#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EMC1	23065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19566346	19566346	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:19566346T>C	ENST00000477853.1	-	8	962	c.920A>G	c.(919-921)tAt>tGt	p.Y307C	EMC1_ENST00000375199.3_Missense_Mutation_p.Y307C|EMC1_ENST00000375208.3_Missense_Mutation_p.Y285C|RP1-43E13.2_ENST00000437898.1_RNA	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	307						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											CAGCGTTCCATAATGGTACTG	0.547																																					p.Y307C		.											.	.	0			c.A920G						.						81.0	83.0	82.0					1																	19566346		2203	4300	6503	SO:0001583	missense	23065	exon8			GTTCCATAATGGT		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.920A>G	1.37:g.19566346T>C	ENSP00000420608:p.Tyr307Cys	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	81	28	NM_001271427	0	0	5	12	7	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	ENST00000477853.1	37	CCDS190.1	.	.	.	.	.	.	.	.	.	.	T	6.476	0.456042	0.12283	.	.	ENSG00000127463	ENST00000477853;ENST00000375199;ENST00000375208	T;T;T	0.21932	1.98;1.98;1.98	5.63	3.3	0.37823	.	0.510435	0.24343	N	0.039353	T	0.10252	0.0251	N	0.08118	0	0.09310	N	0.999998	B;P;P;B	0.35456	0.218;0.502;0.502;0.369	B;B;B;B	0.36418	0.161;0.161;0.224;0.112	T	0.17653	-1.0362	10	0.36615	T	0.2	-5.9075	8.4851	0.33067	0.1216:0.0:0.1381:0.7404	.	285;307;307;307	Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.;.;.;K0090_HUMAN	C	307;307;285	ENSP00000420608:Y307C;ENSP00000364345:Y307C;ENSP00000364354:Y285C	ENSP00000364345:Y307C	Y	-	2	0	KIAA0090	19438933	0.998000	0.40836	0.449000	0.26957	0.158000	0.22134	3.412000	0.52679	2.137000	0.66172	0.533000	0.62120	TAT	.		0.547	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047	
LRRC8D	55144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	90399759	90399759	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:90399759T>A	ENST00000337338.5	+	3	1539	c.1132T>A	c.(1132-1134)Ttt>Att	p.F378I	LRRC8D_ENST00000394593.3_Missense_Mutation_p.F378I	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	378					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		TGTTTATGGCTTTATCTGCCT	0.373																																					p.F378I		.											.	LRRC8D-92	0			c.T1132A						.						118.0	117.0	117.0					1																	90399759		2203	4300	6503	SO:0001583	missense	55144	exon3			TATGGCTTTATCT	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.1132T>A	1.37:g.90399759T>A	ENSP00000338887:p.Phe378Ile	Somatic	167	1		WXS	Illumina HiSeq	Phase_I	143	49	NM_018103	0	0	9	12	3	D3DT29|Q6UWB2|Q9NVW3	Missense_Mutation	SNP	ENST00000337338.5	37	CCDS726.1	.	.	.	.	.	.	.	.	.	.	T	9.959	1.222158	0.22457	.	.	ENSG00000171492	ENST00000337338;ENST00000394593	T;T	0.42513	0.97;0.97	5.86	4.72	0.59763	.	0.393773	0.26919	N	0.021824	T	0.09335	0.0230	N	0.14661	0.345	0.35287	D	0.781816	B	0.10296	0.003	B	0.12156	0.007	T	0.14811	-1.0459	9	.	.	.	.	6.7914	0.23701	0.1355:0.0701:0.0:0.7944	.	378	Q7L1W4	LRC8D_HUMAN	I	378	ENSP00000338887:F378I;ENSP00000378093:F378I	.	F	+	1	0	LRRC8D	90172347	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	2.363000	0.44178	1.004000	0.39156	0.482000	0.46254	TTT	.		0.373	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
GFI1	2672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	92948601	92948601	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:92948601T>C	ENST00000370332.1	-	3	436	c.118A>G	c.(118-120)Agc>Ggc	p.S40G	GFI1_ENST00000427103.1_Missense_Mutation_p.S40G|GFI1_ENST00000294702.5_Missense_Mutation_p.S40G|GFI1_ENST00000483490.1_5'UTR	NM_001127215.1	NP_001120687.1	Q99684	GFI1_HUMAN	growth factor independent 1 transcription repressor	40					auditory receptor cell differentiation (GO:0042491)|cell fate commitment (GO:0045165)|cellular response to lipopolysaccharide (GO:0071222)|inner ear morphogenesis (GO:0042472)|mechanosensory behavior (GO:0007638)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell fate specification (GO:0009996)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vitamin D biosynthetic process (GO:0010957)|positive regulation of cell fate specification (GO:0042660)|positive regulation of interleukin-6-mediated signaling pathway (GO:0070105)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|viral process (GO:0016032)	nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		TTTGAAGTGCTGTCTGCAAAG	0.667																																					p.S40G		.											.	GFI1-514	0			c.A118G						.						26.0	32.0	30.0					1																	92948601		2200	4294	6494	SO:0001583	missense	2672	exon3			AAGTGCTGTCTGC	U67369	CCDS30773.1	1p22	2014-09-17	2007-10-04		ENSG00000162676	ENSG00000162676		"""Zinc fingers, C2H2-type"""	4237	protein-coding gene	gene with protein product		600871	"""growth factor independent 1"""	ZNF163		7789186	Standard	NM_005263		Approved	GFI1A, GFI-1	uc001dov.4	Q99684	OTTHUMG00000010897	ENST00000370332.1:c.118A>G	1.37:g.92948601T>C	ENSP00000359357:p.Ser40Gly	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	55	22	NM_005263	0	0	0	0	0	Q8N564	Missense_Mutation	SNP	ENST00000370332.1	37	CCDS30773.1	.	.	.	.	.	.	.	.	.	.	T	8.861	0.946887	0.18356	.	.	ENSG00000162676	ENST00000370332;ENST00000427103;ENST00000294702	T;T;T	0.09255	3.0;3.0;3.0	5.18	-2.98	0.05513	.	0.726593	0.13857	N	0.357995	T	0.01029	0.0034	N	0.12182	0.205	0.19775	N	0.999954	B	0.02656	0.0	B	0.01281	0.0	T	0.46133	-0.9213	10	0.06891	T	0.86	-6.9644	7.2257	0.26014	0.1163:0.4299:0.0:0.4538	.	40	Q99684	GFI1_HUMAN	G	40	ENSP00000359357:S40G;ENSP00000399719:S40G;ENSP00000294702:S40G	ENSP00000294702:S40G	S	-	1	0	GFI1	92721189	0.003000	0.15002	0.979000	0.43373	0.161000	0.22273	-0.880000	0.04183	-0.481000	0.06792	-0.379000	0.06801	AGC	.		0.667	GFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030054.1	NM_005263	
ABCA4	24	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94506770	94506770	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:94506770T>A	ENST00000370225.3	-	23	3603	c.3517A>T	c.(3517-3519)Agt>Tgt	p.S1173C		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1173					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CCTACCTCACTGCCTTTCCTT	0.567																																					p.S1173C		.											.	ABCA4-162	0			c.A3517T						.						102.0	94.0	97.0					1																	94506770		2203	4300	6503	SO:0001583	missense	24	exon23			CCTCACTGCCTTT	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3517A>T	1.37:g.94506770T>A	ENSP00000359245:p.Ser1173Cys	Somatic	83	1		WXS	Illumina HiSeq	Phase_I	60	19	NM_000350	0	0	0	0	0	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.445557	0.43429	.	.	ENSG00000198691	ENST00000370225	D	0.91351	-2.83	5.75	-0.546	0.11840	.	1.303050	0.04432	N	0.369442	T	0.43211	0.1237	N	0.00510	-1.415	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45659	-0.9246	10	0.21014	T	0.42	.	0.3843	0.00400	0.2675:0.2846:0.2189:0.229	.	1173	P78363	ABCA4_HUMAN	C	1173	ENSP00000359245:S1173C	ENSP00000359245:S1173C	S	-	1	0	ABCA4	94279358	0.000000	0.05858	0.001000	0.08648	0.795000	0.44927	0.319000	0.19522	-0.113000	0.11958	-0.339000	0.08088	AGT	.		0.567	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
TTF2	8458	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	117633172	117633172	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:117633172A>T	ENST00000369466.4	+	15	2559	c.2515A>T	c.(2515-2517)Aaa>Taa	p.K839*		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	839					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		GCCCCAGCGTAAATTTCAGTT	0.368																																					p.K839X													.	TTF2-91	0			c.A2515T						.						128.0	121.0	124.0					1																	117633172		2203	4300	6503	SO:0001587	stop_gained	8458	exon15			CAGCGTAAATTTC	AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.2515A>T	1.37:g.117633172A>T	ENSP00000358478:p.Lys839*	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	57	13	NM_003594	0	0	3	3	0	A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Nonsense_Mutation	SNP	ENST00000369466.4	37	CCDS892.1	.	.	.	.	.	.	.	.	.	.	A	39	7.341644	0.98224	.	.	ENSG00000116830	ENST00000369466	.	.	.	5.1	1.38	0.22167	.	0.596567	0.14006	N	0.347765	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.7907	5.3282	0.15918	0.5193:0.3843:0.0964:0.0	.	.	.	.	X	839	.	ENSP00000358478:K839X	K	+	1	0	TTF2	117434695	0.010000	0.17322	0.403000	0.26384	0.986000	0.74619	0.858000	0.27845	0.413000	0.25759	0.533000	0.62120	AAA	.		0.368	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033277.3		
NBPF9	400818	broad.mit.edu	37	1	144823878	144823878	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:144823878A>C	ENST00000281815.8	+	9	946	c.200A>C	c.(199-201)tAt>tCt	p.Y67S	NBPF9_ENST00000440491.2_Missense_Mutation_p.Y382S|NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000338347.4_Missense_Mutation_p.Y382S			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	715						cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						TATAGATGTTATTCAACTCCT	0.483																																					.													.	.	0			.						.																																			SO:0001583	missense	400818	.			GATGTTATTCAAC		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000281815.8:c.200A>C	1.37:g.144823878A>C	ENSP00000281815:p.Tyr67Ser	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	53	4	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000281815.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.138|8.138	0.784620|0.784620	0.16189|0.16189	.|.	.|.	ENSG00000168614|ENSG00000168614	ENST00000375552|ENST00000338347;ENST00000440491;ENST00000281815	.|T;T;T	.|0.08282	.|3.11;3.11;3.11	0.431|0.431	-0.862|-0.862	0.10673|0.10673	.|.	.|.	.|.	.|.	.|.	T|T	0.06325|0.06325	0.0163|0.0163	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.91635	.|0.999	T|T	0.20638|0.20638	-1.0269|-1.0269	3|7	.|0.20046	.|T	.|0.44	.|.	.|.	.|.	.|.	.|.	.|380	.|A2BGT5	.|.	L|S	381|382;382;67	.|ENSP00000342975:Y382S;ENSP00000390934:Y382S;ENSP00000281815:Y67S	.|ENSP00000281815:Y67S	I|Y	+|+	1|2	0|0	NBPF9|NBPF9	143535235|143535235	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.041000|0.041000	0.13682|0.13682	-1.315000|-1.315000	0.02713|0.02713	-0.698000|-0.698000	0.05085|0.05085	0.163000|0.163000	0.16589|0.16589	ATT|TAT	.		0.483	NBPF9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001037675	
SCYL3	57147	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169824950	169824950	+	Silent	SNP	A	A	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:169824950A>T	ENST00000367770.1	-	11	1508	c.1461T>A	c.(1459-1461)acT>acA	p.T487T	SCYL3_ENST00000367772.4_Silent_p.T487T|SCYL3_ENST00000367771.6_Intron			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	487					cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TCTGTAAAAGAGTATTGTAGT	0.378																																					p.T487T													.	SCYL3-361	0			c.T1461A						.						70.0	71.0	70.0					1																	169824950		2203	4300	6503	SO:0001819	synonymous_variant	57147	exon12			TAAAAGAGTATTG	BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.1461T>A	1.37:g.169824950A>T		Somatic	53	0		WXS	Illumina HiSeq	Phase_I	51	20	NM_181093	0	0	0	0	0	A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Silent	SNP	ENST00000367770.1	37	CCDS1287.1																																																																																			.		0.378	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087550.4	NM_181093	
DNM3	26052	hgsc.bcm.edu;broad.mit.edu	37	1	171810797	171810797	+	Start_Codon_SNP	SNP	A	A	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:171810797A>C	ENST00000355305.5	+	1	158	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	DNM3_ENST00000367731.1_Start_Codon_SNP_p.M1L|DNM3_ENST00000358155.4_Start_Codon_SNP_p.M1L|DNM3_ENST00000520906.1_Start_Codon_SNP_p.M1L|DNM3_ENST00000367733.2_Start_Codon_SNP_p.M1L			Q9UQ16	DYN3_HUMAN	dynamin 3	1					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CTCGGGCAAGATGGGGAACCG	0.692																																					p.M1L		.											.	DNM3-90	0			c.A1C						.						17.0	24.0	22.0					1																	171810797		2051	4215	6266	SO:0001582	initiator_codon_variant	26052	exon1			GGCAAGATGGGGA	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1A>C	1.37:g.171810797A>C	ENSP00000347457:p.Met1Leu	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	28	11	NM_001136127	0	0	0	0	0	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	ENST00000355305.5	37		.	.	.	.	.	.	.	.	.	.	a	25.2	4.614577	0.87359	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906	D;D;D;D;D	0.93307	-3.07;-2.83;-3.08;-3.1;-3.2	3.67	3.67	0.42095	.	0.000000	0.85682	D	0.000000	D	0.85974	0.5822	.	.	.	0.23758	N	0.996926	B;P;P;B	0.40794	0.25;0.729;0.729;0.015	B;B;B;B	0.40134	0.067;0.202;0.32;0.016	T	0.81132	-0.1072	9	0.72032	D	0.01	.	10.5782	0.45240	1.0:0.0:0.0:0.0	.	1;1;1;1	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	L	1	ENSP00000350876:M1L;ENSP00000356707:M1L;ENSP00000347457:M1L;ENSP00000356705:M1L;ENSP00000429701:M1L	ENSP00000347457:M1L	M	+	1	0	DNM3	170077420	1.000000	0.71417	0.925000	0.36789	0.899000	0.52679	4.645000	0.61404	1.656000	0.50722	0.478000	0.44815	ATG	.		0.692	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	Missense_Mutation
NPL	80896	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	182775301	182775301	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:182775301G>C	ENST00000367553.1	+	4	208	c.164G>C	c.(163-165)gGc>gCc	p.G55A	NPL_ENST00000258317.2_Missense_Mutation_p.G55A|NPL_ENST00000367554.3_5'UTR|NPL_ENST00000367550.2_Missense_Mutation_p.G55A|NPL_ENST00000463899.1_3'UTR|NPL_ENST00000367555.1_Missense_Mutation_p.G55A|NPL_ENST00000367552.2_Missense_Mutation_p.G55A	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)	55					carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)			breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						ACAGGAGAAGGCCTGTCCCTG	0.532																																					p.G55A		.											.	NPL-92	0			c.G164C						.						111.0	109.0	110.0					1																	182775301		2203	4300	6503	SO:0001583	missense	80896	exon5			GAGAAGGCCTGTC	AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.164G>C	1.37:g.182775301G>C	ENSP00000356524:p.Gly55Ala	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	85	13	NM_001200052	0	0	14	19	5	B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Missense_Mutation	SNP	ENST00000367553.1	37	CCDS1350.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482498	0.84747	.	.	ENSG00000135838	ENST00000367555;ENST00000367553;ENST00000367552;ENST00000258317;ENST00000367550	D;D;D;D;D	0.94897	-3.55;-1.53;-3.55;-1.53;-3.55	5.26	5.26	0.73747	Aldolase-type TIM barrel (1);	0.050750	0.85682	D	0.000000	D	0.95695	0.8600	M	0.62723	1.935	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.969	D;D;P	0.74023	0.957;0.982;0.671	D	0.93397	0.6757	10	0.06625	T	0.88	-14.9114	15.7916	0.78369	0.0:0.0:1.0:0.0	.	55;55;55	Q9BXD5-4;Q9BXD5;Q9BXD5-3	.;NPL_HUMAN;.	A	55	ENSP00000356526:G55A;ENSP00000356524:G55A;ENSP00000356523:G55A;ENSP00000258317:G55A;ENSP00000356521:G55A	ENSP00000258317:G55A	G	+	2	0	NPL	181041924	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	6.722000	0.74735	2.451000	0.82905	0.563000	0.77884	GGC	.		0.532	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085463.1	NM_030769	
TPR	7175	broad.mit.edu;bcgsc.ca	37	1	186324772	186324772	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:186324772T>A	ENST00000367478.4	-	16	2313	c.2017A>T	c.(2017-2019)Aaa>Taa	p.K673*	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	673					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTTACCTGTTTAAGGGCAGCC	0.408			T	NTRK1	papillary thyroid																																p.K673X				Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR-228	0			c.A2017T						.						128.0	121.0	123.0					1																	186324772		1896	4117	6013	SO:0001587	stop_gained	7175	exon16			CCTGTTTAAGGGC	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2017A>T	1.37:g.186324772T>A	ENSP00000356448:p.Lys673*	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	147	10	NM_003292	0	0	0	0	0	Q15655|Q5SWY0|Q99968	Nonsense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	T	42	9.615943	0.99220	.	.	ENSG00000047410	ENST00000367478	.	.	.	5.22	5.22	0.72569	.	0.166835	0.51477	D	0.000081	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3973	0.74805	0.0:0.0:0.0:1.0	.	.	.	.	X	673	.	ENSP00000356448:K673X	K	-	1	0	TPR	184591395	1.000000	0.71417	0.996000	0.52242	0.919000	0.55068	3.415000	0.52700	2.106000	0.64143	0.482000	0.46254	AAA	.		0.408	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
ANK3	288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	61829643	61829643	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr10:61829643T>C	ENST00000280772.2	-	37	11187	c.10996A>G	c.(10996-10998)Act>Gct	p.T3666A	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3666					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTTTCTACAGTGGTGTCCCCT	0.532																																					p.T3666A		.											.	ANK3-107	0			c.A10996G						.						105.0	110.0	108.0					10																	61829643		2203	4300	6503	SO:0001583	missense	288	exon37			CTACAGTGGTGTC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.10996A>G	10.37:g.61829643T>C	ENSP00000280772:p.Thr3666Ala	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	69	32	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	T	7.641	0.680808	0.14907	.	.	ENSG00000151150	ENST00000280772	T	0.18016	2.24	5.67	1.95	0.26073	.	0.170468	0.27831	N	0.017678	T	0.09730	0.0239	L	0.27053	0.805	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16748	-1.0392	10	0.41790	T	0.15	.	4.0495	0.09788	0.2679:0.1431:0.0:0.589	.	3666	Q12955	ANK3_HUMAN	A	3666	ENSP00000280772:T3666A	ENSP00000280772:T3666A	T	-	1	0	ANK3	61499649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.468000	0.35332	0.366000	0.24427	0.533000	0.62120	ACT	.		0.532	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
SFTPD	6441	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	81702148	81702148	+	Silent	SNP	G	G	C	rs2077117		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr10:81702148G>C	ENST00000372292.3	-	4	469	c.429C>G	c.(427-429)ccC>ccG	p.P143P		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	143	Collagen-like.				defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			ACCTACCTTTGGGCCCAGCTT	0.607																																					p.P143P		.											.	SFTPD-91	0			c.C429G						.						82.0	75.0	77.0					10																	81702148		2203	4300	6503	SO:0001819	synonymous_variant	6441	exon4			ACCTTTGGGCCCA	L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.429C>G	10.37:g.81702148G>C		Somatic	74	0		WXS	Illumina HiSeq	Phase_I	59	22	NM_003019	0	0	0	0	0	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Silent	SNP	ENST00000372292.3	37	CCDS7362.1																																																																																			.		0.607	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		
ADD3	120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	111878343	111878343	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr10:111878343A>G	ENST00000356080.4	+	6	934		c.e6-1		ADD3_ENST00000360162.3_Splice_Site|ADD3_ENST00000277900.8_Splice_Site|ADD3_ENST00000497125.1_Splice_Site	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)							cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GATTTTTTCCAGGTGAAAGTC	0.378																																					.		.											.	ADD3-157	0			c.568-2A>G						.						102.0	104.0	103.0					10																	111878343		2203	4300	6503	SO:0001630	splice_region_variant	120	exon6			TTTTCCAGGTGAA	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.568-1A>G	10.37:g.111878343A>G		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	82	35	NM_019903	0	0	0	0	0	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Splice_Site	SNP	ENST00000356080.4	37	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	A	16.87	3.241968	0.58995	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	.	.	.	5.28	4.11	0.48088	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8604	0.52463	0.8691:0.0:0.0:0.1309	.	.	.	.	.	-1	.	.	.	+	.	.	ADD3	111868333	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	7.423000	0.80229	0.905000	0.36596	0.460000	0.39030	.	.		0.378	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	Intron
MICALCL	84953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	12316190	12316190	+	Silent	SNP	C	C	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr11:12316190C>T	ENST00000256186.2	+	3	1503	c.1212C>T	c.(1210-1212)gaC>gaT	p.D404D		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	404					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		GACTCAAAGACAAATCTTTTG	0.468																																					p.D404D		.											.	MICALCL-91	0			c.C1212T						.						121.0	123.0	122.0					11																	12316190		1848	4097	5945	SO:0001819	synonymous_variant	84953	exon3			CAAAGACAAATCT	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1212C>T	11.37:g.12316190C>T		Somatic	238	0		WXS	Illumina HiSeq	Phase_I	181	65	NM_032867	0	0	0	0	0	Q7RTP7|Q96JU6	Silent	SNP	ENST00000256186.2	37	CCDS41620.1																																																																																			.		0.468	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
TTC17	55761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	43418965	43418965	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr11:43418965C>A	ENST00000039989.4	+	7	856	c.842C>A	c.(841-843)gCt>gAt	p.A281D	TTC17_ENST00000299240.6_Missense_Mutation_p.A281D|TTC17_ENST00000526774.1_3'UTR|RP11-484D2.4_ENST00000394183.2_RNA	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	281					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						TCTGCTGATGCTGCTGTCGTG	0.443																																					p.A281D		.											.	TTC17-95	0			c.C842A						.						238.0	201.0	213.0					11																	43418965		2203	4300	6503	SO:0001583	missense	55761	exon7			CTGATGCTGCTGT	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.842C>A	11.37:g.43418965C>A	ENSP00000039989:p.Ala281Asp	Somatic	276	2		WXS	Illumina HiSeq	Phase_I	270	122	NM_018259	0	0	12	22	10	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	C	35	5.554829	0.96514	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.72725	-0.68;-0.68	5.92	5.92	0.95590	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.86892	0.6042	M	0.85462	2.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.998;0.999	D	0.87691	0.2554	10	0.87932	D	0	-12.9642	20.3206	0.98668	0.0:1.0:0.0:0.0	.	281;281;281	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	D	281	ENSP00000299240:A281D;ENSP00000039989:A281D	ENSP00000039989:A281D	A	+	2	0	TTC17	43375541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.809000	0.96659	0.655000	0.94253	GCT	.		0.443	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
OR5T3	390154	broad.mit.edu;bcgsc.ca	37	11	56019938	56019938	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr11:56019938C>T	ENST00000303059.3	+	1	263	c.263C>T	c.(262-264)cCc>cTc	p.P88L		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					CTCCACAACCCCATGTATTAT	0.363																																					p.P88L													.	OR5T3-68	0			c.C263T						.						97.0	96.0	96.0					11																	56019938		2201	4296	6497	SO:0001583	missense	390154	exon1			ACAACCCCATGTA	AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.263C>T	11.37:g.56019938C>T	ENSP00000305403:p.Pro88Leu	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	99	28	NM_001004747	0	0	0	0	0	Q6IFC7	Missense_Mutation	SNP	ENST00000303059.3	37	CCDS31524.1	.	.	.	.	.	.	.	.	.	.	c	16.19	3.053057	0.55218	.	.	ENSG00000172489	ENST00000303059	T	0.02032	4.49	4.55	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39759	U	0.001271	T	0.11067	0.0270	H	0.94542	3.55	0.58432	D	0.999999	P	0.41450	0.75	B	0.43360	0.417	T	0.04090	-1.0978	10	0.87932	D	0	.	17.8308	0.88682	0.0:1.0:0.0:0.0	.	88	Q8NGG3	OR5T3_HUMAN	L	88	ENSP00000305403:P88L	ENSP00000305403:P88L	P	+	2	0	OR5T3	55776514	1.000000	0.71417	0.958000	0.39756	0.083000	0.17756	7.047000	0.76599	2.512000	0.84698	0.643000	0.83706	CCC	.		0.363	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391599.1	NM_001004747	
OR8U1	219417	broad.mit.edu;bcgsc.ca	37	11	56143937	56143937	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr11:56143937G>C	ENST00000302270.1	+	1	838	c.838G>C	c.(838-840)Gtg>Ctg	p.V280L		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					CTTCTACACAGTGATCATTCC	0.413																																					p.V280L													.	OR8U1-72	0			c.G838C						.						143.0	148.0	146.0					11																	56143937		2044	4227	6271	SO:0001583	missense	219417	exon1			TACACAGTGATCA	AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.838G>C	11.37:g.56143937G>C	ENSP00000304188:p.Val280Leu	Somatic	317	0		WXS	Illumina HiSeq	Phase_I	280	10	NM_001005204	0	0	0	0	0		Missense_Mutation	SNP	ENST00000302270.1	37	CCDS41647.1	.	.	.	.	.	.	.	.	.	.	G	0.050	-1.254672	0.01457	.	.	ENSG00000172199	ENST00000302270	T	0.00279	8.33	5.69	2.69	0.31865	GPCR, rhodopsin-like superfamily (1);	0.174841	0.27411	N	0.019484	T	0.00178	0.0005	N	0.21448	0.665	0.09310	N	1	B	0.28933	0.228	B	0.41666	0.363	T	0.23940	-1.0174	10	0.11794	T	0.64	.	7.9511	0.30014	0.1954:0.1192:0.6855:0.0	.	280	Q8NH10	OR8U1_HUMAN	L	280	ENSP00000304188:V280L	ENSP00000304188:V280L	V	+	1	0	OR8U1	55900513	0.061000	0.20836	0.998000	0.56505	0.181000	0.23173	0.606000	0.24194	1.425000	0.47237	-0.245000	0.11935	GTG	.		0.413	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204	
MALAT1	378938	ucsc.edu;bcgsc.ca	37	11	65267784	65267784	+	lincRNA	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr11:65267784T>C	ENST00000534336.1	+	0	2552				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CAAGAGTAATTACCAACTTAA	0.343																																					.													.	.	0			.						.						39.0	42.0	41.0					11																	65267784		874	1987	2861			378938	.			AGTAATTACCAAC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65267784T>C		Somatic	79	0		WXS	Illumina HiSeq		35	5	.	0	0	48	55	7		RNA	SNP	ENST00000534336.1	37																																																																																				.		0.343	MALAT1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389143.1	NR_002819	
C1QTNF5	114902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	119210071	119210071	+	Silent	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr11:119210071G>C	ENST00000528368.1	-	3	933	c.702C>G	c.(700-702)tcC>tcG	p.S234S	MFRP_ENST00000530681.1_3'UTR|C1QTNF5_ENST00000525657.1_5'UTR|RP11-334E6.10_ENST00000501918.2_RNA|MFRP_ENST00000555262.1_3'UTR|C1QTNF5_ENST00000445041.2_Silent_p.S234S	NM_001278431.1	NP_001265360.1	Q9BXJ0	C1QT5_HUMAN	C1q and tumor necrosis factor related protein 5	234	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(2)	3		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		TGTGCCAGTCGGAGTACACCA	0.552																																					p.S234S		.											.	C1QTNF5-90	0			c.C702G						.						100.0	93.0	96.0					11																	119210071		2199	4295	6494	SO:0001819	synonymous_variant	114902	exon15			CCAGTCGGAGTAC	AF329841	CCDS8420.1	11q23.3	2013-05-10				ENSG00000223953			14344	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 5"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 3"""	608752				12944416	Standard	NM_015645		Approved	CTRP5, DKFZp586B0621, LORD		Q9BXJ0	OTTHUMG00000166198	ENST00000528368.1:c.702C>G	11.37:g.119210071G>C		Somatic	79	0		WXS	Illumina HiSeq	Phase_I	75	26	NM_015645	0	0	66	98	32	A6NDD3|B0YJ35|Q335M2|Q8N6P2|Q9UFX4	Silent	SNP	ENST00000528368.1	37	CCDS8420.1																																																																																			.		0.552	C1QTNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388354.1	NM_015645	
LRP6	4040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	12302076	12302076	+	Silent	SNP	C	C	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr12:12302076C>T	ENST00000261349.4	-	14	3082	c.3006G>A	c.(3004-3006)gtG>gtA	p.V1002V	LRP6_ENST00000543091.1_Silent_p.V1002V	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1002	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				AGCTCACAACCACAGTAAAGC	0.453																																					p.V1002V		.											.	LRP6-661	0			c.G3006A						.						135.0	137.0	136.0					12																	12302076		2203	4300	6503	SO:0001819	synonymous_variant	4040	exon14			CACAACCACAGTA	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3006G>A	12.37:g.12302076C>T		Somatic	282	0		WXS	Illumina HiSeq	Phase_I	262	115	NM_002336	0	0	0	1	1	Q17RZ2	Silent	SNP	ENST00000261349.4	37	CCDS8647.1																																																																																			.		0.453	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
C12orf54	121273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	48888593	48888593	+	Silent	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr12:48888593T>C	ENST00000548364.1	+	7	312	c.255T>C	c.(253-255)ccT>ccC	p.P85P	C12orf54_ENST00000314014.2_Silent_p.P85P|RP11-722P11.4_ENST00000551847.1_RNA			Q6X4T0	CL054_HUMAN	chromosome 12 open reading frame 54	85										endometrium(1)|large_intestine(4)	5						GCATAAGGCCTCCAGATTCCT	0.488																																					p.P85P		.											.	C12orf54-90	0			c.T255C						.						114.0	116.0	116.0					12																	48888593		2203	4300	6503	SO:0001819	synonymous_variant	121273	exon8			AAGGCCTCCAGAT	BC031670	CCDS8764.1	12q13.11	2011-01-31			ENSG00000177627	ENSG00000177627			28553	protein-coding gene	gene with protein product						12477932	Standard	NM_152319		Approved	MGC35033	uc001rrr.3	Q6X4T0	OTTHUMG00000170019	ENST00000548364.1:c.255T>C	12.37:g.48888593T>C		Somatic	186	0		WXS	Illumina HiSeq	Phase_I	183	75	NM_152319	0	0	0	0	0	Q6X4S9|Q8N5S2	Silent	SNP	ENST00000548364.1	37	CCDS8764.1																																																																																			.		0.488	C12orf54-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406875.1	NM_152319	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49437679	49437679	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr12:49437679A>G	ENST00000301067.7	-	22	5290	c.5291T>C	c.(5290-5292)cTg>cCg	p.L1764P		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1764					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CATGTCCTCCAGTTTGCTCTT	0.567											OREG0021780	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1764P		.											.	MLL2-612	0			c.T5291C						.						166.0	177.0	174.0					12																	49437679		2147	4242	6389	SO:0001583	missense	8085	exon22			TCCTCCAGTTTGC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.5291T>C	12.37:g.49437679A>G	ENSP00000301067:p.Leu1764Pro	Somatic	147	0	962	WXS	Illumina HiSeq	Phase_I	119	38	NM_003482	0	0	0	0	0	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	A	14.19	2.462524	0.43736	.	.	ENSG00000167548	ENST00000301067	D	0.92199	-2.99	4.93	4.93	0.64822	.	.	.	.	.	D	0.94925	0.8359	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95361	0.8455	9	0.87932	D	0	.	13.5598	0.61782	1.0:0.0:0.0:0.0	.	1764	O14686	MLL2_HUMAN	P	1764	ENSP00000301067:L1764P	ENSP00000301067:L1764P	L	-	2	0	MLL2	47723946	1.000000	0.71417	0.941000	0.38009	0.935000	0.57460	9.259000	0.95561	1.846000	0.53633	0.260000	0.18958	CTG	.		0.567	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
CNOT2	4848	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	70704758	70704758	+	Silent	SNP	C	C	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr12:70704758C>T	ENST00000418359.3	+	4	583	c.132C>T	c.(130-132)taC>taT	p.Y44Y	CNOT2_ENST00000229195.3_Silent_p.Y44Y	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	44					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			ACATGTACTACAGCCAGTCTT	0.378																																					p.Y44Y													.	CNOT2-226	0			c.C132T						.						112.0	104.0	107.0					12																	70704758		2203	4300	6503	SO:0001819	synonymous_variant	4848	exon4			GTACTACAGCCAG	AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.132C>T	12.37:g.70704758C>T		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	80	20	NM_001199302	0	0	9	19	10	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Silent	SNP	ENST00000418359.3	37	CCDS31857.1																																																																																			.		0.378	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1		
EPSTI1	94240	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	13	43462629	43462629	+	Intron	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr13:43462629C>A	ENST00000398762.3	-	12	957				EPSTI1_ENST00000313640.7_Missense_Mutation_p.E330D|EPSTI1_ENST00000313624.7_3'UTR			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)											endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		TCAATATTTTCTCATATACCC	0.358																																					p.E330D		.											.	EPSTI1-91	0			c.G990T						.						56.0	61.0	59.0					13																	43462629		2203	4300	6503	SO:0001627	intron_variant	94240	exon13			TATTTTCTCATAT	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.954+1G>T	13.37:g.43462629C>A		Somatic	156	2		WXS	Illumina HiSeq	Phase_I	149	57	NM_001002264	0	0	1	1	0	Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	ENST00000398762.3	37	CCDS9387.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.280732	0.40294	.	.	ENSG00000133106	ENST00000313640	.	.	.	5.63	4.79	0.61399	.	0.094876	0.39210	N	0.001421	T	0.63474	0.2514	.	.	.	0.80722	D	1	D	0.55385	0.971	P	0.58077	0.832	T	0.59799	-0.7386	8	0.21540	T	0.41	-6.4173	10.8984	0.47036	0.0:0.9136:0.0:0.0864	.	330	Q96J88-3	.	D	330	.	ENSP00000318982:E330D	E	-	3	2	EPSTI1	42360629	1.000000	0.71417	0.995000	0.50966	0.550000	0.35303	2.068000	0.41471	1.538000	0.49270	0.655000	0.94253	GAG	.		0.358	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	
POTEG	404785	broad.mit.edu;bcgsc.ca	37	14	19553567	19553567	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr14:19553567G>A	ENST00000409832.3	+	1	203	c.151G>A	c.(151-153)Gat>Aat	p.D51N		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	51										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						AGACCACGACGATTCTGCTAT	0.602																																					p.D51N													.	POTEG-1	0			c.G151A						.						101.0	139.0	126.0					14																	19553567		2198	4286	6484	SO:0001583	missense	404785	exon1			CACGACGATTCTG		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.151G>A	14.37:g.19553567G>A	ENSP00000386971:p.Asp51Asn	Somatic	1420	1		WXS	Illumina HiSeq	Phase_I	1334	50	NM_001005356	0	0	0	0	0	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	11.02	1.515679	0.27123	.	.	ENSG00000222036	ENST00000409832	T	0.39997	1.05	.	.	.	.	.	.	.	.	T	0.48572	0.1507	L	0.43152	1.355	0.09310	N	1	D	0.89917	1.0	D	0.68353	0.957	T	0.34304	-0.9834	7	0.36615	T	0.2	.	.	.	.	.	51	Q6S5H5	POTEG_HUMAN	N	51	ENSP00000386971:D51N	ENSP00000386971:D51N	D	+	1	0	POTEG	18623567	0.001000	0.12720	0.010000	0.14722	0.010000	0.07245	0.488000	0.22371	0.162000	0.19483	0.165000	0.16767	GAT	.		0.602	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356	
NFKBIA	4792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	35872504	35872504	+	Silent	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr14:35872504A>G	ENST00000216797.5	-	3	500	c.399T>C	c.(397-399)gcT>gcC	p.A133A	NFKBIA_ENST00000557389.1_Silent_p.A43A|NFKBIA_ENST00000557140.1_Silent_p.A133A|NFKBIA_ENST00000557100.1_5'UTR	NM_020529.2	NP_065390.1	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	133					apoptotic process (GO:0006915)|cellular response to cold (GO:0070417)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|cytoplasmic sequestering of transcription factor (GO:0042994)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein import into nucleus, translocation (GO:0000060)|regulation of cell proliferation (GO:0042127)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to exogenous dsRNA (GO:0043330)|response to muramyl dipeptide (GO:0032495)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|nuclear localization sequence binding (GO:0008139)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(1)|large_intestine(2)|liver(1)	7	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Acetylsalicylic acid(DB00945)	GATCACAGCCAGCTCCCAGAA	0.562																																					p.A133A		.											.	NFKBIA-721	0			c.T399C						.						91.0	96.0	95.0					14																	35872504		2203	4300	6503	SO:0001819	synonymous_variant	4792	exon3			ACAGCCAGCTCCC		CCDS9656.1	14q13	2014-09-17			ENSG00000100906	ENSG00000100906		"""Ankyrin repeat domain containing"""	7797	protein-coding gene	gene with protein product		164008		NFKBI		1829648	Standard	NM_020529		Approved	IKBA, MAD-3, IkappaBalpha	uc001wtf.4	P25963	OTTHUMG00000140220	ENST00000216797.5:c.399T>C	14.37:g.35872504A>G		Somatic	151	1		WXS	Illumina HiSeq	Phase_I	139	7	NM_020529	0	0	121	137	16	B2R8L6	Silent	SNP	ENST00000216797.5	37	CCDS9656.1																																																																																			.		0.562	NFKBIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276683.1	NM_020529	
KLHDC1	122773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	50196254	50196254	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr14:50196254C>G	ENST00000359332.2	+	8	788	c.698C>G	c.(697-699)aCt>aGt	p.T233S	KLHDC1_ENST00000554512.1_3'UTR	NM_172193.2	NP_751943.1	Q8N7A1	KLDC1_HUMAN	kelch domain containing 1	233						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	12	all_epithelial(31;0.00244)|Breast(41;0.00964)					GACACCTGGACTTGGTCTGGA	0.348																																					p.T233S		.											.	KLHDC1-91	0			c.C698G						.						115.0	104.0	108.0					14																	50196254		2203	4299	6502	SO:0001583	missense	122773	exon8			CCTGGACTTGGTC	AF111806	CCDS9692.1	14q21.3	2007-08-01			ENSG00000197776	ENSG00000197776			19836	protein-coding gene	gene with protein product		611281					Standard	NM_172193		Approved	MST025	uc001www.3	Q8N7A1	OTTHUMG00000140295	ENST00000359332.2:c.698C>G	14.37:g.50196254C>G	ENSP00000352282:p.Thr233Ser	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	61	24	NM_172193	0	0	0	0	0	B3KXD9|Q8WYI1	Missense_Mutation	SNP	ENST00000359332.2	37	CCDS9692.1	.	.	.	.	.	.	.	.	.	.	C	9.838	1.190260	0.21954	.	.	ENSG00000197776	ENST00000359332;ENST00000557128	T;T	0.67523	-0.27;-0.27	5.78	1.34	0.21922	Galactose oxidase/kelch, beta-propeller (1);Kelch-type beta propeller (1);	0.164679	0.53938	D	0.000057	T	0.48241	0.1489	N	0.25485	0.75	0.23636	N	0.997233	B;B	0.30361	0.277;0.085	B;B	0.31547	0.132;0.038	T	0.30297	-0.9983	10	0.21014	T	0.42	-0.3182	9.4425	0.38677	0.0:0.5979:0.0:0.4021	.	104;233	G3V3T1;Q8N7A1	.;KLDC1_HUMAN	S	233;104	ENSP00000352282:T233S;ENSP00000451407:T104S	ENSP00000352282:T233S	T	+	2	0	KLHDC1	49266004	0.933000	0.31639	0.991000	0.47740	0.956000	0.61745	0.163000	0.16520	-0.028000	0.13850	-0.237000	0.12165	ACT	.		0.348	KLHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276882.2	NM_172193	
ATP10A	57194	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	25959142	25959142	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr15:25959142C>A	ENST00000356865.6	-	10	2134	c.2023G>T	c.(2023-2025)Gac>Tac	p.D675Y		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	675					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GCCCAGTTGTCCGCCTGGCTG	0.692																																					p.D675Y													.	ATP10A-139	0			c.G2023T						.						24.0	26.0	25.0					15																	25959142		2199	4296	6495	SO:0001583	missense	57194	exon10			AGTTGTCCGCCTG	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2023G>T	15.37:g.25959142C>A	ENSP00000349325:p.Asp675Tyr	Somatic	63	1		WXS	Illumina HiSeq	Phase_I	50	14	NM_024490	0	0	0	0	0	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	8.047	0.765185	0.15914	.	.	ENSG00000206190	ENST00000356865	T	0.10860	2.83	3.77	2.83	0.33086	HAD-like domain (1);	1.723910	0.02350	N	0.075817	T	0.15305	0.0369	L	0.29908	0.895	0.09310	N	1	P	0.38395	0.629	P	0.45474	0.482	T	0.32613	-0.9900	10	0.59425	D	0.04	-3.2906	8.5411	0.33393	0.1612:0.525:0.3138:0.0	.	675	O60312	AT10A_HUMAN	Y	675	ENSP00000349325:D675Y	ENSP00000349325:D675Y	D	-	1	0	ATP10A	23510235	0.002000	0.14202	0.003000	0.11579	0.038000	0.13279	1.500000	0.35682	0.911000	0.36747	0.561000	0.74099	GAC	.		0.692	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
GABRG3	2567	broad.mit.edu	37	15	27777965	27777965	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr15:27777965T>C	ENST00000333743.6	+	10	1596	c.1342T>C	c.(1342-1344)Ttt>Ctt	p.F448L	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	448					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTCCCGGGTCTTTTTCCCCAC	0.473																																					p.F448L	NSCLC(114;800 1656 7410 37729 45293)												.	.	0			c.T1342C						.						72.0	73.0	73.0					15																	27777965		1952	4142	6094	SO:0001583	missense	2567	exon10			CGGGTCTTTTTCC		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1342T>C	15.37:g.27777965T>C	ENSP00000331912:p.Phe448Leu	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	60	3	NM_033223	0	0	0	0	0	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.954120	0.53293	.	.	ENSG00000182256	ENST00000333743	T	0.80824	-1.42	5.75	3.4	0.38934	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.175067	0.50627	D	0.000109	T	0.65080	0.2657	N	0.20401	0.57	0.80722	D	1	B	0.25206	0.12	B	0.33196	0.159	T	0.49504	-0.8933	10	0.08837	T	0.75	.	7.9945	0.30261	0.0:0.0709:0.1369:0.7922	.	448	Q99928	GBRG3_HUMAN	L	448	ENSP00000331912:F448L	ENSP00000331912:F448L	F	+	1	0	GABRG3	25451560	1.000000	0.71417	0.319000	0.25293	0.894000	0.52154	4.846000	0.62860	0.422000	0.26005	0.528000	0.53228	TTT	.		0.473	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
MESDC2	23184	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	81282037	81282037	+	Silent	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr15:81282037G>A	ENST00000261758.4	-	1	182	c.96C>T	c.(94-96)tgC>tgT	p.C32C	RP11-775C24.3_ENST00000563737.1_lincRNA	NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	32	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						CTTCGGCCGCGCAGGACCCAG	0.637																																					p.C32C		.											.	MESDC2-90	0			c.C96T						.						35.0	35.0	35.0					15																	81282037		2203	4298	6501	SO:0001819	synonymous_variant	23184	exon1			GGCCGCGCAGGAC	D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.96C>T	15.37:g.81282037G>A		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	68	33	NM_015154	0	0	10	22	12	B4DW84|D3DW96|Q969U1	Silent	SNP	ENST00000261758.4	37	CCDS32308.1																																																																																			.		0.637	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417673.2	NM_015154	
PAGR1	79447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	29830999	29830999	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr16:29830999C>G	ENST00000320330.6	+	3	1251	c.689C>G	c.(688-690)tCg>tGg	p.S230W	PAGR1_ENST00000609618.1_Missense_Mutation_p.S230W|MVP_ENST00000357402.5_5'Flank|AC009133.12_ENST00000569809.1_RNA|AC009133.20_ENST00000569039.1_RNA|AC009133.12_ENST00000564980.1_RNA|MVP_ENST00000452209.2_5'Flank|MVP_ENST00000395353.1_5'Flank			Q9BTK6	PAGR1_HUMAN	PAXIP1 associated glutamate-rich protein 1	230						histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)											AGCCTGGACTCGGAGGACCCC	0.637																																					p.S230W		.											.	.	0			c.C689G						.						67.0	72.0	70.0					16																	29830999		2197	4300	6497	SO:0001583	missense	79447	exon3			TGGACTCGGAGGA	BC003640	CCDS10655.1	16p11.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000185928	ENSG00000185928			28707	protein-coding gene	gene with protein product	"""glutamate-rich coactivator interacting with SRC1/NCOA1"", ""PTIP-associated 1 protein"", ""glutamate-rich coactivator associated with SRC1"""	612033	"""chromosome 16 open reading frame 53"""	C16orf53		17500065, 19039327	Standard	NM_024516		Approved	MGC4606, GAS, PA1	uc002dug.4	Q9BTK6	OTTHUMG00000132117	ENST00000320330.6:c.689C>G	16.37:g.29830999C>G	ENSP00000326519:p.Ser230Trp	Somatic	147	1		WXS	Illumina HiSeq	Phase_I	113	23	NM_024516	0	0	31	41	10	A2ICR6	Missense_Mutation	SNP	ENST00000320330.6	37	CCDS10655.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524695	0.85600	.	.	ENSG00000185928	ENST00000320330	.	.	.	5.82	5.82	0.92795	.	0.357942	0.29424	N	0.012191	T	0.65471	0.2694	L	0.36672	1.1	0.45161	D	0.998178	D	0.59357	0.985	P	0.58577	0.841	T	0.67098	-0.5756	9	0.87932	D	0	-3.3155	17.5892	0.87991	0.0:1.0:0.0:0.0	.	230	Q9BTK6	PA1_HUMAN	W	230	.	ENSP00000326519:S230W	S	+	2	0	C16orf53	29738500	0.977000	0.34250	1.000000	0.80357	0.863000	0.49368	1.880000	0.39628	2.767000	0.95098	0.655000	0.94253	TCG	.		0.637	PAGR1-002	PUTATIVE	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000473165.1	NM_024516	
ABCC12	94160	broad.mit.edu	37	16	48180262	48180262	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr16:48180262T>C	ENST00000311303.3	-	1	419	c.74A>G	c.(73-75)tAt>tGt	p.Y25C	ABCC12_ENST00000416054.1_Missense_Mutation_p.Y25C|ABCC12_ENST00000448542.1_Missense_Mutation_p.Y25C	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	25						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				GCTGGGGTCATATCTTTCTGC	0.587																																					p.Y25C													.	ABCC12-93	0			c.A74G						.						173.0	148.0	156.0					16																	48180262		2201	4300	6501	SO:0001583	missense	94160	exon1			GGGTCATATCTTT	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.74A>G	16.37:g.48180262T>C	ENSP00000311030:p.Tyr25Cys	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	148	5	NM_033226	0	0	0	0	0	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	37	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	T	17.50	3.403980	0.62288	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054;ENST00000527640	D;D;D;D	0.95412	-3.11;-3.37;-3.52;-3.7	5.45	4.35	0.52113	.	0.146288	0.47093	D	0.000255	D	0.97306	0.9119	M	0.86651	2.83	0.44635	D	0.997611	P;D	0.63046	0.871;0.992	P;D	0.64776	0.779;0.929	D	0.96898	0.9658	10	0.87932	D	0	.	9.5569	0.39343	0.0:0.0:0.177:0.823	.	25;25	Q96J65-2;Q96J65	.;MRP9_HUMAN	C	25	ENSP00000311030:Y25C;ENSP00000401855:Y25C;ENSP00000413046:Y25C;ENSP00000436647:Y25C	ENSP00000311030:Y25C	Y	-	2	0	ABCC12	46737763	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	3.858000	0.55979	0.875000	0.35847	0.496000	0.49642	TAT	.		0.587	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
ZNF423	23090	broad.mit.edu;ucsc.edu	37	16	49670868	49670868	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr16:49670868T>A	ENST00000561648.1	-	4	2248	c.2195A>T	c.(2194-2196)aAg>aTg	p.K732M	ZNF423_ENST00000562871.1_Missense_Mutation_p.K672M|ZNF423_ENST00000535559.1_Missense_Mutation_p.K615M|ZNF423_ENST00000562520.1_Missense_Mutation_p.K672M|ZNF423_ENST00000567169.1_Missense_Mutation_p.K615M|ZNF423_ENST00000563137.2_Missense_Mutation_p.K672M|ZNF423_ENST00000262383.2_Missense_Mutation_p.K732M	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	732					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GATGGACACCTTGGAGTCGAA	0.562																																					p.K732M													.	ZNF423-228	0			c.A2195T						.						100.0	92.0	95.0					16																	49670868		2198	4300	6498	SO:0001583	missense	23090	exon4			GACACCTTGGAGT	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2195A>T	16.37:g.49670868T>A	ENSP00000455426:p.Lys732Met	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	49	6	NM_015069	0	0	3	3	0	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.101470	0.56183	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.31247	1.5;1.5	5.05	5.05	0.67936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.51143	0.1657	L	0.58669	1.825	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	T	0.48658	-0.9016	9	.	.	.	.	14.8066	0.69962	0.0:0.0:0.0:1.0	.	732	Q2M1K9	ZN423_HUMAN	M	732;615	ENSP00000262383:K732M;ENSP00000442321:K615M	.	K	-	2	0	ZNF423	48228369	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	1.907000	0.55213	0.459000	0.35465	AAG	.		0.562	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
MAF	4094	hgsc.bcm.edu	37	16	79633040	79633040	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr16:79633040C>G	ENST00000393350.1	-	1	1571	c.760G>C	c.(760-762)Ggc>Cgc	p.G254R	MAF_ENST00000326043.4_Missense_Mutation_p.G254R|MAF_ENST00000569649.1_Missense_Mutation_p.G254R	NM_001031804.2	NP_001026974.1	O75444	MAF_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog	254	Gly-rich.|Represses ARE-mediated transcription.				cell development (GO:0048468)|cytokine production (GO:0001816)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of chondrocyte differentiation (GO:0032330)|transcription from RNA polymerase II promoter (GO:0006366)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)	10		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		AAGTGCAGGCCGCCGGCGGCG	0.791			T	IGH@	MM																																p.G254R		.		Dom	yes		16	16q22-q23	4094	v-maf musculoaponeurotic fibrosarcoma oncogene homolog		L	.	MAF-1270	0			c.G760C						.						6.0	7.0	6.0					16																	79633040		2125	4201	6326	SO:0001583	missense	4094	exon1			GCAGGCCGCCGGC		CCDS10928.1, CCDS42198.1	16q22-q23	2013-07-09	2013-07-09		ENSG00000178573	ENSG00000178573			6776	protein-coding gene	gene with protein product		177075				14998484	Standard	NM_005360		Approved	c-MAF	uc002ffm.3	O75444	OTTHUMG00000137621	ENST00000393350.1:c.760G>C	16.37:g.79633040C>G	ENSP00000377019:p.Gly254Arg	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	6	4	NM_001031804	0	0	45	81	36	Q66I47|Q9UP93	Missense_Mutation	SNP	ENST00000393350.1	37	CCDS42198.1	.	.	.	.	.	.	.	.	.	.	C	4.402	0.074251	0.08485	.	.	ENSG00000178573	ENST00000326043;ENST00000393350	T;T	0.80123	-1.34;-1.34	3.26	2.26	0.28386	.	0.620036	0.12924	U	0.427943	T	0.64148	0.2572	N	0.19112	0.55	0.25604	N	0.986568	B;P	0.39391	0.399;0.671	B;B	0.41946	0.048;0.371	T	0.53865	-0.8378	10	0.10636	T	0.68	-14.237	5.2354	0.15443	0.0:0.6509:0.2161:0.133	.	254;254	O75444;O75444-1	MAF_HUMAN;.	R	254	ENSP00000327048:G254R;ENSP00000377019:G254R	ENSP00000327048:G254R	G	-	1	0	MAF	78190541	.	.	0.980000	0.43619	0.978000	0.69477	.	.	1.540000	0.49301	0.442000	0.29010	GGC	.		0.791	MAF-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317037.1		
GFAP	2670	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	42987523	42987523	+	Intron	SNP	G	G	C	rs9908084|rs386797323	byFrequency	TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr17:42987523G>C	ENST00000253408.5	-	7	1237				GFAP_ENST00000588735.1_Intron|GFAP_ENST00000435360.2_Missense_Mutation_p.T426R	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein						astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				AGCCGGCGGCGTTCCATTTAC	0.537																																					p.T426R		.											.	GFAP-516	0			c.C1277G						.						215.0	191.0	198.0					17																	42987523		1568	3582	5150	SO:0001627	intron_variant	2670	exon8			GGCGGCGTTCCAT	S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.1171+459C>G	17.37:g.42987523G>C		Somatic	158	1		WXS	Illumina HiSeq	Phase_I	149	48	NM_001131019	0	0	0	0	0	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Missense_Mutation	SNP	ENST00000253408.5	37	CCDS11491.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.251401	0.39797	.	.	ENSG00000131095	ENST00000435360	D	0.84516	-1.86	4.79	3.8	0.43715	.	.	.	.	.	T	0.70193	0.3196	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.67791	-0.5579	9	0.66056	D	0.02	.	9.5131	0.39089	0.0951:0.0:0.9049:0.0	.	426	E9PAX3	.	R	426	ENSP00000403962:T426R	ENSP00000403962:T426R	T	-	2	0	GFAP	40343049	1.000000	0.71417	0.910000	0.35882	0.158000	0.22134	1.941000	0.40233	1.599000	0.50093	0.655000	0.94253	ACG	G|0.911;A|0.089		0.537	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448701.1	NM_002055	
HSF5	124535	broad.mit.edu;bcgsc.ca	37	17	56565509	56565509	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr17:56565509G>A	ENST00000323777.3	-	1	236	c.127C>T	c.(127-129)Cag>Tag	p.Q43*		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	43					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AAGAGCGGCTGATCGATAAGC	0.726																																					p.Q43X													.	HSF5-71	0			c.C127T						.						8.0	10.0	10.0					17																	56565509		1895	3831	5726	SO:0001587	stop_gained	124535	exon1			GCGGCTGATCGAT	BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.127C>T	17.37:g.56565509G>A	ENSP00000313243:p.Gln43*	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	35	18	NM_001080439	0	0	0	0	0	Q08EH7|Q8N7V2	Nonsense_Mutation	SNP	ENST00000323777.3	37	CCDS32690.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.96|18.96	3.733181|3.733181	0.69189|0.69189	.|.	.|.	ENSG00000176160|ENSG00000176160	ENST00000323777|ENST00000412540	.|.	.|.	.|.	4.09|4.09	4.09|4.09	0.47781|0.47781	.|.	0.000000|.	0.45361|.	D|.	0.000367|.	.|T	.|0.60818	.|0.2298	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73164	.|-0.4069	.|4	0.40728|0.87932	T|D	0.16|0	.|.	10.7446|10.7446	0.46172|0.46172	0.0:0.0:0.8095:0.1905|0.0:0.0:0.8095:0.1905	.|.	.|.	.|.	.|.	X|L	43|64	.|.	ENSP00000313243:Q43X|ENSP00000396453:S64L	Q|S	-|-	1|2	0|0	HSF5|HSF5	53920508|53920508	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.244000|0.244000	0.25665|0.25665	4.373000|4.373000	0.59537|0.59537	2.269000|2.269000	0.75478|0.75478	0.462000|0.462000	0.41574|0.41574	CAG|TCA	.		0.726	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444719.1	XM_064190	
GPR142	350383	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72368139	72368139	+	Silent	SNP	C	C	A	rs143074832		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr17:72368139C>A	ENST00000335666.4	+	4	837	c.789C>A	c.(787-789)ccC>ccA	p.P263P		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	263						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						TGTGCCACCCCCTGCACCATC	0.667																																					p.P263P													.	GPR142-93	0			c.C789A						.						61.0	48.0	52.0					17																	72368139		2202	4300	6502	SO:0001819	synonymous_variant	350383	exon4			CCACCCCCTGCAC	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.789C>A	17.37:g.72368139C>A		Somatic	45	0		WXS	Illumina HiSeq	Phase_I	51	9	NM_181790	0	0	0	0	0	A4CYJ8|Q86SL3	Silent	SNP	ENST00000335666.4	37	CCDS11698.1																																																																																			C|0.999;T|0.001		0.667	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
RNF157	114804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74158077	74158077	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr17:74158077C>A	ENST00000269391.6	-	10	931	c.799G>T	c.(799-801)Gaa>Taa	p.E267*	RNF157_ENST00000319945.6_Nonsense_Mutation_p.E267*	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	267							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			ACTTCGTCTTCAGCCACCTGG	0.527																																					p.E267X	GBM(186;507 2120 27388 27773 52994)	.											.	RNF157-228	0			c.G799T						.						96.0	68.0	78.0					17																	74158077		2203	4300	6503	SO:0001587	stop_gained	114804	exon10			CGTCTTCAGCCAC	AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.799G>T	17.37:g.74158077C>A	ENSP00000269391:p.Glu267*	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	67	31	NM_052916	0	0	0	0	0	Q8NB72|Q96N56	Nonsense_Mutation	SNP	ENST00000269391.6	37	CCDS32740.1	.	.	.	.	.	.	.	.	.	.	C	38	6.984953	0.97983	.	.	ENSG00000141576	ENST00000269391;ENST00000319945;ENST00000301610	.	.	.	5.73	5.73	0.89815	.	0.044080	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-18.6068	19.893	0.96937	0.0:1.0:0.0:0.0	.	.	.	.	X	267;267;229	.	ENSP00000269391:E267X	E	-	1	0	RNF157	71669672	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.782000	0.85680	2.693000	0.91896	0.655000	0.94253	GAA	.		0.527	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732	
TMC6	11322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	76115385	76115385	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr17:76115385G>C	ENST00000590602.1	-	14	1963	c.1804C>G	c.(1804-1806)Ctg>Gtg	p.L602V	TMC6_ENST00000392467.3_Missense_Mutation_p.L602V|TMC6_ENST00000322933.4_Missense_Mutation_p.L181V|TMC6_ENST00000322914.3_Missense_Mutation_p.L602V|TMC6_ENST00000591436.1_Missense_Mutation_p.L181V|TMC6_ENST00000592076.1_Intron|TMC6_ENST00000306591.7_Intron			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	602					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CACCAGGTCAGAGTCTGCCCA	0.622																																					p.L602V		.											.	TMC6-90	0			c.C1804G						.						133.0	117.0	123.0					17																	76115385		2203	4300	6503	SO:0001583	missense	11322	exon14			AGGTCAGAGTCTG	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.1804C>G	17.37:g.76115385G>C	ENSP00000465261:p.Leu602Val	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	100	31	NM_001127198	0	0	0	0	0	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	ENST00000590602.1	37	CCDS32748.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.992746	0.74703	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000322933;ENST00000392466	T;T;T	0.67698	-0.28;-0.28;-0.28	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000002	T	0.79707	0.4492	L	0.60904	1.88	0.47994	D	0.999565	D;D	0.89917	0.998;1.0	D;D	0.83275	0.98;0.996	T	0.82232	-0.0559	10	0.72032	D	0.01	-16.0397	17.6365	0.88123	0.0:0.0:1.0:0.0	.	602;181	Q7Z403;Q7Z403-3	TMC6_HUMAN;.	V	602;602;181;68	ENSP00000313408:L602V;ENSP00000376260:L602V;ENSP00000313479:L181V	ENSP00000313408:L602V	L	-	1	2	TMC6	73626980	1.000000	0.71417	0.980000	0.43619	0.951000	0.60555	3.385000	0.52485	2.164000	0.68074	0.555000	0.69702	CTG	.		0.622	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1		
LGI4	163175	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	35617832	35617832	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr19:35617832G>T	ENST00000310123.3	-	7	1237	c.718C>A	c.(718-720)Ccc>Acc	p.P240T	LGI4_ENST00000493050.1_5'UTR|LGI4_ENST00000392225.3_Missense_Mutation_p.P240T	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	240					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCGGCGAAGGGCTGTGCCAGC	0.662																																					p.P240T		.											.	LGI4-91	0			c.C718A						.						40.0	46.0	44.0					19																	35617832		2203	4300	6503	SO:0001583	missense	163175	exon7			CGAAGGGCTGTGC	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.718C>A	19.37:g.35617832G>T	ENSP00000312273:p.Pro240Thr	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	334	26	NM_139284	0	0	4	4	0	B2RN53|B9EGS7|Q5M8T1	Missense_Mutation	SNP	ENST00000310123.3	37	CCDS12444.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222746	0.58668	.	.	ENSG00000153902	ENST00000310123;ENST00000392225;ENST00000437421	D;D	0.81579	-1.51;-1.51	3.94	3.94	0.45596	.	0.000000	0.64402	D	0.000013	D	0.87245	0.6129	M	0.64170	1.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88525	0.3099	10	0.72032	D	0.01	.	13.5039	0.61474	0.0:0.0:1.0:0.0	.	151;240	Q658V8;Q8N135	.;LGI4_HUMAN	T	240	ENSP00000312273:P240T;ENSP00000376059:P240T	ENSP00000312273:P240T	P	-	1	0	LGI4	40309672	1.000000	0.71417	1.000000	0.80357	0.325000	0.28411	7.564000	0.82326	2.025000	0.59659	0.313000	0.20887	CCC	.		0.662	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1		
CYP1B1	1545	hgsc.bcm.edu;broad.mit.edu	37	2	38302357	38302357	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:38302357G>C	ENST00000260630.3	-	2	576	c.175C>G	c.(175-177)Ctg>Gtg	p.L59V	CYP1B1-AS1_ENST00000589303.1_RNA|CYP1B1_ENST00000407341.1_Missense_Mutation_p.L59V|CYP1B1-AS1_ENST00000431999.1_RNA|CYP1B1_ENST00000494864.1_Intron	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1	59					angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	TTTCCGATCAGTGGCCACGCA	0.721																																					p.L59V		.											.	CYP1B1-515	0			c.C175G						.						8.0	10.0	9.0					2																	38302357		2147	4207	6354	SO:0001583	missense	1545	exon2			CGATCAGTGGCCA	U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.175C>G	2.37:g.38302357G>C	ENSP00000260630:p.Leu59Val	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	12	6	NM_000104	0	0	5	10	5	Q5TZW8|Q93089|Q9H316	Missense_Mutation	SNP	ENST00000260630.3	37	CCDS1793.1	.	.	.	.	.	.	.	.	.	.	G	5.939	0.357214	0.11239	.	.	ENSG00000138061	ENST00000260630;ENST00000407341	T;T	0.69561	-0.41;-0.41	4.29	2.42	0.29668	.	0.389391	0.24269	N	0.040011	T	0.50292	0.1607	N	0.20574	0.59	0.26804	N	0.969141	B	0.27910	0.193	B	0.38378	0.272	T	0.41627	-0.9498	10	0.14656	T	0.56	.	7.627	0.28218	0.0953:0.1661:0.7386:0.0	.	59	Q53TK1	.	V	59	ENSP00000260630:L59V;ENSP00000384972:L59V	ENSP00000260630:L59V	L	-	1	2	CYP1B1	38155861	0.008000	0.16893	0.990000	0.47175	0.027000	0.11550	0.123000	0.15708	0.415000	0.25817	-0.479000	0.04858	CTG	.		0.721	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218580.3	NM_000104	
BOLA3	388962	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	74362686	74362686	+	3'UTR	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:74362686C>A	ENST00000327428.5	-	0	477				BOLA3_ENST00000295326.4_Missense_Mutation_p.R90I	NM_212552.2	NP_997717.2	Q53S33	BOLA3_HUMAN	bolA family member 3							extracellular region (GO:0005576)				large_intestine(1)|lung(1)	2						CATCCAAGGTCTTAAGCAGCA	0.388																																					p.R90I		.											.	BOLA3-90	0			c.G269T						.						190.0	163.0	172.0					2																	74362686		2203	4300	6503	SO:0001624	3_prime_UTR_variant	388962	exon3			CAAGGTCTTAAGC	BC017744	CCDS33224.1, CCDS33225.1	2p13.1	2013-09-02	2013-09-02		ENSG00000163170	ENSG00000163170			24415	protein-coding gene	gene with protein product		613183	"""bolA-like 3 (E. coli)"", ""bolA homolog 3 (E. coli)"""			14718656	Standard	NM_001035505		Approved		uc002skc.1	Q53S33	OTTHUMG00000152834	ENST00000327428.5:c.*34G>T	2.37:g.74362686C>A		Somatic	131	1		WXS	Illumina HiSeq	Phase_I	105	33	NM_001035505	0	0	16	32	16	G3XAB0	Missense_Mutation	SNP	ENST00000327428.5	37	CCDS33225.1	.	.	.	.	.	.	.	.	.	.	C	11.64	1.698137	0.30142	.	.	ENSG00000163170	ENST00000295326	.	.	.	4.01	-5.54	0.02544	.	.	.	.	.	T	0.19525	0.0469	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.13407	0.009	T	0.28808	-1.0032	8	0.87932	D	0	.	7.5135	0.27587	0.0:0.262:0.5237:0.2143	.	90	G3XAB0	.	I	90	.	ENSP00000295326:R90I	R	-	2	0	BOLA3	74216194	0.000000	0.05858	0.000000	0.03702	0.591000	0.36615	-1.560000	0.02160	-0.961000	0.03609	-0.290000	0.09829	AGA	.		0.388	BOLA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328207.2	NM_212552	
WDR33	55339	hgsc.bcm.edu	37	2	128474756	128474756	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:128474756G>A	ENST00000322313.4	-	17	3000	c.2842C>T	c.(2842-2844)Ccc>Tcc	p.P948S		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	948					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CCTTGTCCGGGGTTCAGAGGG	0.473																																					p.P948S		.											.	WDR33-90	0			c.C2842T						.						41.0	39.0	40.0					2																	128474756		2203	4300	6503	SO:0001583	missense	55339	exon17			GTCCGGGGTTCAG		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.2842C>T	2.37:g.128474756G>A	ENSP00000325377:p.Pro948Ser	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	30	11	NM_018383	0	0	9	23	14	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	37	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911907	0.52439	.	.	ENSG00000136709	ENST00000322313	D	0.89270	-2.49	5.27	4.33	0.51752	.	0.109084	0.41712	D	0.000831	T	0.77110	0.4082	N	0.08118	0	0.80722	D	1	B	0.14012	0.009	B	0.19666	0.026	T	0.72494	-0.4276	10	0.36615	T	0.2	-6.9429	11.0259	0.47744	0.0:0.188:0.812:0.0	.	948	Q9C0J8	WDR33_HUMAN	S	948	ENSP00000325377:P948S	ENSP00000325377:P948S	P	-	1	0	WDR33	128191226	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.042000	0.41222	2.473000	0.83533	0.563000	0.77884	CCC	.		0.473	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
WDR33	55339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	128526506	128526506	+	Splice_Site	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:128526506C>A	ENST00000322313.4	-	3	432		c.e3+1		WDR33_ENST00000393006.1_Splice_Site|WDR33_ENST00000409658.3_Splice_Site	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33						mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CATGTACTTACATCATTGTAA	0.323																																					.		.											.	WDR33-90	0			c.273+1G>T						.						138.0	126.0	130.0					2																	128526506		2203	4300	6503	SO:0001630	splice_region_variant	55339	exon4			TACTTACATCATT		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.273+1G>T	2.37:g.128526506C>A		Somatic	142	0		WXS	Illumina HiSeq	Phase_I	126	48	NM_018383	0	0	0	0	0	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Splice_Site	SNP	ENST00000322313.4	37	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530432	0.85706	.	.	ENSG00000136709	ENST00000322313;ENST00000436787;ENST00000393006;ENST00000409658;ENST00000408998	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8826	0.92362	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR33	128242976	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.506000	0.81665	2.627000	0.88993	0.655000	0.94253	.	.		0.323	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	Intron
RBM45	129831	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	178977555	178977555	+	Silent	SNP	C	C	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:178977555C>T	ENST00000286070.5	+	1	374	c.282C>T	c.(280-282)aaC>aaT	p.N94N		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	94	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			TCGGCCCCAACGACACCAAGC	0.662																																					p.N94N													.	RBM45-22	0			c.C282T						.						38.0	39.0	38.0					2																	178977555		2203	4300	6503	SO:0001819	synonymous_variant	129831	exon1			CCCCAACGACACC	AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.282C>T	2.37:g.178977555C>T		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	55	7	NM_152945	0	0	2	5	3	Q6NYL0|Q8NFC9	Silent	SNP	ENST00000286070.5	37	CCDS33335.1																																																																																			.		0.662	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334375.2	NM_152945	
ZNF335	63925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	44579218	44579218	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr20:44579218T>C	ENST00000322927.2	-	21	3306	c.3206A>G	c.(3205-3207)cAc>cGc	p.H1069R	ZNF335_ENST00000426788.1_Missense_Mutation_p.H914R	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1069					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				TAGGCTTGAGTGCTGTGCCAT	0.592																																					p.H1069R		.											.	ZNF335-94	0			c.A3206G						.						126.0	137.0	133.0					20																	44579218		2203	4300	6503	SO:0001583	missense	63925	exon21			CTTGAGTGCTGTG	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3206A>G	20.37:g.44579218T>C	ENSP00000325326:p.His1069Arg	Somatic	256	0		WXS	Illumina HiSeq	Phase_I	229	25	NM_022095	0	0	5	5	0	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	37	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.613272	0.66672	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	D;D	0.88975	-2.45;-2.45	4.82	4.82	0.62117	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.97235	0.9096	H	0.99783	4.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.98479	1.0604	10	0.87932	D	0	-30.0634	14.0159	0.64523	0.0:0.0:0.0:1.0	.	914;1069	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	R	1069;846;914	ENSP00000325326:H1069R;ENSP00000397098:H914R	ENSP00000243961:H846R	H	-	2	0	ZNF335	44012625	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	7.442000	0.80503	2.166000	0.68216	0.460000	0.39030	CAC	.		0.592	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
ZFP64	55734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	50701575	50701575	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr20:50701575G>A	ENST00000361387.2	-	9	1519	c.1459C>T	c.(1459-1461)Cgg>Tgg	p.R487W	ZFP64_ENST00000371523.4_Missense_Mutation_p.R268W|ZFP64_ENST00000371518.2_Intron	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						TGGTGCAGCCGGCTGTGCTCC	0.632																																					p.R487W		.											.	ZFP64-155	0			c.C1459T						.						55.0	59.0	58.0					20																	50701575		2203	4300	6503	SO:0001583	missense	55734	exon9			GCAGCCGGCTGTG	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1459C>T	20.37:g.50701575G>A	ENSP00000355179:p.Arg487Trp	Somatic	134	1		WXS	Illumina HiSeq	Phase_I	145	37	NM_199427	0	0	1	4	3	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000361387.2	37	CCDS13439.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187374	0.78789	.	.	ENSG00000020256	ENST00000371523;ENST00000361387	T;T	0.09073	3.02;3.03	4.65	4.65	0.58169	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	.	.	.	.	T	0.34483	0.0899	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.988;0.999	T	0.27706	-1.0066	9	0.87932	D	0	.	14.6115	0.68519	0.0:0.0:0.8542:0.1458	.	487;268	Q9NTW7;Q9NTW7-2	ZF64B_HUMAN;.	W	268;487	ENSP00000360578:R268W;ENSP00000355179:R487W	ENSP00000355179:R487W	R	-	1	2	ZFP64	50134982	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.318000	0.33643	2.569000	0.86673	0.655000	0.94253	CGG	.		0.632	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079743.2	NM_018197	
ZBTB46	140685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62421455	62421455	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr20:62421455C>G	ENST00000245663.4	-	2	806	c.656G>C	c.(655-657)gGa>gCa	p.G219A	ZBTB46_ENST00000302995.2_Missense_Mutation_p.G219A|ZBTB46_ENST00000395104.1_Missense_Mutation_p.G219A|ZBTB46_ENST00000480766.1_5'Flank	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	219					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					GCCCACGTCTCCAGGCCATAG	0.602																																					p.G219A		.											.	ZBTB46-154	0			c.G656C						.						65.0	61.0	62.0					20																	62421455		2203	4300	6503	SO:0001583	missense	140685	exon2			ACGTCTCCAGGCC	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.656G>C	20.37:g.62421455C>G	ENSP00000245663:p.Gly219Ala	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	59	23	NM_025224	0	0	3	4	1	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Missense_Mutation	SNP	ENST00000245663.4	37	CCDS13538.1	.	.	.	.	.	.	.	.	.	.	C	7.452	0.642959	0.14451	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	T;T;T	0.08807	3.05;3.05;3.05	5.53	5.53	0.82687	.	0.168310	0.53938	D	0.000060	T	0.08846	0.0219	L	0.40543	1.245	0.26386	N	0.976659	B	0.12630	0.006	B	0.10450	0.005	T	0.34428	-0.9829	10	0.08837	T	0.75	.	18.4243	0.90604	0.0:1.0:0.0:0.0	.	219	Q86UZ6	ZBT46_HUMAN	A	219	ENSP00000245663:G219A;ENSP00000303102:G219A;ENSP00000378536:G219A	ENSP00000245663:G219A	G	-	2	0	ZBTB46	61891899	0.511000	0.26179	0.923000	0.36655	0.092000	0.18411	3.313000	0.51935	2.609000	0.88269	0.650000	0.86243	GGA	.		0.602	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
KRTAP27-1	643812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	31709825	31709825	+	Silent	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr21:31709825G>A	ENST00000382835.2	-	1	187	c.162C>T	c.(160-162)tgC>tgT	p.C54C		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	54						intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						TGGTTTCATTGCAGGTTTCTT	0.448																																					p.C54C		.											.	KRTAP27-1-24	0			c.C162T						.						159.0	150.0	153.0					21																	31709825		2203	4300	6503	SO:0001819	synonymous_variant	643812	exon1			TTCATTGCAGGTT	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.162C>T	21.37:g.31709825G>A		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	145	50	NM_001077711	0	0	0	0	0		Silent	SNP	ENST00000382835.2	37	CCDS33532.1																																																																																			.		0.448	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
TIAM1	7074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	32638551	32638551	+	Silent	SNP	G	G	A	rs202182190	byFrequency	TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr21:32638551G>A	ENST00000286827.3	-	5	1209	c.738C>T	c.(736-738)aaC>aaT	p.N246N	TIAM1_ENST00000469412.1_Intron|TIAM1_ENST00000541036.1_Silent_p.N246N	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	246					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CCGGCCCCCCGTTTGCTGTCA	0.537													G|||	2	0.000399361	0.0	0.0	5008	,	,		16227	0.001		0.0	False		,,,				2504	0.001				p.N246N		.											.	TIAM1-724	0			c.C738T						.						68.0	72.0	71.0					21																	32638551		2203	4300	6503	SO:0001819	synonymous_variant	7074	exon5			CCCCCCGTTTGCT		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.738C>T	21.37:g.32638551G>A		Somatic	157	0		WXS	Illumina HiSeq	Phase_I	147	48	NM_003253	0	0	0	0	0	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	CCDS13609.1																																																																																			G|0.999;A|0.000		0.537	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
XKR3	150165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	17280836	17280836	+	Silent	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr22:17280836G>T	ENST00000331428.5	-	3	516	c.414C>A	c.(412-414)atC>atA	p.I138I		NM_175878.3	NP_787074.2	Q5GH77	XKR3_HUMAN	XK, Kell blood group complex subunit-related family, member 3	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TTCTCTTTGTGATGCTAACTT	0.398																																					p.I138I		.											.	XKR3-92	0			c.C414A						.						209.0	186.0	193.0					22																	17280836		1885	4131	6016	SO:0001819	synonymous_variant	150165	exon3			CTTTGTGATGCTA	AY989815	CCDS42975.1	22q11.1	2007-01-16	2006-01-12		ENSG00000172967	ENSG00000172967			28778	protein-coding gene	gene with protein product		611674	"""X Kell blood group precursor-related family, member 3"""			16431037	Standard	NM_175878		Approved	MGC57211, XTES	uc002zlv.3	Q5GH77	OTTHUMG00000143726	ENST00000331428.5:c.414C>A	22.37:g.17280836G>T		Somatic	152	2		WXS	Illumina HiSeq	Phase_I	123	54	NM_175878	0	0	0	0	0	B2RPN1|Q52PG8|Q8N7E1	Silent	SNP	ENST00000331428.5	37	CCDS42975.1																																																																																			.		0.398	XKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289789.1	NM_175878	
SMARCB1	6598	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	24145544	24145544	+	Missense_Mutation	SNP	C	C	T	rs137986695		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr22:24145544C>T	ENST00000263121.7	+	5	759	c.563C>T	c.(562-564)cCc>cTc	p.P188L	SMARCB1_ENST00000344921.6_Missense_Mutation_p.P197L|SMARCB1_ENST00000407082.3_Missense_Mutation_p.P142L|SMARCB1_ENST00000407422.3_Missense_Mutation_p.P179L	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	188	2 X approximate tandem repeats.|HIV-1 integrase-binding.|MYC-binding.				ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(6)|p.P188L(1)|p.V185_M193del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				GTGCTGGTCCCCATCCGGCTG	0.592			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.P188L		.	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	.	SMARCB1-2699	8	Unknown(3)|Deletion - Frameshift(3)|Substitution - Missense(1)|Deletion - In frame(1)	soft_tissue(5)|central_nervous_system(2)|skin(1)	c.C563T						.						114.0	103.0	107.0					22																	24145544		2203	4300	6503	SO:0001583	missense	6598	exon5			TGGTCCCCATCCG	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.563C>T	22.37:g.24145544C>T	ENSP00000263121:p.Pro188Leu	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	114	10	NM_003073	0	0	142	147	5	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	ENST00000263121.7	37	CCDS13817.1	.	.	.	.	.	.	.	.	.	.	C	34	5.321447	0.95682	.	.	ENSG00000099956	ENST00000417137;ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.98251	0.9421	M	0.92784	3.345	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.993;0.999	D;D;D;D	0.97110	0.982;1.0;0.983;0.997	D	0.99323	1.0907	10	0.72032	D	0.01	-25.3436	17.5295	0.87810	0.0:1.0:0.0:0.0	.	197;179;188;206	G5E975;Q17S11;Q12824;C9JTA6	.;.;SNF5_HUMAN;.	L	206;197;188;179;142	ENSP00000388489:P206L;ENSP00000340883:P197L;ENSP00000263121:P188L;ENSP00000383984:P179L;ENSP00000385226:P142L	ENSP00000263121:P188L	P	+	2	0	SMARCB1	22475544	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.810000	0.86072	2.472000	0.83506	0.644000	0.83932	CCC	.		0.592	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
DRG1	4733	hgsc.bcm.edu;broad.mit.edu	37	22	31799189	31799189	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr22:31799189A>G	ENST00000331457.4	+	3	502	c.341A>G	c.(340-342)cAg>cGg	p.Q114R	DRG1_ENST00000433341.1_3'UTR	NM_004147.3	NP_004138.1	Q9Y295	DRG1_HUMAN	developmentally regulated GTP binding protein 1	114	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|polysome (GO:0005844)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	11						GCCAAGATCCAGGTGAGTCAA	0.458																																					p.Q114R		.											.	DRG1-90	0			c.A341G						.						63.0	55.0	57.0					22																	31799189		2203	4300	6503	SO:0001630	splice_region_variant	4733	exon3			AGATCCAGGTGAG	AJ005940	CCDS13897.1	22q12.2	2010-02-26	2001-11-28		ENSG00000185721	ENSG00000185721			3029	protein-coding gene	gene with protein product		603952	"""developmentally regulated GTP-binding protein 1"""	NEDD3		7929244, 1449490	Standard	NM_004147		Approved		uc003aku.3	Q9Y295	OTTHUMG00000030792	ENST00000331457.4:c.342+1A>G	22.37:g.31799189A>G		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	52	3	NM_004147	0	0	0	0	0	B2RDS8|Q6FGP8|Q8WW69|Q9UGF2	Missense_Mutation	SNP	ENST00000331457.4	37	CCDS13897.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.565846	0.86439	.	.	ENSG00000185721	ENST00000331457	T	0.31247	1.5	5.25	5.25	0.73442	Small GTP-binding protein domain (1);GTP-binding domain, HSR1-related (1);	0.103621	0.64402	D	0.000002	T	0.57975	0.2090	M	0.90922	3.16	0.80722	D	1	P	0.50943	0.94	P	0.55011	0.766	T	0.69026	-0.5254	10	0.87932	D	0	-19.5383	15.0384	0.71767	1.0:0.0:0.0:0.0	.	114	Q9Y295	DRG1_HUMAN	R	114	ENSP00000329715:Q114R	ENSP00000329715:Q114R	Q	+	2	0	DRG1	30129189	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.378000	0.90144	2.288000	0.76882	0.533000	0.62120	CAG	.		0.458	DRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075680.5	NM_004147	Missense_Mutation
C1QTNF6	114904	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37578392	37578392	+	Missense_Mutation	SNP	C	C	T	rs369130130		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr22:37578392C>T	ENST00000337843.2	-	3	748	c.673G>A	c.(673-675)Gag>Aag	p.E225K	RP1-151B14.6_ENST00000419128.1_RNA|C1QTNF6_ENST00000255836.6_Missense_Mutation_p.E101K|C1QTNF6_ENST00000397110.2_Missense_Mutation_p.E225K|C1QTNF6_ENST00000470655.1_5'UTR	NM_031910.3	NP_114116.3	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	206	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein heterotrimerization (GO:0070208)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(1)|large_intestine(2)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)	11						ATGCTGCGCTCGCTGGGCTGC	0.577																																					p.E225K													.	C1QTNF6-90	0			c.G673A						.	C	LYS/GLU,LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	85.0	65.0	72.0		673,673	4.9	1.0	22		72	0,8600		0,0,4300	no	missense,missense	C1QTNF6	NM_031910.3,NM_182486.1	56,56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	225/279,225/279	37578392	1,13005	2203	4300	6503	SO:0001583	missense	114904	exon3			TGCGCTCGCTGGG	AF329842	CCDS13943.1	22q13.1	2014-02-21			ENSG00000133466	ENSG00000133466			14343	protein-coding gene	gene with protein product		614910				12975309	Standard	NM_031910		Approved	CTRP6, ZACRP6	uc003aqy.1	Q9BXI9	OTTHUMG00000150538	ENST00000337843.2:c.673G>A	22.37:g.37578392C>T	ENSP00000338812:p.Glu225Lys	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	42	10	NM_182486	0	0	7	11	4	Q5H9G8|Q6ZRM7	Missense_Mutation	SNP	ENST00000337843.2	37	CCDS13943.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200483	0.79015	2.27E-4	0.0	ENSG00000133466	ENST00000397110;ENST00000337843;ENST00000255836	T;T;T	0.21191	2.02;2.02;2.02	4.94	4.94	0.65067	Tumour necrosis factor-like (2);Complement C1q protein (2);	0.226034	0.45361	D	0.000377	T	0.30135	0.0755	L	0.38838	1.175	0.58432	D	0.999999	D;D	0.58970	0.984;0.973	P;P	0.53450	0.726;0.608	T	0.01661	-1.1301	10	0.40728	T	0.16	.	18.1776	0.89766	0.0:1.0:0.0:0.0	.	225;206	Q9BXI9-2;Q9BXI9	.;C1QT6_HUMAN	K	225;225;101	ENSP00000380299:E225K;ENSP00000338812:E225K;ENSP00000255836:E101K	ENSP00000255836:E101K	E	-	1	0	C1QTNF6	35908338	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.818000	0.86416	2.286000	0.76751	0.561000	0.74099	GAG	.		0.577	C1QTNF6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318807.1	NM_182486	
PRICKLE2	166336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	64084893	64084893	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr3:64084893A>G	ENST00000295902.6	-	8	2954	c.2369T>C	c.(2368-2370)tTc>tCc	p.F790S	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.F846S|RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	790					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		TTCTCCTAGGAAATAGCCCTC	0.567																																					p.F790S		.											.	PRICKLE2-95	0			c.T2369C						.						76.0	77.0	77.0					3																	64084893		2203	4300	6503	SO:0001583	missense	166336	exon8			CCTAGGAAATAGC	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.2369T>C	3.37:g.64084893A>G	ENSP00000295902:p.Phe790Ser	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	84	39	NM_198859	0	0	0	1	1	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.039965	0.75732	.	.	ENSG00000163637	ENST00000295902	D	0.88046	-2.33	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.92004	0.7467	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	D	0.92874	0.6317	10	0.87932	D	0	-40.9764	15.8395	0.78835	1.0:0.0:0.0:0.0	.	790	Q7Z3G6	PRIC2_HUMAN	S	790	ENSP00000295902:F790S	ENSP00000295902:F790S	F	-	2	0	PRICKLE2	64059933	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.962000	0.93254	2.152000	0.67230	0.533000	0.62120	TTC	.		0.567	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
DBR1	51163	broad.mit.edu	37	3	137892448	137892448	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr3:137892448T>C	ENST00000260803.4	-	2	371	c.218A>G	c.(217-219)aAg>aGg	p.K73R	DBR1_ENST00000463982.2_5'UTR|DBR1_ENST00000505015.2_5'UTR	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	73					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						AACTGGAGCCTTTTTCTCTCC	0.398																																					p.K73R													.	DBR1-90	0			c.A218G						.						109.0	112.0	111.0					3																	137892448		2203	4300	6503	SO:0001583	missense	51163	exon2			GGAGCCTTTTTCT	AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.218A>G	3.37:g.137892448T>C	ENSP00000260803:p.Lys73Arg	Somatic	194	1		WXS	Illumina HiSeq	Phase_I	170	4	NM_016216	0	0	7	7	0	Q96GH0|Q9NXQ6	Missense_Mutation	SNP	ENST00000260803.4	37	CCDS33863.1	.	.	.	.	.	.	.	.	.	.	T	14.42	2.530194	0.45073	.	.	ENSG00000138231	ENST00000260803	T	0.32272	1.46	5.58	5.58	0.84498	Metallophosphoesterase domain (1);	0.105722	0.64402	D	0.000006	T	0.25419	0.0618	L	0.47716	1.5	0.80722	D	1	B	0.25772	0.134	B	0.26416	0.069	T	0.07986	-1.0744	10	0.20046	T	0.44	-4.5131	9.0631	0.36447	0.1638:0.0:0.0:0.8362	.	73	Q9UK59	DBR1_HUMAN	R	73	ENSP00000260803:K73R	ENSP00000260803:K73R	K	-	2	0	DBR1	139375138	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.727000	0.61993	2.120000	0.65058	0.533000	0.62120	AAG	.		0.398	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357585.1		
KPNA4	3840	ucsc.edu;bcgsc.ca	37	3	160232961	160232961	+	Intron	SNP	A	A	G	rs3836374		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr3:160232961A>G	ENST00000334256.4	-	12	1338				SCARNA7_ENST00000458797.1_RNA	NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)						cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TACATAATATACATATTAAAA	0.333																																					.													.	.	0			.						.						36.0	38.0	38.0					3																	160232961		875	1991	2866	SO:0001627	intron_variant	677767	.			TAATATACATATT	AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.1032+278T>C	3.37:g.160232961A>G		Somatic	42	0		WXS	Illumina HiSeq		48	10	.	0	0	1	1	0	A8K4S6|D3DNM2|O00190	RNA	SNP	ENST00000334256.4	37	CCDS3191.1																																																																																			.		0.333	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352960.1	NM_002268	
SLC2A2	6514	broad.mit.edu;bcgsc.ca	37	3	170723087	170723087	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr3:170723087G>A	ENST00000314251.3	-	7	1029	c.950C>T	c.(949-951)tCc>tTc	p.S317F	SLC2A2_ENST00000382808.4_Missense_Mutation_p.S198F	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	317	Monosaccharide binding. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	ATTGATTCCGGAAAATTGCTG	0.423																																					p.S317F													.	SLC2A2-515	0			c.C950T						.						172.0	160.0	164.0					3																	170723087		2203	4300	6503	SO:0001583	missense	6514	exon7			ATTCCGGAAAATT	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.950C>T	3.37:g.170723087G>A	ENSP00000323568:p.Ser317Phe	Somatic	178	0		WXS	Illumina HiSeq	Phase_I	151	9	NM_000340	0	0	0	0	0	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	ENST00000314251.3	37	CCDS3215.1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954567	0.53293	.	.	ENSG00000163581	ENST00000314251;ENST00000382808	T;T	0.76578	-1.03;-1.03	5.53	4.65	0.58169	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.93054	0.7789	H	0.99058	4.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95975	0.8973	10	0.87932	D	0	.	16.0903	0.81086	0.0:0.0:0.8649:0.135	.	317	P11168	GTR2_HUMAN	F	317;198	ENSP00000323568:S317F;ENSP00000372258:S198F	ENSP00000323568:S317F	S	-	2	0	SLC2A2	172205781	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	9.434000	0.97515	1.456000	0.47831	0.591000	0.81541	TCC	.		0.423	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
PLD1	5337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	171394619	171394619	+	Silent	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr3:171394619G>A	ENST00000351298.4	-	18	2127	c.2001C>T	c.(1999-2001)ttC>ttT	p.F667F	PLD1_ENST00000342215.6_Missense_Mutation_p.S558L|PLD1_ENST00000356327.5_Silent_p.F629F|PLD1_ENST00000340989.4_Silent_p.F667F	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	667	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	ACCTGTCAATGAAATCTGCCC	0.542																																					p.F667F	NSCLC(149;2174 3517 34058)	.											.	PLD1-660	0			c.C2001T						.						52.0	46.0	48.0					3																	171394619		2203	4300	6503	SO:0001819	synonymous_variant	5337	exon18			GTCAATGAAATCT	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.2001C>T	3.37:g.171394619G>A		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	47	19	NM_002662	0	0	0	0	0		Silent	SNP	ENST00000351298.4	37	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.505561	0.64410	.	.	ENSG00000075651	ENST00000342215	T	0.34275	1.37	5.81	4.94	0.65067	.	.	.	.	.	T	0.46073	0.1374	.	.	.	0.28598	N	0.90932	.	.	.	.	.	.	T	0.42515	-0.9447	6	0.49607	T	0.09	-20.5851	14.4529	0.67397	0.0699:0.0:0.9301:0.0	.	.	.	.	L	558	ENSP00000339936:S558L	ENSP00000339936:S558L	S	-	2	0	PLD1	172877313	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.889000	0.56212	1.464000	0.47987	0.557000	0.71058	TCA	.		0.542	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
SEL1L3	23231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	25806261	25806261	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr4:25806261A>T	ENST00000399878.3	-	10	1800	c.1678T>A	c.(1678-1680)Ttt>Att	p.F560I	SEL1L3_ENST00000264868.5_Missense_Mutation_p.F525I|SEL1L3_ENST00000502949.1_Missense_Mutation_p.F407I	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	560						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						TCCGTCAGAAAGGGGACGATA	0.433																																					p.F560I		.											.	.	0			c.T1678A						.						93.0	89.0	90.0					4																	25806261		1896	4134	6030	SO:0001583	missense	23231	exon10			TCAGAAAGGGGAC	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.1678T>A	4.37:g.25806261A>T	ENSP00000382767:p.Phe560Ile	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	55	23	NM_015187	0	0	4	4	0	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	ENST00000399878.3	37	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	A	12.90	2.076787	0.36662	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.13538	2.79;2.8;2.58	6.02	2.18	0.27775	Tetratricopeptide-like helical (1);	0.882014	0.10506	N	0.666713	T	0.12732	0.0309	L	0.47716	1.5	0.26551	N	0.973918	B	0.19445	0.036	B	0.12837	0.008	T	0.35375	-0.9791	10	0.20519	T	0.43	-0.7039	10.2524	0.43377	0.7466:0.0:0.2534:0.0	.	560	Q68CR1	SE1L3_HUMAN	I	560;525;407	ENSP00000382767:F560I;ENSP00000264868:F525I;ENSP00000425438:F407I	ENSP00000264868:F525I	F	-	1	0	SEL1L3	25415359	0.998000	0.40836	0.775000	0.31657	0.911000	0.54048	2.508000	0.45450	0.151000	0.19162	0.533000	0.62120	TTT	.		0.433	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187	
ACSL1	2180	broad.mit.edu;ucsc.edu	37	4	185724472	185724472	+	Splice_Site	SNP	A	A	T	rs201598489		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr4:185724472A>T	ENST00000515030.1	-	2	521		c.e2+1		ACSL1_ENST00000454703.2_Intron|ACSL1_ENST00000504342.1_Splice_Site|ACSL1_ENST00000437665.3_Splice_Site|ACSL1_ENST00000513317.1_Splice_Site|ACSL1_ENST00000281455.2_Splice_Site|ACSL1_ENST00000504900.1_Splice_Site|ACSL1_ENST00000507295.1_Splice_Site			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1						adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCCTCCACTCACCGCCACTTC	0.547																																					.													.	ACSL1-92	0			c.195+2T>A						.						48.0	46.0	47.0					4																	185724472		2203	4300	6503	SO:0001630	splice_region_variant	2180	exon3			CCACTCACCGCCA	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.195+1T>A	4.37:g.185724472A>T		Somatic	13	0		WXS	Illumina HiSeq	Phase_I	12	8	NM_001995	0	0	0	36	36	B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Splice_Site	SNP	ENST00000515030.1	37	CCDS3839.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.248886	0.80024	.	.	ENSG00000151726	ENST00000515030;ENST00000281455;ENST00000507295;ENST00000504342;ENST00000513317;ENST00000504900	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9604	0.71153	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACSL1	185961466	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	8.626000	0.90969	2.114000	0.64651	0.533000	0.62120	.	.		0.547	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995	Intron
FAM149A	25854	hgsc.bcm.edu	37	4	187088232	187088232	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr4:187088232C>G	ENST00000356371.5	+	12	2148	c.2148C>G	c.(2146-2148)agC>agG	p.S716R	FAM149A_ENST00000389354.5_Missense_Mutation_p.S425R|FAM149A_ENST00000227065.4_Missense_Mutation_p.S425R|FAM149A_ENST00000503432.1_Missense_Mutation_p.S425R|FAM149A_ENST00000514153.1_Missense_Mutation_p.S425R|FAM149A_ENST00000502970.1_Missense_Mutation_p.S425R			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	716										breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		CAAGGCCCAGCACAACCCACA	0.453																																					p.S425R		.											.	FAM149A-90	0			c.C1275G						.						72.0	66.0	68.0					4																	187088232		2203	4300	6503	SO:0001583	missense	25854	exon11			GCCCAGCACAACC	AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.2148C>G	4.37:g.187088232C>G	ENSP00000348732:p.Ser716Arg	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_001006655	0	0	47	47	0	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Missense_Mutation	SNP	ENST00000356371.5	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	14.29|14.29|14.29	2.492410|2.492410|2.492410	0.44352|0.44352|0.44352	.|.|.	.|.|.	ENSG00000109794|ENSG00000109794|ENSG00000109794	ENST00000510843|ENST00000512271|ENST00000503432;ENST00000356371;ENST00000227065;ENST00000502970;ENST00000514153;ENST00000389354	.|.|T;T;T;T;T;T	.|.|0.13420	.|.|2.68;2.59;2.68;2.68;2.68;2.68	5.72|5.72|5.72	3.68|3.68|3.68	0.42216|0.42216|0.42216	.|.|.	.|.|0.120460	.|.|0.64402	.|.|D	.|.|0.000020	T|T|T	0.31199|0.31199|0.31199	0.0789|0.0789|0.0789	M|M|M	0.70595|0.70595|0.70595	2.14|2.14|2.14	0.27657|0.27657|0.27657	N|N|N	0.947213|0.947213|0.947213	.|.|D;D	.|.|0.76494	.|.|0.999;0.997	.|.|D;D	.|.|0.72075	.|.|0.976;0.91	T|T|T	0.04565|0.04565|0.04565	-1.0942|-1.0942|-1.0942	5|5|10	.|.|0.66056	.|.|D	.|.|0.02	-14.6564|-14.6564|-14.6564	7.8564|7.8564|7.8564	0.29485|0.29485|0.29485	0.0:0.7449:0.0:0.2551|0.0:0.7449:0.0:0.2551|0.0:0.7449:0.0:0.2551	.|.|.	.|.|716;716	.|.|A5PLN7-3;A5PLN7	.|.|.;F149A_HUMAN	G|D|R	103|103|425;716;425;425;425;425	.|.|ENSP00000426835:S425R;ENSP00000348732:S716R;ENSP00000227065:S425R;ENSP00000427155:S425R;ENSP00000424380:S425R;ENSP00000374005:S425R	.|.|ENSP00000227065:S425R	A|H|S	+|+|+	2|1|3	0|0|2	FAM149A|FAM149A|FAM149A	187325226|187325226|187325226	0.995000|0.995000|0.995000	0.38212|0.38212|0.38212	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.151000|0.151000|0.151000	0.21798|0.21798|0.21798	0.130000|0.130000|0.130000	0.15850|0.15850|0.15850	1.434000|1.434000|1.434000	0.47414|0.47414|0.47414	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCA|CAC|AGC	.		0.453	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655	
TNPO1	3842	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	72151675	72151675	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr5:72151675G>A	ENST00000337273.5	+	4	706	c.280G>A	c.(280-282)Ggt>Agt	p.G94S	TNPO1_ENST00000513944.1_3'UTR|TNPO1_ENST00000506351.2_Missense_Mutation_p.G86S|TNPO1_ENST00000447967.2_Missense_Mutation_p.G86S|TNPO1_ENST00000454282.1_Intron|TNPO1_ENST00000523768.1_Intron	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	94	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		CTTCCCAAATGGTGTAACAGA	0.328																																					p.G94S		.											.	TNPO1-228	0			c.G280A						.						62.0	62.0	62.0					5																	72151675		2203	4297	6500	SO:0001583	missense	3842	exon4			CCAAATGGTGTAA	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.280G>A	5.37:g.72151675G>A	ENSP00000336712:p.Gly94Ser	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	81	20	NM_002270	0	0	7	9	2	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	37	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.737401	0.49045	.	.	ENSG00000083312	ENST00000337273;ENST00000447967;ENST00000506351	T;T;T	0.65549	-0.16;-0.16;-0.16	4.89	4.89	0.63831	Armadillo-like helical (1);Armadillo-type fold (1);Importin-beta, N-terminal (3);	0.095869	0.64402	D	0.000001	T	0.43255	0.1239	N	0.10685	0.025	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29852	-0.9998	10	0.18276	T	0.48	-2.9577	18.4554	0.90718	0.0:0.0:1.0:0.0	.	94	Q92973	TNPO1_HUMAN	S	94;86;86	ENSP00000336712:G94S;ENSP00000415164:G86S;ENSP00000425118:G86S	ENSP00000336712:G94S	G	+	1	0	TNPO1	72187431	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.320000	0.96346	2.430000	0.82344	0.650000	0.86243	GGT	.		0.328	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
FGF1	2246	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	141974869	141974869	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr5:141974869C>A	ENST00000359370.6	-	4	533	c.454G>T	c.(454-456)Gtc>Ttc	p.V152F	FGF1_ENST00000494579.1_5'UTR|FGF1_ENST00000337706.2_Missense_Mutation_p.V152F|AC005592.2_ENST00000414314.1_RNA|FGF1_ENST00000360966.5_3'UTR|FGF1_ENST00000378046.1_Missense_Mutation_p.V152F|FGF1_ENST00000407758.1_3'UTR|FGF1_ENST00000419524.2_Missense_Mutation_p.V152F|AC005592.2_ENST00000443800.1_RNA	NM_000800.4|NM_001144892.2|NM_001144934.1|NM_001144935.1|NM_001257205.1|NM_001257206.1|NM_001257207.1|NM_001257210.1|NM_001257212.1|NM_033137.2	NP_000791.1|NP_001138364.1|NP_001138406.1|NP_001138407.1|NP_001244134.1|NP_001244135.1|NP_001244136.1|NP_001244139.1|NP_001244141.1|NP_149128.1	P05230	FGF1_HUMAN	fibroblast growth factor 1 (acidic)	152					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|branch elongation involved in ureteric bud branching (GO:0060681)|cell differentiation (GO:0030154)|cellular response to heat (GO:0034605)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesonephric epithelium development (GO:0072163)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	fibroblast growth factor receptor binding (GO:0005104)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|S100 protein binding (GO:0044548)			large_intestine(1)|lung(2)	3		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Amlexanox(DB01025)|Pazopanib(DB06589)|Pentosan Polysulfate(DB00686)	TCAGAAGAGACTGGCAGGGGG	0.493																																					p.V152F		.											.	FGF1-947	0			c.G454T						.						65.0	66.0	66.0					5																	141974869		2203	4300	6503	SO:0001583	missense	2246	exon4			AAGAGACTGGCAG	X59065	CCDS4275.1, CCDS4276.1	5q31.3-q33.2	2014-01-30			ENSG00000113578	ENSG00000113578		"""Endogenous ligands"""	3665	protein-coding gene	gene with protein product	"""heparin-binding growth factor 1"", ""endothelial cell growth factor, alpha"", ""endothelial cell growth factor, beta"""	131220		FGFA		1697263, 3523756	Standard	NM_033137		Approved	AFGF, ECGF, ECGFA, ECGFB, HBGF1, ECGF-beta, FGF-alpha, GLIO703	uc031slo.1	P05230	OTTHUMG00000059703	ENST00000359370.6:c.454G>T	5.37:g.141974869C>A	ENSP00000352329:p.Val152Phe	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	105	36	NM_001257209	0	0	0	0	0	B2R5T0|D3DQF2|P07502|Q16588	Missense_Mutation	SNP	ENST00000359370.6	37	CCDS4275.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694692	0.68386	.	.	ENSG00000113578	ENST00000359370;ENST00000378046;ENST00000337706;ENST00000441680;ENST00000419524	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.87	5.87	0.94306	.	0.081539	0.51477	D	0.000089	T	0.58133	0.2101	M	0.80982	2.52	0.54753	D	0.999984	P;D	0.53745	0.465;0.962	B;P	0.48189	0.132;0.57	T	0.64495	-0.6394	10	0.87932	D	0	.	20.2084	0.98285	0.0:1.0:0.0:0.0	.	151;152	A8K147;P05230	.;FGF1_HUMAN	F	152	ENSP00000352329:V152F;ENSP00000367285:V152F;ENSP00000338548:V152F;ENSP00000404742:V152F;ENSP00000396195:V152F	ENSP00000338548:V152F	V	-	1	0	FGF1	141955053	0.996000	0.38824	0.940000	0.37924	0.841000	0.47740	4.573000	0.60893	2.774000	0.95407	0.650000	0.86243	GTC	.		0.493	FGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132735.2	NM_000800	
KIF13A	63971	broad.mit.edu;bcgsc.ca	37	6	17783900	17783900	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:17783900G>A	ENST00000259711.6	-	29	3626	c.3521C>T	c.(3520-3522)cCa>cTa	p.P1174L	KIF13A_ENST00000378816.5_Missense_Mutation_p.P1174L|KIF13A_ENST00000378814.5_Missense_Mutation_p.P1161L|KIF13A_ENST00000378843.2_Missense_Mutation_p.P1161L|KIF13A_ENST00000378826.2_Missense_Mutation_p.P1174L	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1174					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GAAGAGAACTGGTATGTGGGT	0.318																																					p.P1174L													.	KIF13A-137	0			c.C3521T						.						71.0	70.0	70.0					6																	17783900		1820	4071	5891	SO:0001583	missense	63971	exon29			AGAACTGGTATGT	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.3521C>T	6.37:g.17783900G>A	ENSP00000259711:p.Pro1174Leu	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	8	4	NM_001105566	0	0	1	3	2	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.135171|5.135171	0.94517|0.94517	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816;ENST00000506044|ENST00000358380	T;T;T;T;T;T|.	0.80994|.	-1.42;0.74;-1.44;-1.4;-1.42;-1.4|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.80706|.	0.4674|.	M|M	0.85299|0.85299	2.745|2.745	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.998;0.999;1.0;0.999|.	T|.	0.81417|.	-0.0942|.	10|.	0.87932|.	D|.	0|.	.|.	19.3733|19.3733	0.94498|0.94498	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1161;1174;1174;1161|.	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3|.	.;.;KI13A_HUMAN;.|.	L|X	1161;178;1174;1174;1161;1174;172|568	ENSP00000368091:P1161L;ENSP00000425616:P178L;ENSP00000259711:P1174L;ENSP00000368103:P1174L;ENSP00000368120:P1161L;ENSP00000368093:P1174L|.	ENSP00000259711:P1174L|.	P|Q	-|-	2|1	0|0	KIF13A|KIF13A	17891879|17891879	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.990000|0.990000	0.78478|0.78478	9.689000|9.689000	0.98673|0.98673	2.667000|2.667000	0.90743|0.90743	0.561000|0.561000	0.74099|0.74099	CCA|CAG	.		0.318	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
XPO5	57510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43541219	43541219	+	Silent	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:43541219G>C	ENST00000265351.7	-	2	435	c.225C>G	c.(223-225)gtC>gtG	p.V75V	POLH_ENST00000535400.1_5'Flank|POLH_ENST00000372236.4_5'Flank|POLH_ENST00000372226.1_5'Flank	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	75	Necessary for interaction with Ran.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			CTCCTTACTTGACAACGTGTT	0.433																																					p.V75V		.											.	XPO5-271	0			c.C225G						.						87.0	85.0	86.0					6																	43541219		1910	4111	6021	SO:0001819	synonymous_variant	57510	exon2			TTACTTGACAACG	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.225C>G	6.37:g.43541219G>C		Somatic	84	0		WXS	Illumina HiSeq	Phase_I	433	223	NM_020750	0	0	0	2	2	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Silent	SNP	ENST00000265351.7	37	CCDS47430.1																																																																																			.		0.433	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750	
CDC5L	988	broad.mit.edu;bcgsc.ca	37	6	44390390	44390390	+	Silent	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:44390390T>C	ENST00000371477.3	+	10	1547	c.1248T>C	c.(1246-1248)ccT>ccC	p.P416P		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	416	Interaction with PPP1R8.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTAGGACTCCTTCTAATGGAG	0.408																																					p.P416P													.	CDC5L-229	0			c.T1248C						.						77.0	84.0	82.0					6																	44390390		2203	4300	6503	SO:0001819	synonymous_variant	988	exon10			GACTCCTTCTAAT	D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.1248T>C	6.37:g.44390390T>C		Somatic	192	0		WXS	Illumina HiSeq	Phase_I	1017	39	NM_001253	0	0	0	0	0	Q76N46|Q99974	Silent	SNP	ENST00000371477.3	37	CCDS4912.1																																																																																			.		0.408	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040743.1		
TNFRSF21	27242	broad.mit.edu	37	6	47251682	47251682	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:47251682T>C	ENST00000296861.2	-	3	1628	c.1235A>G	c.(1234-1236)aAt>aGt	p.N412S		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	412					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			ACCATGGCCATTGCAGTAGTA	0.512																																					p.N412S													.	TNFRSF21-227	0			c.A1235G						.						97.0	100.0	99.0					6																	47251682		2203	4300	6503	SO:0001583	missense	27242	exon3			TGGCCATTGCAGT	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1235A>G	6.37:g.47251682T>C	ENSP00000296861:p.Asn412Ser	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	254	4	NM_014452	0	0	0	0	0	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.423588	0.83559	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	D	0.89746	-2.56	6.17	6.17	0.99709	Death (1);DEATH-like (1);	0.000000	0.85682	D	0.000000	D	0.89458	0.6721	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91741	0.5404	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	412	O75509	TNR21_HUMAN	S	412;101	ENSP00000296861:N412S	ENSP00000296861:N412S	N	-	2	0	TNFRSF21	47359641	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	5.712000	0.68407	2.371000	0.80710	0.533000	0.62120	AAT	.		0.512	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
LATS1	9113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	150005370	150005370	+	Silent	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:150005370G>T	ENST00000543571.1	-	4	1402	c.855C>A	c.(853-855)atC>atA	p.I285I	LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000392273.3_Silent_p.I285I|LATS1_ENST00000253339.5_Silent_p.I285I	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		AGATTCGGGAGATTACGTATT	0.532																																					p.I285I		.											.	LATS1-992	0			c.C855A						.						153.0	144.0	147.0					6																	150005370		2203	4300	6503	SO:0001819	synonymous_variant	9113	exon4			TCGGGAGATTACG	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.855C>A	6.37:g.150005370G>T		Somatic	179	0		WXS	Illumina HiSeq	Phase_I	172	77	NM_001270519	0	0	0	4	4		Silent	SNP	ENST00000543571.1	37	CCDS34551.1																																																																																			.		0.532	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
ESR1	2099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152201893	152201893	+	Silent	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:152201893A>G	ENST00000206249.3	+	3	1109	c.747A>G	c.(745-747)ggA>ggG	p.G249G	ESR1_ENST00000427531.2_Silent_p.G76G|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000456483.2_Silent_p.G249G|ESR1_ENST00000440973.1_Silent_p.G249G|ESR1_ENST00000443427.1_Silent_p.G249G|ESR1_ENST00000338799.5_Silent_p.G249G	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	249	Mediates interaction with DNTTIP2.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	ACGAAGTGGGAATGATGAAAG	0.547																																					p.G249G		.											.	ESR1-1042	0			c.A747G						.						50.0	50.0	50.0					6																	152201893		2203	4300	6503	SO:0001819	synonymous_variant	2099	exon3			AGTGGGAATGATG	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.747A>G	6.37:g.152201893A>G		Somatic	52	0		WXS	Illumina HiSeq	Phase_I	41	13	NM_000125	0	0	0	0	0	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Silent	SNP	ENST00000206249.3	37	CCDS5234.1	.	.	.	.	.	.	.	.	.	.	A	9.711	1.157115	0.21454	.	.	ENSG00000091831	ENST00000427531	.	.	.	5.42	-10.8	0.00216	.	.	.	.	.	T	0.33089	0.0851	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58918	-0.7551	4	.	.	.	.	11.1314	0.48349	0.3958:0.3957:0.2085:0.0	.	.	.	.	G	154	.	.	E	+	2	0	ESR1	152243586	0.000000	0.05858	0.469000	0.27204	0.972000	0.66771	-2.223000	0.01214	-2.121000	0.00825	-1.074000	0.02243	GAA	.		0.547	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
MYCT1	80177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	153043198	153043198	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:153043198G>T	ENST00000367245.5	+	2	526	c.518G>T	c.(517-519)tGt>tTt	p.C173F	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	173						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		TTTCTGCAATGTCCACCACTT	0.498																																					p.C173F		.											.	MYCT1-91	0			c.G518T						.						89.0	87.0	88.0					6																	153043198		2203	4300	6503	SO:0001583	missense	80177	exon2			TGCAATGTCCACC	AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.518G>T	6.37:g.153043198G>T	ENSP00000356214:p.Cys173Phe	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	103	46	NM_025107	0	0	4	4	0	Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	ENST00000367245.5	37	CCDS5239.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.28|18.28	3.589712|3.589712	0.66105|0.66105	.|.	.|.	ENSG00000120279|ENSG00000120279	ENST00000367245|ENST00000532295	T|.	0.32753|.	1.44|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.364348|.	0.35838|.	N|.	0.002941|.	T|T	0.64875|0.64875	0.2638|0.2638	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	P;P|.	0.50617|.	0.937;0.853|.	P;P|.	0.49999|.	0.628;0.628|.	T|T	0.61907|0.61907	-0.6966|-0.6966	10|5	0.51188|.	T|.	0.08|.	-9.8469|-9.8469	16.985|16.985	0.86338|0.86338	0.0:0.1271:0.8729:0.0|0.0:0.1271:0.8729:0.0	.|.	125;173|.	D6Q1S4;Q8N699|.	.;MYCT1_HUMAN|.	F|F	173|154	ENSP00000356214:C173F|.	ENSP00000356214:C173F|.	C|V	+|+	2|1	0|0	MYCT1|MYCT1	153084891|153084891	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.964000|0.964000	0.63967|0.63967	5.162000|5.162000	0.64942|0.64942	2.727000|2.727000	0.93392|0.93392	0.579000|0.579000	0.79373|0.79373	TGT|GTC	.		0.498	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042750.2	NM_025107	
IPCEF1	26034	broad.mit.edu	37	6	154521109	154521109	+	Silent	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:154521109C>G	ENST00000265198.4	-	10	755	c.600G>C	c.(598-600)ctG>ctC	p.L200L	OPRM1_ENST00000337049.4_Intron|IPCEF1_ENST00000519344.1_Silent_p.L172L|IPCEF1_ENST00000367220.4_Silent_p.L201L|IPCEF1_ENST00000422970.2_Silent_p.L201L|IPCEF1_ENST00000519091.1_5'UTR	NM_001130700.1|NM_015553.2	NP_001124172.1|NP_056368.1	Q8WWN9	ICEF1_HUMAN	interaction protein for cytohesin exchange factors 1	200	Ser-rich.				oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of GTP catabolic process (GO:0033126)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	12						CTGTATTTTCCAGGGAAGAGA	0.418																																					p.L201L													.	IPCEF1-90	0			c.G603C						.						101.0	100.0	100.0					6																	154521109		2203	4300	6503	SO:0001819	synonymous_variant	26034	exon11			ATTTTCCAGGGAA	AB007863	CCDS5245.1, CCDS47509.1	6q25.2	2013-01-10			ENSG00000074706	ENSG00000074706		"""Pleckstrin homology (PH) domain containing"""	21204	protein-coding gene	gene with protein product	"""phosphoinositide binding protein PIP3-E"""					11804589, 19756519	Standard	NM_001130699		Approved	PIP3-E, KIAA0403	uc021zhc.1	Q8WWN9	OTTHUMG00000015872	ENST00000265198.4:c.600G>C	6.37:g.154521109C>G		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	110	3	NM_001130699	0	0	0	0	0	A8K1K2|B7ZL78|B7ZL80|O43153|Q5HYL8	Silent	SNP	ENST00000265198.4	37	CCDS5245.1																																																																																			.		0.418	IPCEF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042789.2	NM_001130699	
TTLL2	83887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	167755036	167755036	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:167755036G>T	ENST00000239587.5	+	3	1736	c.1648G>T	c.(1648-1650)Gat>Tat	p.D550Y		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	550					cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CAAAGCTCCAGATCCCCAAGC	0.502																																					p.D550Y		.											.	TTLL2-92	0			c.G1648T						.						113.0	104.0	107.0					6																	167755036		2203	4300	6503	SO:0001583	missense	83887	exon3			GCTCCAGATCCCC	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.1648G>T	6.37:g.167755036G>T	ENSP00000239587:p.Asp550Tyr	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	135	51	NM_031949	0	0	0	0	0	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	ENST00000239587.5	37	CCDS5301.1	.	.	.	.	.	.	.	.	.	.	G	4.684	0.127134	0.08981	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.02395	4.31	4.04	-7.0	0.01599	.	2.486670	0.01433	N	0.014832	T	0.00552	0.0018	N	0.14661	0.345	0.09310	N	1	B	0.23185	0.081	B	0.16722	0.016	T	0.45659	-0.9246	10	0.56958	D	0.05	.	3.3015	0.06984	0.368:0.3942:0.1298:0.108	.	550	Q9BWV7	TTLL2_HUMAN	Y	550;477	ENSP00000239587:D550Y	ENSP00000239587:D550Y	D	+	1	0	TTLL2	167675026	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.123000	0.15708	-1.248000	0.02503	0.491000	0.48974	GAT	.		0.502	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
TBL2	26608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	72988278	72988278	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr7:72988278G>A	ENST00000305632.5	-	3	677	c.436C>T	c.(436-438)Cct>Tct	p.P146S	TBL2_ENST00000452475.1_Missense_Mutation_p.P146S|TBL2_ENST00000432538.1_Missense_Mutation_p.P110S|TBL2_ENST00000459913.1_5'UTR	NM_012453.2	NP_036585.1	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	146							poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	19		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTGCAGTCAGGGCTGAAGCGC	0.612																																					p.P146S		.											.	TBL2-90	0			c.C436T						.						95.0	75.0	82.0					7																	72988278		2203	4300	6503	SO:0001583	missense	26608	exon3			AGTCAGGGCTGAA	AF056183	CCDS5551.1	7q11.23	2013-01-10			ENSG00000106638	ENSG00000106638		"""WD repeat domain containing"""	11586	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 13"""	605842				9860302, 10575226	Standard	XM_006715923		Approved	WS-betaTRP, WBSCR13, DKFZP43N024	uc003tyh.3	Q9Y4P3	OTTHUMG00000023427	ENST00000305632.5:c.436C>T	7.37:g.72988278G>A	ENSP00000307260:p.Pro146Ser	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	89	27	NM_012453	0	0	0	0	0	Q9UQE2	Missense_Mutation	SNP	ENST00000305632.5	37	CCDS5551.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841121	0.91197	.	.	ENSG00000106638	ENST00000305632;ENST00000541783;ENST00000432538;ENST00000452475	T;T;T	0.38077	1.16;1.16;1.16	5.3	5.3	0.74995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63803	0.2542	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66701	-0.5857	10	0.49607	T	0.09	-9.9847	16.4333	0.83861	0.0:0.0:1.0:0.0	.	110;146	E9PF19;Q9Y4P3	.;TBL2_HUMAN	S	146;146;110;146	ENSP00000307260:P146S;ENSP00000413979:P110S;ENSP00000407371:P146S	ENSP00000307260:P146S	P	-	1	0	TBL2	72626214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.735000	0.98825	2.491000	0.84063	0.561000	0.74099	CCT	.		0.612	TBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252233.3	NM_012453	
MFHAS1	9258	hgsc.bcm.edu	37	8	8750559	8750559	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr8:8750559T>C	ENST00000276282.6	-	1	596	c.10A>G	c.(10-12)Atg>Gtg	p.M4V	RNU6-682P_ENST00000363843.1_RNA	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	4										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CCACTGTCCATCCCAGCCATG	0.756																																					p.M4V	Melanoma(103;1201 2045 17515 28966)	.											.	MFHAS1-90	0			c.A10G						.						3.0	3.0	3.0					8																	8750559		1577	3199	4776	SO:0001583	missense	9258	exon1			TGTCCATCCCAGC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.10A>G	8.37:g.8750559T>C	ENSP00000276282:p.Met4Val	Somatic	3	0		WXS	Illumina HiSeq	Phase_I	15	5	NM_004225	0	0	0	0	0	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	T	12.24	1.878455	0.33162	.	.	ENSG00000147324	ENST00000276282	T	0.33216	1.42	3.87	2.66	0.31614	.	1.223050	0.06260	N	0.693747	T	0.17152	0.0412	N	0.08118	0	0.21105	N	0.99978	B	0.02656	0.0	B	0.01281	0.0	T	0.28744	-1.0034	10	0.23891	T	0.37	.	8.696	0.34296	0.0:0.0:0.1918:0.8082	.	4	Q9Y4C4	MFHA1_HUMAN	V	4	ENSP00000276282:M4V	ENSP00000276282:M4V	M	-	1	0	MFHAS1	8787969	0.980000	0.34600	0.977000	0.42913	0.611000	0.37282	2.561000	0.45905	0.513000	0.28278	0.369000	0.22263	ATG	.		0.756	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
MTUS1	57509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	17581310	17581310	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr8:17581310A>G	ENST00000262102.6	-	4	2544	c.2320T>C	c.(2320-2322)Tca>Cca	p.S774P	MTUS1_ENST00000519263.1_Intron|MTUS1_ENST00000381869.3_Intron|MTUS1_ENST00000544260.1_5'Flank|MTUS1_ENST00000381861.3_5'Flank	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	774					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TTCACCCATGACGACTGTGCA	0.463																																					p.S774P		.											.	MTUS1-92	0			c.T2320C						.						152.0	141.0	144.0					8																	17581310		1865	4099	5964	SO:0001583	missense	57509	exon4			CCCATGACGACTG	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2320T>C	8.37:g.17581310A>G	ENSP00000262102:p.Ser774Pro	Somatic	235	1		WXS	Illumina HiSeq	Phase_I	137	59	NM_001001924	0	0	1	3	2	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	A	15.94	2.980872	0.53827	.	.	ENSG00000129422	ENST00000262102	T	0.42900	0.96	3.8	3.8	0.43715	.	2.627820	0.01895	N	0.038843	T	0.55081	0.1898	L	0.32530	0.975	0.53688	D	0.999979	D	0.69078	0.997	D	0.64410	0.925	T	0.44528	-0.9322	10	0.29301	T	0.29	-2.2162	12.137	0.53977	1.0:0.0:0.0:0.0	.	774	Q9ULD2	MTUS1_HUMAN	P	774	ENSP00000262102:S774P	ENSP00000262102:S774P	S	-	1	0	MTUS1	17625590	0.099000	0.21834	0.064000	0.19789	0.885000	0.51271	2.939000	0.48995	1.933000	0.56026	0.533000	0.62120	TCA	.		0.463	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
TGFBR1	7046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	101894937	101894937	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr9:101894937C>G	ENST00000374994.4	+	3	607	c.490C>G	c.(490-492)Cct>Gct	p.P164A	TGFBR1_ENST00000374990.2_Intron|TGFBR1_ENST00000552516.1_Missense_Mutation_p.P168A|TGFBR1_ENST00000550253.1_Missense_Mutation_p.P95A	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	164					activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TGAAGAGGACCCTTCATTAGA	0.438																																					p.P164A		.											.	TGFBR1-954	0			c.C490G						.						160.0	135.0	144.0					9																	101894937		2203	4300	6503	SO:0001583	missense	7046	exon3			GAGGACCCTTCAT		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.490C>G	9.37:g.101894937C>G	ENSP00000364133:p.Pro164Ala	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	137	43	NM_004612	0	0	7	9	2	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	37	CCDS6738.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864541	0.51482	.	.	ENSG00000106799	ENST00000547314;ENST00000552573;ENST00000374994;ENST00000540092;ENST00000552516;ENST00000548365;ENST00000550253;ENST00000546584	T;T;T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.68495	0.3007	L	0.58583	1.82	0.80722	D	1	B	0.28850	0.225	B	0.31290	0.127	T	0.63310	-0.6666	10	0.11182	T	0.66	.	19.3122	0.94192	0.0:1.0:0.0:0.0	.	164	P36897	TGFR1_HUMAN	A	95;99;164;164;168;99;95;161	ENSP00000449934:P95A;ENSP00000447182:P99A;ENSP00000364133:P164A;ENSP00000447297:P168A;ENSP00000448518:P99A;ENSP00000450052:P95A;ENSP00000447707:P161A	ENSP00000364133:P164A	P	+	1	0	TGFBR1	100934758	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	7.818000	0.86416	2.865000	0.98341	0.655000	0.94253	CCT	.		0.438	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3		
DAB2IP	153090	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	124522288	124522288	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr9:124522288G>T	ENST00000408936.3	+	6	922	c.740G>T	c.(739-741)gGc>gTc	p.G247V	DAB2IP_ENST00000259371.2_Missense_Mutation_p.G219V|DAB2IP_ENST00000309989.1_Missense_Mutation_p.G123V			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	247	C2.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						CGCACCACGGGCAAGCTCAAG	0.597																																					p.G219V													.	DAB2IP-91	0			c.G656T						.						124.0	113.0	117.0					9																	124522288		2203	4300	6503	SO:0001583	missense	153090	exon6			CCACGGGCAAGCT	AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.740G>T	9.37:g.124522288G>T	ENSP00000386183:p.Gly247Val	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	72	18	NM_032552	0	0	9	14	5	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	SNP	ENST00000408936.3	37		.	.	.	.	.	.	.	.	.	.	G	16.06	3.014511	0.54468	.	.	ENSG00000136848	ENST00000394340;ENST00000436835;ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	T;T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3;0.3	4.97	4.97	0.65823	.	0.087217	0.85682	D	0.000000	T	0.35480	0.0933	N	0.01761	-0.735	0.80722	D	1	B	0.21071	0.051	B	0.22152	0.038	T	0.36187	-0.9758	10	0.66056	D	0.02	.	17.5948	0.88009	0.0:0.0:1.0:0.0	.	219	G3XA90	.	V	219;123;219;247;156;123	ENSP00000377872:G219V;ENSP00000409327:G123V;ENSP00000259371:G219V;ENSP00000386183:G247V;ENSP00000362887:G156V;ENSP00000310827:G123V	ENSP00000259371:G219V	G	+	2	0	DAB2IP	123562109	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	9.869000	0.99810	2.454000	0.82982	0.561000	0.74099	GGC	.		0.597	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
COQ4	51117	bcgsc.ca	37	9	131095814	131095814	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr9:131095814C>A	ENST00000300452.3	+	7	1011	c.688C>A	c.(688-690)Cca>Aca	p.P230T	COQ4_ENST00000461102.1_3'UTR	NM_016035.3	NP_057119			coenzyme Q4											endometrium(4)|large_intestine(1)|lung(4)	9						GCGCAGAGCCCCATGTGTCCT	0.607																																					p.P230T													.	COQ4-90	0			c.C688A						.						65.0	63.0	64.0					9																	131095814		2203	4300	6503	SO:0001583	missense	51117	exon7			AGAGCCCCATGTG	AF151850	CCDS6898.1	9q34.2	2013-10-18	2013-10-18		ENSG00000167113	ENSG00000167113			19693	protein-coding gene	gene with protein product		612898	"""coenzyme Q4 homolog (yeast)"", ""coenzyme Q4 homolog (S. cerevisiae)"""			11469793, 18474229	Standard	NM_016035		Approved	CGI-92	uc004bur.4	Q9Y3A0	OTTHUMG00000020743	ENST00000300452.3:c.688C>A	9.37:g.131095814C>A	ENSP00000300452:p.Pro230Thr	Somatic	122	3		WXS	Illumina HiSeq	Phase_1	105	40	NM_016035	0	0	50	86	36		Missense_Mutation	SNP	ENST00000300452.3	37	CCDS6898.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.015381	0.35511	.	.	ENSG00000167113	ENST00000300452	T	0.40225	1.04	5.52	5.52	0.82312	.	0.104785	0.64402	D	0.000008	T	0.29524	0.0736	N	0.25060	0.705	0.80722	D	1	P	0.39352	0.669	B	0.38106	0.265	T	0.05321	-1.0892	10	0.30078	T	0.28	-32.9145	12.1376	0.53981	0.2708:0.7292:0.0:0.0	.	230	Q9Y3A0	COQ4_HUMAN	T	230	ENSP00000300452:P230T	ENSP00000300452:P230T	P	+	1	0	COQ4	130135635	1.000000	0.71417	0.836000	0.33094	0.348000	0.29142	3.429000	0.52800	2.597000	0.87782	0.655000	0.94253	CCA	.		0.607	COQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054427.1	NM_016035	
NUP214	8021	bcgsc.ca	37	9	134004848	134004848	+	Silent	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr9:134004848G>T	ENST00000359428.5	+	4	720	c.576G>T	c.(574-576)acG>acT	p.T192T	RNU6-881P_ENST00000516813.1_RNA|NUP214_ENST00000411637.2_Silent_p.T192T|NUP214_ENST00000451030.1_Silent_p.T192T			P35658	NU214_HUMAN	nucleoporin 214kDa	192	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)	p.T192T(1)		NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TTCCTTCCACGGTAGCAGTAA	0.448			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.T192T	Pancreas(4;24 48 25510 30394 32571)			Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214-1131	1	Substitution - coding silent(1)	endometrium(1)	c.G576T						.						193.0	161.0	172.0					9																	134004848		2203	4300	6503	SO:0001819	synonymous_variant	8021	exon4			TTCCACGGTAGCA	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.576G>T	9.37:g.134004848G>T		Somatic	181	2		WXS	Illumina HiSeq	Phase_1	193	14	NM_005085	0	0	5	6	1	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Silent	SNP	ENST00000359428.5	37	CCDS6940.1																																																																																			.		0.448	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
KCTD4	386618	broad.mit.edu	37	13	45768267	45768269	+	In_Frame_Del	DEL	TTA	TTA	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	TTA	TTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr13:45768267_45768269delTTA	ENST00000379108.1	-	1	583_585	c.434_436delTAA	c.(433-438)ataaca>aca	p.I145del	GTF2F2_ENST00000340473.6_Intron|KCTD4_ENST00000405872.1_In_Frame_Del_p.I145del			Q8WVF5	KCTD4_HUMAN	potassium channel tetramerization domain containing 4	145					protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)		TGGTTATCTGTTATTTCCAAGAA	0.414																																					p.145_146del													.	KCTD4-90	0			c.434_436del						.																																			SO:0001651	inframe_deletion	386618	exon2			TATCTGTTATTTC	BC018063	CCDS9396.1	13q14.12-q14.13	2013-06-20	2013-06-20		ENSG00000180332	ENSG00000180332			23227	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 4"""				Standard	NM_198404		Approved	bA321C24.3	uc001uzx.4	Q8WVF5	OTTHUMG00000016844	ENST00000379108.1:c.434_436delTAA	13.37:g.45768267_45768269delTTA	ENSP00000368402:p.Ile145del	Somatic	167	0		WXS	Illumina HiSeq	Phase_I	154	15	NM_198404	0	0	0	0	0	Q5W0P9	In_Frame_Del	DEL	ENST00000379108.1	37	CCDS9396.1																																																																																			.		0.414	KCTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044757.1		
PLA2G4F	255189	broad.mit.edu	37	15	42444915	42444915	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr15:42444915delC	ENST00000382396.4	-	7	658	c.572delG	c.(571-573)ggafs	p.G191fs	PLA2G4F_ENST00000397272.3_Frame_Shift_Del_p.G191fs			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	191					arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		TGTCCCATCTCCCCGGAGCGT	0.622																																					p.G191fs													.	PLA2G4F-94	0			c.572delG						.						48.0	40.0	42.0					15																	42444915		2187	4269	6456	SO:0001589	frameshift_variant	255189	exon7			CCATCTCCCCGGA		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.572delG	15.37:g.42444915delC	ENSP00000371833:p.Gly191fs	Somatic	4	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_213600	0	0	0	0	0	Q6ZMC8	Frame_Shift_Del	DEL	ENST00000382396.4	37	CCDS32204.1																																																																																			.		0.622	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	
SERPINB11	89778	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	61379816	61379816	+	RNA	DEL	A	A	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr18:61379816delA	ENST00000382749.5	+	0	491				SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000489748.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				AAGCTGGAAGAATTCATTCCG	0.423																																					.	Ovarian(27;496 784 5942 8975 23930)	.											.	SERPINB11-67	0			.						.						96.0	96.0	96.0					18																	61379816		1888	4113	6001			89778	.			.			18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61379816delA		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	127	50	.	0	0	0	0	0	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Targeted_Region	DEL	ENST00000382749.5	37																																																																																				.		0.423	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000207392.3	NM_080475	
BCL2L11	10018	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	111921708	111921716	+	Splice_Site	DEL	AGGTATTTT	AGGTATTTT	-	rs142125092		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	AGGTATTTT	AGGTATTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:111921708_111921716delAGGTATTTT	ENST00000393256.3	+	4	771_778	c.498_505delAGGTATTTT	c.(496-507)agaggtattttt>agtt	p.166_169RGIF>S	BCL2L11_ENST00000308659.8_Splice_Site_p.106_109RGIF>S	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	166					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						TTGTTGTTTCAGGTATTTTTGAATAATTA	0.445																																					p.167_169del		.											.	BCL2L11-1083	0			c.499_505del						.																																			SO:0001630	splice_region_variant	10018	exon4			.	AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.499-1AGGTATTTT>-	2.37:g.111921708_111921716delAGGTATTTT		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	58	13	NM_138621	0	0	0	0	0	A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Frame_Shift_Del	DEL	ENST00000393256.3	37	CCDS2089.1																																																																																			.		0.445	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254022.3		In_Frame_Del
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	230701700	230701702	+	Splice_Site	DEL	ACT	ACT	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	ACT	ACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:230701700_230701702delACT	ENST00000283943.5	-	5	1186	c.1008delAGT	c.(1006-1008)aga>ag	p.R338del	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Splice_Site_p.R380del|TRIP12_ENST00000409677.1_Splice_Site_p.R380del|TRIP12_ENST00000389045.3_Splice_Site_p.R35del	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	338					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AGCCTCGCCGACTACAACAGAAA	0.483																																					p.336_336del		.											.	TRIP12-572	0			c.1008_1008del						.																																			SO:0001630	splice_region_variant	9320	exon5			.	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1008-1AGT>-	2.37:g.230701700_230701702delACT		Somatic	54	0		WXS	Illumina HiSeq	Phase_I	47	23	NM_004238	0	0	0	0	0	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Frame_Shift_Del	DEL	ENST00000283943.5	37	CCDS33391.1																																																																																			.		0.483	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	In_Frame_Del
MKL1	57591	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	40816560	40816562	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr22:40816560_40816562delCCC	ENST00000355630.3	-	11	1490_1492	c.900_902delGGG	c.(898-903)ctggga>cta	p.G301del	MKL1_ENST00000407029.1_In_Frame_Del_p.G301del|MKL1_ENST00000396617.3_In_Frame_Del_p.G301del|MKL1_ENST00000402042.1_In_Frame_Del_p.G251del	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	301					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CCCGCTGCTTCCCAGGGCCTCGC	0.665			T	RBM15	acute megakaryocytic leukemia																																p.300_301del		.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1-948	0			c.900_902del						.																																			SO:0001651	inframe_deletion	57591	exon11			.	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.900_902delGGG	22.37:g.40816560_40816562delCCC	ENSP00000347847:p.Gly301del	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	97	39	NM_020831	0	0	0	0	0	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	In_Frame_Del	DEL	ENST00000355630.3	37	CCDS14003.1																																																																																			.		0.665	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
STOX2	56977	broad.mit.edu	37	4	184931856	184931856	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr4:184931856delA	ENST00000308497.4	+	3	3300	c.1865delA	c.(1864-1866)gagfs	p.E622fs	STOX2_ENST00000438269.1_Frame_Shift_Del_p.E622fs	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	622					embryo development (GO:0009790)|maternal placenta development (GO:0001893)					breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		AAGAATAAGGAGGACCATGAC	0.532																																					p.E622fs													.	STOX2-22	0			c.1865delA						.						47.0	47.0	47.0					4																	184931856		1954	4146	6100	SO:0001589	frameshift_variant	56977	exon3			ATAAGGAGGACCA	AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.1865delA	4.37:g.184931856delA	ENSP00000311257:p.Glu622fs	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	70	8	NM_020225	0	0	0	0	0	A6H8U4|Q9NPS8	Frame_Shift_Del	DEL	ENST00000308497.4	37	CCDS47167.1																																																																																			.		0.532	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361433.3	NM_020225	
FNIP1	96459	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	131007378	131007379	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr5:131007378_131007379delCT	ENST00000510461.1	-	14	2853_2854	c.2758_2759delAG	c.(2758-2760)agtfs	p.S921fs	CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307968.7_Frame_Shift_Del_p.S893fs|FNIP1_ENST00000307954.8_Frame_Shift_Del_p.S876fs	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	921					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		TTTATCTGAACTCTCTTTATCC	0.416																																					p.920_920del		.											.	FNIP1-92	0			c.2758_2759del						.																																			SO:0001589	frameshift_variant	96459	exon14			.	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.2758_2759delAG	5.37:g.131007382_131007383delCT	ENSP00000421985:p.Ser921fs	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	144	61	NM_133372	0	0	0	0	0	D6RJH5|Q86T47|Q9BUT0	Frame_Shift_Del	DEL	ENST00000510461.1	37	CCDS34227.1																																																																																			.		0.416	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
UBR2	23304	broad.mit.edu	37	6	42611951	42611951	+	Splice_Site	DEL	G	G	-	rs112519289	byFrequency	TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:42611951delG	ENST00000372899.1	+	19	2355		c.e19-1		UBR2_ENST00000372883.3_Splice_Site|UBR2_ENST00000372901.1_Splice_Site	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2						cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			AAAAAAAAAAGACAGGTGTCT	0.373																																					.													.	UBR2-94	0			c.2098-1G>-						.						74.0	81.0	79.0					6																	42611951		2203	4300	6503	SO:0001630	splice_region_variant	23304	exon19			AAAAAAGACAGGT	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.2098-1G>-	6.37:g.42611951delG		Somatic	159	0		WXS	Illumina HiSeq	Phase_I	1177	6	NM_015255	0	0	0	0	0	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Splice_Site	DEL	ENST00000372899.1	37	CCDS4870.1																																																																																			.		0.373	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	Intron
AUTS2	26053	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	70255838	70255838	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr7:70255838delT	ENST00000342771.4	+	19	3957	c.3636delT	c.(3634-3636)cctfs	p.P1213fs	AUTS2_ENST00000406775.2_Frame_Shift_Del_p.P1189fs	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1213										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ACAAGACCCCTCCGACAGCAG	0.677																																					p.P1212fs		.											.	AUTS2-92	0			c.3636delT						.						43.0	48.0	46.0					7																	70255838		2203	4299	6502	SO:0001589	frameshift_variant	26053	exon19			.	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3636delT	7.37:g.70255838delT	ENSP00000344087:p.Pro1213fs	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	45	13	NM_015570	0	0	0	0	0	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Frame_Shift_Del	DEL	ENST00000342771.4	37	CCDS5539.1																																																																																			.		0.677	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
CUX1	1523	broad.mit.edu	37	7	101892133	101892135	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr7:101892133_101892135delCAG	ENST00000292535.7	+	24	4367_4369	c.4329_4331delCAG	c.(4327-4332)aacagc>aac	p.S1448del	CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_In_Frame_Del_p.S1459del|CUX1_ENST00000549414.2_In_Frame_Del_p.S1426del|CUX1_ENST00000550008.2_In_Frame_Del_p.S1392del|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000556210.1_In_Frame_Del_p.S1290del|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000546411.2_In_Frame_Del_p.S1346del|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1448					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CGCCCAGCAACAGCAGCAGCAGC	0.823																																					p.1454_1455del													.	CUX1-160	0			c.4362_4364del						.		,,,,,,	29,1415		8,13,701					,,,,,,	1.6	1.0			2	105,3503		14,77,1713	no	coding,intron,intron,intron,intron,intron,coding	CUX1	NM_181552.3,NM_181500.2,NM_001913.3,NM_001202546.1,NM_001202545.1,NM_001202544.1,NM_001202543.1	,,,,,,	22,90,2414	A1A1,A1R,RR		2.9102,2.0083,2.6524	,,,,,,	,,,,,,		134,4918				SO:0001651	inframe_deletion	1523	exon24			CAGCAACAGCAGC	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.4329_4331delCAG	7.37:g.101892142_101892144delCAG	ENSP00000292535:p.Ser1448del	Somatic	6	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_001202543	0	0	0	0	0	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	In_Frame_Del	DEL	ENST00000292535.7	37	CCDS5721.1																																																																																			.		0.823	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
CLTA	1211	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	36211662	36211662	+	Frame_Shift_Del	DEL	G	G	-	rs192679731		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr9:36211662delG	ENST00000242285.6	+	7	758	c.638delG	c.(637-639)cggfs	p.R213fs	CLTA_ENST00000396603.2_Frame_Shift_Del_p.R201fs|CLTA_ENST00000433436.2_Frame_Shift_Del_p.R213fs|CLTA_ENST00000470744.1_Frame_Shift_Del_p.R195fs|CLTA_ENST00000345519.5_Frame_Shift_Del_p.R183fs|CLTA_ENST00000466396.1_Frame_Shift_Del_p.R161fs|CLTA_ENST00000540080.1_Frame_Shift_Del_p.R131fs|CLTA_ENST00000538225.1_Frame_Shift_Del_p.R195fs			P09496	CLCA_HUMAN	clathrin, light chain A	213					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	clathrin heavy chain binding (GO:0032050)|peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	6			STAD - Stomach adenocarcinoma(86;0.228)			GAGTGGGAACGGGTGGCCCGG	0.542																																					p.R213fs		.											.	CLTA-90	0			c.638delG						.						99.0	94.0	96.0					9																	36211662		2203	4300	6503	SO:0001589	frameshift_variant	1211	exon7			.		CCDS6600.1, CCDS6601.1, CCDS43802.1, CCDS55306.1, CCDS55307.1	9p13.3	2010-05-11	2010-05-11		ENSG00000122705	ENSG00000122705			2090	protein-coding gene	gene with protein product		118960	"""clathrin, light polypeptide (Lca)"""			7713494	Standard	NM_007096		Approved	Lca	uc003zzc.3	P09496	OTTHUMG00000019896	ENST00000242285.6:c.638delG	9.37:g.36211662delG	ENSP00000242285:p.Arg213fs	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	111	41	NM_007096	0	0	0	0	0	A8K4W3|B4DIN1|F5H6N3|Q2XPN5|Q53XZ1	Frame_Shift_Del	DEL	ENST00000242285.6	37	CCDS6601.1																																																																																			.		0.542	CLTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052405.1	NM_007096	
ENTPD5	957	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	74443764	74443765	+	Splice_Site	INS	-	-	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr14:74443764_74443765insA	ENST00000334696.6	-	8	837		c.e8-2		ENTPD5_ENST00000557325.1_Splice_Site	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5						'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		CTAATATGCCTAAAAAGAAAGA	0.366																																					.		.											.	ENTPD5-91	0			c.518-2->T						.																																			SO:0001630	splice_region_variant	957	exon9			.	AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.518-2->T	14.37:g.74443769_74443769dupA		Somatic	144	0		WXS	Illumina HiSeq	Phase_I	100	38	NM_001249	0	0	0	0	0	A1L4C5|Q96RX0	Splice_Site	INS	ENST00000334696.6	37	CCDS9825.1																																																																																			.		0.366	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412637.1	NM_001249	Intron
