#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACOT1	641371	hgsc.bcm.edu	37	14	74009978	74009978	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr14:74009978delC	ENST00000311148.4	+	3	1193	c.885delC	c.(883-885)gtcfs	p.V295fs	HEATR4_ENST00000560393.1_Intron|ACOT1_ENST00000557556.1_Frame_Shift_Del_p.V269fs|HEATR4_ENST00000553558.1_Intron|HEATR4_ENST00000334988.2_Intron	NM_001037161.1	NP_001032238.1	Q86TX2	ACOT1_HUMAN	acyl-CoA thioesterase 1	295					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(1)|lung(2)	4				OV - Ovarian serous cystadenocarcinoma(108;1.37e-45)|BRCA - Breast invasive adenocarcinoma(234;0.0033)		TTGTGGATGTCCTGAACAGCC	0.542																																																	0													40.0	29.0	33.0					14																	74009978		2195	4269	6464	SO:0001589	frameshift_variant	641371			DQ082754	CCDS32117.1	14q24.3	2013-09-20			ENSG00000184227	ENSG00000184227		"""Acyl CoA thioesterases"""	33128	protein-coding gene	gene with protein product		614313				16103133, 16940157	Standard	NM_001037161		Approved	ACH2, CTE-1, LACH2		Q86TX2	OTTHUMG00000171607	ENST00000311148.4:c.885delC	14.37:g.74009978delC	ENSP00000311224:p.Val295fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L173|Q3I5F9	Frame_Shift_Del	DEL	ENST00000311148.4	37	CCDS32117.1																																																																																				0.542	ACOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414432.1		NM_001037161	
ACOT2	10965	hgsc.bcm.edu	37	14	74041836	74041836	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr14:74041836delC	ENST00000238651.5	+	3	1253	c.1071delC	c.(1069-1071)gtcfs	p.V357fs	ACOT2_ENST00000538782.1_Frame_Shift_Del_p.V160fs|ACOT2_ENST00000557857.1_3'UTR	NM_006821.5	NP_006812.3	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2	357					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		TTGTGGATGTCCTGAACAGCC	0.537																																																	0													10.0	10.0	10.0					14																	74041836		1760	3653	5413	SO:0001589	frameshift_variant	10965			AY005822, AK001939	CCDS9816.1	14q24.3	2013-09-20			ENSG00000119673	ENSG00000119673		"""Acyl CoA thioesterases"""	18431	protein-coding gene	gene with protein product	"""mitochondrial acyl-CoA thioesterase 1"""	609972				16103133, 16940157	Standard	NM_006821		Approved	Mte1, ZAP128	uc001xon.5	P49753	OTTHUMG00000171608	ENST00000238651.5:c.1071delC	14.37:g.74041836delC	ENSP00000238651:p.Val357fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q3I5F8|Q53EK4|Q9NUX4	Frame_Shift_Del	DEL	ENST00000238651.5	37	CCDS9816.1																																																																																				0.537	ACOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414435.1		NM_006821	
ACTG1	71	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	79478982	79478982	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr17:79478982G>C	ENST00000575842.1	-	2	736	c.310C>G	c.(310-312)Ctg>Gtg	p.L104V	ACTG1_ENST00000573283.1_Missense_Mutation_p.L104V|RP13-766D20.2_ENST00000430912.1_RNA|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000575087.1_Missense_Mutation_p.L104V|ACTG1_ENST00000331925.2_Missense_Mutation_p.L104V			P63261	ACTG_HUMAN	actin, gamma 1	104					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)	p.L104V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			TCGGTCAGCAGCACTGGGTGC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											45.0	53.0	50.0					17																	79478982		2203	4299	6502	SO:0001583	missense	71				CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.310C>G	17.37:g.79478982G>C	ENSP00000458162:p.Leu104Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Silent	SNP	ENST00000575842.1	37	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080067	0.36662	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.96491	-4.03	4.51	0.954	0.19595	Actin/actin-like conserved site (1);	0.000000	0.56097	D	0.000038	D	0.98112	0.9377	M	0.93678	3.445	0.40613	D	0.981695	P	0.39665	0.682	D	0.67900	0.954	D	0.97158	0.9836	10	0.87932	D	0	.	5.7627	0.18209	0.1897:0.0:0.658:0.1523	.	104	P63261	ACTG_HUMAN	V	104	ENSP00000331514:L104V	ENSP00000331514:L104V	L	-	1	2	ACTG1	77093577	1.000000	0.71417	0.998000	0.56505	0.767000	0.43475	4.294000	0.59043	0.224000	0.20940	0.563000	0.77884	CTG		0.627	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2		NM_001614	
ADRB2	154	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	148207220	148207220	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr5:148207220G>C	ENST00000305988.4	+	1	1065	c.826G>C	c.(826-828)Ggc>Cgc	p.G276R		NM_000024.5	NP_000015	P07550	ADRB2_HUMAN	adrenoceptor beta 2, surface	276					activation of adenylate cyclase activity (GO:0007190)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|bone resorption (GO:0045453)|brown fat cell differentiation (GO:0050873)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|diet induced thermogenesis (GO:0002024)|endosome to lysosome transport (GO:0008333)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor-mediated endocytosis (GO:0006898)|regulation of sodium ion transport (GO:0002028)|regulation of vasodilation (GO:0042312)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta2-adrenergic receptor activity (GO:0004941)|norepinephrine binding (GO:0051380)|potassium channel regulator activity (GO:0015459)|protein homodimerization activity (GO:0042803)	p.G276R(1)		endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(3)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)	CAAGACGTTAGGCATCATCAT	0.522																																																	1	Substitution - Missense(1)	kidney(1)											114.0	103.0	106.0					5																	148207220		2203	4300	6503	SO:0001583	missense	154			AF022953	CCDS4292.1	5q31-q32	2012-08-08	2012-05-09		ENSG00000169252	ENSG00000169252		"""GPCR / Class A : Adrenoceptors : beta"""	286	protein-coding gene	gene with protein product		109690	"""adrenergic, beta-2-, receptor, surface"""	ADRB2R			Standard	NM_000024		Approved	ADRBR, BAR, B2AR	uc003lpr.2	P07550	OTTHUMG00000129933	ENST00000305988.4:c.826G>C	5.37:g.148207220G>C	ENSP00000305372:p.Gly276Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B0LPE4|B2R7X2|O14823|O14824|O14825|O14826|Q4JG18|Q53GA6|Q6GMT4|Q6P4D8|Q8NEQ9|Q96EC3|Q9UCZ0|Q9UCZ1|Q9UCZ2|Q9UCZ3|Q9UH95|Q9UHA1|Q9UMZ5	Missense_Mutation	SNP	ENST00000305988.4	37	CCDS4292.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156769	0.78114	.	.	ENSG00000169252	ENST00000305988	T	0.37752	1.18	5.3	5.3	0.74995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.77398	0.4124	H	0.98818	4.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86737	0.1952	10	0.87932	D	0	.	19.1566	0.93514	0.0:0.0:1.0:0.0	.	276	P07550	ADRB2_HUMAN	R	276	ENSP00000305372:G276R	ENSP00000305372:G276R	G	+	1	0	ADRB2	148187413	1.000000	0.71417	0.976000	0.42696	0.992000	0.81027	9.625000	0.98406	2.763000	0.94921	0.561000	0.74099	GGC		0.522	ADRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252189.1		NM_000024	
AKAP7	9465	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	131540937	131540937	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr6:131540937C>A	ENST00000431975.2	+	7	937	c.839C>A	c.(838-840)tCc>tAc	p.S280Y	AKAP7_ENST00000368123.4_Missense_Mutation_p.S258Y|AKAP7_ENST00000537868.1_Missense_Mutation_p.S16Y|AKAP7_ENST00000541650.1_Missense_Mutation_p.S279Y|AKAP7_ENST00000263050.3_Missense_Mutation_p.S16Y	NM_016377.3	NP_057461.2	Q9P0M2	AKA7G_HUMAN	A kinase (PRKA) anchor protein 7	280						cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|nucleotide binding (GO:0000166)|protein kinase A binding (GO:0051018)	p.S258Y(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|stomach(1)	13	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		TGTGAATCTTCCATTGTGATT	0.269																																																	1	Substitution - Missense(1)	kidney(1)											79.0	81.0	80.0					6																	131540937		2202	4299	6501	SO:0001583	missense	9465			AF047715	CCDS5142.1, CCDS5143.1, CCDS5144.1, CCDS5142.2	6q23.2	2012-10-24			ENSG00000118507	ENSG00000118507		"""A-kinase anchor proteins"""	377	protein-coding gene	gene with protein product		604693				9545239	Standard	NM_016377		Approved	AKAP18, AKAP15	uc003qck.4	O43687	OTTHUMG00000015563	ENST00000431975.2:c.839C>A	6.37:g.131540937C>A	ENSP00000405252:p.Ser280Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B4DUC3|Q9HCZ8	Missense_Mutation	SNP	ENST00000431975.2	37	CCDS5142.2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161866	0.78226	.	.	ENSG00000118507	ENST00000431975;ENST00000541650;ENST00000368123;ENST00000537868;ENST00000263050	T;T;T	0.67865	-0.29;-0.29;-0.29	5.77	5.77	0.91146	Protein kinase A anchor protein, RI-RII subunit-binding domain (1);	0.000000	0.64402	D	0.000002	T	0.68201	0.2975	L	0.27053	0.805	0.49389	D	0.999781	D;D	0.89917	1.0;1.0	D;D	0.81914	0.986;0.995	T	0.72814	-0.4179	10	0.87932	D	0	-6.6163	17.4919	0.87707	0.0:1.0:0.0:0.0	.	279;280	F5GXD1;Q9P0M2	.;AKA7G_HUMAN	Y	280;279;258;16;16	ENSP00000405252:S280Y;ENSP00000441048:S279Y;ENSP00000357105:S258Y	ENSP00000263050:S16Y	S	+	2	0	AKAP7	131582630	0.999000	0.42202	0.997000	0.53966	0.994000	0.84299	5.302000	0.65733	2.729000	0.93468	0.655000	0.94253	TCC		0.269	AKAP7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042209.2		NM_004842	
ARFGEF1	10565	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	68111271	68111271	+	Silent	SNP	A	A	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr8:68111271A>G	ENST00000262215.3	-	39	5837	c.5448T>C	c.(5446-5448)atT>atC	p.I1816I	ARFGEF1_ENST00000517955.1_5'UTR|ARFGEF1_ENST00000520381.1_Intron	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1816					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.I1816I(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GAAGTTCAGGAATCAAGTCAA	0.368																																																	1	Substitution - coding silent(1)	kidney(1)											132.0	127.0	129.0					8																	68111271		2203	4300	6503	SO:0001819	synonymous_variant	10565			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.5448T>C	8.37:g.68111271A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	ENST00000262215.3	37	CCDS6199.1																																																																																				0.368	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4		NM_006421	
ARID1A	8289	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	27107213	27107213	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:27107213T>C	ENST00000324856.7	+	20	7195	c.6824T>C	c.(6823-6825)aTt>aCt	p.I2275T	ARID1A_ENST00000540690.1_Missense_Mutation_p.I603T|ARID1A_ENST00000374152.2_Missense_Mutation_p.I1892T|ARID1A_ENST00000457599.2_Missense_Mutation_p.I2058T	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2275					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.I2275T(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TCACAAGTCATTTGTGATGTA	0.498			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Substitution - Missense(1)	kidney(1)											124.0	100.0	108.0					1																	27107213		2203	4300	6503	SO:0001583	missense	8289			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6824T>C	1.37:g.27107213T>C	ENSP00000320485:p.Ile2275Thr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.778358	0.49786	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	T;T;T;T	0.49432	0.78;0.78;3.8;0.78	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.60418	0.2267	L	0.52573	1.65	0.58432	D	0.999997	D;D;D	0.67145	0.991;0.985;0.996	P;P;D	0.64144	0.86;0.842;0.922	T	0.64702	-0.6345	10	0.87932	D	0	-5.294	14.4364	0.67284	0.0:0.0:0.0:1.0	.	1892;2275;2058	O14497-3;O14497;O14497-2	.;ARI1A_HUMAN;.	T	2275;2058;1892;603	ENSP00000320485:I2275T;ENSP00000387636:I2058T;ENSP00000363267:I1892T;ENSP00000442437:I603T	ENSP00000320485:I2275T	I	+	2	0	ARID1A	26979800	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.627000	0.83176	2.063000	0.61619	0.482000	0.46254	ATT		0.498	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2		NM_139135	
BANK1	55024	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	102751087	102751087	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr4:102751087T>A	ENST00000322953.4	+	2	467	c.193T>A	c.(193-195)Ttc>Atc	p.F65I	BANK1_ENST00000508653.1_Intron|BANK1_ENST00000504592.1_Missense_Mutation_p.F50I|BANK1_ENST00000428908.1_Intron|BANK1_ENST00000444316.2_Missense_Mutation_p.F35I	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	65	Interaction with ITPR2.				B cell activation (GO:0042113)			p.F65I(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		CTTGGAGAATTTCTCTTTTCG	0.368																																																	1	Substitution - Missense(1)	kidney(1)											80.0	82.0	81.0					4																	102751087		2203	4300	6503	SO:0001583	missense	55024			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.193T>A	4.37:g.102751087T>A	ENSP00000320509:p.Phe65Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	37	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	T	9.538	1.112733	0.20795	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000444316	T;T;T	0.08720	3.06;3.06;3.06	5.18	3.92	0.45320	.	0.824242	0.10599	N	0.655823	T	0.06371	0.0164	L	0.33485	1.01	0.09310	N	1	P;P	0.37276	0.589;0.589	B;B	0.30316	0.114;0.114	T	0.28073	-1.0055	10	0.23302	T	0.38	.	10.2487	0.43356	0.0:0.0:0.3029:0.697	.	65;50	Q8NDB2;Q8NDB2-2	BANK1_HUMAN;.	I	50;65;35	ENSP00000421443:F50I;ENSP00000320509:F65I;ENSP00000388817:F35I	ENSP00000320509:F65I	F	+	1	0	BANK1	102970110	0.000000	0.05858	0.089000	0.20774	0.797000	0.45037	0.458000	0.21892	1.950000	0.56595	0.528000	0.53228	TTC		0.368	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1		NM_017935	
BCAR3	8412	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	94048304	94048304	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:94048304T>C	ENST00000370244.1	-	9	1528	c.1240A>G	c.(1240-1242)Aag>Gag	p.K414E	BCAR3_ENST00000260502.6_Missense_Mutation_p.K414E|BCAR3_ENST00000539242.1_Missense_Mutation_p.K90E|BCAR3_ENST00000370243.1_Missense_Mutation_p.K414E|BCAR3_ENST00000370247.3_Missense_Mutation_p.K323E|BCAR3_ENST00000466632.1_5'UTR	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	414					lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)	p.K414E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		GAGGGAACCTTGAGGAACGGC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											67.0	60.0	62.0					1																	94048304		2203	4300	6503	SO:0001583	missense	8412			U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.1240A>G	1.37:g.94048304T>C	ENSP00000359264:p.Lys414Glu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Missense_Mutation	SNP	ENST00000370244.1	37	CCDS745.1	.	.	.	.	.	.	.	.	.	.	T	1.083	-0.666469	0.03428	.	.	ENSG00000137936	ENST00000370247;ENST00000260502;ENST00000370244;ENST00000370243;ENST00000539242	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	4.5	3.35	0.38373	.	0.365937	0.28354	N	0.015647	T	0.21468	0.0517	M	0.63428	1.95	0.41318	D	0.987152	B;B;B	0.24483	0.104;0.077;0.104	B;B;B	0.25140	0.058;0.028;0.058	T	0.17137	-1.0379	10	0.06494	T	0.89	-12.4328	11.5475	0.50702	0.0:0.0:0.1499:0.8501	.	194;414;323	B3KNL6;O75815;Q5TEW3	.;BCAR3_HUMAN;.	E	323;414;414;414;90	ENSP00000359267:K323E;ENSP00000260502:K414E;ENSP00000359264:K414E;ENSP00000359263:K414E;ENSP00000441343:K90E	ENSP00000260502:K414E	K	-	1	0	BCAR3	93820892	0.963000	0.33076	0.539000	0.28077	0.031000	0.12232	2.791000	0.47829	0.838000	0.34948	0.533000	0.62120	AAG		0.627	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028420.1			
BCAR3	8412	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	94048425	94048425	+	Silent	SNP	G	G	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:94048425G>T	ENST00000370244.1	-	9	1407	c.1119C>A	c.(1117-1119)gcC>gcA	p.A373A	BCAR3_ENST00000260502.6_Silent_p.A373A|BCAR3_ENST00000539242.1_Silent_p.A49A|BCAR3_ENST00000370243.1_Silent_p.A373A|BCAR3_ENST00000370247.3_Silent_p.A282A|BCAR3_ENST00000466632.1_5'UTR	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	373					lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)	p.A373A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		CTGGGCTCAGGGCAGGCTCGC	0.642																																																	1	Substitution - coding silent(1)	kidney(1)											44.0	45.0	45.0					1																	94048425		2203	4300	6503	SO:0001819	synonymous_variant	8412			U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.1119C>A	1.37:g.94048425G>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Silent	SNP	ENST00000370244.1	37	CCDS745.1																																																																																				0.642	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028420.1			
BDH2	56898	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	104000886	104000886	+	Silent	SNP	G	G	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr4:104000886G>T	ENST00000296424.4	-	10	831	c.711C>A	c.(709-711)gtC>gtA	p.V237V	SLC9B2_ENST00000339611.4_5'Flank|SLC9B2_ENST00000503230.1_5'Flank|SLC9B2_ENST00000394785.3_5'Flank	NM_020139.3	NP_064524.3	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	237					epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|heme metabolic process (GO:0042168)|iron ion homeostasis (GO:0055072)|siderophore biosynthetic process (GO:0019290)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)	p.V237V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		CATCAATGATGACAGGGTTAC	0.443																																																	1	Substitution - coding silent(1)	kidney(1)											130.0	113.0	119.0					4																	104000886		2203	4300	6503	SO:0001819	synonymous_variant	56898			AF164790	CCDS3663.1	4q24	2011-09-14			ENSG00000164039	ENSG00000164039	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	32389	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 15C, member 1"""		"""dehydrogenase/reductase (SDR family) member 6"""	DHRS6		16380372, 19027726	Standard	XM_005263140		Approved	UCPA-OR, FLJ13261, UNQ6308, PRO20933, SDR15C1	uc003hwz.3	Q9BUT1	OTTHUMG00000074039	ENST00000296424.4:c.711C>A	4.37:g.104000886G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K295|B4DUF6|Q503A0|Q6IA46|Q6UWD3|Q9H8S8|Q9NRX8	Silent	SNP	ENST00000296424.4	37	CCDS3663.1																																																																																				0.443	BDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157159.2		NM_020139	
SPRYD7	57213	broad.mit.edu;hgsc.bcm.edu	37	13	50489191	50489191	+	3'UTR	SNP	A	A	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr13:50489191A>G	ENST00000361840.3	-	0	703				SPRYD7_ENST00000378195.2_3'UTR	NM_020456.2	NP_065189.1	Q5W111	SPRY7_HUMAN	SPRY domain containing 7											haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)	6						TTTTAAAAACAAATACATTCA	0.294																																																	0													35.0	38.0	37.0					13																	50489191		2200	4290	6490	SO:0001624	3_prime_UTR_variant	0			AF055016	CCDS9422.1, CCDS45046.1	13q14.3	2011-05-25	2011-05-25	2011-05-25	ENSG00000123178	ENSG00000123178			14297	protein-coding gene	gene with protein product		607866	"""chromosome 13 open reading frame 1"""	C13orf1		11306461, 11771308	Standard	NM_020456		Approved	CLLD6	uc001vdl.2	Q5W111	OTTHUMG00000016924	ENST00000361840.3:c.*8T>C	13.37:g.50489191A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K3G1|O60648|Q8TBG8|Q96T69	RNA	SNP	ENST00000361840.3	37	CCDS9422.1																																																																																				0.294	SPRYD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044942.2		NM_020456	
WDR81	124997	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	1617206	1617206	+	5'Flank	SNP	C	C	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr17:1617206C>A	ENST00000309182.5	+	0	0				WDR81_ENST00000437219.2_5'Flank|WDR81_ENST00000446363.1_5'Flank|MIR22HG_ENST00000362190.1_lincRNA	NM_152348.3	NP_689561.2	Q562E7	WDR81_HUMAN	WD repeat domain 81						negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GGGCAGAGGGCAACAGTTCTT	0.572																																																	0													62.0	59.0	60.0					17																	1617206		1568	3582	5150	SO:0001631	upstream_gene_variant	0			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941		17.37:g.1617206C>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	RNA	SNP	ENST00000309182.5	37																																																																																					0.572	WDR81-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000338064.3		NM_152348	
CAMK1	8536	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	9809372	9809383	+	In_Frame_Del	DEL	TCGTAGATGTCT	TCGTAGATGTCT	-	rs372987743		TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	TCGTAGATGTCT	TCGTAGATGTCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr3:9809372_9809383delTCGTAGATGTCT	ENST00000256460.3	-	2	228_239	c.51_62delAGACATCTACGA	c.(49-63)agagacatctacgac>agc	p.17_21RDIYD>S		NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	17	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		ATCTCGGAAGTCGTAGATGTCTCTAATGTCCT	0.608																																																	0																																										SO:0001651	inframe_deletion	8536			L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.51_62delAGACATCTACGA	3.37:g.9809372_9809383delTCGTAGATGTCT	ENSP00000256460:p.Arg17_Asp21delinsSer	Somatic		WXS	Illumina HiSeq	Phase_I	Q3KPF6	In_Frame_Del	DEL	ENST00000256460.3	37	CCDS2582.1																																																																																				0.608	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1		NM_003656	
CCDC157	550631	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	30766638	30766638	+	Silent	SNP	C	C	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr22:30766638C>G	ENST00000405659.1	+	5	1453	c.744C>G	c.(742-744)ccC>ccG	p.P248P	CCDC157_ENST00000338306.3_Silent_p.P248P			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	248								p.P197P(1)|p.P248P(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						AGAACCTGCCCTCGTCCTTAG	0.657																																																	2	Substitution - coding silent(2)	kidney(2)											74.0	60.0	64.0					22																	30766638		2203	4300	6503	SO:0001819	synonymous_variant	550631			BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.744C>G	22.37:g.30766638C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q0VD76|Q9BYA4	Silent	SNP	ENST00000405659.1	37	CCDS33632.2																																																																																				0.657	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320936.1		NM_001017437	
CLSTN1	22883	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	9809930	9809930	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:9809930G>T	ENST00000377298.4	-	6	1483	c.691C>A	c.(691-693)Cat>Aat	p.H231N	CLSTN1_ENST00000377288.3_Missense_Mutation_p.H231N|CLSTN1_ENST00000361311.4_Missense_Mutation_p.H221N	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	231	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)	p.H231N(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		TTATATTGATGTTCTTTCCCG	0.423																																																	1	Substitution - Missense(1)	kidney(1)											202.0	172.0	182.0					1																	9809930		2203	4300	6503	SO:0001583	missense	22883			AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.691C>A	1.37:g.9809930G>T	ENSP00000366513:p.His231Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Missense_Mutation	SNP	ENST00000377298.4	37	CCDS30580.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.888137	0.33348	.	.	ENSG00000171603	ENST00000377298;ENST00000361311;ENST00000435891;ENST00000377288;ENST00000539822	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	5.97	5.05	0.67936	Cadherin (5);Cadherin-like (1);	0.341251	0.38720	N	0.001591	T	0.51126	0.1656	L	0.38692	1.165	0.45439	D	0.998416	B;B;B	0.22276	0.067;0.054;0.067	B;B;B	0.27380	0.079;0.047;0.079	T	0.51474	-0.8701	10	0.66056	D	0.02	-7.7848	15.4705	0.75437	0.0672:0.0:0.9328:0.0	.	231;221;231	B4E3Q1;O94985-2;O94985	.;.;CSTN1_HUMAN	N	231;221;51;231;231	ENSP00000366513:H231N;ENSP00000354997:H221N;ENSP00000401934:H51N;ENSP00000366502:H231N	ENSP00000354997:H221N	H	-	1	0	CLSTN1	9732517	1.000000	0.71417	0.224000	0.23877	0.148000	0.21650	6.570000	0.73996	2.835000	0.97688	0.591000	0.81541	CAT		0.423	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1			
CNTNAP4	85445	broad.mit.edu;hgsc.bcm.edu	37	16	76495979	76495979	+	Missense_Mutation	SNP	C	C	T	rs375548298		TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr16:76495979C>T	ENST00000476707.1	+	8	1608	c.1469C>T	c.(1468-1470)tCg>tTg	p.S490L	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S486L|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S414L|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S438L			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	487	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.S486L(1)|p.S462L(1)|p.S414L(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CAGATTTATTCGGGTGGCACC	0.493																																																	3	Substitution - Missense(3)	kidney(3)						C	LEU/SER,LEU/SER	0,4396		0,0,2198	55.0	52.0	53.0		1241,1459	1.6	0.0	16		53	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CNTNAP4	NM_138994.3,NM_033401.3	145,145	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	414/1236,487/1309	76495979	1,12995	2198	4300	6498	SO:0001583	missense	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1469C>T	16.37:g.76495979C>T	ENSP00000417628:p.Ser490Leu	Somatic		WXS	Illumina HiSeq	Phase_I	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	C	7.372	0.627055	0.14257	0.0	1.16E-4	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	4.64	1.57	0.23409	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.674592	0.11844	N	0.523983	T	0.63189	0.2490	.	.	.	0.28021	N	0.93453	B;B;B;B	0.19583	0.033;0.037;0.037;0.034	B;B;B;B	0.27170	0.077;0.022;0.032;0.045	T	0.56986	-0.7888	9	0.56958	D	0.05	.	5.7167	0.17964	0.1562:0.6812:0.0:0.1626	.	414;490;462;487	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	L	486;438;414;490	ENSP00000306893:S486L;ENSP00000439733:S438L;ENSP00000418741:S414L;ENSP00000417628:S490L	ENSP00000306893:S486L	S	+	2	0	CNTNAP4	75053480	0.860000	0.29831	0.004000	0.12327	0.098000	0.18820	2.132000	0.42083	0.274000	0.22072	-0.188000	0.12872	TCG		0.493	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1		NM_033401	
COL1A2	1278	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	94050324	94050324	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr7:94050324C>A	ENST00000297268.6	+	38	2770	c.2299C>A	c.(2299-2301)Cca>Aca	p.P767T		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	767			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.P767T(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CATTTAGGGTCCAAATGGTCC	0.443										HNSCC(75;0.22)																																							1	Substitution - Missense(1)	kidney(1)											154.0	140.0	145.0					7																	94050324		2203	4300	6503	SO:0001583	missense	1278			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2299C>A	7.37:g.94050324C>A	ENSP00000297268:p.Pro767Thr	Somatic		WXS	Illumina HiSeq	Phase_I	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174766	0.78452	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.96651	-4.08	5.63	5.63	0.86233	.	0.058954	0.64402	D	0.000001	D	0.96876	0.8980	M	0.71920	2.185	0.58432	D	0.999999	P	0.47841	0.901	P	0.49276	0.605	D	0.96988	0.9720	10	0.66056	D	0.02	.	20.0609	0.97674	0.0:1.0:0.0:0.0	.	767	P08123	CO1A2_HUMAN	T	767;768	ENSP00000297268:P767T	ENSP00000297268:P767T	P	+	1	0	COL1A2	93888260	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	3.868000	0.56055	2.824000	0.97209	0.655000	0.94253	CCA		0.443	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2		NM_000089	
CSMD2	114784	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	34052715	34052715	+	Missense_Mutation	SNP	C	C	T	rs143826784		TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:34052715C>T	ENST00000373381.4	-	45	7086	c.6910G>A	c.(6910-6912)Gtc>Atc	p.V2304I		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2306	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V2306I(2)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTCTCTGTGACGACTTCGGCG	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		18264	0.0		0.0	False		,,,				2504	0.001																2	Substitution - Missense(2)	kidney(1)|endometrium(1)						C	ILE/VAL	0,4406		0,0,2203	119.0	88.0	98.0		6916	4.7	1.0	1	dbSNP_134	98	1,8599	1.2+/-3.3	0,1,4299	no	missense	CSMD2	NM_052896.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	2306/3488	34052715	1,13005	2203	4300	6503	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.6910G>A	1.37:g.34052715C>T	ENSP00000362479:p.Val2304Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	C	13.82	2.351714	0.41700	0.0	1.16E-4	ENSG00000121904	ENST00000373381	T	0.64618	-0.11	5.84	4.74	0.60224	Complement control module (2);Sushi/SCR/CCP (3);	0.234554	0.37261	N	0.002173	T	0.37320	0.0999	N	0.05330	-0.07	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.11329	0.006;0.006	T	0.23797	-1.0178	10	0.27785	T	0.31	.	7.4865	0.27437	0.0:0.7891:0.0:0.2109	.	2306;2304	Q7Z408;E7EUA6	CSMD2_HUMAN;.	I	2304	ENSP00000362479:V2304I	ENSP00000241312:V2306I	V	-	1	0	CSMD2	33825302	0.762000	0.28451	0.989000	0.46669	0.990000	0.78478	1.094000	0.30951	2.764000	0.94973	0.655000	0.94253	GTC		0.527	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_052896	
CUL1	8454	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	148454216	148454216	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr7:148454216C>T	ENST00000325222.4	+	4	736	c.457C>T	c.(457-459)Cga>Tga	p.R153*	CUL1_ENST00000602748.1_Nonsense_Mutation_p.R153*|CUL1_ENST00000409469.1_Nonsense_Mutation_p.R153*	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	153					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)		p.R153*(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TGACGAAGGACGAAAAGGAAT	0.338																																																	1	Substitution - Nonsense(1)	kidney(1)											107.0	106.0	106.0					7																	148454216		2203	4300	6503	SO:0001587	stop_gained	8454			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.457C>T	7.37:g.148454216C>T	ENSP00000326804:p.Arg153*	Somatic		WXS	Illumina HiSeq	Phase_I	D3DWG3|O60719|Q08AL6|Q8IYW1	Nonsense_Mutation	SNP	ENST00000325222.4	37	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	C	40	8.318099	0.98757	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	.	.	.	5.26	3.39	0.38822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.7299	14.3252	0.66515	0.271:0.729:0.0:0.0	.	.	.	.	X	153;153;111;80	.	ENSP00000326804:R153X	R	+	1	2	CUL1	148085149	1.000000	0.71417	0.880000	0.34516	0.996000	0.88848	5.823000	0.69272	0.671000	0.31185	0.650000	0.86243	CGA		0.338	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1		NM_003592	
DSG4	147409	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	28972163	28972163	+	Nonsense_Mutation	SNP	C	C	T	rs267606777		TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr18:28972163C>T	ENST00000308128.4	+	8	1000	c.865C>T	c.(865-867)Cga>Tga	p.R289*	RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Nonsense_Mutation_p.R289*|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	289	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		Missing (in HYPT6). {ECO:0000269|PubMed:12705872, ECO:0000269|PubMed:15191570}.		anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R289*(2)		NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GGAACTGATACGATTACAAGC	0.343																																																	2	Substitution - Nonsense(2)	kidney(2)	GRCh37	CM061705	DSG4	M							127.0	125.0	126.0					18																	28972163		2203	4300	6503	SO:0001587	stop_gained	147409			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.865C>T	18.37:g.28972163C>T	ENSP00000311859:p.Arg289*	Somatic		WXS	Illumina HiSeq	Phase_I	A2RUI1|Q6Y9L9|Q8IXV4	Nonsense_Mutation	SNP	ENST00000308128.4	37	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	C	37	6.107777	0.97291	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	.	.	.	5.45	2.49	0.30216	.	0.000000	0.28595	N	0.014782	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1408	0.36903	0.4798:0.453:0.0:0.0673	.	.	.	.	X	289	.	ENSP00000311859:R289X	R	+	1	2	DSG4	27226161	0.768000	0.28519	0.932000	0.37286	0.939000	0.58152	0.838000	0.27572	0.764000	0.33197	-0.152000	0.13540	CGA		0.343	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1		NM_177986	
DUSP16	80824	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	12629998	12629998	+	Silent	SNP	A	A	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr12:12629998A>T	ENST00000228862.2	-	7	2398	c.1767T>A	c.(1765-1767)acT>acA	p.T589T	DUSP16_ENST00000298573.4_3'UTR|DUSP16_ENST00000545864.1_5'Flank	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	589					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.T589T(1)		endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		GGTCTCCGCAAGTGGGCAGCT	0.572																																					Ovarian(158;443 1896 15437 36069 46477)												1	Substitution - coding silent(1)	kidney(1)											80.0	84.0	83.0					12																	12629998		2203	4300	6503	SO:0001819	synonymous_variant	80824			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.1767T>A	12.37:g.12629998A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q547C7|Q96QS2|Q9C0G3	Silent	SNP	ENST00000228862.2	37	CCDS8650.1																																																																																				0.572	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400311.1		NM_030640	
EMILIN1	11117	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	27307380	27307380	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr2:27307380G>C	ENST00000380320.4	+	5	3037	c.2538G>C	c.(2536-2538)gaG>gaC	p.E846D	KHK_ENST00000260598.5_5'Flank|KHK_ENST00000260599.6_5'Flank	NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	846	Collagen-like.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.E846D(1)		breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACGGGCAAGAGGGCCCCATCG	0.697																																																	1	Substitution - Missense(1)	kidney(1)											37.0	42.0	41.0					2																	27307380		2202	4297	6499	SO:0001583	missense	11117			AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.2538G>C	2.37:g.27307380G>C	ENSP00000369677:p.Glu846Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	ENST00000380320.4	37	CCDS1733.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.822|4.822	0.152888|0.152888	0.09185|0.09185	.|.	.|.	ENSG00000138080|ENSG00000138080	ENST00000380320;ENST00000544143|ENST00000433140	D|.	0.93659|.	-3.26|.	4.82|4.82	-0.329|-0.329	0.12686|0.12686	.|.	1.371810|.	0.04399|.	N|.	0.363820|.	T|T	0.14874|0.14874	0.0359|0.0359	N|N	0.04373|0.04373	-0.215|-0.215	0.21256|0.21256	N|N	0.999745|0.999745	B;B|.	0.19073|.	0.009;0.033|.	B;B|.	0.19391|.	0.025;0.025|.	T|T	0.30995|0.30995	-0.9959|-0.9959	10|5	0.12766|.	T|.	0.61|.	-4.9249|-4.9249	7.7334|7.7334	0.28799|0.28799	0.616:0.0:0.384:0.0|0.616:0.0:0.384:0.0	.|.	177;846|.	Q96IH6;Q9Y6C2|.	.;EMIL1_HUMAN|.	D|T	846;177|177	ENSP00000369677:E846D|.	ENSP00000369677:E846D|.	E|R	+|+	3|2	2|0	EMILIN1|EMILIN1	27160884|27160884	0.502000|0.502000	0.26107|0.26107	0.307000|0.307000	0.25127|0.25127	0.585000|0.585000	0.36419|0.36419	0.754000|0.754000	0.26390|0.26390	0.015000|0.015000	0.14971|0.14971	0.462000|0.462000	0.41574|0.41574	GAG|AGG		0.697	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214185.1		NM_007046	
EMR3	84658	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	14755050	14755050	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr19:14755050C>T	ENST00000253673.5	-	9	1020	c.920G>A	c.(919-921)tGg>tAg	p.W307*	EMR3_ENST00000443157.2_Nonsense_Mutation_p.W181*|EMR3_ENST00000344373.4_Nonsense_Mutation_p.W255*|EMR3_ENST00000599900.1_Nonsense_Mutation_p.W92*	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	307	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.W307*(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						TGTGCTCTTCCAGTAGACACA	0.453																																																	1	Substitution - Nonsense(1)	kidney(1)											87.0	78.0	81.0					19																	14755050		2203	4300	6503	SO:0001587	stop_gained	84658			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.920G>A	19.37:g.14755050C>T	ENSP00000253673:p.Trp307*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000253673.5	37	CCDS12315.1	.	.	.	.	.	.	.	.	.	.	c	22.5	4.300073	0.81136	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	.	.	.	3.3	3.3	0.37823	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3895	0.44160	0.0:1.0:0.0:0.0	.	.	.	.	X	181;307;255	.	ENSP00000253673:W307X	W	-	2	0	EMR3	14616050	1.000000	0.71417	0.983000	0.44433	0.155000	0.21991	3.107000	0.50329	1.876000	0.54355	0.639000	0.83563	TGG		0.453	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1		NM_032571	
FAM19A4	151647	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	68802104	68802104	+	Missense_Mutation	SNP	G	G	A	rs267599929		TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr3:68802104G>A	ENST00000295569.7	-	4	688	c.196C>T	c.(196-198)Cgc>Tgc	p.R66C		NM_001005527.2|NM_182522.4	NP_001005527.1|NP_872328.1	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A4	66						extracellular region (GO:0005576)		p.R66C(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(5)|skin(2)	10		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		TCTTCTATGCGGTTCTTATTG	0.542																																																	1	Substitution - Missense(1)	kidney(1)											96.0	83.0	87.0					3																	68802104		2203	4300	6503	SO:0001583	missense	151647			AY325117	CCDS2907.1	3p14.1	2014-08-14			ENSG00000163377	ENSG00000163377			21591	protein-coding gene	gene with protein product						15028294, 25109685	Standard	NM_182522		Approved	TAFA-4	uc021xah.1	Q96LR4	OTTHUMG00000158744	ENST00000295569.7:c.196C>T	3.37:g.68802104G>A	ENSP00000295569:p.Arg66Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8MVT2	Missense_Mutation	SNP	ENST00000295569.7	37	CCDS2907.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099444	0.76983	.	.	ENSG00000163377	ENST00000295569;ENST00000495737	.	.	.	5.46	3.47	0.39725	.	0.106099	0.64402	D	0.000011	T	0.74891	0.3776	M	0.65975	2.015	0.39001	D	0.959341	D	0.71674	0.998	D	0.67900	0.954	T	0.80044	-0.1547	9	0.87932	D	0	-21.4951	13.6823	0.62493	0.0:0.0:0.5718:0.4282	.	66	Q96LR4	F19A4_HUMAN	C	66	.	ENSP00000295569:R66C	R	-	1	0	FAM19A4	68884794	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.973000	0.56845	1.285000	0.44548	0.591000	0.81541	CGC		0.542	FAM19A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352002.1		NM_182522	
FAM83B	222584	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	54805594	54805594	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr6:54805594C>T	ENST00000306858.7	+	5	1941	c.1825C>T	c.(1825-1827)Cca>Tca	p.P609S	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	609								p.P609S(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					GTCAGAGGCACCAAAAATGCA	0.433																																																	1	Substitution - Missense(1)	kidney(1)											53.0	51.0	52.0					6																	54805594		2199	4292	6491	SO:0001583	missense	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1825C>T	6.37:g.54805594C>T	ENSP00000304078:p.Pro609Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	C	0.271	-0.992976	0.02162	.	.	ENSG00000168143	ENST00000306858	T	0.26067	1.76	5.55	2.51	0.30379	.	2.366650	0.01361	N	0.012222	T	0.07052	0.0179	L	0.35723	1.085	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.17048	-1.0382	10	0.21014	T	0.42	-6.6606	5.0431	0.14469	0.1357:0.5328:0.0:0.3315	.	609	Q5T0W9	FA83B_HUMAN	S	609	ENSP00000304078:P609S	ENSP00000304078:P609S	P	+	1	0	FAM83B	54913553	0.000000	0.05858	0.021000	0.16686	0.131000	0.20780	0.088000	0.14979	0.683000	0.31428	-0.345000	0.07892	CCA		0.433	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1		XM_294139	
MTFR2	113115	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	136562720	136562720	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr6:136562720C>G	ENST00000420702.1	-	5	765	c.376G>C	c.(376-378)Gaa>Caa	p.E126Q	MTFR2_ENST00000451457.2_Missense_Mutation_p.E126Q	NM_001099286.1	NP_001092756.1	Q6P444	MTFR2_HUMAN	mitochondrial fission regulator 2	126					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	mitochondrion (GO:0005739)		p.E126Q(1)									TTCACAGTTTCTTTCTGTCTT	0.393																																																	1	Substitution - Missense(1)	kidney(1)											109.0	101.0	104.0					6																	136562720		2203	4300	6503	SO:0001583	missense	0			BC011716	CCDS5176.1	6q23.2	2012-11-30	2012-11-29	2012-11-29	ENSG00000146410	ENSG00000146410			21115	protein-coding gene	gene with protein product			"""DUF729 domain containing 1"", ""family with sequence similarity 54, member A"""	DUFD1, FAM54A			Standard	NM_138419		Approved		uc003qgt.1	Q6P444	OTTHUMG00000015643	ENST00000420702.1:c.376G>C	6.37:g.136562720C>G	ENSP00000395232:p.Glu126Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8D8|E1P585|Q5JWR7|Q6ZUE8|Q7L3U6|Q9BZ39	Missense_Mutation	SNP	ENST00000420702.1	37	CCDS5176.1	.	.	.	.	.	.	.	.	.	.	C	6.664	0.491122	0.12702	.	.	ENSG00000146410	ENST00000451457;ENST00000420702;ENST00000418509	T;T;T	0.51071	0.72;0.72;0.72	5.59	1.75	0.24633	.	0.646411	0.16608	N	0.207006	T	0.13243	0.0321	L	0.35542	1.07	0.09310	N	1	B	0.18013	0.025	B	0.22152	0.038	T	0.31971	-0.9924	10	0.16896	T	0.51	-4.9149	7.2146	0.25953	0.0:0.4223:0.0:0.5777	.	126	Q6P444	FA54A_HUMAN	Q	126;126;83	ENSP00000407010:E126Q;ENSP00000395232:E126Q;ENSP00000410861:E83Q	ENSP00000410861:E83Q	E	-	1	0	FAM54A	136604413	0.001000	0.12720	0.001000	0.08648	0.020000	0.10135	0.502000	0.22594	0.412000	0.25729	-0.672000	0.03802	GAA		0.393	MTFR2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042378.2		NM_138419	
FOXM1	2305	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	2983386	2983386	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr12:2983386T>A	ENST00000359843.3	-	2	327	c.259A>T	c.(259-261)Atc>Ttc	p.I87F	RHNO1_ENST00000489288.2_5'Flank|FOXM1_ENST00000361953.3_Missense_Mutation_p.I87F|FOXM1_ENST00000342628.2_Missense_Mutation_p.I87F|RHNO1_ENST00000461997.2_5'Flank|FOXM1_ENST00000537018.1_5'Flank	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	87					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.I87F(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GCTGTGATGATGCTGTGAATA	0.517																																																	1	Substitution - Missense(1)	kidney(1)											171.0	143.0	152.0					12																	2983386		2203	4300	6503	SO:0001583	missense	2305			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.259A>T	12.37:g.2983386T>A	ENSP00000352901:p.Ile87Phe	Somatic		WXS	Illumina HiSeq	Phase_I	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	ENST00000359843.3	37	CCDS8515.1	.	.	.	.	.	.	.	.	.	.	T	17.31	3.356026	0.61293	.	.	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.95238	-3.49;-3.65;-3.57	5.15	5.15	0.70609	.	0.110600	0.64402	D	0.000007	D	0.96651	0.8907	M	0.72118	2.19	0.46298	D	0.998975	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;0.999	D;D;D;D;D	0.76575	0.972;0.972;0.988;0.972;0.988	D	0.97163	0.9839	10	0.87932	D	0	.	14.3268	0.66526	0.0:0.0:0.0:1.0	.	87;87;87;87;87	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	F	87	ENSP00000342307:I87F;ENSP00000354492:I87F;ENSP00000352901:I87F	ENSP00000342307:I87F	I	-	1	0	FOXM1	2853647	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	2.273000	0.43381	2.160000	0.67779	0.533000	0.62120	ATC		0.517	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1		NM_021953	
FYB	2533	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	39202090	39202090	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr5:39202090G>C	ENST00000351578.6	-	2	1163	c.973C>G	c.(973-975)Cca>Gca	p.P325A	FYB_ENST00000512982.1_Missense_Mutation_p.P325A|FYB_ENST00000515010.1_Missense_Mutation_p.P325A|FYB_ENST00000505428.1_Missense_Mutation_p.P325A|FYB_ENST00000540520.1_Missense_Mutation_p.P335A	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	325					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)	p.P325A(3)|p.P335A(1)		endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			TGGCCCCATGGCCCCCCCACT	0.537																																																	4	Substitution - Missense(4)	kidney(4)											87.0	88.0	88.0					5																	39202090		1860	4091	5951	SO:0001583	missense	2533			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.973C>G	5.37:g.39202090G>C	ENSP00000316460:p.Pro325Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	ENST00000351578.6	37	CCDS47200.1	.	.	.	.	.	.	.	.	.	.	G	4.137	0.023806	0.08006	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.27402	1.68;1.68;1.67;1.67;1.71	5.93	4.17	0.49024	.	0.387702	0.25887	N	0.027656	T	0.26882	0.0658	L	0.60455	1.87	0.09310	N	0.999999	P;P	0.35745	0.518;0.518	B;B	0.31245	0.087;0.126	T	0.12604	-1.0541	10	0.37606	T	0.19	-2.01	9.6665	0.39988	0.2689:0.0:0.7311:0.0	.	335;325	B4DLN2;O15117	.;FYB_HUMAN	A	325;325;325;325;335;325	ENSP00000316460:P325A;ENSP00000426346:P325A;ENSP00000425845:P325A;ENSP00000427114:P325A;ENSP00000442840:P335A	ENSP00000316460:P325A	P	-	1	0	FYB	39237847	0.372000	0.25064	0.013000	0.15412	0.022000	0.10575	0.788000	0.26872	0.867000	0.35654	0.655000	0.94253	CCA		0.537	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1		NM_001465	
GBF1	8729	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	104126846	104126846	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr10:104126846G>C	ENST00000369983.3	+	20	2695	c.2435G>C	c.(2434-2436)tGt>tCt	p.C812S		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	812	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.C812S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		TTTCAGAATTGTAATGGCTCC	0.483																																																	1	Substitution - Missense(1)	kidney(1)											150.0	129.0	136.0					10																	104126846		2203	4300	6503	SO:0001583	missense	8729			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.2435G>C	10.37:g.104126846G>C	ENSP00000359000:p.Cys812Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.819791	0.32145	.	.	ENSG00000107862	ENST00000369983	T	0.77877	-1.13	5.68	5.68	0.88126	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.260239	0.45126	D	0.000398	T	0.65059	0.2655	L	0.31207	0.915	0.39800	D	0.972559	B;B;B	0.11235	0.002;0.004;0.001	B;B;B	0.17098	0.005;0.017;0.002	T	0.59637	-0.7417	10	0.07325	T	0.83	-8.4588	14.2554	0.66048	0.0:0.2663:0.7337:0.0	.	812;812;812	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	S	812	ENSP00000359000:C812S	ENSP00000359000:C812S	C	+	2	0	GBF1	104116836	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.523000	0.60545	2.676000	0.91093	0.563000	0.77884	TGT		0.483	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1			
GGN	199720	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	38876071	38876071	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr19:38876071C>T	ENST00000334928.6	-	3	1963	c.1831G>A	c.(1831-1833)Gtc>Atc	p.V611I	AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_5'UTR|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	611	Interactions with ZNF403/GGNBP2 and OAZ3. {ECO:0000250}.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)		p.V611I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CAGGCAGAGACGTTGCGTGGC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											48.0	37.0	41.0					19																	38876071		2203	4300	6503	SO:0001583	missense	199720			AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1831G>A	19.37:g.38876071C>T	ENSP00000334940:p.Val611Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	37	CCDS12516.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843468	0.71488	.	.	ENSG00000179168	ENST00000334928	.	.	.	3.57	3.57	0.40892	.	0.000000	0.36893	N	0.002345	T	0.48095	0.1481	L	0.29908	0.895	0.30575	N	0.763108	D	0.69078	0.997	D	0.70716	0.97	T	0.49418	-0.8942	9	0.59425	D	0.04	-7.9647	10.5283	0.44963	0.0:1.0:0.0:0.0	.	611	Q86UU5	GGN_HUMAN	I	611	.	ENSP00000334940:V611I	V	-	1	0	GGN	43567911	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.988000	0.49386	1.813000	0.52934	0.455000	0.32223	GTC		0.627	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1		NM_152657	
GPBAR1	151306	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	219127645	219127645	+	Silent	SNP	G	G	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr2:219127645G>T	ENST00000522678.1	+	2	1066	c.198G>T	c.(196-198)ctG>ctT	p.L66L	GPBAR1_ENST00000479077.1_Silent_p.L66L|GPBAR1_ENST00000519574.1_Silent_p.L66L|GPBAR1_ENST00000521462.1_Silent_p.L66L	NM_001077191.1	NP_001070659.1	Q8TDU6	GPBAR_HUMAN	G protein-coupled bile acid receptor 1	66					cell surface bile acid receptor signaling pathway (GO:0038184)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid receptor activity (GO:0038181)|G-protein coupled bile acid receptor activity (GO:0038182)	p.L66L(2)		cervix(1)|kidney(1)|large_intestine(1)|ovary(1)	4		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCACGGGTCTGGCATTGCCCA	0.652																																																	2	Substitution - coding silent(2)	kidney(2)											46.0	52.0	50.0					2																	219127645		2138	4241	6379	SO:0001819	synonymous_variant	151306			AB086170	CCDS46515.1	2q35	2012-08-08			ENSG00000179921	ENSG00000179921			19680	protein-coding gene	gene with protein product		610147				12419312	Standard	NM_170699		Approved	BG37, GPCR, TGR5, M-BAR, GPCR19, GPR131, MGC40597	uc010zjw.1	Q8TDU6	OTTHUMG00000155203	ENST00000522678.1:c.198G>T	2.37:g.219127645G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B3KV35	Silent	SNP	ENST00000522678.1	37	CCDS46515.1																																																																																				0.652	GPBAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338767.3		NM_001077191	
GPR123	84435	broad.mit.edu;hgsc.bcm.edu	37	10	134942620	134942620	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr10:134942620C>G	ENST00000392607.3	+	7	1724	c.1288C>G	c.(1288-1290)Cca>Gca	p.P430A	GPR123_ENST00000392606.2_Missense_Mutation_p.P333A|GPR123_ENST00000607359.1_Missense_Mutation_p.P1149A	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	430					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P1149A(1)|p.P430A(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		TAGCCGGCACCCAGCAGAGGA	0.692																																																	2	Substitution - Missense(2)	kidney(2)											12.0	12.0	12.0					10																	134942620		2121	4199	6320	SO:0001583	missense	84435			AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.1288C>G	10.37:g.134942620C>G	ENSP00000376384:p.Pro430Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000392607.3	37	CCDS41580.1	.	.	.	.	.	.	.	.	.	.	.	0.348	-0.946643	0.02304	.	.	ENSG00000197177	ENST00000368577;ENST00000392607;ENST00000392606	T	0.03524	3.9	4.39	-1.42	0.08913	.	1.919140	0.03524	N	0.221412	T	0.01592	0.0051	N	0.00801	-1.175	0.09310	N	1	B;B	0.20261	0.001;0.043	B;B	0.17722	0.0;0.019	T	0.45056	-0.9287	10	0.54805	T	0.06	-2.1691	6.13	0.20199	0.1333:0.2608:0.5229:0.083	.	430;1149	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	A	1149;430;334	ENSP00000376384:P430A	ENSP00000357566:P1149A	P	+	1	0	GPR123	134792610	0.004000	0.15560	0.000000	0.03702	0.079000	0.17450	0.425000	0.21346	-0.534000	0.06315	0.561000	0.74099	CCA		0.692	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2			
GTF2I	2969	hgsc.bcm.edu	37	7	74149837	74149840	+	Frame_Shift_Del	DEL	AAGA	AAGA	-			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	AAGA	AAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr7:74149837_74149840delAAGA	ENST00000324896.4	+	17	1787_1790	c.1398_1401delAAGA	c.(1396-1401)ttaagafs	p.LR466fs	GTF2I_ENST00000346152.4_Frame_Shift_Del_p.LR445fs|GTF2I_ENST00000416070.1_Frame_Shift_Del_p.LR425fs|GTF2I_ENST00000353920.4_Frame_Shift_Del_p.LR446fs	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	466					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						TCACTAAATTAAGAAAGATGGTGG	0.275																																																	0									,,,,	4,1578		1,2,788					,,,,	4.4	0.1			2	20,2954		3,14,1470	no	frameshift,frameshift,frameshift,frameshift,frameshift	GTF2I	NM_033001.2,NM_033000.2,NM_032999.2,NM_001518.3,NM_001163636.1	,,,,	4,16,2258	A1A1,A1R,RR		0.6725,0.2528,0.5268	,,,,	,,,,		24,4532				SO:0001589	frameshift_variant	2969			U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1398_1401delAAGA	7.37:g.74149841_74149844delAAGA	ENSP00000322542:p.Leu466fs	Somatic		WXS	Illumina HiSeq	Phase_I	O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Frame_Shift_Del	DEL	ENST00000324896.4	37	CCDS5573.1																																																																																				0.275	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252708.1		NM_032999	
MROH2B	133558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	41065513	41065513	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr5:41065513T>G	ENST00000399564.4	-	4	731	c.281A>C	c.(280-282)gAa>gCa	p.E94A		NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	94								p.E94A(1)									ACTTTGTACTTCATACATCAC	0.428																																																	1	Substitution - Missense(1)	kidney(1)											88.0	82.0	84.0					5																	41065513		1924	4143	6067	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.281A>C	5.37:g.41065513T>G	ENSP00000382476:p.Glu94Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.428356	0.83667	.	.	ENSG00000171495	ENST00000399564	T	0.08193	3.12	6.16	6.16	0.99307	Armadillo-type fold (1);	0.000000	0.64402	D	0.000012	T	0.28234	0.0697	M	0.73962	2.25	0.37081	D	0.899008	D	0.71674	0.998	D	0.81914	0.995	T	0.09443	-1.0674	10	0.48119	T	0.1	.	13.1979	0.59749	0.0:0.0:0.0:1.0	.	94	Q7Z745	HTRB2_HUMAN	A	94	ENSP00000382476:E94A	ENSP00000382476:E94A	E	-	2	0	HEATR7B2	41101270	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.868000	0.56055	2.367000	0.80283	0.528000	0.53228	GAA		0.428	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2		NM_173489	
IGF2R	3482	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	160471666	160471666	+	Silent	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr6:160471666C>T	ENST00000356956.1	+	19	2824	c.2676C>T	c.(2674-2676)gtC>gtT	p.V892V		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	892					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.V892V(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TCCATCTCGTCTGCTCCAGGG	0.557																																																	1	Substitution - coding silent(1)	kidney(1)											59.0	50.0	53.0					6																	160471666		2203	4300	6503	SO:0001819	synonymous_variant	3482			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.2676C>T	6.37:g.160471666C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	37	CCDS5273.1																																																																																				0.557	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1		NM_000876	
IPO11	51194	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	61779118	61779118	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr5:61779118A>C	ENST00000325324.6	+	10	1188	c.1019A>C	c.(1018-1020)gAa>gCa	p.E340A	KIF2A_ENST00000509663.2_Intron|IPO11_ENST00000409296.3_Missense_Mutation_p.E380A	NM_016338.4	NP_057422.3	Q9UI26	IPO11_HUMAN	importin 11	340					ribosomal protein import into nucleus (GO:0006610)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)	p.E340A(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(14)|skin(4)|stomach(2)	30		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		AAAAATTTTGAAGGTAATTCC	0.264																																																	1	Substitution - Missense(1)	kidney(1)											35.0	35.0	35.0					5																	61779118		2201	4288	6489	SO:0001583	missense	51194			AF111109	CCDS34167.1, CCDS47217.1	5q12.1	2008-09-19			ENSG00000086200	ENSG00000086200		"""Importins"""	20628	protein-coding gene	gene with protein product		610889					Standard	NM_016338		Approved	RanBP11	uc011cqr.2	Q9UI26	OTTHUMG00000154400	ENST00000325324.6:c.1019A>C	5.37:g.61779118A>C	ENSP00000316651:p.Glu340Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGJ5|B4DZ73|D3DW98|Q8N5R2|Q9NSJ6|Q9NVB1	Missense_Mutation	SNP	ENST00000325324.6	37	CCDS34167.1	.	.	.	.	.	.	.	.	.	.	A	16.79	3.221335	0.58560	.	.	ENSG00000086200	ENST00000325324;ENST00000409296	T;T	0.25414	1.81;1.8	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.137970	0.64402	D	0.000003	T	0.26557	0.0649	L	0.51914	1.62	0.80722	D	1	B;B	0.22909	0.077;0.026	B;B	0.17722	0.019;0.014	T	0.02588	-1.1137	10	0.40728	T	0.16	.	15.6779	0.77341	1.0:0.0:0.0:0.0	.	380;340	Q9UI26-2;Q9UI26	.;IPO11_HUMAN	A	340;380	ENSP00000316651:E340A;ENSP00000386992:E380A	ENSP00000316651:E340A	E	+	2	0	IPO11	61814875	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.595000	0.90840	2.153000	0.67306	0.528000	0.53228	GAA		0.264	IPO11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335062.1		NM_016338	
KANK1	23189	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	732501	732501	+	Silent	SNP	T	T	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr9:732501T>C	ENST00000382303.1	+	10	3781	c.3129T>C	c.(3127-3129)acT>acC	p.T1043T	KANK1_ENST00000382293.3_Silent_p.T885T|KANK1_ENST00000382297.2_Silent_p.T1043T|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1043					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)	p.T1043T(1)|p.T885T(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		ATGAAGACACTCGGGGAATGG	0.473																																																	2	Substitution - coding silent(2)	kidney(2)											174.0	153.0	160.0					9																	732501		2203	4300	6503	SO:0001819	synonymous_variant	23189			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3129T>C	9.37:g.732501T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	ENST00000382303.1	37	CCDS34976.1																																																																																				0.473	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2		NM_015158	
KCNH7	90134	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	163236424	163236424	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr2:163236424T>G	ENST00000332142.5	-	14	3169	c.3070A>C	c.(3070-3072)Agc>Cgc	p.S1024R		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	1024					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.S1024R(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GTGAGGTCGCTTTCGGTTTCA	0.507																																					GBM(196;1492 2208 17507 24132 45496)												1	Substitution - Missense(1)	kidney(1)											192.0	180.0	184.0					2																	163236424		2203	4300	6503	SO:0001583	missense	90134			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.3070A>C	2.37:g.163236424T>G	ENSP00000331727:p.Ser1024Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.022667	0.54683	.	.	ENSG00000184611	ENST00000332142	D	0.87103	-2.21	5.97	5.97	0.96955	.	0.186437	0.64402	D	0.000017	T	0.77246	0.4102	N	0.19112	0.55	0.80722	D	1	P	0.42409	0.779	B	0.33690	0.168	T	0.78033	-0.2362	10	0.30854	T	0.27	.	16.4383	0.83889	0.0:0.0:0.0:1.0	.	1024	Q9NS40	KCNH7_HUMAN	R	1024	ENSP00000331727:S1024R	ENSP00000331727:S1024R	S	-	1	0	KCNH7	162944670	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.707000	0.74654	2.287000	0.76781	0.482000	0.46254	AGC		0.507	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1		NM_033272	
KLHL21	9903	broad.mit.edu;hgsc.bcm.edu	37	1	6655551	6655551	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:6655551C>T	ENST00000377658.4	-	3	1545	c.1494G>A	c.(1492-1494)atG>atA	p.M498I	KLHL21_ENST00000467612.1_Missense_Mutation_p.M131I|KLHL21_ENST00000377663.3_Missense_Mutation_p.M498I|KLHL21_ENST00000463043.1_Missense_Mutation_p.M131I	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	498					chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)		p.M498I(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		TTACCTGATTCATGGACGGGA	0.552																																																	1	Substitution - Missense(1)	kidney(1)											126.0	105.0	112.0					1																	6655551		2203	4300	6503	SO:0001583	missense	9903			AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.1494G>A	1.37:g.6655551C>T	ENSP00000366886:p.Met498Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Missense_Mutation	SNP	ENST00000377658.4	37	CCDS30575.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366411	0.82463	.	.	ENSG00000162413	ENST00000377658;ENST00000377663	T;T	0.67865	-0.29;-0.29	4.93	4.01	0.46588	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.70657	0.3249	M	0.88775	2.98	0.80722	D	1	B;B	0.33637	0.064;0.42	B;B	0.32289	0.019;0.143	T	0.75354	-0.3347	10	0.59425	D	0.04	.	13.3074	0.60359	0.0:0.9219:0.0:0.0781	.	498;498	Q9UJP4;Q9UJP4-2	KLH21_HUMAN;.	I	498	ENSP00000366886:M498I;ENSP00000366891:M498I	ENSP00000366886:M498I	M	-	3	0	KLHL21	6578138	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.587000	0.82613	1.382000	0.46385	0.655000	0.94253	ATG		0.552	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004188.1		NM_014851	
LMTK2	22853	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	97766647	97766647	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr7:97766647G>A	ENST00000297293.5	+	2	417	c.124G>A	c.(124-126)Gaa>Aaa	p.E42K	LMTK2_ENST00000493372.1_3'UTR	NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	42					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)	p.E42K(2)		NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					ACCTGCTGCAGAAGTTTCCTC	0.348																																																	2	Substitution - Missense(2)	kidney(2)											77.0	77.0	77.0					7																	97766647		2203	4300	6503	SO:0001583	missense	22853			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.124G>A	7.37:g.97766647G>A	ENSP00000297293:p.Glu42Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	ENST00000297293.5	37	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601977	0.87055	.	.	ENSG00000164715	ENST00000297293	T	0.78246	-1.16	5.12	5.12	0.69794	.	0.198328	0.45126	D	0.000396	T	0.81564	0.4849	L	0.38175	1.15	0.36122	D	0.845521	D	0.76494	0.999	D	0.65987	0.94	T	0.81267	-0.1010	10	0.22109	T	0.4	.	17.5682	0.87927	0.0:0.0:1.0:0.0	.	42	Q8IWU2	LMTK2_HUMAN	K	42	ENSP00000297293:E42K	ENSP00000297293:E42K	E	+	1	0	LMTK2	97604583	1.000000	0.71417	0.843000	0.33291	0.987000	0.75469	5.268000	0.65536	2.379000	0.81126	0.591000	0.81541	GAA		0.348	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1		NM_014916	
NRROS	375387	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	196387275	196387275	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr3:196387275C>T	ENST00000328557.4	+	3	964	c.761C>T	c.(760-762)aCg>aTg	p.T254M		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	254					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T254M(1)									GAGCTGGAGACGCTGGACCTG	0.632																																																	1	Substitution - Missense(1)	kidney(1)											71.0	72.0	72.0					3																	196387275		2203	4300	6503	SO:0001583	missense	375387			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.761C>T	3.37:g.196387275C>T	ENSP00000328625:p.Thr254Met	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000328557.4	37	CCDS3319.1	.	.	.	.	.	.	.	.	.	.	C	6.210	0.406983	0.11754	.	.	ENSG00000174004	ENST00000328557	T	0.01034	5.42	5.95	-0.893	0.10567	.	0.540943	0.21192	N	0.078628	T	0.01287	0.0042	L	0.61218	1.895	0.24949	N	0.991804	B	0.26775	0.159	B	0.20955	0.032	T	0.39921	-0.9590	10	0.30854	T	0.27	.	12.5769	0.56369	0.0:0.3686:0.0:0.6314	.	254	Q86YC3	LRC33_HUMAN	M	254	ENSP00000328625:T254M	ENSP00000328625:T254M	T	+	2	0	LRRC33	197871672	0.005000	0.15991	0.034000	0.17996	0.754000	0.42855	0.186000	0.16978	-0.508000	0.06540	-0.137000	0.14449	ACG		0.632	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1		NM_198565	
MAOA	4128	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	43571993	43571993	+	Silent	SNP	A	A	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chrX:43571993A>G	ENST00000338702.3	+	5	576	c.453A>G	c.(451-453)aaA>aaG	p.K151K	MAOA_ENST00000542639.1_Silent_p.K18K|MAOA_ENST00000497485.1_3'UTR	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	151					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)	p.K151K(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	ATGCTGACAAATGGGACAAAA	0.438																																																	1	Substitution - coding silent(1)	kidney(1)											114.0	94.0	101.0					X																	43571993		2203	4299	6502	SO:0001819	synonymous_variant	4128				CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.453A>G	X.37:g.43571993A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4DF46|Q16426	Silent	SNP	ENST00000338702.3	37	CCDS14260.1																																																																																				0.438	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056300.1		NM_000240	
MCCC2	64087	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	70945080	70945080	+	Splice_Site	SNP	G	G	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr5:70945080G>A	ENST00000340941.6	+	14	1502	c.1373G>A	c.(1372-1374)aGc>aAc	p.S458N	MCCC2_ENST00000323375.8_Splice_Site_p.S420N	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)	458	Carboxyltransferase.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)	p.S458N(1)		endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	AGAGCATATAGGTAGGTGTCA	0.438																																																	1	Substitution - Missense(1)	kidney(1)											75.0	74.0	74.0					5																	70945080		2203	4300	6503	SO:0001630	splice_region_variant	64087			AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.1373+1G>A	5.37:g.70945080G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NIY9|Q96C27|Q9Y4L7	Missense_Mutation	SNP	ENST00000340941.6	37	CCDS34184.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339590	0.41398	.	.	ENSG00000131844	ENST00000340941;ENST00000323375;ENST00000509539	D;D;D	0.97642	-3.14;-3.14;-4.47	5.35	3.44	0.39384	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.185450	0.56097	D	0.000027	D	0.95723	0.8609	L	0.58669	1.825	0.80722	D	1	B	0.27498	0.18	B	0.37451	0.25	D	0.94362	0.7588	10	0.56958	D	0.05	-17.9784	10.0559	0.42244	0.0868:0.1517:0.7616:0.0	.	458	Q9HCC0	MCCB_HUMAN	N	458;420;230	ENSP00000343657:S458N;ENSP00000327308:S420N;ENSP00000425474:S230N	ENSP00000327308:S420N	S	+	2	0	MCCC2	70980836	1.000000	0.71417	0.113000	0.21522	0.038000	0.13279	7.919000	0.87513	1.258000	0.44101	0.650000	0.86243	AGC		0.438	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369243.4			Missense_Mutation
MPZL2	10205	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	118133279	118133279	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr11:118133279A>G	ENST00000278937.2	-	3	438	c.310T>C	c.(310-312)Tac>Cac	p.Y104H	MPZL2_ENST00000525647.1_5'Flank|MPZL2_ENST00000438295.2_Missense_Mutation_p.Y104H	NM_005797.3	NP_005788.1	O60487	MPZL2_HUMAN	myelin protein zero-like 2	104	Ig-like V-type.				anatomical structure morphogenesis (GO:0009653)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)|T cell differentiation in thymus (GO:0033077)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y104H(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|skin(1)	11	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		GAGGCATCGTACCGCTCAGGA	0.527																																																	1	Substitution - Missense(1)	kidney(1)											136.0	103.0	114.0					11																	118133279		2200	4296	6496	SO:0001583	missense	10205			AF275945	CCDS8393.1	11q24	2013-01-11	2007-08-01	2007-08-01		ENSG00000149573		"""Immunoglobulin superfamily / V-set domain containing"""	3496	protein-coding gene	gene with protein product		604873	"""epithelial V-like antigen 1"""	EVA1		9585423	Standard	NM_005797		Approved	EVA	uc001psn.3	O60487		ENST00000278937.2:c.310T>C	11.37:g.118133279A>G	ENSP00000278937:p.Tyr104His	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2R1	Missense_Mutation	SNP	ENST00000278937.2	37	CCDS8393.1	.	.	.	.	.	.	.	.	.	.	A	6.218	0.408452	0.11754	.	.	ENSG00000149573	ENST00000278937;ENST00000438295	T;T	0.64438	-0.1;-0.1	5.98	0.0787	0.14413	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.572209	0.20527	N	0.090599	T	0.36524	0.0970	N	0.11201	0.11	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.18681	-1.0329	10	0.24483	T	0.36	.	8.9625	0.35856	0.219:0.0:0.0741:0.707	.	104	O60487	MPZL2_HUMAN	H	104	ENSP00000278937:Y104H;ENSP00000408362:Y104H	ENSP00000278937:Y104H	Y	-	1	0	MPZL2	117638489	0.000000	0.05858	0.015000	0.15790	0.106000	0.19336	-0.268000	0.08607	0.067000	0.16545	0.528000	0.53228	TAC		0.527	MPZL2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392113.1		NM_005797	
KMT2A	4297	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	118370617	118370617	+	Silent	SNP	T	T	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr11:118370617T>A	ENST00000389506.5	+	24	6138	c.6138T>A	c.(6136-6138)ccT>ccA	p.P2046P	KMT2A_ENST00000354520.4_Silent_p.P2008P|KMT2A_ENST00000534358.1_Silent_p.P2049P			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2046	FYR N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00875}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.P2046P(1)|p.P2049P(1)									AGCTCTTTCCTATTGGATATC	0.428																																																	2	Substitution - coding silent(2)	kidney(2)											100.0	95.0	97.0					11																	118370617		2200	4296	6496	SO:0001819	synonymous_variant	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.6138T>A	11.37:g.118370617T>A		Somatic		WXS	Illumina HiSeq	Phase_I	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Silent	SNP	ENST00000389506.5	37	CCDS31686.1																																																																																				0.428	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2		NM_005933	
MYBL1	4603	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	67484765	67484765	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr8:67484765C>A	ENST00000522677.3	-	12	2090	c.1680G>T	c.(1678-1680)aaG>aaT	p.K560N	MYBL1_ENST00000524176.2_Missense_Mutation_p.K560N|MYBL1_ENST00000517885.1_Missense_Mutation_p.K218N	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	560					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.K560N(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			CAAGCGCATTCTTAAAAGGAG	0.303																																																	2	Substitution - Missense(2)	breast(1)|kidney(1)											104.0	95.0	98.0					8																	67484765		1809	4073	5882	SO:0001583	missense	4603			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1680G>T	8.37:g.67484765C>A	ENSP00000429633:p.Lys560Asn	Somatic		WXS	Illumina HiSeq	Phase_I	E7EW29|Q495F9	Missense_Mutation	SNP	ENST00000522677.3	37	CCDS47867.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.836273	0.71373	.	.	ENSG00000185697	ENST00000522677;ENST00000517885;ENST00000524176	T;T;T	0.51817	0.69;0.69;0.69	5.59	4.72	0.59763	C-myb, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.69584	0.3127	M	0.86864	2.845	0.53005	D	0.999967	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.97110	1.0;0.994;1.0	T	0.73864	-0.3848	10	0.87932	D	0	-14.0084	9.1086	0.36714	0.0:0.7678:0.0:0.2322	.	560;559;560	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	N	560;218;560	ENSP00000429633:K560N;ENSP00000428265:K218N;ENSP00000428011:K560N	ENSP00000428265:K218N	K	-	3	2	MYBL1	67647319	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.834000	0.27518	1.501000	0.48654	0.655000	0.94253	AAG		0.303	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3		XM_034274	
MYO10	4651	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	16711272	16711272	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr5:16711272G>C	ENST00000513610.1	-	20	2466	c.2012C>G	c.(2011-2013)gCt>gGt	p.A671G	MYO10_ENST00000427430.2_Missense_Mutation_p.A28G|MYO10_ENST00000515803.1_Missense_Mutation_p.A10G|MYO10_ENST00000505695.1_Missense_Mutation_p.A10G|MYO10_ENST00000512061.1_5'UTR|MYO10_ENST00000274203.9_Missense_Mutation_p.A28G	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	671	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.A671G(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CGCATACCCAGCTTTGCGGAT	0.488																																																	1	Substitution - Missense(1)	kidney(1)											43.0	44.0	44.0					5																	16711272		1872	4120	5992	SO:0001583	missense	4651			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.2012C>G	5.37:g.16711272G>C	ENSP00000421280:p.Ala671Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	37	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790112	0.90367	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430;ENST00000513882	D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	5.26	5.26	0.73747	Myosin head, motor domain (2);	.	.	.	.	D	0.94948	0.8366	M	0.90542	3.125	0.49798	D	0.999827	P;D	0.54207	0.896;0.965	B;P	0.58820	0.334;0.846	D	0.95547	0.8617	9	0.62326	D	0.03	.	18.8714	0.92317	0.0:0.0:1.0:0.0	.	312;671	Q69YP8;Q9HD67	.;MYO10_HUMAN	G	671;10;28;10;28;682	ENSP00000421280:A671G;ENSP00000425051:A10G;ENSP00000274203:A28G;ENSP00000421170:A10G;ENSP00000391106:A28G;ENSP00000421309:A682G	ENSP00000274203:A28G	A	-	2	0	MYO10	16764272	1.000000	0.71417	0.397000	0.26308	0.989000	0.77384	6.639000	0.74314	2.447000	0.82792	0.462000	0.41574	GCT		0.488	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1		NM_012334	
NOTCH2	4853	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	120468210	120468210	+	Missense_Mutation	SNP	C	C	T	rs202022988		TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:120468210C>T	ENST00000256646.2	-	25	4448	c.4229G>A	c.(4228-4230)cGc>cAc	p.R1410H	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1410	EGF-like 35. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.R1410H(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAGTTCACAGCGGCTACCCGA	0.647			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	1	Substitution - Missense(1)	kidney(1)											45.0	47.0	47.0					1																	120468210		2203	4299	6502	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.4229G>A	1.37:g.120468210C>T	ENSP00000256646:p.Arg1410His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	C	9.092	1.001974	0.19121	.	.	ENSG00000134250	ENST00000256646	T	0.45276	0.9	5.62	-1.0	0.10196	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.382209	0.18794	N	0.130981	T	0.06050	0.0157	N	0.13371	0.34	0.27362	N	0.955934	B	0.02656	0.0	B	0.01281	0.0	T	0.39121	-0.9629	10	0.13108	T	0.6	.	5.1674	0.15092	0.1269:0.3322:0.0:0.5409	.	1410	Q04721	NOTC2_HUMAN	H	1410	ENSP00000256646:R1410H	ENSP00000256646:R1410H	R	-	2	0	NOTCH2	120269733	0.102000	0.21896	0.995000	0.50966	0.903000	0.53119	-0.556000	0.05992	-0.195000	0.10382	-0.268000	0.10319	CGC		0.647	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1		NM_024408	
NSD1	64324	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	176562309	176562309	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr5:176562309T>C	ENST00000439151.2	+	2	250	c.205T>C	c.(205-207)Tac>Cac	p.Y69H	NSD1_ENST00000347982.4_Intron|NSD1_ENST00000361032.4_Missense_Mutation_p.Y69H|NSD1_ENST00000511258.1_Intron|NSD1_ENST00000354179.4_Intron	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	69					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.Y69H(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCCATCTTGTTACATTCCACT	0.413			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	2	Substitution - Missense(2)	kidney(2)											102.0	92.0	95.0					5																	176562309		2203	4300	6503	SO:0001583	missense	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.205T>C	5.37:g.176562309T>C	ENSP00000395929:p.Tyr69His	Somatic		WXS	Illumina HiSeq	Phase_I	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	T	17.33	3.361243	0.61403	.	.	ENSG00000165671	ENST00000439151;ENST00000361032	D;D	0.97016	-3.74;-4.21	5.23	5.23	0.72850	.	0.138480	0.33631	N	0.004702	D	0.94958	0.8369	N	0.08118	0	0.80722	D	1	D;D;D	0.71674	0.998;0.994;0.99	D;P;P	0.69142	0.962;0.855;0.836	D	0.96347	0.9255	10	0.87932	D	0	.	14.2571	0.66060	0.0:0.0:0.0:1.0	.	69;69;69	Q96L73-3;Q96L73;Q6PJ64	.;NSD1_HUMAN;.	H	69	ENSP00000395929:Y69H;ENSP00000354310:Y69H	ENSP00000354310:Y69H	Y	+	1	0	NSD1	176494915	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.586000	0.60984	2.197000	0.70478	0.454000	0.30748	TAC		0.413	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2		NM_172349	
NUP160	23279	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	47827752	47827752	+	Missense_Mutation	SNP	A	A	C	rs201150459		TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr11:47827752A>C	ENST00000378460.2	-	20	2605	c.2559T>G	c.(2557-2559)aaT>aaG	p.N853K	NUP160_ENST00000530326.1_Missense_Mutation_p.N739K|RNA5SP340_ENST00000517132.1_RNA|NUP160_ENST00000528071.1_Missense_Mutation_p.N739K	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	853					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.N853K(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TTTCAGGCCAATTCAATCCAG	0.403																																																	1	Substitution - Missense(1)	kidney(1)											110.0	113.0	112.0					11																	47827752		2201	4298	6499	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.2559T>G	11.37:g.47827752A>C	ENSP00000367721:p.Asn853Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	ENST00000378460.2	37	CCDS31484.1	.	.	.	.	.	.	.	.	.	.	a	17.93	3.508517	0.64410	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.42513	1.54;0.97;0.97	5.53	-2.91	0.05631	.	0.256670	0.41001	D	0.000977	T	0.30696	0.0773	L	0.51422	1.61	0.80722	D	1	P	0.41475	0.751	B	0.40165	0.321	T	0.45160	-0.9280	10	0.06625	T	0.88	.	14.4876	0.67629	0.4642:0.0:0.5358:0.0	.	853	Q12769	NU160_HUMAN	K	853;739;739	ENSP00000367721:N853K;ENSP00000433590:N739K;ENSP00000432367:N739K	ENSP00000367721:N853K	N	-	3	2	NUP160	47784328	0.927000	0.31430	0.963000	0.40424	0.967000	0.64934	-0.002000	0.12924	-0.866000	0.04068	-0.253000	0.11424	AAT		0.403	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2		NM_015231	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52621512	52621515	+	Frame_Shift_Del	DEL	ACAA	ACAA	-			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	ACAA	ACAA	ACAA	-	ACAA	ACAA	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr3:52621512_52621515delACAA	ENST00000296302.7	-	19	2978_2981	c.2977_2980delTTGT	c.(2977-2982)ttgtatfs	p.LY993fs	PBRM1_ENST00000356770.4_Frame_Shift_Del_p.LY961fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.LY1008fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.LY993fs|PBRM1_ENST00000410007.1_Intron|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.LY993fs|PBRM1_ENST00000394830.3_Intron|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.LY1008fs			Q86U86	PB1_HUMAN	polybromo 1	993	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CAACAGCCATACAACCATTTTTCA	0.348			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0																																										SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2977_2980delTTGT	3.37:g.52621512_52621515delACAA	ENSP00000296302:p.Leu993fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.348	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PLAGL2	5326	broad.mit.edu;hgsc.bcm.edu	37	20	30784502	30784502	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr20:30784502G>A	ENST00000246229.4	-	3	1508	c.1244C>T	c.(1243-1245)tCc>tTc	p.S415F		NM_002657.3	NP_002648.1	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	415					chylomicron assembly (GO:0034378)|lipid metabolic process (GO:0006629)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|post-embryonic development (GO:0009791)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S415F(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|liver(1)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CAGTAGGTGGGAGAAGTCCAC	0.647																																					Colon(163;15 1893 11280 16306 47518)												1	Substitution - Missense(1)	kidney(1)											28.0	29.0	29.0					20																	30784502		2202	4300	6502	SO:0001583	missense	5326				CCDS13197.1	20q11.21	2013-01-08			ENSG00000126003	ENSG00000126003		"""Zinc fingers, C2H2-type"""	9047	protein-coding gene	gene with protein product	"""C2H2-type zinc finger protein"""	604866				15585652, 17950244	Standard	NM_002657		Approved	ZNF900	uc002wxn.2	Q9UPG8	OTTHUMG00000032210	ENST00000246229.4:c.1244C>T	20.37:g.30784502G>A	ENSP00000246229:p.Ser415Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8T5|E1P5M3|Q92584	Missense_Mutation	SNP	ENST00000246229.4	37	CCDS13197.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469610	0.63625	.	.	ENSG00000126003	ENST00000246229	T	0.15017	2.46	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.31451	0.0797	L	0.54323	1.7	0.58432	D	0.999998	D	0.65815	0.995	P	0.57911	0.829	T	0.01528	-1.1332	10	0.87932	D	0	.	13.455	0.61193	0.0:0.0:0.8436:0.1564	.	415	Q9UPG8	PLAL2_HUMAN	F	415	ENSP00000246229:S415F	ENSP00000246229:S415F	S	-	2	0	PLAGL2	30248163	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.623000	0.83113	2.590000	0.87494	0.650000	0.86243	TCC		0.647	PLAGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078615.2		NM_002657	
PRTFDC1	56952	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	25145923	25145923	+	Splice_Site	SNP	T	T	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr10:25145923T>G	ENST00000320152.6	-	6	453	c.425A>C	c.(424-426)gAt>gCt	p.D142A	PRTFDC1_ENST00000376378.1_Splice_Site_p.D142A	NM_020200.5	NP_064585.1	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	142					nucleoside metabolic process (GO:0009116)	cytosol (GO:0005829)	magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)	p.D142A(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9						TCCGACAACATCCTTTGCAAA	0.398																																																	1	Substitution - Missense(1)	kidney(1)											231.0	189.0	203.0					10																	25145923		2203	4300	6503	SO:0001630	splice_region_variant	56952			AF226056	CCDS7145.1, CCDS60506.1	10p12.31	2003-11-10			ENSG00000099256	ENSG00000099256			23333	protein-coding gene	gene with protein product		610751					Standard	XM_005252537		Approved	HHGP	uc001ise.1	Q9NRG1	OTTHUMG00000017829	ENST00000320152.6:c.424-1A>C	10.37:g.25145923T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z1Z3|Q53HA7|Q59EL9|Q5VV18|Q5VV20	Missense_Mutation	SNP	ENST00000320152.6	37	CCDS7145.1	.	.	.	.	.	.	.	.	.	.	T	7.815	0.716550	0.15306	.	.	ENSG00000099256	ENST00000320152;ENST00000358336;ENST00000376378	D;D	0.99929	-8.12;-8.12	5.59	5.59	0.84812	Phosphoribosyltransferase (1);	0.210015	0.48767	D	0.000176	D	0.99898	0.9951	M	0.74881	2.28	0.80722	D	1	D;D	0.71674	0.972;0.998	P;D	0.65987	0.545;0.94	D	0.95872	0.8892	10	0.51188	T	0.08	.	15.761	0.78080	0.0:0.0:0.0:1.0	.	142;142	Q9NRG1-2;Q9NRG1	.;PRDC1_HUMAN	A	142	ENSP00000318602:D142A;ENSP00000365558:D142A	ENSP00000318602:D142A	D	-	2	0	PRTFDC1	25185929	1.000000	0.71417	0.986000	0.45419	0.099000	0.18886	1.917000	0.39996	2.135000	0.66039	0.454000	0.30748	GAT		0.398	PRTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047243.2		NM_020200	Missense_Mutation
RABGAP1	23637	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	125782628	125782628	+	Silent	SNP	T	T	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr9:125782628T>C	ENST00000373647.4	+	13	1818	c.1684T>C	c.(1684-1686)Tta>Cta	p.L562L		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	562					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.L490L(1)|p.L562L(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						GTTGTCATCCTTAGTAAGAAA	0.418																																																	2	Substitution - coding silent(2)	kidney(2)											111.0	104.0	106.0					9																	125782628		2203	4300	6503	SO:0001819	synonymous_variant	23637			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.1684T>C	9.37:g.125782628T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	ENST00000373647.4	37	CCDS6848.2																																																																																				0.418	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3		NM_012197	
RAD50	10111	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	131930637	131930637	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr5:131930637A>G	ENST00000265335.6	+	12	2257	c.1870A>G	c.(1870-1872)Agt>Ggt	p.S624G	RAD50_ENST00000378823.3_Missense_Mutation_p.S485G			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	624					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.S624G(1)|p.S485G(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCAGTTGTCCAGTTACGAAGA	0.343								Homologous recombination																																									2	Substitution - Missense(2)	kidney(2)											91.0	99.0	97.0					5																	131930637		2203	4300	6503	SO:0001583	missense	10111			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.1870A>G	5.37:g.131930637A>G	ENSP00000265335:p.Ser624Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	37	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	A	11.94	1.787586	0.31593	.	.	ENSG00000113522	ENST00000378823;ENST00000265335;ENST00000453394	T;T;T	0.07567	3.44;3.67;3.18	5.94	3.4	0.38934	.	0.463989	0.27604	N	0.018628	T	0.07548	0.0190	L	0.44542	1.39	0.28454	N	0.916225	B	0.12013	0.005	B	0.10450	0.005	T	0.15867	-1.0422	10	0.37606	T	0.19	-1.6671	7.3651	0.26768	0.6173:0.1314:0.0:0.2514	.	624	Q92878	RAD50_HUMAN	G	485;624;563	ENSP00000368100:S485G;ENSP00000265335:S624G;ENSP00000400049:S563G	ENSP00000265335:S624G	S	+	1	0	RAD50	131958536	0.011000	0.17503	0.882000	0.34594	0.979000	0.70002	1.318000	0.33643	1.039000	0.40074	0.459000	0.35465	AGT		0.343	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5		NM_005732	
RBM26	64062	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	79940847	79940847	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr13:79940847A>C	ENST00000438737.2	-	7	1496	c.1056T>G	c.(1054-1056)atT>atG	p.I352M	RBM26_ENST00000438724.1_Missense_Mutation_p.I352M|RBM26_ENST00000461008.1_5'Flank|RBM26_ENST00000267229.7_Missense_Mutation_p.I352M			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	352	Pro-rich.				mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.I352M(2)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		GGGGTGTAAGAATTGGTGGAG	0.537																																																	2	Substitution - Missense(2)	kidney(2)											47.0	50.0	49.0					13																	79940847		2203	4300	6503	SO:0001583	missense	64062			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.1056T>G	13.37:g.79940847A>C	ENSP00000387531:p.Ile352Met	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Missense_Mutation	SNP	ENST00000438737.2	37		.	.	.	.	.	.	.	.	.	.	A	18.06	3.539140	0.65085	.	.	ENSG00000139746	ENST00000267229;ENST00000438737;ENST00000327303;ENST00000438724	T;T	0.42513	0.97;0.97	5.49	4.26	0.50523	.	0.059602	0.64402	D	0.000002	T	0.22085	0.0532	N	0.04880	-0.145	0.39090	D	0.961084	P;P;P	0.43701	0.815;0.718;0.815	B;B;B	0.40009	0.316;0.168;0.316	T	0.06752	-1.0809	9	.	.	.	-18.937	11.8752	0.52544	0.9303:0.0:0.0697:0.0	.	352;352;352	Q5T8P6-2;Q5T8P6;Q5T8P6-3	.;RBM26_HUMAN;.	M	352;353;352;352	ENSP00000267229:I352M;ENSP00000390222:I352M	.	I	-	3	3	RBM26	78838848	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.122000	0.57910	0.967000	0.38186	0.533000	0.62120	ATT		0.537	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045373.4		NM_022118	
RBM28	55131	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	127961369	127961369	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr7:127961369T>A	ENST00000223073.2	-	14	1627	c.1513A>T	c.(1513-1515)Aag>Tag	p.K505*	RBM28_ENST00000481788.1_5'UTR|RBM28_ENST00000415472.2_Nonsense_Mutation_p.K364*	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	505	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K505*(1)		breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						AGCAGCAGCTTTCTGAGCTGT	0.507																																																	1	Substitution - Nonsense(1)	kidney(1)											171.0	150.0	157.0					7																	127961369		2203	4300	6503	SO:0001587	stop_gained	55131			AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.1513A>T	7.37:g.127961369T>A	ENSP00000223073:p.Lys505*	Somatic		WXS	Illumina HiSeq	Phase_I	A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Nonsense_Mutation	SNP	ENST00000223073.2	37	CCDS5801.1	.	.	.	.	.	.	.	.	.	.	T	40	8.306268	0.98752	.	.	ENSG00000106344	ENST00000223073;ENST00000415472	.	.	.	5.72	5.72	0.89469	.	0.167364	0.53938	D	0.000054	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6702	10.0801	0.42384	0.0:0.0:0.1686:0.8314	.	.	.	.	X	505;364	.	ENSP00000223073:K505X	K	-	1	0	RBM28	127748605	0.983000	0.35010	0.998000	0.56505	0.974000	0.67602	1.169000	0.31871	2.171000	0.68590	0.533000	0.62120	AAG		0.507	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2		NM_018077	
RC3H1	149041	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	173934019	173934019	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:173934019A>G	ENST00000367696.2	-	10	1925	c.1574T>C	c.(1573-1575)aTa>aCa	p.I525T	RC3H1_ENST00000367694.2_Missense_Mutation_p.I525T|RC3H1_ENST00000258349.4_Missense_Mutation_p.I525T			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	525					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I525T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						CAGATGATCTATTTTTCCTGG	0.423																																																	1	Substitution - Missense(1)	kidney(1)											130.0	120.0	124.0					1																	173934019		2203	4300	6503	SO:0001583	missense	149041			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.1574T>C	1.37:g.173934019A>G	ENSP00000356669:p.Ile525Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.482162	0.44147	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.43688	0.94;0.94;0.94	5.79	3.4	0.38934	.	0.329226	0.43260	N	0.000595	T	0.22513	0.0543	N	0.08118	0	0.30416	N	0.778603	B;B;B;B	0.20459	0.026;0.026;0.045;0.026	B;B;B;B	0.23419	0.02;0.02;0.046;0.02	T	0.12319	-1.0552	10	0.48119	T	0.1	-0.2861	8.1385	0.31069	0.8134:0.0:0.0659:0.1207	.	525;525;525;525	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	T	525	ENSP00000356669:I525T;ENSP00000258349:I525T;ENSP00000356667:I525T	ENSP00000258349:I525T	I	-	2	0	RC3H1	172200642	1.000000	0.71417	0.650000	0.29550	0.979000	0.70002	5.295000	0.65692	0.418000	0.25898	0.528000	0.53228	ATA		0.423	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2		NM_172071	
RMND5B	64777	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	177574549	177574549	+	Frame_Shift_Del	DEL	T	T	-	rs375864830		TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr5:177574549delT	ENST00000515098.1	+	10	1227	c.876delT	c.(874-876)tgtfs	p.C292fs	RMND5B_ENST00000542098.1_Frame_Shift_Del_p.C279fs|RMND5B_ENST00000313386.4_Frame_Shift_Del_p.C292fs			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	292										endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTCTGGCTGTGTGGCGCTGC	0.582																																																	0													88.0	75.0	80.0					5																	177574549		2203	4300	6503	SO:0001589	frameshift_variant	64777			BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.876delT	5.37:g.177574549delT	ENSP00000420875:p.Cys292fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q1HE27|Q6UVY7|Q9H6F6	Frame_Shift_Del	DEL	ENST00000515098.1	37	CCDS4431.1																																																																																				0.582	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373542.1		NM_022762	
RNASEL	6041	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	182544563	182544563	+	Silent	SNP	A	A	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:182544563A>G	ENST00000367559.3	-	7	2443	c.2190T>C	c.(2188-2190)gcT>gcC	p.A730A	RNASEL_ENST00000444138.1_Silent_p.A730A	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	730					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)	p.A730A(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						TGGCCCCACCAGCTCCATCAC	0.488																																																	1	Substitution - coding silent(1)	kidney(1)											150.0	146.0	148.0					1																	182544563		2203	4300	6503	SO:0001819	synonymous_variant	6041			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.2190T>C	1.37:g.182544563A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q5W0L2|Q6AI46	Silent	SNP	ENST00000367559.3	37	CCDS1347.1																																																																																				0.488	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085189.1		NM_021133	
SEC23IP	11196	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	121657969	121657969	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr10:121657969G>C	ENST00000369075.3	+	2	266	c.194G>C	c.(193-195)aGc>aCc	p.S65T	SEC23IP_ENST00000543134.1_Intron	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	65	Interaction with SEC23A.				acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S65T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		GAGGAGGACAGCTTCCTTGGT	0.448																																																	1	Substitution - Missense(1)	kidney(1)											186.0	167.0	174.0					10																	121657969		2203	4300	6503	SO:0001583	missense	11196			AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.194G>C	10.37:g.121657969G>C	ENSP00000358071:p.Ser65Thr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	37	CCDS7618.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861174	0.91433	.	.	ENSG00000107651	ENST00000369075	D	0.97303	-4.33	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.98169	0.9395	M	0.71581	2.175	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.98192	1.0463	10	0.41790	T	0.15	-10.1621	18.8903	0.92397	0.0:0.0:1.0:0.0	.	65	Q9Y6Y8	S23IP_HUMAN	T	65	ENSP00000358071:S65T	ENSP00000358071:S65T	S	+	2	0	SEC23IP	121647959	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.117000	0.94347	2.464000	0.83262	0.655000	0.94253	AGC		0.448	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1			
SHANK2	22941	broad.mit.edu;hgsc.bcm.edu	37	11	70338536	70338536	+	Silent	SNP	G	G	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr11:70338536G>T	ENST00000423696.2	-	12	1242	c.1206C>A	c.(1204-1206)ccC>ccA	p.P402P	SHANK2_ENST00000357171.3_Silent_p.P193P|SHANK2_ENST00000409530.1_Silent_p.P192P|SHANK2_ENST00000449833.2_Silent_p.P186P|SHANK2_ENST00000449116.2_Silent_p.P183P|SHANK2_ENST00000338508.4_Silent_p.P782P|SHANK2_ENST00000409161.1_Silent_p.P185P			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	402					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)	p.P193P(1)|p.P186P(1)|p.P782P(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CAGCGCGGGAGGGCTTGGAGG	0.607																																																	3	Substitution - coding silent(3)	kidney(3)											53.0	51.0	52.0					11																	70338536		2200	4294	6494	SO:0001819	synonymous_variant	22941			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.1206C>A	11.37:g.70338536G>T		Somatic		WXS	Illumina HiSeq	Phase_I	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		.	.	.	.	.	.	.	.	.	.	G	10.74	1.435589	0.25813	.	.	ENSG00000162105	ENST00000412252	.	.	.	4.53	-1.89	0.07689	.	.	.	.	.	T	0.38585	0.1046	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28267	-1.0049	4	.	.	.	.	0.7408	0.00974	0.2049:0.1901:0.3353:0.2698	.	.	.	.	I	192	.	.	L	-	1	0	SHANK2	70016184	0.274000	0.24191	0.798000	0.32154	0.989000	0.77384	-0.059000	0.11731	-0.434000	0.07275	0.650000	0.86243	CTC		0.607	SHANK2-203	KNOWN	basic	protein_coding	protein_coding			NM_012309	
SLC14A2	8170	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	43212331	43212331	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr18:43212331G>T	ENST00000255226.6	+	5	1354	c.538G>T	c.(538-540)Gga>Tga	p.G180*	SLC14A2_ENST00000586448.1_Nonsense_Mutation_p.G180*	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	180					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)	p.G180*(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CATTGCCTCAGGACTCCATGG	0.532																																																	1	Substitution - Nonsense(1)	kidney(1)											220.0	186.0	198.0					18																	43212331		2203	4300	6503	SO:0001587	stop_gained	8170			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.538G>T	18.37:g.43212331G>T	ENSP00000255226:p.Gly180*	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Q7|Q2TBD6|Q96PH5	Nonsense_Mutation	SNP	ENST00000255226.6	37	CCDS11924.1	.	.	.	.	.	.	.	.	.	.	G	45	11.772244	0.99601	.	.	ENSG00000132874	ENST00000255226;ENST00000323329	.	.	.	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.4769	18.0792	0.89437	0.0:0.0:1.0:0.0	.	.	.	.	X	180	.	ENSP00000255226:G180X	G	+	1	0	SLC14A2	41466329	1.000000	0.71417	0.956000	0.39512	0.894000	0.52154	8.834000	0.92094	2.564000	0.86499	0.563000	0.77884	GGA		0.532	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1			
SLC5A12	159963	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	26718743	26718743	+	Silent	SNP	A	A	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr11:26718743A>G	ENST00000396005.3	-	8	1317	c.1008T>C	c.(1006-1008)ctT>ctC	p.L336L	SLC5A12_ENST00000280467.6_Silent_p.L336L	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	336					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.L336L(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AAGCCACAAAAAGTCCTGGCA	0.398																																																	2	Substitution - coding silent(2)	kidney(2)											149.0	140.0	143.0					11																	26718743		2203	4299	6502	SO:0001819	synonymous_variant	159963			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1008T>C	11.37:g.26718743A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q86UC7	Silent	SNP	ENST00000396005.3	37	CCDS7860.2																																																																																				0.398	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1		NM_178498	
SLC9A1	6548	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	27440753	27440753	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:27440753G>C	ENST00000263980.3	-	2	952	c.377C>G	c.(376-378)tCa>tGa	p.S126*	SLC9A1_ENST00000374086.3_Nonsense_Mutation_p.S126*|SLC9A1_ENST00000545949.1_Intron	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	126					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)	p.S126*(2)		central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	GACGATGCTTGAGATAGTGGG	0.637																																																	2	Substitution - Nonsense(2)	cervix(1)|kidney(1)											40.0	41.0	41.0					1																	27440753		2203	4299	6502	SO:0001587	stop_gained	6548			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.377C>G	1.37:g.27440753G>C	ENSP00000263980:p.Ser126*	Somatic		WXS	Illumina HiSeq	Phase_I	B1ALD6|D3DPL4|Q96EM2	Nonsense_Mutation	SNP	ENST00000263980.3	37	CCDS295.1	.	.	.	.	.	.	.	.	.	.	G	40	8.336982	0.98767	.	.	ENSG00000090020	ENST00000263980;ENST00000374086	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.0453	0.93018	0.0:0.0:1.0:0.0	.	.	.	.	X	126	.	ENSP00000263980:S126X	S	-	2	0	SLC9A1	27313340	1.000000	0.71417	0.980000	0.43619	0.977000	0.68977	9.823000	0.99369	2.751000	0.94390	0.655000	0.94253	TCA		0.637	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2		NM_003047	
SVOPL	136306	broad.mit.edu;hgsc.bcm.edu	37	7	138333763	138333763	+	Silent	SNP	G	G	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr7:138333763G>T	ENST00000419765.3	-	7	687	c.654C>A	c.(652-654)gcC>gcA	p.A218A	SVOPL_ENST00000288513.5_Silent_p.A66A|SVOPL_ENST00000421622.1_Silent_p.A98A|SVOPL_ENST00000436657.1_Silent_p.A66A	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	218						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.A218A(1)|p.A66A(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						CCACCTTGAAGGCCACGATGA	0.587																																																	2	Substitution - coding silent(2)	kidney(2)											66.0	56.0	60.0					7																	138333763		2203	4300	6503	SO:0001819	synonymous_variant	136306			BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.654C>A	7.37:g.138333763G>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000419765.3	37	CCDS47721.1																																																																																				0.587	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342092.4		NM_174959	
SYCP2L	221711	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	10907856	10907856	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr6:10907856G>C	ENST00000283141.6	+	10	1054	c.758G>C	c.(757-759)tGg>tCg	p.W253S	RP11-637O19.3_ENST00000480294.1_3'UTR|SYCP2L_ENST00000543878.1_Missense_Mutation_p.W94S	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	253						nucleus (GO:0005634)		p.W253S(1)		breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			GTCCATAAATGGTTTGATGAT	0.373																																																	1	Substitution - Missense(1)	kidney(1)											128.0	124.0	125.0					6																	10907856		1840	4094	5934	SO:0001583	missense	221711			AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.758G>C	6.37:g.10907856G>C	ENSP00000283141:p.Trp253Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	ENST00000283141.6	37	CCDS43423.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.832688	0.50845	.	.	ENSG00000153157	ENST00000543878;ENST00000283141	T;T	0.56103	0.48;1.66	5.48	4.58	0.56647	.	0.000000	0.64402	D	0.000002	T	0.69351	0.3101	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.74438	-0.3665	10	0.87932	D	0	.	15.3324	0.74223	0.0:0.0:0.8598:0.1402	.	94;253	B4DFB8;Q5T4T6	.;SYC2L_HUMAN	S	94;253	ENSP00000440676:W94S;ENSP00000283141:W253S	ENSP00000283141:W253S	W	+	2	0	SYCP2L	11015842	1.000000	0.71417	1.000000	0.80357	0.234000	0.25298	4.692000	0.61746	2.563000	0.86464	0.655000	0.94253	TGG		0.373	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3		NM_194299	
TBC1D24	57465	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	2549923	2549923	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr16:2549923G>A	ENST00000293970.5	+	6	1427	c.1294G>A	c.(1294-1296)Gtg>Atg	p.V432M	TBC1D24_ENST00000434757.2_Missense_Mutation_p.V432M|TBC1D24_ENST00000567020.1_Missense_Mutation_p.V426M|RP11-20I23.1_ENST00000564543.1_Intron	NM_001199107.1	NP_001186036.1	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	432	TLD.				neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|terminal bouton (GO:0043195)	Rab GTPase activator activity (GO:0005097)	p.V426M(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(4)	13						AGAATGCTTTGTGTTTAGGGT	0.577																																																	1	Substitution - Missense(1)	kidney(1)											210.0	229.0	222.0					16																	2549923		2018	4168	6186	SO:0001583	missense	57465			AB032997	CCDS42107.1, CCDS55980.1	16p13.3	2014-05-07				ENSG00000162065			29203	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 6"""	613577	"""deafness, autosomal recessive 86"""	DFNB86		10574461, 24387994, 24729539	Standard	NM_001199107		Approved	KIAA1171, TLDC6, DFNA65	uc002cql.3	Q9ULP9		ENST00000293970.5:c.1294G>A	16.37:g.2549923G>A	ENSP00000293970:p.Val432Met	Somatic		WXS	Illumina HiSeq	Phase_I	A0JNW3|B9A6M6|Q2KJ08	Missense_Mutation	SNP	ENST00000293970.5	37	CCDS55980.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322937	0.81580	.	.	ENSG00000162065	ENST00000293970;ENST00000434757	T	0.50548	0.74	5.65	5.65	0.86999	TLDc (2);	0.000000	0.85682	D	0.000000	T	0.74261	0.3693	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.78568	-0.2154	10	0.87932	D	0	-33.9513	18.2983	0.90154	0.0:0.0:1.0:0.0	.	432;426	Q9ULP9;Q9ULP9-2	TBC24_HUMAN;.	M	426;432	ENSP00000390106:V432M	ENSP00000293970:V426M	V	+	1	0	TBC1D24	2489924	1.000000	0.71417	0.986000	0.45419	0.988000	0.76386	9.138000	0.94501	2.660000	0.90430	0.555000	0.69702	GTG		0.577	TBC1D24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000435637.1		NM_020705	
IGFLR1	79713	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	36230813	36230813	+	Silent	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr19:36230813C>T	ENST00000592537.1	-	4	619	c.519G>A	c.(517-519)ttG>ttA	p.L173L	IGFLR1_ENST00000592889.1_Intron|IGFLR1_ENST00000344990.3_Intron|IGFLR1_ENST00000246532.1_Silent_p.L173L|KMT2B_ENST00000607650.1_RNA|IGFLR1_ENST00000587101.1_5'UTR|AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000588992.1_Intron			Q9H665	IGFR1_HUMAN	IGF-like family receptor 1	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L173L(1)		endometrium(2)|kidney(3)|large_intestine(1)|lung(8)|prostate(1)	15						CTATCACCGCCAAGGTCAGGA	0.602																																																	1	Substitution - coding silent(1)	kidney(1)											82.0	79.0	80.0					19																	36230813		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026226	CCDS12472.1	19q13.12	2012-10-02	2011-04-04	2011-04-04	ENSG00000126246	ENSG00000126246			23620	protein-coding gene	gene with protein product		614143	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 4"", ""transmembrane protein 149"""	U2AF1L4, TMEM149		21454693	Standard	NM_024660		Approved	FLJ22573	uc002obd.4	Q9H665		ENST00000592537.1:c.519G>A	19.37:g.36230813C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N5X0	Silent	SNP	ENST00000592537.1	37	CCDS12472.1																																																																																				0.602	IGFLR1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459077.1		NM_024660	
TNIK	23043	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	170893117	170893117	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr3:170893117G>A	ENST00000436636.2	-	9	1041	c.697C>T	c.(697-699)Ctc>Ttc	p.L233F	TNIK_ENST00000470834.1_Missense_Mutation_p.L233F|TNIK_ENST00000538048.1_Missense_Mutation_p.L233F|TNIK_ENST00000357327.5_Missense_Mutation_p.L233F|TNIK_ENST00000369326.5_Missense_Mutation_p.L233F|TNIK_ENST00000475336.1_Missense_Mutation_p.L233F|TNIK_ENST00000341852.6_Missense_Mutation_p.L233F|TNIK_ENST00000284483.8_Missense_Mutation_p.L233F|TNIK_ENST00000460047.1_Missense_Mutation_p.L233F|TNIK_ENST00000488470.1_Missense_Mutation_p.L233F	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.L233F(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			ATGTCACAGAGAGCTGCAAGA	0.557																																																	2	Substitution - Missense(2)	kidney(2)											59.0	60.0	60.0					3																	170893117		1961	4168	6129	SO:0001583	missense	23043			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.697C>T	3.37:g.170893117G>A	ENSP00000399511:p.Leu233Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	ENST00000436636.2	37	CCDS46956.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642131	0.87859	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834;ENST00000468757	T;T;T;T;T;T;T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31;3.1	5.09	5.09	0.68999	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.067323	0.64402	D	0.000009	T	0.25005	0.0607	N	0.08118	0	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;0.997;1.0;0.999;0.997;0.997;1.0;0.998	D;D;D;D;D;D;D;D	0.79108	0.967;0.983;0.992;0.955;0.983;0.983;0.992;0.99	T	0.37478	-0.9704	10	0.87932	D	0	.	18.7037	0.91630	0.0:0.0:1.0:0.0	.	233;233;233;233;233;233;233;233	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	F	233;233;233;233;233;233;233;233;233;233;207	ENSP00000399511:L233F;ENSP00000358332:L233F;ENSP00000443278:L233F;ENSP00000345352:L233F;ENSP00000284483:L233F;ENSP00000418156:L233F;ENSP00000349880:L233F;ENSP00000418916:L233F;ENSP00000418378:L233F;ENSP00000419990:L233F;ENSP00000417338:L207F	ENSP00000284483:L233F	L	-	1	0	TNIK	172375811	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.827000	0.86722	2.642000	0.89623	0.655000	0.94253	CTC		0.557	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2		XM_039796	
TNRC6B	23112	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	40662303	40662303	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr22:40662303A>C	ENST00000454349.2	+	5	2280	c.2069A>C	c.(2068-2070)aAa>aCa	p.K690T	TNRC6B_ENST00000301923.9_Intron|TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000335727.9_Missense_Mutation_p.K690T	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	690	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						ACAGAGTGGAAAGACCCCAAG	0.527																																																	0													22.0	24.0	23.0					22																	40662303		1890	4136	6026	SO:0001583	missense	23112			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.2069A>C	22.37:g.40662303A>C	ENSP00000401946:p.Lys690Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.45|13.45	2.242207|2.242207	0.39598|0.39598	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000446273|ENST00000454349;ENST00000400140;ENST00000335727	T|T;T	0.16073|0.13538	2.37|2.58;2.6	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.145914|0.145914	0.64402|0.64402	D|D	0.000010|0.000010	T|T	0.26304|0.26304	0.0642|0.0642	L|L	0.34521|0.34521	1.04|1.04	0.36113|0.36113	D|D	0.844962|0.844962	.|D;P;P	.|0.63880	.|0.993;0.92;0.952	.|D;B;P	.|0.70227	.|0.968;0.438;0.542	T|T	0.15206|0.15206	-1.0445|-1.0445	8|10	0.49607|0.38643	T|T	0.09|0.18	-6.5163|-6.5163	15.4632|15.4632	0.75377|0.75377	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|690;690;690	.|Q9UPQ9;A8MYY3;Q9UPQ9-1	.|TNR6B_HUMAN;.;.	Q|T	433|690	ENSP00000409429:K433Q|ENSP00000401946:K690T;ENSP00000338371:K690T	ENSP00000409429:K433Q|ENSP00000338371:K690T	K|K	+|+	1|2	0|0	TNRC6B|TNRC6B	38992249|38992249	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	4.517000|4.517000	0.60503|0.60503	2.069000|2.069000	0.61940|0.61940	0.260000|0.260000	0.18958|0.18958	AAG|AAA		0.527	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding				
TRPC4	7223	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	38266299	38266299	+	Silent	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr13:38266299C>T	ENST00000379705.3	-	4	1928	c.1071G>A	c.(1069-1071)ctG>ctA	p.L357L	TRPC4_ENST00000358477.2_Silent_p.L357L|TRPC4_ENST00000379679.1_Silent_p.L184L|TRPC4_ENST00000426868.2_Silent_p.L357L|TRPC4_ENST00000338947.5_Silent_p.L184L|TRPC4_ENST00000379673.2_Silent_p.L357L|TRPC4_ENST00000447043.1_Silent_p.L357L|TRPC4_ENST00000379681.3_Silent_p.L357L|TRPC4_ENST00000355779.2_Silent_p.L357L			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	357					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.L357L(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TCCTGATGAACAGTCCAAGTG	0.463																																																	2	Substitution - coding silent(2)	kidney(2)											114.0	110.0	111.0					13																	38266299		2203	4300	6503	SO:0001819	synonymous_variant	7223			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1071G>A	13.37:g.38266299C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	ENST00000379705.3	37	CCDS9365.1																																																																																				0.463	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2		NM_003306	
TSHZ3	57616	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	31767620	31767620	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr19:31767620T>C	ENST00000240587.4	-	2	3406	c.3079A>G	c.(3079-3081)Aaa>Gaa	p.K1027E		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	1027					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K1027E(1)|p.K844E(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GTCACCATTTTTTCTGACGGT	0.498																																																	2	Substitution - Missense(2)	kidney(2)											159.0	135.0	143.0					19																	31767620		2203	4300	6503	SO:0001583	missense	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.3079A>G	19.37:g.31767620T>C	ENSP00000240587:p.Lys1027Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	T	10.79	1.450247	0.26074	.	.	ENSG00000121297	ENST00000240587	T	0.12147	2.71	5.71	5.71	0.89125	.	0.151082	0.56097	D	0.000021	T	0.17534	0.0421	L	0.54323	1.7	0.53688	D	0.999978	B	0.06786	0.001	B	0.04013	0.001	T	0.01305	-1.1390	10	0.62326	D	0.03	-16.0865	15.9886	0.80183	0.0:0.0:0.0:1.0	.	1027	Q63HK5	TSH3_HUMAN	E	1027	ENSP00000240587:K1027E	ENSP00000240587:K1027E	K	-	1	0	TSHZ3	36459460	1.000000	0.71417	0.981000	0.43875	0.642000	0.38348	7.348000	0.79366	2.173000	0.68751	0.533000	0.62120	AAA		0.498	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2		NM_020856	
TTN	7273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	179427281	179427281	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr2:179427281C>G	ENST00000591111.1	-	276	78879	c.78655G>C	c.(78655-78657)Gtg>Ctg	p.V26219L	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V18987L|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V18795L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V27860L|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V18920L|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V25292L|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26219	Fibronectin type-III 90. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V25290L(1)|p.V18920L(1)|p.V18987L(1)|p.V18795L(1)|p.V25292L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTCAGACACTTTAACGGGT	0.438																																																	5	Substitution - Missense(5)	kidney(5)											83.0	80.0	81.0					2																	179427281		1859	4098	5957	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.78655G>C	2.37:g.179427281C>G	ENSP00000465570:p.Val26219Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	12.91	2.078957	0.36662	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	5.67	5.67	0.87782	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.41396	0.1157	N	0.25380	0.74	0.50632	D	0.999882	B;B;B;B	0.18166	0.026;0.026;0.026;0.026	B;B;B;B	0.18561	0.018;0.018;0.018;0.022	T	0.26224	-1.0109	9	0.87932	D	0	.	19.7469	0.96255	0.0:1.0:0.0:0.0	.	18795;18920;18987;26219	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	25292;18795;18987;18920;18793	ENSP00000343764:V25292L;ENSP00000434586:V18795L;ENSP00000340554:V18987L;ENSP00000352154:V18920L	ENSP00000340554:V18987L	V	-	1	0	TTN	179135527	1.000000	0.71417	0.843000	0.33291	0.908000	0.53690	4.913000	0.63341	2.673000	0.90976	0.561000	0.74099	GTG		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
UBN2	254048	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	138944050	138944050	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr7:138944050A>G	ENST00000473989.3	+	5	839	c.839A>G	c.(838-840)aAg>aGg	p.K280R	UBN2_ENST00000288561.8_Missense_Mutation_p.K197R	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	280	Lys-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)		p.K197R(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						GAGATGAAGAAGCGGAAGCGG	0.383																																																	1	Substitution - Missense(1)	kidney(1)											123.0	129.0	127.0					7																	138944050		1836	4088	5924	SO:0001583	missense	254048			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.839A>G	7.37:g.138944050A>G	ENSP00000418648:p.Lys280Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	ENST00000473989.3	37	CCDS43655.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.8|25.8	4.675342|4.675342	0.88445|0.88445	.|.	.|.	ENSG00000157741|ENSG00000157741	ENST00000486663;ENST00000473989;ENST00000288561|ENST00000483726	T;T;T|.	0.22336|.	1.96;1.96;1.96|.	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	0.090204|.	0.85682|.	D|.	0.000000|.	T|T	0.68550|0.68550	0.3013|0.3013	L|L	0.54323|0.54323	1.7|1.7	0.50813|0.50813	D|D	0.999892|0.999892	D|.	0.60575|.	0.988|.	P|.	0.54759|.	0.76|.	T|T	0.66544|0.66544	-0.5897|-0.5897	10|5	0.38643|.	T|.	0.18|.	-4.0519|-4.0519	14.9418|14.9418	0.71000|0.71000	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	280|.	Q6ZU65|.	UBN2_HUMAN|.	R|G	103;280;197|49	ENSP00000417849:K103R;ENSP00000418648:K280R;ENSP00000288561:K197R|.	ENSP00000288561:K197R|.	K|S	+|+	2|1	0|0	UBN2|UBN2	138594590|138594590	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	5.462000|5.462000	0.66707|0.66707	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	AAG|AGC		0.383	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3		NM_173569	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10188204	10188204	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr3:10188204delT	ENST00000256474.2	+	2	1187	c.347delT	c.(346-348)cttfs	p.L116fs	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Intron	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	116	Involved in binding to CCT complex.		L -> V (in VHLD). {ECO:0000269|PubMed:8730290}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.?(2)|p.W117fs*14(2)|p.H115fs*15(1)|p.W117fs*42(1)|p.H115fs*41(1)|p.H115fs*42(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		ATAGGTCACCTTTGGCTCTTC	0.527		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	8	Deletion - Frameshift(6)|Unknown(2)	kidney(8)											173.0	161.0	165.0					3																	10188204		2203	4300	6503	SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.347delT	3.37:g.10188204delT	ENSP00000256474:p.Leu116fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.527	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WDFY3	23001	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	85664902	85664902	+	Silent	SNP	G	G	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr4:85664902G>A	ENST00000295888.4	-	37	6431	c.6024C>T	c.(6022-6024)taC>taT	p.Y2008Y	WDFY3_ENST00000322366.6_Silent_p.Y2008Y	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2008					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.Y2008Y(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TATCCAAAATGTAAGTTTGAA	0.318																																																	1	Substitution - coding silent(1)	kidney(1)											99.0	99.0	99.0					4																	85664902		2203	4300	6503	SO:0001819	synonymous_variant	23001			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.6024C>T	4.37:g.85664902G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	CCDS3609.1																																																																																				0.318	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2		NM_014991	
WDR93	56964	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	90276288	90276288	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr15:90276288T>A	ENST00000268130.7	+	13	1483	c.1382T>A	c.(1381-1383)aTt>aAt	p.I461N	WDR93_ENST00000444934.2_Missense_Mutation_p.I178N|WDR93_ENST00000560294.1_Intron	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	461					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.I461N(1)		NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			TGCCAAAGCATTCACTTCCTA	0.478																																																	1	Substitution - Missense(1)	kidney(1)											111.0	120.0	117.0					15																	90276288		2200	4299	6499	SO:0001583	missense	56964				CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.1382T>A	15.37:g.90276288T>A	ENSP00000268130:p.Ile461Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N7Y8|Q9NP89	Missense_Mutation	SNP	ENST00000268130.7	37	CCDS32326.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.177341	0.78564	.	.	ENSG00000140527	ENST00000268130;ENST00000444934	T;T	0.35973	1.28;2.04	5.73	5.73	0.89815	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.408897	0.22927	N	0.053958	T	0.44008	0.1273	L	0.57536	1.79	0.31624	N	0.649964	P	0.49090	0.919	P	0.48627	0.584	T	0.58640	-0.7601	10	0.87932	D	0	-5.5681	12.4501	0.55673	0.0:0.0:0.0:1.0	.	461	Q6P2C0	WDR93_HUMAN	N	461;178	ENSP00000268130:I461N;ENSP00000403871:I178N	ENSP00000268130:I461N	I	+	2	0	WDR93	88077292	0.914000	0.31030	0.996000	0.52242	0.979000	0.70002	4.193000	0.58385	2.187000	0.69744	0.524000	0.50904	ATT		0.478	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416369.1		NM_020212	
WNK1	65125	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	936351	936351	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr12:936351G>C	ENST00000315939.6	+	3	1719	c.1076G>C	c.(1075-1077)gGc>gCc	p.G359A	WNK1_ENST00000447667.2_Missense_Mutation_p.G359A|WNK1_ENST00000535572.1_Missense_Mutation_p.G359A|WNK1_ENST00000530271.2_Missense_Mutation_p.G359A|WNK1_ENST00000537687.1_Missense_Mutation_p.G359A	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	359	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.G359A(2)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTTATCACCGGCCCTACTGGC	0.483																																					Colon(19;451 567 6672 12618 28860)												2	Substitution - Missense(2)	kidney(2)											172.0	173.0	173.0					12																	936351		2203	4300	6503	SO:0001583	missense	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1076G>C	12.37:g.936351G>C	ENSP00000313059:p.Gly359Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	G	33	5.264874	0.95399	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000447667;ENST00000530271	T;T;T;T;T	0.71461	1.82;1.82;1.82;-0.57;1.82	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000014	T	0.77003	0.4067	N	0.21142	0.635	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.998	T	0.80353	-0.1418	10	0.87932	D	0	-12.1235	19.1856	0.93642	0.0:0.0:1.0:0.0	.	359;359;359	F5GWT4;Q9H4A3;F6UYG0	.;WNK1_HUMAN;.	A	359	ENSP00000441972:G359A;ENSP00000313059:G359A;ENSP00000444465:G359A;ENSP00000392542:G359A;ENSP00000433548:G359A	ENSP00000313059:G359A	G	+	2	0	WNK1	806612	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.869000	0.99810	2.548000	0.85928	0.491000	0.48974	GGC		0.483	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1		NM_018979	
YLPM1	56252	broad.mit.edu;ucsc.edu	37	14	75230625	75230626	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr14:75230625_75230626insCC	ENST00000552421.1	+	1	557_558	c.433_434insCC	c.(433-435)tccfs	p.S145fs	YLPM1_ENST00000238571.3_Frame_Shift_Ins_p.S145fs|YLPM1_ENST00000325680.7_Frame_Shift_Ins_p.S145fs			P49750	YLPM1_HUMAN	YLP motif containing 1	145	Pro-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GGAGCTGGAATCCCCCCCTGAA	0.619																																																	0																																										SO:0001589	frameshift_variant	56252			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.438_439dupCC	14.37:g.75230630_75230631dupCC	ENSP00000447921:p.Ser145fs	Somatic		WXS	Illumina GAIIx	Phase_I	P49752|Q96I64|Q9P1V7	Frame_Shift_Ins	INS	ENST00000552421.1	37																																																																																					0.619	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1		NM_019589	
ZDHHC5	25921	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	57457522	57457522	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr11:57457522C>T	ENST00000287169.3	+	5	1766	c.404C>T	c.(403-405)cCc>cTc	p.P135L	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.P82L	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	135					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.P135L(1)		endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						CATCACTGCCCCTGGGTGAAT	0.458																																																	1	Substitution - Missense(1)	kidney(1)											141.0	141.0	141.0					11																	57457522		2201	4296	6497	SO:0001583	missense	25921			AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.404C>T	11.37:g.57457522C>T	ENSP00000287169:p.Pro135Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	ENST00000287169.3	37	CCDS7965.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812742	0.90707	.	.	ENSG00000156599	ENST00000527985;ENST00000287169;ENST00000528177;ENST00000532842	T;T;T;T	0.27104	1.69;1.69;1.69;1.69	5.23	4.31	0.51392	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.058424	0.64402	D	0.000001	T	0.59335	0.2186	M	0.93016	3.37	0.80722	D	1	D	0.63880	0.993	D	0.67103	0.949	T	0.72443	-0.4292	10	0.87932	D	0	-9.2394	15.5442	0.76081	0.0:0.8613:0.1387:0.0	.	135	Q9C0B5	ZDHC5_HUMAN	L	82;135;33;33	ENSP00000432202:P82L;ENSP00000287169:P135L;ENSP00000431209:P33L;ENSP00000435593:P33L	ENSP00000287169:P135L	P	+	2	0	ZDHHC5	57214098	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.213000	0.77950	1.409000	0.46915	0.563000	0.77884	CCC		0.458	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393694.1		NM_015457	
ZMYM1	79830	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	35580008	35580008	+	Silent	SNP	C	C	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:35580008C>A	ENST00000373330.1	+	11	2751	c.2577C>A	c.(2575-2577)gtC>gtA	p.V859V	ZMYM1_ENST00000359858.4_Silent_p.V859V|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	859						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V859V(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTGAATTTGTCTTTTGTTTGA	0.323																																																	1	Substitution - coding silent(1)	kidney(1)											72.0	61.0	64.0					1																	35580008		1814	4079	5893	SO:0001819	synonymous_variant	79830			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.2577C>A	1.37:g.35580008C>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DPR7|Q7Z3Q4	Silent	SNP	ENST00000373330.1	37	CCDS41302.1																																																																																				0.323	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1		NM_024772	
ZNF215	7762	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	6953811	6953811	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr11:6953811A>C	ENST00000278319.5	+	3	896	c.308A>C	c.(307-309)gAa>gCa	p.E103A	ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000414517.2_Missense_Mutation_p.E103A|ZNF215_ENST00000529903.1_Missense_Mutation_p.E103A	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	103	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E103A(1)		NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		CTGCCTGAAGAAGTCAGGACT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											62.0	66.0	64.0					11																	6953811		2201	4296	6497	SO:0001583	missense	7762			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.308A>C	11.37:g.6953811A>C	ENSP00000278319:p.Glu103Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q96C84	Missense_Mutation	SNP	ENST00000278319.5	37	CCDS7775.1	.	.	.	.	.	.	.	.	.	.	A	17.21	3.331919	0.60853	.	.	ENSG00000149054	ENST00000278319;ENST00000414517;ENST00000529903	T;T;T	0.08370	3.1;3.1;3.1	3.86	3.86	0.44501	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.175198	0.27415	N	0.019462	T	0.28532	0.0706	M	0.87456	2.885	0.27503	N	0.951934	P;D;D	0.58620	0.896;0.978;0.983	P;P;D	0.66196	0.596;0.735;0.942	T	0.06661	-1.0814	10	0.87932	D	0	-13.6525	9.3551	0.38161	1.0:0.0:0.0:0.0	.	103;103;103	B4DYW9;Q96C84;Q9UL58	.;.;ZN215_HUMAN	A	103	ENSP00000278319:E103A;ENSP00000393202:E103A;ENSP00000432306:E103A	ENSP00000278319:E103A	E	+	2	0	ZNF215	6910387	1.000000	0.71417	0.992000	0.48379	0.832000	0.47134	3.205000	0.51090	1.966000	0.57179	0.533000	0.62120	GAA		0.413	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384550.1			
ZNF292	23036	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	87969169	87969169	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr6:87969169A>C	ENST00000369577.3	+	8	5865	c.5822A>C	c.(5821-5823)cAa>cCa	p.Q1941P	ZNF292_ENST00000339907.4_Missense_Mutation_p.Q1936P	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1941						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.Q1941P(2)|p.Q1796P(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AAGAAGAATCAATTGAAATTT	0.348																																																	4	Substitution - Missense(4)	endometrium(2)|kidney(2)											22.0	22.0	22.0					6																	87969169		1827	4061	5888	SO:0001583	missense	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.5822A>C	6.37:g.87969169A>C	ENSP00000358590:p.Gln1941Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	A	13.63	2.295553	0.40594	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.09723	2.95;2.96	6.11	6.11	0.99139	.	0.050165	0.85682	D	0.000000	T	0.11665	0.0284	N	0.11789	0.175	0.50813	D	0.999892	D	0.71674	0.998	D	0.75484	0.986	T	0.31364	-0.9946	10	0.72032	D	0.01	.	16.7021	0.85357	1.0:0.0:0.0:0.0	.	1941	O60281	ZN292_HUMAN	P	1941;1936	ENSP00000358590:Q1941P;ENSP00000342847:Q1936P	ENSP00000342847:Q1936P	Q	+	2	0	ZNF292	88025888	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.060000	0.64312	2.343000	0.79666	0.533000	0.62120	CAA		0.348	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2		NM_015021	
ZNF560	147741	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	9578075	9578075	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr19:9578075A>C	ENST00000301480.4	-	10	1761	c.1548T>G	c.(1546-1548)ttT>ttG	p.F516L		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	516					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F516L(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TGTAACACTTAAAGGGCTTCT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											106.0	109.0	108.0					19																	9578075		2203	4300	6503	SO:0001583	missense	147741			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.1548T>G	19.37:g.9578075A>C	ENSP00000301480:p.Phe516Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.083052	0.36758	.	.	ENSG00000198028	ENST00000301480	T	0.21932	1.98	2.05	-0.113	0.13568	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22859	0.0552	L	0.55103	1.725	0.09310	N	1	P	0.42757	0.789	P	0.46110	0.504	T	0.14980	-1.0453	9	0.66056	D	0.02	.	5.3144	0.15847	0.6851:0.0:0.3148:0.0	.	516	Q96MR9	ZN560_HUMAN	L	516	ENSP00000301480:F516L	ENSP00000301480:F516L	F	-	3	2	ZNF560	9439075	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	0.027000	0.13621	-0.102000	0.12197	0.402000	0.26972	TTT		0.413	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1		NM_152476	
ZNF429	353088	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	21719682	21719682	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr19:21719682A>C	ENST00000358491.4	+	4	1035	c.827A>C	c.(826-828)aAg>aCg	p.K276T	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	276				Missing (in Ref. 2; AAP30884 and 3; AAK01422). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K276T(1)		endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						ACTACCCATAAGAGAATTCAT	0.373																																																	1	Substitution - Missense(1)	kidney(1)											38.0	42.0	40.0					19																	21719682		2122	4272	6394	SO:0001583	missense	353088			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.827A>C	19.37:g.21719682A>C	ENSP00000351280:p.Lys276Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	6.358	0.434176	0.12045	.	.	ENSG00000197013	ENST00000358491	T	0.17854	2.25	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13586	0.0329	L	0.35542	1.07	0.21220	N	0.999755	B	0.29552	0.248	B	0.34093	0.175	T	0.30504	-0.9976	9	0.62326	D	0.03	.	6.7189	0.23318	1.0:0.0:0.0:0.0	.	276	Q86V71	ZN429_HUMAN	T	276	ENSP00000351280:K276T	ENSP00000351280:K276T	K	+	2	0	ZNF429	21511522	0.000000	0.05858	0.017000	0.16124	0.016000	0.09150	0.472000	0.22116	0.251000	0.21505	0.248000	0.18094	AAG		0.373	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1		NM_001001415	
ZNF713	349075	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	56007482	56007482	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr7:56007482G>A	ENST00000429591.2	+	4	1114	c.1076G>A	c.(1075-1077)tGt>tAt	p.C359Y	MRPS17_ENST00000426595.1_Intron	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C359Y(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CCTTACGAATGTGGTTTCTGT	0.403																																																	1	Substitution - Missense(1)	kidney(1)											68.0	70.0	69.0					7																	56007482		2203	4300	6503	SO:0001583	missense	349075			AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.1076G>A	7.37:g.56007482G>A	ENSP00000416662:p.Cys359Tyr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000429591.2	37	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128679	0.56721	.	.	ENSG00000178665	ENST00000429591	D	0.85088	-1.94	3.26	3.26	0.37387	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.169754	0.28700	N	0.014426	D	0.94604	0.8261	H	0.97682	4.055	0.49389	D	0.999783	D	0.89917	1.0	D	0.97110	1.0	D	0.95695	0.8744	10	0.87932	D	0	.	12.8046	0.57605	0.0:0.0:1.0:0.0	.	359	Q8N859	ZN713_HUMAN	Y	359	ENSP00000416662:C359Y	ENSP00000416662:C359Y	C	+	2	0	ZNF713	55974976	1.000000	0.71417	0.912000	0.35992	0.685000	0.39939	8.997000	0.93544	2.129000	0.65627	0.467000	0.42956	TGT		0.403	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1		NM_182633	
C9orf163	158055	broad.mit.edu	37	9	139379131	139379131	+	Silent	SNP	G	G	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr9:139379131G>A	ENST00000354376.1	+	1	1185	c.231G>A	c.(229-231)caG>caA	p.Q77Q		NM_152571.2	NP_689784.1	Q8N9P6	CI163_HUMAN	chromosome 9 open reading frame 163	77								p.Q77Q(1)		kidney(1)|lung(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.36e-06)|Epithelial(140;5.65e-06)		TGCCACGCCAGCAGGGCCGCA	0.662																																																	1	Substitution - coding silent(1)	kidney(1)											30.0	31.0	30.0					9																	139379131		2200	4300	6500	SO:0001819	synonymous_variant	158055			AK055336	CCDS7001.1	9q34.3	2006-03-21			ENSG00000196366	ENSG00000196366			26718	protein-coding gene	gene with protein product							Standard	NM_152571		Approved	FLJ36779	uc004chy.3	Q8N9P6	OTTHUMG00000131725	ENST00000354376.1:c.231G>A	9.37:g.139379131G>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000354376.1	37	CCDS7001.1																																																																																				0.662	C9orf163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254644.1		NM_152571	
Unknown	0	broad.mit.edu	37	1	16974745	16974745	+	IGR	SNP	G	G	A	rs28526603	byFrequency	TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:16974745G>A								CROCCP2 (13691 upstream) : RNU1-3 (18534 downstream)																							CCTGGAACCGGAGGGCCGGGG	0.711																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16974745G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.711									
Unknown	0	broad.mit.edu	37	1	16974758	16974758	+	IGR	SNP	G	G	A	rs28484638	byFrequency	TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr1:16974758G>A								CROCCP2 (13704 upstream) : RNU1-3 (18521 downstream)																							GGCCGGGGCGGGGTCTCGGCC	0.716																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16974758G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.716									
RNPEPL1	57140	broad.mit.edu	37	2	241514017	241514017	+	Silent	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr2:241514017C>T	ENST00000270357.4	+	6	1160	c.567C>T	c.(565-567)gtC>gtT	p.V189V		NM_018226.4	NP_060696.4	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like 1	189					leukotriene biosynthetic process (GO:0019370)		aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V189V(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	13		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		ACAGCCCGGTCAGCAAACTGC	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											44.0	51.0	49.0					2																	241514017		2201	4300	6501	SO:0001819	synonymous_variant	57140					2q37.3	2012-03-06			ENSG00000142327	ENSG00000142327			10079	protein-coding gene	gene with protein product		605287				19508204	Standard	NM_018226		Approved		uc002vzi.4	Q9HAU8	OTTHUMG00000133357	ENST00000270357.4:c.567C>T	2.37:g.241514017C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q5XKC3|Q6NX56|Q96AC9|Q9H033|Q9NVD0	Silent	SNP	ENST00000270357.4	37																																																																																					0.647	RNPEPL1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257190.4		NM_018226	
TMEM208	29100	broad.mit.edu	37	16	67261756	67261756	+	Silent	SNP	C	C	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr16:67261756C>T	ENST00000304800.9	+	2	130	c.24C>T	c.(22-24)ggC>ggT	p.G8G	TMEM208_ENST00000565201.1_Silent_p.G8G|LRRC29_ENST00000341546.3_5'Flank|LRRC29_ENST00000409509.1_5'Flank|LRRC29_ENST00000393992.1_5'Flank|AC040160.1_ENST00000454102.2_5'Flank|TMEM208_ENST00000563953.1_5'UTR|LRRC29_ENST00000462169.1_5'Flank	NM_014187.3	NP_054906.2	Q9BTX3	TM208_HUMAN	transmembrane protein 208	8					autophagy (GO:0006914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.G8G(1)		breast(1)|kidney(2)|lung(1)|upper_aerodigestive_tract(1)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		GCAAAGTGGGCACGAGAGGGA	0.537																																																	1	Substitution - coding silent(1)	kidney(1)											59.0	64.0	62.0					16																	67261756		1970	4160	6130	SO:0001819	synonymous_variant	29100				CCDS45511.1	16q22.1	2008-05-02			ENSG00000168701	ENSG00000168701			25015	protein-coding gene	gene with protein product						11042152	Standard	NM_014187		Approved	HSPC171	uc002esi.2	Q9BTX3		ENST00000304800.9:c.24C>T	16.37:g.67261756C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q05CT0|Q96D25|Q9NZZ7	Silent	SNP	ENST00000304800.9	37	CCDS45511.1																																																																																				0.537	TMEM208-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421976.2		NM_014187	
IL12A	3592	broad.mit.edu	37	3	159706882	159706882	+	Silent	SNP	A	A	C			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr3:159706882A>C	ENST00000305579.2	+	1	346	c.39A>C	c.(37-39)tcA>tcC	p.S13S	IL12A_ENST00000480787.1_Silent_p.S13S|IL12A-AS1_ENST00000497452.1_RNA|IL12A_ENST00000466512.1_Silent_p.S13S	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	0					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)	p.S13S(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CACCGCCCTCACCTGCCGCGG	0.652											OREG0015908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	kidney(1)											17.0	22.0	20.0					3																	159706882		2202	4298	6500	SO:0001819	synonymous_variant	0			M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.39A>C	3.37:g.159706882A>C		Somatic	1803	WXS	Illumina GAIIx	Phase_I	Q96QZ1	Splice_Site	SNP	ENST00000305579.2	37	CCDS3187.1																																																																																				0.652	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352602.2		NM_000882	
VAC14	55697	broad.mit.edu	37	16	70834811	70834811	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr16:70834811G>T	ENST00000261776.5	-	0	253				RP11-424M24.5_ENST00000574178.1_lincRNA	NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)						phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				CATGGTGGCAGCTGGGGGAAC	0.701																																																	0																																												55697			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.-8C>A	16.37:g.70834811G>T		Somatic		WXS	Illumina GAIIx	Phase_I	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Translation_Start_Site	SNP	ENST00000261776.5	37	CCDS10896.1																																																																																				0.701	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268973.3		NM_018052	
WHAMMP3	339005	broad.mit.edu	37	15	23205094	23205094	+	RNA	SNP	G	G	A			TCGA-CJ-4912-01A-01D-1429-08	TCGA-CJ-4912-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	894ade93-8feb-4f93-a31a-d9e16eb81743	fa597cce-bae4-49b7-8d02-d00582f821f0	g.chr15:23205094G>A	ENST00000400153.2	-	0	760					NR_003521.1		Q1A5X7	WHAL1_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3																		AGTACTGGAAGAACGTGGTTG	0.373																																																	0																																												0			BC048987		15q11.2	2014-03-20	2011-06-24	2011-06-24	ENSG00000187667	ENSG00000276141			27892	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1 (pseudogene)"""	WHDC1L1, WHAMML1		18226259	Standard	NR_003521		Approved		uc001yvg.3	Q1A5X7	OTTHUMG00000171921		15.37:g.23205094G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q1A5X8|Q52M16|Q52M18	RNA	SNP	ENST00000400153.2	37																																																																																					0.373	WHAMMP3-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000415907.1		NR_003521	
