#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS16	170690	broad.mit.edu;ucsc.edu	37	5	5242262	5242262	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr5:5242262T>A	ENST00000274181.7	+	17	2758	c.2620T>A	c.(2620-2622)Tgg>Agg	p.W874R		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	874	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.W874R(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CAGCTACACTTGGGCCATCGT	0.632																																																	2	Substitution - Missense(2)	kidney(2)											47.0	52.0	51.0					5																	5242262		2059	4199	6258	SO:0001583	missense	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2620T>A	5.37:g.5242262T>A	ENSP00000274181:p.Trp874Arg	Somatic		WXS	Illumina GAIIx	Phase_I	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.268319	0.80469	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.70045	-0.45	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.83880	0.5350	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.86697	0.1927	10	0.72032	D	0.01	.	15.0565	0.71917	0.0:0.0:0.0:1.0	.	874;874	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	R	874	ENSP00000274181:W874R	ENSP00000274181:W874R	W	+	1	0	ADAMTS16	5295262	1.000000	0.71417	0.902000	0.35471	0.713000	0.41058	6.749000	0.74883	2.198000	0.70561	0.524000	0.50904	TGG		0.632	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1		NM_139056	
AHNAK	79026	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	62296732	62296732	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr11:62296732C>A	ENST00000378024.4	-	5	5431	c.5157G>T	c.(5155-5157)aaG>aaT	p.K1719N	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1719					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.K1719N(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GCATACTGAACTTGGGCATTT	0.502																																																	1	Substitution - Missense(1)	kidney(1)											205.0	212.0	209.0					11																	62296732		2202	4299	6501	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5157G>T	11.37:g.62296732C>A	ENSP00000367263:p.Lys1719Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	C	10.11	1.259521	0.23051	.	.	ENSG00000124942	ENST00000378024	T	0.12147	2.71	3.9	2.01	0.26516	.	0.000000	0.38778	U	0.001568	T	0.43033	0.1229	H	0.94503	3.545	0.27005	N	0.964826	D	0.67145	0.996	D	0.77557	0.99	T	0.37384	-0.9708	10	0.51188	T	0.08	.	8.7794	0.34783	0.0:0.7327:0.0:0.2673	.	1719	Q09666	AHNK_HUMAN	N	1719	ENSP00000367263:K1719N	ENSP00000367263:K1719N	K	-	3	2	AHNAK	62053308	0.036000	0.19791	0.986000	0.45419	0.060000	0.15804	-0.428000	0.06991	0.251000	0.21505	-0.679000	0.03777	AAG		0.502	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1		NM_024060	
ATP1A1	476	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	116932958	116932958	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr1:116932958C>A	ENST00000295598.5	+	9	1399	c.1147C>A	c.(1147-1149)Cag>Aag	p.Q383K	ATP1A1_ENST00000369496.4_Missense_Mutation_p.Q352K|ATP1A1_ENST00000537345.1_Missense_Mutation_p.Q383K	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	383					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.Q383K(1)		NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	AACTCTGACTCAGAACCGGAT	0.488																																																	1	Substitution - Missense(1)	kidney(1)											85.0	75.0	79.0					1																	116932958		2203	4300	6503	SO:0001583	missense	476			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.1147C>A	1.37:g.116932958C>A	ENSP00000295598:p.Gln383Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	C	34	5.300163	0.95574	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000339159;ENST00000369496	T;T;T	0.80653	-1.4;-1.4;-1.4	4.87	4.87	0.63330	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.86439	0.5933	L	0.58354	1.805	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.995;0.996	D	0.87620	0.2509	10	0.87932	D	0	.	18.2082	0.89861	0.0:1.0:0.0:0.0	.	383;383	F5H3A1;P05023	.;AT1A1_HUMAN	K	383;383;382;352	ENSP00000295598:Q383K;ENSP00000445306:Q383K;ENSP00000358508:Q352K	ENSP00000295598:Q383K	Q	+	1	0	ATP1A1	116734481	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.640000	0.83355	2.558000	0.86282	0.650000	0.86243	CAG		0.488	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5		NM_001160233	
ASUN	55726	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	27075598	27075598	+	Silent	SNP	A	A	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr12:27075598A>G	ENST00000261191.7	-	8	1376	c.840T>C	c.(838-840)gaT>gaC	p.D280D	ASUN_ENST00000539625.1_Silent_p.D179D	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	280					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D280D(1)									GTAGCTCCACATCATAATTGG	0.289																																																	1	Substitution - coding silent(1)	kidney(1)											131.0	124.0	126.0					12																	27075598		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.840T>C	12.37:g.27075598A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Silent	SNP	ENST00000261191.7	37	CCDS8708.1	.	.	.	.	.	.	.	.	.	.	A	9.899	1.206235	0.22205	.	.	ENSG00000064102	ENST00000536232	.	.	.	5.53	0.531	0.17108	.	.	.	.	.	T	0.57710	0.2072	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51949	-0.8640	4	.	.	.	-29.7607	9.7894	0.40697	0.7176:0.0:0.2824:0.0	.	.	.	.	T	38	.	.	M	-	2	0	C12orf11	26966865	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.882000	0.39648	0.150000	0.19136	0.477000	0.44152	ATG		0.289	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402819.1		NM_018164	
CBX1	10951	broad.mit.edu;hgsc.bcm.edu	37	17	46148933	46148933	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr17:46148933G>A	ENST00000393408.3	-	5	902	c.422C>T	c.(421-423)tCt>tTt	p.S141F	CBX1_ENST00000225603.4_Missense_Mutation_p.S141F	NM_006807.4	NP_006798.1	P83916	CBX1_HUMAN	chromobox homolog 1	141	Chromo 2; shadow subtype. {ECO:0000255|PROSITE-ProRule:PRU00053}.				negative regulation of transcription, DNA-templated (GO:0045892)	chromatin (GO:0000785)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|pericentric heterochromatin (GO:0005721)|spindle (GO:0005819)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)	p.S141F(1)		breast(1)|central_nervous_system(1)|kidney(1)|prostate(1)	4						AGCCTCATCAGAGTTTTTCCT	0.488																																					NSCLC(136;694 2497 38792 39034)												1	Substitution - Missense(1)	kidney(1)											57.0	48.0	51.0					17																	46148933		2203	4300	6503	SO:0001583	missense	10951			U35451	CCDS11525.1	17q21.32	2010-07-06	2010-06-24		ENSG00000108468	ENSG00000108468			1551	protein-coding gene	gene with protein product	"""HP1 beta homolog (Drosophila )"""	604511	"""chromobox homolog 1 (Drosophila HP1 beta)"""			9169582	Standard	NM_001127228		Approved	HP1Hs-beta, M31, MOD1, CBX, HP1-BETA	uc002ind.4	P83916	OTTHUMG00000150417	ENST00000393408.3:c.422C>T	17.37:g.46148933G>A	ENSP00000377060:p.Ser141Phe	Somatic		WXS	Illumina HiSeq	Phase_I	P23197	Missense_Mutation	SNP	ENST00000393408.3	37	CCDS11525.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537411	0.65085	.	.	ENSG00000108468	ENST00000225603;ENST00000393408;ENST00000402583	.	.	.	5.28	5.28	0.74379	Chromo shadow (1);Chromo domain-like (1);Chromo domain/shadow (2);Chromo shadow, subgroup (1);	0.000000	0.64402	U	0.000001	T	0.78929	0.4361	M	0.81179	2.53	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.78902	-0.2021	9	0.42905	T	0.14	-9.6933	18.2281	0.89924	0.0:0.0:1.0:0.0	.	141	P83916	CBX1_HUMAN	F	141;141;145	.	ENSP00000225603:S141F	S	-	2	0	CBX1	43503932	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.747000	0.98863	2.689000	0.91719	0.549000	0.68633	TCT		0.488	CBX1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318016.1		NM_006807	
CEP152	22995	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	49048532	49048532	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr15:49048532G>C	ENST00000380950.2	-	20	3100	c.2913C>G	c.(2911-2913)atC>atG	p.I971M	CEP152_ENST00000325747.5_Missense_Mutation_p.I878M|CEP152_ENST00000399334.3_Missense_Mutation_p.I971M	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	971					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)	p.I971M(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TTTGTTCTTGGATTCTGTGGA	0.393																																																	1	Substitution - Missense(1)	kidney(1)											202.0	186.0	191.0					15																	49048532		1845	4093	5938	SO:0001583	missense	22995			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.2913C>G	15.37:g.49048532G>C	ENSP00000370337:p.Ile971Met	Somatic		WXS	Illumina HiSeq	Phase_I	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968212	0.53614	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.59906	0.23;0.27;0.28	5.54	-0.842	0.10748	.	0.502730	0.20568	N	0.089787	T	0.59528	0.2200	M	0.67953	2.075	0.30998	N	0.72066	D;D;D	0.63046	0.96;0.992;0.985	P;P;P	0.60068	0.605;0.868;0.758	T	0.57665	-0.7772	10	0.38643	T	0.18	-1.534	1.2114	0.01905	0.2941:0.2272:0.3199:0.1588	.	878;971;971	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	M	971;878;971	ENSP00000370337:I971M;ENSP00000321000:I878M;ENSP00000382271:I971M	ENSP00000321000:I878M	I	-	3	3	CEP152	46835824	0.949000	0.32298	0.992000	0.48379	0.912000	0.54170	0.007000	0.13174	-0.097000	0.12307	-0.469000	0.05056	ATC		0.393	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1		NM_014985	
COL6A5	256076	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	130098768	130098768	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr3:130098768C>T	ENST00000432398.2	+	4	1669	c.1175C>T	c.(1174-1176)aCa>aTa	p.T392I	COL6A5_ENST00000265379.6_Missense_Mutation_p.T392I	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	392	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.T392I(1)		endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CCAGAACAGACAATTTCCACG	0.413																																																	1	Substitution - Missense(1)	kidney(1)											67.0	56.0	60.0					3																	130098768		692	1591	2283	SO:0001583	missense	256076			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.1175C>T	3.37:g.130098768C>T	ENSP00000390895:p.Thr392Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	C	9.800	1.180298	0.21787	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.83755	-1.76;-1.76	5.19	-6.04	0.02178	.	.	.	.	.	T	0.65995	0.2745	L	0.34521	1.04	0.09310	N	1	B	0.18310	0.027	B	0.21917	0.037	T	0.51741	-0.8667	9	0.28530	T	0.3	.	1.3447	0.02161	0.1606:0.2829:0.3049:0.2516	.	392	A8TX70-2	.	I	392	ENSP00000390895:T392I;ENSP00000265379:T392I	ENSP00000265379:T392I	T	+	2	0	COL6A5	131581458	0.000000	0.05858	0.000000	0.03702	0.922000	0.55478	0.046000	0.14035	-0.825000	0.04290	0.455000	0.32223	ACA		0.413	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_153264	
CTSH	1512	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	79227327	79227327	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr15:79227327T>A	ENST00000220166.5	-	5	507	c.398A>T	c.(397-399)aAa>aTa	p.K133I	CTSH_ENST00000534533.1_5'UTR	NM_004390.3	NP_004381.2	P09668	CATH_HUMAN	cathepsin H	133					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|bradykinin catabolic process (GO:0010815)|cellular response to thyroid hormone stimulus (GO:0097067)|dichotomous subdivision of terminal units involved in lung branching (GO:0060448)|ERK1 and ERK2 cascade (GO:0070371)|immune response-regulating signaling pathway (GO:0002764)|membrane protein proteolysis (GO:0033619)|metanephros development (GO:0001656)|negative regulation of apoptotic process (GO:0043066)|neuropeptide catabolic process (GO:0010813)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidase activity (GO:0010952)|protein destabilization (GO:0031648)|proteolysis (GO:0006508)|response to retinoic acid (GO:0032526)|spermatogenesis (GO:0007283)|surfactant homeostasis (GO:0043129)|T cell mediated cytotoxicity (GO:0001913)|zymogen activation (GO:0031638)	acrosomal vesicle (GO:0001669)|alveolar lamellar body (GO:0097208)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|outer dense fiber (GO:0001520)	aminopeptidase activity (GO:0004177)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)|HLA-A specific activating MHC class I receptor activity (GO:0030108)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|thyroid hormone binding (GO:0070324)	p.K133I(1)		central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)	10						TACCTGATTTTTCACAGGTGA	0.488																																																	1	Substitution - Missense(1)	kidney(1)											111.0	96.0	101.0					15																	79227327		2196	4293	6489	SO:0001583	missense	1512			X07549	CCDS10308.1	15q25.1	2014-01-28			ENSG00000103811	ENSG00000103811	3.4.22.16	"""Cathepsins"""	2535	protein-coding gene	gene with protein product		116820		CPSB		2849458	Standard	NM_004390		Approved	ACC-4, ACC-5	uc021srk.1	P09668	OTTHUMG00000144171	ENST00000220166.5:c.398A>T	15.37:g.79227327T>A	ENSP00000220166:p.Lys133Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBK0|Q96NY6|Q9BUM7	Missense_Mutation	SNP	ENST00000220166.5	37	CCDS10308.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.622807	0.87460	.	.	ENSG00000103811	ENST00000220166;ENST00000394758;ENST00000528741;ENST00000444399	D;D	0.90732	-2.72;-2.72	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.96904	0.8989	H	0.98426	4.23	0.46564	D	0.999107	D;B	0.71674	0.998;0.247	D;P	0.77557	0.99;0.495	D	0.97294	0.9926	10	0.72032	D	0.01	.	10.6604	0.45698	0.0:0.0:0.0:1.0	.	133;121	E9PF73;E9PBP2	.;.	I	133;121;57;133	ENSP00000220166:K133I;ENSP00000435329:K57I	ENSP00000220166:K133I	K	-	2	0	CTSH	77014382	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.129000	0.64739	2.011000	0.59026	0.533000	0.62120	AAA		0.488	CTSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291370.1		NM_004390	
DMXL1	1657	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	118502425	118502425	+	Silent	SNP	A	A	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr5:118502425A>G	ENST00000311085.8	+	22	5165	c.5085A>G	c.(5083-5085)gaA>gaG	p.E1695E	DMXL1_ENST00000539542.1_Silent_p.E1695E	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1695								p.E1695E(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AAAGATTTGAACATTCTGCAG	0.353																																																	1	Substitution - coding silent(1)	kidney(1)											89.0	92.0	91.0					5																	118502425		2202	4300	6502	SO:0001819	synonymous_variant	1657			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.5085A>G	5.37:g.118502425A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000311085.8	37	CCDS4125.1																																																																																				0.353	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1		NM_005509	
ENPP5	59084	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	46133254	46133254	+	Silent	SNP	A	A	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr6:46133254A>G	ENST00000371383.2	-	4	1136	c.876T>C	c.(874-876)aaT>aaC	p.N292N	ENPP5_ENST00000492313.1_5'UTR|ENPP5_ENST00000230565.3_Silent_p.N292N					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)									p.N292N(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						AAACAGTAAGATTAGGATGAG	0.408																																																	1	Substitution - coding silent(1)	kidney(1)											197.0	174.0	182.0					6																	46133254		2203	4300	6503	SO:0001819	synonymous_variant	59084			AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.876T>C	6.37:g.46133254A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000371383.2	37	CCDS4915.1																																																																																				0.408	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040779.2			
FAM175B	23172	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	126523420	126523420	+	Silent	SNP	T	T	C			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr10:126523420T>C	ENST00000298492.5	+	9	1173	c.1128T>C	c.(1126-1128)gaT>gaC	p.D376D		NM_032182.3	NP_115558.3	Q15018	F175B_HUMAN	family with sequence similarity 175, member B	376					cellular response to freezing (GO:0071497)	BRISC complex (GO:0070552)|cytoplasm (GO:0005737)	polyubiquitin binding (GO:0031593)	p.D376D(1)		NS(1)	1						ACGACAGTGATTATGAAAATT	0.507																																																	1	Substitution - coding silent(1)	kidney(1)											64.0	63.0	63.0					10																	126523420		2203	4300	6503	SO:0001819	synonymous_variant	23172			D63877	CCDS31308.2	10q26.2	2013-01-24	2008-07-02	2008-07-02	ENSG00000165660	ENSG00000165660			28975	protein-coding gene	gene with protein product	"""Abraxas brother"""	611144	"""KIAA0157"""	KIAA0157		8590280	Standard	NM_032182		Approved	Em:AC068896.4, ABRO1	uc001lib.4	Q15018	OTTHUMG00000019218	ENST00000298492.5:c.1128T>C	10.37:g.126523420T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DKR2|Q96H11	Silent	SNP	ENST00000298492.5	37	CCDS31308.2																																																																																				0.507	FAM175B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050891.2		NM_032182	
FAM180A	389558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu|broad.mit.edu;ucsc.edu	37	7	135433271	135433272	+	Missense_Mutation	DNP	AC	AC	TA			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr7:135433271_135433272AC>TA	ENST00000338588.3	-	1	322_323	c.57_58GT>TA	c.(55-60)atGTgc>atTAgc	p.19_20MC>IS	FAM180A_ENST00000435869.1_5'UTR|FAM180A_ENST00000415751.1_Missense_Mutation_p.19_20MC>IS	NM_205855.3	NP_995327.1	Q6UWF9	F180A_HUMAN	family with sequence similarity 180, member A	19						extracellular region (GO:0005576)		p.M19I(1)|p.C20S(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)	14						CACCTGTGGCACATAGAAGCCT	0.416																																																	2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	389558			AC091736, AK290250, AK310180, AY358803	CCDS5841.1	7q33	2008-07-25			ENSG00000189320	ENSG00000189320			33773	protein-coding gene	gene with protein product						12975309, 12690205	Standard	NM_205855		Approved	HWKM1940, UNQ1940	uc003vtd.3	Q6UWF9	OTTHUMG00000155537	ENST00000338588.3:c.57_58delinsTA	7.37:g.135433271_135433272delinsTA	ENSP00000342336:p.M19_C20delinsIS	Somatic		WXS	Illumina HiSeq|Illumina GAIIx	Phase_I	B2RP85	Missense_Mutation	SNP	ENST00000338588.3	37	CCDS5841.1																																																																																				0.416	FAM180A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340554.2		NM_205855	
FAT1	2195	broad.mit.edu;ucsc.edu	37	4	187629281	187629281	+	Silent	SNP	A	A	C			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr4:187629281A>C	ENST00000441802.2	-	2	1910	c.1701T>G	c.(1699-1701)ccT>ccG	p.P567P		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	567	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P567P(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCTCAAACAAAGGTGTGTTGT	0.443										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												2	Substitution - coding silent(2)	kidney(2)											64.0	61.0	62.0					4																	187629281		1880	4121	6001	SO:0001819	synonymous_variant	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.1701T>G	4.37:g.187629281A>C		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000441802.2	37	CCDS47177.1																																																																																				0.443	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3		NM_005245	
GLB1L	79411	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	220101846	220101846	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr2:220101846A>G	ENST00000295759.7	-	17	2226	c.1913T>C	c.(1912-1914)cTt>cCt	p.L638P	GLB1L_ENST00000497855.1_5'UTR|GLB1L_ENST00000392089.2_Missense_Mutation_p.L638P|GLB1L_ENST00000409640.1_Missense_Mutation_p.L548P|GLB1L_ENST00000356283.3_Missense_Mutation_p.L548P			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	638					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)	p.L638P(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATCAGCTGAAAGGGAATTGAT	0.483																																																	1	Substitution - Missense(1)	kidney(1)											149.0	135.0	140.0					2																	220101846		2203	4300	6503	SO:0001583	missense	79411				CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.1913T>C	2.37:g.220101846A>G	ENSP00000295759:p.Leu638Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q96DR0	Missense_Mutation	SNP	ENST00000295759.7	37	CCDS2437.1	.	.	.	.	.	.	.	.	.	.	A	12.95	2.090922	0.36855	.	.	ENSG00000163521	ENST00000295759;ENST00000409640;ENST00000392089;ENST00000356283	D;D;D;D	0.97404	-4.37;-4.1;-4.37;-4.1	5.08	3.85	0.44370	Galactose-binding domain-like (1);	5.409120	0.00166	N	0.000003	D	0.96383	0.8820	L	0.29908	0.895	0.24148	N	0.995704	P;P	0.51537	0.946;0.91	P;P	0.53809	0.735;0.548	D	0.90359	0.4372	10	0.37606	T	0.19	-4.8562	10.1477	0.42774	0.8334:0.1666:0.0:0.0	.	548;638	Q6UWU2-2;Q6UWU2	.;GLB1L_HUMAN	P	638;548;638;548	ENSP00000295759:L638P;ENSP00000386354:L548P;ENSP00000375939:L638P;ENSP00000348628:L548P	ENSP00000295759:L638P	L	-	2	0	GLB1L	219810090	0.998000	0.40836	0.831000	0.32960	0.091000	0.18340	4.341000	0.59335	2.254000	0.74563	0.533000	0.62120	CTT		0.483	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256822.2		NM_024506	
GLG1	2734	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	74524933	74524933	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr16:74524933T>A	ENST00000422840.2	-	8	1414	c.1415A>T	c.(1414-1416)gAg>gTg	p.E472V	GLG1_ENST00000447066.2_Missense_Mutation_p.E461V|GLG1_ENST00000205061.5_Missense_Mutation_p.E472V	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	472					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.E472V(1)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						GTTCCCCTTCTCCCCTCGAAC	0.488																																																	1	Substitution - Missense(1)	kidney(1)											127.0	116.0	119.0					16																	74524933		2198	4300	6498	SO:0001583	missense	2734				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.1415A>T	16.37:g.74524933T>A	ENSP00000405984:p.Glu472Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.391278	0.62066	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.71	5.71	0.89125	.	0.163510	0.52532	D	0.000062	T	0.43478	0.1249	N	0.14661	0.345	0.80722	D	1	P;P;B	0.47106	0.85;0.89;0.029	P;B;B	0.45971	0.499;0.444;0.017	T	0.43750	-0.9372	9	0.42905	T	0.14	-6.3258	15.9905	0.80202	0.0:0.0:0.0:1.0	.	472;472;461	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	V	472;461;472	.	ENSP00000205061:E472V	E	-	2	0	GLG1	73082434	1.000000	0.71417	0.957000	0.39632	0.977000	0.68977	5.975000	0.70475	2.176000	0.68965	0.533000	0.62120	GAG		0.488	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1		NM_012201	
IQCF2	389123	broad.mit.edu;ucsc.edu	37	3	51897084	51897084	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr3:51897084C>A	ENST00000333127.3	+	3	222	c.193C>A	c.(193-195)Cat>Aat	p.H65N	IQCF2_ENST00000429548.1_3'UTR	NM_203424.1	NP_982248.1	Q8IXL9	IQCF2_HUMAN	IQ motif containing F2	65	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.							p.H65N(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GACACTGCTGCATGCAGCCCT	0.572																																																	1	Substitution - Missense(1)	kidney(1)											80.0	83.0	82.0					3																	51897084		2203	4300	6503	SO:0001583	missense	389123			AK128883	CCDS2835.1	3p21.31	2008-02-05			ENSG00000184345	ENSG00000184345			31815	protein-coding gene	gene with protein product							Standard	NM_203424		Approved		uc003dbt.1	Q8IXL9	OTTHUMG00000156914	ENST00000333127.3:c.193C>A	3.37:g.51897084C>A	ENSP00000329904:p.His65Asn	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000333127.3	37	CCDS2835.1	.	.	.	.	.	.	.	.	.	.	c	12.57	1.977421	0.34848	.	.	ENSG00000184345	ENST00000333127	T	0.71341	-0.56	5.06	4.18	0.49190	.	0.000000	0.52532	D	0.000079	T	0.81522	0.4840	M	0.82823	2.61	0.24112	N	0.995839	D	0.76494	0.999	D	0.64144	0.922	T	0.72763	-0.4195	10	0.28530	T	0.3	-27.2843	11.6251	0.51139	0.0:0.8208:0.1792:0.0	.	65	Q8IXL9	IQCF2_HUMAN	N	65	ENSP00000329904:H65N	ENSP00000329904:H65N	H	+	1	0	IQCF2	51872124	0.953000	0.32496	0.613000	0.29037	0.004000	0.04260	2.120000	0.41968	1.457000	0.47850	-0.175000	0.13238	CAT		0.572	IQCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346594.1		NM_203424	
KBTBD2	25948	broad.mit.edu;ucsc.edu	37	7	32909724	32909724	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr7:32909724C>T	ENST00000304056.4	-	4	1804	c.1105G>A	c.(1105-1107)Gtc>Atc	p.V369I	AVL9_ENST00000404479.1_Intron|KBTBD2_ENST00000485611.1_5'Flank	NM_015483.2	NP_056298.2	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	369								p.V369I(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|urinary_tract(1)	17			GBM - Glioblastoma multiforme(11;0.0499)			TTTATGCGGACAAAAAGCATT	0.413																																																	1	Substitution - Missense(1)	kidney(1)											149.0	137.0	141.0					7																	32909724		2203	4300	6503	SO:0001583	missense	25948			AB040922	CCDS34614.1	7p14.3	2013-01-08	2003-12-12	2003-12-12	ENSG00000170852	ENSG00000170852		"""BTB/POZ domain containing"""	21751	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 1"""	BKLHD1		10819331	Standard	NM_015483		Approved	DKFZP566C134	uc003tdb.2	Q8IY47	OTTHUMG00000152984	ENST00000304056.4:c.1105G>A	7.37:g.32909724C>T	ENSP00000302586:p.Val369Ile	Somatic		WXS	Illumina GAIIx	Phase_I	A8K9T7|Q86Y62|Q9P239|Q9UFM7|Q9Y382	Missense_Mutation	SNP	ENST00000304056.4	37	CCDS34614.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.63|14.63	2.593611|2.593611	0.46214|0.46214	.|.	.|.	ENSG00000170852|ENSG00000170852	ENST00000537125|ENST00000304056	.|T	.|0.66280	.|-0.2	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Kelch-type beta propeller (1);	.|0.052860	.|0.85682	.|D	.|0.000000	T|T	0.52581|0.52581	0.1743|0.1743	N|N	0.22421|0.22421	0.69|0.69	0.46222|0.46222	D|D	0.998934|0.998934	.|B	.|0.11235	.|0.004	.|B	.|0.09377	.|0.004	T|T	0.42172|0.42172	-0.9467|-0.9467	6|10	0.02654|0.42905	T|T	1|0.14	.|.	20.0752|20.0752	0.97739|0.97739	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|369	.|Q8IY47	.|KBTB2_HUMAN	Y|I	172|369	.|ENSP00000302586:V369I	ENSP00000440299:C172Y|ENSP00000302586:V369I	C|V	-|-	2|1	0|0	KBTBD2|KBTBD2	32876249|32876249	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	5.748000|5.748000	0.68697|0.68697	2.826000|2.826000	0.97356|0.97356	0.491000|0.491000	0.48974|0.48974	TGT|GTC		0.413	KBTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328890.1		XM_291224	
KLHL5	51088	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	39083717	39083717	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr4:39083717C>G	ENST00000504108.1	+	4	1259	c.976C>G	c.(976-978)Cgt>Ggt	p.R326G	KLHL5_ENST00000508137.2_Missense_Mutation_p.R139G|KLHL5_ENST00000261426.5_Missense_Mutation_p.R265G|KLHL5_ENST00000359687.2_Missense_Mutation_p.R326G|KLHL5_ENST00000381930.3_Missense_Mutation_p.R326G|KLHL5_ENST00000261425.3_Missense_Mutation_p.R280G	NM_015990.4	NP_057074.3	Q96PQ7	KLHL5_HUMAN	kelch-like family member 5	326						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R326C(3)|p.R326G(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29						TCTTGGAATTCGTTCTTTTGC	0.393																																																	4	Substitution - Missense(4)	large_intestine(3)|kidney(1)											204.0	193.0	197.0					4																	39083717		2203	4300	6503	SO:0001583	missense	51088			AF272976	CCDS3449.1, CCDS33974.1, CCDS33975.1, CCDS54756.1	4p15.1	2013-01-30	2013-01-30		ENSG00000109790	ENSG00000109790		"""Kelch-like"", ""BTB/POZ domain containing"""	6356	protein-coding gene	gene with protein product		608064	"""kelch (Drosophila)-like 5"", ""kelch-like 5 (Drosophila)"""			11590829, 14672410	Standard	NM_001007075		Approved		uc003gtp.3	Q96PQ7	OTTHUMG00000097819	ENST00000504108.1:c.976C>G	4.37:g.39083717C>G	ENSP00000423897:p.Arg326Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8K170|B7WP68|E9PCF4|F8WAE7|G3XA92|Q6Y881|Q86XW0|Q9NUK3|Q9NV27|Q9NVA9|Q9Y2X2	Missense_Mutation	SNP	ENST00000504108.1	37	CCDS33974.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792929	0.90453	.	.	ENSG00000109790	ENST00000544221;ENST00000261425;ENST00000508137;ENST00000504108;ENST00000359687;ENST00000381930;ENST00000261426	T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41	5.45	5.45	0.79879	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	M	0.82433	2.59	0.80722	D	1	B;P;P	0.46457	0.192;0.878;0.852	B;P;P	0.54270	0.215;0.747;0.631	T	0.82950	-0.0203	10	0.66056	D	0.02	.	19.6602	0.95864	0.0:1.0:0.0:0.0	.	265;326;326	F8WAE7;Q96PQ7;Q96PQ7-2	.;KLHL5_HUMAN;.	G	360;280;139;326;326;326;265	ENSP00000261425:R280G;ENSP00000423080:R139G;ENSP00000423897:R326G;ENSP00000352716:R326G;ENSP00000371355:R326G;ENSP00000261426:R265G	ENSP00000261425:R280G	R	+	1	0	KLHL5	38760112	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.776000	0.85560	2.729000	0.93468	0.460000	0.39030	CGT		0.393	KLHL5-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360604.1			
LY75	4065	hgsc.bcm.edu;ucsc.edu	37	2	160721395	160721395	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr2:160721395delC	ENST00000263636.4	-	14	2181	c.2154delG	c.(2152-2154)aggfs	p.R718fs	LY75-CD302_ENST00000504764.1_Frame_Shift_Del_p.R718fs|LY75_ENST00000553424.1_Frame_Shift_Del_p.R718fs|LY75-CD302_ENST00000505052.1_Frame_Shift_Del_p.R718fs|LY75_ENST00000554112.1_Frame_Shift_Del_p.R718fs	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	718	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		AATCTGGGCTCCTTTTATTCA	0.368																																																	0													146.0	130.0	136.0					2																	160721395		2203	4300	6503	SO:0001589	frameshift_variant	100526664			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.2154delG	2.37:g.160721395delC	ENSP00000263636:p.Arg718fs	Somatic		WXS	Illumina HiSeq	Phase_I	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Frame_Shift_Del	DEL	ENST00000263636.4	37	CCDS2211.1																																																																																				0.368	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1			
MTMR4	9110	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	56573389	56573389	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr17:56573389A>T	ENST00000323456.5	-	16	2238	c.2114T>A	c.(2113-2115)cTt>cAt	p.L705H	MTMR4_ENST00000579925.1_Missense_Mutation_p.L648H	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	705					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.L705H(1)		breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGCGGTATTAAGCAGTTTGTA	0.493																																																	1	Substitution - Missense(1)	kidney(1)											240.0	239.0	239.0					17																	56573389		2203	4300	6503	SO:0001583	missense	9110			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.2114T>A	17.37:g.56573389A>T	ENSP00000325285:p.Leu705His	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	37	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	A	2.136	-0.398021	0.04865	.	.	ENSG00000108389	ENST00000323456	D	0.93953	-3.32	4.57	3.48	0.39840	.	1.315110	0.04755	N	0.425275	D	0.91835	0.7416	L	0.27053	0.805	0.23198	N	0.998139	D	0.65815	0.995	P	0.56398	0.797	T	0.81915	-0.0714	10	0.15066	T	0.55	.	7.014	0.24877	0.8964:0.0:0.1036:0.0	.	705	Q9NYA4	MTMR4_HUMAN	H	705	ENSP00000325285:L705H	ENSP00000325285:L705H	L	-	2	0	MTMR4	53928388	0.002000	0.14202	0.838000	0.33150	0.720000	0.41350	1.119000	0.31258	0.887000	0.36136	0.533000	0.62120	CTT		0.493	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1		NM_004687	
MUC16	94025	broad.mit.edu;ucsc.edu	37	19	9046549	9046549	+	Silent	SNP	A	A	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr19:9046549A>G	ENST00000397910.4	-	5	35285	c.35082T>C	c.(35080-35082)ccT>ccC	p.P11694P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11696	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P11694P(1)|p.P7327P(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTCTGTGGAGGATGAGTGA	0.522																																																	2	Substitution - coding silent(2)	kidney(2)											115.0	113.0	114.0					19																	9046549		2011	4178	6189	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35082T>C	19.37:g.9046549A>G		Somatic		WXS	Illumina GAIIx	Phase_I	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690	
MYCL	4610	broad.mit.edu;hgsc.bcm.edu	37	1	40363317	40363317	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr1:40363317A>C	ENST00000372816.2	-	2	1269	c.822T>G	c.(820-822)agT>agG	p.S274R	RP1-118J21.5_ENST00000418255.1_RNA|MYCL_ENST00000397332.2_Missense_Mutation_p.S304R			P12524	MYCL_HUMAN	v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog	274						nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S304R(1)									CAGTATCAGAACTGACAGGTT	0.547																																																	1	Substitution - Missense(1)	kidney(1)											109.0	108.0	108.0					1																	40363317		2203	4300	6503	SO:0001583	missense	4610				CCDS30682.1, CCDS44117.1, CCDS44117.2, CCDS53300.1	1p34.3	2013-07-09	2013-07-09	2013-07-09	ENSG00000116990	ENSG00000116990		"""Basic helix-loop-helix proteins"""	7555	protein-coding gene	gene with protein product	"""l-myc protein"", ""myc-related gene from lung cancer"", ""oncogene lmyc"""	164850	"""v-myc avian myelocytomatosis viral oncogene homolog 1, lung carcinoma derived"""	MYCL1		8978772	Standard	NM_001033082		Approved	LMYC, bHLHe38	uc001cer.2	P12524	OTTHUMG00000009243	ENST00000372816.2:c.822T>G	1.37:g.40363317A>C	ENSP00000361903:p.Ser274Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2C9|B4DJH2|Q14897|Q5QPL0|Q5QPL1|Q9NUE9	Missense_Mutation	SNP	ENST00000372816.2	37	CCDS30682.1	.	.	.	.	.	.	.	.	.	.	A	11.17	1.560809	0.27827	.	.	ENSG00000116990	ENST00000397332;ENST00000372816	T;T	0.79845	-1.11;-1.31	5.91	2.46	0.29980	.	2.201000	0.01409	N	0.013911	T	0.72285	0.3441	N	0.24115	0.695	0.80722	D	1	B	0.16396	0.017	B	0.14023	0.01	T	0.52823	-0.8524	10	0.46703	T	0.11	-8.0581	8.7383	0.34541	0.7064:0.0:0.2936:0.0	.	274	P12524	MYCL1_HUMAN	R	304;274	ENSP00000380494:S304R;ENSP00000361903:S274R	ENSP00000361903:S274R	S	-	3	2	MYCL1	40135904	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	0.799000	0.27028	0.515000	0.28320	0.533000	0.62120	AGT		0.547	MYCL-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277004.1		NM_001033082	
NOM1	64434	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	156761876	156761876	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr7:156761876T>G	ENST00000275820.3	+	10	2409	c.2394T>G	c.(2392-2394)agT>agG	p.S798R		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	798						nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S798R(1)		endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		AAGACCTCAGTTTAATTTTCA	0.368																																																	1	Substitution - Missense(1)	kidney(1)											75.0	78.0	77.0					7																	156761876		2201	4299	6500	SO:0001583	missense	64434			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.2394T>G	7.37:g.156761876T>G	ENSP00000275820:p.Ser798Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	.	.	.	.	.	.	.	.	.	.	T	3.509	-0.100093	0.07010	.	.	ENSG00000146909	ENST00000275820	T	0.11712	2.75	5.14	2.74	0.32292	.	1.165980	0.05989	N	0.645613	T	0.09423	0.0232	L	0.29908	0.895	0.09310	N	1	B	0.26902	0.163	B	0.28709	0.093	T	0.41858	-0.9485	10	0.16420	T	0.52	-0.6861	8.8305	0.35080	0.0:0.2198:0.0:0.7802	.	798	Q5C9Z4	NOM1_HUMAN	R	798	ENSP00000275820:S798R	ENSP00000275820:S798R	S	+	3	2	NOM1	156454637	0.000000	0.05858	0.188000	0.23233	0.439000	0.31926	0.152000	0.16302	0.811000	0.34303	0.482000	0.46254	AGT		0.368	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1		NM_138400	
NOX1	27035	broad.mit.edu;ucsc.edu	37	X	100105317	100105317	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chrX:100105317A>T	ENST00000372966.3	-	9	1161	c.956T>A	c.(955-957)aTg>aAg	p.M319K	NOX1_ENST00000372964.1_Intron|NOX1_ENST00000217885.5_Missense_Mutation_p.M319K|NOX1_ENST00000372960.4_Missense_Mutation_p.M282K	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	319	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)	p.M319K(1)		cervix(1)|lung(3)|ovary(1)|skin(2)	7						CCCCACTTCCATGCTGAAGCC	0.438																																																	1	Substitution - Missense(1)	kidney(1)											48.0	43.0	45.0					X																	100105317		2203	4300	6503	SO:0001583	missense	27035			AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.956T>A	X.37:g.100105317A>T	ENSP00000362057:p.Met319Lys	Somatic		WXS	Illumina GAIIx	Phase_I	A8K836|O95691|Q2PP02	Missense_Mutation	SNP	ENST00000372966.3	37	CCDS14474.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.13|16.13	3.035324|3.035324	0.54896|0.54896	.|.	.|.	ENSG00000007952|ENSG00000007952	ENST00000427768|ENST00000372966;ENST00000217885;ENST00000372960;ENST00000372957	.|T;T;T	.|0.13538	.|2.58;2.58;2.58	3.87|3.87	2.71|2.71	0.32032|0.32032	.|Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	.|0.049199	.|0.85682	.|D	.|0.000000	T|T	0.36468|0.36468	0.0968|0.0968	M|M	0.87038|0.87038	2.855|2.855	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D	.|0.64830	.|0.994;0.98;0.992	.|D;P;D	.|0.75020	.|0.985;0.897;0.958	T|T	0.06075|0.06075	-1.0847|-1.0847	5|10	.|0.54805	.|T	.|0.06	-9.2071|-9.2071	7.4191|7.4191	0.27061|0.27061	0.8926:0.0:0.1074:0.0|0.8926:0.0:0.1074:0.0	.|.	.|282;319;319	.|A6NGA6;Q9Y5S8-3;Q9Y5S8	.|.;.;NOX1_HUMAN	Q|K	3|319;319;282;8	.|ENSP00000362057:M319K;ENSP00000217885:M319K;ENSP00000362051:M282K	.|ENSP00000217885:M319K	H|M	-|-	3|2	2|0	NOX1|NOX1	99991973|99991973	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	6.362000|6.362000	0.73077|0.73077	0.420000|0.420000	0.25954|0.25954	0.345000|0.345000	0.21793|0.21793	CAT|ATG		0.438	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057495.1		NM_007052	
ORC1	4998	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	52849596	52849596	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr1:52849596T>C	ENST00000371568.3	-	12	1987	c.1769A>G	c.(1768-1770)cAa>cGa	p.Q590R	ORC1_ENST00000371566.1_Missense_Mutation_p.Q590R	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	590	Necessary and sufficient for ORC complex assembly.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Q590R(1)		breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TGTTGCTTTTTGGCCTGTTAG	0.507																																																	1	Substitution - Missense(1)	kidney(1)											149.0	133.0	138.0					1																	52849596		2203	4300	6503	SO:0001583	missense	4998				CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.1769A>G	1.37:g.52849596T>C	ENSP00000360623:p.Gln590Arg	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	37	CCDS566.1	.	.	.	.	.	.	.	.	.	.	T	19.50	3.839949	0.71488	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.55930	0.49;0.49	5.84	5.84	0.93424	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.099124	0.64402	D	0.000001	T	0.54983	0.1892	L	0.49126	1.545	0.80722	D	1	B;B	0.33549	0.417;0.417	B;B	0.39935	0.314;0.314	T	0.58154	-0.7686	10	0.72032	D	0.01	-3.2765	16.2033	0.82103	0.0:0.0:0.0:1.0	.	585;590	B7Z8H0;Q13415	.;ORC1_HUMAN	R	590	ENSP00000360623:Q590R;ENSP00000360621:Q590R	ENSP00000360621:Q590R	Q	-	2	0	ORC1	52622184	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.662000	0.83803	2.223000	0.72356	0.460000	0.39030	CAA		0.507	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1		NM_004153	
PALMD	54873	broad.mit.edu;ucsc.edu	37	1	100155420	100155420	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr1:100155420C>T	ENST00000263174.4	+	7	1979	c.1604C>T	c.(1603-1605)tCc>tTc	p.S535F	PALMD_ENST00000605497.1_Missense_Mutation_p.S535F	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	535					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)		p.S535F(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		GAGGATCCATCCTTAACAGGT	0.463																																																	1	Substitution - Missense(1)	kidney(1)											47.0	47.0	47.0					1																	100155420		2191	4285	6476	SO:0001583	missense	54873			AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.1604C>T	1.37:g.100155420C>T	ENSP00000263174:p.Ser535Phe	Somatic		WXS	Illumina GAIIx	Phase_I	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Missense_Mutation	SNP	ENST00000263174.4	37	CCDS758.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.558546	0.65538	.	.	ENSG00000099260	ENST00000263174	T	0.31247	1.5	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000003	T	0.48960	0.1529	M	0.63843	1.955	0.52099	D	0.999941	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	T	0.50499	-0.8821	10	0.87932	D	0	-7.9822	19.415	0.94690	0.0:1.0:0.0:0.0	.	535;455	Q9NP74;Q9NP74-2	PALMD_HUMAN;.	F	535	ENSP00000263174:S535F	ENSP00000263174:S535F	S	+	2	0	PALMD	99928008	0.998000	0.40836	0.755000	0.31263	0.762000	0.43233	5.677000	0.68142	2.577000	0.86979	0.563000	0.77884	TCC		0.463	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1		NM_017734	
PFKFB3	5209	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	6268194	6268194	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr10:6268194A>T	ENST00000379775.4	+	14	1711	c.1381A>T	c.(1381-1383)Agt>Tgt	p.S461C	PFKFB3_ENST00000360521.2_Missense_Mutation_p.S461C|PFKFB3_ENST00000379789.4_Missense_Mutation_p.S441C|PFKFB3_ENST00000540253.1_Missense_Mutation_p.S475C|PFKFB3_ENST00000536985.1_3'UTR|PFKFB3_ENST00000379782.3_Missense_Mutation_p.S461C|PFKFB3_ENST00000379785.1_Missense_Mutation_p.S461C|PFKFB3_ENST00000317350.4_Missense_Mutation_p.S461C	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	461	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)	p.S461C(2)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						GAGACGCAATAGTGTCACCCC	0.542																																																	2	Substitution - Missense(2)	kidney(2)											104.0	118.0	113.0					10																	6268194		2203	4300	6503	SO:0001583	missense	5209				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.1381A>T	10.37:g.6268194A>T	ENSP00000369100:p.Ser461Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	ENST00000379775.4	37	CCDS7078.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.471521	0.84533	.	.	ENSG00000170525	ENST00000379789;ENST00000540253;ENST00000379781;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499;ENST00000414237	.	.	.	5.24	5.24	0.73138	.	0.078462	0.85682	D	0.000000	T	0.72985	0.3529	M	0.76574	2.34	0.80722	D	1	D;D;B;D	0.61697	0.99;0.978;0.01;0.962	P;P;B;B	0.53649	0.731;0.497;0.007;0.301	T	0.77960	-0.2391	9	0.87932	D	0	-13.3171	15.1499	0.72689	1.0:0.0:0.0:0.0	.	475;461;461;441	B7Z955;Q16875-2;Q16875;Q5VX15	.;.;F263_HUMAN;.	C	441;475;55;461;461;461;461;461;461;30	.	ENSP00000369105:S461C	S	+	1	0	PFKFB3	6308200	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.646000	0.91053	1.982000	0.57802	0.533000	0.62120	AGT		0.542	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1			
PKN2	5586	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	89271212	89271212	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr1:89271212A>G	ENST00000370521.3	+	11	1893	c.1534A>G	c.(1534-1536)Att>Gtt	p.I512V	PKN2_ENST00000370513.5_Missense_Mutation_p.I464V|PKN2_ENST00000544045.1_Missense_Mutation_p.I186V|PKN2_ENST00000316005.7_Missense_Mutation_p.I512V|PKN2_ENST00000370505.3_Missense_Mutation_p.I355V	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	512					apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.I512V(2)		breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		TCAAATGAATATTAATATTGC	0.373																																																	2	Substitution - Missense(2)	kidney(2)											64.0	62.0	62.0					1																	89271212		1864	4087	5951	SO:0001583	missense	5586			U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.1534A>G	1.37:g.89271212A>G	ENSP00000359552:p.Ile512Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	ENST00000370521.3	37	CCDS714.1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.419233	0.42918	.	.	ENSG00000065243	ENST00000370521;ENST00000316005;ENST00000370505;ENST00000370513;ENST00000544045	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	6.02	6.02	0.97574	.	0.000000	0.45361	U	0.000362	T	0.52533	0.1740	L	0.58101	1.795	0.53005	D	0.999961	B;B;D;P	0.59357	0.303;0.189;0.985;0.937	B;B;D;B	0.67548	0.134;0.134;0.952;0.38	T	0.53514	-0.8428	10	0.52906	T	0.07	.	16.5311	0.84359	1.0:0.0:0.0:0.0	.	496;464;512;512	B4DTP5;E7ESL7;Q16513;B1AL79	.;.;PKN2_HUMAN;.	V	512;512;355;464;186	ENSP00000359552:I512V;ENSP00000317851:I512V;ENSP00000359536:I355V;ENSP00000359544:I464V;ENSP00000439643:I186V	ENSP00000317851:I512V	I	+	1	0	PKN2	89043800	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.864000	0.75494	2.306000	0.77630	0.482000	0.46254	ATT		0.373	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3		NM_006256	
SLC19A2	10560	hgsc.bcm.edu;ucsc.edu	37	1	169437458	169437458	+	Frame_Shift_Del	DEL	C	C	-	rs530420883		TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr1:169437458delC	ENST00000236137.5	-	5	1492	c.1256delG	c.(1255-1257)cgcfs	p.R419fs	SLC19A2_ENST00000367804.4_Frame_Shift_Del_p.R218fs	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	419					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	TAGGGCATAGCGTTCCATGCT	0.358																																																	0													87.0	77.0	81.0					1																	169437458		2203	4300	6503	SO:0001589	frameshift_variant	10560			AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.1256delG	1.37:g.169437458delC	ENSP00000236137:p.Arg419fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Frame_Shift_Del	DEL	ENST00000236137.5	37	CCDS1280.1																																																																																				0.358	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086106.1		NM_006996	
SLC39A10	57181	hgsc.bcm.edu;ucsc.edu	37	2	196545001	196545001	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr2:196545001delT	ENST00000409086.3	+	2	510	c.235delT	c.(235-237)tttfs	p.F80fs	SLC39A10_ENST00000359634.5_Frame_Shift_Del_p.F80fs|SLC39A10_ENST00000541054.1_Intron	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	80					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			AAGATTATCCTTTTTTGGTTT	0.338																																																	0													67.0	71.0	70.0					2																	196545001		2202	4299	6501	SO:0001589	frameshift_variant	57181				CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.235delT	2.37:g.196545001delT	ENSP00000386766:p.Phe80fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Frame_Shift_Del	DEL	ENST00000409086.3	37	CCDS33353.1																																																																																				0.338	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1		XM_047707	
SLC47A1	55244	hgsc.bcm.edu;ucsc.edu	37	17	19451355	19451355	+	Missense_Mutation	SNP	G	G	T	rs150632967	byFrequency	TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr17:19451355G>T	ENST00000270570.4	+	4	450	c.364G>T	c.(364-366)Gtc>Ttc	p.V122F	SLC47A1_ENST00000436810.2_Missense_Mutation_p.V99F|SLC47A1_ENST00000457293.1_Missense_Mutation_p.V122F|SLC47A1_ENST00000575023.1_Missense_Mutation_p.V122F|SLC47A1_ENST00000584348.1_3'UTR|SLC47A1_ENST00000542886.1_Missense_Mutation_p.V122F|SLC47A1_ENST00000571335.1_5'UTR|SLC47A1_ENST00000395585.1_Missense_Mutation_p.V122F	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	122					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	GAGTGCGCTCGTCCTGCTCCT	0.602																																																	0													140.0	115.0	124.0					17																	19451355		2203	4300	6503	SO:0001583	missense	55244				CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.364G>T	17.37:g.19451355G>T	ENSP00000270570:p.Val122Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	37	CCDS11209.1	.	.	.	.	.	.	.	.	.	.	g	10.93	1.490156	0.26686	.	.	ENSG00000142494	ENST00000436810;ENST00000270570;ENST00000457293;ENST00000542886;ENST00000395585	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	4.99	-2.98	0.05513	.	0.479354	0.22592	N	0.058074	T	0.30324	0.0761	N	0.16903	0.455	0.24701	N	0.993256	P;D;P;P	0.54964	0.872;0.969;0.592;0.487	P;P;P;P	0.62184	0.622;0.899;0.519;0.613	T	0.35798	-0.9774	10	0.87932	D	0	-26.2373	11.383	0.49768	0.7264:0.0:0.2736:0.0	.	99;122;122;122	E7EX57;B4DYV3;Q96FL8;Q96FL8-3	.;.;S47A1_HUMAN;.	F	99;122;122;122;122	ENSP00000407155:V99F;ENSP00000270570:V122F;ENSP00000415586:V122F;ENSP00000440435:V122F;ENSP00000378951:V122F	ENSP00000270570:V122F	V	+	1	0	SLC47A1	19391947	1.000000	0.71417	0.006000	0.13384	0.007000	0.05969	2.669000	0.46825	-0.986000	0.03498	-1.533000	0.00918	GTC		0.602	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1		NM_018242	
SUCLG1	8802	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	84660489	84660489	+	Silent	SNP	C	C	T			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr2:84660489C>T	ENST00000393868.2	-	6	870	c.660G>A	c.(658-660)caG>caA	p.Q220Q	SUCLG1_ENST00000491123.1_5'Flank	NM_003849.3	NP_003840.2	P53597	SUCA_HUMAN	succinate-CoA ligase, alpha subunit	220					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)	p.Q220Q(1)		kidney(4)|large_intestine(4)|lung(2)	10					Succinic acid(DB00139)	CGCACAAAGACTGCCCCAATC	0.368																																					Ovarian(48;203 1101 37206 40305 50790)												1	Substitution - coding silent(1)	kidney(1)											78.0	71.0	73.0					2																	84660489		2203	4300	6503	SO:0001819	synonymous_variant	8802			Z68204	CCDS1967.2	2p11.3	2008-02-05	2008-01-08		ENSG00000163541	ENSG00000163541	6.2.1.4		11449	protein-coding gene	gene with protein product		611224	"""succinate-CoA ligase, GDP-forming, alpha subunit"""			9128182	Standard	NM_003849		Approved		uc002son.3	P53597	OTTHUMG00000130023	ENST00000393868.2:c.660G>A	2.37:g.84660489C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9BWB0|Q9UNP6	Silent	SNP	ENST00000393868.2	37	CCDS1967.2																																																																																				0.368	SUCLG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252298.2		NM_003849	
LRRC53	100144878	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	74954920	74954920	+	Intron	SNP	C	C	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr1:74954920C>G	ENST00000294635.4	-	2	89				TNNI3K_ENST00000370891.2_Silent_p.L824L|TNNI3K_ENST00000326637.3_Silent_p.L723L|FPGT-TNNI3K_ENST00000557284.2_Silent_p.L837L			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53							integral component of membrane (GO:0016021)		p.L723L(1)		NS(1)|breast(1)|lung(2)	4						AAGAGTGTCTCTGCAACATTG	0.383																																																	1	Substitution - coding silent(1)	kidney(1)											75.0	86.0	82.0					1																	74954920		2203	4300	6503	SO:0001627	intron_variant	51086					1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.26-5861G>C	1.37:g.74954920C>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000294635.4	37																																																																																					0.383	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000026515.2			
TNR	7143	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	175348829	175348829	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr1:175348829T>C	ENST00000367674.2	-	9	2530	c.1822A>G	c.(1822-1824)Acc>Gcc	p.T608A	TNR_ENST00000263525.2_Missense_Mutation_p.T608A			Q92752	TENR_HUMAN	tenascin R	608	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.T608A(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TCAAGGCTGGTTGCTGTGCGA	0.478																																																	1	Substitution - Missense(1)	kidney(1)											107.0	81.0	90.0					1																	175348829		2203	4300	6503	SO:0001583	missense	7143			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1822A>G	1.37:g.175348829T>C	ENSP00000356646:p.Thr608Ala	Somatic		WXS	Illumina HiSeq	Phase_I	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.461170	0.43736	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.61627	0.09;0.09	5.44	5.44	0.79542	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.118551	0.56097	D	0.000027	T	0.50990	0.1648	M	0.76328	2.33	0.33717	D	0.616548	B	0.06786	0.001	B	0.09377	0.004	T	0.57376	-0.7822	10	0.25106	T	0.35	.	4.0482	0.09783	0.1728:0.1204:0.0:0.7068	.	608	Q92752	TENR_HUMAN	A	608	ENSP00000356646:T608A;ENSP00000263525:T608A	ENSP00000263525:T608A	T	-	1	0	TNR	173615452	0.993000	0.37304	0.996000	0.52242	0.958000	0.62258	2.444000	0.44890	2.053000	0.61076	0.533000	0.62120	ACC		0.478	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4		NM_003285	
TUSC3	7991	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	15480643	15480643	+	Missense_Mutation	SNP	A	A	C	rs11545035	byFrequency	TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr8:15480643A>C	ENST00000503731.1	+	2	341	c.193A>C	c.(193-195)Atc>Ctc	p.I65L	TUSC3_ENST00000382020.4_Missense_Mutation_p.I65L|TUSC3_ENST00000503191.1_3'UTR|TUSC3_ENST00000506802.1_Missense_Mutation_p.I65L|TUSC3_ENST00000509380.1_Missense_Mutation_p.I65L	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	65	Thioredoxin.		I -> V (in dbSNP:rs11545035).		cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.I65L(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		CAGACGCTCAATCTTCCGAAT	0.388																																																	2	Substitution - Missense(2)	kidney(2)											75.0	75.0	75.0					8																	15480643		2203	4300	6503	SO:0001583	missense	7991			AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.193A>C	8.37:g.15480643A>C	ENSP00000424544:p.Ile65Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	A	13.73	2.325626	0.41197	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.59	0.165	0.14995	Thioredoxin-like fold (2);	0.154257	0.56097	N	0.000022	T	0.24661	0.0598	N	0.19112	0.55	0.39885	D	0.973699	B;B;B;B;B;B	0.16603	0.009;0.014;0.002;0.003;0.014;0.018	B;B;B;B;B;B	0.25614	0.004;0.062;0.001;0.016;0.019;0.014	T	0.05053	-1.0909	10	0.33940	T	0.23	-11.7947	8.1491	0.31130	0.443:0.0:0.557:0.0	.	65;65;65;65;65;65	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	L	65	ENSP00000371450:I65L;ENSP00000425777:I65L;ENSP00000423426:I65L;ENSP00000424544:I65L	ENSP00000221167:I65L	I	+	1	0	TUSC3	15525014	1.000000	0.71417	0.588000	0.28705	0.999000	0.98932	6.250000	0.72435	0.157000	0.19338	0.528000	0.53228	ATC		0.388	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1		NM_006765	
XIRP2	129446	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	167992508	167992508	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr2:167992508G>C	ENST00000409728.1	+	3	587	c.498G>C	c.(496-498)aaG>aaC	p.K166N	XIRP2_ENST00000409756.2_Missense_Mutation_p.K166N|XIRP2-AS1_ENST00000525330.1_RNA|XIRP2_ENST00000409195.1_Missense_Mutation_p.K166N|XIRP2_ENST00000295237.9_Missense_Mutation_p.K166N|XIRP2_ENST00000409043.1_Missense_Mutation_p.K166N|XIRP2_ENST00000420519.1_Missense_Mutation_p.K166N	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.K166N(2)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ATTCAGACAAGAAAGGCAAGG	0.433																																																	2	Substitution - Missense(2)	kidney(2)											97.0	97.0	97.0					2																	167992508		1905	4128	6033	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.498G>C	2.37:g.167992508G>C	ENSP00000386619:p.Lys166Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	37	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	G	12.54	1.967261	0.34754	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	D;D;T;D;D;T	0.84516	-1.52;-1.86;3.84;-1.52;-1.86;3.84	5.51	4.63	0.57726	.	.	.	.	.	T	0.80696	0.4672	.	.	.	0.25397	N	0.988473	P;P	0.46512	0.573;0.879	B;P	0.45167	0.3;0.472	T	0.69124	-0.5228	8	0.27785	T	0.31	-7.5124	9.763	0.40543	0.1577:0.0:0.8423:0.0	.	166;166	A4UGR9-4;A4UGR9-6	.;.	N	166	ENSP00000386454:K166N;ENSP00000386619:K166N;ENSP00000386840:K166N;ENSP00000386724:K166N;ENSP00000415541:K166N;ENSP00000295237:K166N	ENSP00000295237:K166N	K	+	3	2	XIRP2	167700754	0.644000	0.27277	0.992000	0.48379	0.738000	0.42128	0.362000	0.20284	1.323000	0.45263	0.591000	0.81541	AAG		0.433	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1		NM_152381	
CRTC1	23373	broad.mit.edu	37	19	18856654	18856654	+	Silent	SNP	C	C	T			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr19:18856654C>T	ENST00000321949.8	+	3	291	c.265C>T	c.(265-267)Ctg>Ttg	p.L89L	CRTC1_ENST00000601916.1_Silent_p.L14L|CRTC1_ENST00000338797.6_Silent_p.L105L|CRTC1_ENST00000594658.1_Silent_p.L48L	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1									p.L105L(1)|p.L89L(1)	CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						ATCCTCGGGCCTGGACACCAG	0.667																																																	2	Substitution - coding silent(2)	kidney(2)											51.0	63.0	59.0					19																	18856654		2203	4300	6503	SO:0001819	synonymous_variant	23373			AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.265C>T	19.37:g.18856654C>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000321949.8	37	CCDS32963.1																																																																																				0.667	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465151.3		NM_025021	
EPHB6	2051	broad.mit.edu	37	7	142562259	142562259	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr7:142562259delC	ENST00000392957.2	+	7	1488	c.701delC	c.(700-702)gccfs	p.A234fs	EPHB6_ENST00000442129.1_Frame_Shift_Del_p.A234fs|EPHB6_ENST00000411471.2_Intron	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	234	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					ACCTGCCCTGCCGTGCTCCGA	0.662																																																	0													65.0	74.0	71.0					7																	142562259		2201	4296	6497	SO:0001589	frameshift_variant	2051			D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.701delC	7.37:g.142562259delC	ENSP00000376684:p.Ala234fs	Somatic		WXS	Illumina GAIIx	Phase_I	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Frame_Shift_Del	DEL	ENST00000392957.2	37	CCDS5873.2																																																																																				0.662	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			
RP11-166D19.1	0	broad.mit.edu	37	11	121970479	121970479	+	RNA	SNP	C	C	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr11:121970479C>A	ENST00000531381.1	-	0	732				MIR125B1_ENST00000385236.1_RNA																							CGACTCGCAGCTCCCAAGAGC	0.413																																																	0													62.0	58.0	59.0					11																	121970479		1567	3581	5148			406911																															11.37:g.121970479C>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000531381.1	37																																																																																					0.413	RP11-166D19.1-004	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000387641.1			
OPRD1	4985	broad.mit.edu	37	1	29185486	29185486	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr1:29185486C>A	ENST00000234961.2	+	2	490	c.248C>A	c.(247-249)gCc>gAc	p.A83D		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	83					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)	p.A83D(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	ATGAAGACGGCCACCAACATC	0.478																																																	1	Substitution - Missense(1)	kidney(1)											112.0	114.0	113.0					1																	29185486		2203	4300	6503	SO:0001583	missense	4985			U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.248C>A	1.37:g.29185486C>A	ENSP00000234961:p.Ala83Asp	Somatic		WXS	Illumina GAIIx	Phase_I	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511234	0.85389	.	.	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.38887	1.11	4.46	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.68632	0.3022	M	0.93808	3.46	0.80722	D	1	P	0.41947	0.766	P	0.54590	0.756	T	0.77437	-0.2588	10	0.87932	D	0	.	14.6367	0.68694	0.0:1.0:0.0:0.0	.	83	P41143	OPRD_HUMAN	D	83	ENSP00000234961:A83D	ENSP00000234961:A83D	A	+	2	0	OPRD1	29058073	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.651000	0.83577	2.315000	0.78130	0.462000	0.41574	GCC		0.478	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1		NM_000911	
RRAD	6236	broad.mit.edu	37	16	66956073	66956073	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr16:66956073G>T	ENST00000299759.6	-	5	1083	c.833C>A	c.(832-834)gCg>gAg	p.A278E	RRAD_ENST00000420652.1_Missense_Mutation_p.A278E			P55042	RAD_HUMAN	Ras-related associated with diabetes	278	Calmodulin-binding.				small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.A278E(6)		endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GAAGCGCTTCGCCTTTTTGCC	0.612																																																	6	Substitution - Missense(6)	kidney(4)|prostate(1)|endometrium(1)											94.0	75.0	81.0					16																	66956073		2200	4300	6500	SO:0001583	missense	6236			L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.833C>A	16.37:g.66956073G>T	ENSP00000299759:p.Ala278Glu	Somatic		WXS	Illumina GAIIx	Phase_I	Q96F39	Missense_Mutation	SNP	ENST00000299759.6	37	CCDS10824.1	.	.	.	.	.	.	.	.	.	.	G	36	5.625454	0.96671	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.68181	-0.31;-0.31	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.83524	0.5273	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84232	0.0467	10	0.87932	D	0	.	20.328	0.98708	0.0:0.0:1.0:0.0	.	278	P55042	RAD_HUMAN	E	278	ENSP00000388744:A278E;ENSP00000299759:A278E	ENSP00000299759:A278E	A	-	2	0	RRAD	65513574	1.000000	0.71417	0.969000	0.41365	0.983000	0.72400	9.471000	0.97696	2.802000	0.96397	0.561000	0.74099	GCG		0.612	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268830.1		NM_004165	
SBDSP1	155370	broad.mit.edu	37	7	72307377	72307377	+	IGR	SNP	C	C	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr7:72307377C>G								TYW1B (8600 upstream) : RN7SL625P (4639 downstream)																							CTTGCTCAAACTATTTGACAT	0.363																																																	0																																										SO:0001628	intergenic_variant	155370																															7.37:g.72307377C>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.363									
SLC38A8	146167	broad.mit.edu	37	16	84050801	84050801	+	Silent	SNP	C	C	A			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr16:84050801C>A	ENST00000299709.3	-	7	896	c.897G>T	c.(895-897)cgG>cgT	p.R299R		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	299					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)		p.R299R(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						CAAAAAGGACCCGGGCCACAA	0.547																																																	1	Substitution - coding silent(1)	kidney(1)											128.0	99.0	109.0					16																	84050801		2200	4300	6500	SO:0001819	synonymous_variant	146167				CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.897G>T	16.37:g.84050801C>A		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000299709.3	37	CCDS32495.1																																																																																				0.547	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432623.1		NM_001080442	
TMEM198	130612	broad.mit.edu	37	2	220413932	220413932	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr2:220413932T>G	ENST00000344458.2	+	5	1386	c.801T>G	c.(799-801)gaT>gaG	p.D267E	RP11-256I23.1_ENST00000596829.1_RNA|MIR3132_ENST00000581997.1_RNA|TMEM198_ENST00000373883.3_Missense_Mutation_p.D267E			Q66K66	TM198_HUMAN	transmembrane protein 198	267	Arg-rich.				multicellular organismal development (GO:0007275)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D267E(2)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	16		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		AGCAGGAAGATCGCAAGGAGA	0.642																																																	2	Substitution - Missense(2)	kidney(2)											88.0	95.0	93.0					2																	220413932		2203	4300	6503	SO:0001583	missense	130612			BC068567	CCDS33385.1	2q35	2011-12-06			ENSG00000188760	ENSG00000188760			33704	protein-coding gene	gene with protein product							Standard	NM_001005209		Approved	MGC99813, TMEM198A	uc002vmf.3	Q66K66	OTTHUMG00000059156	ENST00000344458.2:c.801T>G	2.37:g.220413932T>G	ENSP00000343507:p.Asp267Glu	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000344458.2	37	CCDS33385.1	.	.	.	.	.	.	.	.	.	.	T	5.128	0.209183	0.09757	.	.	ENSG00000188760	ENST00000344458;ENST00000373883	.	.	.	4.95	-5.72	0.02406	.	0.179238	0.47093	N	0.000254	T	0.06508	0.0167	N	0.03608	-0.345	0.20703	N	0.999869	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	9	0.02654	T	1	-15.0479	1.7541	0.02978	0.4184:0.2745:0.1135:0.1936	.	267	Q66K66	TM198_HUMAN	E	267	.	ENSP00000343507:D267E	D	+	3	2	TMEM198	220122176	0.280000	0.24249	0.772000	0.31596	0.943000	0.58893	-0.160000	0.10041	-1.129000	0.02918	-0.406000	0.06334	GAT		0.642	TMEM198-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131063.1		NM_001005209	
TRUB2	26995	broad.mit.edu	37	9	131083994	131083994	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr9:131083994T>C	ENST00000372890.4	-	2	458	c.125A>G	c.(124-126)aAg>aGg	p.K42R	COQ4_ENST00000300452.3_5'Flank|COQ4_ENST00000372875.3_5'Flank|TRUB2_ENST00000460320.1_5'UTR|COQ4_ENST00000609948.1_5'Flank|TRUB2_ENST00000546104.1_5'UTR|COQ4_ENST00000608951.1_5'Flank	NM_015679.1	NP_056494.1	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase family member 2	42					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.K42R(1)		kidney(2)|large_intestine(2)|lung(3)|ovary(1)	8						AGCGGGAGGCTTCCTGGCATT	0.468																																																	1	Substitution - Missense(1)	kidney(1)											81.0	66.0	71.0					9																	131083994		2203	4300	6503	SO:0001583	missense	26995			AK001956	CCDS6897.1	9q34.11	2014-01-28	2013-09-02		ENSG00000167112	ENSG00000167112			17170	protein-coding gene	gene with protein product		610727	"""TruB pseudouridine (psi) synthase homolog 2 (E. coli)"""			12736709	Standard	NM_015679		Approved	CLONE24922	uc004buq.1	O95900	OTTHUMG00000020741	ENST00000372890.4:c.125A>G	9.37:g.131083994T>C	ENSP00000361982:p.Lys42Arg	Somatic		WXS	Illumina GAIIx	Phase_I	B7Z7G5	Missense_Mutation	SNP	ENST00000372890.4	37	CCDS6897.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.484200	0.26598	.	.	ENSG00000167112	ENST00000372890	T	0.18338	2.22	5.83	-1.14	0.09741	Pseudouridine synthase, catalytic domain (1);	0.409426	0.29145	N	0.013002	T	0.09686	0.0238	L	0.38531	1.155	0.09310	N	0.999996	B	0.14805	0.011	B	0.14023	0.01	T	0.30765	-0.9967	10	0.19590	T	0.45	-11.4791	5.2959	0.15752	0.0:0.2156:0.254:0.5304	.	42	O95900	TRUB2_HUMAN	R	42	ENSP00000361982:K42R	ENSP00000361982:K42R	K	-	2	0	TRUB2	130123815	0.025000	0.19082	0.032000	0.17829	0.972000	0.66771	0.290000	0.18975	-0.139000	0.11414	0.460000	0.39030	AAG		0.468	TRUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054419.1		NM_015679	
UHRF1	29128	broad.mit.edu	37	19	4941811	4941811	+	RNA	DEL	G	G	-			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr19:4941811delG	ENST00000592666.1	+	0	1517							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		AGACTCTGCCGGGTCTGCGCC	0.697																																																	0													11.0	14.0	13.0					19																	4941811		2107	4202	6309			29128			AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4941811delG		Somatic		WXS	Illumina GAIIx	Phase_I	A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	Frame_Shift_Del	DEL	ENST00000592666.1	37																																																																																					0.697	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000450444.1		NM_001048201	
UNC5A	90249	broad.mit.edu	37	5	176297519	176297519	+	Silent	SNP	T	T	C			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr5:176297519T>C	ENST00000329542.4	+	6	1144	c.870T>C	c.(868-870)agT>agC	p.S290S	UNC5A_ENST00000261961.3_Silent_p.S250S	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	290	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S290S(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACTGTACCAGTGACCTCTGTG	0.642																																																	1	Substitution - coding silent(1)	kidney(1)											64.0	67.0	66.0					5																	176297519		2200	4299	6499	SO:0001819	synonymous_variant	90249			AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.870T>C	5.37:g.176297519T>C		Somatic		WXS	Illumina GAIIx	Phase_I	B2RXE6|Q8TF26|Q96GP4	Silent	SNP	ENST00000329542.4	37	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	T	0.851	-0.738711	0.03111	.	.	ENSG00000113763	ENST00000509580	.	.	.	4.57	-3.75	0.04372	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.3915	13.3302	0.60483	0.0:0.3588:0.0:0.6412	.	.	.	.	R	312	.	.	X	+	1	0	UNC5A	176230125	0.000000	0.05858	0.973000	0.42090	0.013000	0.08279	-2.371000	0.01074	-0.585000	0.05905	-0.756000	0.03474	TGA		0.642	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1		XM_030300	
HERC2P9	440248	broad.mit.edu	37	15	28913498	28913498	+	RNA	SNP	T	T	G			TCGA-CZ-4863-01A-01D-1501-10	TCGA-CZ-4863-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4286d73b-1fb9-41a3-baba-46f23100586a	1b3a35ca-6f5c-41e2-95ab-f90ff0fcec8f	g.chr15:28913498T>G	ENST00000528584.1	+	0	1320					NR_036443.1				hect domain and RLD 2 pseudogene 9																		GAGAGAATATTCAGGTGAGTA	0.448																																																	0																																												0			BC047911		15q13.1	2011-05-24			ENSG00000206149	ENSG00000206149			30495	pseudogene	pseudogene							Standard	NR_036443		Approved	FLJ59185	uc010azc.3		OTTHUMG00000167114		15.37:g.28913498T>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000528584.1	37																																																																																					0.448	HERC2P9-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000393268.1		NR_036443	
