#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PEX10	5192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	2340282	2340282	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:2340282C>G	ENST00000447513.2	-	3	277	c.209G>C	c.(208-210)gGg>gCg	p.G70A	PEX10_ENST00000288774.3_Missense_Mutation_p.G70A|PEX10_ENST00000515760.1_5'UTR|PEX10_ENST00000507596.1_Missense_Mutation_p.G70A	NM_002617.3	NP_002608.1	O60683	PEX10_HUMAN	peroxisomal biogenesis factor 10	70					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	integral component of peroxisomal membrane (GO:0005779)|intracellular (GO:0005622)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	7	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		GTACTCCTCCCCCAGGGTCTG	0.677																																					p.G70A	GBM(12;9 508 1649 13619)	.											.	PEX10-90	0			c.G209C						.						94.0	95.0	95.0					1																	2340282		2203	4300	6503	SO:0001583	missense	5192	exon3			TCCTCCCCCAGGG	AF060502	CCDS41.1, CCDS44045.1	1p36.32	2013-01-09	2008-08-26		ENSG00000157911	ENSG00000157911		"""RING-type (C3HC4) zinc fingers"""	8851	protein-coding gene	gene with protein product		602859	"""peroxisome biogenesis factor 10"""			9683594	Standard	NM_002617		Approved	RNF69	uc001ajg.3	O60683	OTTHUMG00000001637	ENST00000447513.2:c.209G>C	1.37:g.2340282C>G	ENSP00000407922:p.Gly70Ala	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	58	14	NM_002617	0	0	17	33	16	B3KWD8|Q5T095|Q9BW90	Missense_Mutation	SNP	ENST00000447513.2	37	CCDS44045.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210641	0.79240	.	.	ENSG00000157911	ENST00000288774;ENST00000447513;ENST00000507596	D;D;D	0.88201	-2.35;-2.35;-2.35	4.48	4.48	0.54585	Pex, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95661	0.8589	M	0.92833	3.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96912	0.9668	10	0.87932	D	0	2.6652	16.1137	0.81283	0.0:1.0:0.0:0.0	.	70;70	O60683;O60683-2	PEX10_HUMAN;.	A	70	ENSP00000288774:G70A;ENSP00000407922:G70A;ENSP00000424291:G70A	ENSP00000288774:G70A	G	-	2	0	PEX10	2330142	1.000000	0.71417	1.000000	0.80357	0.668000	0.39293	5.505000	0.66981	2.035000	0.60131	0.462000	0.41574	GGG	.		0.677	PEX10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367454.1	NM_153818	
PER3	8863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	7887456	7887456	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:7887456G>A	ENST00000361923.2	+	17	2618	c.2443G>A	c.(2443-2445)Gca>Aca	p.A815T	PER3_ENST00000377532.3_Missense_Mutation_p.A823T|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	815	Pro-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		AAGAGAATACGCAGCCCCCGG	0.622																																					p.A815T		.											.	PER3-93	0			c.G2443A						.						67.0	69.0	68.0					1																	7887456		2203	4300	6503	SO:0001583	missense	8863	exon17			GAATACGCAGCCC	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2443G>A	1.37:g.7887456G>A	ENSP00000355031:p.Ala815Thr	Somatic	162	0		WXS	Illumina HiSeq	Phase_I	112	28	NM_016831	0	0	10	13	3	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	.	.	.	.	.	.	.	.	.	.	G	7.390	0.630557	0.14322	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.10192	2.9;2.9	3.68	-2.56	0.06268	.	2.865610	0.00841	N	0.001740	T	0.04003	0.0112	N	0.11427	0.14	0.09310	N	1	B;P;B;B	0.34662	0.07;0.462;0.41;0.07	B;B;B;B	0.24541	0.011;0.054;0.053;0.011	T	0.20009	-1.0288	10	0.17369	T	0.5	.	0.9429	0.01359	0.3343:0.3073:0.2098:0.1487	.	815;823;823;815	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	T	823;815;26	ENSP00000366755:A823T;ENSP00000355031:A815T	ENSP00000355031:A815T	A	+	1	0	PER3	7810043	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.918000	0.28678	-0.394000	0.07727	0.561000	0.74099	GCA	.		0.622	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
CELA2A	63036	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	15793929	15793929	+	Nonsense_Mutation	SNP	C	C	T	rs375207414		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:15793929C>T	ENST00000359621.4	+	7	713	c.688C>T	c.(688-690)Cag>Tag	p.Q230*	CELA2B_ENST00000494280.1_3'UTR	NM_033440.2	NP_254275.1	P08217	CEL2A_HUMAN	chymotrypsin-like elastase family, member 2A	230	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|keratohyalin granule (GO:0036457)	serine hydrolase activity (GO:0017171)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(2)|prostate(1)	16						CGGCCGGTGGCAGGTGCACGG	0.607																																					p.Q230X													.	CELA2A-92	0			c.C688T						.						67.0	64.0	65.0					1																	15793929		2203	4300	6503	SO:0001587	stop_gained	63036	exon7			CGGTGGCAGGTGC		CCDS157.1	1p36.21	2009-07-09			ENSG00000142615	ENSG00000142615	3.4.21.71		24609	protein-coding gene	gene with protein product	"""elastase 2A"""	609443				3646943, 2834346	Standard	NM_033440		Approved	ELA2A	uc001awk.3	P08217	OTTHUMG00000002258	ENST00000359621.4:c.688C>T	1.37:g.15793929C>T	ENSP00000352639:p.Gln230*	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	66	8	NM_033440	0	0	0	0	0	B2R5I4|Q14243	Nonsense_Mutation	SNP	ENST00000359621.4	37	CCDS157.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440241	0.25900	.	.	ENSG00000142615	ENST00000359621	.	.	.	3.08	-4.98	0.03019	.	0.467062	0.18391	U	0.142670	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	16.3146	0.82913	0.0:0.6887:0.3113:0.0	.	.	.	.	X	230	.	ENSP00000352639:Q230X	Q	+	1	0	CELA2A	15666516	1.000000	0.71417	0.110000	0.21437	0.023000	0.10783	2.255000	0.43222	-1.584000	0.01636	-0.689000	0.03729	CAG	.		0.607	CELA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006445.1	NM_033440	
CLCNKB	1188	broad.mit.edu	37	1	16378296	16378296	+	Silent	SNP	A	A	C	rs199755248		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:16378296A>C	ENST00000375679.4	+	14	1500	c.1389A>C	c.(1387-1389)ccA>ccC	p.P463P	CLCNKB_ENST00000375667.3_Silent_p.P294P	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	463					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CCATCATGCCAGGGGGGTATG	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		18264	0.001		0.0	False		,,,				2504	0.0				p.P463P													.	CLCNKB-91	0			c.A1389C	GRCh37	CD004305	CLCNKB	D		.						66.0	66.0	66.0					1																	16378296		2203	4300	6503	SO:0001819	synonymous_variant	1188	exon14			CATGCCAGGGGGG	AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.1389A>C	1.37:g.16378296A>C		Somatic	116	0		WXS	Illumina HiSeq	Phase_I	99	5	NM_000085	0	0	7	7	0	B3KUY3|Q5T5Q7|Q5T5Q8	Silent	SNP	ENST00000375679.4	37	CCDS168.1																																																																																			A|0.992;C|0.008		0.622	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026331.1	NM_000085	
ATXN7L2	127002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110034064	110034064	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:110034064C>A	ENST00000369870.3	+	10	1894	c.1879C>A	c.(1879-1881)Ctg>Atg	p.L627M	CYB561D1_ENST00000533024.1_5'Flank|CYB561D1_ENST00000310611.4_5'Flank|CYB561D1_ENST00000420578.2_5'Flank|CYB561D1_ENST00000393709.3_5'Flank|CYB561D1_ENST00000369868.3_5'Flank|CYB561D1_ENST00000528785.1_5'Flank|ATXN7L2_ENST00000459635.1_3'UTR|CYB561D1_ENST00000496961.1_5'Flank|CYB561D1_ENST00000430195.2_5'Flank|CYB561D1_ENST00000527072.1_5'Flank	NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	627										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		GGCAGGGCCCCTGGACTGTCG	0.622																																					p.L627M		.											.	ATXN7L2-92	0			c.C1879A						.						35.0	40.0	38.0					1																	110034064		2203	4300	6503	SO:0001583	missense	127002	exon10			GGGCCCCTGGACT	BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1879C>A	1.37:g.110034064C>A	ENSP00000358886:p.Leu627Met	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	52	20	NM_153340	0	0	3	5	2		Missense_Mutation	SNP	ENST00000369870.3	37	CCDS30794.1	.	.	.	.	.	.	.	.	.	.	C	14.37	2.514316	0.44763	.	.	ENSG00000162650	ENST00000369870;ENST00000369869	T	0.38560	1.13	5.36	3.26	0.37387	.	0.440276	0.19115	N	0.122331	T	0.23451	0.0567	N	0.24115	0.695	0.25930	N	0.983008	P;D	0.64830	0.946;0.994	P;P	0.55222	0.714;0.771	T	0.04678	-1.0934	10	0.72032	D	0.01	-0.0215	7.9316	0.29905	0.0:0.7788:0.0:0.2212	.	254;627	Q5T6C4;Q5T6C5	.;AT7L2_HUMAN	M	627;254	ENSP00000358886:L627M	ENSP00000358885:L254M	L	+	1	2	ATXN7L2	109835587	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.056000	0.41355	0.647000	0.30713	-0.258000	0.10820	CTG	.		0.622	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030331.1	NM_153340	
INSRR	3645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156811976	156811976	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:156811976T>G	ENST00000368195.3	-	19	3721	c.3325A>C	c.(3325-3327)Aac>Cac	p.N1109H	NTRK1_ENST00000392302.2_Missense_Mutation_p.L38W	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1109	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACAAACTTGTTGGCAGCAAGG	0.572																																					p.N1109H		.											.	INSRR-1403	0			c.A3325C						.						104.0	95.0	98.0					1																	156811976		2203	4300	6503	SO:0001583	missense	3645	exon19			ACTTGTTGGCAGC	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3325A>C	1.37:g.156811976T>G	ENSP00000357178:p.Asn1109His	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	41	12	NM_014215	0	0	0	0	0	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.4|23.4	4.413045|4.413045	0.83449|0.83449	.|.	.|.	ENSG00000198400|ENSG00000027644	ENST00000392302|ENST00000368195	T|D	0.76839|0.82803	-1.05|-1.65	4.83|4.83	4.83|4.83	0.62350|0.62350	.|Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.|0.260110	.|0.27223	.|N	.|0.020345	T|T	0.67664|0.67664	0.2917|0.2917	N|N	0.17594|0.17594	0.5|0.5	0.37606|0.37606	D|D	0.920732|0.920732	D|P	0.76494|0.41102	0.999|0.738	D|P	0.64042|0.44623	0.921|0.455	T|T	0.76490|0.76490	-0.2940|-0.2940	9|10	0.87932|0.72032	D|D	0|0.01	.|.	13.364|13.364	0.60674|0.60674	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	38|1109	A6NF12|P14616	.|INSRR_HUMAN	W|H	38|1109	ENSP00000376120:L38W|ENSP00000357178:N1109H	ENSP00000376120:L38W|ENSP00000357178:N1109H	L|N	+|-	2|1	0|0	NTRK1|INSRR	155078600|155078600	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	7.868000|7.868000	0.87116|0.87116	2.041000|2.041000	0.60428|0.60428	0.459000|0.459000	0.35465|0.35465	TTG|AAC	.		0.572	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
C1orf21	81563	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	184476745	184476745	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:184476745G>T	ENST00000235307.6	+	3	553	c.118G>T	c.(118-120)Gaa>Taa	p.E40*		NM_030806.3	NP_110433.1	Q9H246	CA021_HUMAN	chromosome 1 open reading frame 21	40										breast(1)|lung(1)	2		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)		CAAACCAGTGGAAGAGGTCAA	0.348																																					p.E40X													.	C1orf21-90	0			c.G118T						.						79.0	82.0	81.0					1																	184476745		2203	4300	6503	SO:0001587	stop_gained	81563	exon3			CCAGTGGAAGAGG	AF312864	CCDS1362.1	1q25	2008-07-18			ENSG00000116667	ENSG00000116667			15494	protein-coding gene	gene with protein product	"""proliferation-inducing protein 13"""					11318611	Standard	NM_030806		Approved	PIG13	uc001gqv.1	Q9H246	OTTHUMG00000035386	ENST00000235307.6:c.118G>T	1.37:g.184476745G>T	ENSP00000235307:p.Glu40*	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	85	17	NM_030806	0	0	25	26	1	B2R551	Nonsense_Mutation	SNP	ENST00000235307.6	37	CCDS1362.1	.	.	.	.	.	.	.	.	.	.	G	41	8.721385	0.98929	.	.	ENSG00000116667	ENST00000235307	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6012	0.95563	0.0:0.0:1.0:0.0	.	.	.	.	X	40	.	ENSP00000235307:E40X	E	+	1	0	C1orf21	182743368	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.777000	0.62361	2.876000	0.98609	0.655000	0.94253	GAA	.		0.348	C1orf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085784.2	NM_030806	
PLEKHA6	22874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	204198070	204198070	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:204198070T>C	ENST00000272203.3	-	19	3062	c.2746A>G	c.(2746-2748)Aag>Gag	p.K916E	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.K936E	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	916										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CTCACCTCCTTATTGATGTCC	0.587																																					p.K916E		.											.	PLEKHA6-654	0			c.A2746G						.						116.0	112.0	113.0					1																	204198070		2203	4300	6503	SO:0001583	missense	22874	exon19			CCTCCTTATTGAT	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2746A>G	1.37:g.204198070T>C	ENSP00000272203:p.Lys916Glu	Somatic	163	0		WXS	Illumina HiSeq	Phase_I	187	49	NM_014935	0	0	0	0	0	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.148801	0.57151	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.45276	0.9;0.9	5.3	5.3	0.74995	.	0.265846	0.36628	N	0.002497	T	0.59649	0.2209	M	0.72894	2.215	0.35019	D	0.757628	D	0.58268	0.982	D	0.67548	0.952	T	0.71002	-0.4718	10	0.49607	T	0.09	-32.3486	10.459	0.44567	0.0:0.0786:0.0:0.9214	.	916	Q9Y2H5	PKHA6_HUMAN	E	916;936	ENSP00000272203:K916E;ENSP00000402046:K936E	ENSP00000272203:K916E	K	-	1	0	PLEKHA6	202464693	1.000000	0.71417	0.875000	0.34327	0.332000	0.28634	5.520000	0.67080	1.995000	0.58328	0.460000	0.39030	AAG	.		0.587	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
USH2A	7399	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	216019211	216019211	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:216019211G>T	ENST00000307340.3	-	45	9396	c.9010C>A	c.(9010-9012)Cac>Aac	p.H3004N	USH2A_ENST00000366943.2_Missense_Mutation_p.H3004N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3004	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTGATGCTGTGGACTCCATTG	0.433										HNSCC(13;0.011)																											p.H3004N													.	USH2A-115	0			c.C9010A						.						97.0	90.0	92.0					1																	216019211		2203	4300	6503	SO:0001583	missense	7399	exon45			TGCTGTGGACTCC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9010C>A	1.37:g.216019211G>T	ENSP00000305941:p.His3004Asn	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	68	13	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.314024	0.40996	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.52754	0.65;0.65	5.91	1.85	0.25348	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.292176	0.24165	N	0.040943	T	0.53238	0.1784	M	0.73598	2.24	0.39147	D	0.962158	P	0.44659	0.84	P	0.50270	0.636	T	0.50608	-0.8808	10	0.38643	T	0.18	.	7.7082	0.28663	0.1958:0.1221:0.6821:0.0	.	3004	O75445	USH2A_HUMAN	N	3004	ENSP00000305941:H3004N;ENSP00000355910:H3004N	ENSP00000305941:H3004N	H	-	1	0	USH2A	214085834	1.000000	0.71417	0.966000	0.40874	0.991000	0.79684	3.052000	0.49893	0.078000	0.16900	0.655000	0.94253	CAC	.		0.433	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
TP53BP2	7159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	223984099	223984099	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:223984099A>G	ENST00000343537.7	-	13	2433	c.2142T>C	c.(2140-2142)aaT>aaC	p.N714N	TP53BP2_ENST00000391879.2_5'UTR|TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391878.2_Silent_p.N585N	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	708					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		TTCGGTAAGGATTAGATAAGA	0.438																																					p.N714N		.											.	TP53BP2-229	0			c.T2142C						.						143.0	139.0	140.0					1																	223984099		2203	4300	6503	SO:0001819	synonymous_variant	7159	exon13			GTAAGGATTAGAT	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2142T>C	1.37:g.223984099A>G		Somatic	208	0		WXS	Illumina HiSeq	Phase_I	228	52	NM_001031685	0	0	40	75	35	B4DG66|Q12892|Q86X75|Q96KQ3	Silent	SNP	ENST00000343537.7	37	CCDS44319.1																																																																																			.		0.438	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
PHRF1	57661	ucsc.edu	37	11	608874	608874	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:608874G>A	ENST00000264555.5	+	14	3546	c.3418G>A	c.(3418-3420)Gaa>Aaa	p.E1140K	PHRF1_ENST00000533464.1_Missense_Mutation_p.E1136K|PHRF1_ENST00000416188.2_Missense_Mutation_p.E1139K|PHRF1_ENST00000413872.2_Missense_Mutation_p.E1138K	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1140	Arg-rich.				mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GCATCAGCGGGAACGCAGCCA	0.652																																					p.E1139K													.	PHRF1-22	0			c.G3415A						.						23.0	29.0	27.0					11																	608874		2200	4294	6494	SO:0001583	missense	57661	exon14			CAGCGGGAACGCA	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.3418G>A	11.37:g.608874G>A	ENSP00000264555:p.Glu1140Lys	Somatic	55	0		WXS	Illumina HiSeq		46	4	NM_020901	0	0	41	41	0	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37		.	.	.	.	.	.	.	.	.	.	G	13.66	2.302829	0.40795	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	4.69	3.73	0.42828	.	0.348665	0.20929	N	0.083136	T	0.25531	0.0621	L	0.32530	0.975	0.31444	N	0.671646	D;D;D;D	0.59767	0.976;0.986;0.986;0.976	P;P;P;P	0.56088	0.622;0.791;0.791;0.622	T	0.09335	-1.0679	10	0.72032	D	0.01	-26.6618	15.9627	0.79941	0.0:0.1469:0.8531:0.0	.	1136;1138;1139;1140	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	K	1140;1138;1139;1136	ENSP00000264555:E1140K;ENSP00000388589:E1138K;ENSP00000410626:E1139K;ENSP00000431870:E1136K	ENSP00000264555:E1140K	E	+	1	0	PHRF1	598874	0.995000	0.38212	0.782000	0.31804	0.013000	0.08279	1.843000	0.39259	2.441000	0.82636	0.561000	0.74099	GAA	.		0.652	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
ATG2A	23130	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64679328	64679328	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:64679328T>A	ENST00000377264.3	-	9	1326	c.1214A>T	c.(1213-1215)cAg>cTg	p.Q405L	ATG2A_ENST00000421419.2_Missense_Mutation_p.Q405L	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	405					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						TGGGTGGGCCTGGGCAGAGAG	0.647																																					p.Q405L													.	ATG2A-69	0			c.A1214T						.						27.0	31.0	30.0					11																	64679328		2201	4295	6496	SO:0001583	missense	23130	exon9			TGGGCCTGGGCAG		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.1214A>T	11.37:g.64679328T>A	ENSP00000366475:p.Gln405Leu	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	37	10	NM_015104	0	0	11	20	9	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	T	12.31	1.898377	0.33535	.	.	ENSG00000110046	ENST00000421419;ENST00000377264;ENST00000227459	T;T	0.07567	3.18;3.18	4.42	3.32	0.38043	.	1.024010	0.07881	U	0.969545	T	0.06645	0.0170	N	0.19112	0.55	0.29096	N	0.881767	B	0.02656	0.0	B	0.01281	0.0	T	0.33343	-0.9872	10	0.30854	T	0.27	.	9.1303	0.36841	0.0:0.0:0.2379:0.7621	.	405	Q2TAZ0	ATG2A_HUMAN	L	405	ENSP00000410522:Q405L;ENSP00000366475:Q405L	ENSP00000227459:Q405L	Q	-	2	0	ATG2A	64435904	0.992000	0.36948	0.830000	0.32933	0.974000	0.67602	1.816000	0.38992	0.912000	0.36772	0.459000	0.35465	CAG	.		0.647	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
BBS1	582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66282135	66282135	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:66282135A>G	ENST00000318312.7	+	4	469	c.418A>G	c.(418-420)Aac>Gac	p.N140D	BBS1_ENST00000537537.1_Silent_p.G43G|BBS1_ENST00000529766.1_3'UTR|BBS1_ENST00000393994.2_Missense_Mutation_p.N140D|BBS1_ENST00000455748.2_Missense_Mutation_p.N140D|CTD-3074O7.11_ENST00000419755.3_Missense_Mutation_p.N177D	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	140					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						AGACCTTTGGAACCAGGCCAA	0.502									Bardet-Biedl syndrome																												p.N140D	GBM(152;173 2612 9770 10137)	.											.	BBS1-91	0			c.A418G						.						74.0	72.0	72.0					11																	66282135		2200	4295	6495	SO:0001583	missense	582	exon4	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	CTTTGGAACCAGG	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.418A>G	11.37:g.66282135A>G	ENSP00000317469:p.Asn140Asp	Somatic	151	1		WXS	Illumina HiSeq	Phase_I	127	25	NM_024649	0	0	47	91	44	Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	ENST00000318312.7	37	CCDS8142.1	.	.	.	.	.	.	.	.	.	.	A	8.126	0.781967	0.16189	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000455748;ENST00000393994;ENST00000524705	D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6	4.95	2.59	0.31030	.	.	.	.	.	T	0.80793	0.4691	L	0.45581	1.43	0.80722	D	1	B;B;B;B	0.11235	0.0;0.0;0.004;0.003	B;B;B;B	0.11329	0.001;0.001;0.004;0.006	T	0.65356	-0.6188	9	0.13470	T	0.59	.	4.2202	0.10554	0.6433:0.1757:0.181:0.0	.	140;140;140;177	E7EQH1;Q32MM9;Q8NFJ9;Q8NFJ9-2	.;.;BBS1_HUMAN;.	D	177;140;140;140;47	ENSP00000398526:N177D;ENSP00000317469:N140D;ENSP00000405764:N140D;ENSP00000377563:N140D;ENSP00000436927:N47D	ENSP00000317469:N140D	N	+	1	0	BBS1;CTD-3074O7.11	66038711	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	0.988000	0.29616	0.316000	0.23135	-0.472000	0.04984	AAC	.		0.502	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393235.2		
MAML2	84441	hgsc.bcm.edu	37	11	95825431	95825431	+	Silent	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:95825431T>C	ENST00000524717.1	-	2	3048	c.1764A>G	c.(1762-1764)caA>caG	p.Q588Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	588					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgTTGGGTGTAGT	0.522			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q588Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.A1764G						.																																			SO:0001819	synonymous_variant	84441	exon2			TTGCTGTTGGGTG	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1764A>G	11.37:g.95825431T>C		Somatic	11	2		WXS	Illumina HiSeq	Phase_I	11	3	NM_032427	0	0	21	21	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.522	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
TMEM133	83935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	100863392	100863392	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:100863392T>A	ENST00000303130.2	+	1	582	c.353T>A	c.(352-354)cTt>cAt	p.L118H		NM_032021.2	NP_114410.1	Q9H2Q1	TM133_HUMAN	transmembrane protein 133	118						integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)|lung(1)|prostate(1)	5		Acute lymphoblastic leukemia(157;0.000869)|all_hematologic(158;0.014)		BRCA - Breast invasive adenocarcinoma(274;0.0675)		CCAGTTCCACTTGGTAATAAC	0.388																																					p.L118H		.											.	TMEM133-90	0			c.T353A						.						142.0	137.0	138.0					11																	100863392		2203	4299	6502	SO:0001583	missense	83935	exon1			TTCCACTTGGTAA	AF247167	CCDS8309.1	11q22.1	2006-03-09				ENSG00000170647			24033	protein-coding gene	gene with protein product						12477932	Standard	NM_032021		Approved	AD031	uc001pgf.3	Q9H2Q1		ENST00000303130.2:c.353T>A	11.37:g.100863392T>A	ENSP00000303999:p.Leu118His	Somatic	177	0		WXS	Illumina HiSeq	Phase_I	153	28	NM_032021	0	0	10	21	11		Missense_Mutation	SNP	ENST00000303130.2	37	CCDS8309.1	.	.	.	.	.	.	.	.	.	.	T	8.089	0.774082	0.16051	.	.	ENSG00000170647	ENST00000303130	.	.	.	2.67	-1.16	0.09678	.	.	.	.	.	T	0.22704	0.0548	N	0.08118	0	0.09310	N	1	D	0.65815	0.995	P	0.56398	0.797	T	0.14448	-1.0472	8	0.87932	D	0	.	4.3705	0.11246	0.1931:0.0:0.4529:0.3539	.	118	Q9H2Q1	TM133_HUMAN	H	118	.	ENSP00000303999:L118H	L	+	2	0	TMEM133	100368602	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.318000	0.08050	-0.257000	0.09459	-0.329000	0.08387	CTT	.		0.388	TMEM133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395137.1	NM_032021	
PHLDB1	23187	hgsc.bcm.edu;bcgsc.ca	37	11	118516166	118516166	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:118516166G>C	ENST00000361417.2	+	17	3625	c.3214G>C	c.(3214-3216)Ggg>Cgg	p.G1072R	PHLDB1_ENST00000524713.1_Missense_Mutation_p.G215R|PHLDB1_ENST00000527898.1_Missense_Mutation_p.G123R|PHLDB1_ENST00000356063.5_Missense_Mutation_p.G1025R|PHLDB1_ENST00000534672.1_3'UTR	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1072										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TGCCCTTCACGGGGCAGCACC	0.657																																					p.G1072R		.											.	PHLDB1-90	0			c.G3214C						.						43.0	52.0	49.0					11																	118516166		2200	4295	6495	SO:0001583	missense	23187	exon16			CTTCACGGGGCAG		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3214G>C	11.37:g.118516166G>C	ENSP00000354498:p.Gly1072Arg	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	90	26	NM_001144758	0	0	22	22	0	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268966	0.80469	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063;ENST00000527898;ENST00000524713	T;T;T;T	0.50277	1.41;1.48;0.75;0.76	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.65883	0.2734	L	0.59436	1.845	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;0.997;0.999;0.995;0.991	D;D;D;D;D	0.97110	1.0;0.966;0.989;0.976;0.922	T	0.57124	-0.7865	10	0.21014	T	0.42	-37.8382	19.9036	0.96999	0.0:0.0:1.0:0.0	.	215;436;831;1025;1072	B4DK17;B0YJ65;Q5W9G0;Q86UU1-2;Q86UU1	.;.;.;.;PHLB1_HUMAN	R	1072;846;436;1025;123;215	ENSP00000354498:G1072R;ENSP00000348359:G1025R;ENSP00000435388:G123R;ENSP00000434905:G215R	ENSP00000348359:G1025R	G	+	1	0	PHLDB1	118021376	1.000000	0.71417	0.821000	0.32701	0.728000	0.41692	5.896000	0.69822	2.706000	0.92434	0.655000	0.94253	GGG	.		0.657	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
GRIK4	2900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	120745883	120745883	+	Silent	SNP	C	C	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:120745883C>T	ENST00000527524.2	+	11	1382	c.1095C>T	c.(1093-1095)ttC>ttT	p.F365F	GRIK4_ENST00000438375.2_Silent_p.F365F|RP11-640N11.2_ENST00000505153.2_RNA	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	365					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		ACATTGAATTCAACAGCAAAG	0.502																																					p.F365F		.											.	GRIK4-92	0			c.C1095T						.						130.0	112.0	118.0					11																	120745883		2203	4299	6502	SO:0001819	synonymous_variant	2900	exon9			TGAATTCAACAGC	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1095C>T	11.37:g.120745883C>T		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	136	24	NM_014619	0	0	0	0	0	A8K9L1	Silent	SNP	ENST00000527524.2	37	CCDS8433.1																																																																																			.		0.502	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
CDON	50937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	125880565	125880565	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:125880565A>T	ENST00000392693.3	-	8	1350	c.1223T>A	c.(1222-1224)aTt>aAt	p.I408N	CDON_ENST00000263577.7_Missense_Mutation_p.I408N	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	408	Ig-like C2-type 5.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TGGTGCCGTAATTATAACTGG	0.428																																					p.I408N		.											.	CDON-158	0			c.T1223A						.						63.0	61.0	62.0					11																	125880565		2201	4299	6500	SO:0001583	missense	50937	exon8			GCCGTAATTATAA	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.1223T>A	11.37:g.125880565A>T	ENSP00000376458:p.Ile408Asn	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	75	18	NM_016952	0	0	1	2	1	O14631	Missense_Mutation	SNP	ENST00000392693.3	37	CCDS58192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.259|7.259	0.604826|0.604826	0.14002|0.14002	.|.	.|.	ENSG00000064309|ENSG00000064309	ENST00000392693;ENST00000263577|ENST00000534661	T;T|.	0.29142|.	1.58;1.58|.	5.01|5.01	2.7|2.7	0.31948|0.31948	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.421653|.	0.19358|.	N|.	0.116221|.	T|T	0.38612|0.38612	0.1047|0.1047	L|L	0.43923|0.43923	1.385|1.385	0.09310|0.09310	N|N	0.999999|0.999999	P;P|.	0.36392|.	0.551;0.496|.	B;B|.	0.39738|.	0.308;0.205|.	T|T	0.21965|0.21965	-1.0230|-1.0230	10|5	0.66056|.	D|.	0.02|.	-2.7576|-2.7576	8.6995|8.6995	0.34316|0.34316	0.7929:0.0:0.2071:0.0|0.7929:0.0:0.2071:0.0	.|.	408;408|.	Q4KMG0;Q4KMG0-2|.	CDON_HUMAN;.|.	N|K	408|383	ENSP00000376458:I408N;ENSP00000263577:I408N|.	ENSP00000263577:I408N|.	I|N	-|-	2|3	0|2	CDON|CDON	125385775|125385775	0.210000|0.210000	0.23517|0.23517	0.307000|0.307000	0.25127|0.25127	0.339000|0.339000	0.28857|0.28857	1.941000|1.941000	0.40233|0.40233	0.272000|0.272000	0.22027|0.22027	0.482000|0.482000	0.46254|0.46254	ATT|AAT	.		0.428	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
CACNA1C	775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	2716231	2716231	+	Silent	SNP	C	C	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:2716231C>T	ENST00000347598.4	+	27	3351	c.3351C>T	c.(3349-3351)gaC>gaT	p.D1117D	CACNA1C_ENST00000399641.1_Silent_p.D1097D|CACNA1C_ENST00000399617.1_Silent_p.D1097D|CACNA1C_ENST00000399634.1_Silent_p.D1097D|CACNA1C_ENST00000335762.5_Silent_p.D1122D|CACNA1C_ENST00000399638.1_Silent_p.D1097D|CACNA1C_ENST00000399637.1_Silent_p.D1097D|CACNA1C-AS3_ENST00000543559.1_RNA|CACNA1C_ENST00000402845.3_Silent_p.D1097D|CACNA1C_ENST00000399606.1_Silent_p.D1117D|CACNA1C_ENST00000399621.1_Silent_p.D1097D|CACNA1C_ENST00000399595.1_Silent_p.D1097D|CACNA1C_ENST00000399601.1_Silent_p.D1097D|CACNA1C_ENST00000399629.1_Silent_p.D1097D|CACNA1C_ENST00000399644.1_Silent_p.D1097D|CACNA1C_ENST00000327702.7_Silent_p.D1097D|CACNA1C_ENST00000399591.1_Silent_p.D1097D|CACNA1C_ENST00000399597.1_Silent_p.D1097D|CACNA1C_ENST00000399603.1_Silent_p.D1097D|CACNA1C_ENST00000399649.1_Silent_p.D1097D|CACNA1C_ENST00000406454.3_Silent_p.D1097D|CACNA1C_ENST00000344100.3_Silent_p.D1097D|CACNA1C_ENST00000399655.1_Silent_p.D1097D|CACNA1C_ENST00000480911.1_Silent_p.D1097D	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1117	Dihydropyridine binding. {ECO:0000250}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCAAGTTTGACTTTGACAATG	0.567																																					p.D1117D		.											.	CACNA1C-34	0			c.C3351T						.						59.0	64.0	62.0					12																	2716231		2169	4287	6456	SO:0001819	synonymous_variant	775	exon27			GTTTGACTTTGAC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3351C>T	12.37:g.2716231C>T		Somatic	50	2		WXS	Illumina HiSeq	Phase_I	45	12	NM_199460	0	0	2	2	0	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	CCDS44788.1																																																																																			.		0.567	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
SLC2A14	144195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7982586	7982586	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:7982586T>A	ENST00000543909.1	-	10	1117	c.358A>T	c.(358-360)Att>Ttt	p.I120F	SLC2A14_ENST00000340749.5_Missense_Mutation_p.I97F|SLC2A14_ENST00000542546.1_Missense_Mutation_p.I11F|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000539924.1_Missense_Mutation_p.I135F|SLC2A14_ENST00000431042.2_Missense_Mutation_p.I97F|SLC2A14_ENST00000535295.1_Missense_Mutation_p.I11F|SLC2A14_ENST00000396589.2_Missense_Mutation_p.I120F			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	120					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		AGGTTGACAATCAGCATTGAA	0.458																																					p.I120F		.											.	SLC2A14-91	0			c.A358T						.						62.0	61.0	61.0					12																	7982586		2203	4300	6503	SO:0001583	missense	144195	exon6			TGACAATCAGCAT	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.358A>T	12.37:g.7982586T>A	ENSP00000440480:p.Ile120Phe	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	81	16	NM_153449	0	0	31	31	0	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	t	10.42	1.346517	0.24426	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924;ENST00000546234;ENST00000542782;ENST00000535344;ENST00000537557;ENST00000535266	T;T;T;T;T;T;T;T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86	3.11	1.89	0.25635	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.451473	0.22797	N	0.055529	T	0.63094	0.2482	L	0.49455	1.56	0.09310	N	1	B;B;B;B	0.17852	0.02;0.006;0.002;0.024	B;B;B;B	0.24394	0.049;0.049;0.013;0.053	T	0.46076	-0.9217	10	0.15499	T	0.54	.	7.3787	0.26843	0.0:0.0:0.4716:0.5284	.	135;11;97;120	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	F	97;120;97;120;11;11;135;97;97;97;120;120	ENSP00000340450:I97F;ENSP00000440480:I120F;ENSP00000407287:I97F;ENSP00000379834:I120F;ENSP00000440492:I11F;ENSP00000443903:I11F;ENSP00000445929:I135F;ENSP00000440043:I97F;ENSP00000438312:I97F;ENSP00000443217:I97F;ENSP00000440044:I120F;ENSP00000437653:I120F	ENSP00000340450:I97F	I	-	1	0	SLC2A14	7873853	0.000000	0.05858	0.522000	0.27862	0.249000	0.25844	-0.458000	0.06737	0.201000	0.20466	0.377000	0.23210	ATT	.		0.458	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449	
DDX12P	440081	broad.mit.edu	37	12	9574020	9574020	+	IGR	SNP	T	T	C	rs200847155		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:9574020T>C								RP13-735L24.1 (23807 upstream) : SNORA75 (23633 downstream)														p.L672L(1)									ACGTGAATTCTAGCGGCTGGT	0.597																																					.													.	.	1	Substitution - coding silent(1)	endometrium(1)	.						.						53.0	57.0	55.0					12																	9574020		692	1591	2283	SO:0001628	intergenic_variant	440081	.			GAATTCTAGCGGC																													12.37:g.9574020T>C		Somatic	114	0		WXS	Illumina HiSeq	Phase_I	151	4	.	0	0	2	21	19		RNA	SNP		37																																																																																				T|0.998;C|0.002	0	0.597								
SLC38A1	81539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	46633478	46633478	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:46633478T>A	ENST00000398637.5	-	3	800	c.106A>T	c.(106-108)Aat>Tat	p.N36Y	SLC38A1_ENST00000549049.1_Missense_Mutation_p.N36Y|SLC38A1_ENST00000546893.1_Missense_Mutation_p.N36Y|SLC38A1_ENST00000552197.1_Missense_Mutation_p.N36Y|SLC38A1_ENST00000439706.1_Missense_Mutation_p.N36Y|SLC38A1_ENST00000549633.1_Intron	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	36					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			ATCTGACCATTTTCTACTTCG	0.413																																					p.N36Y		.											.	SLC38A1-518	0			c.A106T						.						159.0	147.0	151.0					12																	46633478		1872	4125	5997	SO:0001583	missense	81539	exon3			GACCATTTTCTAC	AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.106A>T	12.37:g.46633478T>A	ENSP00000381634:p.Asn36Tyr	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	171	33	NM_030674	0	0	15	20	5	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	ENST00000398637.5	37	CCDS41774.1	.	.	.	.	.	.	.	.	.	.	T	19.53	3.844471	0.71488	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197;ENST00000550173	T;T;T;T;T	0.07688	3.33;3.33;3.33;3.33;3.17	4.93	4.93	0.64822	.	0.000000	0.56097	D	0.000026	T	0.13457	0.0326	N	0.08118	0	0.46437	D	0.999046	D;P	0.89917	1.0;0.871	D;B	0.87578	0.998;0.327	T	0.35076	-0.9803	10	0.66056	D	0.02	-24.0257	14.896	0.70644	0.0:0.0:0.0:1.0	.	36;36	F8VX04;Q9H2H9	.;S38A1_HUMAN	Y	36	ENSP00000449607:N36Y;ENSP00000398142:N36Y;ENSP00000381634:N36Y;ENSP00000447853:N36Y;ENSP00000449756:N36Y	ENSP00000381634:N36Y	N	-	1	0	SLC38A1	44919745	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.732000	0.62029	1.975000	0.57531	0.477000	0.44152	AAT	.		0.413	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404218.2		
TCTN1	79600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	111070319	111070319	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:111070319C>T	ENST00000551590.1	+	5	823	c.667C>T	c.(667-669)Cct>Tct	p.P223S	AC144522.1_ENST00000408319.1_RNA|TCTN1_ENST00000551555.2_3'UTR|TCTN1_ENST00000377654.3_Missense_Mutation_p.P45S|HVCN1_ENST00000548312.1_Intron|TCTN1_ENST00000397659.4_Missense_Mutation_p.P223S|TCTN1_ENST00000397655.3_Missense_Mutation_p.P223S			Q2MV58	TECT1_HUMAN	tectonic family member 1	223					central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						TCTGAGATTTCCTTCGTCCCT	0.398																																					p.P223S		.											.	TCTN1-90	0			c.C667T						.						197.0	184.0	188.0					12																	111070319		1898	4131	6029	SO:0001583	missense	79600	exon5			AGATTTCCTTCGT	AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.667C>T	12.37:g.111070319C>T	ENSP00000448735:p.Pro223Ser	Somatic	182	1		WXS	Illumina HiSeq	Phase_I	244	52	NM_024549	0	0	78	117	39	A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Missense_Mutation	SNP	ENST00000551590.1	37	CCDS41835.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656513	0.88154	.	.	ENSG00000204852	ENST00000397650;ENST00000551590;ENST00000397655;ENST00000377654;ENST00000547868;ENST00000548095;ENST00000397657;ENST00000397659;ENST00000397652	D;D;D;D	0.98313	-4.86;-4.86;-4.86;-4.86	5.97	5.97	0.96955	Domain of unknown function DUF1619 (1);	0.000000	0.85682	D	0.000000	D	0.99099	0.9690	M	0.87180	2.865	0.58432	D	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.99716	1.1008	10	0.87932	D	0	-15.0486	18.9916	0.92794	0.0:1.0:0.0:0.0	.	223;223;223;163;167	Q2MV58;Q2MV58-3;Q2MV58-2;C9J1H5;C9J1H4	TECT1_HUMAN;.;.;.;.	S	163;223;223;45;45;223;45;223;167	ENSP00000448735:P223S;ENSP00000380775:P223S;ENSP00000366882:P45S;ENSP00000380779:P223S	ENSP00000366882:P45S	P	+	1	0	TCTN1	109554702	1.000000	0.71417	0.767000	0.31495	0.782000	0.44232	4.913000	0.63341	2.835000	0.97688	0.591000	0.81541	CCT	.		0.398	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316016.2	NM_024549	
ATXN2	6311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	111908459	111908459	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:111908459G>C	ENST00000377617.3	-	19	3247	c.3086C>G	c.(3085-3087)gCc>gGc	p.A1029G	ATXN2_ENST00000535949.1_Missense_Mutation_p.A740G|ATXN2_ENST00000608853.1_Missense_Mutation_p.A869G|ATXN2_ENST00000389153.4_Missense_Mutation_p.A766G|ATXN2_ENST00000542287.2_Missense_Mutation_p.A764G|ATXN2_ENST00000550104.1_3'UTR	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	1029	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						TGGTGGGGTGGCTGCAATCGG	0.532																																					p.A1029G		.											.	ATXN2-136	0			c.C3086G						.						139.0	128.0	132.0					12																	111908459		2203	4300	6503	SO:0001583	missense	6311	exon19			GGGGTGGCTGCAA	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.3086C>G	12.37:g.111908459G>C	ENSP00000366843:p.Ala1029Gly	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	179	63	NM_002973	0	0	17	38	21	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	37	CCDS31902.1	.	.	.	.	.	.	.	.	.	.	G	34	5.351916	0.95830	.	.	ENSG00000204842	ENST00000389154;ENST00000389153;ENST00000377617;ENST00000482777;ENST00000542287;ENST00000535949	T	0.77620	-1.11	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.85444	0.5698	L	0.52573	1.65	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.997;0.993;0.999;0.998	D;D;D;D;D	0.85130	0.994;0.985;0.978;0.997;0.994	T	0.81564	-0.0875	10	0.27082	T	0.32	-9.4636	19.888	0.96917	0.0:0.0:1.0:0.0	.	48;1029;740;764;766	Q99700-3;Q99700;Q24JQ7;F8VQP2;F8WB06	.;ATX2_HUMAN;.;.;.	G	84;766;1029;48;764;740	ENSP00000366843:A1029G	ENSP00000366843:A1029G	A	-	2	0	ATXN2	110392842	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.720000	0.93068	0.591000	0.81541	GCC	.		0.532	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
SBNO1	55206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	123806180	123806180	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:123806180T>C	ENST00000602398.1	-	17	2352	c.2225A>G	c.(2224-2226)aAt>aGt	p.N742S	SBNO1_ENST00000420886.2_Missense_Mutation_p.N742S|SBNO1_ENST00000602750.1_Missense_Mutation_p.N741S|SBNO1_ENST00000267176.4_Missense_Mutation_p.N741S			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	742					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		ACTTTCTTCATTATCAGAGGC	0.403																																					p.N742S		.											.	SBNO1-292	0			c.A2225G						.						193.0	173.0	180.0					12																	123806180		2203	4300	6503	SO:0001583	missense	55206	exon16			TCTTCATTATCAG	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.2225A>G	12.37:g.123806180T>C	ENSP00000473665:p.Asn742Ser	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	218	90	NM_001167856	0	0	5	14	9	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	T	3.761	-0.049616	0.07407	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	T;T	0.28666	1.6;1.6	5.33	4.15	0.48705	.	0.449012	0.24209	N	0.040557	T	0.09949	0.0244	N	0.00926	-1.1	0.35755	D	0.819721	B;B;B	0.19200	0.0;0.001;0.034	B;B;B	0.21917	0.001;0.001;0.037	T	0.20538	-1.0272	10	0.06365	T	0.9	-14.1214	12.2297	0.54480	0.0:0.0:0.1426:0.8574	.	742;741;740	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	S	742;741	ENSP00000387361:N742S;ENSP00000267176:N741S	ENSP00000267176:N741S	N	-	2	0	SBNO1	122372133	0.996000	0.38824	0.986000	0.45419	0.996000	0.88848	1.100000	0.31025	0.819000	0.34492	0.460000	0.39030	AAT	.		0.403	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
MTHFD1	4522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	64915025	64915025	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr14:64915025A>C	ENST00000545908.1	+	23	2666	c.2437A>C	c.(2437-2439)Aat>Cat	p.N813H	CTD-2555O16.2_ENST00000556640.1_RNA|MTHFD1_ENST00000216605.8_Missense_Mutation_p.N757H			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	757	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	AGTGGCCGTGAATGCATTCAA	0.383																																					p.N757H	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	.											.	MTHFD1-92	0			c.A2269C						.						79.0	78.0	78.0					14																	64915025		2203	4300	6503	SO:0001583	missense	4522	exon23			GCCGTGAATGCAT	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.2437A>C	14.37:g.64915025A>C	ENSP00000438588:p.Asn813His	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	59	12	NM_005956	0	0	3	9	6	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	37		.	.	.	.	.	.	.	.	.	.	A	21.0	4.077868	0.76528	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605	T;T;T	0.47177	0.85;0.85;0.85	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.82898	0.5137	H	0.99573	4.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90598	0.4542	10	0.87932	D	0	-21.8056	16.1926	0.82004	1.0:0.0:0.0:0.0	.	813;757	F5H2F4;G3V2B8	.;.	H	813;757;813	ENSP00000438588:N813H;ENSP00000450560:N757H;ENSP00000216605:N813H	ENSP00000216605:N757H	N	+	1	0	MTHFD1	63984778	1.000000	0.71417	0.914000	0.36105	0.594000	0.36715	9.339000	0.96797	2.219000	0.72066	0.533000	0.62120	AAT	.		0.383	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1		
GALNT16	57452	bcgsc.ca	37	14	69787575	69787575	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr14:69787575C>A	ENST00000337827.4	+	2	652	c.325C>A	c.(325-327)Cgc>Agc	p.R109S	GALNT16_ENST00000448469.3_Missense_Mutation_p.R109S|GALNT16_ENST00000553669.1_Missense_Mutation_p.R109S	NM_001168368.1|NM_020692.2	NP_001161840.1|NP_065743.2	Q8N428	GLT16_HUMAN	polypeptide N-acetylgalactosaminyltransferase 16	109					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										CCGGGACACCCGCCATTACAG	0.532																																					p.R109S													.	.	0			c.C325A						.						58.0	54.0	56.0					14																	69787575		2203	4300	6503	SO:0001583	missense	57452	exon2			GACACCCGCCATT	AB032956	CCDS32107.1	14q24.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000100626	ENSG00000100626	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23233	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 16"""	615132	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16"""	GALNTL1		10574461, 22186971	Standard	NM_020692		Approved	KIAA1130, GalNAc-T16	uc010aqu.2	Q8N428	OTTHUMG00000171231	ENST00000337827.4:c.325C>A	14.37:g.69787575C>A	ENSP00000336729:p.Arg109Ser	Somatic	75	0		WXS	Illumina HiSeq	Phase_1	97	6	NM_001168368	0	0	0	0	0	Q4KMG3|Q58A55|Q9ULT9	Missense_Mutation	SNP	ENST00000337827.4	37	CCDS32107.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366029	0.82463	.	.	ENSG00000100626	ENST00000337827;ENST00000448469;ENST00000553669	T;T;T	0.62105	0.05;0.05;0.05	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.82365	0.5021	M	0.91663	3.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.85654	0.1284	10	0.87932	D	0	.	12.7073	0.57067	0.275:0.725:0.0:0.0	.	109;109	Q8N428;Q58A55	GLTL1_HUMAN;.	S	109	ENSP00000336729:R109S;ENSP00000402970:R109S;ENSP00000451200:R109S	ENSP00000336729:R109S	R	+	1	0	GALNTL1	68857328	0.997000	0.39634	1.000000	0.80357	0.843000	0.47879	3.698000	0.54771	2.660000	0.90430	0.650000	0.86243	CGC	.		0.532	GALNT16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412434.1	NM_001168368	
STON2	85439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	81744521	81744521	+	Silent	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr14:81744521G>A	ENST00000267540.2	-	4	1334	c.1134C>T	c.(1132-1134)caC>caT	p.H378H	STON2_ENST00000555447.1_Silent_p.H378H|STON2_ENST00000556280.1_5'Flank	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	378					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		CAGCATCAGAGTGTGACTGGG	0.448																																					p.H378H		.											.	STON2-95	0			c.C1134T						.						95.0	95.0	95.0					14																	81744521		2203	4300	6503	SO:0001819	synonymous_variant	85439	exon6			ATCAGAGTGTGAC	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.1134C>T	14.37:g.81744521G>A		Somatic	131	1		WXS	Illumina HiSeq	Phase_I	129	29	NM_001256430	0	0	5	7	2	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Silent	SNP	ENST00000267540.2	37	CCDS9875.1																																																																																			.		0.448	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	96784101	96784101	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr14:96784101C>G	ENST00000359933.4	-	19	3864	c.2971G>C	c.(2971-2973)Gcc>Ccc	p.A991P		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	991					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AGCTGACTGGCTACTGAAAGC	0.343																																					p.A991P		.											.	ATG2B-93	0			c.G2971C						.						101.0	96.0	98.0					14																	96784101		1833	4104	5937	SO:0001583	missense	55102	exon19			GACTGGCTACTGA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.2971G>C	14.37:g.96784101C>G	ENSP00000353010:p.Ala991Pro	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	189	35	NM_018036	0	0	5	7	2	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998612	0.74818	.	.	ENSG00000066739	ENST00000359933	T	0.39997	1.05	5.54	5.54	0.83059	.	0.164574	0.39759	U	0.001274	T	0.63034	0.2477	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.54576	-0.8273	10	0.25751	T	0.34	.	19.8585	0.96775	0.0:1.0:0.0:0.0	.	991	Q96BY7	ATG2B_HUMAN	P	991	ENSP00000353010:A991P	ENSP00000353010:A991P	A	-	1	0	ATG2B	95853854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.496000	0.81526	2.760000	0.94817	0.655000	0.94253	GCC	.		0.343	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
SCAPER	49855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	77087751	77087751	+	Silent	SNP	A	A	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr15:77087751A>T	ENST00000563290.1	-	8	737	c.642T>A	c.(640-642)cgT>cgA	p.R214R	SCAPER_ENST00000538941.2_5'UTR|SCAPER_ENST00000324767.7_Silent_p.R214R|SCAPER_ENST00000562890.1_5'UTR			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	214						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TGGGAGCCAGACGAGGAGCTG	0.418																																					p.R214R		.											.	SCAPER-137	0			c.T642A						.						65.0	63.0	63.0					15																	77087751		1863	4094	5957	SO:0001819	synonymous_variant	49855	exon7			AGCCAGACGAGGA	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.642T>A	15.37:g.77087751A>T		Somatic	76	1		WXS	Illumina HiSeq	Phase_I	83	20	NM_020843	0	0	3	3	0	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Silent	SNP	ENST00000563290.1	37	CCDS53962.1																																																																																			.		0.418	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
TMED3	23423	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	79606106	79606106	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr15:79606106C>G	ENST00000299705.5	+	2	364	c.176C>G	c.(175-177)aCt>aGt	p.T59S	TMED3_ENST00000536821.1_Missense_Mutation_p.T59S|TMED3_ENST00000424155.2_Missense_Mutation_p.T59S	NM_007364.2	NP_031390.1	Q9Y3Q3	TMED3_HUMAN	transmembrane emp24 protein transport domain containing 3	59	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				protein transport (GO:0015031)	COPI vesicle coat (GO:0030126)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)|ovary(1)|skin(1)	9						CAGGTCATCACTGGAGGCCAC	0.478																																					p.T59S		.											.	TMED3-92	0			c.C176G						.						94.0	82.0	86.0					15																	79606106		2196	4293	6489	SO:0001583	missense	23423	exon2			TCATCACTGGAGG	BC022232	CCDS10310.1, CCDS73768.1	15q24-q25	2011-02-09	2005-08-26	2005-01-07	ENSG00000166557	ENSG00000166557			28889	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 22"", ""transmembrane emp24 domain containing 3"""	C15orf22		12975309	Standard	XM_005254263		Approved	p24B	uc002beu.3	Q9Y3Q3	OTTHUMG00000144170	ENST00000299705.5:c.176C>G	15.37:g.79606106C>G	ENSP00000299705:p.Thr59Ser	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	51	8	NM_007364	0	0	0	0	0	A8K069|B4DN05|Q2T9F8	Missense_Mutation	SNP	ENST00000299705.5	37	CCDS10310.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220785	0.58560	.	.	ENSG00000166557	ENST00000299705;ENST00000424155;ENST00000536821;ENST00000543455	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	4.88	4.88	0.63580	GOLD (3);	0.258714	0.39407	N	0.001373	T	0.12220	0.0297	L	0.28694	0.88	0.47698	D	0.999498	B;B	0.29085	0.232;0.004	B;B	0.35607	0.206;0.01	T	0.06954	-1.0798	10	0.08599	T	0.76	-25.4826	15.9067	0.79436	0.0:1.0:0.0:0.0	.	59;59	B4DN05;Q9Y3Q3	.;TMED3_HUMAN	S	59	ENSP00000299705:T59S;ENSP00000414983:T59S;ENSP00000446062:T59S;ENSP00000440228:T59S	ENSP00000299705:T59S	T	+	2	0	TMED3	77393161	0.995000	0.38212	0.976000	0.42696	0.985000	0.73830	3.616000	0.54174	2.680000	0.91292	0.655000	0.94253	ACT	.		0.478	TMED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291369.1	NM_007364	
SRRM2	23524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2808492	2808492	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr16:2808492T>A	ENST00000301740.8	+	5	1086	c.537T>A	c.(535-537)agT>agA	p.S179R		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	179	Ser-rich.			SS -> NN (in Ref. 2; AAF21439). {ECO:0000305}.	mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGTCTAGCAGTTCTCGCTCAC	0.423																																					p.S179R		.											.	SRRM2-93	0			c.T537A						.						161.0	166.0	165.0					16																	2808492		2198	4300	6498	SO:0001583	missense	23524	exon5			TAGCAGTTCTCGC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.537T>A	16.37:g.2808492T>A	ENSP00000301740:p.Ser179Arg	Somatic	268	0		WXS	Illumina HiSeq	Phase_I	274	50	NM_016333	0	0	31	48	17	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.195477	0.58126	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000396975;ENST00000426305	T	0.25250	1.81	5.15	2.81	0.32909	.	0.000000	0.64402	D	0.000006	T	0.29749	0.0743	N	0.19112	0.55	0.32407	N	0.551109	D	0.71674	0.998	D	0.76071	0.987	T	0.32955	-0.9887	10	0.87932	D	0	-4.3082	6.3143	0.21182	0.0:0.2621:0.0:0.7379	.	179	Q9UQ35	SRRM2_HUMAN	R	179;179;83;144	ENSP00000301740:S179R	ENSP00000301740:S179R	S	+	3	2	SRRM2	2748493	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.382000	0.20635	0.797000	0.33971	0.528000	0.53228	AGT	.		0.423	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
SRCAP	10847	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30750805	30750805	+	Missense_Mutation	SNP	T	T	A	rs142948420	byFrequency	TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr16:30750805T>A	ENST00000262518.4	+	34	9829	c.9444T>A	c.(9442-9444)agT>agA	p.S3148R	SRCAP_ENST00000344771.4_Missense_Mutation_p.S2990R|RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000395059.2_Missense_Mutation_p.S3086R	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	3148					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			TTGGTGGGAGTCCTGGGCTGG	0.647																																					p.S3148R													.	SRCAP-94	0			c.T9444A						.						21.0	25.0	24.0					16																	30750805		2197	4299	6496	SO:0001583	missense	10847	exon34			TGGGAGTCCTGGG	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.9444T>A	16.37:g.30750805T>A	ENSP00000262518:p.Ser3148Arg	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	40	6	NM_006662	0	1	48	81	32	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	T	6.071	0.381466	0.11524	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.92048	-2.95;-2.96;-2.96	4.97	-3.81	0.04294	.	0.629076	0.14021	N	0.346808	T	0.79287	0.4420	N	0.08118	0	0.09310	N	1	B;B	0.25105	0.118;0.021	B;B	0.30401	0.115;0.039	T	0.69022	-0.5255	10	0.87932	D	0	-0.0059	3.9292	0.09276	0.1722:0.5003:0.1321:0.1954	.	3086;3148	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	R	3148;3086;2990	ENSP00000262518:S3148R;ENSP00000378499:S3086R;ENSP00000343042:S2990R	ENSP00000262518:S3148R	S	+	3	2	SRCAP	30658306	0.586000	0.26782	0.072000	0.20136	0.980000	0.70556	-0.209000	0.09358	-0.600000	0.05790	0.379000	0.24179	AGT	T|0.997;C|0.003		0.647	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
E2F4	1874	broad.mit.edu;bcgsc.ca	37	16	67233265	67233265	+	IGR	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr16:67233265C>A	ENST00000379378.3	+	0	2096				ELMO3_ENST00000477898.1_5'Flank|ELMO3_ENST00000393997.2_Silent_p.I65I|MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000360833.1_Silent_p.I65I	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		AGATTGCCATCAAGATGCGTG	0.682																																					p.I65I													.	ELMO3-90	0			c.C195A						.						32.0	40.0	37.0					16																	67233265		2111	4222	6333	SO:0001628	intergenic_variant	79767	exon1			TGCCATCAAGATG	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67233265C>A		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	86	15	NM_024712	0	0	0	8	8	A6NGR8|B5BU56|Q12991|Q15328	Silent	SNP	ENST00000379378.3	37	CCDS32464.1																																																																																			.		0.682	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
WSCD1	23302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	6012935	6012935	+	Silent	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:6012935C>G	ENST00000574946.1	+	6	1248	c.858C>G	c.(856-858)ccC>ccG	p.P286P	WSCD1_ENST00000574232.1_Silent_p.P286P|WSCD1_ENST00000317744.5_Silent_p.P286P|WSCD1_ENST00000573634.1_Silent_p.P170P|WSCD1_ENST00000539421.1_Silent_p.P286P			Q658N2	WSCD1_HUMAN	WSC domain containing 1	286	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.P286P(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						AGGAGTTCCCCTTGGCCATTC	0.557																																					p.P286P		.											.	WSCD1-90	1	Substitution - coding silent(1)	endometrium(1)	c.C858G						.						260.0	245.0	250.0					17																	6012935		2203	4300	6503	SO:0001819	synonymous_variant	23302	exon6			GTTCCCCTTGGCC		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.858C>G	17.37:g.6012935C>G		Somatic	483	1		WXS	Illumina HiSeq	Phase_I	392	87	NM_015253	0	0	0	0	0	A8K0N8|D3DTM3|O60276|Q96G45	Silent	SNP	ENST00000574946.1	37	CCDS32538.1																																																																																			.		0.557	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253	
POLR2A	5430	ucsc.edu	37	17	7414839	7414839	+	Missense_Mutation	SNP	C	C	T	rs142714917		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:7414839C>T	ENST00000322644.6	+	24	4432	c.4033C>T	c.(4033-4035)Cgg>Tgg	p.R1345W		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1345					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GAGCTTGATGCGGGTGCTGAG	0.572																																					p.R1345W													.	POLR2A-91	0			c.C4033T						.	C	TRP/ARG	0,4406		0,0,2203	138.0	99.0	112.0		4033	4.6	1.0	17	dbSNP_134	112	1,8599	1.2+/-3.3	0,1,4299	no	missense	POLR2A	NM_000937.4	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1345/1971	7414839	1,13005	2203	4300	6503	SO:0001583	missense	5430	exon24			TTGATGCGGGTGC			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.4033C>T	17.37:g.7414839C>T	ENSP00000314949:p.Arg1345Trp	Somatic	40	0		WXS	Illumina HiSeq		40	4	NM_000937	0	0	110	110	0	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313368	0.81358	0.0	1.16E-4	ENSG00000181222	ENST00000535204;ENST00000545644;ENST00000322644	T	0.77620	-1.11	4.59	4.59	0.56863	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.64402	D	0.000001	D	0.86230	0.5883	M	0.76170	2.325	0.80722	D	1	D	0.76494	0.999	P	0.61658	0.892	D	0.88200	0.2883	10	0.87932	D	0	-10.9548	16.7406	0.85458	0.0:1.0:0.0:0.0	.	1345	P24928	RPB1_HUMAN	W	1301;244;1345	ENSP00000314949:R1345W	ENSP00000314949:R1345W	R	+	1	2	SLC35G6	7355563	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.890000	0.39728	2.564000	0.86499	0.449000	0.29647	CGG	C|1.000;T|0.000		0.572	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	377	53		WXS	Illumina HiSeq		397	58	NM_145301	0	0	5	40	35	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
ZNF830	91603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	33289281	33289281	+	Silent	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:33289281T>C	ENST00000361952.3	+	1	733	c.696T>C	c.(694-696)caT>caC	p.H232H	CCT6B_ENST00000436961.3_5'Flank|CCT6B_ENST00000314144.5_5'Flank|CCT6B_ENST00000421975.3_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	232					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				CAGAAATACATGAAAAAGTGG	0.448																																					p.H232H		.											.	ZNF830-89	0			c.T696C						.						49.0	48.0	48.0					17																	33289281		2203	4300	6503	SO:0001819	synonymous_variant	91603	exon1			AATACATGAAAAA	AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.696T>C	17.37:g.33289281T>C		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	59	16	NM_052857	0	0	18	32	14	Q96F60|Q96GZ5|Q9BU38	Silent	SNP	ENST00000361952.3	37	CCDS32618.1																																																																																			.		0.448	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448018.1	NM_052857	
NR1D1	9572	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	38253601	38253601	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:38253601A>G	ENST00000246672.3	-	2	717	c.87T>C	c.(85-87)ccT>ccC	p.P29P		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	29	Modulating.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					AGAGGGATTCAGGGCTGGTGC	0.592																																					p.P29P		.											.	NR1D1-226	0			c.T87C						.						57.0	62.0	60.0					17																	38253601		2203	4300	6503	SO:0001819	synonymous_variant	9572	exon2			GGATTCAGGGCTG	X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.87T>C	17.37:g.38253601A>G		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	30	12	NM_021724	0	0	23	51	28	Q0P5Z4|Q15304	Silent	SNP	ENST00000246672.3	37	CCDS11361.1																																																																																			.		0.592	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257135.1		
NAGS	162417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42083544	42083544	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:42083544T>C	ENST00000293404.3	+	3	972	c.854T>C	c.(853-855)cTg>cCg	p.L285P	PYY_ENST00000360085.2_5'Flank	NM_153006.2	NP_694551.1	Q8N159	NAGS_HUMAN	N-acetylglutamate synthase	285	Amino-acid kinase domain (AAK).				arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial matrix (GO:0005759)	acetyl-CoA:L-glutamate N-acetyltransferase activity (GO:0004042)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8		Breast(137;0.00536)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GCCAAGGCGCTGCGGCCCACC	0.662																																					p.L285P		.											.	NAGS-90	0			c.T854C						.						29.0	29.0	29.0					17																	42083544		2200	4297	6497	SO:0001583	missense	162417	exon3			AGGCGCTGCGGCC	AY116537	CCDS11473.1	17q21.31	2008-02-05				ENSG00000161653			17996	protein-coding gene	gene with protein product		608300				15050968, 12459178	Standard	NM_153006		Approved	AGAS, ARGA, NAT7	uc002ies.3	Q8N159		ENST00000293404.3:c.854T>C	17.37:g.42083544T>C	ENSP00000293404:p.Leu285Pro	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	60	14	NM_153006	0	0	0	0	0	B2RAZ9|Q8IWR4	Missense_Mutation	SNP	ENST00000293404.3	37	CCDS11473.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.478496	0.84747	.	.	ENSG00000161653	ENST00000541745;ENST00000293404	D	0.94576	-3.46	4.49	4.49	0.54785	Aspartate/glutamate/uridylate kinase (2);	0.000000	0.64402	D	0.000014	D	0.96815	0.8960	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.98	D	0.97143	0.9826	10	0.87932	D	0	-18.0769	11.7799	0.52008	0.0:0.0:0.0:1.0	.	119;285	Q2NKP2;Q8N159	.;NAGS_HUMAN	P	119;285	ENSP00000293404:L285P	ENSP00000293404:L285P	L	+	2	0	NAGS	39439070	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	6.544000	0.73878	1.883000	0.54544	0.374000	0.22700	CTG	.		0.662	NAGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457660.1	NM_153006	
DCXR	51181	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79994491	79994491	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:79994491C>A	ENST00000306869.2	-	5	426	c.377G>T	c.(376-378)gGa>gTa	p.G126V	DCXR_ENST00000584318.1_5'UTR|RP13-650J16.1_ENST00000582558.1_RNA|RP13-650J16.1_ENST00000584705.1_RNA	NM_001195218.1|NM_016286.3	NP_001182147.1|NP_057370.1	Q7Z4W1	DCXR_HUMAN	dicarbonyl/L-xylulose reductase	126					D-xylose metabolic process (GO:0042732)|glucose metabolic process (GO:0006006)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|xylulose metabolic process (GO:0005997)	brush border (GO:0005903)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)	L-xylulose reductase (NADP+) activity (GO:0050038)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)			kidney(1)|lung(3)	4	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CCCTGGGACTCCCCGGGCTAT	0.622																																					p.G126V													.	DCXR-90	0			c.G377T						.						47.0	52.0	50.0					17																	79994491		2203	4300	6503	SO:0001583	missense	51181	exon5			GGGACTCCCCGGG	AB013846	CCDS11799.1	17q25.3	2011-09-14				ENSG00000169738	1.1.1.10	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 20C, member 1"""	608347				11882650, 19027726	Standard	NM_016286		Approved	KIDCR, DCR, SDR20C1	uc002kdg.3	Q7Z4W1		ENST00000306869.2:c.377G>T	17.37:g.79994491C>A	ENSP00000303356:p.Gly126Val	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	85	16	NM_016286	0	0	99	143	44	Q9BTZ3|Q9UHY9	Missense_Mutation	SNP	ENST00000306869.2	37	CCDS11799.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987714	0.35036	.	.	ENSG00000169738	ENST00000306869	T	0.33216	1.42	5.12	5.12	0.69794	NAD(P)-binding domain (1);	0.136289	0.49305	D	0.000159	T	0.61912	0.2385	M	0.89163	3.01	0.80722	D	1	D	0.63046	0.992	D	0.64687	0.928	T	0.69595	-0.5103	9	.	.	.	.	18.5287	0.90983	0.0:1.0:0.0:0.0	.	126	Q7Z4W1	DCXR_HUMAN	V	126	ENSP00000303356:G126V	.	G	-	2	0	DCXR	77587780	1.000000	0.71417	0.825000	0.32803	0.457000	0.32468	5.611000	0.67674	2.355000	0.79922	0.655000	0.94253	GGA	.		0.622	DCXR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442153.2		
SCAMP4	113178	ucsc.edu	37	19	1924169	1924169	+	Silent	SNP	G	G	A	rs574299368		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:1924169G>A	ENST00000316097.8	+	7	843	c.576G>A	c.(574-576)acG>acA	p.T192T	SCAMP4_ENST00000409472.1_Silent_p.T158T	NM_079834.2	NP_524558.1	Q969E2	SCAM4_HUMAN	secretory carrier membrane protein 4	192					protein transport (GO:0015031)	integral component of membrane (GO:0016021)							Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTGGAACACGGGCACTTGGC	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		15318	0.0		0.0	False		,,,				2504	0.001				p.T192T													.	SCAMP4-68	0			c.G576A						.						42.0	52.0	49.0					19																	1924169		2033	4178	6211	SO:0001819	synonymous_variant	113178	exon7			GAACACGGGCACT	AK091166	CCDS45903.1	19p13.3	2013-02-21			ENSG00000227500	ENSG00000227500		"""Secretory carrier membrane proteins"""	30385	protein-coding gene	gene with protein product		613764					Standard	NM_079834		Approved	FLJ33847	uc002luj.4	Q969E2	OTTHUMG00000154590	ENST00000316097.8:c.576G>A	19.37:g.1924169G>A		Somatic	14	0		WXS	Illumina HiSeq		21	3	NM_079834	0	0	37	67	30	Q8N2N1|Q8NAV0	Silent	SNP	ENST00000316097.8	37	CCDS45903.1	.	.	.	.	.	.	.	.	.	.	g	0.171	-1.071883	0.01918	.	.	ENSG00000227500	ENST00000414057	.	.	.	4.97	-9.94	0.00449	.	.	.	.	.	T	0.35508	0.0934	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44467	-0.9326	4	.	.	.	-22.8526	3.3328	0.07091	0.1707:0.2631:0.3836:0.1826	.	.	.	.	Q	202	.	.	R	+	2	0	SCAMP4	1875169	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-7.020000	0.00046	-2.994000	0.00278	-0.487000	0.04747	CGG	.		0.617	SCAMP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336210.3	NM_079834	
CATSPERD	257062	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	5744442	5744442	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:5744442A>G	ENST00000381624.3	+	8	639	c.578A>G	c.(577-579)gAa>gGa	p.E193G	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	193					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											TCATAGGCAGAAATCATTGGG	0.368																																					p.E193G		.											.	.	0			c.A578G						.						177.0	156.0	162.0					19																	5744442		1821	4093	5914	SO:0001583	missense	257062	exon8			AGGCAGAAATCAT	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.578A>G	19.37:g.5744442A>G	ENSP00000371037:p.Glu193Gly	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	125	16	NM_152784	0	0	0	0	0	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	37	CCDS12149.2	.	.	.	.	.	.	.	.	.	.	A	11.28	1.590905	0.28357	.	.	ENSG00000174898	ENST00000394548;ENST00000381624	T	0.16597	2.33	2.61	-0.961	0.10337	.	1.018470	0.07916	U	0.975045	T	0.14227	0.0344	L	0.60455	1.87	0.09310	N	0.999999	P	0.46512	0.879	B	0.40009	0.316	T	0.20974	-1.0259	10	0.66056	D	0.02	.	0.3749	0.00385	0.3898:0.2527:0.1457:0.2118	.	193	Q86XM0	TM146_HUMAN	G	119;193	ENSP00000371037:E193G	ENSP00000371037:E193G	E	+	2	0	TMEM146	5695442	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	0.059000	0.14322	-0.283000	0.09115	0.260000	0.18958	GAA	.		0.368	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
PNPLA6	10908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7619510	7619510	+	Silent	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:7619510G>A	ENST00000221249.6	+	24	2852	c.2421G>A	c.(2419-2421)caG>caA	p.Q807Q	PNPLA6_ENST00000414982.3_Silent_p.Q855Q|PNPLA6_ENST00000450331.3_Silent_p.Q807Q|PNPLA6_ENST00000545201.2_Silent_p.Q780Q|PNPLA6_ENST00000600737.1_Silent_p.Q845Q	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	846					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						TACTCTACCAGACGGACGCCT	0.667																																					p.Q855Q		.											.	PNPLA6-47	0			c.G2565A						.						87.0	74.0	79.0					19																	7619510		2203	4300	6503	SO:0001819	synonymous_variant	10908	exon23			CTACCAGACGGAC	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2421G>A	19.37:g.7619510G>A		Somatic	144	1		WXS	Illumina HiSeq	Phase_I	127	35	NM_001166111	0	1	79	114	34	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	ENST00000221249.6	37	CCDS32891.1																																																																																			.		0.667	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
QTRT1	81890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10823458	10823458	+	Missense_Mutation	SNP	A	A	G	rs568561273		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:10823458A>G	ENST00000250237.5	+	8	896	c.886A>G	c.(886-888)Act>Gct	p.T296A		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	296					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CCTGGTGCCCACTGGGAACCT	0.622																																					p.T296A		.											.	QTRT1-91	0			c.A886G						.						118.0	111.0	113.0					19																	10823458		2203	4300	6503	SO:0001583	missense	81890	exon8			GTGCCCACTGGGA	AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.886A>G	19.37:g.10823458A>G	ENSP00000250237:p.Thr296Ala	Somatic	249	0		WXS	Illumina HiSeq	Phase_I	228	44	NM_031209	0	0	41	63	22	B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	37	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	A	0.571	-0.841326	0.02692	.	.	ENSG00000213339	ENST00000250237	.	.	.	3.87	3.87	0.44632	.	0.163748	0.42821	U	0.000652	T	0.28067	0.0692	L	0.43923	1.385	0.26123	N	0.980526	B	0.14805	0.011	B	0.17433	0.018	T	0.21143	-1.0254	9	0.07990	T	0.79	-8.686	6.4838	0.22077	0.7837:0.0:0.0:0.2163	.	296	Q9BXR0	TGT_HUMAN	A	296	.	ENSP00000250237:T296A	T	+	1	0	QTRT1	10684458	1.000000	0.71417	0.998000	0.56505	0.601000	0.36947	5.570000	0.67398	1.631000	0.50456	0.379000	0.24179	ACT	.		0.622	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209	
NOTCH3	4854	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	15289675	15289675	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:15289675C>G	ENST00000263388.2	-	23	3871	c.3796G>C	c.(3796-3798)Ggt>Cgt	p.G1266R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1266	EGF-like 32. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCCCCAGGACCCGGGCTAGGA	0.652																																					p.G1266R		.											.	NOTCH3-855	0			c.G3796C						.						36.0	32.0	33.0					19																	15289675		2198	4296	6494	SO:0001583	missense	4854	exon23			CAGGACCCGGGCT	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3796G>C	19.37:g.15289675C>G	ENSP00000263388:p.Gly1266Arg	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	17	5	NM_000435	0	0	10	10	0	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.333583	0.41297	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.92099	-2.97	3.54	2.41	0.29592	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.94016	0.8083	M	0.72894	2.215	0.09310	N	1	P;D	0.89917	0.566;1.0	B;D	0.87578	0.131;0.998	D	0.84646	0.0698	9	0.54805	T	0.06	.	4.1418	0.10196	0.0:0.7058:0.0:0.2942	.	1217;1266	Q59FL3;Q9UM47	.;NOTC3_HUMAN	R	1266;1216	ENSP00000263388:G1266R	ENSP00000263388:G1266R	G	-	1	0	NOTCH3	15150675	0.011000	0.17503	0.110000	0.21437	0.729000	0.41735	0.970000	0.29383	1.813000	0.52934	0.561000	0.74099	GGT	.		0.652	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
CEACAM5	1048	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42219580	42219580	+	Missense_Mutation	SNP	G	G	A	rs199857011		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:42219580G>A	ENST00000221992.6	+	4	829	c.715G>A	c.(715-717)Gcc>Acc	p.A239T	CEACAM5_ENST00000405816.1_Missense_Mutation_p.A239T|CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000398599.4_Missense_Mutation_p.A239T	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	239	Ig-like 3.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		TGGCCCGGATGCCCCCACCAT	0.507																																					p.A239T													.	CEACAM5-92	0			c.G715A						.						71.0	73.0	73.0					19																	42219580		2203	4300	6503	SO:0001583	missense	1048	exon4			CCGGATGCCCCCA	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.715G>A	19.37:g.42219580G>A	ENSP00000221992:p.Ala239Thr	Somatic	100	1		WXS	Illumina HiSeq	Phase_I	106	30	NM_004363	0	0	0	0	0	H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	CCDS12584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	0.003|0.003	-2.415378|-2.415378	0.00191|0.00191	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000221992;ENST00000405816|ENST00000398599	T;T|.	0.14144|.	2.53;2.53|.	3.18|3.18	-4.69|-4.69	0.03299|0.03299	.|.	.|.	.|.	.|.	.|.	T|T	0.10981|0.10981	0.0268|0.0268	N|N	0.01771|0.01771	-0.73|-0.73	0.09310|0.09310	N|N	1|1	B;B|.	0.18863|.	0.003;0.031|.	B;B|.	0.26517|.	0.023;0.07|.	T|T	0.34875|0.34875	-0.9811|-0.9811	9|5	0.05833|.	T|.	0.94|.	.|.	8.6733|8.6733	0.34163|0.34163	0.4851:0.0:0.5149:0.0|0.4851:0.0:0.5149:0.0	.|.	239;239|.	P06731;Q53G30|.	CEAM5_HUMAN;.|.	T|Y	239|235	ENSP00000221992:A239T;ENSP00000385072:A239T|.	ENSP00000221992:A239T|.	A|C	+|+	1|2	0|0	CEACAM5|CEACAM5	46911420|46911420	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.028000|0.028000	0.11728|0.11728	-0.933000|-0.933000	0.03959|0.03959	-0.755000|-0.755000	0.04709|0.04709	0.305000|0.305000	0.20034|0.20034	GCC|TGC	G|1.000;T|0.000		0.507	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363	
RASIP1	54922	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49230414	49230414	+	Splice_Site	SNP	G	G	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:49230414G>T	ENST00000222145.4	-	7	2077	c.1873C>A	c.(1873-1875)Cac>Aac	p.H625N	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	625	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CCCTCAGGGTGGCTTGAAAAA	0.552																																					p.H625N													.	RASIP1-228	0			c.C1873A						.						27.0	30.0	29.0					19																	49230414		2202	4300	6502	SO:0001630	splice_region_variant	54922	exon7			CAGGGTGGCTTGA	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.1872-1C>A	19.37:g.49230414G>T		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	44	16	NM_017805	0	0	0	0	0	Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	CCDS12731.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315668	0.23908	.	.	ENSG00000105538	ENST00000222145	T	0.21191	2.02	5.46	4.43	0.53597	Dilute (1);	0.203282	0.40818	N	0.001002	T	0.16981	0.0408	L	0.38838	1.175	0.33974	D	0.647144	B	0.22604	0.072	B	0.18871	0.023	T	0.14587	-1.0467	10	0.32370	T	0.25	-11.7215	12.111	0.53840	0.0837:0.0:0.9163:0.0	.	625	Q5U651	RAIN_HUMAN	N	625	ENSP00000222145:H625N	ENSP00000222145:H625N	H	-	1	0	RASIP1	53922226	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	2.411000	0.44600	1.459000	0.47892	0.591000	0.81541	CAC	.		0.552	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	Missense_Mutation
IL4I1	259307	ucsc.edu	37	19	50397531	50397531	+	Silent	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:50397531G>C	ENST00000391826.2	-	5	703	c.561C>G	c.(559-561)ctC>ctG	p.L187L	IL4I1_ENST00000341114.3_Silent_p.L209L|IL4I1_ENST00000595948.1_Silent_p.L209L	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	187						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	CCACCTGGTTGAGAGCCATCT	0.622																																					p.L209L													.	IL4I1-523	0			c.C627G						.						90.0	87.0	88.0					19																	50397531		2203	4300	6503	SO:0001819	synonymous_variant	259307	exon7			CTGGTTGAGAGCC	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.561C>G	19.37:g.50397531G>C		Somatic	21	0		WXS	Illumina HiSeq		23	4	NM_172374	0	0	0	0	0	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Silent	SNP	ENST00000391826.2	37	CCDS12787.1																																																																																			.		0.622	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1		
GPR32	2854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	51273914	51273914	+	Silent	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:51273914G>C	ENST00000270590.4	+	1	194	c.57G>C	c.(55-57)ctG>ctC	p.L19L		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	19					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CTGGGGTCCTGACACGTGATC	0.512																																					p.L19L	Esophageal Squamous(113;152 1581 5732 15840 44398)	.											.	GPR32-91	0			c.G57C						.						80.0	65.0	70.0					19																	51273914		2203	4300	6503	SO:0001819	synonymous_variant	2854	exon1			GGTCCTGACACGT	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.57G>C	19.37:g.51273914G>C		Somatic	51	0		WXS	Illumina HiSeq	Phase_I	45	8	NM_001506	0	0	0	0	0	Q502U7|Q6NWS5	Silent	SNP	ENST00000270590.4	37	CCDS12801.1																																																																																			.		0.512	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
ZNF416	55659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58084258	58084258	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:58084258A>G	ENST00000196489.3	-	4	1236	c.1014T>C	c.(1012-1014)agT>agC	p.S338S		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	338					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		TAAGGTTGGAACTTTGGCTAA	0.428																																					p.S338S		.											.	ZNF416-90	0			c.T1014C						.						96.0	93.0	94.0					19																	58084258		2203	4300	6503	SO:0001819	synonymous_variant	55659	exon4			GTTGGAACTTTGG	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.1014T>C	19.37:g.58084258A>G		Somatic	74	0		WXS	Illumina HiSeq	Phase_I	75	15	NM_017879	0	0	4	6	2	Q9NWW8	Silent	SNP	ENST00000196489.3	37	CCDS12954.1																																																																																			.		0.428	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879	
SMEK2	57223	broad.mit.edu;ucsc.edu	37	2	55844410	55844410	+	Silent	SNP	C	C	T	rs142775723		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr2:55844410C>T	ENST00000345102.5	-	1	313	c.12G>A	c.(10-12)acG>acA	p.T4T	SMEK2_ENST00000477749.1_5'UTR|SMEK2_ENST00000272313.5_Silent_p.T4T|RP11-554J4.1_ENST00000608113.1_RNA|SMEK2_ENST00000407823.3_Silent_p.T4T	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	4	WH1.				positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CTCGCCGCCGCGTATCCGACA	0.622																																					p.T4T													.	SMEK2-228	0			c.G12A						.	C	,	1,4405	2.1+/-5.4	0,1,2202	55.0	45.0	48.0		12,12	1.5	1.0	2	dbSNP_134	48	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	SMEK2	NM_001122964.1,NM_020463.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	4/850,4/765	55844410	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57223	exon1			CCGCCGCGTATCC	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.12G>A	2.37:g.55844410C>T		Somatic	25	0		WXS	Illumina HiSeq	Phase_I	26	4	NM_001122964	0	0	28	35	7	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Silent	SNP	ENST00000345102.5	37	CCDS46289.1																																																																																			C|1.000;T|0.000		0.622	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
DUSP11	8446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74007101	74007101	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr2:74007101T>C	ENST00000272444.3	-	1	183	c.142A>G	c.(142-144)Atg>Gtg	p.M48V	DUSP11_ENST00000377706.4_Start_Codon_SNP_p.M1V|DUSP11_ENST00000443070.1_Missense_Mutation_p.M48V|DUSP11_ENST00000480948.1_5'Flank	NM_003584.2	NP_003575.2	O75319	DUS11_HUMAN	dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)	1					peptidyl-tyrosine dephosphorylation (GO:0035335)|polynucleotide 5' dephosphorylation (GO:0098507)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|phosphatase activity (GO:0016791)|poly(A) RNA binding (GO:0044822)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|skin(1)	12						CACTGGCTCATGTGGGTCCCA	0.607											OREG0014714	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M48V		.											.	DUSP11-227	0			c.A142G						.						61.0	61.0	61.0					2																	74007101		2203	4300	6503	SO:0001583	missense	8446	exon1			GGCTCATGTGGGT	AF023917	CCDS1928.2	2p13.1	2011-06-09			ENSG00000144048	ENSG00000144048		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3066	protein-coding gene	gene with protein product		603092				9685386	Standard	NM_003584		Approved	PIR1	uc002sjp.3	O75319	OTTHUMG00000129816	ENST00000272444.3:c.142A>G	2.37:g.74007101T>C	ENSP00000272444:p.Met48Val	Somatic	108	0	1149	WXS	Illumina HiSeq	Phase_I	82	24	NM_003584	0	0	15	19	4	B2RCT8|Q6AI47|Q9BWE3	Missense_Mutation	SNP	ENST00000272444.3	37	CCDS1928.2	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742276	0.49151	.	.	ENSG00000144048	ENST00000272444;ENST00000443070;ENST00000377706	T;T	0.32988	1.43;2.01	4.6	4.6	0.57074	.	0.059637	0.56097	D	0.000024	T	0.35008	0.0917	.	.	.	0.80722	D	1	P;D	0.55172	0.882;0.97	B;P	0.48627	0.428;0.584	T	0.10291	-1.0636	9	0.51188	T	0.08	-4.2088	10.6571	0.45682	0.0:0.0:0.0:1.0	.	48;1	C9JYA6;O75319	.;DUS11_HUMAN	V	48;48;1	ENSP00000413444:M48V;ENSP00000366935:M1V	ENSP00000272444:M48V	M	-	1	0	DUSP11	73860609	1.000000	0.71417	0.998000	0.56505	0.013000	0.08279	3.027000	0.49697	2.285000	0.76669	0.533000	0.62120	ATG	.		0.607	DUSP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252047.3		
DPP10	57628	broad.mit.edu	37	2	116572492	116572492	+	Silent	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr2:116572492T>C	ENST00000410059.1	+	20	2304	c.1824T>C	c.(1822-1824)ggT>ggC	p.G608G	DPP10_ENST00000393147.2_Silent_p.G612G|DPP10_ENST00000310323.8_Silent_p.G601G|DPP10_ENST00000409163.1_Silent_p.G558G	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	608						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GATTCCAGGGTCTGAAAATTT	0.393																																					p.G612G													.	DPP10-142	0			c.T1836C						.						123.0	126.0	125.0					2																	116572492		2203	4300	6503	SO:0001819	synonymous_variant	57628	exon20			CCAGGGTCTGAAA	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1824T>C	2.37:g.116572492T>C		Somatic	102	1		WXS	Illumina HiSeq	Phase_I	103	3	NM_001178034	0	0	0	0	0	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	CCDS46400.1																																																																																			.		0.393	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
ARHGEF4	50649	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	131801882	131801882	+	Missense_Mutation	SNP	G	G	A	rs376653204		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr2:131801882G>A	ENST00000326016.5	+	12	2129	c.1610G>A	c.(1609-1611)cGc>cAc	p.R537H	ARHGEF4_ENST00000525839.1_Missense_Mutation_p.R537H|ARHGEF4_ENST00000409303.1_Missense_Mutation_p.R477H|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000392953.3_Missense_Mutation_p.R537H|ARHGEF4_ENST00000355771.3_Missense_Mutation_p.R466H	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	537	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		GACCTGCTCCGCCGCGACGTG	0.642																																					p.R537H													.	ARHGEF4-292	0			c.G1610A						.	G	HIS/ARG,HIS/ARG	0,4400		0,0,2200	43.0	36.0	39.0		1610,1610	4.1	1.0	2		39	1,8599		0,1,4299	no	missense,missense	ARHGEF4	NM_015320.2,NM_032995.1	29,29	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,	537/691,537/671	131801882	1,12999	2200	4300	6500	SO:0001583	missense	50649	exon12			TGCTCCGCCGCGA	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.1610G>A	2.37:g.131801882G>A	ENSP00000316845:p.Arg537His	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	23	10	NM_032995	0	0	0	0	0	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	37	CCDS2165.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491248	0.84962	0.0	1.16E-4	ENSG00000136002	ENST00000326016;ENST00000392953;ENST00000525839;ENST00000409303;ENST00000355771	D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52	4.96	4.08	0.47627	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.93743	0.8000	M	0.83953	2.67	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71414	0.973;0.954;0.973	D	0.93816	0.7114	10	0.87932	D	0	.	11.1025	0.48184	0.0912:0.0:0.9088:0.0	.	477;537;537	E9PEM0;Q9NR80-4;Q9NR80	.;.;ARHG4_HUMAN	H	537;537;537;477;466	ENSP00000316845:R537H;ENSP00000376680:R537H;ENSP00000432267:R537H;ENSP00000387285:R477H;ENSP00000348017:R466H	ENSP00000316845:R537H	R	+	2	0	ARHGEF4	131518352	1.000000	0.71417	0.988000	0.46212	0.864000	0.49448	7.373000	0.79623	1.097000	0.41459	0.561000	0.74099	CGC	.		0.642	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
FRG1B	284802	bcgsc.ca	37	20	29628225	29628225	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr20:29628225A>G	ENST00000278882.3	+	6	608		c.e6-1		FRG1B_ENST00000358464.4_Splice_Site|FRG1B_ENST00000439954.2_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTTTCACTTAGGGGAAAATG	0.358																																					.													.	FRG1B-22	0			c.529-2A>G						.																																			SO:0001630	splice_region_variant	284802	exon5			TCACTTAGGGGAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-1A>G	20.37:g.29628225A>G		Somatic	141	3		WXS	Illumina HiSeq	Phase_1	159	12	NR_003579	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	.	8.410	0.843922	0.16963	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.89	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7774	0.29046	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28241886	1.000000	0.71417	0.998000	0.56505	0.247000	0.25773	7.946000	0.87746	1.131000	0.42111	0.147000	0.16070	.	.		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	Intron
CSE1L	1434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47691344	47691344	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr20:47691344A>G	ENST00000262982.2	+	11	1212	c.1089A>G	c.(1087-1089)gaA>gaG	p.E363E	CSE1L_ENST00000396192.3_Silent_p.E307E|CSE1L_ENST00000542325.1_Silent_p.E146E	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	363					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AAGCATTTGAAGATAATTCTG	0.383																																					p.E363E		.											.	CSE1L-290	0			c.A1089G						.						172.0	158.0	163.0					20																	47691344		2203	4300	6503	SO:0001819	synonymous_variant	1434	exon11			ATTTGAAGATAAT	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1089A>G	20.37:g.47691344A>G		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	58	12	NM_001316	0	0	25	50	25	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Silent	SNP	ENST00000262982.2	37	CCDS13412.1																																																																																			.		0.383	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
BRWD1	54014	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	40582820	40582820	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr21:40582820G>T	ENST00000333229.2	-	35	4263	c.3936C>A	c.(3934-3936)aaC>aaA	p.N1312K	BRWD1_ENST00000380800.3_Missense_Mutation_p.N1312K|BRWD1_ENST00000342449.3_Missense_Mutation_p.N1312K	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1312					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TTTCAACATAGTTCGTAGCTC	0.348																																					p.N1312K	Melanoma(170;988 1986 4794 16843 39731)												.	BRWD1-94	0			c.C3936A						.						108.0	100.0	103.0					21																	40582820		2203	4300	6503	SO:0001583	missense	54014	exon35			AACATAGTTCGTA	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3936C>A	21.37:g.40582820G>T	ENSP00000330753:p.Asn1312Lys	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	72	14	NM_018963	0	0	2	5	3	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	G	7.370	0.626714	0.14257	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.53857	0.6;0.62;0.7	5.36	2.35	0.29111	Bromodomain (1);	1.097550	0.06850	N	0.797170	T	0.36054	0.0953	L	0.34521	1.04	0.09310	N	0.999994	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.29640	-1.0005	10	0.07644	T	0.81	-0.1417	5.4851	0.16745	0.1606:0.0:0.5729:0.2665	.	1312;1312	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	K	1312	ENSP00000330753:N1312K;ENSP00000344333:N1312K;ENSP00000370178:N1312K	ENSP00000330753:N1312K	N	-	3	2	BRWD1	39504690	0.688000	0.27680	0.321000	0.25320	0.990000	0.78478	1.019000	0.30014	1.346000	0.45694	0.585000	0.79938	AAC	.		0.348	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
TXN2	25828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	36876727	36876727	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr22:36876727T>C	ENST00000216185.2	-	2	624	c.158A>G	c.(157-159)tAc>tGc	p.Y53C	TXN2_ENST00000416967.1_De_novo_Start_OutOfFrame|TXN2_ENST00000403313.1_Missense_Mutation_p.Y53C|TXN2_ENST00000487725.1_5'UTR			Q99757	THIOM_HUMAN	thioredoxin 2	53					cell redox homeostasis (GO:0045454)|cellular response to nutrient levels (GO:0031669)|glycerol ether metabolic process (GO:0006662)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)	dendrite (GO:0030425)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)	protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|lung(1)|prostate(1)	3						CCTCGTGGTGTATATTGTCCG	0.542																																					p.Y53C		.											.	TXN2-90	0			c.A158G						.						162.0	137.0	145.0					22																	36876727		2203	4300	6503	SO:0001583	missense	25828	exon2			GTGGTGTATATTG	U78678	CCDS13928.1	22q13.1	2008-06-11			ENSG00000100348	ENSG00000100348			17772	protein-coding gene	gene with protein product		609063				9006939, 17220299	Standard	NM_012473		Approved	MT-TRX	uc003apk.1	Q99757	OTTHUMG00000150596	ENST00000216185.2:c.158A>G	22.37:g.36876727T>C	ENSP00000216185:p.Tyr53Cys	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	117	24	NM_012473	0	0	113	183	70	Q5JZA0|Q6FH60|Q9UH29	Missense_Mutation	SNP	ENST00000216185.2	37	CCDS13928.1	.	.	.	.	.	.	.	.	.	.	t	4.360	0.066374	0.08388	.	.	ENSG00000100348	ENST00000216185;ENST00000403313	T;T	0.11495	2.77;2.77	5.59	-4.59	0.03400	Thioredoxin-like fold (1);	1.054490	0.07330	N	0.879042	T	0.07413	0.0187	L	0.47716	1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44559	-0.9320	10	0.38643	T	0.18	.	0.2548	0.00210	0.3331:0.1924:0.2444:0.2301	.	53	Q99757	THIOM_HUMAN	C	53	ENSP00000216185:Y53C;ENSP00000385393:Y53C	ENSP00000216185:Y53C	Y	-	2	0	TXN2	35206673	0.001000	0.12720	0.004000	0.12327	0.028000	0.11728	-0.205000	0.09411	-0.499000	0.06623	-0.459000	0.05422	TAC	.		0.542	TXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319016.1	NM_012473	
CNTN6	27255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	1371578	1371578	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:1371578C>G	ENST00000446702.2	+	11	1950	c.1323C>G	c.(1321-1323)atC>atG	p.I441M	CNTN6_ENST00000539053.1_Missense_Mutation_p.I369M|CNTN6_ENST00000350110.2_Missense_Mutation_p.I441M			Q9UQ52	CNTN6_HUMAN	contactin 6	441	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GGGCAGCTATCTCTTGGAAAA	0.333																																					p.I441M		.											.	CNTN6-345	0			c.C1323G						.						57.0	59.0	58.0					3																	1371578		2202	4299	6501	SO:0001583	missense	27255	exon11			AGCTATCTCTTGG	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.1323C>G	3.37:g.1371578C>G	ENSP00000407822:p.Ile441Met	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	59	14	NM_014461	0	0	27	42	15	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	37	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929637	0.52759	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.72282	-0.64;-0.64;-0.64	5.71	0.115	0.14643	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.491996	0.18537	N	0.138338	T	0.81128	0.4758	M	0.92604	3.325	0.09310	N	1	P	0.48350	0.909	P	0.57371	0.819	T	0.70901	-0.4746	10	0.72032	D	0.01	.	4.4769	0.11748	0.0:0.2343:0.1888:0.5769	.	441	Q9UQ52	CNTN6_HUMAN	M	441;369;441	ENSP00000407822:I441M;ENSP00000442791:I369M;ENSP00000341882:I441M	ENSP00000341882:I441M	I	+	3	3	CNTN6	1346578	0.000000	0.05858	0.482000	0.27366	0.987000	0.75469	-0.078000	0.11375	0.093000	0.17368	0.563000	0.77884	ATC	.		0.333	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
PLXNB1	5364	hgsc.bcm.edu	37	3	48456619	48456619	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:48456619G>C	ENST00000358536.4	-	20	4201	c.3932C>G	c.(3931-3933)gCa>gGa	p.A1311G	PLXNB1_ENST00000465117.1_Splice_Site|PLXNB1_ENST00000358459.4_Missense_Mutation_p.A1128G|PLXNB1_ENST00000296440.6_Missense_Mutation_p.A1311G|PLXNB1_ENST00000456774.1_Missense_Mutation_p.A1128G|PLXNB1_ENST00000448774.2_Intron	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1311	IPT/TIG 3.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AAGGGAACATGCCGTCTCCGG	0.642																																					p.A1311G		.											.	PLXNB1-293	0			c.C3932G						.						62.0	62.0	62.0					3																	48456619		2203	4300	6503	SO:0001583	missense	5364	exon20			GAACATGCCGTCT	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.3932C>G	3.37:g.48456619G>C	ENSP00000351338:p.Ala1311Gly	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	54	3	NM_001130082	0	0	85	85	0	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	37	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	G	5.873	0.345186	0.11126	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99	5.14	-2.76	0.05896	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);	1.568640	0.03917	N	0.282842	T	0.43122	0.1233	N	0.02539	-0.55	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.08055	0.0;0.003	T	0.23154	-1.0196	10	0.23891	T	0.37	.	1.1745	0.01832	0.2302:0.1071:0.1985:0.4641	.	1311;1128	O43157;O43157-2	PLXB1_HUMAN;.	G	1311;1128;1311;1128	ENSP00000296440:A1311G;ENSP00000351242:A1128G;ENSP00000351338:A1311G;ENSP00000414199:A1128G	ENSP00000296440:A1311G	A	-	2	0	PLXNB1	48431623	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.040000	0.13905	-0.007000	0.14345	0.655000	0.94253	GCA	.		0.642	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
CHDH	55349	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	53857341	53857341	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:53857341A>G	ENST00000315251.6	-	3	1132	c.695T>C	c.(694-696)aTc>aCc	p.I232T		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	232					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ACCTTCATGGATGGTCATGTC	0.612																																					p.I232T		.											.	CHDH-91	0			c.T695C						.						46.0	48.0	47.0					3																	53857341		2203	4300	6503	SO:0001583	missense	55349	exon3			TCATGGATGGTCA	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.695T>C	3.37:g.53857341A>G	ENSP00000319851:p.Ile232Thr	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	17	5	NM_018397	0	0	0	0	0	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	.	.	.	.	.	.	.	.	.	.	A	15.66	2.898970	0.52227	.	.	ENSG00000016391	ENST00000315251	T	0.39592	1.07	5.72	5.72	0.89469	Glucose-methanol-choline oxidoreductase, N-terminal (1);	0.161948	0.52532	D	0.000066	T	0.56046	0.1959	L	0.55103	1.725	0.53688	D	0.999973	D	0.63046	0.992	D	0.66084	0.941	T	0.57106	-0.7868	10	0.52906	T	0.07	-30.1407	11.1366	0.48378	0.8624:0.0:0.0:0.1376	.	232	Q8NE62	CHDH_HUMAN	T	232	ENSP00000319851:I232T	ENSP00000319851:I232T	I	-	2	0	CHDH	53832381	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.882000	0.92420	2.182000	0.69389	0.455000	0.32223	ATC	.		0.612	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
VGLL3	389136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	87017993	87017993	+	Silent	SNP	C	C	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:87017993C>T	ENST00000398399.2	-	3	1047	c.684G>A	c.(682-684)cgG>cgA	p.R228R	VGLL3_ENST00000383698.3_Silent_p.R228R	NM_016206.2	NP_057290.2			vestigial-like family member 3											NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		GGTGGTGGTGCCGCATGTACA	0.612																																					p.R228R		.											.	VGLL3-90	0			c.G684A						.						90.0	91.0	91.0					3																	87017993		2183	4286	6469	SO:0001819	synonymous_variant	389136	exon3			GTGGTGCCGCATG	AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.684G>A	3.37:g.87017993C>T		Somatic	77	1		WXS	Illumina HiSeq	Phase_I	78	21	NM_016206	0	0	0	0	0		Silent	SNP	ENST00000398399.2	37	CCDS43110.1	.	.	.	.	.	.	.	.	.	.	C	8.637	0.895168	0.17613	.	.	ENSG00000206538	ENST00000494229	.	.	.	5.81	-2.88	0.05682	.	.	.	.	.	T	0.36608	0.0973	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33394	-0.9870	4	.	.	.	-10.5859	0.3879	0.00405	0.2096:0.2183:0.2673:0.3047	.	.	.	.	T	162	.	.	A	-	1	0	VGLL3	87100683	0.025000	0.19082	0.985000	0.45067	0.991000	0.79684	-0.558000	0.05978	-0.371000	0.08004	-0.409000	0.06214	GCA	.		0.612	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352805.1	NM_016206	
PARP14	54625	broad.mit.edu;ucsc.edu	37	3	122414352	122414352	+	Silent	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:122414352G>A	ENST00000474629.2	+	5	944	c.678G>A	c.(676-678)gtG>gtA	p.V226V		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		TTCTGGAAGTGACAAACACAA	0.373																																					p.V226V													.	PARP14-525	0			c.G678A						.						42.0	41.0	42.0					3																	122414352		1840	4083	5923	SO:0001819	synonymous_variant	54625	exon5			GGAAGTGACAAAC	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.678G>A	3.37:g.122414352G>A		Somatic	25	0		WXS	Illumina HiSeq	Phase_I	25	5	NM_017554	0	0	10	18	8	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	37	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	G	1.080	-0.667224	0.03428	.	.	ENSG00000173193	ENST00000494811	.	.	.	5.65	-2.94	0.05581	.	.	.	.	.	T	0.42177	0.1191	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	T	0.29579	-1.0007	4	.	.	.	.	4.0851	0.09943	0.5094:0.1036:0.2814:0.1056	.	.	.	.	N	154	.	.	D	+	1	0	PARP14	123897042	0.001000	0.12720	0.001000	0.08648	0.388000	0.30384	-0.265000	0.08644	-0.886000	0.03966	-0.137000	0.14449	GAC	.		0.373	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
EPHB1	2047	broad.mit.edu;bcgsc.ca	37	3	134873005	134873005	+	Missense_Mutation	SNP	G	G	A	rs183234182		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:134873005G>A	ENST00000398015.3	+	6	1679	c.1309G>A	c.(1309-1311)Gtt>Att	p.V437I	EPHB1_ENST00000493838.1_5'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	437	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CCCCTCCACCGTTCCCATCAT	0.532													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20316	0.0		0.0	False		,,,				2504	0.0				p.V437I													.	EPHB1-1492	0			c.G1309A						.	G	ILE/VAL	0,4304		0,0,2152	199.0	212.0	207.0		1309	5.0	1.0	3		207	1,8563		0,1,4281	no	missense	EPHB1	NM_004441.4	29	0,1,6433	AA,AG,GG		0.0117,0.0,0.0078	possibly-damaging	437/985	134873005	1,12867	2152	4282	6434	SO:0001583	missense	2047	exon6			TCCACCGTTCCCA	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1309G>A	3.37:g.134873005G>A	ENSP00000381097:p.Val437Ile	Somatic	370	1		WXS	Illumina HiSeq	Phase_I	359	18	NM_004441	0	0	0	0	0	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	19.63	3.862742	0.71949	0.0	1.17E-4	ENSG00000154928	ENST00000398015	T	0.55588	0.51	5.0	5.0	0.66597	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.066621	0.64402	D	0.000014	T	0.50922	0.1644	M	0.64997	1.995	0.80722	D	1	P	0.42556	0.783	B	0.36885	0.235	T	0.56408	-0.7984	10	0.41790	T	0.15	.	18.0819	0.89443	0.0:0.0:1.0:0.0	.	437	P54762	EPHB1_HUMAN	I	437	ENSP00000381097:V437I	ENSP00000381097:V437I	V	+	1	0	EPHB1	136355695	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.657000	0.98554	2.610000	0.88304	0.655000	0.94253	GTT	G|0.999;A|0.000		0.532	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
TLR1	7096	broad.mit.edu;bcgsc.ca	37	4	38798114	38798114	+	Missense_Mutation	SNP	A	A	T	rs151285692		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:38798114A>T	ENST00000502213.2	-	3	2568	c.2339T>A	c.(2338-2340)cTg>cAg	p.L780Q	TLR1_ENST00000510552.1_5'Flank|TLR1_ENST00000308979.2_Missense_Mutation_p.L780Q			Q15399	TLR1_HUMAN	toll-like receptor 1	780					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TTGCTCTGTCAGCTTAATATT	0.388																																					p.L780Q	GBM(5;216 373 40795 46382)												.	TLR1-524	0			c.T2339A						.						73.0	70.0	71.0					4																	38798114		2203	4300	6503	SO:0001583	missense	7096	exon4			TCTGTCAGCTTAA	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.2339T>A	4.37:g.38798114A>T	ENSP00000421259:p.Leu780Gln	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	67	7	NM_003263	0	0	23	24	1	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	ENST00000502213.2	37	CCDS33973.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.167950	0.78339	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	T;T	0.02216	4.39;4.39	5.1	3.83	0.44106	Toll/interleukin-1 receptor homology (TIR) domain (1);	0.346719	0.20408	N	0.092903	T	0.13286	0.0322	M	0.87547	2.89	0.18873	N	0.999989	D	0.89917	1.0	D	0.75020	0.985	T	0.01401	-1.1364	10	0.87932	D	0	.	11.844	0.52374	0.8539:0.1461:0.0:0.0	.	780	Q15399	TLR1_HUMAN	Q	780	ENSP00000354932:L780Q;ENSP00000421259:L780Q	ENSP00000354932:L780Q	L	-	2	0	TLR1	38474509	0.147000	0.22687	0.273000	0.24645	0.669000	0.39330	4.139000	0.58024	2.057000	0.61298	0.460000	0.39030	CTG	A|1.000;G|0.000		0.388	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3		
SLC30A9	10463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	42072612	42072612	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:42072612T>A	ENST00000264451.7	+	15	1502	c.1322T>A	c.(1321-1323)cTc>cAc	p.L441H		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	441					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TCAGCATTCCTCATCTACACT	0.458																																					p.L441H		.											.	SLC30A9-91	0			c.T1322A						.						211.0	177.0	188.0					4																	42072612		2203	4300	6503	SO:0001583	missense	10463	exon15			CATTCCTCATCTA	AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.1322T>A	4.37:g.42072612T>A	ENSP00000264451:p.Leu441His	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	133	43	NM_006345	0	0	34	66	32	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	ENST00000264451.7	37	CCDS3465.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.512256	0.85389	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.71817	-0.6	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.87188	0.6115	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90228	0.4277	10	0.87932	D	0	-6.7973	15.4439	0.75213	0.0:0.0:0.0:1.0	.	441	Q6PML9	ZNT9_HUMAN	H	441;269	ENSP00000264451:L441H	ENSP00000264451:L441H	L	+	2	0	SLC30A9	41767369	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.951000	0.87819	2.099000	0.63709	0.533000	0.62120	CTC	.		0.458	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216842.3		
KCTD8	386617	hgsc.bcm.edu	37	4	44449962	44449962	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:44449962G>C	ENST00000360029.3	-	1	862	c.579C>G	c.(577-579)caC>caG	p.H193Q	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	193					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						cgccaccaccgtgcgctcccg	0.761										HNSCC(17;0.042)																											p.H193Q		.											.	KCTD8-92	0			c.C579G						.						2.0	2.0	2.0					4																	44449962		1063	2306	3369	SO:0001583	missense	386617	exon1			ACCACCGTGCGCT	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.579C>G	4.37:g.44449962G>C	ENSP00000353129:p.His193Gln	Somatic	4	1		WXS	Illumina HiSeq	Phase_I	3	2	NM_198353	0	0	0	0	0	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	G	2.286	-0.363634	0.05103	.	.	ENSG00000183783	ENST00000360029	T	0.36520	1.25	4.23	2.48	0.30137	.	1.393860	0.05249	U	0.513652	T	0.17577	0.0422	N	0.08118	0	0.09310	N	1	B	0.27625	0.183	B	0.09377	0.004	T	0.21109	-1.0255	10	0.15066	T	0.55	.	6.621	0.22802	0.3052:0.0:0.6948:0.0	.	193	Q6ZWB6	KCTD8_HUMAN	Q	193	ENSP00000353129:H193Q	ENSP00000353129:H193Q	H	-	3	2	KCTD8	44144719	0.000000	0.05858	0.021000	0.16686	0.174000	0.22865	-0.252000	0.08806	0.416000	0.25844	-0.203000	0.12734	CAC	.		0.761	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
TXK	7294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	48076056	48076056	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:48076056T>A	ENST00000264316.4	-	13	1338	c.1253A>T	c.(1252-1254)gAt>gTt	p.D418V	TXK_ENST00000507351.1_Missense_Mutation_p.D73V	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	418	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						GACATACTCATCATCCAAAAC	0.368																																					p.D418V		.											.	TXK-521	0			c.A1253T						.						100.0	97.0	98.0					4																	48076056		2203	4300	6503	SO:0001583	missense	7294	exon13			TACTCATCATCCA	L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.1253A>T	4.37:g.48076056T>A	ENSP00000264316:p.Asp418Val	Somatic	66	1		WXS	Illumina HiSeq	Phase_I	104	18	NM_003328	0	0	0	0	0	Q14220	Missense_Mutation	SNP	ENST00000264316.4	37	CCDS3480.1	.	.	.	.	.	.	.	.	.	.	T	17.41	3.382395	0.61845	.	.	ENSG00000074966	ENST00000264316;ENST00000507351	D;D	0.84146	-1.81;-1.81	5.64	5.64	0.86602	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.063498	0.64402	D	0.000008	D	0.91314	0.7261	M	0.67569	2.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	D	0.92105	0.5691	10	0.87932	D	0	.	15.1937	0.73067	0.0:0.0:0.0:1.0	.	105;418	B4DTB5;P42681	.;TXK_HUMAN	V	418;73	ENSP00000264316:D418V;ENSP00000423481:D73V	ENSP00000264316:D418V	D	-	2	0	TXK	47770813	1.000000	0.71417	1.000000	0.80357	0.262000	0.26303	7.868000	0.87116	2.367000	0.80283	0.528000	0.53228	GAT	.		0.368	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219869.7	NM_003328	
WDFY3	23001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	85781624	85781624	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:85781624G>A	ENST00000295888.4	-	4	528	c.121C>T	c.(121-123)Cac>Tac	p.H41Y	WDFY3_ENST00000322366.6_Missense_Mutation_p.H41Y	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	41					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGAGTCATGTGCCGGGGAGGA	0.577																																					p.H41Y		.											.	WDFY3-93	0			c.C121T						.						140.0	129.0	133.0					4																	85781624		2203	4300	6503	SO:0001583	missense	23001	exon4			TCATGTGCCGGGG	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.121C>T	4.37:g.85781624G>A	ENSP00000295888:p.His41Tyr	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	156	30	NM_014991	0	0	4	4	0	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238404	0.79800	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000509172	T;T	0.63744	-0.06;-0.06	5.72	5.72	0.89469	.	0.045076	0.85682	D	0.000000	T	0.43255	0.1239	N	0.08118	0	0.80722	D	1	D;D	0.52996	0.957;0.957	B;B	0.43575	0.402;0.424	T	0.48364	-0.9042	10	0.02654	T	1	.	19.8968	0.96969	0.0:0.0:1.0:0.0	.	41;41	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	Y	41	ENSP00000318466:H41Y;ENSP00000295888:H41Y	ENSP00000295888:H41Y	H	-	1	0	WDFY3	86000648	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.580000	0.98207	2.691000	0.91804	0.655000	0.94253	CAC	.		0.577	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
CENPE	1062	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	104117130	104117130	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:104117130G>A	ENST00000265148.3	-	4	393	c.304C>T	c.(304-306)Cat>Tat	p.H102Y	CENPE_ENST00000380026.3_Missense_Mutation_p.H102Y	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	102	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.H102Y(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ACTCCCAAATGATCTTCTGAA	0.348																																					p.H102Y													.	CENPE-277	1	Substitution - Missense(1)	skin(1)	c.C304T						.						111.0	105.0	107.0					4																	104117130		2203	4300	6503	SO:0001583	missense	1062	exon4			CCAAATGATCTTC	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.304C>T	4.37:g.104117130G>A	ENSP00000265148:p.His102Tyr	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	44	8	NM_001813	0	0	0	0	0	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	G	0.240	-1.014671	0.02095	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705;ENST00000514974	T;T;T;T	0.72725	-0.68;-0.68;-0.68;2.3	5.17	2.4	0.29515	Kinesin, motor domain (4);	.	.	.	.	T	0.48572	0.1507	N	0.25201	0.72	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32981	-0.9886	9	0.02654	T	1	.	7.6421	0.28300	0.7877:0.0:0.0778:0.1344	.	102;102	Q02224-3;Q02224	.;CENPE_HUMAN	Y	102	ENSP00000265148:H102Y;ENSP00000369365:H102Y;ENSP00000423981:H102Y;ENSP00000426023:H102Y	ENSP00000265148:H102Y	H	-	1	0	CENPE	104336579	0.071000	0.21146	0.997000	0.53966	0.978000	0.69477	1.290000	0.33319	0.817000	0.34445	-0.373000	0.07131	CAT	.		0.348	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ADAMTS19	171019	broad.mit.edu	37	5	128983499	128983499	+	Silent	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr5:128983499T>C	ENST00000274487.4	+	12	2041	c.1896T>C	c.(1894-1896)ccT>ccC	p.P632P	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	632	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CCTCAGCACCTGAACATCTGG	0.502																																					p.P632P													.	ADAMTS19-295	0			c.T1896C						.						149.0	147.0	147.0					5																	128983499		2203	4300	6503	SO:0001819	synonymous_variant	171019	exon12			AGCACCTGAACAT	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1896T>C	5.37:g.128983499T>C		Somatic	191	0		WXS	Illumina HiSeq	Phase_I	213	8	NM_133638	0	0	0	0	0		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																			.		0.502	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
RAD50	10111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	131976367	131976367	+	Silent	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr5:131976367T>C	ENST00000265335.6	+	24	4009	c.3622T>C	c.(3622-3624)Tta>Cta	p.L1208L	AC004041.2_ENST00000417516.1_RNA|AC004041.2_ENST00000457489.1_RNA|AC004041.2_ENST00000458509.1_RNA|AC004041.2_ENST00000435042.1_RNA|RAD50_ENST00000378823.3_Silent_p.L1069L			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1208	Ala/Asp-rich (DA-box).				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTTCCAGGTATTAGCCTCACT	0.498								Homologous recombination																													p.L1208L		.											.	RAD50-229	0			c.T3622C						.						168.0	156.0	160.0					5																	131976367		2203	4300	6503	SO:0001819	synonymous_variant	10111	exon24			CAGGTATTAGCCT	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3622T>C	5.37:g.131976367T>C		Somatic	186	0		WXS	Illumina HiSeq	Phase_I	177	36	NM_005732	0	0	0	0	0	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Silent	SNP	ENST00000265335.6	37	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	T	12.52	1.963735	0.34659	.	.	ENSG00000113522	ENST00000455677	.	.	.	5.94	1.0	0.19881	.	.	.	.	.	T	0.55226	0.1907	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	T	0.46275	-0.9203	4	.	.	.	-7.5964	8.3809	0.32470	0.0:0.5216:0.0:0.4784	.	.	.	.	T	86	.	.	I	+	2	0	RAD50	132004266	0.068000	0.21057	0.032000	0.17829	0.920000	0.55202	0.417000	0.21214	0.177000	0.19895	0.528000	0.53228	ATT	.		0.498	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
PCDHGA11	56105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140802438	140802438	+	Silent	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr5:140802438G>C	ENST00000398587.2	+	1	1677	c.1644G>C	c.(1642-1644)tcG>tcC	p.S548S	PCDHGA11_ENST00000518882.1_Silent_p.S548S|PCDHGA10_ENST00000398610.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	548	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAACGTGTCGCTGAGCCTGT	0.607																																					p.S548S		.											.	.	0			c.G1644C						.						151.0	172.0	165.0					5																	140802438		2203	4300	6503	SO:0001819	synonymous_variant	56105	exon1			CGTGTCGCTGAGC	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1644G>C	5.37:g.140802438G>C		Somatic	349	1		WXS	Illumina HiSeq	Phase_I	301	52	NM_032091	0	0	0	1	1	B7ZVY8|Q9Y5D8|Q9Y5D9	Silent	SNP	ENST00000398587.2	37	CCDS47294.1																																																																																			.		0.607	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
TRIM38	10475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	25967011	25967011	+	Silent	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr6:25967011G>C	ENST00000357085.3	+	3	737	c.261G>C	c.(259-261)acG>acC	p.T87T	TRIM38_ENST00000349458.3_Silent_p.T87T	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	87					negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.T87T(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						TCAAAGAGACGGATCAAGAAA	0.562																																					p.T87T		.											.	TRIM38-226	1	Substitution - coding silent(1)	lung(1)	c.G261C						.						61.0	58.0	59.0					6																	25967011		2203	4300	6503	SO:0001819	synonymous_variant	10475	exon3			AGAGACGGATCAA	U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.261G>C	6.37:g.25967011G>C		Somatic	54	0		WXS	Illumina HiSeq	Phase_I	54	17	NM_006355	0	0	50	78	28	B2R862	Silent	SNP	ENST00000357085.3	37	CCDS4568.1																																																																																			.		0.562	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040076.2		
ITPR3	3710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	33644599	33644599	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr6:33644599G>A	ENST00000374316.5	+	27	4397	c.3337G>A	c.(3337-3339)Gag>Aag	p.E1113K	ITPR3_ENST00000605930.1_Missense_Mutation_p.E1113K			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1113					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GATCAAGTCGGAGCTGGACCG	0.622																																					p.E1113K		.											.	ITPR3-1085	0			c.G3337A						.						93.0	80.0	85.0					6																	33644599		2203	4300	6503	SO:0001583	missense	3710	exon26			AAGTCGGAGCTGG	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.3337G>A	6.37:g.33644599G>A	ENSP00000363435:p.Glu1113Lys	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	67	19	NM_002224	0	0	35	61	26	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587672	0.86851	.	.	ENSG00000096433	ENST00000374316	D	0.91237	-2.81	5.22	5.22	0.72569	.	0.111019	0.64402	D	0.000010	D	0.85822	0.5786	L	0.44542	1.39	0.58432	D	0.999993	P	0.45594	0.862	B	0.41917	0.37	D	0.88575	0.3132	10	0.87932	D	0	-36.8399	18.8137	0.92070	0.0:0.0:1.0:0.0	.	1113	Q14573	ITPR3_HUMAN	K	1113	ENSP00000363435:E1113K	ENSP00000363435:E1113K	E	+	1	0	ITPR3	33752577	1.000000	0.71417	0.943000	0.38184	0.927000	0.56198	8.010000	0.88615	2.435000	0.82474	0.655000	0.94253	GAG	.		0.622	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
CPNE5	57699	broad.mit.edu;bcgsc.ca	37	6	36712081	36712081	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr6:36712081T>A	ENST00000244751.2	-	19	2077	c.1453A>T	c.(1453-1455)Atc>Ttc	p.I485F	CPNE5_ENST00000393189.2_Missense_Mutation_p.I193F|CPNE5_ENST00000459703.1_5'UTR	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	485	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						ACGATAATGATGGACATGGGG	0.607																																					p.I485F													.	CPNE5-91	0			c.A1453T						.						66.0	47.0	53.0					6																	36712081		2197	4296	6493	SO:0001583	missense	57699	exon19			TAATGATGGACAT	H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1453A>T	6.37:g.36712081T>A	ENSP00000244751:p.Ile485Phe	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	10	6	NM_020939	0	0	1	1	0	Q7Z6C8	Missense_Mutation	SNP	ENST00000244751.2	37	CCDS4825.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.847684	0.91277	.	.	ENSG00000124772	ENST00000244751;ENST00000393189	T;T	0.35421	1.31;1.31	5.19	5.19	0.71726	von Willebrand factor, type A (2);Copine (1);	0.104258	0.64402	D	0.000006	T	0.68613	0.3020	H	0.98612	4.28	0.80722	D	1	D	0.67145	0.996	D	0.72625	0.978	T	0.81645	-0.0839	10	0.87932	D	0	.	13.0484	0.58939	0.0:0.0:0.0:1.0	.	485	Q9HCH3	CPNE5_HUMAN	F	485;193	ENSP00000244751:I485F;ENSP00000376885:I193F	ENSP00000244751:I485F	I	-	1	0	CPNE5	36820059	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.693000	0.84214	1.983000	0.57843	0.369000	0.22263	ATC	.		0.607	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939	
DOPEY1	23033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	83839062	83839062	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr6:83839062C>A	ENST00000349129.2	+	16	2436	c.2176C>A	c.(2176-2178)Caa>Aaa	p.Q726K	DOPEY1_ENST00000237163.5_Missense_Mutation_p.Q707K|DOPEY1_ENST00000369739.3_Missense_Mutation_p.Q717K	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	726					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CAGAAATTCACAAGGAGATGT	0.398																																					p.Q726K		.											.	DOPEY1-155	0			c.C2176A						.						78.0	77.0	78.0					6																	83839062		2203	4300	6503	SO:0001583	missense	23033	exon16			AATTCACAAGGAG	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.2176C>A	6.37:g.83839062C>A	ENSP00000195654:p.Gln726Lys	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	85	16	NM_015018	0	0	4	5	1	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151734	0.38021	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.21734	1.99;1.99	5.68	5.68	0.88126	.	0.594531	0.18093	N	0.151930	T	0.15392	0.0371	L	0.57536	1.79	0.80722	D	1	B;B;B	0.15473	0.004;0.013;0.004	B;B;B	0.13407	0.006;0.009;0.006	T	0.02610	-1.1134	10	0.32370	T	0.25	.	19.7974	0.96491	0.0:1.0:0.0:0.0	.	617;717;726	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	K	726;707;707	ENSP00000195654:Q726K;ENSP00000237163:Q707K	ENSP00000237163:Q707K	Q	+	1	0	DOPEY1	83895781	0.879000	0.30193	0.997000	0.53966	0.964000	0.63967	3.092000	0.50207	2.673000	0.90976	0.650000	0.86243	CAA	.		0.398	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
FAM120B	84498	hgsc.bcm.edu;bcgsc.ca	37	6	170700175	170700175	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr6:170700175C>G	ENST00000476287.1	+	8	2673	c.2565C>G	c.(2563-2565)atC>atG	p.I855M	FAM120B_ENST00000537664.1_Missense_Mutation_p.I878M|FAM120B_ENST00000540480.1_Missense_Mutation_p.I867M|FAM120B_ENST00000252510.9_Missense_Mutation_p.I187M	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	855					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		ACAGACGCATCACTGGCCGAG	0.562																																					p.I855M		.											.	FAM120B-91	0			c.C2565G						.						72.0	62.0	65.0					6																	170700175		2203	4300	6503	SO:0001583	missense	84498	exon8			ACGCATCACTGGC	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.2565C>G	6.37:g.170700175C>G	ENSP00000417970:p.Ile855Met	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	58	4	NM_032448	0	0	37	37	0	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	37	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.500782	0.26861	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287;ENST00000252510	T;T;T	0.09723	2.96;2.95;2.97	5.5	-3.03	0.05429	.	0.167917	0.40469	N	0.001099	T	0.06371	0.0164	L	0.27053	0.805	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.71656	0.967;0.974	T	0.22382	-1.0218	10	0.56958	D	0.05	-19.2842	7.8011	0.29174	0.1064:0.3727:0.0:0.5209	.	855;855	Q96EK7;F2Z2E1	F120B_HUMAN;.	M	867;878;855;187	ENSP00000444125:I867M;ENSP00000440125:I878M;ENSP00000417970:I855M	ENSP00000252510:I187M	I	+	3	3	FAM120B	170542100	0.002000	0.14202	0.000000	0.03702	0.051000	0.14879	-0.226000	0.09139	-0.631000	0.05560	0.655000	0.94253	ATC	.		0.562	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
OGDH	4967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44685022	44685022	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr7:44685022G>T	ENST00000222673.5	+	3	361	c.319G>T	c.(319-321)Gtg>Ttg	p.V107L	OGDH_ENST00000444676.1_Missense_Mutation_p.V107L|OGDH_ENST00000443864.2_Missense_Mutation_p.V107L|OGDH_ENST00000439616.2_Intron|OGDH_ENST00000543843.1_Missense_Mutation_p.V47L|OGDH_ENST00000447398.1_Missense_Mutation_p.V107L|OGDH_ENST00000449767.1_Missense_Mutation_p.V107L	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	107					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	CCTGGCTGCTGTGGCCCATGC	0.597																																					p.V107L		.											.	OGDH-228	0			c.G319T						.						85.0	83.0	83.0					7																	44685022		2203	4300	6503	SO:0001583	missense	4967	exon3			GCTGCTGTGGCCC	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.319G>T	7.37:g.44685022G>T	ENSP00000222673:p.Val107Leu	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	169	35	NM_001165036	0	0	95	128	33	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	ENST00000222673.5	37	CCDS34627.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.775197	0.31411	.	.	ENSG00000105953	ENST00000443864;ENST00000449767;ENST00000447398;ENST00000419661;ENST00000444676;ENST00000222673;ENST00000543843	T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.81	-4.96	0.03038	.	1.033080	0.07585	N	0.921017	T	0.10680	0.0261	N	0.02181	-0.65	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.0;0.001	T	0.27054	-1.0085	10	0.05620	T	0.96	-2.8184	1.8649	0.03196	0.4868:0.1815:0.1602:0.1715	.	107;107;107;107	E9PBM1;E9PDF2;Q02218;Q96DD3	.;.;ODO1_HUMAN;.	L	107;107;107;107;107;107;47	ENSP00000388084:V107L;ENSP00000392878:V107L;ENSP00000388183:V107L;ENSP00000411830:V107L;ENSP00000414662:V107L;ENSP00000222673:V107L;ENSP00000443821:V47L	ENSP00000222673:V107L	V	+	1	0	OGDH	44651547	0.003000	0.15002	0.000000	0.03702	0.974000	0.67602	0.473000	0.22132	-0.618000	0.05656	0.655000	0.94253	GTG	.		0.597	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
POM121	9883	ucsc.edu	37	7	72420466	72420466	+	3'UTR	SNP	C	C	T	rs534576722		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr7:72420466C>T	ENST00000395270.1	+	0	5498				NSUN5P2_ENST00000388955.4_RNA	NM_001257190.1	NP_001244119.1	Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.R41H(1)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				GGGAGCCTGGCGGGGGTCCAG	0.622																																					.													.	NSUN5P2-90	1	Substitution - Missense(1)	endometrium(1)	.						.						34.0	39.0	37.0					7																	72420466		2201	4300	6501	SO:0001624	3_prime_UTR_variant	260294	.			GCCTGGCGGGGGT	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000395270.1:c.*1457C>T	7.37:g.72420466C>T		Somatic	83	1		WXS	Illumina HiSeq		86	2	.	0	0	9	18	9	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	RNA	SNP	ENST00000395270.1	37	CCDS59059.1																																																																																			.		0.622	POM121-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252020.1		
MET	4233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116423407	116423407	+	Missense_Mutation	SNP	G	G	C	rs121913671		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr7:116423407G>C	ENST00000318493.6	+	19	3923	c.3736G>C	c.(3736-3738)Gac>Cac	p.D1246H	MET_ENST00000397752.3_Missense_Mutation_p.D1228H|MET_ENST00000539704.1_Missense_Mutation_p.D98H			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D1246H(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TCTTGCCAGAGACATGTATGA	0.378			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.D1246H		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	1	Substitution - Missense(1)	kidney(1)	c.G3736C	GRCh37	CM970946	MET	M	rs121913671	.						106.0	99.0	102.0					7																	116423407		1841	4093	5934	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GCCAGAGACATGT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3736G>C	7.37:g.116423407G>C	ENSP00000317272:p.Asp1246His	Somatic	67	1		WXS	Illumina HiSeq	Phase_I	101	30	NM_001127500	0	0	132	323	191	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285616	0.80803	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	D;D;D	0.83837	-1.77;-1.77;-1.77	5.46	5.46	0.80206	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91327	0.7265	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91745	0.5407	10	0.87932	D	0	.	19.6667	0.95895	0.0:0.0:1.0:0.0	.	1246;1228	P08581-2;P08581	.;MET_HUMAN	H	1228;1246;98	ENSP00000380860:D1228H;ENSP00000317272:D1246H;ENSP00000445020:D98H	ENSP00000317272:D1246H	D	+	1	0	MET	116210643	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.813000	0.99286	2.721000	0.93114	0.563000	0.77884	GAC	.		0.378	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
HR	55806	broad.mit.edu	37	8	21984840	21984840	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr8:21984840G>A	ENST00000381418.4	-	3	2595	c.1115C>T	c.(1114-1116)cCc>cTc	p.P372L	HR_ENST00000312841.8_Missense_Mutation_p.P372L	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	372					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		GTGGCTGGGGGGACAGGCCCT	0.657																																					p.P372L													.	HR-154	0			c.C1115T						.						110.0	125.0	120.0					8																	21984840		2203	4300	6503	SO:0001583	missense	55806	exon3			CTGGGGGGACAGG	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.1115C>T	8.37:g.21984840G>A	ENSP00000370826:p.Pro372Leu	Somatic	348	0		WXS	Illumina HiSeq	Phase_I	325	8	NM_018411	0	0	0	0	0	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	ENST00000381418.4	37	CCDS6022.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528779	0.27387	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.72167	-0.63;-0.63	6.04	3.02	0.34903	.	0.358324	0.24245	N	0.040228	T	0.50034	0.1592	N	0.16656	0.425	0.43729	D	0.99621	B;B	0.17038	0.02;0.012	B;B	0.16722	0.016;0.007	T	0.26155	-1.0111	10	0.31617	T	0.26	-2.4697	6.8335	0.23923	0.3373:0.0:0.6627:0.0	.	372;372	O43593-2;O43593	.;HAIR_HUMAN	L	372	ENSP00000370826:P372L;ENSP00000326765:P372L	ENSP00000326765:P372L	P	-	2	0	HR	22040785	0.079000	0.21365	0.908000	0.35775	0.600000	0.36913	0.167000	0.16602	0.304000	0.22809	0.563000	0.77884	CCC	.		0.657	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1		
NEFL	4747	ucsc.edu	37	8	24813289	24813289	+	RNA	SNP	C	C	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr8:24813289C>T	ENST00000221169.5	-	0	1335				CTD-2168K21.2_ENST00000607735.1_RNA			P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TGGTCACGTCCATCTCCACGG	0.567																																					p.M247I													.	NEFL-24	0			c.G741A						.						49.0	54.0	52.0					8																	24813289		2151	4251	6402			4747	exon1			CACGTCCATCTCC		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24813289C>T		Somatic	31	0		WXS	Illumina HiSeq		34	4	NM_006158	0	0	21	21	0	B9ZVN2|Q16154|Q8IU72	Missense_Mutation	SNP	ENST00000221169.5	37																																																																																				.		0.567	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158	
ADAM32	203102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	39044454	39044454	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr8:39044454A>G	ENST00000379907.4	+	11	1069	c.942A>G	c.(940-942)gcA>gcG	p.A314A	ADAM32_ENST00000519315.1_Intron|ADAM32_ENST00000437682.2_Intron	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	314	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			CTCTGGAGGCATTTGCAGTTA	0.358																																					p.A314A		.											.	ADAM32-227	0			c.A942G						.						79.0	76.0	77.0					8																	39044454		1814	4076	5890	SO:0001819	synonymous_variant	203102	exon11			GGAGGCATTTGCA	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.942A>G	8.37:g.39044454A>G		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	139	34	NM_145004	0	0	0	0	0	Q8TC42	Silent	SNP	ENST00000379907.4	37	CCDS47846.1																																																																																			.		0.358	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
OSGIN2	734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	90936955	90936955	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr8:90936955G>C	ENST00000297438.2	+	6	1068	c.713G>C	c.(712-714)aGg>aCg	p.R238T	OSGIN2_ENST00000451899.2_Missense_Mutation_p.R282T	NM_004337.2	NP_004328.1	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family member 2	238					meiotic nuclear division (GO:0007126)					breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(1)	17			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TGGGAAATTAGGGGTTATCAG	0.418																																					p.R282T		.											.	OSGIN2-68	0			c.G845C						.						75.0	77.0	76.0					8																	90936955		2203	4300	6503	SO:0001583	missense	734	exon6			AAATTAGGGGTTA	AF061326	CCDS6248.1, CCDS47888.1	8q21	2006-10-05	2006-10-05	2006-10-05	ENSG00000164823	ENSG00000164823			1355	protein-coding gene	gene with protein product		604598	"""chromosome 8 open reading frame 1"""	C8orf1		9933573	Standard	NM_004337		Approved	hT41	uc003yeh.3	Q9Y236	OTTHUMG00000163811	ENST00000297438.2:c.713G>C	8.37:g.90936955G>C	ENSP00000297438:p.Arg238Thr	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	95	30	NM_001126111	0	1	10	23	12		Missense_Mutation	SNP	ENST00000297438.2	37	CCDS6248.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436313	0.25813	.	.	ENSG00000164823	ENST00000297438;ENST00000451899	T;T	0.22539	1.95;1.95	5.25	5.25	0.73442	.	0.041552	0.85682	D	0.000000	T	0.16769	0.0403	L	0.43152	1.355	0.80722	D	1	B;B	0.31077	0.307;0.163	B;B	0.26416	0.069;0.068	T	0.05209	-1.0899	10	0.17832	T	0.49	-3.8246	12.2313	0.54490	0.0783:0.0:0.9217:0.0	.	282;238	Q9Y236-2;Q9Y236	.;OSGI2_HUMAN	T	238;282	ENSP00000297438:R238T;ENSP00000396445:R282T	ENSP00000297438:R238T	R	+	2	0	OSGIN2	91006130	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.061000	0.89467	2.461000	0.83175	0.555000	0.69702	AGG	.		0.418	OSGIN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375691.1	NM_004337	
SLC2A8	29988	broad.mit.edu;bcgsc.ca	37	9	130160364	130160364	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr9:130160364T>A	ENST00000373371.3	+	3	489	c.400T>A	c.(400-402)Tgc>Agc	p.C134S	SLC2A8_ENST00000373360.3_Missense_Mutation_p.C134S|SLC2A8_ENST00000373352.1_Intron	NM_001271712.1|NM_014580.3	NP_001258641.1|NP_055395.2	Q9NY64	GTR8_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 8	134					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|male meiosis I (GO:0007141)|response to hypoxia (GO:0001666)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	glucose binding (GO:0005536)|glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	11						CGGCCTGGCCTGCGGTGTTGC	0.697																																					p.C134S													.	SLC2A8-92	0			c.T400A						.						8.0	10.0	9.0					9																	130160364		2148	4227	6375	SO:0001583	missense	29988	exon3			CTGGCCTGCGGTG	AJ245937	CCDS6870.1, CCDS65138.1, CCDS75903.1	9q33.3	2013-05-22	2008-09-02		ENSG00000136856	ENSG00000136856		"""Solute carriers"""	13812	protein-coding gene	gene with protein product		605245	"""solute carrier family 2 (facilitated glucose transporter) member 8"""			10671487, 10821868	Standard	NM_014580		Approved	GLUTX1, GLUT8	uc004bqu.4	Q9NY64	OTTHUMG00000020702	ENST00000373371.3:c.400T>A	9.37:g.130160364T>A	ENSP00000362469:p.Cys134Ser	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	24	8	NM_014580	0	0	11	14	3	Q8WUZ9|Q9NSC4	Missense_Mutation	SNP	ENST00000373371.3	37	CCDS6870.1	.	.	.	.	.	.	.	.	.	.	T	11.12	1.544394	0.27563	.	.	ENSG00000136856	ENST00000373371;ENST00000373360	T;T	0.74526	-0.85;-0.85	5.24	2.51	0.30379	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.079753	0.85682	D	0.000000	T	0.43567	0.1253	N	0.02296	-0.605	0.34103	D	0.662034	B;B	0.22276	0.067;0.02	B;B	0.23716	0.048;0.006	T	0.48328	-0.9045	10	0.32370	T	0.25	.	4.8407	0.13489	0.401:0.0:0.1361:0.463	.	134;134	Q5VVV9;Q9NY64	.;GTR8_HUMAN	S	134	ENSP00000362469:C134S;ENSP00000362458:C134S	ENSP00000362458:C134S	C	+	1	0	SLC2A8	129200185	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.375000	0.52410	1.990000	0.58119	0.528000	0.53228	TGC	.		0.697	SLC2A8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054177.1	NM_014580	
VSIG4	11326	ucsc.edu	37	X	65244923	65244923	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chrX:65244923C>T	ENST00000374737.4	-	6	992	c.884G>A	c.(883-885)tGt>tAt	p.C295Y	VSIG4_ENST00000455586.2_Missense_Mutation_p.C295Y|VSIG4_ENST00000412866.2_Missense_Mutation_p.C201Y	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	295					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AACCACCATACAGCACAAGGA	0.423																																					p.C295Y													.	VSIG4-130	0			c.G884A						.						125.0	89.0	101.0					X																	65244923		2203	4300	6503	SO:0001583	missense	11326	exon6			ACCATACAGCACA	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.884G>A	X.37:g.65244923C>T	ENSP00000363869:p.Cys295Tyr	Somatic	13	0		WXS	Illumina HiSeq		16	4	NM_001257403	0	0	160	160	0	Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	37	CCDS14383.1	.	.	.	.	.	.	.	.	.	.	C	8.447	0.852121	0.17034	.	.	ENSG00000155659	ENST00000374737;ENST00000455586;ENST00000412866	T;T;T	0.33654	1.54;1.4;1.81	4.29	1.42	0.22433	.	0.346876	0.24755	N	0.035868	T	0.49150	0.1540	M	0.72894	2.215	0.09310	N	1	B;D;D;D;D	0.76494	0.031;0.994;0.995;0.999;0.996	B;P;D;D;P	0.85130	0.01;0.904;0.986;0.997;0.804	T	0.33007	-0.9885	10	0.87932	D	0	-4.7028	1.7676	0.03005	0.2098:0.4659:0.2011:0.1232	.	201;295;285;201;295	C9J1L3;Q9Y279-2;C9JH67;Q9Y279-3;Q9Y279	.;.;.;.;VSIG4_HUMAN	Y	295;295;201	ENSP00000363869:C295Y;ENSP00000411581:C295Y;ENSP00000394143:C201Y	ENSP00000363869:C295Y	C	-	2	0	VSIG4	65161648	0.353000	0.24904	0.032000	0.17829	0.007000	0.05969	0.388000	0.20735	0.827000	0.34685	-0.191000	0.12829	TGT	.		0.423	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268	
THOC2	57187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	122770007	122770007	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chrX:122770007A>G	ENST00000245838.8	-	19	1972	c.1941T>C	c.(1939-1941)ggT>ggC	p.G647G	THOC2_ENST00000491737.1_Silent_p.G532G|THOC2_ENST00000355725.4_Silent_p.G647G	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	647					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						GAAAAACTGCACCACAGAAAC	0.323																																					p.G647G		.											.	THOC2-133	0			c.T1941C						.						99.0	82.0	88.0					X																	122770007		1821	4069	5890	SO:0001819	synonymous_variant	57187	exon19			AACTGCACCACAG	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.1941T>C	X.37:g.122770007A>G		Somatic	59	1		WXS	Illumina HiSeq	Phase_I	72	36	NM_001081550	0	0	1	12	11	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Silent	SNP	ENST00000245838.8	37	CCDS43988.1																																																																																			.		0.323	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
ZNF275	10838	ucsc.edu	37	X	152613054	152613054	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chrX:152613054G>A	ENST00000421401.3	+	4	1088	c.911G>A	c.(910-912)aGg>aAg	p.R304K	ZNF275_ENST00000370251.3_Missense_Mutation_p.R304K|ZNF275_ENST00000440091.1_Missense_Mutation_p.R334K|ZNF275_ENST00000370249.2_Missense_Mutation_p.R251K			Q9NSD4	ZN275_HUMAN	zinc finger protein 275	304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTCTTCCGAAGGAGCTCGGAG	0.682																																					p.R304K													.	ZNF275-109	0			c.G911A						.						17.0	19.0	18.0					X																	152613054		2195	4290	6485	SO:0001583	missense	10838	exon4			TCCGAAGGAGCTC	BC041602		Xq28	2013-01-08			ENSG00000063587	ENSG00000063587		"""Zinc fingers, C2H2-type"", ""-"""	13069	protein-coding gene	gene with protein product							Standard	NM_001080485		Approved		uc004fhg.2	Q9NSD4	OTTHUMG00000067450	ENST00000421401.3:c.911G>A	X.37:g.152613054G>A	ENSP00000398977:p.Arg304Lys	Somatic	14	0		WXS	Illumina HiSeq		7	2	NM_001080485	0	0	1	6	5	A6NE92	Missense_Mutation	SNP	ENST00000421401.3	37		.	.	.	.	.	.	.	.	.	.	G	14.74	2.624733	0.46840	.	.	ENSG00000063587	ENST00000370251;ENST00000421401;ENST00000440091;ENST00000370249	T;T;T;T	0.57107	0.42;3.2;3.2;3.2	4.49	4.49	0.54785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.31051	N	0.008343	T	0.42017	0.1184	L	0.46614	1.455	0.09310	N	1	B;B	0.26635	0.036;0.155	B;B	0.25759	0.017;0.063	T	0.27191	-1.0081	10	0.36615	T	0.2	-33.123	7.5945	0.28039	0.1167:0.0:0.8833:0.0	.	304;304	Q9NSD4;A6NFS0	ZN275_HUMAN;.	K	304;304;334;251	ENSP00000359271:R304K;ENSP00000398977:R304K;ENSP00000411097:R334K;ENSP00000359269:R251K	ENSP00000359269:R251K	R	+	2	0	ZNF275	152266248	0.000000	0.05858	0.488000	0.27440	0.300000	0.27592	0.263000	0.18478	2.218000	0.71995	0.436000	0.28706	AGG	.		0.682	ZNF275-201	KNOWN	basic	protein_coding	protein_coding		NM_001080485	
THRAP3	9967	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	36767245	36767245	+	Frame_Shift_Del	DEL	G	G	-	rs566092059		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:36767245delG	ENST00000354618.5	+	11	2818	c.2594delG	c.(2593-2595)cggfs	p.R865fs	THRAP3_ENST00000469141.2_Frame_Shift_Del_p.R865fs	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	865	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AAAAGAAACCGGGAAGAGGAG	0.478			T	USP6	aneurysmal bone cysts																																p.R865fs	Pancreas(129;785 1795 20938 23278 32581)	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	THRAP3-663	0			c.2594delG						.						66.0	68.0	67.0					1																	36767245		2203	4300	6503	SO:0001589	frameshift_variant	9967	exon11			.	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.2594delG	1.37:g.36767245delG	ENSP00000346634:p.Arg865fs	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	78	21	NM_005119	0	0	0	0	0	D3DPS5|Q5VTK6	Frame_Shift_Del	DEL	ENST00000354618.5	37	CCDS405.1																																																																																			.		0.478	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
DNAJC1	64215	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	22171214	22171214	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr10:22171214delT	ENST00000376980.3	-	8	1265	c.975delA	c.(973-975)aaafs	p.K325fs		NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	325	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				TATTTACCTGTTTTTTCTGTG	0.323																																					p.K325fs		.											.	DNAJC1-226	0			c.975delA						.						142.0	132.0	135.0					10																	22171214		2202	4300	6502	SO:0001589	frameshift_variant	64215	exon8			.	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.975delA	10.37:g.22171214delT	ENSP00000366179:p.Lys325fs	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	77	16	NM_022365	0	0	0	0	0	B0YIZ8|Q5VX89|Q9H6B8	Frame_Shift_Del	DEL	ENST00000376980.3	37	CCDS7136.1																																																																																			.		0.323	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047149.1	NM_022365	
PHLDB1	23187	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	118516164	118516164	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:118516164delA	ENST00000361417.2	+	17	3623	c.3212delA	c.(3211-3213)cacfs	p.H1071fs	PHLDB1_ENST00000524713.1_Frame_Shift_Del_p.H214fs|PHLDB1_ENST00000527898.1_Frame_Shift_Del_p.H122fs|PHLDB1_ENST00000356063.5_Frame_Shift_Del_p.H1024fs|PHLDB1_ENST00000534672.1_3'UTR	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1071										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GATGCCCTTCACGGGGCAGCA	0.652																																					p.H1071fs		.											.	PHLDB1-90	0			c.3212delA						.						42.0	51.0	48.0					11																	118516164		2200	4295	6495	SO:0001589	frameshift_variant	23187	exon16			.		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3212delA	11.37:g.118516164delA	ENSP00000354498:p.His1071fs	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	92	27	NM_001144758	0	0	0	0	0	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Frame_Shift_Del	DEL	ENST00000361417.2	37	CCDS8401.1																																																																																			.		0.652	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
PHLDB1	23187	hgsc.bcm.edu	37	11	118516168	118516168	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:118516168delG	ENST00000361417.2	+	17	3627	c.3216delG	c.(3214-3216)gggfs	p.G1072fs	PHLDB1_ENST00000524713.1_Frame_Shift_Del_p.G215fs|PHLDB1_ENST00000527898.1_Frame_Shift_Del_p.G123fs|PHLDB1_ENST00000356063.5_Frame_Shift_Del_p.G1025fs|PHLDB1_ENST00000534672.1_3'UTR	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1072										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCCTTCACGGGGCAGCACCCT	0.657																																					p.G1072fs		.											.	PHLDB1-90	0			c.3216delG						.						44.0	53.0	50.0					11																	118516168		2200	4295	6495	SO:0001589	frameshift_variant	23187	exon16			.		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3216delG	11.37:g.118516168delG	ENSP00000354498:p.Gly1072fs	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	90	19	NM_001144758	0	0	0	0	0	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Frame_Shift_Del	DEL	ENST00000361417.2	37	CCDS8401.1																																																																																			.		0.657	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
HEATR3	55027	bcgsc.ca	37	16	50112873	50112889	+	Frame_Shift_Del	DEL	GGAATTTCTCATAAAAG	GGAATTTCTCATAAAAG	-	rs11645775		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	GGAATTTCTCATAAAAG	GGAATTTCTCATAAAAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr16:50112873_50112889delGGAATTTCTCATAAAAG	ENST00000299192.7	+	7	1176_1192	c.985_1001delGGAATTTCTCATAAAAG	c.(985-1002)ggaatttctcataaaagafs	p.GISHKR329fs	HEATR3_ENST00000285767.4_Frame_Shift_Del_p.GISHKR243fs	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	329										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						TGAAATGGAAGGAATTTCTCATAAAAGAAGAGTCAGA	0.369																																					p.329_334del													.	HEATR3-92	0			c.985_1001del						.																																			SO:0001589	frameshift_variant	55027	exon7			ATGGAAGGAATTT	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.985_1001delGGAATTTCTCATAAAAG	16.37:g.50112873_50112889delGGAATTTCTCATAAAAG	ENSP00000299192:p.Gly329fs	Somatic	68	0		WXS	Illumina HiSeq	Phase_1	72	6	NM_182922	0	0	0	0	0	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Frame_Shift_Del	DEL	ENST00000299192.7	37	CCDS10739.1																																																																																			.		0.369	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	
NR3C2	4306	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	149357285	149357285	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:149357285delT	ENST00000358102.3	-	2	1090	c.728delA	c.(727-729)aatfs	p.N243fs	NR3C2_ENST00000512865.1_Frame_Shift_Del_p.N243fs|NR3C2_ENST00000511528.1_Frame_Shift_Del_p.N243fs|NR3C2_ENST00000344721.4_Frame_Shift_Del_p.N243fs|NR3C2_ENST00000355292.3_Frame_Shift_Del_p.N243fs	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	243	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	GGAGCCTCGATTTTCAACATT	0.527																																					p.N243fs	Melanoma(27;428 957 40335 51025 51111)	.											.	NR3C2-154	0			c.728delA						.						74.0	76.0	75.0					4																	149357285		2203	4300	6503	SO:0001589	frameshift_variant	4306	exon2			.	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.728delA	4.37:g.149357285delT	ENSP00000350815:p.Asn243fs	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	149	46	NM_001166104	0	0	0	0	0	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Frame_Shift_Del	DEL	ENST00000358102.3	37	CCDS3772.1																																																																																			.		0.527	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
PTCHD3	374308	broad.mit.edu;bcgsc.ca	37	10	27687672	27687673	+	In_Frame_Ins	INS	-	-	GTATAT			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr10:27687672_27687673insGTATAT	ENST00000438700.3	-	4	1971_1972	c.1854_1855insATATAC	c.(1852-1857)tatggg>tatATATACggg	p.617_618insYI		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	617					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TGGAAACACCCATATATACTGC	0.361																																					p.G619delinsIYG													.	PTCHD3-94	0			c.1855_1856insATATAC						.																																			SO:0001652	inframe_insertion	374308	exon4			AACACCCATATAT	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1854_1855insATATAC	10.37:g.27687672_27687673insGTATAT	ENSP00000417658:p.Ile617_Tyr618insTyrIle	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	102	12	NM_001034842	0	0	0	0	0	I3L499|Q6ZU28	In_Frame_Ins	INS	ENST00000438700.3	37	CCDS31173.1																																																																																			.		0.361	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
H2AFJ	55766	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	14927683	14927684	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:14927683_14927684insT	ENST00000544848.1	+	1	414_415	c.279_280insT	c.(280-282)ttafs	p.L94fs		NM_177925.2	NP_808760.1	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	94						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E93D(1)		NS(1)|central_nervous_system(1)|kidney(1)|ovary(1)|skin(1)	5						ACGACGAGGAGTTAAACAAGCT	0.614																																					p.E93fs		.											.	H2AFJ-69	1	Substitution - Missense(1)	ovary(1)	c.279_280insT						.																																			SO:0001589	frameshift_variant	55766	exon1			.	AK001765	CCDS31752.1	12p12.3	2012-09-11			ENSG00000246705	ENSG00000246705		"""Histones / Replication-independent"""	14456	protein-coding gene	gene with protein product							Standard	NM_177925		Approved	FLJ10903, MGC921	uc009zia.3	Q9BTM1	OTTHUMG00000168736	ENST00000544848.1:c.281dupT	12.37:g.14927685_14927685dupT	ENSP00000438553:p.Leu94fs	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	159	58	NM_177925	0	0	0	0	0	Q9NV63	Frame_Shift_Ins	INS	ENST00000544848.1	37	CCDS31752.1																																																																																			.		0.614	H2AFJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400845.1	NM_177925	
CAMK1	8536	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	9800959	9800960	+	Intron	INS	-	-	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:9800959_9800960insT	ENST00000256460.3	-	10	1090				OGG1_ENST00000383826.5_Intron|OGG1_ENST00000302008.8_Frame_Shift_Ins_p.R347fs|OGG1_ENST00000349503.5_Intron|OGG1_ENST00000449570.2_3'UTR|OGG1_ENST00000302036.7_Intron	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I						cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		ACTTCTTCCTCTAGACTTGGAG	0.46																																					p.S346fs		.											.	OGG1-660	0			c.1037_1038insT						.																																			SO:0001627	intron_variant	4968	exon7			.	L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.912+211->A	3.37:g.9800960_9800960dupT		Somatic	172	0		WXS	Illumina HiSeq	Phase_I	157	32	NM_016828	0	0	0	0	0	Q3KPF6	Frame_Shift_Ins	INS	ENST00000256460.3	37	CCDS2582.1																																																																																			.		0.460	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1	NM_003656	
MAML1	9794	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	179193559	179193560	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr5:179193559_179193560insC	ENST00000292599.3	+	2	1811_1812	c.1548_1549insC	c.(1549-1551)cccfs	p.P517fs	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAATACAAAACCCCTTTCTCA	0.559																																					p.K516fs		.											.	MAML1-848	0			c.1548_1549insC						.																																			SO:0001589	frameshift_variant	9794	exon2			.	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1552dupC	5.37:g.179193563_179193563dupC	ENSP00000292599:p.Pro517fs	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	80	19	NM_014757	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000292599.3	37	CCDS34315.1																																																																																			.		0.559	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
TBC1D9B	23061	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	179318454	179318455	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr5:179318454_179318455insA	ENST00000356834.3	-	6	1005_1006	c.968_969insT	c.(967-969)atgfs	p.M323fs	TBC1D9B_ENST00000355235.3_Frame_Shift_Ins_p.M323fs	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	323	GRAM 2.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGAGATGAACATCTGGCCAGG	0.599																																					p.M323fs		.											.	TBC1D9B-154	0			c.969_970insT						.																																			SO:0001589	frameshift_variant	23061	exon6			.	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.969dupT	5.37:g.179318455_179318455dupA	ENSP00000349291:p.Met323fs	Somatic	184	0		WXS	Illumina HiSeq	Phase_I	176	41	NM_198868	0	0	0	0	0	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Frame_Shift_Ins	INS	ENST00000356834.3	37	CCDS43408.1																																																																																			.		0.599	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
KLHL7	55975	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	23163475	23163476	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr7:23163475_23163476insT	ENST00000339077.5	+	2	443_444	c.200_201insT	c.(199-204)cattttfs	p.HF67fs	KLHL7_ENST00000545771.1_Frame_Shift_Ins_p.HF45fs|KLHL7_ENST00000322275.5_Frame_Shift_Ins_p.HF67fs|KLHL7_ENST00000545443.1_Frame_Shift_Ins_p.HF45fs|KLHL7_ENST00000410047.1_Frame_Shift_Ins_p.HF45fs|KLHL7_ENST00000322231.7_Frame_Shift_Ins_p.HF45fs|KLHL7_ENST00000539124.1_Intron|KLHL7_ENST00000542558.1_Intron|KLHL7_ENST00000479288.1_Intron|KLHL7_ENST00000409689.1_Frame_Shift_Ins_p.HF19fs	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	67	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GCAGCCAGTCATTTTTTTAACT	0.332																																					p.H67fs		.											.	KLHL7-90	0			c.200_201insT						.																																			SO:0001589	frameshift_variant	55975	exon2			.		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.207dupT	7.37:g.23163482_23163482dupT	ENSP00000343273:p.His67fs	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	94	30	NM_001172428	0	0	0	0	0	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Frame_Shift_Ins	INS	ENST00000339077.5	37	CCDS34609.1																																																																																			.		0.332	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
MCPH1	79648	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	6335132	6335133	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr8:6335132_6335133insA	ENST00000344683.5	+	10	2029_2030	c.1953_1954insA	c.(1954-1956)atgfs	p.M652fs		NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	652	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		GAACATTAGTCATGACAAGCAT	0.317																																					p.V651fs	Colon(95;1448 1467 8277 34473 35819)	.											.	MCPH1-229	0			c.1953_1954insA						.																																			SO:0001589	frameshift_variant	79648	exon10			.	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1954dupA	8.37:g.6335133_6335133dupA	ENSP00000342924:p.Met652fs	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	281	77	NM_024596	0	0	0	0	0	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Frame_Shift_Ins	INS	ENST00000344683.5	37	CCDS43689.1																																																																																			.		0.317	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
GSN	2934	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	124089637	124089638	+	Frame_Shift_Ins	INS	-	-	C	rs376326631		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr9:124089637_124089638insC	ENST00000373818.4	+	13	1861_1862	c.1792_1793insC	c.(1792-1794)accfs	p.T598fs	GSN_ENST00000373823.3_Frame_Shift_Ins_p.T547fs|GSN_ENST00000412819.1_Frame_Shift_Ins_p.T547fs|GSN_ENST00000373806.1_Frame_Shift_Ins_p.T23fs|GSN_ENST00000373807.1_Frame_Shift_Ins_p.T329fs|GSN_ENST00000436847.1_Frame_Shift_Ins_p.T558fs|GSN_ENST00000373808.2_Frame_Shift_Ins_p.T547fs|GSN_ENST00000394353.2_Frame_Shift_Ins_p.T558fs|GSN_ENST00000545652.1_Frame_Shift_Ins_p.T555fs|GSN_ENST00000341272.2_Frame_Shift_Ins_p.T547fs|GSN_ENST00000449733.1_Frame_Shift_Ins_p.T547fs	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	598	Actin-binding, Ca-sensitive. {ECO:0000255}.				actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						TGTTCTGAAAACCCCCTCAGCC	0.594																																					p.T598fs		.											.	GSN-154	0			c.1792_1793insC						.																																			SO:0001589	frameshift_variant	2934	exon13			.	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.1797dupC	9.37:g.124089642_124089642dupC	ENSP00000362924:p.Thr598fs	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	85	16	NM_000177	0	0	0	0	0	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Frame_Shift_Ins	INS	ENST00000373818.4	37	CCDS6828.1																																																																																			.		0.594	GSN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053861.1	NM_000177	
