#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPHA8	2046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22903099	22903099	+	Silent	SNP	G	G	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr1:22903099G>T	ENST00000166244.3	+	3	621	c.549G>T	c.(547-549)ctG>ctT	p.L183L	EPHA8_ENST00000538803.1_Silent_p.L183L|EPHA8_ENST00000374644.4_Silent_p.L183L	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	183	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCTTCTACCTGGCCTTCCAGG	0.617																																					p.L183L		.											.	EPHA8-1380	0			c.G549T						.						73.0	66.0	69.0					1																	22903099		2203	4300	6503	SO:0001819	synonymous_variant	2046	exon3			CTACCTGGCCTTC	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.549G>T	1.37:g.22903099G>T		Somatic	74	0		WXS	Illumina HiSeq	Phase_I	69	25	NM_020526	0	0	0	0	0	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	37	CCDS225.1																																																																																			.		0.617	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
RCC1	1104	broad.mit.edu	37	1	28862497	28862497	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr1:28862497G>A	ENST00000373833.6	+	10	1061	c.776G>A	c.(775-777)gGc>gAc	p.G259D	RCC1_ENST00000373831.3_Missense_Mutation_p.G290D|RCC1_ENST00000398958.2_Missense_Mutation_p.G259D|RCC1_ENST00000373832.1_Missense_Mutation_p.G259D			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	259					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCATGAGGGCCACGTGTAC	0.592																																					p.G290D													.	RCC1-228	0			c.G869A						.						138.0	116.0	124.0					1																	28862497		2203	4300	6503	SO:0001583	missense	1104	exon8			ATGAGGGCCACGT	X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.776G>A	1.37:g.28862497G>A	ENSP00000362939:p.Gly259Asp	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	69	5	NM_001048194	0	0	21	24	3	Q16269|Q6NT97	Missense_Mutation	SNP	ENST00000373833.6	37	CCDS323.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781523	0.90282	.	.	ENSG00000180198	ENST00000398958;ENST00000373833;ENST00000419074;ENST00000373832;ENST00000373831;ENST00000411533;ENST00000430407	D;D;D;D;D;D;D	0.97959	-4.63;-4.63;-2.36;-4.63;-4.63;-4.63;-4.63	5.56	5.56	0.83823	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.98795	0.9594	M	0.85945	2.785	0.80722	D	1	D;D;D	0.89917	0.972;1.0;1.0	P;D;D	0.83275	0.581;0.996;0.987	D	0.99110	1.0846	9	.	.	.	-17.227	18.2548	0.90016	0.0:0.0:1.0:0.0	.	290;276;259	P18754-2;E9PAT9;P18754	.;.;RCC1_HUMAN	D	259;259;259;259;290;276;259	ENSP00000381931:G259D;ENSP00000362939:G259D;ENSP00000402260:G259D;ENSP00000362938:G259D;ENSP00000362937:G290D;ENSP00000413644:G276D;ENSP00000394650:G259D	.	G	+	2	0	RCC1	28735084	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	9.556000	0.98127	2.890000	0.99128	0.655000	0.94253	GGC	.		0.592	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010323.3	NM_001269	
RAB3B	5865	bcgsc.ca	37	1	52398990	52398990	+	Splice_Site	SNP	C	C	A			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr1:52398990C>A	ENST00000371655.3	-	4	684	c.472G>T	c.(472-474)Ggg>Tgg	p.G158W		NM_002867.3	NP_002858.2	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	158					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of vesicle size (GO:0097494)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9						ATGTACATACCAAGCTGCTCT	0.468																																					p.G158W													.	RAB3B-228	0			c.G472T						.						188.0	145.0	160.0					1																	52398990		2203	4300	6503	SO:0001630	splice_region_variant	5865	exon4			ACATACCAAGCTG	BC005035	CCDS560.1	1p32-p31	2008-02-05			ENSG00000169213	ENSG00000169213		"""RAB, member RAS oncogene"""	9778	protein-coding gene	gene with protein product		179510					Standard	NM_002867		Approved		uc001cth.3	P20337	OTTHUMG00000008627	ENST00000371655.3:c.472+1G>T	1.37:g.52398990C>A		Somatic	138	2		WXS	Illumina HiSeq	Phase_1	124	9	NM_002867	0	0	0	0	0	Q5VUL2|Q9BSI1	Missense_Mutation	SNP	ENST00000371655.3	37	CCDS560.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.699082	0.68501	.	.	ENSG00000169213	ENST00000371655;ENST00000537650	D	0.82803	-1.65	5.15	5.15	0.70609	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95027	0.8390	H	0.98295	4.195	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96813	0.9598	9	.	.	.	.	18.4044	0.90529	0.0:1.0:0.0:0.0	.	158	P20337	RAB3B_HUMAN	W	158	ENSP00000360718:G158W	.	G	-	1	0	RAB3B	52171578	1.000000	0.71417	1.000000	0.80357	0.224000	0.24922	7.340000	0.79292	2.692000	0.91855	0.655000	0.94253	GGG	.		0.468	RAB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023816.1	NM_002867	Missense_Mutation
NOTCH2	4853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	120458888	120458888	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr1:120458888A>T	ENST00000256646.2	-	34	6676	c.6457T>A	c.(6457-6459)Tcc>Acc	p.S2153T		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2153					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GATTCTAGGGAATCAACAGGG	0.498			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.S2153T		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	0			c.T6457A						.						158.0	143.0	148.0					1																	120458888		2203	4300	6503	SO:0001583	missense	4853	exon34	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	CTAGGGAATCAAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.6457T>A	1.37:g.120458888A>T	ENSP00000256646:p.Ser2153Thr	Somatic	123	1		WXS	Illumina HiSeq	Phase_I	111	36	NM_024408	0	0	61	124	63	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	A	16.03	3.006662	0.54361	.	.	ENSG00000134250	ENST00000256646	D	0.84589	-1.87	5.71	5.71	0.89125	.	0.000000	0.36854	U	0.002366	D	0.89908	0.6851	M	0.71871	2.18	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.91129	0.4936	10	0.66056	D	0.02	.	15.1655	0.72821	1.0:0.0:0.0:0.0	.	2153	Q04721	NOTC2_HUMAN	T	2153	ENSP00000256646:S2153T	ENSP00000256646:S2153T	S	-	1	0	NOTCH2	120260411	1.000000	0.71417	0.976000	0.42696	0.192000	0.23643	9.339000	0.96797	2.179000	0.69175	0.459000	0.35465	TCC	.		0.498	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NBPF9	400818	broad.mit.edu	37	1	144823878	144823878	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr1:144823878A>C	ENST00000281815.8	+	9	946	c.200A>C	c.(199-201)tAt>tCt	p.Y67S	NBPF9_ENST00000440491.2_Missense_Mutation_p.Y382S|NBPF9_ENST00000338347.4_Missense_Mutation_p.Y382S|NBPF9_ENST00000468645.1_3'UTR			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	715						cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						TATAGATGTTATTCAACTCCT	0.483																																					.													.	.	0			.						.																																			SO:0001583	missense	400818	.			GATGTTATTCAAC		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000281815.8:c.200A>C	1.37:g.144823878A>C	ENSP00000281815:p.Tyr67Ser	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	117	4	.	0	0	8	8	0		Missense_Mutation	SNP	ENST00000281815.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.138|8.138	0.784620|0.784620	0.16189|0.16189	.|.	.|.	ENSG00000168614|ENSG00000168614	ENST00000375552|ENST00000338347;ENST00000440491;ENST00000281815	.|T;T;T	.|0.08282	.|3.11;3.11;3.11	0.431|0.431	-0.862|-0.862	0.10673|0.10673	.|.	.|.	.|.	.|.	.|.	T|T	0.06325|0.06325	0.0163|0.0163	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.91635	.|0.999	T|T	0.20638|0.20638	-1.0269|-1.0269	3|7	.|0.20046	.|T	.|0.44	.|.	.|.	.|.	.|.	.|.	.|380	.|A2BGT5	.|.	L|S	381|382;382;67	.|ENSP00000342975:Y382S;ENSP00000390934:Y382S;ENSP00000281815:Y67S	.|ENSP00000281815:Y67S	I|Y	+|+	1|2	0|0	NBPF9|NBPF9	143535235|143535235	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.041000|0.041000	0.13682|0.13682	-1.315000|-1.315000	0.02713|0.02713	-0.698000|-0.698000	0.05085|0.05085	0.163000|0.163000	0.16589|0.16589	ATT|TAT	.		0.483	NBPF9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001037675	
TNKS1BP1	85456	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57085299	57085299	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr11:57085299G>A	ENST00000532437.1	-	3	1102	c.791C>T	c.(790-792)cCt>cTt	p.P264L	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.P264L			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	264	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CACATCAGCAGGTAGCTCCGA	0.502																																					p.P264L													.	TNKS1BP1-91	0			c.C791T						.						69.0	65.0	67.0					11																	57085299		2201	4296	6497	SO:0001583	missense	85456	exon4			TCAGCAGGTAGCT	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.791C>T	11.37:g.57085299G>A	ENSP00000437271:p.Pro264Leu	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	49	8	NM_033396	0	0	0	0	0	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	9.170	1.020971	0.19433	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.38077	1.16;1.16	3.96	3.04	0.35103	.	0.185799	0.26234	N	0.025556	T	0.24547	0.0595	L	0.32530	0.975	0.09310	N	0.999999	B	0.13594	0.008	B	0.17098	0.017	T	0.10428	-1.0630	10	0.49607	T	0.09	-2.5359	6.8012	0.23752	0.1261:0.0:0.8739:0.0	.	264	Q9C0C2	TB182_HUMAN	L	264	ENSP00000350990:P264L;ENSP00000437271:P264L	ENSP00000350990:P264L	P	-	2	0	TNKS1BP1	56841875	0.169000	0.23002	0.605000	0.28930	0.178000	0.23041	0.774000	0.26675	2.206000	0.71126	0.462000	0.41574	CCT	.		0.502	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
NAA16	79612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	41905433	41905433	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr13:41905433A>T	ENST00000379406.3	+	8	1159	c.835A>T	c.(835-837)Att>Ttt	p.I279F	NAA16_ENST00000403412.3_Missense_Mutation_p.I279F|NAA16_ENST00000379367.3_Missense_Mutation_p.I279F	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	279					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						GAGGCTTCAAATTTATGAAGA	0.318																																					p.I279F		.											.	NAA16-90	0			c.A835T						.						73.0	81.0	78.0					13																	41905433		2203	4296	6499	SO:0001583	missense	79612	exon8			CTTCAAATTTATG	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.835A>T	13.37:g.41905433A>T	ENSP00000368716:p.Ile279Phe	Somatic	187	0		WXS	Illumina HiSeq	Phase_I	148	47	NM_001110798	0	0	6	10	4	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	37	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	A	13.46	2.242909	0.39598	.	.	ENSG00000172766	ENST00000379367;ENST00000379406;ENST00000403412	T;T;T	0.45276	0.9;0.9;0.9	5.53	1.72	0.24424	.	0.233772	0.36167	N	0.002755	T	0.35008	0.0917	L	0.47716	1.5	0.49915	D	0.999832	B;P;B	0.37423	0.031;0.594;0.002	B;P;B	0.44860	0.049;0.462;0.008	T	0.09443	-1.0674	10	0.13470	T	0.59	-3.7053	5.4616	0.16619	0.647:0.1367:0.2163:0.0	.	279;279;279	Q6N069;Q6N069-4;Q6N069-5	NAA16_HUMAN;.;.	F	279	ENSP00000368674:I279F;ENSP00000368716:I279F;ENSP00000386103:I279F	ENSP00000368674:I279F	I	+	1	0	NAA16	40803433	1.000000	0.71417	0.989000	0.46669	0.977000	0.68977	2.768000	0.47645	0.070000	0.16634	0.459000	0.35465	ATT	.		0.318	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
TEP1	7011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20841196	20841196	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr14:20841196C>T	ENST00000262715.5	-	48	6965	c.6925G>A	c.(6925-6927)Gaa>Aaa	p.E2309K	TEP1_ENST00000556935.1_Missense_Mutation_p.E2201K|TEP1_ENST00000545983.1_Missense_Mutation_p.E647K	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2309					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GCCTTAGCTTCCTGCCACAAG	0.517																																					p.E2309K		.											.	TEP1-95	0			c.G6925A						.						77.0	78.0	78.0					14																	20841196		2203	4300	6503	SO:0001583	missense	7011	exon48			TAGCTTCCTGCCA		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.6925G>A	14.37:g.20841196C>T	ENSP00000262715:p.Glu2309Lys	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	103	41	NM_007110	0	0	4	8	4	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.58|12.58	1.981914|1.981914	0.34942|0.34942	.|.	.|.	ENSG00000129566|ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000545983|ENST00000553984	T;T;T|.	0.56103|.	2.26;2.26;0.48|.	5.77|5.77	2.31|2.31	0.28768|0.28768	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.860064|.	0.10567|.	N|.	0.659553|.	T|T	0.19485|0.19485	0.0468|0.0468	N|N	0.14661|0.14661	0.345|0.345	0.20638|0.20638	N|N	0.999872|0.999872	B;B;B;B|.	0.14805|.	0.007;0.004;0.011;0.002|.	B;B;B;B|.	0.13407|.	0.006;0.007;0.009;0.003|.	T|T	0.25467|0.25467	-1.0131|-1.0131	10|5	0.06757|.	T|.	0.87|.	0.0511|0.0511	5.2313|5.2313	0.15424|0.15424	0.0:0.62:0.1541:0.2259|0.0:0.62:0.1541:0.2259	.|.	647;2201;1652;2309|.	B4E0B6;G3V5X7;G3V2A4;Q99973|.	.;.;.;TEP1_HUMAN|.	K|E	2309;2309;2201;647|15	ENSP00000262715:E2309K;ENSP00000452574:E2201K;ENSP00000438849:E647K|.	ENSP00000262715:E2309K|.	E|G	-|-	1|2	0|0	TEP1|TEP1	19911036|19911036	0.182000|0.182000	0.23173|0.23173	0.350000|0.350000	0.25708|0.25708	0.972000|0.972000	0.66771|0.66771	0.105000|0.105000	0.15333|0.15333	0.154000|0.154000	0.19237|0.19237	-0.150000|-0.150000	0.13652|0.13652	GAA|GGA	.		0.517	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
AHNAK2	113146	ucsc.edu	37	14	105415291	105415291	+	Missense_Mutation	SNP	G	G	A	rs568117634		TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr14:105415291G>A	ENST00000333244.5	-	7	6616	c.6497C>T	c.(6496-6498)tCt>tTt	p.S2166F	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2166						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCTGGGGCAGACACCCCAAA	0.592													.|||	0	0.0	0.0	0.0	5008	,	,		16538	0.0		0.0	False		,,,				2504	0.0				p.S2166F													.	AHNAK2-47	0			c.C6497T						.						208.0	149.0	170.0					14																	105415291		1940	3520	5460	SO:0001583	missense	113146	exon7			GGGGCAGACACCC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6497C>T	14.37:g.105415291G>A	ENSP00000353114:p.Ser2166Phe	Somatic	539	0		WXS	Illumina HiSeq		485	2	NM_138420	0	0	96	96	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	16.92	3.256462	0.59321	.	.	ENSG00000185567	ENST00000333244	T	0.01025	5.43	4.35	4.35	0.52113	.	.	.	.	.	T	0.08403	0.0209	M	0.91406	3.205	0.09310	N	1	D	0.71674	0.998	D	0.87578	0.998	T	0.04752	-1.0929	9	0.52906	T	0.07	.	16.9291	0.86184	0.0:0.0:1.0:0.0	.	2166	Q8IVF2	AHNK2_HUMAN	F	2166	ENSP00000353114:S2166F	ENSP00000353114:S2166F	S	-	2	0	AHNAK2	104486336	0.018000	0.18449	0.006000	0.13384	0.001000	0.01503	1.888000	0.39708	1.995000	0.58328	0.306000	0.20318	TCT	.		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
NDNL2	56160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	29561225	29561225	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr15:29561225G>C	ENST00000332303.4	-	1	808	c.685C>G	c.(685-687)Cga>Gga	p.R229G	FAM189A1_ENST00000261275.4_Intron	NM_138704.3	NP_619649.1	Q96MG7	MAGG1_HUMAN	necdin-like 2	229	Interaction with NSMCE1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)		p.R229*(1)		breast(3)|large_intestine(2)|lung(3)	8		all_lung(180;4.69e-11)|Breast(32;0.0013)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00736)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		TAACGCTGTCGCACAAAGTCC	0.532																																					p.R229G		.											.	NDNL2-90	1	Substitution - Nonsense(1)	large_intestine(1)	c.C685G						.						68.0	75.0	73.0					15																	29561225		2203	4300	6503	SO:0001583	missense	56160	exon1			GCTGTCGCACAAA	AF490510	CCDS10023.1	15q13.1	2008-02-01			ENSG00000185115	ENSG00000185115			7677	protein-coding gene	gene with protein product		608243				18086888	Standard	NM_138704		Approved	HCA4, MAGEG1, MAGEL3, NSE3, NSMCE3	uc001zco.3	Q96MG7	OTTHUMG00000129261	ENST00000332303.4:c.685C>G	15.37:g.29561225G>C	ENSP00000330694:p.Arg229Gly	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	134	50	NM_138704	0	0	17	34	17	Q8IW16|Q8TEI6|Q9H214	Missense_Mutation	SNP	ENST00000332303.4	37	CCDS10023.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392428	0.62066	.	.	ENSG00000185115	ENST00000332303	T	0.06142	3.34	4.1	3.16	0.36331	.	0.069228	0.56097	D	0.000039	T	0.24470	0.0593	M	0.86864	2.845	0.41871	D	0.990272	D	0.64830	0.994	D	0.68483	0.958	T	0.02150	-1.1205	10	0.87932	D	0	.	9.1001	0.36662	0.0:0.0:0.7819:0.2181	.	229	Q96MG7	MAGG1_HUMAN	G	229	ENSP00000330694:R229G	ENSP00000330694:R229G	R	-	1	2	NDNL2	27348517	0.989000	0.36119	0.984000	0.44739	0.885000	0.51271	1.680000	0.37607	1.262000	0.44165	0.563000	0.77884	CGA	.		0.532	NDNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251370.1	NM_138704	
ARHGAP11A	9824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	32928906	32928906	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr15:32928906T>G	ENST00000361627.3	+	12	2654	c.1932T>G	c.(1930-1932)ttT>ttG	p.F644L	ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.F455L|ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.F455L	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	644					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		AAAATCTATTTGAAACTAATG	0.358																																					p.F644L	Colon(45;757 1134 30003 36652)	.											.	ARHGAP11A-292	0			c.T1932G						.						30.0	32.0	31.0					15																	32928906		2197	4296	6493	SO:0001583	missense	9824	exon12			TCTATTTGAAACT	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.1932T>G	15.37:g.32928906T>G	ENSP00000355090:p.Phe644Leu	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	46	25	NM_014783	0	0	0	0	0	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	37	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	3.671	-0.067535	0.07273	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.08370	3.1	4.68	0.799	0.18667	.	0.649114	0.13886	N	0.355958	T	0.05686	0.0149	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40869	-0.9540	10	0.27785	T	0.31	.	6.2376	0.20772	0.2542:0.0:0.2632:0.4826	.	644	Q6P4F7	RHGBA_HUMAN	L	644;455	ENSP00000355090:F644L	ENSP00000355090:F644L	F	+	3	2	ARHGAP11A	30716198	0.999000	0.42202	0.595000	0.28798	0.557000	0.35523	1.332000	0.33805	-0.039000	0.13602	0.455000	0.32223	TTT	.		0.358	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	
NR2F2	7026	broad.mit.edu	37	15	96877563	96877563	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr15:96877563C>G	ENST00000394166.3	+	2	2090	c.701C>G	c.(700-702)cCc>cGc	p.P234R	NR2F2_ENST00000453270.2_Missense_Mutation_p.P81R|MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000421109.2_Missense_Mutation_p.P101R|NR2F2_ENST00000394171.2_Missense_Mutation_p.P81R	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	234	Interaction with ZFPM2. {ECO:0000250}.|Ligand-binding. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			CCCTTCTTCCCCGACCTGCAG	0.617																																					p.P234R													.	NR2F2-228	0			c.C701G						.						133.0	123.0	126.0					15																	96877563		2197	4298	6495	SO:0001583	missense	7026	exon2			TCTTCCCCGACCT	M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.701C>G	15.37:g.96877563C>G	ENSP00000377721:p.Pro234Arg	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	159	6	NM_021005	0	0	357	357	0	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Missense_Mutation	SNP	ENST00000394166.3	37	CCDS10375.1	.	.	.	.	.	.	.	.	.	.	C	32	5.175228	0.94807	.	.	ENSG00000185551	ENST00000421109;ENST00000394166;ENST00000394171;ENST00000453270	D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81	5.09	5.09	0.68999	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.96131	0.8739	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.989	D	0.97151	0.9831	10	0.72032	D	0.01	.	18.4813	0.90812	0.0:1.0:0.0:0.0	.	234;101	P24468;Q3KQR7	COT2_HUMAN;.	R	101;234;81;81	ENSP00000401674:P101R;ENSP00000377721:P234R;ENSP00000377726:P81R;ENSP00000389853:P81R	ENSP00000377721:P234R	P	+	2	0	NR2F2	94678567	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.818000	0.86416	2.376000	0.81061	0.655000	0.94253	CCC	.		0.617	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
TMC5	79838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	19490814	19490814	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr16:19490814C>G	ENST00000396229.2	+	14	2980	c.2231C>G	c.(2230-2232)tCt>tGt	p.S744C	TMC5_ENST00000219821.5_Missense_Mutation_p.S498C|TMC5_ENST00000381414.4_Missense_Mutation_p.S744C|TMC5_ENST00000541464.1_Missense_Mutation_p.S692C|TMC5_ENST00000542583.2_Missense_Mutation_p.S744C|CTA-363E6.6_ENST00000561762.1_RNA|TMC5_ENST00000561503.1_Missense_Mutation_p.S385C|TMC5_ENST00000564959.1_Missense_Mutation_p.S427C	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	744					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TTTGTGTTCTCTTTAGTCAAT	0.473																																					p.S744C		.											.	TMC5-91	0			c.C2231G						.						246.0	253.0	250.0					16																	19490814		2197	4300	6497	SO:0001583	missense	79838	exon14			TGTTCTCTTTAGT	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2231C>G	16.37:g.19490814C>G	ENSP00000379531:p.Ser744Cys	Somatic	344	1		WXS	Illumina HiSeq	Phase_I	389	116	NM_001105249	0	0	0	0	0	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	37	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	C	11.59	1.684070	0.29872	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16	5.15	5.15	0.70609	.	0.292700	0.35207	N	0.003365	T	0.49864	0.1582	N	0.26042	0.785	0.34863	D	0.742852	B;B;B;B;B;B	0.31548	0.068;0.12;0.008;0.01;0.328;0.281	B;B;B;B;B;B	0.30401	0.07;0.081;0.023;0.026;0.115;0.07	T	0.62973	-0.6740	10	0.48119	T	0.1	-9.1731	14.3209	0.66487	0.0:0.8051:0.1949:0.0	.	692;427;498;498;744;744	F5GYU8;E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2	.;.;.;.;TMC5_HUMAN;.	C	692;744;744;744;498;427	ENSP00000441227:S692C;ENSP00000370822:S744C;ENSP00000379531:S744C;ENSP00000446274:S744C;ENSP00000219821:S498C	ENSP00000219821:S498C	S	+	2	0	TMC5	19398315	0.525000	0.26290	0.987000	0.45799	0.873000	0.50193	0.913000	0.28611	2.387000	0.81309	0.555000	0.69702	TCT	.		0.473	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
EEF2K	29904	ucsc.edu	37	16	22274500	22274500	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr16:22274500C>T	ENST00000263026.5	+	12	1843	c.1369C>T	c.(1369-1371)Cga>Tga	p.R457*		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	457					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		CCCTGAGCCCCGAGAACATGT	0.552																																					p.R457X	NSCLC(195;1411 2157 20319 27471 51856)												.	EEF2K-856	0			c.C1369T						.						80.0	65.0	71.0					16																	22274500		2197	4300	6497	SO:0001587	stop_gained	29904	exon12			GAGCCCCGAGAAC	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1369C>T	16.37:g.22274500C>T	ENSP00000263026:p.Arg457*	Somatic	26	0		WXS	Illumina HiSeq		28	4	NM_013302	0	0	0	0	0	Q8N588	Nonsense_Mutation	SNP	ENST00000263026.5	37	CCDS10604.1	.	.	.	.	.	.	.	.	.	.	C	41	8.849534	0.98976	.	.	ENSG00000103319	ENST00000263026	.	.	.	5.39	3.37	0.38596	.	0.826423	0.11375	N	0.570474	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.031	8.9336	0.35686	0.3659:0.5072:0.1269:0.0	.	.	.	.	X	457	.	ENSP00000263026:R457X	R	+	1	2	EEF2K	22182001	0.894000	0.30519	1.000000	0.80357	0.951000	0.60555	0.801000	0.27055	0.722000	0.32252	0.650000	0.86243	CGA	.		0.552	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302	
ITGAX	3687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31383749	31383749	+	Silent	SNP	G	G	A			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr16:31383749G>A	ENST00000268296.4	+	18	2332	c.2211G>A	c.(2209-2211)acG>acA	p.T737T	ITGAX_ENST00000562522.1_Silent_p.T737T	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	737					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TGAACTTCACGCTGGTGGGCA	0.637																																					p.T737T		.											.	ITGAX-229	0			c.G2211A						.						87.0	76.0	80.0					16																	31383749		2197	4300	6497	SO:0001819	synonymous_variant	3687	exon18			CTTCACGCTGGTG	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2211G>A	16.37:g.31383749G>A		Somatic	101	1		WXS	Illumina HiSeq	Phase_I	130	68	NM_000887	0	0	24	25	1	Q8IVA6	Silent	SNP	ENST00000268296.4	37	CCDS10711.1																																																																																			.		0.637	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
C16orf70	80262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67168085	67168085	+	Silent	SNP	T	T	C			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr16:67168085T>C	ENST00000219139.3	+	7	653	c.465T>C	c.(463-465)caT>caC	p.H155H	C16orf70_ENST00000569683.1_3'UTR|C16orf70_ENST00000569600.1_Silent_p.H155H	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70	155										cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		ATTTTGCCCATGGCCTGGCTT	0.483																																					p.H155H		.											.	C16orf70-70	0			c.T465C						.						107.0	100.0	102.0					16																	67168085		2200	4300	6500	SO:0001819	synonymous_variant	80262	exon7			TGCCCATGGCCTG	AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510	ENST00000219139.3:c.465T>C	16.37:g.67168085T>C		Somatic	109	0		WXS	Illumina HiSeq	Phase_I	175	52	NM_025187	0	0	8	11	3	Q9HA86	Silent	SNP	ENST00000219139.3	37	CCDS10828.1																																																																																			.		0.483	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2	NM_025187	
MYH13	8735	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10267725	10267725	+	Silent	SNP	C	C	T	rs374269997		TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr17:10267725C>T	ENST00000418404.3	-	2	286	c.123G>A	c.(121-123)gcG>gcA	p.A41A	MYH13_ENST00000252172.4_Silent_p.A41A			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	41					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CCTTATTATCCGCTACAAAGC	0.453																																					p.A41A													.	MYH13-6	0			c.G123A						.						118.0	113.0	114.0					17																	10267725		1929	4139	6068	SO:0001819	synonymous_variant	8735	exon3			ATTATCCGCTACA	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.123G>A	17.37:g.10267725C>T		Somatic	53	0		WXS	Illumina HiSeq	Phase_I	64	13	NM_003802	0	0	0	0	0	O95252|Q9P0U8	Silent	SNP	ENST00000418404.3	37	CCDS45613.1																																																																																			.		0.453	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
ERAL1	26284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27182278	27182278	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr17:27182278T>C	ENST00000254928.5	+	1	323	c.226T>C	c.(226-228)Ttc>Ctc	p.F76L	FAM222B_ENST00000583953.1_5'Flank|ERAL1_ENST00000578001.1_3'UTR	NM_005702.2	NP_005693.1	O75616	ERAL1_HUMAN	Era-like 12S mitochondrial rRNA chaperone 1	76					ribosomal small subunit assembly (GO:0000028)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)			CTTCCTCGGATTCTCTCAGCC	0.602																																					p.F76L		.											.	ERAL1-91	0			c.T226C						.						41.0	43.0	42.0					17																	27182278		2203	4300	6503	SO:0001583	missense	26284	exon1			CTCGGATTCTCTC	AF082657	CCDS11244.1	17q11.2	2013-05-22	2013-05-22		ENSG00000132591	ENSG00000132591			3424	protein-coding gene	gene with protein product		607435	"""Era (E. coli G-protein homolog)-like 1"", ""Era G-protein-like 1 (E. coli)"""			10945472, 20604745	Standard	NM_005702		Approved	HERA-B	uc002hcy.1	O75616	OTTHUMG00000132675	ENST00000254928.5:c.226T>C	17.37:g.27182278T>C	ENSP00000254928:p.Phe76Leu	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	95	56	NM_005702	0	0	39	110	71	B3KN21|C9JEC6|O75617|Q8WUY4|Q96LE2|Q96TC0	Missense_Mutation	SNP	ENST00000254928.5	37	CCDS11244.1	.	.	.	.	.	.	.	.	.	.	T	9.501	1.103237	0.20632	.	.	ENSG00000132591	ENST00000254928	.	.	.	5.25	-1.46	0.08800	.	0.850078	0.10643	N	0.650826	T	0.07188	0.0182	N	0.02011	-0.69	0.09310	N	0.999995	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.33904	-0.9850	9	0.02654	T	1	-3.854	1.1254	0.01734	0.3213:0.163:0.3615:0.1542	.	76;76	O75616;O75616-2	ERAL1_HUMAN;.	L	76	.	ENSP00000254928:F76L	F	+	1	0	ERAL1	24206404	0.113000	0.22115	0.236000	0.24074	0.049000	0.14656	-0.256000	0.08757	-0.052000	0.13311	0.459000	0.35465	TTC	.		0.602	ERAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255937.2		
DLGAP1	9229	broad.mit.edu;bcgsc.ca	37	18	3499238	3499238	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr18:3499238G>T	ENST00000315677.3	-	13	3474	c.2879C>A	c.(2878-2880)aCc>aAc	p.T960N	DLGAP1_ENST00000584874.1_Missense_Mutation_p.T960N|DLGAP1_ENST00000534970.1_Missense_Mutation_p.T644N|DLGAP1_ENST00000539435.1_Missense_Mutation_p.T668N|DLGAP1_ENST00000400150.3_Missense_Mutation_p.T676N|DLGAP1_ENST00000400147.2_Missense_Mutation_p.T658N|DLGAP1_ENST00000400155.1_Missense_Mutation_p.T666N|DLGAP1_ENST00000400149.3_Missense_Mutation_p.T650N|DLGAP1_ENST00000581699.1_Missense_Mutation_p.T666N	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	960					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GGCGCTCTCGGTGGCCGAGTT	0.731																																					p.T960N													.	DLGAP1-229	0			c.C2879A						.						9.0	10.0	10.0					18																	3499238		2182	4274	6456	SO:0001583	missense	9229	exon13			CTCTCGGTGGCCG	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.2879C>A	18.37:g.3499238G>T	ENSP00000316377:p.Thr960Asn	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	25	6	NM_004746	0	0	2	2	0	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687473	0.68157	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435	T;T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96;1.96	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.51483	0.1677	M	0.81497	2.545	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;1.0;0.998;1.0;1.0;1.0	T	0.57458	-0.7808	10	0.87932	D	0	-28.0728	18.7351	0.91751	0.0:0.0:1.0:0.0	.	644;656;666;668;960;658	B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;O14490;O14490-2	.;.;.;.;DLGP1_HUMAN;.	N	960;658;676;650;666;644;668	ENSP00000316377:T960N;ENSP00000383011:T658N;ENSP00000383014:T676N;ENSP00000383013:T650N;ENSP00000383019:T666N;ENSP00000437817:T644N;ENSP00000446312:T668N	ENSP00000316377:T960N	T	-	2	0	DLGAP1	3489238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.661000	0.98601	2.426000	0.82243	0.557000	0.71058	ACC	.		0.731	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4		
ZNF559	84527	hgsc.bcm.edu;bcgsc.ca	37	19	9453293	9453293	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr19:9453293C>G	ENST00000393883.2	+	6	1814	c.1166C>G	c.(1165-1167)gCc>gGc	p.A389G	ZNF559_ENST00000586255.1_Intron|ZNF559_ENST00000317221.7_3'UTR|ZNF559_ENST00000603380.1_Missense_Mutation_p.A389G|CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF177_ENST00000602856.1_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000538743.1_Missense_Mutation_p.A309G|ZNF177_ENST00000446085.4_Intron|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000587557.1_Missense_Mutation_p.A453G	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						TGTGGAAAAGCCTTTATTAAT	0.403																																					p.A453G		.											.	ZNF559-91	0			c.C1358G						.						63.0	58.0	60.0					19																	9453293		2203	4300	6503	SO:0001583	missense	84527	exon6			GAAAAGCCTTTAT	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.1166C>G	19.37:g.9453293C>G	ENSP00000377461:p.Ala389Gly	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	74	26	NM_001202406	0	0	6	6	0	K7EMG6	Missense_Mutation	SNP	ENST00000393883.2	37	CCDS12211.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599554	0.46318	.	.	ENSG00000188321	ENST00000317221;ENST00000538743;ENST00000393883	T;T	0.13901	2.55;2.55	2.22	-0.134	0.13481	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10766	0.0263	N	0.21324	0.655	0.09310	N	1	B;B;B	0.25441	0.028;0.126;0.108	B;B;B	0.38500	0.035;0.275;0.114	T	0.44682	-0.9312	9	0.72032	D	0.01	.	2.8735	0.05624	0.0:0.4172:0.241:0.3417	.	389;389;309	B3KPL8;Q9BR84;B4DP29	.;ZN559_HUMAN;.	G	389;309;389	ENSP00000442832:A309G;ENSP00000377461:A389G	ENSP00000325393:A389G	A	+	2	0	ZNF559	9314293	0.000000	0.05858	0.051000	0.19133	0.916000	0.54674	-0.790000	0.04604	0.024000	0.15214	0.313000	0.20887	GCC	.		0.403	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
HSPBP1	23640	ucsc.edu	37	19	55777303	55777303	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr19:55777303G>A	ENST00000255631.5	-	7	1154	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	HSPBP1_ENST00000376343.3_Intron|HSPBP1_ENST00000433386.2_Missense_Mutation_p.R282W|HSPBP1_ENST00000587922.1_Missense_Mutation_p.R282W	NM_001130106.1|NM_012267.4	NP_001123578.1|NP_036399.3	Q9NZL4	HPBP1_HUMAN	HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1	285					negative regulation of catalytic activity (GO:0043086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)		enzyme inhibitor activity (GO:0004857)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	8			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		TGCTCTGTCCGCACCAGGGCC	0.687																																					p.R282W													.	HSPBP1-90	0			c.C844T						.						18.0	19.0	19.0					19																	55777303		2201	4298	6499	SO:0001583	missense	23640	exon6			CTGTCCGCACCAG		CCDS33111.1	19q13.42	2008-12-16			ENSG00000133265	ENSG00000133265			24989	protein-coding gene	gene with protein product	"""hsp70 interacting protein"", ""Hsp70 binding protein 1"""	612939				10786638, 9830037	Standard	NM_001130106		Approved	HspBP1, FES1	uc002qkd.3	Q9NZL4		ENST00000255631.5:c.844C>T	19.37:g.55777303G>A	ENSP00000255631:p.Arg282Trp	Somatic	33	0		WXS	Illumina HiSeq		34	4	NM_012267	0	0	111	111	0	B3KQP0|B4DG11|O95351|Q6ZNU5	Missense_Mutation	SNP	ENST00000255631.5	37	CCDS33111.1	.	.	.	.	.	.	.	.	.	.	g	15.51	2.854878	0.51376	.	.	ENSG00000133265	ENST00000433386;ENST00000255631	T;T	0.52983	0.64;0.64	4.19	3.03	0.35002	Armadillo-like helical (1);Armadillo-type fold (1);	0.201340	0.43110	D	0.000614	T	0.57021	0.2025	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.71656	0.974;0.622	T	0.56189	-0.8020	10	0.72032	D	0.01	-5.7405	7.7056	0.28648	0.0:0.1554:0.5988:0.2458	.	285;328	Q9NZL4;B4DG11	HPBP1_HUMAN;.	W	282	ENSP00000398244:R282W;ENSP00000255631:R282W	ENSP00000255631:R282W	R	-	1	2	HSPBP1	60469115	1.000000	0.71417	0.893000	0.35052	0.981000	0.71138	5.268000	0.65536	0.659000	0.30945	0.486000	0.48141	CGG	.		0.687	HSPBP1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452670.1	NM_012267	
ZNRF3	84133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	29445350	29445350	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr22:29445350T>C	ENST00000544604.2	+	8	1356	c.1181T>C	c.(1180-1182)gTc>gCc	p.V394A	ZNRF3_ENST00000402174.1_Missense_Mutation_p.V294A|ZNRF3_ENST00000332811.4_Missense_Mutation_p.V294A|ZNRF3_ENST00000406323.3_Missense_Mutation_p.V294A	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	394					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						GGCAACCCCGTCACCTTGCTG	0.667																																					p.V394A		.											.	ZNRF3-69	0			c.T1181C						.						56.0	64.0	61.0					22																	29445350		2180	4280	6460	SO:0001583	missense	84133	exon8			ACCCCGTCACCTT	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.1181T>C	22.37:g.29445350T>C	ENSP00000443824:p.Val394Ala	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	55	15	NM_001206998	0	0	12	23	11	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Missense_Mutation	SNP	ENST00000544604.2	37	CCDS56225.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.345420	0.24426	.	.	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000462485;ENST00000402174;ENST00000406323	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	5.53	4.5	0.54988	.	0.316033	0.36665	N	0.002471	T	0.67702	0.2921	L	0.44542	1.39	0.34781	D	0.734712	P	0.45531	0.86	B	0.37692	0.256	T	0.70029	-0.4984	10	0.07325	T	0.83	-5.454	10.3398	0.43870	0.0:0.0764:0.0:0.9236	.	394	Q9ULT6	ZNRF3_HUMAN	A	394;294;101;294;294	ENSP00000443824:V394A;ENSP00000328614:V294A;ENSP00000384456:V294A;ENSP00000384553:V294A	ENSP00000328614:V294A	V	+	2	0	ZNRF3	27775350	1.000000	0.71417	0.291000	0.24904	0.272000	0.26649	7.390000	0.79816	0.945000	0.37605	0.533000	0.62120	GTC	.		0.667	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	
ZNF619	285267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	40529349	40529349	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr3:40529349C>T	ENST00000314686.5	+	6	1705	c.1300C>T	c.(1300-1302)Cac>Tac	p.H434Y	ZNF619_ENST00000432264.2_Missense_Mutation_p.H450Y|ZNF619_ENST00000520737.1_3'UTR|ZNF619_ENST00000456778.1_Missense_Mutation_p.H406Y|ZNF619_ENST00000521353.1_Missense_Mutation_p.H490Y|ZNF619_ENST00000522736.1_Missense_Mutation_p.H441Y|ZNF619_ENST00000429348.2_Missense_Mutation_p.H450Y|ZNF619_ENST00000447116.2_Missense_Mutation_p.H490Y			Q8N2I2	ZN619_HUMAN	zinc finger protein 619	434					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		TCAGCGAGTTCACACTGGGGA	0.463																																					p.H490Y		.											.	ZNF619-91	0			c.C1468T						.						92.0	95.0	94.0					3																	40529349		2203	4300	6503	SO:0001583	missense	285267	exon6			CGAGTTCACACTG	AK075245	CCDS46801.1, CCDS46802.1, CCDS46803.1	3p21.33	2013-01-08			ENSG00000177873	ENSG00000177873		"""Zinc fingers, C2H2-type"", ""-"""	26910	protein-coding gene	gene with protein product							Standard	NM_001145083		Approved	FLJ90764	uc011azb.2	Q8N2I2	OTTHUMG00000131391	ENST00000314686.5:c.1300C>T	3.37:g.40529349C>T	ENSP00000322529:p.His434Tyr	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	115	64	NM_001145082	0	0	4	6	2	B4E271|C9JRN5|D4PHA2|E9PCD9	Missense_Mutation	SNP	ENST00000314686.5	37		.	.	.	.	.	.	.	.	.	.	C	16.06	3.017099	0.54576	.	.	ENSG00000177873	ENST00000314686;ENST00000447116;ENST00000429348;ENST00000456778;ENST00000442066;ENST00000522736;ENST00000521353;ENST00000432264	T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	2.44	2.44	0.29823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.82010	0.4944	M	0.87269	2.87	0.30841	N	0.735643	D;D;D;D;D;D	0.89917	0.999;0.998;0.998;1.0;0.998;0.999	D;D;D;D;D;D	0.91635	0.996;0.982;0.976;0.999;0.976;0.996	T	0.79495	-0.1780	9	0.87932	D	0	.	10.5917	0.45314	0.0:1.0:0.0:0.0	.	406;450;490;392;441;434	B4E271;C9JRN5;E9PCD9;B7Z9B3;Q17RW3;Q8N2I2	.;.;.;.;.;ZN619_HUMAN	Y	434;490;450;406;71;441;490;450	ENSP00000322529:H434Y;ENSP00000411132:H490Y;ENSP00000398024:H450Y;ENSP00000397232:H406Y;ENSP00000428004:H441Y;ENSP00000430705:H490Y;ENSP00000388710:H450Y	ENSP00000322529:H434Y	H	+	1	0	ZNF619	40504353	0.998000	0.40836	0.972000	0.41901	0.869000	0.49853	3.961000	0.56759	1.376000	0.46267	0.563000	0.77884	CAC	.		0.463	ZNF619-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000254180.2	NM_173656	
RPL29	6159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52029445	52029445	+	Silent	SNP	G	G	A			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr3:52029445G>A	ENST00000466397.1	-	2	173	c.33C>T	c.(31-33)aaC>aaT	p.N11N	RPL29_ENST00000479017.1_Silent_p.N11N|RPL29_ENST00000294189.6_Silent_p.N11N|RPL29_ENST00000481629.1_Silent_p.N11N|RPL29_ENST00000495383.1_Silent_p.N11N|RPL29_ENST00000475248.1_Silent_p.N11N			P47914	RL29_HUMAN	ribosomal protein L29	11					cellular protein metabolic process (GO:0044267)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ACTTACACTGGTTGTGTGTGG	0.567																																					p.N11N		.											.	RPL29-90	0			c.C33T						.						130.0	106.0	114.0					3																	52029445		2203	4300	6503	SO:0001819	synonymous_variant	6159	exon2			ACACTGGTTGTGT	U10248	CCDS2845.1	3p21.3-p21.2	2013-03-11			ENSG00000162244	ENSG00000162244		"""L ribosomal proteins"""	10331	protein-coding gene	gene with protein product	"""60S ribosomal protein L29"", ""heparin/heparan sulfate-interacting protein"", ""HP/HS-interacting protein"", ""heparin/heparan sulfate-binding protein"", ""cell surface heparin-binding protein HIP"""	601832	"""ribosomal protein L29 pseudogene 10"""	RPL29P10		8597591	Standard	NM_000992		Approved	HIP, HUMRPL29, L29	uc003dcs.3	P47914	OTTHUMG00000155262	ENST00000466397.1:c.33C>T	3.37:g.52029445G>A		Somatic	106	0		WXS	Illumina HiSeq	Phase_I	116	26	NM_000992	0	0	0	0	0	A8K0H3|B2R4M8|Q6IPY3	Silent	SNP	ENST00000466397.1	37	CCDS2845.1																																																																																			.		0.567	RPL29-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349680.2	NM_000992	
HGD	3081	broad.mit.edu	37	3	120366724	120366724	+	Splice_Site	SNP	C	C	G			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr3:120366724C>G	ENST00000283871.5	-	7	928	c.469G>C	c.(469-471)Gtt>Ctt	p.V157L		NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	157					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		CAGAACTCACCAATCAAGAAG	0.353																																					p.V157L													.	HGD-68	0			c.G469C						.						128.0	135.0	133.0					3																	120366724		2203	4296	6499	SO:0001630	splice_region_variant	3081	exon7			ACTCACCAATCAA		CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.469+1G>C	3.37:g.120366724C>G		Somatic	211	0		WXS	Illumina HiSeq	Phase_I	261	7	NM_000187	0	0	0	0	0	A8K417|B2R8Z0	Missense_Mutation	SNP	ENST00000283871.5	37	CCDS3000.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829413	0.90955	.	.	ENSG00000113924	ENST00000283871;ENST00000476082	D;D	0.99023	-5.34;-5.34	6.02	6.02	0.97574	Cupin, RmlC-type (1);	0.119337	0.56097	D	0.000028	D	0.99086	0.9686	M	0.85542	2.76	0.80722	D	1	D	0.54601	0.967	P	0.54346	0.749	D	0.99497	1.0952	9	.	.	.	-0.0022	18.0346	0.89296	0.0:1.0:0.0:0.0	.	157	Q93099	HGD_HUMAN	L	157;116	ENSP00000283871:V157L;ENSP00000419560:V116L	.	V	-	1	0	HGD	121849414	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.405000	0.73272	2.865000	0.98341	0.655000	0.94253	GTT	.		0.353	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355410.1		Missense_Mutation
POLQ	10721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121168266	121168266	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr3:121168266T>C	ENST00000264233.5	-	26	7288	c.7160A>G	c.(7159-7161)tAt>tGt	p.Y2387C		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2387					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		AATGATCCCATAGCAAATCTG	0.358								DNA polymerases (catalytic subunits)																													p.Y2387C	Pancreas(152;907 1925 26081 31236 36904)	.											.	POLQ-664	0			c.A7160G						.						166.0	164.0	164.0					3																	121168266		2203	4300	6503	SO:0001583	missense	10721	exon26			ATCCCATAGCAAA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.7160A>G	3.37:g.121168266T>C	ENSP00000264233:p.Tyr2387Cys	Somatic	343	1		WXS	Illumina HiSeq	Phase_I	395	195	NM_199420	0	0	0	0	0	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.113078	0.77210	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	D	0.98221	-4.8	5.26	5.26	0.73747	DNA-directed DNA polymerase, family A, palm domain (2);DNA-directed DNA polymerase, family A, conserved site (1);	0.061290	0.64402	D	0.000002	D	0.99184	0.9717	M	0.93854	3.465	0.45502	D	0.99846	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99211	1.0876	10	0.87932	D	0	.	14.8334	0.70164	0.0:0.0:0.0:1.0	.	2387;1559	O75417;O75417-2	DPOLQ_HUMAN;.	C	2010;2387;2523	ENSP00000264233:Y2387C	ENSP00000264233:Y2387C	Y	-	2	0	POLQ	122650956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.345000	0.79337	1.968000	0.57251	0.533000	0.62120	TAT	.		0.358	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
KPNA4	3840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	160249255	160249255	+	Silent	SNP	A	A	G			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr3:160249255A>G	ENST00000334256.4	-	6	683	c.378T>C	c.(376-378)gaT>gaC	p.D126D		NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)	126					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CTCACTTGTCATCTCTTTCAA	0.303																																					p.D126D		.											.	KPNA4-226	0			c.T378C						.						78.0	85.0	83.0					3																	160249255		2202	4296	6498	SO:0001819	synonymous_variant	3840	exon6			CTTGTCATCTCTT	AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.378T>C	3.37:g.160249255A>G		Somatic	182	0		WXS	Illumina HiSeq	Phase_I	235	128	NM_002268	0	0	0	0	0	A8K4S6|D3DNM2|O00190	Silent	SNP	ENST00000334256.4	37	CCDS3191.1																																																																																			.		0.303	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352960.1	NM_002268	
DGKG	1608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	186006591	186006591	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr3:186006591G>A	ENST00000265022.3	-	6	991	c.452C>T	c.(451-453)tCt>tTt	p.S151F	DGKG_ENST00000344484.4_Missense_Mutation_p.S151F|DGKG_ENST00000382164.4_Missense_Mutation_p.S151F|DGKG_ENST00000544847.1_Missense_Mutation_p.S151F	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	151	Poly-Ser.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CGAGCTTGAAGACCGAGGGAC	0.552																																					p.S151F		.											.	DGKG-714	0			c.C452T						.						138.0	151.0	147.0					3																	186006591		2203	4300	6503	SO:0001583	missense	1608	exon6			CTTGAAGACCGAG	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.452C>T	3.37:g.186006591G>A	ENSP00000265022:p.Ser151Phe	Somatic	346	0		WXS	Illumina HiSeq	Phase_I	420	97	NM_001346	0	0	0	0	0	B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	ENST00000265022.3	37	CCDS3274.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439692	0.43326	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	5.74	1.92	0.25849	.	2.306020	0.01541	N	0.019244	T	0.42765	0.1217	L	0.38175	1.15	0.09310	N	1	B;B;B;B	0.31435	0.323;0.219;0.323;0.217	B;B;B;B	0.38378	0.272;0.188;0.272;0.092	T	0.20273	-1.0280	10	0.34782	T	0.22	.	3.4838	0.07611	0.1475:0.1347:0.5782:0.1396	.	151;151;151;151	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	F	151;151;151;151;154	ENSP00000265022:S151F;ENSP00000339777:S151F;ENSP00000371599:S151F;ENSP00000440507:S151F	ENSP00000265022:S151F	S	-	2	0	DGKG	187489285	0.974000	0.33945	0.001000	0.08648	0.025000	0.11179	3.286000	0.51724	0.139000	0.18822	0.563000	0.77884	TCT	.		0.552	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
MUC4	4585	broad.mit.edu	37	3	195516451	195516451	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr3:195516451G>C	ENST00000463781.3	-	2	2459	c.2000C>G	c.(1999-2001)cCa>cGa	p.P667R	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P667R|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	672					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAAGAACCTGGGGTGGTGAC	0.572																																					p.P667R													.	MUC4-90	0			c.C2000G						.						141.0	153.0	149.0					3																	195516451		2064	4199	6263	SO:0001583	missense	4585	exon2			GAACCTGGGGTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2000C>G	3.37:g.195516451G>C	ENSP00000417498:p.Pro667Arg	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	156	5	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	3.097	-0.185528	0.06340	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.57595	0.39;0.42	3.05	1.24	0.21308	.	2.959370	0.01480	N	0.016651	T	0.34571	0.0902	N	0.19112	0.55	0.09310	N	1	P;P	0.46020	0.871;0.523	B;B	0.37239	0.244;0.073	T	0.27536	-1.0071	10	0.27785	T	0.31	0.217	5.0874	0.14691	0.2807:0.0:0.7193:0.0	.	667;672	E7ESK3;Q99102	.;MUC4_HUMAN	R	667;667;641	ENSP00000417498:P667R;ENSP00000420243:P667R	ENSP00000376209:P641R	P	-	2	0	MUC4	197000846	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	1.099000	0.31013	0.333000	0.23563	-0.166000	0.13349	CCA	.		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
KLHL8	57563	broad.mit.edu;bcgsc.ca	37	4	88091355	88091355	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr4:88091355C>T	ENST00000273963.5	-	8	1754	c.1413G>A	c.(1411-1413)atG>atA	p.M471I	KLHL8_ENST00000498875.2_Missense_Mutation_p.M395I|KLHL8_ENST00000512111.1_Missense_Mutation_p.M471I|KLHL8_ENST00000545252.1_Missense_Mutation_p.M120I|KLHL8_ENST00000425278.2_Missense_Mutation_p.M288I	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	471					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		ATAAAGAAGCCATTCCATCAT	0.368																																					p.M471I													.	KLHL8-90	0			c.G1413A						.						87.0	83.0	84.0					4																	88091355		2203	4300	6503	SO:0001583	missense	57563	exon8			AGAAGCCATTCCA	AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1413G>A	4.37:g.88091355C>T	ENSP00000273963:p.Met471Ile	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	127	9	NM_020803	0	0	6	7	1	Q53XA3|Q6N018	Missense_Mutation	SNP	ENST00000273963.5	37	CCDS3617.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.492809	0.44352	.	.	ENSG00000145332	ENST00000273963;ENST00000498875;ENST00000425278;ENST00000545252;ENST00000512111	T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09	5.9	3.07	0.35406	Galactose oxidase, beta-propeller (1);	0.316179	0.33401	N	0.004948	T	0.49423	0.1556	N	0.04090	-0.28	0.26143	N	0.980252	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.28396	-1.0045	10	0.23891	T	0.37	.	3.0759	0.06246	0.3035:0.3389:0.0:0.3576	.	288;395;471	Q68DU9;Q6N018;Q9P2G9	.;.;KLHL8_HUMAN	I	471;395;288;120;471	ENSP00000273963:M471I;ENSP00000426451:M395I;ENSP00000408854:M288I;ENSP00000439514:M120I;ENSP00000424131:M471I	ENSP00000273963:M471I	M	-	3	0	KLHL8	88310379	0.994000	0.37717	1.000000	0.80357	0.979000	0.70002	0.363000	0.20301	0.294000	0.22547	0.563000	0.77884	ATG	.		0.368	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253040.1		
GRM4	2914	ucsc.edu	37	6	34100765	34100765	+	Missense_Mutation	SNP	C	C	T	rs375789000		TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr6:34100765C>T	ENST00000538487.2	-	2	952	c.509G>A	c.(508-510)cGc>cAc	p.R170H	GRM4_ENST00000374181.4_Missense_Mutation_p.R170H|GRM4_ENST00000374177.3_Intron	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	170					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.R170H(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CTTGAAGAGGCGAAGGATGTT	0.642																																					p.R170H													.	GRM4-525	2	Substitution - Missense(2)	prostate(2)	c.G509A						.	C	HIS/ARG	0,4406		0,0,2203	69.0	60.0	63.0		509	3.9	1.0	6		63	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRM4	NM_000841.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	170/913	34100765	1,13005	2203	4300	6503	SO:0001583	missense	2914	exon2			AAGAGGCGAAGGA	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.509G>A	6.37:g.34100765C>T	ENSP00000440556:p.Arg170His	Somatic	53	0		WXS	Illumina HiSeq		31	4	NM_001256811	0	0	0	0	0	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.550463	0.86127	0.0	1.16E-4	ENSG00000124493	ENST00000374181;ENST00000538487	D;D	0.83419	-1.72;-1.72	3.91	3.91	0.45181	GPCR, family 3, conserved site (1);Extracellular ligand-binding receptor (1);	0.071236	0.56097	U	0.000026	D	0.92077	0.7489	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.985;0.997;0.947	D	0.93784	0.7086	10	0.59425	D	0.04	.	15.6761	0.77326	0.0:1.0:0.0:0.0	.	170;170;170	B7ZLU9;A1L4F9;Q14833	.;.;GRM4_HUMAN	H	170	ENSP00000363296:R170H;ENSP00000440556:R170H	ENSP00000363296:R170H	R	-	2	0	GRM4	34208743	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.612000	0.82975	2.005000	0.58758	0.467000	0.42956	CGC	.		0.642	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
RUNX2	860	hgsc.bcm.edu;broad.mit.edu	37	6	45390466	45390466	+	Silent	SNP	A	A	G	rs575896136	byFrequency	TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr6:45390466A>G	ENST00000371438.1	+	2	553	c.195A>G	c.(193-195)caA>caG	p.Q65Q	RUNX2_ENST00000541979.1_Silent_p.Q133Q|RUNX2_ENST00000465038.2_Silent_p.Q65Q|RUNX2_ENST00000352853.5_Silent_p.Q133Q|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371432.3_Silent_p.Q51Q|RUNX2_ENST00000371436.6_Silent_p.Q65Q|RUNX2_ENST00000576263.1_Silent_p.Q65Q|RUNX2_ENST00000359524.5_Silent_p.Q51Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	65	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcaacagcagcagc	0.731													A|||	8	0.00159744	0.0023	0.0	5008	,	,		7675	0.002		0.0	False		,,,				2504	0.0031				p.Q65Q		.											.	RUNX2-417	0			c.A195G						.						10.0	15.0	14.0					6																	45390466		1452	3071	4523	SO:0001819	synonymous_variant	860	exon3			GCAGCAACAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.195A>G	6.37:g.45390466A>G		Somatic	46	0		WXS	Illumina HiSeq	Phase_I	48	4	NM_001024630	2	6	156	7180	7016	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	37	CCDS43467.2																																																																																			.		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
C7orf57	136288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	48081007	48081007	+	Silent	SNP	C	C	A			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr7:48081007C>A	ENST00000348904.3	+	3	344	c.132C>A	c.(130-132)ctC>ctA	p.L44L	C7orf57_ENST00000430738.1_Silent_p.L89L|C7orf57_ENST00000420324.1_Silent_p.L89L|C7orf57_ENST00000539619.1_Silent_p.L44L|C7orf57_ENST00000435376.1_5'UTR	NM_001100159.2	NP_001093629.1	Q8NEG2	CG057_HUMAN	chromosome 7 open reading frame 57	44										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	9						TCCCAGGTCTCAGCAATTTGG	0.542																																					p.L44L		.											.	C7orf57-1	0			c.C132A						.						51.0	55.0	54.0					7																	48081007		1920	4141	6061	SO:0001819	synonymous_variant	136288	exon3			AGGTCTCAGCAAT	BC031107	CCDS47583.1, CCDS59054.1, CCDS75594.1	7p12.3	2011-11-25			ENSG00000164746	ENSG00000164746			22247	protein-coding gene	gene with protein product							Standard	NM_001100159		Approved		uc003toh.5	Q8NEG2	OTTHUMG00000155808	ENST00000348904.3:c.132C>A	7.37:g.48081007C>A		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	100	46	NM_001100159	0	0	0	0	0	C9JBJ8	Silent	SNP	ENST00000348904.3	37	CCDS47583.1																																																																																			.		0.542	C7orf57-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341745.1	NM_001100159	
ST7	7982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116863027	116863027	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr7:116863027A>G	ENST00000265437.5	+	16	1965	c.1751A>G	c.(1750-1752)cAa>cGa	p.Q584R	ST7_ENST00000393447.4_Intron|ST7_ENST00000393449.1_Intron|ST7_ENST00000422922.1_Intron|ST7_ENST00000393446.2_Intron|ST7_ENST00000323984.3_Intron|ST7_ENST00000393443.1_Intron|ST7_ENST00000393451.3_Intron|ST7_ENST00000432298.1_Intron|ST7_ENST00000393444.3_Intron	NM_021908.2	NP_068708.1	Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		caacatttccaaaactgaact	0.517																																					p.Q584R		.											.	ST7-515	0			c.A1751G						.						86.0	86.0	86.0					7																	116863027		2203	4300	6503	SO:0001583	missense	7982	exon16			ATTTCCAAAACTG	AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000265437.5:c.1751A>G	7.37:g.116863027A>G	ENSP00000265437:p.Gln584Arg	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	84	42	NM_021908	0	0	17	67	50	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000265437.5	37	CCDS5770.1	.	.	.	.	.	.	.	.	.	.	A	11.22	1.575245	0.28092	.	.	ENSG00000004866	ENST00000265437	T	0.18174	2.23	4.5	-2.45	0.06481	.	0.926145	0.09155	N	0.840984	T	0.07548	0.0190	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16394	-1.0404	10	0.48119	T	0.1	-0.0371	5.8835	0.18868	0.2864:0.5195:0.1941:0.0	.	561;584	B7Z573;Q9NRC1	.;ST7_HUMAN	R	584	ENSP00000265437:Q584R	ENSP00000265437:Q584R	Q	+	2	0	ST7	116650263	0.048000	0.20356	0.982000	0.44146	0.470000	0.32858	-0.930000	0.03972	-0.261000	0.09405	-0.331000	0.08364	CAA	.		0.517	ST7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000141622.1	NM_021908	
POP1	10940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	99161148	99161148	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr8:99161148G>A	ENST00000401707.2	+	13	1897	c.1816G>A	c.(1816-1818)Gtg>Atg	p.V606M	POP1_ENST00000349693.3_Missense_Mutation_p.V606M	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	606					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GCCAGGAAAAGTGACTGGTGA	0.478																																					p.V606M		.											.	POP1-154	0			c.G1816A						.						83.0	72.0	76.0					8																	99161148		2203	4300	6503	SO:0001583	missense	10940	exon13			GGAAAAGTGACTG	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.1816G>A	8.37:g.99161148G>A	ENSP00000385787:p.Val606Met	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	47	16	NM_001145860	0	0	4	6	2	A8K5W9|Q15037	Missense_Mutation	SNP	ENST00000401707.2	37	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075851	0.36662	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.37411	1.2;1.2	5.46	4.58	0.56647	.	0.468009	0.23298	N	0.049711	T	0.25232	0.0613	L	0.38838	1.175	0.33165	D	0.54748	B	0.28233	0.204	B	0.21151	0.033	T	0.31420	-0.9944	10	0.41790	T	0.15	-5.9978	7.3479	0.26674	0.2299:0.0:0.7701:0.0	.	606	Q99575	POP1_HUMAN	M	606	ENSP00000385787:V606M;ENSP00000339529:V606M	ENSP00000339529:V606M	V	+	1	0	POP1	99230324	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.436000	0.52856	1.311000	0.45024	-0.150000	0.13652	GTG	.		0.478	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
ASPN	54829	hgsc.bcm.edu	37	9	95237030	95237030	+	Missense_Mutation	SNP	A	A	C	rs143279922		TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr9:95237030A>C	ENST00000375544.3	-	2	393	c.150T>G	c.(148-150)gaT>gaG	p.D50E	ASPN_ENST00000450139.2_Missense_Mutation_p.D22E|ASPN_ENST00000375543.1_Missense_Mutation_p.D50E|ASPN_ENST00000395538.3_Missense_Mutation_p.D50E|CENPP_ENST00000375587.3_Intron	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	50	Poly-Asp.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						TGTCCtcatcatcatcatcat	0.398																																					p.D50E		.											.	ASPN-514	0			c.T150G						.						112.0	102.0	105.0					9																	95237030		2203	4300	6503	SO:0001583	missense	54829	exon2			CTCATCATCATCA	AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.150T>G	9.37:g.95237030A>C	ENSP00000364694:p.Asp50Glu	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	34	5	NM_001193335	0	0	0	0	0	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	ENST00000375544.3	37		.	.	.	.	.	.	.	.	.	.	A	2.759	-0.258312	0.05791	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538;ENST00000450139	T;T;T	0.52983	0.64;0.69;0.69	3.41	-5.95	0.02241	.	1.551710	0.03954	N	0.288946	T	0.32645	0.0836	L	0.40543	1.245	0.09310	N	1	B;B	0.32245	0.361;0.001	B;B	0.27380	0.079;0.001	T	0.11941	-1.0567	10	0.22109	T	0.4	.	7.6964	0.28598	0.4608:0.1193:0.4198:0.0	.	50;50	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	E	50;50;50;22	ENSP00000364694:D50E;ENSP00000364693:D50E;ENSP00000378909:D50E	ENSP00000364693:D50E	D	-	3	2	ASPN	94276851	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-1.911000	0.01583	-2.152000	0.00794	-2.339000	0.00246	GAT	A|1.000;C|0.000		0.398	ASPN-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000053094.1	NM_017680	
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	113163288	113163288	+	Splice_Site	SNP	A	A	C			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr9:113163288A>C	ENST00000401783.2	-	40	10004	c.9668T>G	c.(9667-9669)cTt>cGt	p.L3223R	SVEP1_ENST00000374469.1_Splice_Site_p.L3200R|SVEP1_ENST00000297826.5_Splice_Site_p.L1149R	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3223	Sushi 30. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GGTTCCATCAAGCTAAGTGAC	0.358																																					p.L3223R		.											.	SVEP1-75	0			c.T9668G						.						71.0	69.0	70.0					9																	113163288		1863	4093	5956	SO:0001630	splice_region_variant	79987	exon40			CCATCAAGCTAAG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.9667-1T>G	9.37:g.113163288A>C		Somatic	110	1		WXS	Illumina HiSeq	Phase_I	102	33	NM_153366	0	0	0	0	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	A	11.59	1.682850	0.29872	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.64438	-0.1;-0.1;-0.1	5.77	0.841	0.18918	Complement control module (2);Sushi/SCR/CCP (3);	0.788063	0.11913	N	0.517487	T	0.50905	0.1643	L	0.43923	1.385	0.80722	D	1	P	0.38335	0.627	B	0.42827	0.399	T	0.35025	-0.9805	10	0.16420	T	0.52	.	4.5369	0.12038	0.4726:0.0:0.31:0.2173	.	3223	Q4LDE5	SVEP1_HUMAN	R	3223;3200;1149	ENSP00000384917:L3223R;ENSP00000363593:L3200R;ENSP00000297826:L1149R	ENSP00000297826:L1149R	L	-	2	0	SVEP1	112203109	0.984000	0.35163	0.995000	0.50966	0.842000	0.47809	1.505000	0.35736	-0.072000	0.12864	0.524000	0.50904	CTT	.		0.358	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Missense_Mutation
BEND2	139105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	18195783	18195783	+	Silent	SNP	A	A	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chrX:18195783A>T	ENST00000380033.4	-	10	1668	c.1536T>A	c.(1534-1536)atT>atA	p.I512I	BEND2_ENST00000380030.3_Silent_p.I421I	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	512	BEN 1. {ECO:0000255|PROSITE- ProRule:PRU00784}.									NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						TGGAGAACAAAATACGAACCA	0.428																																					p.I512I		.											.	BEND2-133	0			c.T1536A						.						267.0	253.0	258.0					X																	18195783		2203	4300	6503	SO:0001819	synonymous_variant	139105	exon10			GAACAAAATACGA	AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.1536T>A	X.37:g.18195783A>T		Somatic	265	0		WXS	Illumina HiSeq	Phase_I	291	207	NM_153346	0	0	0	0	0	E9PFY2|Q4V9S2|Q5JXE5	Silent	SNP	ENST00000380033.4	37	CCDS14184.1																																																																																			.		0.428	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346	
KDM6A	7403	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	44733231	44733231	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chrX:44733231A>T	ENST00000377967.4	+	2	264	c.223A>T	c.(223-225)Aag>Tag	p.K75*	KDM6A_ENST00000543216.1_Nonsense_Mutation_p.K75*|KDM6A_ENST00000382899.4_Nonsense_Mutation_p.K75*|KDM6A_ENST00000536777.1_Nonsense_Mutation_p.K75*	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	75	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0(8)|p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						CCTACTGGGCAAGGTAAGGCA	0.657			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.K75X	Colon(129;1273 1667 15230 27352 52914)			Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A-2748	14	No detectable mRNA/protein(8)|Whole gene deletion(6)	haematopoietic_and_lymphoid_tissue(6)|oesophagus(4)|breast(2)|pancreas(2)	c.A223T						.						68.0	56.0	60.0					X																	44733231		2203	4300	6503	SO:0001587	stop_gained	7403	exon2			CTGGGCAAGGTAA	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.223A>T	X.37:g.44733231A>T	ENSP00000367203:p.Lys75*	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	12	8	NM_021140	0	0	0	0	0	Q52LL9|Q5JVQ7	Nonsense_Mutation	SNP	ENST00000377967.4	37	CCDS14265.1	.	.	.	.	.	.	.	.	.	.	A	38	7.137178	0.98088	.	.	ENSG00000147050	ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216;ENST00000542299	.	.	.	4.84	4.84	0.62591	.	0.050879	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.8412	12.3196	0.54977	1.0:0.0:0.0:0.0	.	.	.	.	X	75	.	ENSP00000367203:K75X	K	+	1	0	KDM6A	44618175	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.813000	0.86123	1.584000	0.49913	0.486000	0.48141	AAG	.		0.657	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
MUL1	79594	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	20827614	20827614	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr1:20827614delG	ENST00000264198.3	-	4	764	c.628delC	c.(628-630)ctgfs	p.L210fs		NM_024544.2	NP_078820.2	Q969V5	MUL1_HUMAN	mitochondrial E3 ubiquitin protein ligase 1	210					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|cellular response to exogenous dsRNA (GO:0071360)|mitochondrial fission (GO:0000266)|mitochondrion localization (GO:0051646)|negative regulation of cell growth (GO:0030308)|negative regulation of chemokine (C-C motif) ligand 5 production (GO:0071650)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of innate immune response (GO:0045824)|negative regulation of mitochondrial fusion (GO:0010637)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein sumoylation (GO:0033235)|protein stabilization (GO:0050821)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)	cytoplasm (GO:0005737)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(5)	11		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		GGCGGCTGCAGGCGGACAGAG	0.607																																					p.L210fs		.											.	MUL1-90	0			c.628delC						.						87.0	84.0	85.0					1																	20827614		2203	4300	6503	SO:0001589	frameshift_variant	79594	exon4			.	BC014010	CCDS208.1	1p36.12	2013-01-11	2010-09-17	2008-03-26	ENSG00000090432	ENSG00000090432		"""RING-type (C3HC4) zinc fingers"""	25762	protein-coding gene	gene with protein product	"""ring finger protein 218"", ""mitochondria-anchored protein ligase"", ""growth inhibition and death E3 ligase"", ""mitochondrial ubiquitin ligase activator of NFKB 1"""	612037	"""chromosome 1 open reading frame 166"""	C1orf166		18591963, 12761501, 18213395, 18207745	Standard	NM_024544		Approved	FLJ12875, MULAN, RNF218, MAPL, GIDE	uc001bdi.4	Q969V5	OTTHUMG00000002838	ENST00000264198.3:c.628delC	1.37:g.20827614delG	ENSP00000264198:p.Leu210fs	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	142	45	NM_024544	0	0	0	0	0	B5M497|Q7Z431|Q9H9B5	Frame_Shift_Del	DEL	ENST00000264198.3	37	CCDS208.1																																																																																			.		0.607	MUL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007951.1	NM_024544	
KBTBD4	55709	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	47597183	47597183	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr11:47597183delT	ENST00000526005.1	-	3	811	c.658delA	c.(658-660)agafs	p.R220fs	KBTBD4_ENST00000430070.2_Frame_Shift_Del_p.R236fs|KBTBD4_ENST00000395288.2_Frame_Shift_Del_p.R220fs|NDUFS3_ENST00000533507.1_Intron|RNU5E-10P_ENST00000363506.1_RNA|KBTBD4_ENST00000533290.1_Frame_Shift_Del_p.R245fs|KBTBD4_ENST00000450908.1_5'Flank|KBTBD4_ENST00000525720.1_Frame_Shift_Del_p.R269fs			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	220	BACK.									NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						AAAGCCTCTCTTTCCTCTTTA	0.443																																					p.R236fs		.											.	KBTBD4-91	0			c.706delA						.						164.0	158.0	160.0					11																	47597183		2201	4298	6499	SO:0001589	frameshift_variant	55709	exon3			.	AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.658delA	11.37:g.47597183delT	ENSP00000433340:p.Arg220fs	Somatic	182	0		WXS	Illumina HiSeq	Phase_I	176	44	NM_018095	0	0	0	0	0	D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Frame_Shift_Del	DEL	ENST00000526005.1	37	CCDS7940.1																																																																																			.		0.443	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000391763.1	NM_016506	
MAPK8IP3	23162	hgsc.bcm.edu	37	16	1817800	1817807	+	Splice_Site	DEL	CCACAGGC	CCACAGGC	-	rs201517459|rs181043730	byFrequency	TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	CCACAGGC	CCACAGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr16:1817800_1817807delCCACAGGC	ENST00000250894.4	+	28	3563_3565	c.3406_3408delCCACAGGC	c.(3406-3408)ccadel	p.P1136fs	MAPK8IP3_ENST00000356010.5_Splice_Site_p.P1130fs	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	1136					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)	p.?(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						CCGCTCTCCCCCACAGGCACTGGCAAGC	0.654																																					p.1136_1136del		.											.	MAPK8IP3-1109	1	Unknown(1)	lung(1)	c.3407_3408del						.																																			SO:0001630	splice_region_variant	23162	exon28			.	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.3407-1CCACAGGC>-	16.37:g.1817800_1817807delCCACAGGC		Somatic	93	0		WXS	Illumina HiSeq	Phase_I	66	14	NM_015133	0	0	0	0	0	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Frame_Shift_Del	DEL	ENST00000250894.4	37	CCDS10442.2																																																																																			.		0.654	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439	Frame_Shift_Del
TNRC6A	27327	broad.mit.edu	37	16	24807240	24807240	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr16:24807240delA	ENST00000395799.3	+	9	3670	c.3541delA	c.(3541-3543)aaafs	p.K1182fs	TNRC6A_ENST00000315183.7_Frame_Shift_Del_p.K1182fs	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1182	Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TCTGAGTGGCAAAAAAAGGAG	0.398																																					p.K1181fs													.	TNRC6A-92	0			c.3541delA						.						243.0	224.0	231.0					16																	24807240		2197	4300	6497	SO:0001589	frameshift_variant	27327	exon9			AGTGGCAAAAAAA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.3541delA	16.37:g.24807240delA	ENSP00000379144:p.Lys1182fs	Somatic	260	0		WXS	Illumina HiSeq	Phase_I	312	7	NM_014494	0	0	0	0	0	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Frame_Shift_Del	DEL	ENST00000395799.3	37	CCDS10624.2																																																																																			.		0.398	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
ZNF559	84527	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9453288	9453288	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr19:9453288delA	ENST00000393883.2	+	6	1809	c.1161delA	c.(1159-1161)ggafs	p.G387fs	ZNF559_ENST00000586255.1_Intron|ZNF559_ENST00000317221.7_3'UTR|ZNF559_ENST00000603380.1_Frame_Shift_Del_p.G387fs|CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF177_ENST00000602856.1_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000538743.1_Frame_Shift_Del_p.G307fs|ZNF177_ENST00000446085.4_Intron|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000587557.1_Frame_Shift_Del_p.G451fs	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						AGGAATGTGGAAAAGCCTTTA	0.393																																					p.G451fs		.											.	ZNF559-91	0			c.1353delA						.						62.0	57.0	59.0					19																	9453288		2203	4300	6503	SO:0001589	frameshift_variant	84527	exon6			.	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.1161delA	19.37:g.9453288delA	ENSP00000377461:p.Gly387fs	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	72	20	NM_001202406	0	0	0	0	0	K7EMG6	Frame_Shift_Del	DEL	ENST00000393883.2	37	CCDS12211.1																																																																																			.		0.393	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	176637880	176637880	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr5:176637880delT	ENST00000439151.2	+	5	2525	c.2480delT	c.(2479-2481)attfs	p.I827fs	NSD1_ENST00000361032.4_Frame_Shift_Del_p.I724fs|NSD1_ENST00000354179.4_Frame_Shift_Del_p.I558fs|NSD1_ENST00000347982.4_Frame_Shift_Del_p.I558fs	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	827					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TTGGCCAGCATTTCTAAAAGT	0.413			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.I827fs		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1-188	0			c.2480delT						.						69.0	70.0	69.0					5																	176637880		2203	4300	6503	SO:0001589	frameshift_variant	64324	exon5	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	.	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.2480delT	5.37:g.176637880delT	ENSP00000395929:p.Ile827fs	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	49	13	NM_022455	0	0	0	0	0	Q96PD8|Q96RN7	Frame_Shift_Del	DEL	ENST00000439151.2	37	CCDS4412.1																																																																																			.		0.413	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
MYO6	4646	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	76542650	76542650	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr6:76542650delA	ENST00000369977.3	+	6	622	c.483delA	c.(481-483)acafs	p.T161fs	MYO6_ENST00000369985.4_Frame_Shift_Del_p.T161fs|MYO6_ENST00000369981.3_Frame_Shift_Del_p.T161fs|MYO6_ENST00000369975.1_Frame_Shift_Del_p.T161fs	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	161	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CAGAAAATACAAAATTTGTTC	0.413																																					p.T161fs		.											.	MYO6-92	0			c.483delA						.						74.0	80.0	78.0					6																	76542650		2203	4300	6503	SO:0001589	frameshift_variant	4646	exon6			.	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.483delA	6.37:g.76542650delA	ENSP00000358994:p.Thr161fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	140	43	NM_004999	0	0	0	0	0	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Frame_Shift_Del	DEL	ENST00000369977.3	37	CCDS34487.1																																																																																			.		0.413	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
LRBA	987	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	151271258	151271259	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr4:151271258_151271259insAT	ENST00000357115.3	-	49	7523_7524	c.7280_7281insAT	c.(7279-7281)attfs	p.I2427fs	LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000535741.1_Frame_Shift_Ins_p.I2416fs|LRBA_ENST00000507224.1_Frame_Shift_Ins_p.I2416fs|LRBA_ENST00000510413.1_Frame_Shift_Ins_p.I2416fs	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2427	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TATAGCCAAAAATGAGATCAAT	0.391																																					p.I2427fs		.											.	LRBA-157	0			c.7281_7282insAT						.																																			SO:0001589	frameshift_variant	987	exon49			.	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.7279_7280dupAT	4.37:g.151271259_151271260dupAT	ENSP00000349629:p.Ile2427fs	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	70	12	NM_006726	0	0	0	0	0	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Frame_Shift_Ins	INS	ENST00000357115.3	37	CCDS3773.1																																																																																			.		0.391	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
ZNF559	84527	bcgsc.ca	37	19	9453288	9453289	+	Missense_Mutation	DNP	AA	AA	GG			TCGA-BQ-7060-01A-11D-1961-08	TCGA-BQ-7060-11A-01D-1961-08	AA	AA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3a023a28-7d8a-4390-995a-a2a91db99ceb	4a037b1b-bb44-4cec-83b6-2c926f8e4859	g.chr19:9453288_9453289AA>GG	ENST00000393883.2	+	6	1809_1810	c.1161_1162AA>GG	c.(1159-1164)ggAAaa>ggGGaa	p.K388E	ZNF559_ENST00000586255.1_Intron|ZNF559_ENST00000317221.7_3'UTR|ZNF559_ENST00000603380.1_Missense_Mutation_p.K388E|CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF177_ENST00000602856.1_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000538743.1_Missense_Mutation_p.K308E|ZNF177_ENST00000446085.4_Intron|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000587557.1_Missense_Mutation_p.K452E	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						AGGAATGTGGAAAAGCCTTTAT	0.396																																					p.K388E													.	ZNF559-91	0			c.A1354G						.																																			SO:0001583	missense	84527	exon6			TGTGGAAAAGCCT	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	Exception_encountered	19.37:g.9453288_9453289delinsGG	ENSP00000377461:p.Lys388Glu	Somatic	67	0		WXS	Illumina HiSeq	Phase_1	72	20	NM_001202406	0	0	0	0	0	K7EMG6	Missense_Mutation	DNP	ENST00000393883.2	37	CCDS12211.1																																																																																			.		0.396	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
