D	0.65815	0.912;0.995	P;D	0.69654	0.876;0.965	D	0.94917	0.8070	10	0.87932	D	0	-16.8236	14.3504	0.66697	0.0:0.0:1.0:0.0	.	56;56	A6QRI9;P27635	.;RL10_HUMAN	K	56;56;56;56;56;5;39	ENSP00000358832:E56K;ENSP00000413436:E56K;ENSP00000341730:E56K;ENSP00000385621:E5K	ENSP00000341730:E56K	E	+	1	0	RPL10	153281105	1.000000	0.71417	0.996000	0.52242	0.891000	0.51852	8.919000	0.92770	1.963000	0.57068	0.600000	0.82982	GAA	.		0.507	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127774.5	NM_006013	
TMEM52	339456	broad.mit.edu	37	1	1850628	1850636	+	In_Frame_Del	DEL	AGCGGCAGG	AGCGGCAGG	-	rs575852588	byFrequency	TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	AGCGGCAGG	AGCGGCAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr1:1850628_1850636delAGCGGCAGG	ENST00000310991.3	-	1	76_84	c.69_77delCCTGCCGCT	c.(67-78)ctcctgccgctg>ctg	p.23_26LLPL>L	TMEM52_ENST00000378602.3_5'Flank	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	23						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CACCTgcggcagcggcaggagcggcagga	0.766														1798	0.359026	0.0673	0.5072	5008	,	,		10019	0.4792		0.4891	False		,,,				2504	0.3906				p.23_26del													.	TMEM52-68	0			c.69_77del						.			61,649		27,7,321						0.9	1.0			2	719,1347		316,87,630	no	coding	TMEM52	NM_178545.3		343,94,951	A1A1,A1R,RR		34.8015,8.5915,28.098				780,1996				SO:0001651	inframe_deletion	339456	exon1			TGCGGCAGCGGCA	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.69_77delCCTGCCGCT	1.37:g.1850637_1850645delAGCGGCAGG	ENSP00000311122:p.Leu23_Pro25del	Somatic	5	0		WXS	Illumina HiSeq	Phase_I	7	3	NM_178545	0	0	0	0	0	Q4VXS6|Q6UX25	In_Frame_Del	DEL	ENST00000310991.3	37	CCDS35.1																																																																																			.		0.766	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002781.1	NM_178545	
MRPL9	65005	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	151735603	151735616	+	Frame_Shift_Del	DEL	CGCTCCACGATGAC	CGCTCCACGATGAC	-	rs567245913|rs199843916		TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	CGCTCCACGATGAC	CGCTCCACGATGAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr1:151735603_151735616delCGCTCCACGATGAC	ENST00000368830.3	-	2	244_257	c.160_173delGTCATCGTGGAGCG	c.(160-174)gtcatcgtggagcgcfs	p.VIVER54fs	OAZ3_ENST00000315067.8_Start_Codon_Del|RP11-98D18.2_ENST00000420382.1_RNA|OAZ3_ENST00000321531.5_Start_Codon_Del|OAZ3_ENST00000453029.2_5'Flank|RP11-98D18.3_ENST00000512280.1_RNA|MRPL9_ENST00000368829.3_Frame_Shift_Del_p.VIVER54fs|OAZ3_ENST00000479764.1_5'Flank|MRPL9_ENST00000467306.1_5'UTR	NM_031420.2	NP_113608.1	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9	54					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.R58H(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTTCCACCAGCGCTCCACGATGACCGTGCCCTGG	0.668																																					p.54_58del		.											.	MRPL9-91	1	Substitution - Missense(1)	large_intestine(1)	c.160_173del						.																																			SO:0001589	frameshift_variant	65005	exon2			.	AK026363	CCDS1003.1, CCDS72916.1	1q21	2012-09-13			ENSG00000143436	ENSG00000143436		"""Mitochondrial ribosomal proteins / large subunits"""	14277	protein-coding gene	gene with protein product		611824					Standard	XM_005245455		Approved		uc001eyv.3	Q9BYD2	OTTHUMG00000013063	ENST00000368830.3:c.160_173delGTCATCGTGGAGCG	1.37:g.151735603_151735616delCGCTCCACGATGAC	ENSP00000357823:p.Val54fs	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	47	12	NM_031420	0	0	0	0	0	B2RD99|Q5SZR2|Q9BSW8	Frame_Shift_Del	DEL	ENST00000368830.3	37	CCDS1003.1																																																																																			.		0.668	MRPL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036653.2	NM_031420	
C2CD3	26005	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	73745646	73745646	+	Intron	DEL	G	G	-			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr11:73745646delG	ENST00000334126.7	-	31	6108				C2CD3_ENST00000542452.1_5'Flank|C2CD3_ENST00000313663.7_Frame_Shift_Del_p.Y1963fs			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3						brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					AGTTACTTCAGTAACTACCTA	0.368																																					p.Y1963fs		.											.	C2CD3-75	0			c.5889delC						.						74.0	74.0	74.0					11																	73745646		2200	4293	6493	SO:0001627	intron_variant	26005	exon31			.	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.5882-323C>-	11.37:g.73745646delG		Somatic	51	0		WXS	Illumina HiSeq	Phase_I	40	10	NM_015531	0	0	0	0	0	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Frame_Shift_Del	DEL	ENST00000334126.7	37																																																																																				.		0.368	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
HAPLN3	145864	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	89422488	89422488	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr15:89422488delG	ENST00000359595.3	-	4	720	c.506delC	c.(505-507)cctfs	p.P169fs	HAPLN3_ENST00000562889.1_Frame_Shift_Del_p.P231fs	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	169	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	GGACTGGTAAGGAAAGACCAC	0.632											OREG0023445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P169fs		.											.	HAPLN3-90	0			c.506delC						.						36.0	41.0	39.0					15																	89422488		2200	4299	6499	SO:0001589	frameshift_variant	145864	exon4			.	AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.506delC	15.37:g.89422488delG	ENSP00000352606:p.Pro169fs	Somatic	68	0	1267	WXS	Illumina HiSeq	Phase_I	65	19	NM_178232	0	0	0	0	0	A8K7P0	Frame_Shift_Del	DEL	ENST00000359595.3	37	CCDS10346.1																																																																																			.		0.632	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309070.1	NM_178232	
PLEKHB2	55041	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	131904282	131904282	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr2:131904282delC	ENST00000403716.1	+	8	1165	c.605delC	c.(604-606)gcafs	p.A202fs	PLEKHB2_ENST00000409612.1_Frame_Shift_Del_p.A202fs|PLEKHB2_ENST00000409279.1_Frame_Shift_Del_p.A202fs|PLEKHB2_ENST00000438882.2_Frame_Shift_Del_p.H166fs|PLEKHB2_ENST00000538982.1_Frame_Shift_Del_p.A154fs|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000409158.1_Frame_Shift_Del_p.A210fs|PLEKHB2_ENST00000439822.2_Frame_Shift_Del_p.H158fs|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000234115.6_Frame_Shift_Del_p.A201fs	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	202						endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		AGCGACCTGGCACTGGGCATG	0.507																																					p.A216fs		.											.	PLEKHB2-92	0			c.647delC						.						160.0	166.0	164.0					2																	131904282		2203	4300	6503	SO:0001589	frameshift_variant	55041	exon9			.		CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.605delC	2.37:g.131904282delC	ENSP00000385892:p.Ala202fs	Somatic	293	0		WXS	Illumina HiSeq	Phase_I	311	83	NM_001267062	0	0	0	0	0	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Frame_Shift_Del	DEL	ENST00000403716.1	37	CCDS46413.1																																																																																			.		0.507	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958	
PLEKHB2	55041	hgsc.bcm.edu	37	2	131904282	131904284	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr2:131904282_131904284delCAC	ENST00000403716.1	+	8	1165_1167	c.605_607delCAC	c.(604-609)gcactg>gtg	p.202_203AL>V	PLEKHB2_ENST00000409612.1_In_Frame_Del_p.202_203AL>V|PLEKHB2_ENST00000409279.1_In_Frame_Del_p.202_203AL>V|PLEKHB2_ENST00000438882.2_In_Frame_Del_p.H166del|PLEKHB2_ENST00000538982.1_In_Frame_Del_p.154_155AL>V|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000409158.1_In_Frame_Del_p.210_211AL>V|PLEKHB2_ENST00000439822.2_In_Frame_Del_p.H158del|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000234115.6_In_Frame_Del_p.201_202AL>V	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	202						endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		AGCGACCTGGCACTGGGCATGCT	0.512																																					p.216_217del		.											.	PLEKHB2-92	0			c.647_649del						.																																			SO:0001651	inframe_deletion	55041	exon9			.		CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.605_607delCAC	2.37:g.131904282_131904284delCAC	ENSP00000385892:p.Ala202_Leu203delinsVal	Somatic	302	0		WXS	Illumina HiSeq	Phase_I	317	51	NM_001267062	0	0	0	0	0	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	In_Frame_Del	DEL	ENST00000403716.1	37	CCDS46413.1																																																																																			.		0.512	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958	
AZI2	64343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	28382066	28382066	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:28382066delC	ENST00000479665.1	-	2	574	c.43delG	c.(43-45)gaafs	p.E15fs	AZI2_ENST00000420543.2_Frame_Shift_Del_p.E15fs|AZI2_ENST00000457172.1_Frame_Shift_Del_p.E15fs|AZI2_ENST00000295748.3_5'UTR|AZI2_ENST00000334100.6_Frame_Shift_Del_p.E15fs	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2	15	Homodimerization. {ECO:0000250}.				dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						TGGGCTTTTTCATGATTCAGA	0.348																																					p.E15fs		.											.	AZI2-92	0			c.43delG						.						104.0	107.0	106.0					3																	28382066		2203	4300	6503	SO:0001589	frameshift_variant	64343	exon2			.	AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.43delG	3.37:g.28382066delC	ENSP00000419371:p.Glu15fs	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	127	50	NM_001134432	0	0	0	0	0	A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Frame_Shift_Del	DEL	ENST00000479665.1	37	CCDS2647.1																																																																																			.		0.348	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252998.2	NM_203326	
CISH	1154	broad.mit.edu;bcgsc.ca	37	3	50645554	50645554	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:50645554delA	ENST00000348721.3	-	3	441	c.261delT	c.(259-261)attfs	p.I87fs	CISH_ENST00000443053.2_Frame_Shift_Del_p.I104fs	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	87	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CGCTGGCCGTAATGGAACCCC	0.562																																					p.I104fs													.	CISH-710	0			c.312delT						.						38.0	38.0	38.0					3																	50645554		2203	4300	6503	SO:0001589	frameshift_variant	1154	exon4			GGCCGTAATGGAA	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.261delT	3.37:g.50645554delA	ENSP00000294173:p.Ile87fs	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	69	10	NM_013324	0	0	0	0	0	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Frame_Shift_Del	DEL	ENST00000348721.3	37	CCDS2831.1																																																																																			.		0.562	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	NM_145071	
RASA2	5922	broad.mit.edu;bcgsc.ca	37	3	141326509	141326518	+	Splice_Site	DEL	TTATTATTTA	TTATTATTTA	-			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	TTATTATTTA	TTATTATTTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:141326509_141326518delTTATTATTTA	ENST00000452898.1	+	20	1971		c.e20-1		RASA2_ENST00000509118.1_Splice_Site|RASA2_ENST00000286364.3_Splice_Site	NM_006506.2	NP_006497.2	Q15283	RASA2_HUMAN	RAS p21 protein activator 2						intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	34						TTTACTTTTTTTATTATTTAGGCAAAGATG	0.305																																					.													.	RASA2-661	0			.						.																																			SO:0001630	splice_region_variant	5922	.			CTTTTTTTATTAT	AF115573	CCDS3117.1	3q22-q23	2013-01-10			ENSG00000155903	ENSG00000155903		"""Pleckstrin homology (PH) domain containing"""	9872	protein-coding gene	gene with protein product		601589				8699317	Standard	NM_006506		Approved	GAP1M	uc003etz.1	Q15283	OTTHUMG00000160221	ENST00000452898.1:c.1937-1TTATTATTTA>-	3.37:g.141326509_141326518delTTATTATTTA		Somatic	34	0		WXS	Illumina HiSeq	Phase_I	35	21	.	0	0	0	0	0	A8K7K1|G3V0F9|O00695|Q15284|Q92594|Q99577|Q9UEQ2	Splice_Site	DEL	ENST00000452898.1	37																																																																																				.		0.305	RASA2-201	KNOWN	basic	protein_coding	protein_coding		NM_006506	Intron
KIAA1211	57482	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	57182080	57182080	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr4:57182080delT	ENST00000504228.1	+	6	2517	c.2412delT	c.(2410-2412)cctfs	p.P804fs	KIAA1211_ENST00000541073.1_Frame_Shift_Del_p.P797fs|KIAA1211_ENST00000264229.6_Frame_Shift_Del_p.P804fs			Q6ZU35	K1211_HUMAN	KIAA1211	804										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CAAGCCTTCCTTACCCTCCGC	0.592																																					p.P804fs		.											.	KIAA1211-70	0			c.2412delT						.						81.0	89.0	86.0					4																	57182080		2023	4206	6229	SO:0001589	frameshift_variant	57482	exon8			.	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.2412delT	4.37:g.57182080delT	ENSP00000423366:p.Pro804fs	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	65	22	NM_020722	0	0	0	0	0	Q9NTE2|Q9NTP8|Q9ULK9	Frame_Shift_Del	DEL	ENST00000504228.1	37	CCDS43230.1																																																																																			.		0.592	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
GFRAL	389400	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	55223709	55223709	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr6:55223709delC	ENST00000340465.2	+	6	811	c.725delC	c.(724-726)tcafs	p.S242fs		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	242					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ACATTTCAGTCAAAATGCTGG	0.398																																					p.S242X		.											.	GFRAL-154	0			c.725delC						.						115.0	106.0	109.0					6																	55223709		2203	4300	6503	SO:0001589	frameshift_variant	389400	exon6			.	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.725delC	6.37:g.55223709delC	ENSP00000343636:p.Ser242fs	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	130	46	NM_207410	0	0	0	0	0	Q5VTF6	Nonsense_Mutation	DEL	ENST00000340465.2	37	CCDS4957.1																																																																																			.		0.398	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410	
PROX1	5629	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	214170437	214170438	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr1:214170437_214170438insAT	ENST00000366958.4	+	2	1167_1168	c.559_560insAT	c.(559-561)aatfs	p.N187fs	PROX1_ENST00000261454.4_Frame_Shift_Ins_p.N187fs|PROX1_ENST00000435016.1_Frame_Shift_Ins_p.N187fs|PROX1_ENST00000498508.2_Frame_Shift_Ins_p.N187fs	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	187					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		ATTAAGGGGCAATGAAAATGAA	0.505																																					p.N187fs		.											.	PROX1-654	0			c.559_560insAT						.																																			SO:0001589	frameshift_variant	5629	exon2			.	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.560_561dupAT	1.37:g.214170438_214170439dupAT	ENSP00000355925:p.Asn187fs	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	74	21	NM_001270616	0	0	0	0	0	A6NK29|A8K2B1|Q5SW76|Q8TB91	Frame_Shift_Ins	INS	ENST00000366958.4	37	CCDS31021.1																																																																																			.		0.505	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
SRCAP	10847	broad.mit.edu	37	16	30736370	30736371	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr16:30736370_30736371insC	ENST00000262518.4	+	25	6010_6011	c.5625_5626insC	c.(5626-5628)cccfs	p.P1876fs	SRCAP_ENST00000395059.2_Frame_Shift_Ins_p.P1814fs|SRCAP_ENST00000344771.4_Frame_Shift_Ins_p.P1718fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1876	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTCGACGCCAGCCCCCCCCACC	0.569																																					p.Q1875fs													.	SRCAP-94	0			c.5625_5626insC						.																																			SO:0001589	frameshift_variant	10847	exon25			ACGCCAGCCCCCC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5633dupC	16.37:g.30736378_30736378dupC	ENSP00000262518:p.Pro1876fs	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	237	0	NM_006662	0	0	0	0	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Ins	INS	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.569	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
DNAJC28	54943	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	34861049	34861050	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr21:34861049_34861050insA	ENST00000314399.3	-	2	1089_1090	c.651_652insT	c.(649-654)tttgacfs	p.D218fs	DNAJC28_ENST00000402202.1_Frame_Shift_Ins_p.D218fs|DNAJC28_ENST00000381947.3_Frame_Shift_Ins_p.D218fs	NM_017833.3	NP_060303.2	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28	218										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(5)|skin(1)|urinary_tract(1)	18						CTGAGATTGTCAAAGTCTCCTT	0.386																																					p.D218_N219delinsX		.											.	DNAJC28-90	0			c.652_653insT						.																																			SO:0001589	frameshift_variant	54943	exon2			.	AK000468	CCDS13626.1	21q22.11	2011-09-02	2008-06-17	2008-06-17	ENSG00000177692	ENSG00000177692		"""Heat shock proteins / DNAJ (HSP40)"""	1297	protein-coding gene	gene with protein product	"""Orf28"""		"""chromosome 21 open reading frame 55"""	C21orf55			Standard	NM_017833		Approved	C21orf78	uc002yrw.3	Q9NX36	OTTHUMG00000065531	ENST00000314399.3:c.652dupT	21.37:g.34861052_34861052dupA	ENSP00000320303:p.Asp218fs	Somatic	202	0		WXS	Illumina HiSeq	Phase_I	202	51	NM_017833	0	0	0	0	0	D3DSF2	Nonsense_Mutation	INS	ENST00000314399.3	37	CCDS13626.1																																																																																			.		0.386	DNAJC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140454.3		
MITF	4286	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	69988260	69988261	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:69988260_69988261insT	ENST00000448226.2	+	4	721_722	c.594_595insT	c.(595-597)tttfs	p.F199fs	MITF_ENST00000394355.2_Frame_Shift_Ins_p.F174fs|MITF_ENST00000352241.4_Frame_Shift_Ins_p.F199fs|MITF_ENST00000328528.6_Frame_Shift_Ins_p.F198fs|MITF_ENST00000531774.1_Frame_Shift_Ins_p.F36fs|MITF_ENST00000314589.5_Frame_Shift_Ins_p.F183fs|MITF_ENST00000314557.6_Frame_Shift_Ins_p.F92fs|MITF_ENST00000472437.1_Frame_Shift_Ins_p.F147fs|MITF_ENST00000394351.3_Frame_Shift_Ins_p.F92fs			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	199					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)	p.K91N(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		GATTTTATAAGTTTGAAGAGCA	0.441			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.K198fs	Melanoma(29;269 969 31479 41502 42961)	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF-524	1	Substitution - Missense(1)	large_intestine(1)	c.594_595insT						.																																			SO:0001589	frameshift_variant	4286	exon4			.		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.597dupT	3.37:g.69988263_69988263dupT	ENSP00000391803:p.Phe199fs	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	75	38	NM_198159	0	0	0	0	0	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Frame_Shift_Ins	INS	ENST00000448226.2	37																																																																																				.		0.441	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
KDR	3791	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	55981041	55981042	+	Splice_Site	INS	-	-	T			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr4:55981041_55981042insT	ENST00000263923.4	-	5	952_953	c.657_658insA	c.(655-660)gtaggg>gtaAggg	p.G220fs		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	220					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTCCTCTTACCTACAACGACAA	0.347			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.G220fs		.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR-2298	0			c.658_659insA						.																																			SO:0001630	splice_region_variant	3791	exon5			.	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.658+1->A	4.37:g.55981042_55981042dupT		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	93	27	NM_002253	0	0	0	0	0	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Frame_Shift_Ins	INS	ENST00000263923.4	37	CCDS3497.1																																																																																			.		0.347	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		Frame_Shift_Ins
PLEKHB2	55041	hgsc.bcm.edu;bcgsc.ca	37	2	131904283	131904284	+	Missense_Mutation	DNP	AC	AC	GG			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr2:131904283_131904284AC>GG	ENST00000403716.1	+	8	1166_1167	c.606_607AC>GG	c.(604-609)gcACtg>gcGGtg	p.L203V	PLEKHB2_ENST00000409612.1_Missense_Mutation_p.L203V|PLEKHB2_ENST00000409279.1_Missense_Mutation_p.L203V|PLEKHB2_ENST00000438882.2_Missense_Mutation_p.H166R|PLEKHB2_ENST00000538982.1_Missense_Mutation_p.L155V|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.L211V|PLEKHB2_ENST00000439822.2_Missense_Mutation_p.H158R|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000234115.6_Missense_Mutation_p.L202V	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	203						endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		GCGACCTGGCACTGGGCATGCT	0.51																																					p.L211V		.											.	PLEKHB2	0			c.C649G						.																																			SO:0001583	missense	55041	exon9			CTGGCACTGGGCA		CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	Exception_encountered	2.37:g.131904283_131904284delinsGG	ENSP00000385892:p.Leu203Val	Somatic	305.0	0.0		WXS	Illumina HiSeq	Phase_I	310.0	84.0		0	0	0	0	0	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	DNP	ENST00000403716.1	37	CCDS46413.1																																																																																			.		0.510	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958	
USP19	10869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49148708	49148709	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-BQ-7045-01A-31D-1961-08	TCGA-BQ-7045-11A-01D-1961-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	413a9e10-cac7-4b6c-91cd-b58fd4499c07	0ed1c015-2f52-4269-98d4-b78e9323f29c	g.chr3:49148708_49148709TC>AT	ENST00000398888.2	-	21	3316_3317	c.2998_2999GA>AT	c.(2998-3000)GAg>ATg	p.E1000M	USP19_ENST00000434032.2_Missense_Mutation_p.E1101M|USP19_ENST00000398898.2_Missense_Mutation_p.E1040M|USP19_ENST00000398896.1_Missense_Mutation_p.E808M|USP19_ENST00000417901.1_Missense_Mutation_p.E1103M|USP19_ENST00000398892.3_Missense_Mutation_p.E1040M|USP19_ENST00000453664.1_Missense_Mutation_p.E1091M	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	1000	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TAGCCGCTGCTCTCGGTTGGAT	0.545																																					p.E1101M		.											.	USP19	0			c.G3307A						.																																			SO:0001583	missense	10869	exon22			GCTGCTCTCGGTT	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.2998_2999delinsAT	3.37:g.49148708_49148709delinsAT	ENSP00000381863:p.Glu1000Met	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	58.0		0	0	0	0	0	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	DNP	ENST00000398888.2	37	CCDS43090.1																																																																																			.		0.545	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
