#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CDK11A	728642	broad.mit.edu	37	1	1638914	1638914	+	Silent	SNP	G	G	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr1:1638914G>T	ENST00000378633.1	-	11	1267	c.1188C>A	c.(1186-1188)ccC>ccA	p.P396P	CDK11A_ENST00000378638.2_Silent_p.P359P|CDK11A_ENST00000378635.3_3'UTR|RP1-283E3.8_ENST00000598846.1_RNA|CDK11A_ENST00000356200.3_Silent_p.P359P|CDK11A_ENST00000495016.1_5'Flank|CDK11A_ENST00000357760.2_Silent_p.P392P|CDK11A_ENST00000404249.3_Silent_p.P393P|CDK11A_ENST00000358779.5_Silent_p.P383P			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	396					apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						CAGGGGAGTCGGGCACATAGT	0.672																																					p.P393P	Pancreas(186;965 2119 30274 40311 50569)												.	CDK11A-14	0			c.C1179A						.						49.0	62.0	58.0					1																	1638914		2019	4148	6167	SO:0001819	synonymous_variant	728642	exon11			GGAGTCGGGCACA	AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.1188C>A	1.37:g.1638914G>T		Somatic	22	0		WXS	Illumina HiSeq	Phase_I	29	15	NM_024011	0	0	23	29	6	O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Silent	SNP	ENST00000378633.1	37																																																																																				.		0.672	CDK11A-005	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000001735.1	NM_024011	
NPHP4	261734	broad.mit.edu	37	1	5935029	5935029	+	Silent	SNP	G	G	A			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr1:5935029G>A	ENST00000378156.4	-	21	3214	c.2949C>T	c.(2947-2949)gcC>gcT	p.A983A	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	983					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCCAGCGTGGCGTGGAGCG	0.627																																					p.A983A													.	NPHP4-515	0			c.C2949T						.						74.0	93.0	87.0					1																	5935029		2186	4268	6454	SO:0001819	synonymous_variant	261734	exon21			CAGCGTGGCGTGG	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.2949C>T	1.37:g.5935029G>A		Somatic	55	0		WXS	Illumina HiSeq	Phase_I	59	6	NM_015102	0	0	8	9	1	Q8IWC0	Silent	SNP	ENST00000378156.4	37	CCDS44052.1																																																																																			.		0.627	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2		
RPS6KA1	6195	broad.mit.edu;bcgsc.ca	37	1	26885310	26885310	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr1:26885310T>C	ENST00000374168.2	+	14	1251	c.1097T>C	c.(1096-1098)aTc>aCc	p.I366T	RPS6KA1_ENST00000530003.1_Missense_Mutation_p.I350T|RPS6KA1_ENST00000531382.1_Missense_Mutation_p.I375T|RPS6KA1_ENST00000526792.1_Missense_Mutation_p.I274T|RPS6KA1_ENST00000374166.4_Missense_Mutation_p.I355T|RPS6KA1_ENST00000374162.2_Missense_Mutation_p.I274T	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	366	AGC-kinase C-terminal.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		TCCCCAGGCATCCCCCCCAGC	0.672																																					p.I375T													.	RPS6KA1-510	0			c.T1124C						.						64.0	64.0	64.0					1																	26885310		2203	4300	6503	SO:0001583	missense	6195	exon13			CAGGCATCCCCCC	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1097T>C	1.37:g.26885310T>C	ENSP00000363283:p.Ile366Thr	Somatic	105	1		WXS	Illumina HiSeq	Phase_I	97	5	NM_001006665	0	0	0	0	0	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Missense_Mutation	SNP	ENST00000374168.2	37	CCDS284.1	.	.	.	.	.	.	.	.	.	.	T	11.99	1.802617	0.31869	.	.	ENSG00000117676	ENST00000374168;ENST00000374166;ENST00000526792;ENST00000374162;ENST00000530003;ENST00000374164;ENST00000531382;ENST00000403732	T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.55	5.55	0.83447	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.101317	0.64402	D	0.000003	T	0.45256	0.1333	L	0.46614	1.455	0.80722	D	1	B;B;B	0.31413	0.003;0.004;0.322	B;B;B	0.32211	0.057;0.008;0.142	T	0.47911	-0.9080	10	0.87932	D	0	.	15.8615	0.79026	0.0:0.0:0.0:1.0	.	350;375;366	B7Z2K7;Q15418-2;Q15418	.;.;KS6A1_HUMAN	T	366;355;274;274;350;86;375;24	ENSP00000363283:I366T;ENSP00000363281:I355T;ENSP00000431651:I274T;ENSP00000363277:I274T;ENSP00000432281:I350T;ENSP00000435412:I375T;ENSP00000383967:I24T	ENSP00000363277:I274T	I	+	2	0	RPS6KA1	26757897	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.778000	0.85637	2.333000	0.79357	0.533000	0.62120	ATC	.		0.672	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
CGN	57530	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151509762	151509762	+	Silent	SNP	C	C	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr1:151509762C>T	ENST00000271636.7	+	21	3685	c.3552C>T	c.(3550-3552)taC>taT	p.Y1184Y		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	1178	Tail.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)	p.Y1184Y(1)		NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			ACAGTGTCTACGATCCCTCGT	0.537																																					p.Y1184Y													.	CGN-93	1	Substitution - coding silent(1)	lung(1)	c.C3552T						.						123.0	92.0	102.0					1																	151509762		2203	4300	6503	SO:0001819	synonymous_variant	57530	exon21			TGTCTACGATCCC	AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.3552C>T	1.37:g.151509762C>T		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	64	18	NM_020770	0	0	10	13	3	A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	ENST00000271636.7	37	CCDS999.1																																																																																			.		0.537	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
ADAR	103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154562826	154562826	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr1:154562826T>C	ENST00000368474.4	-	7	2529	c.2330A>G	c.(2329-2331)aAg>aGg	p.K777R	ADAR_ENST00000292205.5_Missense_Mutation_p.K820R|ADAR_ENST00000368471.3_Missense_Mutation_p.K482R	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	777	DRBM 3. {ECO:0000255|PROSITE- ProRule:PRU00266}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GCCTTGCTTCTTGCTGTGTGC	0.542																																					p.K777R		.											.	ADAR-157	0			c.A2330G						.						99.0	92.0	94.0					1																	154562826		2203	4300	6503	SO:0001583	missense	103	exon7			TGCTTCTTGCTGT	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2330A>G	1.37:g.154562826T>C	ENSP00000357459:p.Lys777Arg	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	129	22	NM_001111	0	0	49	58	9	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	T	34	5.404549	0.96051	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.94	5.94	0.96194	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.93038	0.7784	M	0.83223	2.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.997;0.999	D	0.94043	0.7311	10	0.87932	D	0	-29.5181	16.3951	0.83601	0.0:0.0:0.0:1.0	.	758;777;777	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	R	820;777;482;772	ENSP00000292205:K820R;ENSP00000357459:K777R;ENSP00000357456:K482R;ENSP00000431794:K772R	ENSP00000292205:K820R	K	-	2	0	ADAR	152829450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.424000	0.80242	2.272000	0.75746	0.460000	0.39030	AAG	.		0.542	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
CACNA1S	779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201034981	201034981	+	Silent	SNP	G	G	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr1:201034981G>T	ENST00000362061.3	-	22	3064	c.2838C>A	c.(2836-2838)ggC>ggA	p.G946G	CACNA1S_ENST00000367338.3_Silent_p.G946G	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	946					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGAGCTGGACGCCGATGCAGG	0.622																																					p.G946G		.											.	CACNA1S-94	0			c.C2838A						.						85.0	70.0	75.0					1																	201034981		2203	4300	6503	SO:0001819	synonymous_variant	779	exon22			CTGGACGCCGATG	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.2838C>A	1.37:g.201034981G>T		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	30	10	NM_000069	0	0	0	0	0	A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	ENST00000362061.3	37	CCDS1407.1																																																																																			.		0.622	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
SVIL	6840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	29811367	29811367	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr10:29811367G>C	ENST00000355867.4	-	16	4113	c.3361C>G	c.(3361-3363)Ccc>Gcc	p.P1121A	SVIL_ENST00000375398.2_Missense_Mutation_p.P1121A|SVIL_ENST00000535393.1_Missense_Mutation_p.P19A|SVIL_ENST00000375400.3_Missense_Mutation_p.P695A	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1121					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GTTTTGCTGGGTGAGTCAAGA	0.468																																					p.P1121A		.											.	SVIL-96	0			c.C3361G						.						70.0	70.0	70.0					10																	29811367		2203	4300	6503	SO:0001583	missense	6840	exon16			TGCTGGGTGAGTC	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.3361C>G	10.37:g.29811367G>C	ENSP00000348128:p.Pro1121Ala	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	86	29	NM_021738	0	0	8	8	0	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	G	9.477	1.097117	0.20552	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393;ENST00000535994	T;T;T;T	0.12255	2.79;2.83;2.83;2.7	5.82	2.6	0.31112	.	0.415737	0.28482	N	0.015187	T	0.07863	0.0197	L	0.32530	0.975	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.001;0.003;0.001	T	0.21827	-1.0234	10	0.12430	T	0.62	-11.1568	4.4588	0.11656	0.2785:0.2093:0.5123:0.0	.	19;695;1121	F5H2Q5;O95425-2;O95425	.;.;SVIL_HUMAN	A	695;1121;1121;19;75	ENSP00000364549:P695A;ENSP00000364547:P1121A;ENSP00000348128:P1121A;ENSP00000445472:P19A	ENSP00000348128:P1121A	P	-	1	0	SVIL	29851373	0.955000	0.32602	0.678000	0.29963	0.512000	0.34134	1.769000	0.38522	0.798000	0.33994	0.563000	0.77884	CCC	.		0.468	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
PARD3	56288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	34648076	34648076	+	Splice_Site	SNP	T	T	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr10:34648076T>C	ENST00000374789.3	-	14	2391	c.2066A>G	c.(2065-2067)gAg>gGg	p.E689G	PARD3_ENST00000374776.1_Splice_Site_p.E676G|PARD3_ENST00000544292.1_Splice_Site_p.E406G|PARD3_ENST00000340077.5_Splice_Site_p.E689G|PARD3_ENST00000374773.1_Splice_Site_p.E689G|PARD3_ENST00000374794.3_Splice_Site_p.E632G|PARD3_ENST00000545260.1_Splice_Site_p.E632G|PARD3_ENST00000374788.3_Splice_Site_p.E689G|PARD3_ENST00000545693.1_Splice_Site_p.E676G|PARD3_ENST00000374768.1_Splice_Site_p.E127G|PARD3_ENST00000350537.4_Splice_Site_p.E676G|PARD3_ENST00000374790.3_Splice_Site_p.E632G|PARD3_ENST00000346874.4_Splice_Site_p.E689G	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	689					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				ATTTCTTACCTCATTGCACTT	0.378																																					p.E689G		.											.	PARD3-92	0			c.A2066G						.						167.0	156.0	160.0					10																	34648076		2203	4300	6503	SO:0001630	splice_region_variant	56288	exon14			CTTACCTCATTGC	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2067+1A>G	10.37:g.34648076T>C		Somatic	171	0		WXS	Illumina HiSeq	Phase_I	161	47	NM_001184792	0	0	0	0	0	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.328750	0.41197	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292;ENST00000374768	T;T;T;T;T;T;T;T;T;T;T;T;T	0.20332	2.43;2.43;2.49;2.49;2.52;2.45;2.42;2.43;2.1;2.08;2.16;2.12;2.25	5.56	5.56	0.83823	PDZ/DHR/GLGF (1);	0.414096	0.28706	N	0.014403	T	0.30916	0.0780	L	0.50333	1.59	0.80722	D	1	P;P;B;P;B;P;P;B;B;P;P;B;B;P;B	0.46512	0.719;0.879;0.391;0.719;0.391;0.82;0.719;0.236;0.023;0.597;0.825;0.069;0.076;0.506;0.085	B;B;B;B;B;P;B;B;B;B;P;B;B;P;B	0.49502	0.377;0.409;0.304;0.377;0.304;0.613;0.377;0.076;0.013;0.209;0.533;0.113;0.078;0.502;0.113	T	0.01508	-1.1337	10	0.45353	T	0.12	.	15.7055	0.77577	0.0:0.0:0.0:1.0	.	632;632;676;676;676;689;689;689;632;676;689;689;676;689;406	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q5VWU8;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10;F5GZI3	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.;.;.	G	676;632;689;689;689;632;676;632;676;689;689;406;127	ENSP00000443147:E676G;ENSP00000440857:E632G;ENSP00000363921:E689G;ENSP00000363920:E689G;ENSP00000340591:E689G;ENSP00000363926:E632G;ENSP00000311986:E676G;ENSP00000363922:E632G;ENSP00000363908:E676G;ENSP00000341844:E689G;ENSP00000363905:E689G;ENSP00000444429:E406G;ENSP00000363900:E127G	ENSP00000341844:E689G	E	-	2	0	PARD3	34688082	1.000000	0.71417	0.990000	0.47175	0.190000	0.23558	6.186000	0.72026	2.114000	0.64651	0.533000	0.62120	GAG	.		0.378	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	Missense_Mutation
TMEM26	219623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	63212836	63212836	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr10:63212836C>T	ENST00000399298.3	-	1	372	c.4G>A	c.(4-6)Gag>Aag	p.E2K	TMEM26_ENST00000399293.1_Missense_Mutation_p.E2K|RP11-809M12.1_ENST00000389640.4_RNA	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	2						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					ACCAGTCCCTCCATGCTGGCC	0.667																																					p.E2K		.											.	TMEM26-90	0			c.G4A						.						45.0	54.0	51.0					10																	63212836		2126	4227	6353	SO:0001583	missense	219623	exon1			GTCCCTCCATGCT	BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.4G>A	10.37:g.63212836C>T	ENSP00000382237:p.Glu2Lys	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	75	28	NM_178505	0	0	1	3	2	Q6ZVM0|Q8IVN9	Missense_Mutation	SNP	ENST00000399298.3	37	CCDS41530.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.755604	0.49362	.	.	ENSG00000196932	ENST00000399298;ENST00000399293	.	.	.	5.01	4.1	0.47936	.	0.902018	0.09509	N	0.792586	T	0.46132	0.1377	L	0.50333	1.59	0.34559	D	0.71215	P	0.43392	0.805	B	0.34722	0.188	T	0.53373	-0.8448	9	0.24483	T	0.36	-18.3363	14.8814	0.70537	0.1446:0.8554:0.0:0.0	.	2	Q6ZUK4	TMM26_HUMAN	K	2	.	ENSP00000382232:E2K	E	-	1	0	TMEM26	62882842	1.000000	0.71417	1.000000	0.80357	0.204000	0.24138	4.777000	0.62361	1.315000	0.45114	-0.182000	0.12963	GAG	.		0.667	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1	NM_178505	
DNAJB12	54788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	74100871	74100871	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr10:74100871T>A	ENST00000444643.2	-	4	847	c.515A>T	c.(514-516)cAg>cTg	p.Q172L	DNAJB12_ENST00000338820.3_Missense_Mutation_p.Q206L|DNAJB12_ENST00000394903.2_Missense_Mutation_p.Q206L|DNAJB12_ENST00000461919.1_5'UTR			Q9NXW2	DJB12_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 12	172	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|skin(1)	4						ATCGCCGAACTGGTCATACTG	0.602																																					p.Q206L		.											.	DNAJB12-226	0			c.A617T						.						75.0	67.0	69.0					10																	74100871		2203	4300	6503	SO:0001583	missense	54788	exon4			CCGAACTGGTCAT	AK000034	CCDS7316.2	10q22	2011-09-02			ENSG00000148719	ENSG00000148719		"""Heat shock proteins / DNAJ (HSP40)"""	14891	protein-coding gene	gene with protein product		608376				11147971	Standard	NM_001002762		Approved	DJ10, FLJ20027	uc001jta.2	Q9NXW2	OTTHUMG00000018436	ENST00000444643.2:c.515A>T	10.37:g.74100871T>A	ENSP00000403313:p.Gln172Leu	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	69	24	NM_017626	0	0	22	36	14	B7Z7I3|Q9H6H0	Missense_Mutation	SNP	ENST00000444643.2	37		.	.	.	.	.	.	.	.	.	.	T	8.916	0.959878	0.18507	.	.	ENSG00000148719	ENST00000338820;ENST00000394903;ENST00000444643	T;T;T	0.73258	-0.73;-0.73;-0.73	5.48	5.48	0.80851	Heat shock protein DnaJ, N-terminal (3);	0.122950	0.64402	D	0.000020	T	0.59528	0.2200	N	0.17474	0.49	0.58432	D	0.999999	D;P	0.54207	0.965;0.879	P;B	0.49887	0.625;0.227	T	0.59721	-0.7401	10	0.02654	T	1	-6.3488	15.622	0.76813	0.0:0.0:0.0:1.0	.	172;172	Q9NXW2-2;Q9NXW2	.;DJB12_HUMAN	L	206;206;172	ENSP00000345575:Q206L;ENSP00000378363:Q206L;ENSP00000403313:Q172L	ENSP00000345575:Q206L	Q	-	2	0	DNAJB12	73770877	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	5.015000	0.64035	2.086000	0.62901	0.529000	0.55759	CAG	.		0.602	DNAJB12-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048581.2		
CTSD	1509	broad.mit.edu;bcgsc.ca	37	11	1776167	1776167	+	Missense_Mutation	SNP	G	G	A	rs373621431		TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr11:1776167G>A	ENST00000236671.2	-	6	928	c.796C>T	c.(796-798)Cgc>Tgc	p.R266C	RP11-295K3.1_ENST00000427721.1_Silent_p.P136P	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	266					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TAGGCCTTGCGGGTGACATTC	0.627																																					p.R266C													.	CTSD-90	0			c.C796T						.	G	CYS/ARG	0,4404		0,0,2202	101.0	90.0	93.0		796	4.2	1.0	11		93	1,8597	1.2+/-3.3	0,1,4298	no	missense	CTSD	NM_001909.4	180	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	266/413	1776167	1,13001	2202	4299	6501	SO:0001583	missense	1509	exon6			CCTTGCGGGTGAC	M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.796C>T	11.37:g.1776167G>A	ENSP00000236671:p.Arg266Cys	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	105	31	NM_001909	0	2	2822	4322	1498	Q6IB57	Missense_Mutation	SNP	ENST00000236671.2	37	CCDS7725.1	.	.	.	.	.	.	.	.	.	.	g	21.0	4.084397	0.76642	0.0	1.16E-4	ENSG00000117984	ENST00000236671;ENST00000429746;ENST00000438213	T;T;T	0.62788	0.16;0.0;0.32	4.25	4.25	0.50352	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.85617	0.5738	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90785	0.4682	10	0.87932	D	0	.	17.2114	0.86931	0.0:0.0:1.0:0.0	.	266	P07339	CATD_HUMAN	C	266;4;251	ENSP00000236671:R266C;ENSP00000402586:R4C;ENSP00000415036:R251C	ENSP00000236671:R266C	R	-	1	0	CTSD	1732743	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	5.338000	0.65947	2.373000	0.80994	0.455000	0.32223	CGC	.		0.627	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
NRXN2	9379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64453122	64453122	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr11:64453122C>T	ENST00000377551.1	-	5	1359	c.1148G>A	c.(1147-1149)cGc>cAc	p.R383H	NRXN2_ENST00000265459.6_Missense_Mutation_p.R383H|NRXN2_ENST00000377559.3_Missense_Mutation_p.R359H|NRXN2_ENST00000409571.1_Missense_Mutation_p.R383H			Q9P2S2	NRX2A_HUMAN	neurexin 2	383	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TCCTACCTGGCGCAGGTTTCG	0.602																																					p.R383H		.											.	NRXN2-232	0			c.G1148A						.						86.0	87.0	86.0					11																	64453122		2201	4297	6498	SO:0001583	missense	9379	exon6			ACCTGGCGCAGGT		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1148G>A	11.37:g.64453122C>T	ENSP00000366774:p.Arg383His	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	124	40	NM_015080	0	0	0	0	0	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.9|25.9	4.684359|4.684359	0.88639|0.88639	.|.	.|.	ENSG00000110076|ENSG00000110076	ENST00000417749|ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571;ENST00000442300	.|T;T;T;T;T	.|0.78481	.|-1.18;-1.18;-1.18;-1.18;-1.18	4.0|4.0	4.0|4.0	0.46444|0.46444	.|Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.|0.000000	.|0.44097	.|U	.|0.000496	D|D	0.84969|0.84969	0.5590|0.5590	M|M	0.62088|0.62088	1.915|1.915	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.87578	.|0.998;0.987;0.998	D|D	0.86396|0.86396	0.1739|0.1739	5|10	.|0.87932	.|D	.|0	.|.	11.9853|11.9853	0.53145|0.53145	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|359;383;136	.|Q9P2S2-2;Q9P2S2;E7EV67	.|.;NRX2A_HUMAN;.	T|H	144|383;359;383;359;383;154	.|ENSP00000366774:R383H;ENSP00000366782:R359H;ENSP00000265459:R383H;ENSP00000386416:R383H;ENSP00000388971:R154H	.|ENSP00000265459:R383H	A|R	-|-	1|2	0|0	NRXN2|NRXN2	64209698|64209698	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	7.814000|7.814000	0.86154|0.86154	1.951000|1.951000	0.56629|0.56629	0.467000|0.467000	0.42956|0.42956	GCC|CGC	.		0.602	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
ROBO4	54538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	124765531	124765531	+	Silent	SNP	G	G	A			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr11:124765531G>A	ENST00000306534.3	-	6	1343	c.858C>T	c.(856-858)acC>acT	p.T286T	ROBO4_ENST00000526899.1_5'Flank|ROBO4_ENST00000533054.1_Silent_p.T141T	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	286	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GGGCAGTCTGGGTCCTGAACA	0.672																																					p.T286T		.											.	ROBO4-92	0			c.C858T						.						36.0	44.0	41.0					11																	124765531		2193	4283	6476	SO:0001819	synonymous_variant	54538	exon6			AGTCTGGGTCCTG	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.858C>T	11.37:g.124765531G>A		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	117	36	NM_019055	0	0	0	0	0	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	ENST00000306534.3	37	CCDS8455.1																																																																																			.		0.672	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055	
LRP6	4040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	12334210	12334210	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr12:12334210T>G	ENST00000261349.4	-	6	1216	c.1140A>C	c.(1138-1140)gaA>gaC	p.E380D	LRP6_ENST00000543091.1_Missense_Mutation_p.E380D	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	380	Beta-propeller 2.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TGGCCCTCACTTCATCATCAG	0.463																																					p.E380D		.											.	LRP6-661	0			c.A1140C						.						216.0	181.0	193.0					12																	12334210		2203	4300	6503	SO:0001583	missense	4040	exon6			CCTCACTTCATCA	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1140A>C	12.37:g.12334210T>G	ENSP00000261349:p.Glu380Asp	Somatic	179	1		WXS	Illumina HiSeq	Phase_I	169	59	NM_002336	0	0	0	3	3	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	T	13.15	2.151454	0.38021	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.96200	-3.94;-3.94	5.82	5.82	0.92795	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000006	D	0.92678	0.7673	L	0.60012	1.86	0.49687	D	0.999818	B;B	0.12013	0.001;0.005	B;B	0.17979	0.003;0.02	D	0.88054	0.2789	10	0.28530	T	0.3	.	8.5301	0.33329	0.0:0.1434:0.0:0.8566	.	380;380	F5H7J9;O75581	.;LRP6_HUMAN	D	380	ENSP00000261349:E380D;ENSP00000442472:E380D	ENSP00000261349:E380D	E	-	3	2	LRP6	12225477	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.255000	0.32909	2.222000	0.72286	0.533000	0.62120	GAA	.		0.463	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
CAND1	55832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	67691215	67691215	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr12:67691215C>A	ENST00000545606.1	+	5	957	c.520C>A	c.(520-522)Cct>Act	p.P174T		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	174					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TAATTTCCATCCTTCAATTCT	0.408																																					p.P174T		.											.	CAND1-516	0			c.C520A						.						119.0	122.0	121.0					12																	67691215		2203	4300	6503	SO:0001583	missense	55832	exon5			TTCCATCCTTCAA		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.520C>A	12.37:g.67691215C>A	ENSP00000442318:p.Pro174Thr	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	154	35	NM_018448	0	0	10	17	7	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.751582	0.49257	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047	T	0.66099	-0.19	5.34	5.34	0.76211	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63546	0.2520	M	0.65498	2.005	0.80722	D	1	B	0.25521	0.128	B	0.27380	0.079	T	0.59968	-0.7354	9	.	.	.	-15.7741	19.057	0.93069	0.0:1.0:0.0:0.0	.	174	Q86VP6	CAND1_HUMAN	T	174;174;16	ENSP00000442318:P174T	.	P	+	1	0	CAND1	65977482	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.879000	0.69690	2.508000	0.84585	0.655000	0.94253	CCT	.		0.408	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
TDG	6996	hgsc.bcm.edu	37	12	104359839	104359839	+	Splice_Site	SNP	G	G	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr12:104359839G>C	ENST00000392872.3	+	1	257		c.e1+1		TDG_ENST00000544861.1_Splice_Site|C12orf73_ENST00000543740.2_5'Flank|C12orf73_ENST00000553183.1_5'Flank|TDG_ENST00000266775.9_Splice_Site	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		ACGCGGGCAGGTAATACCGGG	0.716								Base excision repair (BER), DNA glycosylases																													.		.											.	TDG-661	0			c.23+1G>C						.						9.0	11.0	10.0					12																	104359839		2158	4241	6399	SO:0001630	splice_region_variant	6996	exon1			GGGCAGGTAATAC	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.23+1G>C	12.37:g.104359839G>C		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	17	2	NM_003211	0	0	0	0	0	Q8IUZ6|Q8IZM3	Splice_Site	SNP	ENST00000392872.3	37	CCDS9095.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921936	0.33908	.	.	ENSG00000139372	ENST00000392872;ENST00000537100	.	.	.	5.29	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5561	0.39339	0.0968:0.0:0.9032:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TDG	102883969	1.000000	0.71417	1.000000	0.80357	0.205000	0.24178	4.279000	0.58953	1.225000	0.43566	0.491000	0.48974	.	.		0.716	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2		Intron
CIT	11113	broad.mit.edu	37	12	120150415	120150415	+	Silent	SNP	G	G	C	rs147828404		TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr12:120150415G>C	ENST00000261833.7	-	35	4591	c.4539C>G	c.(4537-4539)ctC>ctG	p.L1513L	MIR1178_ENST00000408396.1_RNA|CIT_ENST00000392521.2_Silent_p.L1555L|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1513	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CTGTATTTGCGAGTTCGGAAG	0.607																																					p.L1555L													.	CIT-399	0			c.C4665G						.						66.0	65.0	65.0					12																	120150415		2203	4300	6503	SO:0001819	synonymous_variant	11113	exon36			ATTTGCGAGTTCG	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.4539C>G	12.37:g.120150415G>C		Somatic	109	0		WXS	Illumina HiSeq	Phase_I	84	4	NM_001206999	0	0	1	1	0	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	37	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	G	5.626	0.300157	0.10622	.	.	ENSG00000122966	ENST00000392520	.	.	.	5.92	-4.88	0.03113	.	.	.	.	.	T	0.39358	0.1075	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41342	-0.9514	4	.	.	.	.	3.3781	0.07244	0.536:0.2225:0.1298:0.1118	.	.	.	.	W	1126	.	.	S	-	2	0	CIT	118634798	0.000000	0.05858	0.979000	0.43373	0.980000	0.70556	-0.772000	0.04694	-0.505000	0.06568	-0.738000	0.03535	TCG	G|1.000;A|0.000		0.607	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
CHD8	57680	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	21862588	21862588	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr14:21862588T>A	ENST00000557364.1	-	31	5710	c.5447A>T	c.(5446-5448)gAa>gTa	p.E1816V	CHD8_ENST00000399982.2_Missense_Mutation_p.E1816V|CHD8_ENST00000555962.1_5'Flank|CHD8_ENST00000430710.3_Missense_Mutation_p.E1537V|SNORD9_ENST00000362566.1_RNA|SNORD8_ENST00000363915.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1816					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AGGGTCATATTCCACACCAAA	0.438																																					p.E1816V													.	CHD8-277	0			c.A5447T						.						64.0	64.0	64.0					14																	21862588		1999	4184	6183	SO:0001583	missense	57680	exon30			TCATATTCCACAC	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.5447A>T	14.37:g.21862588T>A	ENSP00000451601:p.Glu1816Val	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	26	9	NM_001170629	0	0	2	6	4	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	CCDS53885.1	.	.	.	.	.	.	.	.	.	.	T	12.37	1.917857	0.33815	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.85258	-1.96;-1.96;-1.96	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.71316	0.3325	N	0.04335	-0.225	0.80722	D	1	B	0.19073	0.033	B	0.24155	0.051	T	0.67542	-0.5644	10	0.32370	T	0.25	-24.4652	14.5778	0.68262	0.0:0.0:0.0:1.0	.	1537	Q9HCK8-2	.	V	1537;1816;1536;1816	ENSP00000406288:E1537V;ENSP00000382863:E1816V;ENSP00000451601:E1816V	ENSP00000262707:E1536V	E	-	2	0	CHD8	20932428	0.917000	0.31117	1.000000	0.80357	0.950000	0.60333	3.169000	0.50809	2.272000	0.75746	0.460000	0.39030	GAA	.		0.438	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
NR2F2	7026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	96875635	96875635	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr15:96875635A>G	ENST00000394166.3	+	1	1690	c.301A>G	c.(301-303)Agc>Ggc	p.S101G	MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000453270.2_5'Flank|NR2F2_ENST00000421109.2_Intron|NR2F2_ENST00000394171.2_5'Flank	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	101					anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			GGGCTGCAAGAGCTTCTTCAA	0.612																																					p.S101G		.											.	NR2F2-228	0			c.A301G						.						66.0	53.0	57.0					15																	96875635		2197	4298	6495	SO:0001583	missense	7026	exon1			TGCAAGAGCTTCT	M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.301A>G	15.37:g.96875635A>G	ENSP00000377721:p.Ser101Gly	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	35	14	NM_021005	0	0	45	88	43	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Missense_Mutation	SNP	ENST00000394166.3	37	CCDS10375.1	.	.	.	.	.	.	.	.	.	.	A	17.76	3.468861	0.63625	.	.	ENSG00000185551	ENST00000394166	D	0.96745	-4.11	4.61	4.61	0.57282	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.187668	0.42821	N	0.000656	D	0.91784	0.7401	N	0.01235	-0.94	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.88109	0.2824	10	0.02654	T	1	.	12.8472	0.57837	1.0:0.0:0.0:0.0	.	101	P24468	COT2_HUMAN	G	101	ENSP00000377721:S101G	ENSP00000377721:S101G	S	+	1	0	NR2F2	94676639	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.257000	0.72480	1.705000	0.51264	0.379000	0.24179	AGC	.		0.612	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
CAMKK1	84254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	3788981	3788981	+	Start_Codon_SNP	SNP	T	T	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr17:3788981T>C	ENST00000348335.2	-	2	149	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	CAMKK1_ENST00000381769.2_Missense_Mutation_p.M28V|CAMKK1_ENST00000158166.5_Start_Codon_SNP_p.M1V|CAMKK1_ENST00000381771.2_Start_Codon_SNP_p.M1V	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	1					synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		CCCCCCTCCATTGCTTCAGTC	0.582																																					p.M1V		.											.	CAMKK1-334	0			c.A1G						.						39.0	38.0	39.0					17																	3788981		2203	4300	6503	SO:0001582	initiator_codon_variant	84254	exon2			CCTCCATTGCTTC	AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.1A>G	17.37:g.3788981T>C	ENSP00000323118:p.Met1Val	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	99	17	NM_032294	0	0	2	3	1	Q9BQH3	Missense_Mutation	SNP	ENST00000348335.2	37	CCDS11038.1	.	.	.	.	.	.	.	.	.	.	T	14.31	2.496111	0.44352	.	.	ENSG00000004660	ENST00000381769;ENST00000348335;ENST00000381771;ENST00000158166	T;T;T;T	0.74421	-0.47;-0.37;-0.84;-0.81	4.6	4.6	0.57074	.	0.057619	0.64402	D	0.000004	D	0.83806	0.5334	.	.	.	0.80722	D	1	P;P	0.43578	0.811;0.713	P;P	0.60789	0.879;0.678	D	0.85601	0.1252	9	0.87932	D	0	-40.8262	11.9824	0.53127	0.0:0.0:0.0:1.0	.	1;1	F8W9H1;Q8N5S9	.;KKCC1_HUMAN	V	28;1;1;1	ENSP00000371188:M28V;ENSP00000323118:M1V;ENSP00000371190:M1V;ENSP00000158166:M1V	ENSP00000158166:M1V	M	-	1	0	CAMKK1	3735730	0.992000	0.36948	0.978000	0.43139	0.923000	0.55619	2.528000	0.45624	1.953000	0.56701	0.459000	0.35465	ATG	.		0.582	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207456.1	NM_032294, NM_172206, NM_172207	Missense_Mutation
MYBBP1A	10514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	4451584	4451584	+	Silent	SNP	C	C	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr17:4451584C>T	ENST00000254718.4	-	12	1884	c.1578G>A	c.(1576-1578)acG>acA	p.T526T	MYBBP1A_ENST00000381556.2_Silent_p.T526T			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	526	Interaction with MYB. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						GCTTGAACTGCGTGCTGAGGG	0.637																																					p.T526T		.											.	MYBBP1A-92	0			c.G1578A						.						64.0	64.0	64.0					17																	4451584		2203	4300	6503	SO:0001819	synonymous_variant	10514	exon12			GAACTGCGTGCTG	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.1578G>A	17.37:g.4451584C>T		Somatic	136	0		WXS	Illumina HiSeq	Phase_I	198	111	NM_014520	0	0	6	27	21	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Silent	SNP	ENST00000254718.4	37	CCDS11046.1																																																																																			.		0.637	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
KRT40	125115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39140321	39140321	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr17:39140321T>A	ENST00000398486.2	-	3	365	c.205A>T	c.(205-207)Aat>Tat	p.N69Y	KRT40_ENST00000377755.4_Missense_Mutation_p.N69Y	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	69	Head.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				CAGGGACTATTACAACTCCCA	0.547																																					p.N69Y		.											.	.	0			c.A205T						.						114.0	117.0	116.0					17																	39140321		2173	4258	6431	SO:0001583	missense	125115	exon3			GACTATTACAACT	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.205A>T	17.37:g.39140321T>A	ENSP00000381500:p.Asn69Tyr	Somatic	166	1		WXS	Illumina HiSeq	Phase_I	228	126	NM_182497	0	0	0	0	0	Q6IFU5	Missense_Mutation	SNP	ENST00000398486.2	37	CCDS42320.1	.	.	.	.	.	.	.	.	.	.	T	10.08	1.253146	0.22965	.	.	ENSG00000204889	ENST00000377755;ENST00000398486	D;D	0.83419	-1.72;-1.72	4.54	-0.567	0.11763	.	0.221645	0.22876	N	0.054568	T	0.74764	0.3759	M	0.71036	2.16	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.57277	-0.7839	10	0.21014	T	0.42	.	4.4502	0.11617	0.0:0.3063:0.3369:0.3568	.	69	Q6A162	K1C40_HUMAN	Y	69	ENSP00000366984:N69Y;ENSP00000381500:N69Y	ENSP00000366984:N69Y	N	-	1	0	KRT40	36393847	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.054000	0.14205	-0.220000	0.09988	0.482000	0.46254	AAT	.		0.547	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497	
ADAM11	4185	broad.mit.edu;bcgsc.ca	37	17	42855164	42855164	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr17:42855164C>G	ENST00000200557.6	+	23	2172	c.2003C>G	c.(2002-2004)cCa>cGa	p.P668R	ADAM11_ENST00000535346.1_Missense_Mutation_p.P468R	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	668	Cys-rich.				integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				CGCTGCCTGCCAGCTTCTGCC	0.657																																					p.P668R													.	ADAM11-227	0			c.C2003G						.						43.0	40.0	41.0					17																	42855164		2203	4300	6503	SO:0001583	missense	4185	exon23			GCCTGCCAGCTTC	D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.2003C>G	17.37:g.42855164C>G	ENSP00000200557:p.Pro668Arg	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	72	48	NM_002390	0	0	1	1	0	Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	37	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260507	0.80246	.	.	ENSG00000073670	ENST00000200557;ENST00000535346	T;T	0.02067	4.47;4.87	4.36	4.36	0.52297	ADAM, cysteine-rich (1);	0.000000	0.85682	D	0.000000	T	0.11879	0.0289	M	0.73430	2.235	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.967;0.998	T	0.01776	-1.1276	10	0.44086	T	0.13	.	15.8196	0.78628	0.0:1.0:0.0:0.0	.	468;668	B4DKD2;O75078	.;ADA11_HUMAN	R	668;468	ENSP00000200557:P668R;ENSP00000443773:P468R	ENSP00000200557:P668R	P	+	2	0	ADAM11	40210690	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.550000	0.82173	2.256000	0.74724	0.561000	0.74099	CCA	.		0.657	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
GPRC5C	55890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72436053	72436053	+	Silent	SNP	T	T	A			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr17:72436053T>A	ENST00000481232.1	+	2	784	c.273T>A	c.(271-273)tcT>tcA	p.S91S	GPRC5C_ENST00000342648.5_Intron|GPRC5C_ENST00000392629.2_Silent_p.S58S|GPRC5C_ENST00000392627.1_Silent_p.S91S			Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	46					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						GTGACCGCTCTGGGGCGTGGG	0.662																																					p.S91S		.											.	GPRC5C-525	0			c.T273A						.						62.0	59.0	60.0					17																	72436053		2203	4299	6502	SO:0001819	synonymous_variant	55890	exon2			CCGCTCTGGGGCG	AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000481232.1:c.273T>A	17.37:g.72436053T>A		Somatic	95	0		WXS	Illumina HiSeq	Phase_I	178	98	NM_022036	0	0	57	250	193	B5BUN4|Q2NL85|Q9NZG5	Silent	SNP	ENST00000481232.1	37																																																																																				.		0.662	GPRC5C-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000145095.2		
POTEC	388468	broad.mit.edu	37	18	14513675	14513675	+	Missense_Mutation	SNP	T	T	C	rs371810308	byFrequency	TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr18:14513675T>C	ENST00000358970.5	-	10	1518	c.1519A>G	c.(1519-1521)Aaa>Gaa	p.K507E		NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	507								p.K507E(2)		NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						GAATTCATTTTCTTTTCAGCC	0.284													.|||	3	0.000599042	0.0	0.0	5008	,	,		16953	0.003		0.0	False		,,,				2504	0.0				p.K507E													.	POTEC-3	2	Substitution - Missense(2)	urinary_tract(1)|prostate(1)	c.A1519G						.						164.0	115.0	130.0					18																	14513675		692	1590	2282	SO:0001583	missense	388468	exon10			TCATTTTCTTTTC	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.1519A>G	18.37:g.14513675T>C	ENSP00000351856:p.Lys507Glu	Somatic	95	1		WXS	Illumina HiSeq	Phase_I	110	4	NM_001137671	0	0	0	0	0		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	t	0.001	-3.812128	0.00004	.	.	ENSG00000183206	ENST00000358970	T	0.32753	1.44	1.53	-3.07	0.05363	.	.	.	.	.	T	0.10165	0.0249	N	0.11427	0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31752	-0.9932	9	0.02654	T	1	.	3.0168	0.06063	0.0:0.3604:0.2511:0.3885	.	507	B2RU33	POTEC_HUMAN	E	507	ENSP00000351856:K507E	ENSP00000351856:K507E	K	-	1	0	POTEC	14503675	0.024000	0.19004	0.012000	0.15200	0.024000	0.10985	-0.021000	0.12504	-1.054000	0.03214	-3.018000	0.00074	AAA	.		0.284	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
FZR1	51343	broad.mit.edu;bcgsc.ca	37	19	3525916	3525916	+	Silent	SNP	G	G	A	rs201664307		TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr19:3525916G>A	ENST00000395095.3	+	2	120	c.120G>A	c.(118-120)tcG>tcA	p.S40S	FZR1_ENST00000441788.2_Silent_p.S40S|FZR1_ENST00000313639.8_Silent_p.S40S	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	40					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGTGTCCTCGCCCAGCAAGC	0.647																																					p.S40S													.	FZR1-227	0			c.G120A						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	38.0	37.0	37.0		120,120,120	-9.3	0.9	19		37	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous,coding-synonymous	FZR1	NM_001136197.1,NM_001136198.1,NM_016263.3	,,	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	,,	40/405,40/497,40/494	3525916	1,12999	2203	4297	6500	SO:0001819	synonymous_variant	51343	exon2			GTCCTCGCCCAGC	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.120G>A	19.37:g.3525916G>A		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	39	11	NM_001136197	0	0	12	18	6	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Silent	SNP	ENST00000395095.3	37	CCDS45916.1																																																																																			G|0.999;A|0.001		0.647	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
ZNF493	284443	hgsc.bcm.edu	37	19	21606636	21606636	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr19:21606636T>C	ENST00000355504.4	+	2	1057	c.791T>C	c.(790-792)cTt>cCt	p.L264P	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Missense_Mutation_p.L392P	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						TTCTCAACCCTTACTAAACAT	0.368																																					p.L392P		.											.	ZNF493-516	0			c.T1175C						.						38.0	41.0	40.0					19																	21606636		2197	4293	6490	SO:0001583	missense	284443	exon4			CAACCCTTACTAA	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.791T>C	19.37:g.21606636T>C	ENSP00000347691:p.Leu264Pro	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	68	4	NM_001076678	0	0	5	6	1	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	37	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	12.34	1.909058	0.33721	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.53857	0.6;0.6	1.03	1.03	0.20045	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.72898	0.3518	M	0.91972	3.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.72327	-0.4327	9	0.87932	D	0	.	6.9938	0.24769	0.0:0.0:0.0:1.0	.	264;392	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	P	392;264	ENSP00000376110:L392P;ENSP00000347691:L264P	ENSP00000347691:L264P	L	+	2	0	ZNF493	21398476	0.172000	0.23043	0.012000	0.15200	0.012000	0.07955	3.865000	0.56033	0.379000	0.24794	0.373000	0.22412	CTT	.		0.368	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
C2orf44	80304	bcgsc.ca	37	2	24261378	24261378	+	Silent	SNP	G	G	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr2:24261378G>C	ENST00000295148.4	-	2	1044	c.987C>G	c.(985-987)acC>acG	p.T329T	C2orf44_ENST00000406895.3_Silent_p.T329T	NM_025203.2	NP_079479.1	Q9H6R7	CB044_HUMAN	chromosome 2 open reading frame 44	329									C2orf44/ALK(2)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTCGTCATGGTAACTGCCT	0.408			T	ALK	NSCLC																																p.T329T				Dom	yes		2	2p23.3	80304	chromosome 2 open reading frame 44		E	.	C2orf44-154	0			c.C987G						.																																			SO:0001819	synonymous_variant	80304	exon2			CGTCATGGTAACT	AK025598	CCDS1705.1, CCDS46229.1	2p23.3	2012-07-30			ENSG00000163026	ENSG00000163026			26157	protein-coding gene	gene with protein product						22327622	Standard	NM_025203		Approved	FLJ21945	uc002rep.2	Q9H6R7	OTTHUMG00000125498	ENST00000295148.4:c.987C>G	2.37:g.24261378G>C		Somatic	75	0		WXS	Illumina HiSeq	Phase_1	89	5	NM_025203	0	0	1	1	0	D6W532|Q8IYK0|Q9HBP5	Silent	SNP	ENST00000295148.4	37	CCDS1705.1																																																																																			.		0.408	C2orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246825.1	NM_025203	
KCNG3	170850	ucsc.edu	37	2	42720017	42720017	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr2:42720017G>A	ENST00000306078.1	-	1	1220	c.625C>T	c.(625-627)Cgg>Tgg	p.R209W	KCNG3_ENST00000394973.4_Missense_Mutation_p.R209W|MTA3_ENST00000405592.1_5'Flank	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G, member 3	209					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	6						TACCTGCTCCGGTCATCCAGG	0.687																																					p.R209W													.	KCNG3-90	0			c.C625T						.						22.0	17.0	19.0					2																	42720017		2167	4259	6426	SO:0001583	missense	170850	exon1			TGCTCCGGTCATC	AB070604	CCDS1809.1, CCDS42674.1	2p21	2011-07-05			ENSG00000171126	ENSG00000171126		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18306	protein-coding gene	gene with protein product		606767				11852086, 16382104	Standard	NM_133329		Approved	Kv6.3	uc002rsn.3	Q8TAE7	OTTHUMG00000128604	ENST00000306078.1:c.625C>T	2.37:g.42720017G>A	ENSP00000304127:p.Arg209Trp	Somatic	28	0		WXS	Illumina HiSeq		41	4	NM_172344	0	0	0	0	0	Q53SC1	Missense_Mutation	SNP	ENST00000306078.1	37	CCDS1809.1	.	.	.	.	.	.	.	.	.	.	G	15.32	2.797664	0.50208	.	.	ENSG00000171126	ENST00000306078;ENST00000394973	D;D	0.97378	-4.32;-4.36	4.55	4.55	0.56014	.	15.145900	0.00166	N	0.000013	D	0.95611	0.8573	N	0.14661	0.345	0.30668	N	0.753658	B;P	0.44281	0.431;0.831	B;P	0.50231	0.109;0.635	D	0.90095	0.4180	10	0.72032	D	0.01	.	9.2626	0.37621	0.0:0.1576:0.6796:0.1628	.	209;209	Q8TAE7;Q8TAE7-2	KCNG3_HUMAN;.	W	209	ENSP00000304127:R209W;ENSP00000378424:R209W	ENSP00000304127:R209W	R	-	1	2	KCNG3	42573521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.743000	0.47442	2.069000	0.61940	0.563000	0.77884	CGG	.		0.687	KCNG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250464.2	NM_172344	
DCTN1	1639	broad.mit.edu	37	2	74604848	74604848	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr2:74604848C>G	ENST00000361874.3	-	3	602	c.285G>C	c.(283-285)caG>caC	p.Q95H	DCTN1_ENST00000394003.3_Missense_Mutation_p.Q95H|DCTN1_ENST00000407639.2_5'Flank|DCTN1_ENST00000409868.1_Missense_Mutation_p.Q78H|DCTN1_ENST00000409240.1_Missense_Mutation_p.Q78H|DCTN1_ENST00000409438.1_5'Flank|DCTN1_ENST00000409567.3_Missense_Mutation_p.Q95H	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	95					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CTTCAAATACCTGGATCTGAG	0.458																																					p.Q95H													.	DCTN1-95	0			c.G285C						.						124.0	126.0	125.0					2																	74604848		2203	4300	6503	SO:0001583	missense	1639	exon3			AAATACCTGGATC		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.285G>C	2.37:g.74604848C>G	ENSP00000354791:p.Gln95His	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	121	3	NM_001135040	0	0	0	0	0	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	37	CCDS1939.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728596	0.69074	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000409240;ENST00000409868;ENST00000409567;ENST00000458655;ENST00000454119;ENST00000417090;ENST00000437375	T;T;T;T;T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88	5.17	2.35	0.29111	Cytoskeleton-associated protein, Gly-rich domain (2);	0.000000	0.41097	D	0.000953	T	0.81413	0.4817	M	0.69523	2.12	0.80722	D	1	D;P;D;D	0.61697	0.99;0.685;0.967;0.987	D;P;D;D	0.64595	0.922;0.685;0.923;0.927	T	0.79790	-0.1655	10	0.45353	T	0.12	-9.9712	9.8164	0.40856	0.0:0.7639:0.0:0.2361	.	95;78;95;95	E9PGE1;E9PFS5;Q14203;A8MY36	.;.;DCTN1_HUMAN;.	H	95;95;78;78;78;95;102;78;99;78	ENSP00000354791:Q95H;ENSP00000377571:Q95H;ENSP00000386406:Q78H;ENSP00000387327:Q78H;ENSP00000386843:Q95H;ENSP00000414315:Q102H;ENSP00000404038:Q78H;ENSP00000402509:Q99H;ENSP00000395312:Q78H	ENSP00000354791:Q95H	Q	-	3	2	DCTN1	74458356	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.967000	0.29344	0.762000	0.33152	0.655000	0.94253	CAG	.		0.458	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	
APMAP	57136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	24944513	24944513	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr20:24944513C>T	ENST00000217456.2	-	9	1477	c.1187G>A	c.(1186-1188)gGg>gAg	p.G396E	APMAP_ENST00000447138.1_3'UTR	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	396					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										GTACAGGTGCCCATCGTGTTC	0.627																																					p.G396E		.											.	.	0			c.G1187A						.						103.0	94.0	97.0					20																	24944513		2203	4300	6503	SO:0001583	missense	57136	exon9			AGGTGCCCATCGT	AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.1187G>A	20.37:g.24944513C>T	ENSP00000217456:p.Gly396Glu	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	139	24	NM_020531	0	0	109	153	44	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	ENST00000217456.2	37	CCDS13166.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.06|17.06	3.291373|3.291373	0.59976|0.59976	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000217456|ENST00000451442	T|T	0.36520|0.35605	1.25|1.3	4.86|4.86	4.86|4.86	0.63082|0.63082	Six-bladed beta-propeller, TolB-like (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.58708|0.58708	0.2141|0.2141	M|M	0.82132|0.82132	2.575|2.575	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.973|.	D;P|.	0.68192|.	0.956;0.685|.	T|T	0.64643|0.64643	-0.6359|-0.6359	10|8	0.44086|0.62326	T|D	0.13|0.03	-18.3321|-18.3321	15.4972|15.4972	0.75662|0.75662	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	388;396|.	A2A2F9;Q9HDC9|.	.;APMAP_HUMAN|.	E|S	396|389	ENSP00000217456:G396E|ENSP00000395874:G389S	ENSP00000217456:G396E|ENSP00000395874:G389S	G|G	-|-	2|1	0|0	C20orf3|C20orf3	24892513|24892513	1.000000|1.000000	0.71417|0.71417	0.502000|0.502000	0.27614|0.27614	0.164000|0.164000	0.22412|0.22412	7.726000|7.726000	0.84824|0.84824	2.216000|2.216000	0.71823|0.71823	0.561000|0.561000	0.74099|0.74099	GGG|GGC	.		0.627	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078380.2	NM_020531	
NCOA3	8202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	46254125	46254125	+	Splice_Site	SNP	G	G	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr20:46254125G>T	ENST00000371998.3	+	5	448	c.257G>T	c.(256-258)gGa>gTa	p.G86V	NCOA3_ENST00000341724.6_Splice_Site_p.G86V|NCOA3_ENST00000372004.3_Splice_Site_p.G86V|NCOA3_ENST00000371997.3_Splice_Site_p.G86V			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	86					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GTCTTTTCAGGAAAAACTATT	0.378																																					p.G86V		.											.	NCOA3-229	0			c.G257T						.						98.0	89.0	92.0					20																	46254125		2203	4300	6503	SO:0001630	splice_region_variant	8202	exon5			TTTCAGGAAAAAC	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.257-1G>T	20.37:g.46254125G>T		Somatic	63	1		WXS	Illumina HiSeq	Phase_I	105	45	NM_181659	0	0	0	0	0	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920015	0.73098	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.02472	4.28;4.43;4.44;4.29	5.62	5.62	0.85841	Helix-loop-helix DNA-binding (3);	0.000000	0.85682	D	0.000000	T	0.12603	0.0306	L	0.52573	1.65	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.994;0.994;0.995;0.996	D;D;D;D;D	0.97110	1.0;0.922;0.922;0.964;0.943	T	0.01858	-1.1259	9	.	.	.	.	19.6585	0.95853	0.0:0.0:1.0:0.0	.	86;90;86;86;86	Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;NCOA3_HUMAN	V	86	ENSP00000342123:G86V;ENSP00000361073:G86V;ENSP00000361066:G86V;ENSP00000361065:G86V	.	G	+	2	0	NCOA3	45687532	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.062000	0.89475	2.657000	0.90304	0.467000	0.42956	GGA	.		0.378	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	Missense_Mutation
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	41459172	41459172	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr21:41459172G>A	ENST00000400454.1	-	22	4370	c.3893C>T	c.(3892-3894)cCa>cTa	p.P1298L		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1298	Ig-like C2-type 10.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TTTCATCCATGGAGTAGTCAC	0.488																																					p.P1298L	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM-101	0			c.C3893T						.						152.0	147.0	149.0					21																	41459172		1995	4169	6164	SO:0001583	missense	1826	exon22			ATCCATGGAGTAG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3893C>T	21.37:g.41459172G>A	ENSP00000383303:p.Pro1298Leu	Somatic	165	0		WXS	Illumina HiSeq	Phase_I	137	14	NM_001271534	0	0	0	0	0	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.670051	0.88348	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.25912	1.77;1.77	4.71	4.71	0.59529	Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.41488	0.1161	L	0.33339	1.005	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.35226	-0.9797	10	0.59425	D	0.04	.	18.0505	0.89347	0.0:0.0:1.0:0.0	.	1298	O60469	DSCAM_HUMAN	L	1298;1050	ENSP00000383303:P1298L;ENSP00000385342:P1050L	ENSP00000383303:P1298L	P	-	2	0	DSCAM	40381042	1.000000	0.71417	0.262000	0.24481	0.988000	0.76386	9.633000	0.98432	2.316000	0.78162	0.563000	0.77884	CCA	.		0.488	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
SNAP29	9342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	21237785	21237785	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr22:21237785G>C	ENST00000215730.7	+	4	675	c.547G>C	c.(547-549)Gcc>Ccc	p.A183P		NM_004782.3	NP_004773.1	O95721	SNP29_HUMAN	synaptosomal-associated protein, 29kDa	183					autophagic vacuole fusion (GO:0000046)|exocytosis (GO:0006887)|membrane fusion (GO:0061025)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|upper_aerodigestive_tract(1)	9	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			GGCTGGTTCTGCCATGAGTAC	0.498																																					p.A183P		.											.	SNAP29-278	0			c.G547C						.						218.0	198.0	205.0					22																	21237785		2203	4300	6503	SO:0001583	missense	9342	exon4			GGTTCTGCCATGA	AF115436	CCDS13784.1	22q11.21	2008-06-10	2002-08-29		ENSG00000099940	ENSG00000099940			11133	protein-coding gene	gene with protein product	"""soluble 29 kDa NSF attachment protein"""	604202	"""synaptosomal-associated protein, 29kD"""			9852078, 10591208	Standard	NM_004782		Approved	SNAP-29, CEDNIK	uc011ahw.2	O95721	OTTHUMG00000150765	ENST00000215730.7:c.547G>C	22.37:g.21237785G>C	ENSP00000215730:p.Ala183Pro	Somatic	385	1		WXS	Illumina HiSeq	Phase_I	327	100	NM_004782	0	0	19	42	23		Missense_Mutation	SNP	ENST00000215730.7	37	CCDS13784.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944634	0.34283	.	.	ENSG00000099940	ENST00000215730;ENST00000439214	.	.	.	4.17	-2.31	0.06765	SNAP-25 (1);	0.598056	0.18243	N	0.147169	T	0.17408	0.0418	N	0.22421	0.69	0.09310	N	1	P	0.41524	0.753	P	0.44921	0.464	T	0.12319	-1.0552	9	0.33141	T	0.24	-0.0293	2.763	0.05312	0.3197:0.0:0.3417:0.3386	.	183	O95721	SNP29_HUMAN	P	183;90	.	ENSP00000215730:A183P	A	+	1	0	SNAP29	19567785	0.014000	0.17966	0.001000	0.08648	0.009000	0.06853	0.143000	0.16115	-0.176000	0.10707	-0.218000	0.12543	GCC	.		0.498	SNAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320000.4	NM_004782	
HIC2	23119	hgsc.bcm.edu	37	22	21799620	21799620	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr22:21799620T>C	ENST00000443632.2	+	2	808	c.436T>C	c.(436-438)Ttt>Ctt	p.F146L	HIC2_ENST00000407464.2_Missense_Mutation_p.F146L|HIC2_ENST00000407598.2_Missense_Mutation_p.F146L			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	146					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				CGGCAAGCCCTTTGGCTCTGG	0.692																																					p.F146L	NSCLC(23;437 858 2282 27947 40366)	.											.	HIC2-703	0			c.T436C						.						11.0	15.0	13.0					22																	21799620		2165	4263	6428	SO:0001583	missense	23119	exon3			AAGCCCTTTGGCT	AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.436T>C	22.37:g.21799620T>C	ENSP00000387757:p.Phe146Leu	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_015094	0	0	0	0	0	Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Missense_Mutation	SNP	ENST00000443632.2	37	CCDS13789.1	.	.	.	.	.	.	.	.	.	.	T	9.525	1.109373	0.20714	.	.	ENSG00000169635	ENST00000407464;ENST00000407598;ENST00000443632	T;T;T	0.08634	3.07;3.07;3.07	5.01	5.01	0.66863	.	0.114448	0.64402	N	0.000011	T	0.07007	0.0178	L	0.28556	0.865	0.41520	D	0.98839	B	0.12630	0.006	B	0.12837	0.008	T	0.32561	-0.9902	10	0.18276	T	0.48	.	12.7212	0.57144	0.0:0.0:0.0:1.0	.	146	Q96JB3	HIC2_HUMAN	L	146	ENSP00000385319:F146L;ENSP00000384889:F146L;ENSP00000387757:F146L	ENSP00000385319:F146L	F	+	1	0	HIC2	20129620	0.999000	0.42202	0.997000	0.53966	0.275000	0.26752	2.402000	0.44521	2.098000	0.63641	0.459000	0.35465	TTT	.		0.692	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320061.2		
KIAA1407	57577	broad.mit.edu	37	3	113724781	113724781	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr3:113724781T>C	ENST00000295878.3	-	10	1588	c.1442A>G	c.(1441-1443)aAg>aGg	p.K481R	KIAA1407_ENST00000545063.1_Missense_Mutation_p.K312R	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	481										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						CAAGGGAGGCTTTTCCCACAA	0.478																																					p.K481R													.	KIAA1407-92	0			c.A1442G						.						86.0	89.0	88.0					3																	113724781		2203	4300	6503	SO:0001583	missense	57577	exon10			GGAGGCTTTTCCC	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.1442A>G	3.37:g.113724781T>C	ENSP00000295878:p.Lys481Arg	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	177	4	NM_020817	0	0	9	9	0	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	37	CCDS2977.1	.	.	.	.	.	.	.	.	.	.	T	12.69	2.012114	0.35511	.	.	ENSG00000163617	ENST00000295878;ENST00000545063;ENST00000491000	T;T;T	0.47177	1.46;0.85;0.87	5.01	3.81	0.43845	.	0.829403	0.11209	N	0.587888	T	0.32285	0.0824	N	0.22421	0.69	0.80722	D	1	B;B;B	0.17667	0.002;0.023;0.002	B;B;B	0.17098	0.011;0.017;0.011	T	0.04467	-1.0949	10	0.18276	T	0.48	.	9.1934	0.37213	0.0:0.0876:0.0:0.9124	.	468;357;481	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	R	481;312;468	ENSP00000295878:K481R;ENSP00000446381:K312R;ENSP00000418099:K468R	ENSP00000295878:K481R	K	-	2	0	KIAA1407	115207471	0.173000	0.23056	0.775000	0.31657	0.262000	0.26303	0.849000	0.27723	0.877000	0.35895	0.533000	0.62120	AAG	.		0.478	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
HPS3	84343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	148872995	148872995	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr3:148872995A>G	ENST00000296051.2	+	8	1642	c.1502A>G	c.(1501-1503)aAa>aGa	p.K501R	HPS3_ENST00000460120.1_Missense_Mutation_p.K336R	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	501					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CAGCTGTACAAAGAGATGGTA	0.348									Hermansky-Pudlak syndrome																												p.K501R		.											.	HPS3-158	0			c.A1502G						.						136.0	141.0	140.0					3																	148872995		2203	4300	6503	SO:0001583	missense	84343	exon8	Familial Cancer Database	HPS, HPS1-8	TGTACAAAGAGAT	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1502A>G	3.37:g.148872995A>G	ENSP00000296051:p.Lys501Arg	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	96	29	NM_032383	0	0	0	0	0	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	ENST00000296051.2	37	CCDS3140.1	.	.	.	.	.	.	.	.	.	.	A	1.459	-0.562938	0.03939	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.64260	-0.09;-0.09	4.89	3.74	0.42951	.	0.205149	0.44902	N	0.000404	T	0.49474	0.1559	L	0.43923	1.385	0.25950	N	0.982762	B;B	0.22746	0.074;0.027	B;B	0.22386	0.039;0.013	T	0.35992	-0.9766	10	0.28530	T	0.3	-8.4607	7.6211	0.28185	0.8276:0.0:0.1724:0.0	.	336;501	G5E9V4;Q969F9	.;HPS3_HUMAN	R	501;336	ENSP00000296051:K501R;ENSP00000418230:K336R	ENSP00000296051:K501R	K	+	2	0	HPS3	150355685	1.000000	0.71417	0.999000	0.59377	0.018000	0.09664	2.513000	0.45494	1.000000	0.39049	-0.250000	0.11733	AAA	.		0.348	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383	
RBM47	54502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	40440532	40440532	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr4:40440532C>G	ENST00000381793.2	-	3	775	c.379G>C	c.(379-381)Gca>Cca	p.A127P	RBM47_ENST00000319592.4_Missense_Mutation_p.A127P|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000381795.6_Missense_Mutation_p.A127P|RBM47_ENST00000295971.7_Missense_Mutation_p.A127P|RBM47_ENST00000514014.1_Missense_Mutation_p.A89P			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	127	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						TCACGCACTGCGCGCTTGGCC	0.642																																					p.A127P		.											.	RBM47-25	0			c.G379C						.						61.0	51.0	55.0					4																	40440532		2203	4300	6503	SO:0001583	missense	54502	exon4			GCACTGCGCGCTT	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.379G>C	4.37:g.40440532C>G	ENSP00000371212:p.Ala127Pro	Somatic	59	1		WXS	Illumina HiSeq	Phase_I	54	9	NM_001098634	0	0	28	44	16	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Missense_Mutation	SNP	ENST00000381793.2	37	CCDS43223.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668830	0.88348	.	.	ENSG00000163694	ENST00000319592;ENST00000381793;ENST00000381795;ENST00000295971;ENST00000514014;ENST00000515053;ENST00000513473;ENST00000505414;ENST00000514782	T;T;T;T;T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16	5.58	5.58	0.84498	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.76343	0.3974	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.85506	0.1194	10	0.87932	D	0	-18.5386	19.5736	0.95432	0.0:1.0:0.0:0.0	.	127;127	A0AV96-2;A0AV96	.;RBM47_HUMAN	P	127;127;127;127;89;127;127;127;127	ENSP00000320108:A127P;ENSP00000371212:A127P;ENSP00000371214:A127P;ENSP00000295971:A127P;ENSP00000423243:A89P;ENSP00000422564:A127P;ENSP00000421589:A127P;ENSP00000423527:A127P;ENSP00000426542:A127P	ENSP00000295971:A127P	A	-	1	0	RBM47	40135289	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	7.813000	0.86123	2.635000	0.89317	0.313000	0.20887	GCA	.		0.642	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
STPG2	285555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	98633942	98633942	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr4:98633942A>T	ENST00000295268.3	-	10	1317	c.1228T>A	c.(1228-1230)Tta>Ata	p.L410I	STPG2_ENST00000506482.1_5'UTR	NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	410																	GATTTCCTTAAAACAGGATTG	0.348																																					p.L410I		.											.	.	0			c.T1228A						.						98.0	101.0	100.0					4																	98633942		2203	4300	6503	SO:0001583	missense	285555	exon10			TCCTTAAAACAGG	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.1228T>A	4.37:g.98633942A>T	ENSP00000295268:p.Leu410Ile	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	112	39	NM_174952	0	0	0	2	2		Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	A	10.61	1.397643	0.25205	.	.	ENSG00000163116	ENST00000522676;ENST00000295268	T;T	0.49139	0.79;2.73	4.85	2.3	0.28687	.	0.854661	0.09752	N	0.760480	T	0.32704	0.0838	L	0.27053	0.805	0.09310	N	0.999998	P	0.38300	0.626	B	0.40782	0.34	T	0.14868	-1.0457	10	0.23302	T	0.38	-8.0438	4.5761	0.12234	0.4933:0.3146:0.192:0.0	.	410	Q8N412	CD037_HUMAN	I	124;410	ENSP00000428346:L124I;ENSP00000295268:L410I	ENSP00000295268:L410I	L	-	1	2	C4orf37	98852965	0.779000	0.28652	0.948000	0.38648	0.774000	0.43823	0.556000	0.23438	1.930000	0.55929	0.528000	0.53228	TTA	.		0.348	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
DNAH5	1767	hgsc.bcm.edu	37	5	13727614	13727614	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr5:13727614A>G	ENST00000265104.4	-	70	12138		c.e70+1			NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGGACTTTTTACCTGGGCGAT	0.328									Kartagener syndrome																												.		.											.	DNAH5-182	0			c.12033+2T>C						.						54.0	55.0	55.0					5																	13727614		2202	4300	6502	SO:0001630	splice_region_variant	1767	exon71	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CTTTTTACCTGGG	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12033+1T>C	5.37:g.13727614A>G		Somatic	45	0		WXS	Illumina HiSeq	Phase_I	60	3	NM_001369	0	0	0	0	0	Q92860|Q96L74|Q9H5S7|Q9HCG9	Splice_Site	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.273400	0.80580	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9744	0.80049	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAH5	13780614	1.000000	0.71417	0.998000	0.56505	0.858000	0.48976	9.315000	0.96313	2.184000	0.69523	0.528000	0.53228	.	.		0.328	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	Intron
DMXL1	1657	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	118525502	118525502	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr5:118525502C>G	ENST00000311085.8	+	29	7315	c.7235C>G	c.(7234-7236)cCa>cGa	p.P2412R	DMXL1_ENST00000539542.1_Missense_Mutation_p.P2412R	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2412										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TCCTCGGCACCAGTAAGCCAG	0.438																																					p.P2412R													.	DMXL1-92	0			c.C7235G						.						107.0	110.0	109.0					5																	118525502		2202	4300	6502	SO:0001583	missense	1657	exon29			CGGCACCAGTAAG	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.7235C>G	5.37:g.118525502C>G	ENSP00000309690:p.Pro2412Arg	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	146	40	NM_005509	0	0	2	9	7		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	C	5.532	0.283090	0.10458	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.09538	2.97;2.97	6.05	2.08	0.27032	.	0.778290	0.12409	N	0.471491	T	0.08670	0.0215	L	0.42245	1.32	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.35574	-0.9783	10	0.21540	T	0.41	-0.8119	6.1712	0.20418	0.0:0.4786:0.211:0.3104	.	2412;2412	F5H269;Q9Y485	.;DMXL1_HUMAN	R	2412	ENSP00000309690:P2412R;ENSP00000439479:P2412R	ENSP00000309690:P2412R	P	+	2	0	DMXL1	118553401	0.000000	0.05858	0.185000	0.23176	0.361000	0.29550	-0.003000	0.12901	0.903000	0.36546	-0.143000	0.13931	CCA	.		0.438	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
CCNG1	900	bcgsc.ca	37	5	162868217	162868217	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr5:162868217A>G	ENST00000340828.2	+	3	622	c.398A>G	c.(397-399)gAc>gGc	p.D133G	CCNG1_ENST00000512163.1_5'UTR|CCNG1_ENST00000393929.1_Missense_Mutation_p.D133G|AC112205.1_ENST00000599797.1_Intron|CCNG1_ENST00000511683.2_5'UTR|CCNG1_ENST00000510664.1_Splice_Site_p.D5G|CCNG1_ENST00000504553.1_5'UTR	NM_004060.3	NP_004051.1	P51959	CCNG1_HUMAN	cyclin G1	133					brain development (GO:0007420)|cell growth (GO:0016049)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to organonitrogen compound (GO:0010243)|syncytium formation (GO:0006949)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		ACGGTTTCAGACTTGATGAGA	0.373																																					p.D133G													.	CCNG1-725	0			c.A398G						.						127.0	123.0	124.0					5																	162868217		2203	4300	6503	SO:0001583	missense	900	exon4			TTTCAGACTTGAT	D78341	CCDS4360.1	5q32-q34	2010-11-15			ENSG00000113328	ENSG00000113328			1592	protein-coding gene	gene with protein product		601578		CCNG		8954786, 8806701	Standard	NM_004060		Approved		uc003lzb.3	P51959	OTTHUMG00000130380	ENST00000340828.2:c.398A>G	5.37:g.162868217A>G	ENSP00000344635:p.Asp133Gly	Somatic	85	0		WXS	Illumina HiSeq	Phase_1	72	4	NM_199246	0	0	67	67	0	B2R7B2|B4DLW7|D3DQK7|Q15757|Q96L32	Missense_Mutation	SNP	ENST00000340828.2	37	CCDS4360.1	.	.	.	.	.	.	.	.	.	.	A	18.37	3.609937	0.66558	.	.	ENSG00000113328	ENST00000393929;ENST00000340828;ENST00000510097;ENST00000510664	T;T;T;T	0.34667	2.11;2.11;2.11;1.35	5.23	5.23	0.72850	Cyclin, N-terminal (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.42988	0.1227	M	0.78223	2.4	0.80722	D	1	B	0.30482	0.281	B	0.28991	0.097	T	0.48198	-0.9056	10	0.87932	D	0	-3.6381	15.1248	0.72475	1.0:0.0:0.0:0.0	.	133	P51959	CCNG1_HUMAN	G	133;133;133;5	ENSP00000377506:D133G;ENSP00000344635:D133G;ENSP00000423791:D133G;ENSP00000422379:D5G	ENSP00000344635:D133G	D	+	2	0	CCNG1	162800795	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.780000	0.91799	1.979000	0.57680	0.533000	0.62120	GAC	.		0.373	CCNG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252750.3	NM_004060	
RAB24	53917	broad.mit.edu;bcgsc.ca	37	5	176729807	176729807	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr5:176729807C>G	ENST00000303251.6	-	3	630	c.211G>C	c.(211-213)Gag>Cag	p.E71Q	RAB24_ENST00000393611.2_Missense_Mutation_p.E71Q|RAB24_ENST00000303270.6_Missense_Mutation_p.E42Q|PRELID1_ENST00000503216.1_5'Flank|PRELID1_ENST00000303204.4_5'Flank	NM_001031677.2	NP_001026847.1	Q969Q5	RAB24_HUMAN	RAB24, member RAS oncogene family	71					autophagy (GO:0006914)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	autophagic vacuole (GO:0005776)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)					all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCATGGCCTCATAGCGCTCA	0.537																																					p.E71Q													.	RAB24-159	0			c.G211C						.						98.0	93.0	95.0					5																	176729807		2203	4300	6503	SO:0001583	missense	53917	exon3			TGGCCTCATAGCG	AF087904	CCDS34300.1	5q35.3	2009-10-06			ENSG00000169228	ENSG00000169228		"""RAB, member RAS oncogene"""	9765	protein-coding gene	gene with protein product		612415					Standard	NM_001031677		Approved		uc003mfw.3	Q969Q5	OTTHUMG00000130849	ENST00000303251.6:c.211G>C	5.37:g.176729807C>G	ENSP00000304376:p.Glu71Gln	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	84	4	NM_001031677	0	0	47	47	0	Q7Z4Z7	Missense_Mutation	SNP	ENST00000303251.6	37	CCDS34300.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064810	0.76187	.	.	ENSG00000169228	ENST00000393611;ENST00000303251;ENST00000303270	T;T;T	0.76968	-1.06;-1.06;-1.06	5.49	5.49	0.81192	Small GTP-binding protein domain (1);	0.000000	0.85682	U	0.000000	T	0.60637	0.2284	N	0.02765	-0.5	0.80722	D	1	P;P	0.39181	0.536;0.663	B;B	0.37833	0.223;0.259	T	0.70019	-0.4987	10	0.59425	D	0.04	1.7456	18.9659	0.92695	0.0:1.0:0.0:0.0	.	71;42	Q969Q5;F8W8H5	RAB24_HUMAN;.	Q	71;71;42	ENSP00000377235:E71Q;ENSP00000304376:E71Q;ENSP00000302085:E42Q	ENSP00000304376:E71Q	E	-	1	0	RAB24	176662413	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	7.185000	0.77714	2.576000	0.86940	0.555000	0.69702	GAG	.		0.537	RAB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253416.1	NM_130781	
KIAA0319	9856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	24578370	24578370	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr6:24578370C>G	ENST00000378214.3	-	9	1997	c.1473G>C	c.(1471-1473)ttG>ttC	p.L491F	KIAA0319_ENST00000543707.1_Missense_Mutation_p.L491F|KIAA0319_ENST00000430948.2_Missense_Mutation_p.L446F|KIAA0319_ENST00000537886.1_Missense_Mutation_p.L491F|KIAA0319_ENST00000535378.1_Missense_Mutation_p.L482F	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	491	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						CAAGGTTAGACAAGCGTAAGA	0.408																																					p.L491F		.											.	KIAA0319-92	0			c.G1473C						.						144.0	138.0	140.0					6																	24578370		2203	4300	6503	SO:0001583	missense	9856	exon9			GTTAGACAAGCGT	AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.1473G>C	6.37:g.24578370C>G	ENSP00000367459:p.Leu491Phe	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	131	44	NM_001168377	0	0	1	1	0	A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	ENST00000378214.3	37	CCDS34348.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.558223	0.45590	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53	4.12	3.14	0.36123	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);PKD domain (2);	0.101129	0.41396	D	0.000885	T	0.20981	0.0505	M	0.64080	1.96	0.43628	D	0.99601	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.00518	-1.1693	10	0.72032	D	0.01	-0.9176	8.9471	0.35764	0.0:0.8102:0.0:0.1898	.	491;482;491	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	F	491;482;446;491;491	ENSP00000439700:L491F;ENSP00000442403:L482F;ENSP00000401086:L446F;ENSP00000367459:L491F;ENSP00000437656:L491F	ENSP00000367459:L491F	L	-	3	2	KIAA0319	24686349	1.000000	0.71417	0.460000	0.27093	0.015000	0.08874	0.975000	0.29449	2.105000	0.64084	0.555000	0.69702	TTG	.		0.408	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040009.1	NM_014809	
HLA-B	3106	ucsc.edu	37	6	31323371	31323371	+	Splice_Site	SNP	T	T	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr6:31323371T>C	ENST00000412585.2	-	4	648		c.e4-2			NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						TTGGGGGGTCTGATGGGAAGA	0.577									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												.													.	HLA-B-90	0			c.620-2A>G						.						80.0	83.0	82.0					6																	31323371		2203	4300	6503	SO:0001630	splice_region_variant	3106	exon5	Familial Cancer Database	;Lichen Sclerosis, Familial	GGGGTCTGATGGG	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.620-2A>G	6.37:g.31323371T>C		Somatic	136	0		WXS	Illumina HiSeq		169	1	NM_005514	0	0	9	9	0	Q29764	Splice_Site	SNP	ENST00000412585.2	37	CCDS34394.1	.	.	.	.	.	.	.	.	.	.	.	10.61	1.397809	0.25205	.	.	ENSG00000234745	ENST00000412585;ENST00000428231;ENST00000452596;ENST00000434333	.	.	.	3.2	3.2	0.36748	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0844	0.30762	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	HLA-B	31431350	0.998000	0.40836	0.599000	0.28851	0.035000	0.12851	3.253000	0.51469	1.476000	0.48215	0.368000	0.22195	.	.		0.577	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	Intron
DNAH11	8701	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	21737744	21737744	+	Silent	SNP	A	A	G			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr7:21737744A>G	ENST00000409508.3	+	36	6124	c.6093A>G	c.(6091-6093)ttA>ttG	p.L2031L	DNAH11_ENST00000328843.6_Silent_p.L2038L	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2038	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AAATCTTGTTAGTTGCTGAAG	0.423									Kartagener syndrome																												.													.	DNAH11-146	0			.						.						115.0	105.0	108.0					7																	21737744		1948	4162	6110	SO:0001819	synonymous_variant	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CTTGTTAGTTGCT	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.6093A>G	7.37:g.21737744A>G		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	79	38	.	0	0	0	0	0	Q9UJ82	Silent	SNP	ENST00000409508.3	37																																																																																				.		0.423	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
TLN1	7094	broad.mit.edu	37	9	35703618	35703618	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr9:35703618T>C	ENST00000314888.9	-	48	6766	c.6413A>G	c.(6412-6414)gAg>gGg	p.E2138G	TLN1_ENST00000540444.1_Missense_Mutation_p.E2032G|TLN1_ENST00000464379.1_5'UTR	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2138					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTTGGTGGCCTCATCTTCCAC	0.527																																					p.E2138G													.	TLN1-609	0			c.A6413G						.						127.0	113.0	118.0					9																	35703618		2203	4300	6503	SO:0001583	missense	7094	exon48			GTGGCCTCATCTT	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6413A>G	9.37:g.35703618T>C	ENSP00000316029:p.Glu2138Gly	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	72	3	NM_006289	0	0	146	146	0	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.691071	0.88735	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.72167	-0.63;-0.62	5.24	5.24	0.73138	.	0.052219	0.85682	D	0.000000	T	0.72558	0.3475	M	0.78916	2.43	0.80722	D	1	P	0.40107	0.703	B	0.39027	0.288	T	0.76334	-0.2997	10	0.51188	T	0.08	-25.1672	15.1481	0.72674	0.0:0.0:0.0:1.0	.	2138	Q9Y490	TLN1_HUMAN	G	2138;2032	ENSP00000316029:E2138G;ENSP00000442981:E2032G	ENSP00000316029:E2138G	E	-	2	0	TLN1	35693618	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.158000	0.64917	1.998000	0.58463	0.459000	0.35465	GAG	.		0.527	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
SCARNA2	677766	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	109642945	109642945	+	lincRNA	DEL	G	G	-			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr1:109642945delG	ENST00000458748.1	+	0	131					NR_003023.1				small Cajal body-specific RNA 2																		GAGCGTGTTAGGCGAGTGCGT	0.647																																					.		.											.	.	0			.						.						59.0	57.0	57.0					1																	109642945		876	1991	2867			677766	.			.	BK005568		1q13.1	2013-09-05			ENSG00000238881	ENSG00000270066		"""ncRNAs / Small nucleolar RNAs : Small cajal body-specific"""	32558	non-coding RNA	RNA, small nucleolar						15556860	Standard	NR_003023		Approved	mgU2-25/61, HBII-382	uc001dwo.1				1.37:g.109642945delG		Somatic	75	0		WXS	Illumina HiSeq	Phase_I	62	18	.	0	0	0	0	0		RNA	DEL	ENST00000458748.1	37																																																																																				.		0.647	SCARNA2-201	KNOWN	basic	snoRNA	lincRNA		NR_003023	
C11orf84	144097	broad.mit.edu	37	11	63594447	63594448	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr11:63594447_63594448delGT	ENST00000294244.4	+	6	1281_1282	c.982_983delGT	c.(982-984)gtgfs	p.V328fs		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	328										endometrium(3)|kidney(1)|lung(3)|skin(1)	8						GGTTATCCGCGTGCGGATGGAG	0.683																																					p.328_328del													.	C11orf84-90	0			c.982_983del						.																																			SO:0001589	frameshift_variant	144097	exon6			ATCCGCGTGCGGA	BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.982_983delGT	11.37:g.63594447_63594448delGT	ENSP00000294244:p.Val328fs	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	24	7	NM_138471	0	0	0	0	0	Q68CV7|Q6PHS2|Q96IH0	Frame_Shift_Del	DEL	ENST00000294244.4	37	CCDS31594.1																																																																																			.		0.683	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396084.1	NM_138471	
RSPRY1	89970	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	57261323	57261323	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr16:57261323delA	ENST00000537866.1	+	11	2104	c.1231delA	c.(1231-1233)aatfs	p.N411fs	RSPRY1_ENST00000394420.4_Frame_Shift_Del_p.N411fs|RSPRY1_ENST00000563073.1_3'UTR			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	411	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular region (GO:0005576)	zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						GATTTGGTACAATGCCAGAAG	0.453																																					p.N411fs		.											.	RSPRY1-91	0			c.1231delA						.						122.0	104.0	110.0					16																	57261323		2198	4300	6498	SO:0001589	frameshift_variant	89970	exon11			.	AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1231delA	16.37:g.57261323delA	ENSP00000443176:p.Asn411fs	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	99	54	NM_133368	0	0	0	0	0	Q6UX21|Q8ND53	Frame_Shift_Del	DEL	ENST00000537866.1	37	CCDS10775.1																																																																																			.		0.453	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1	NM_133368	
TMEM237	65062	broad.mit.edu;bcgsc.ca	37	2	202493983	202493983	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr2:202493983delA	ENST00000409883.2	-	9	955	c.839delT	c.(838-840)ttgfs	p.L280fs	TMEM237_ENST00000409444.2_Frame_Shift_Del_p.L272fs|TMEM237_ENST00000466839.1_5'UTR	NM_001044385.2	NP_001037850.1	Q96Q45	TM237_HUMAN	transmembrane protein 237	280					cilium assembly (GO:0042384)|regulation of Wnt signaling pathway (GO:0030111)	ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(2)|kidney(1)|large_intestine(1)|lung(3)	7						ACTCAGAGCCAAAAGCAAGTA	0.428																																					p.L280fs													.	.	0			c.839delT						.						73.0	68.0	70.0					2																	202493983		1902	4131	6033	SO:0001589	frameshift_variant	65062	exon8			AGAGCCAAAAGCA	AB053301	CCDS46489.1, CCDS46490.1	2q33	2012-05-08	2011-05-20	2011-05-20	ENSG00000155755	ENSG00000155755			14432	protein-coding gene	gene with protein product		614423	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4"""	ALS2CR4		11586298, 20375344	Standard	NM_001044385		Approved	JBTS14	uc021vvg.2	Q96Q45	OTTHUMG00000154526	ENST00000409883.2:c.839delT	2.37:g.202493983delA	ENSP00000386264:p.Leu280fs	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	28	8	NM_001044385	0	0	0	0	0	B4E1R8|B4E2R8|E9PAR8|E9PBF8|E9PG24|E9PGX0|Q53TS9|Q53TT2|Q7Z3B6|Q8IZ18|Q8NBF8|Q96CY1	Frame_Shift_Del	DEL	ENST00000409883.2	37	CCDS46489.1																																																																																			.		0.428	TMEM237-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335753.1	NM_152388	
BACH1	571	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	30698866	30698866	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr21:30698866delA	ENST00000399921.1	+	3	964	c.721delA	c.(721-723)actfs	p.T241fs	BACH1_ENST00000286800.3_Frame_Shift_Del_p.T241fs	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						CAGAGTCCGTACTGGGGAATC	0.453																																					p.T241fs		.											.	BACH1-92	0			c.721delA						.						57.0	59.0	58.0					21																	30698866		2203	4300	6503	SO:0001589	frameshift_variant	571	exon3			.	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.721delA	21.37:g.30698866delA	ENSP00000382805:p.Thr241fs	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	113	38	NM_206866	0	0	0	0	0	Q3MJE2|Q8NCI5	Frame_Shift_Del	DEL	ENST00000399921.1	37	CCDS13585.1																																																																																			.		0.453	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866	
CCR3	1232	broad.mit.edu	37	3	46306948	46306948	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr3:46306948delT	ENST00000357422.2	+	4	842	c.299delT	c.(298-300)gttfs	p.V100fs	CCR3_ENST00000545097.1_Frame_Shift_Del_p.V121fs|CCR3_ENST00000395940.2_Frame_Shift_Del_p.V100fs|CCR3_ENST00000395942.2_Frame_Shift_Del_p.V100fs|CCR3_ENST00000541018.1_Frame_Shift_Del_p.V100fs			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	100					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		CATAACTGGGTTTTTGGCCAT	0.488																																					p.V121fs													.	CCR3-660	0			c.362delT						.						181.0	175.0	177.0					3																	46306948		2203	4300	6503	SO:0001589	frameshift_variant	1232	exon3			ACTGGGTTTTTGG	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.299delT	3.37:g.46306948delT	ENSP00000350003:p.Val100fs	Somatic	341	0		WXS	Illumina HiSeq	Phase_I	431	7	NM_178328	0	0	0	0	0	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Frame_Shift_Del	DEL	ENST00000357422.2	37	CCDS2738.1																																																																																			.		0.488	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257380.2		
RUNX2	860	broad.mit.edu	37	6	45390446	45390448	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr6:45390446_45390448delCAG	ENST00000371438.1	+	2	533_535	c.175_177delCAG	c.(175-177)cagdel	p.Q71del	RUNX2_ENST00000371432.3_In_Frame_Del_p.Q57del|RUNX2_ENST00000352853.5_In_Frame_Del_p.Q139del|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000576263.1_In_Frame_Del_p.Q71del|RUNX2_ENST00000541979.1_In_Frame_Del_p.Q139del|RUNX2_ENST00000359524.5_In_Frame_Del_p.Q57del|RUNX2_ENST00000371436.6_In_Frame_Del_p.Q71del|RUNX2_ENST00000465038.2_In_Frame_Del_p.Q71del	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	71	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						gcagcagcaacagcagcagcagc	0.729																																					p.59_59del													.	RUNX2-417	0			c.175_177del						.																																			SO:0001651	inframe_deletion	860	exon3			CAGCAACAGCAGC	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.175_177delCAG	6.37:g.45390455_45390457delCAG	ENSP00000360493:p.Gln71del	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	80	7	NM_001024630	0	0	0	0	0	O14614|O14615|O95181	In_Frame_Del	DEL	ENST00000371438.1	37	CCDS43467.2																																																																																			.		0.729	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
KAT6A	7994	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	41836161	41836161	+	Splice_Site	DEL	C	C	-			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr8:41836161delC	ENST00000396930.3	-	7	1585	c.1042delG	c.(1042-1044)gta>ta	p.V348fs	KAT6A_ENST00000265713.2_Splice_Site_p.V348fs|KAT6A_ENST00000485568.1_Splice_Site_p.V348fs|KAT6A_ENST00000406337.1_Splice_Site_p.V348fs	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	348	Interaction with PML.|Interaction with RUNX1-1.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										ACAACTTACACCGTGTTTTGT	0.383																																					p.V348fs		.											.	.	0			c.1042delG						.						338.0	340.0	340.0					8																	41836161		2203	4300	6503	SO:0001630	splice_region_variant	7994	exon7			.	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.1043+1G>-	8.37:g.41836161delC		Somatic	420	0		WXS	Illumina HiSeq	Phase_I	379	105	NM_001099412	0	0	0	0	0	Q76L81	Frame_Shift_Del	DEL	ENST00000396930.3	37	CCDS6124.1																																																																																			.		0.383	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	Frame_Shift_Del
CNTLN	54875	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	17462949	17462949	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr9:17462949delT	ENST00000380647.3	+	20	3426	c.3342delT	c.(3340-3342)aatfs	p.N1114fs	CNTLN_ENST00000262360.5_Frame_Shift_Del_p.N1114fs|CNTLN_ENST00000425824.1_Frame_Shift_Del_p.N1114fs			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	1114					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		AGTCATCAAATGTGAAGACTT	0.299																																					p.N1114fs		.											.	CNTLN-91	0			c.3342delT						.						83.0	81.0	81.0					9																	17462949		1809	4069	5878	SO:0001589	frameshift_variant	54875	exon20			.	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.3342delT	9.37:g.17462949delT	ENSP00000370021:p.Asn1114fs	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	97	29	NM_017738	0	0	0	0	0	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Frame_Shift_Del	DEL	ENST00000380647.3	37	CCDS43789.1																																																																																			.		0.299	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
FGL2	10875	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	76828725	76828726	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-7046-01A-11D-1961-08	TCGA-BQ-7046-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa8122c-c3e4-4e48-a47a-82feb79f1dc0	ea85b7f0-e214-4d27-80c1-c254338b6b0c	g.chr7:76828725_76828726insT	ENST00000248598.5	-	1	417_418	c.385_386insA	c.(385-387)agafs	p.R129fs	RP11-467H10.2_ENST00000459742.1_RNA|CCDC146_ENST00000285871.4_Intron|CCDC146_ENST00000431197.1_Intron	NM_006682.2	NP_006673.1	Q14314	FGL2_HUMAN	fibrinogen-like 2	129						extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)				breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	13						TTCTCTAACTCTGTTATCACCA	0.495																																					p.R129fs		.											.	FGL2-92	0			c.386_387insA						.																																			SO:0001589	frameshift_variant	10875	exon1			.	Z36531	CCDS5591.1	7q11.23	2013-02-06			ENSG00000127951	ENSG00000127951		"""Fibrinogen C domain containing"""	3696	protein-coding gene	gene with protein product		605351				7642106	Standard	NM_006682		Approved	pT49, T49	uc003ugb.3	Q14314	OTTHUMG00000130681	ENST00000248598.5:c.386dupA	7.37:g.76828726_76828726dupT	ENSP00000248598:p.Arg129fs	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	164	33	NM_006682	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000248598.5	37	CCDS5591.1																																																																																			.		0.495	FGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253176.1	NM_006682	
