#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ARPP19	10776	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	52844224	52844224	+	Silent	SNP	C	C	T	rs528673270		TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr15:52844224C>T	ENST00000566423.1	-	4	379	c.246G>A	c.(244-246)ccG>ccA	p.P82P	ARPP19_ENST00000249822.4_Silent_p.P82P|ARPP19_ENST00000561650.1_Silent_p.P66P|ARPP19_ENST00000565288.1_5'UTR|ARPP19_ENST00000563277.1_Silent_p.P66P|ARPP19_ENST00000564163.1_Silent_p.P101P|ARPP19_ENST00000567669.1_Silent_p.P82P|ARPP19_ENST00000569723.1_Silent_p.P41P|ARPP19_ENST00000563566.1_Silent_p.P66P|ARPP19_ENST00000568196.1_Silent_p.P66P|ARPP19_ENST00000561971.1_Silent_p.P101P|ARPP19_ENST00000569281.2_Silent_p.P82P			P56211	ARP19_HUMAN	cAMP-regulated phosphoprotein, 19kDa	82					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of glucose import (GO:0046326)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	phosphatase inhibitor activity (GO:0019212)|potassium channel regulator activity (GO:0015459)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)|receptor binding (GO:0005102)	p.P82P(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						CCGTCTTATCCGGAGCTGCAG	0.438													A|||	1	0.000199681	0.0	0.0	5008	,	,		19255	0.0		0.0	False		,,,				2504	0.001																1	Substitution - coding silent(1)	kidney(1)											157.0	144.0	149.0					15																	52844224		2194	4293	6487	SO:0001819	synonymous_variant	10776			AF084555	CCDS32242.1	15q11.2	2009-04-20	2009-04-20		ENSG00000128989	ENSG00000128989			16967	protein-coding gene	gene with protein product	"""endosulfine alpha-like"""	605487				11279279, 8687439	Standard	NM_006628		Approved	ARPP-19, ARPP-16, ARPP16, ENSAL	uc002acd.1	P56211		ENST00000566423.1:c.246G>A	15.37:g.52844224C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R497|Q6IAM2|Q86TA6|Q9UD70	Silent	SNP	ENST00000566423.1	37	CCDS32242.1																																																																																				0.438	ARPP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419834.1		NM_006628	
CEP128	145508	broad.mit.edu;ucsc.edu	37	14	81259370	81259370	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr14:81259370T>C	ENST00000555265.1	-	14	1669	c.1294A>G	c.(1294-1296)Aca>Gca	p.T432A	CEP128_ENST00000281129.3_Missense_Mutation_p.T432A			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	432						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.T432A(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						GCCTCACATGTGTCAAAGTGA	0.493																																																	1	Substitution - Missense(1)	kidney(1)											166.0	150.0	155.0					14																	81259370		2203	4300	6503	SO:0001583	missense	0			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.1294A>G	14.37:g.81259370T>C	ENSP00000451162:p.Thr432Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	37	CCDS32130.1	.	.	.	.	.	.	.	.	.	.	T	7.256	0.604256	0.14002	.	.	ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619	T;T	0.29397	1.57;1.57	5.36	1.66	0.24008	.	0.652316	0.14958	N	0.288524	T	0.21801	0.0525	L	0.44542	1.39	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.28902	-1.0029	10	0.14252	T	0.57	.	8.5021	0.33163	0.0:0.388:0.0:0.612	.	432	Q6ZU80	CE128_HUMAN	A	432	ENSP00000281129:T432A;ENSP00000451162:T432A	ENSP00000281129:T432A	T	-	1	0	CEP128	80329123	0.463000	0.25799	0.748000	0.31131	0.672000	0.39443	0.655000	0.24933	0.348000	0.23949	0.528000	0.53228	ACA		0.493	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1		NM_152446	
SPATA33	124045	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	89724745	89724745	+	Missense_Mutation	SNP	G	G	C	rs149646248		TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr16:89724745G>C	ENST00000301031.4	+	2	124	c.124G>C	c.(124-126)Gac>Cac	p.D42H	CHMP1A_ENST00000547614.1_5'Flank|CHMP1A_ENST00000253475.5_5'Flank|SPATA33_ENST00000568929.1_Missense_Mutation_p.D12H|CHMP1A_ENST00000535997.2_5'Flank|SPATA33_ENST00000579310.1_Missense_Mutation_p.D43H|CHMP1A_ENST00000550102.1_5'Flank|CHMP1A_ENST00000397901.3_5'Flank	NM_001271908.1|NM_153025.1	NP_001258837.1|NP_694570.1	Q96N06	SPT33_HUMAN	spermatogenesis associated 33	42						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D42H(1)									CAGGCAGGCAGACAGGGAGTC	0.582																																																	1	Substitution - Missense(1)	kidney(1)											43.0	46.0	45.0					16																	89724745		2198	4300	6498	SO:0001583	missense	124045			AK056168	CCDS10983.1, CCDS62012.1, CCDS73929.1	16q24.3	2013-07-16	2013-07-05	2013-07-05	ENSG00000167523	ENSG00000167523			26463	protein-coding gene	gene with protein product		615409	"""chromosome 16 open reading frame 55"""	C16orf55		23844118	Standard	NM_153025		Approved	FLJ31606	uc010vpk.2	Q96N06	OTTHUMG00000138048	ENST00000301031.4:c.124G>C	16.37:g.89724745G>C	ENSP00000301031:p.Asp42His	Somatic		WXS	Illumina HiSeq	Phase_I	A8WFL2|B4DZN8	Missense_Mutation	SNP	ENST00000301031.4	37	CCDS10983.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883747	0.51908	.	.	ENSG00000167523	ENST00000301031;ENST00000457689	T	0.44482	0.92	2.88	1.92	0.25849	.	.	.	.	.	T	0.43897	0.1268	N	0.24115	0.695	0.09310	N	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.68353	0.937;0.957;0.937	T	0.17107	-1.0380	9	0.66056	D	0.02	.	5.7719	0.18257	0.1497:0.0:0.8503:0.0	.	43;56;42	B4DZN8;Q86XC3;Q96N06	.;.;CP055_HUMAN	H	42;43	ENSP00000301031:D42H	ENSP00000301031:D42H	D	+	1	0	C16orf55	88252246	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.397000	0.20883	0.791000	0.33826	0.598000	0.82781	GAC		0.582	SPATA33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269924.2		NM_153025	
PPT1	5538	hgsc.bcm.edu	37	1	40535489	40535490	+	IGR	INS	-	-	G	rs367744502|rs200369781|rs370362556	byFrequency	TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr1:40535489_40535490insG	ENST00000433473.3	-	0	2740				CAP1_ENST00000372805.3_Frame_Shift_Ins_p.R313fs|CAP1_ENST00000372798.1_Frame_Shift_Ins_p.R312fs|CAP1_ENST00000372792.2_Frame_Shift_Ins_p.R313fs|CAP1_ENST00000340450.3_Frame_Shift_Ins_p.R312fs|CAP1_ENST00000479759.1_3'UTR|CAP1_ENST00000372802.1_Frame_Shift_Ins_p.R312fs|CAP1_ENST00000372797.3_Frame_Shift_Ins_p.R313fs	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1						adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CATCCCCCAAACGAGCCACAAA	0.505																																																	0																																										SO:0001628	intergenic_variant	10487			U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495		1.37:g.40535489_40535490insG		Somatic		WXS	Illumina HiSeq	Phase_I	B4DY24|Q6FGQ4	Frame_Shift_Ins	INS	ENST00000433473.3	37	CCDS447.1																																																																																				0.505	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013126.2		NM_000310	
CFL1	1072	hgsc.bcm.edu	37	11	65622863	65622863	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr11:65622863delG	ENST00000525451.2	-	5	1160	c.445delC	c.(445-447)ctgfs	p.L149fs	CFL1_ENST00000534769.1_Frame_Shift_Del_p.L187fs|CFL1_ENST00000531413.1_Frame_Shift_Del_p.L132fs|CFL1_ENST00000308162.5_Frame_Shift_Del_p.L149fs|CFL1_ENST00000524553.1_Frame_Shift_Del_p.L132fs|CFL1_ENST00000531407.1_Frame_Shift_Del_p.L132fs|CFL1_ENST00000527344.1_Frame_Shift_Del_p.L132fs			P23528	COF1_HUMAN	cofilin 1 (non-muscle)	149	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin cytoskeleton organization (GO:0030036)|actin filament depolymerization (GO:0030042)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytoskeleton organization (GO:0007010)|establishment of cell polarity (GO:0030010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|mitotic cytokinesis (GO:0000281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell size (GO:0045792)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of actin filament depolymerization (GO:0030836)|protein import into nucleus (GO:0006606)|protein phosphorylation (GO:0006468)|regulation of cell morphogenesis (GO:0022604)|response to amino acid (GO:0043200)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				breast(1)|kidney(1)|large_intestine(2)|lung(2)	6				READ - Rectum adenocarcinoma(159;0.169)		TTCTCTGCCAGGGTGCAGCGG	0.597																																					Esophageal Squamous(90;820 1366 3932 32351 42291)												0													47.0	47.0	47.0					11																	65622863		2201	4297	6498	SO:0001589	frameshift_variant	1072			X95404	CCDS8114.1	11q13.1	2010-12-03			ENSG00000172757	ENSG00000172757			1874	protein-coding gene	gene with protein product		601442		CFL		8800436	Standard	NM_005507		Approved		uc001ofs.3	P23528		ENST00000525451.2:c.445delC	11.37:g.65622863delG	ENSP00000432660:p.Leu149fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KUQ1|Q53Y87|Q9UCA2	Frame_Shift_Del	DEL	ENST00000525451.2	37	CCDS8114.1																																																																																				0.597	CFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390701.3		NM_005507	
CNOT1	23019	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	58564211	58564211	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr16:58564211T>C	ENST00000317147.5	-	43	6550	c.6218A>G	c.(6217-6219)aAa>aGa	p.K2073R	CNOT1_ENST00000569240.1_Missense_Mutation_p.K2068R|CNOT1_ENST00000245138.4_Missense_Mutation_p.K924R	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	2073					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.K2073R(1)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CGCTAAATATTTGAATAAATC	0.338																																																	1	Substitution - Missense(1)	kidney(1)											64.0	65.0	64.0					16																	58564211		2198	4300	6498	SO:0001583	missense	23019			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.6218A>G	16.37:g.58564211T>C	ENSP00000320949:p.Lys2073Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.360215	0.82353	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000546037;ENST00000245138;ENST00000394200	T	0.51817	0.69	5.72	5.72	0.89469	CCR4-Not complex component, Not1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.46521	0.1397	L	0.53729	1.69	0.80722	D	1	P;B;B	0.34934	0.476;0.222;0.218	B;B;B	0.36244	0.172;0.22;0.202	T	0.39035	-0.9633	10	0.31617	T	0.26	.	15.9886	0.80183	0.0:0.0:0.0:1.0	.	924;2073;2068	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	R	2073;767;78;924;2068	ENSP00000320949:K2073R	ENSP00000245138:K924R	K	-	2	0	CNOT1	57121712	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.002000	0.88514	2.187000	0.69744	0.528000	0.53228	AAA		0.338	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3		NM_016284	
CRB1	23418	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	197411309	197411309	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr1:197411309A>C	ENST00000367400.3	+	11	4027	c.3892A>C	c.(3892-3894)Att>Ctt	p.I1298L	CRB1_ENST00000367399.2_Missense_Mutation_p.I1186L|CRB1_ENST00000367397.1_3'UTR|CRB1_ENST00000544212.1_Missense_Mutation_p.I779L|RP11-75C23.1_ENST00000422250.1_RNA|CRB1_ENST00000535699.1_Missense_Mutation_p.I1274L|CRB1_ENST00000538660.1_Missense_Mutation_p.I762L	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1298	EGF-like 19; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I1298L(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TGAAAAGGACATTGATGAGTG	0.458																																																	1	Substitution - Missense(1)	kidney(1)											294.0	281.0	286.0					1																	197411309		2203	4300	6503	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.3892A>C	1.37:g.197411309A>C	ENSP00000356370:p.Ile1298Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	A	12.64	1.997444	0.35226	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000448952	D;D;D;D;D;D	0.96554	-2.23;-2.23;-2.23;-2.23;-2.23;-4.05	5.36	0.386	0.16254	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.91653	0.7362	L	0.38531	1.155	0.26403	N	0.97639	B;B;P;B	0.36438	0.006;0.441;0.553;0.103	B;B;B;B	0.32724	0.005;0.143;0.151;0.05	T	0.81970	-0.0689	9	0.30854	T	0.27	.	10.2968	0.43629	0.5718:0.0:0.4282:0.0	.	762;1274;1186;1298	B7Z5T2;F5H0L2;P82279-3;P82279	.;.;.;CRUM1_HUMAN	L	1274;762;1298;1186;779;4	ENSP00000438786:I1274L;ENSP00000438091:I762L;ENSP00000356370:I1298L;ENSP00000356369:I1186L;ENSP00000444556:I779L;ENSP00000395407:I4L	ENSP00000356369:I1186L	I	+	1	0	CRB1	195677932	0.593000	0.26840	0.071000	0.20095	0.934000	0.57294	0.263000	0.18478	-0.180000	0.10637	0.482000	0.46254	ATT		0.458	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2		NM_201253	
CTSL3P	392360	broad.mit.edu;hgsc.bcm.edu	37	9	90387883	90387883	+	RNA	SNP	C	C	A			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr9:90387883C>A	ENST00000354530.2	+	0	54					NR_027917.1		Q5NE16	CATL3_HUMAN	cathepsin L family member 3, pseudogene								cysteine-type peptidase activity (GO:0008234)	p.F18L(1)									AACACAGCTTCACAATGGCCA	0.473																																																	1	Substitution - Missense(1)	kidney(1)											134.0	124.0	128.0					9																	90387883		2203	4300	6503			0			AJ851862		9q21.33	2013-01-07	2013-01-07	2013-01-07	ENSG00000188029	ENSG00000188029		"""Cathepsins"""	33132	pseudogene	pseudogene			"""cathepsin L family member 3"""	CTSL3		19663681	Standard	NR_027917		Approved	HCTSL-s	uc004apm.1	Q5NE16	OTTHUMG00000020152		9.37:g.90387883C>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000354530.2	37																																																																																					0.473	CTSL3P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000356542.1		NR_027917	
ETF1	2107	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	137848455	137848455	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr5:137848455G>A	ENST00000360541.5	-	6	951	c.730C>T	c.(730-732)Cag>Tag	p.Q244*	ETF1_ENST00000499810.2_Nonsense_Mutation_p.Q211*|ETF1_ENST00000503014.1_Nonsense_Mutation_p.Q230*	NM_004730.3	NP_004721.1	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	244					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)|translation termination factor activity (GO:0008079)	p.Q244*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTACTTACCTGATCAAACATA	0.403																																																	1	Substitution - Nonsense(1)	kidney(1)											64.0	62.0	63.0					5																	137848455		2203	4300	6503	SO:0001587	stop_gained	2107			AF095901	CCDS4207.1, CCDS75313.1, CCDS75314.1	5q31.2	2008-02-05			ENSG00000120705	ENSG00000120705			3477	protein-coding gene	gene with protein product	"""sup45 (yeast omnipotent suppressor 45) homolog-like 1"", ""polypeptide chain release factor 1"""	600285		SUP45L1, ERF1, ERF		1546371, 7990965	Standard	NM_004730		Approved	eRF1, TB3-1, RF1	uc003ldc.5	P62495	OTTHUMG00000129199	ENST00000360541.5:c.730C>T	5.37:g.137848455G>A	ENSP00000353741:p.Gln244*	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6B4|D3DQC1|P46055|Q5M7Z7|Q96CG1	Nonsense_Mutation	SNP	ENST00000360541.5	37	CCDS4207.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815293	0.90790	.	.	ENSG00000120705	ENST00000499810;ENST00000360541;ENST00000503014	.	.	.	5.38	5.38	0.77491	.	0.051637	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-4.2867	18.762	0.91855	0.0:0.0:1.0:0.0	.	.	.	.	X	211;244;230	.	ENSP00000353741:Q244X	Q	-	1	0	ETF1	137876354	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.634000	0.98435	2.515000	0.84797	0.655000	0.94253	CAG		0.403	ETF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251276.2		NM_004730	
EYS	346007	hgsc.bcm.edu;ucsc.edu	37	6	64436568	64436568	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr6:64436568A>G	ENST00000370621.3	-	43	8666	c.8140T>C	c.(8140-8142)Tcc>Ccc	p.S2714P	EYS_ENST00000503581.1_Missense_Mutation_p.S2693P|EYS_ENST00000370616.2_Missense_Mutation_p.S2714P			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2714					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TCACTTATGGATAAAGCTGAG	0.353																																																	0													48.0	41.0	43.0					6																	64436568		692	1591	2283	SO:0001583	missense	346007				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.8140T>C	6.37:g.64436568A>G	ENSP00000359655:p.Ser2714Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	A	11.25	1.583719	0.28268	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.82711	-1.63;-1.64;-1.64	3.55	2.37	0.29283	Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.54951	0.1890	L	0.38175	1.15	0.54753	D	0.999984	B;B	0.16802	0.019;0.011	B;B	0.18561	0.022;0.01	T	0.47420	-0.9119	9	0.29301	T	0.29	.	4.5696	0.12203	0.6979:0.195:0.1071:0.0	.	2693;2714	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	P	2693;2714;2714	ENSP00000424243:S2693P;ENSP00000359655:S2714P;ENSP00000359650:S2714P	ENSP00000359650:S2714P	S	-	1	0	EYS	64494527	0.909000	0.30893	0.981000	0.43875	0.776000	0.43924	1.574000	0.36482	0.299000	0.22661	0.402000	0.26972	TCC		0.353	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3		XM_294050	
GALR1	2587	broad.mit.edu;ucsc.edu	37	18	74962847	74962847	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr18:74962847T>C	ENST00000299727.3	+	1	343	c.343T>C	c.(343-345)Ttc>Ctc	p.F115L		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	115					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)	p.F115L(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CCACTACTTCTTCACCGTGTC	0.637																																																	1	Substitution - Missense(1)	kidney(1)											132.0	111.0	118.0					18																	74962847		2203	4300	6503	SO:0001583	missense	2587			U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.343T>C	18.37:g.74962847T>C	ENSP00000299727:p.Phe115Leu	Somatic		WXS	Illumina GAIIx	Phase_I	Q4VBL7	Missense_Mutation	SNP	ENST00000299727.3	37	CCDS12012.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.988912	0.53934	.	.	ENSG00000166573	ENST00000299727	T	0.38401	1.14	4.28	4.28	0.50868	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.31482	0.0798	N	0.25245	0.725	0.58432	D	0.999997	P	0.38788	0.647	P	0.49887	0.625	T	0.06075	-1.0847	10	0.02654	T	1	.	13.1006	0.59218	0.0:0.0:0.0:1.0	.	115	P47211	GALR1_HUMAN	L	115	ENSP00000299727:F115L	ENSP00000299727:F115L	F	+	1	0	GALR1	73091835	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.717000	0.61923	1.576000	0.49790	0.477000	0.44152	TTC		0.637	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256362.1			
RP3-470B24.5	0	hgsc.bcm.edu	37	6	168376930	168376971	+	lincRNA	DEL	AGGAGGAGGCAGTGGGGGTCATTACCCCTGCAGTGTGTTGGG	AGGAGGAGGCAGTGGGGGTCATTACCCCTGCAGTGTGTTGGG	-	rs200262961|rs538554643|rs2516607|rs34562778|rs71305246|rs567383784|rs537992678|rs74216590	byFrequency	TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	AGGAGGAGGCAGTGGGGGTCATTACCCCTGCAGTGTGTTGGG	AGGAGGAGGCAGTGGGGGTCATTACCCCTGCAGTGTGTTGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr6:168376930_168376971delAGGAGGAGGCAGTGGGGGTCATTACCCCTGCAGTGTGTTGGG	ENST00000538528.1	-	0	648_689																											TGTGTGGGGAAGGAGGAGGCAGTGGGGGTCATTACCCCTGCAGTGTGTTGGGAGGAGGAGGC	0.636																																																	0																																												100128124																															6.37:g.168376930_168376971delAGGAGGAGGCAGTGGGGGTCATTACCCCTGCAGTGTGTTGGG		Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Del	DEL	ENST00000538528.1	37																																																																																					0.636	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA				
KAT5	10524	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	65480531	65480531	+	Splice_Site	SNP	T	T	G			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr11:65480531T>G	ENST00000377046.3	+	4	557		c.e4+2		KAT5_ENST00000534650.1_Splice_Site|KAT5_ENST00000525204.1_Splice_Site|KAT5_ENST00000352980.4_Splice_Site|KAT5_ENST00000341318.4_Splice_Site|KAT5_ENST00000530446.1_Splice_Site	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5						androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)	p.?(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						AGAGAGGTGGTGAGTAGGTCC	0.567																																																	1	Unknown(1)	kidney(1)											95.0	93.0	94.0					11																	65480531		2201	4297	6498	SO:0001630	splice_region_variant	10524			U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.285+2T>G	11.37:g.65480531T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Splice_Site	SNP	ENST00000377046.3	37	CCDS31610.1	.	.	.	.	.	.	.	.	.	.	t	15.30	2.791853	0.50102	.	.	ENSG00000172977	ENST00000377046;ENST00000352980;ENST00000341318;ENST00000530446;ENST00000528198;ENST00000531880	.	.	.	4.37	3.2	0.36748	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0859	0.36581	0.0:0.0:0.1854:0.8146	.	.	.	.	.	-1	.	.	.	+	.	.	KAT5	65237107	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.445000	0.66594	0.687000	0.31509	0.459000	0.35465	.		0.567	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2		NM_006388	Intron
LILRB1	10859	broad.mit.edu;hgsc.bcm.edu	37	19	55142960	55142960	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr19:55142960C>T	ENST00000396331.1	+	5	437	c.80C>T	c.(79-81)cCc>cTc	p.P27L	LILRB1_ENST00000448689.1_Missense_Mutation_p.P27L|LILRB1_ENST00000427581.2_Missense_Mutation_p.P63L|LILRB1_ENST00000418536.2_Missense_Mutation_p.P27L|LILRB1_ENST00000324602.7_Missense_Mutation_p.P27L|LILRB1_ENST00000396315.1_Missense_Mutation_p.P27L|LILRB1_ENST00000396332.4_Missense_Mutation_p.P27L|LILRB1_ENST00000396327.3_Missense_Mutation_p.P27L|LILRB1_ENST00000434867.2_Missense_Mutation_p.P27L|LILRB1_ENST00000396321.2_Missense_Mutation_p.P27L|LILRB1_ENST00000396317.1_Missense_Mutation_p.P27L|AC009892.1_ENST00000578908.1_RNA	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	27	Ig-like C2-type 1.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.P27L(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GGGCACCTCCCCAAGCCCACC	0.617										HNSCC(37;0.09)																																							1	Substitution - Missense(1)	kidney(1)											66.0	76.0	73.0					19																	55142960		2203	4300	6503	SO:0001583	missense	10859			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.80C>T	19.37:g.55142960C>T	ENSP00000379622:p.Pro27Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	C	7.464	0.645231	0.14451	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.01043	5.41;5.41;5.41;5.41;5.41;5.41;5.41;5.41;5.41;5.41;5.41	2.11	0.97	0.19692	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.129848	0.35615	N	0.003082	T	0.02610	0.0079	M	0.89534	3.04	0.09310	N	1	P;B;B;B;B	0.48998	0.918;0.11;0.374;0.05;0.029	B;B;B;B;B	0.42851	0.4;0.038;0.072;0.027;0.007	T	0.35176	-0.9799	10	0.51188	T	0.08	.	5.9757	0.19377	0.3047:0.6953:0.0:0.0	.	27;27;27;27;27	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	L	27;27;27;27;27;27;27;27;63;27;27	ENSP00000379614:P27L;ENSP00000391514:P27L;ENSP00000409968:P27L;ENSP00000379622:P27L;ENSP00000379618:P27L;ENSP00000315997:P27L;ENSP00000405243:P27L;ENSP00000379623:P27L;ENSP00000395004:P63L;ENSP00000379610:P27L;ENSP00000379608:P27L	ENSP00000315997:P27L	P	+	2	0	LILRB1	59834772	0.002000	0.14202	0.015000	0.15790	0.035000	0.12851	0.471000	0.22100	0.202000	0.20498	0.194000	0.17425	CCC		0.617	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4			
MAGT1	84061	broad.mit.edu;hgsc.bcm.edu	37	X	77150869	77150869	+	Silent	SNP	G	G	T			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chrX:77150869G>T	ENST00000373336.3	-	1	68	c.39C>A	c.(37-39)acC>acA	p.T13T	MAGT1_ENST00000358075.6_Silent_p.T45T			Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	13					cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.T13T(1)		cervix(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	17						CCACCACCATGGTCACAGAGA	0.572																																																	1	Substitution - coding silent(1)	kidney(1)											154.0	99.0	118.0					X																	77150869		2203	4296	6499	SO:0001819	synonymous_variant	84061				CCDS14436.2	Xq21.1	2014-09-17			ENSG00000102158	ENSG00000102158			28880	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog B (S. cerevisiae)"""	300715				15804357	Standard	NM_032121		Approved	DKFZp564K142, IAP, OST3B, MRX95	uc004fof.3	Q9H0U3	OTTHUMG00000021882	ENST00000373336.3:c.39C>A	X.37:g.77150869G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RAR4|D3DTE3|Q53G00|Q6P577|Q8NBN6	Silent	SNP	ENST00000373336.3	37																																																																																					0.572	MAGT1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000057302.2		NM_032121	
MARCH10	162333	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	60813347	60813347	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr17:60813347T>A	ENST00000311269.5	-	6	2156	c.1882A>T	c.(1882-1884)Aag>Tag	p.K628*	MARCH10_ENST00000456609.2_Nonsense_Mutation_p.K628*|MARCH10_ENST00000583600.1_Nonsense_Mutation_p.K666*|RP11-156L14.1_ENST00000582564.1_RNA|RP11-156L14.1_ENST00000577270.1_RNA|RP11-156L14.1_ENST00000579201.1_RNA|RP11-156L14.1_ENST00000584597.1_RNA|MARCH10_ENST00000544856.2_Nonsense_Mutation_p.K627*	NM_152598.2	NP_689811.2	Q8NA82	MARHA_HUMAN	membrane-associated ring finger (C3HC4) 10, E3 ubiquitin protein ligase	628					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.K628*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|liver(1)|lung(15)	38						CTGGTTTCCTTTTCATCTGTG	0.383																																																	1	Substitution - Nonsense(1)	kidney(1)											85.0	88.0	87.0					17																	60813347		2203	4300	6503	SO:0001587	stop_gained	162333			AK093076	CCDS11635.1, CCDS74122.1, CCDS74123.1	17q23.3	2013-01-09	2012-02-23	2007-08-20		ENSG00000173838		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	26655	protein-coding gene	gene with protein product		613337	"""ring finger protein 190"", ""membrane-associated ring finger (C3HC4) 10"""	RNF190		17604280	Standard	XM_005257103		Approved	FLJ35757, MARCH-X	uc002jag.4	Q8NA82		ENST00000311269.5:c.1882A>T	17.37:g.60813347T>A	ENSP00000311496:p.Lys628*	Somatic		WXS	Illumina HiSeq	Phase_I	D3DU09|Q8IYS7|Q8N7Z7	Nonsense_Mutation	SNP	ENST00000311269.5	37	CCDS11635.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.887306	0.91814	.	.	ENSG00000173838	ENST00000456609;ENST00000311269;ENST00000544856	.	.	.	5.37	1.71	0.24356	.	0.386354	0.24774	N	0.035720	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.8757	5.9963	0.19495	0.0:0.0846:0.3153:0.6002	.	.	.	.	X	628;628;627	.	ENSP00000311496:K628X	K	-	1	0	MARCH10	58167079	0.063000	0.20901	0.002000	0.10522	0.003000	0.03518	1.119000	0.31258	0.055000	0.16094	-0.466000	0.05196	AAG		0.383	MARCH10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445252.1		NM_152598	
MTUS2	23281	broad.mit.edu;ucsc.edu	37	13	30071435	30071435	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr13:30071435G>C	ENST00000380808.2	+	6	793	c.577G>C	c.(577-579)Gaa>Caa	p.E193Q	MTUS2_ENST00000431530.3_Missense_Mutation_p.E1224Q|MTUS2_ENST00000542829.1_Missense_Mutation_p.E103Q|MTUS2_ENST00000400542.3_3'UTR	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1214						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.E193Q(1)|p.E1224Q(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CCGCCGCTTCGAAGAGGCCTT	0.622																																																	2	Substitution - Missense(2)	kidney(2)											32.0	42.0	39.0					13																	30071435		2083	4229	6312	SO:0001583	missense	23281			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.577G>C	13.37:g.30071435G>C	ENSP00000370186:p.Glu193Gln	Somatic		WXS	Illumina GAIIx	Phase_I	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000380808.2	37	CCDS41874.1	.	.	.	.	.	.	.	.	.	.	G	31	5.058330	0.93846	.	.	ENSG00000132938	ENST00000431530;ENST00000380808;ENST00000542829;ENST00000417109	T;T;T	0.33865	2.12;1.61;1.39	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.61464	0.2349	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.959;0.999	T	0.60910	-0.7169	9	.	.	.	.	17.8315	0.88684	0.0:0.0:1.0:0.0	.	193;1214	Q5JR59-3;Q5JR59	.;MTUS2_HUMAN	Q	1224;193;103;150	ENSP00000392057:E1224Q;ENSP00000370186:E193Q;ENSP00000445403:E103Q	.	E	+	1	0	MTUS2	28969435	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.916000	0.92745	2.677000	0.91161	0.655000	0.94253	GAA		0.622	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044335.2		XM_166270	
NBEAL2	23218	broad.mit.edu;ucsc.edu	37	3	47037324	47037324	+	Silent	SNP	C	C	G			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr3:47037324C>G	ENST00000450053.3	+	14	2198	c.2019C>G	c.(2017-2019)gcC>gcG	p.A673A	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Silent_p.A673A	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	673					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.A234A(1)|p.A673A(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TGTCCTTTGCCGACTCTGCCT	0.577																																																	2	Substitution - coding silent(2)	kidney(2)											88.0	102.0	97.0					3																	47037324		2090	4213	6303	SO:0001819	synonymous_variant	23218			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.2019C>G	3.37:g.47037324C>G		Somatic		WXS	Illumina GAIIx	Phase_I	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	37	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	C	9.151	1.016260	0.19355	.	.	ENSG00000160796	ENST00000416683	.	.	.	4.94	1.47	0.22746	.	.	.	.	.	T	0.53286	0.1787	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40079	-0.9582	4	.	.	.	.	6.0313	0.19681	0.0:0.6431:0.1424:0.2144	.	.	.	.	R	145	.	.	P	+	2	0	NBEAL2	47012328	0.004000	0.15560	0.998000	0.56505	0.997000	0.91878	-0.824000	0.04438	0.086000	0.17137	0.655000	0.94253	CCG		0.577	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3		XM_291064	
NKAIN3	286183	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	63831061	63831061	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr8:63831061A>T	ENST00000523211.1	+	5	653	c.521A>T	c.(520-522)gAa>gTa	p.E174V	NKAIN3_ENST00000328472.5_Missense_Mutation_p.E174V|NKAIN3_ENST00000519049.1_3'UTR	NM_173688.2	NP_775959.1	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E174V(1)		kidney(3)|large_intestine(2)|lung(8)	13	Breast(64;0.127)	Lung NSC(129;0.187)				TCCATGGAAGAAGAAGACACA	0.378																																																	1	Substitution - Missense(1)	kidney(1)											241.0	200.0	213.0					8																	63831061		1863	4105	5968	SO:0001583	missense	286183			AK096949	CCDS55239.1	8q12.3	2014-08-12	2007-10-04	2007-10-04	ENSG00000185942	ENSG00000185942		"""Na+/K+ transporting ATPase interacting"""	26829	protein-coding gene	gene with protein product		612872	"""family with sequence similarity 77, member D"""	FAM77D		17606467	Standard	NM_173688		Approved	FLJ39630	uc010lyq.1	Q8N8D7	OTTHUMG00000164361	ENST00000523211.1:c.521A>T	8.37:g.63831061A>T	ENSP00000429073:p.Glu174Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000523211.1	37	CCDS55239.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184004	0.78677	.	.	ENSG00000185942	ENST00000523211;ENST00000328472	T;T	0.19105	2.17;2.17	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	T	0.51244	0.1663	M	0.85777	2.775	0.52099	D	0.999945	D	0.89917	1.0	D	0.87578	0.998	T	0.58578	-0.7612	10	0.87932	D	0	-8.7884	14.4329	0.67264	1.0:0.0:0.0:0.0	.	174	Q8N8D7	NKAI3_HUMAN	V	174	ENSP00000429073:E174V;ENSP00000333627:E174V	ENSP00000333627:E174V	E	+	2	0	NKAIN3	63993615	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.415000	0.73328	2.160000	0.67779	0.482000	0.46254	GAA		0.378	NKAIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378447.2		NM_173688	
NT5C3A	51251	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	33055308	33055308	+	Silent	SNP	G	G	A			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr7:33055308G>A	ENST00000242210.7	-	8	959	c.883C>T	c.(883-885)Ctg>Ttg	p.L295L	AVL9_ENST00000404479.1_Intron|NT5C3A_ENST00000409467.1_Silent_p.L244L|NT5C3A_ENST00000396152.2_Silent_p.L256L|NT5C3A_ENST00000610140.1_Silent_p.L290L|NT5C3A_ENST00000405342.1_Silent_p.L256L|NT5C3A_ENST00000381626.2_Silent_p.L244L	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	295					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.L256L(2)|p.L295L(2)									CCAATTTTCAGAATGTGCTCA	0.328																																																	4	Substitution - coding silent(4)	lung(2)|kidney(2)											70.0	68.0	69.0					7																	33055308		2203	4300	6503	SO:0001819	synonymous_variant	51251			AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.883C>T	7.37:g.33055308G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Silent	SNP	ENST00000242210.7	37	CCDS34616.1																																																																																				0.328	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328880.1		NM_016489	
NUAK2	81788	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	205275383	205275383	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr1:205275383G>T	ENST00000367157.3	-	5	749	c.623C>A	c.(622-624)aCa>aAa	p.T208K		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2									p.T208K(2)		breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CCCACAGAATGTCTGCAGGAA	0.577																																																	2	Substitution - Missense(2)	kidney(2)											114.0	110.0	111.0					1																	205275383		2203	4300	6503	SO:0001583	missense	81788			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.623C>A	1.37:g.205275383G>T	ENSP00000356125:p.Thr208Lys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000367157.3	37	CCDS1453.1	.	.	.	.	.	.	.	.	.	.	G	34	5.316375	0.95655	.	.	ENSG00000163545	ENST00000367157	T	0.27557	1.66	5.74	5.74	0.90152	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.46442	D	0.000291	T	0.63105	0.2483	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67581	-0.5634	10	0.87932	D	0	.	19.5147	0.95159	0.0:0.0:1.0:0.0	.	208	Q9H093	NUAK2_HUMAN	K	208	ENSP00000356125:T208K	ENSP00000356125:T208K	T	-	2	0	NUAK2	203542006	1.000000	0.71417	0.966000	0.40874	0.941000	0.58515	9.869000	0.99810	2.702000	0.92279	0.655000	0.94253	ACA		0.577	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1		NM_030952	
PKHD1L1	93035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	110471954	110471954	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr8:110471954T>C	ENST00000378402.5	+	47	7239	c.7135T>C	c.(7135-7137)Ttt>Ctt	p.F2379L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2379					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.F2381L(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGGAACTCTGTTTGAAGCAAG	0.378										HNSCC(38;0.096)																																							1	Substitution - Missense(1)	kidney(1)											75.0	69.0	71.0					8																	110471954		1844	4092	5936	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.7135T>C	8.37:g.110471954T>C	ENSP00000367655:p.Phe2379Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.461792	0.63513	.	.	ENSG00000205038	ENST00000378402	D	0.91068	-2.78	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.84511	0.5488	L	0.28608	0.87	0.38115	D	0.937673	B	0.15141	0.012	B	0.21546	0.035	T	0.80714	-0.1259	10	0.21540	T	0.41	.	12.8554	0.57882	0.0:0.0:0.0:1.0	.	2379	Q86WI1	PKHL1_HUMAN	L	2379	ENSP00000367655:F2379L	ENSP00000367655:F2379L	F	+	1	0	PKHD1L1	110541130	1.000000	0.71417	0.960000	0.40013	0.989000	0.77384	4.846000	0.62860	1.940000	0.56252	0.254000	0.18369	TTT		0.378	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1		NM_177531	
RAB11FIP3	9727	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	532561	532561	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr16:532561G>A	ENST00000262305.4	+	4	1328	c.940G>A	c.(940-942)Gag>Aag	p.E314K	RAB11FIP3_ENST00000450428.1_Missense_Mutation_p.E18K|RAB11FIP3_ENST00000457159.1_Missense_Mutation_p.E314K	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	314					cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.E314K(1)		breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				CATGGGCTCCGAGAGCACCTA	0.647																																					Melanoma(160;2366 2595 4474 8099)												1	Substitution - Missense(1)	kidney(1)											99.0	80.0	86.0					16																	532561		2202	4300	6502	SO:0001583	missense	9727			AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.940G>A	16.37:g.532561G>A	ENSP00000262305:p.Glu314Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	Missense_Mutation	SNP	ENST00000262305.4	37	CCDS32351.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703506	0.96812	.	.	ENSG00000090565	ENST00000262305;ENST00000457159;ENST00000434585;ENST00000450428;ENST00000452814;ENST00000449879;ENST00000448401	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	T	0.79335	0.4428	M	0.69823	2.125	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.994;0.986	T	0.80961	-0.1148	8	0.72032	D	0.01	-31.1948	18.3248	0.90250	0.0:0.0:1.0:0.0	.	314;18;314	O75154-3;O75154-2;O75154	.;.;RFIP3_HUMAN	K	314;314;190;18;4;18;18	.	ENSP00000262305:E314K	E	+	1	0	RAB11FIP3	472562	1.000000	0.71417	0.984000	0.44739	0.982000	0.71751	9.359000	0.97115	2.573000	0.86826	0.655000	0.94253	GAG		0.647	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109066.4		NM_014700	
RDH16	8608	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	57345981	57345981	+	Silent	SNP	C	C	T	rs372244884		TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr12:57345981C>T	ENST00000398138.3	-	4	1642	c.786G>A	c.(784-786)tcG>tcA	p.S262S	RDH16_ENST00000360752.4_5'UTR	NM_003708.3	NP_003699.3	O75452	RDH16_HUMAN	retinol dehydrogenase 16 (all-trans)	262					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	electron carrier activity (GO:0009055)|retinol dehydrogenase activity (GO:0004745)	p.S262S(2)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)	16						TGGTCACCAACGACAGATCCT	0.502													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22190	0.0		0.0	False		,,,				2504	0.0				GBM(179;741 2921 43105 45298)												2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)						C		1,4251		0,1,2125	90.0	100.0	97.0		786	0.1	0.0	12		97	0,8496		0,0,4248	no	coding-synonymous	RDH16	NM_003708.3		0,1,6373	TT,TC,CC		0.0,0.0235,0.0078		262/318	57345981	1,12747	2126	4248	6374	SO:0001819	synonymous_variant	8608				CCDS41797.1	12q13.3	2011-09-14	2006-05-09			ENSG00000139547		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29674	protein-coding gene	gene with protein product	"""microsomal NAD+ dependent retinol dehydrogenase 4"", ""short chain dehydrogenase/reductase family 9C, member 8"""		"""retinol dehydrogenase 16 (all-trans and 13-cis)"""			9677409, 10329026, 19027726	Standard	NM_003708		Approved	RODH-4, SDR9C8	uc001smi.4	O75452		ENST00000398138.3:c.786G>A	12.37:g.57345981C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9UNV2	Silent	SNP	ENST00000398138.3	37	CCDS41797.1																																																																																				0.502	RDH16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410898.1		NM_003708	
RNF25	64320	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	219532832	219532832	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr2:219532832G>A	ENST00000295704.2	-	4	697	c.257C>T	c.(256-258)cCc>cTc	p.P86L		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	86	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.				positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P86L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGTCCTCGGGGATTTCGGAT	0.522																																																	1	Substitution - Missense(1)	kidney(1)											217.0	231.0	226.0					2																	219532832		2203	4300	6503	SO:0001583	missense	64320				CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.257C>T	2.37:g.219532832G>A	ENSP00000295704:p.Pro86Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0D6|Q53HQ5|Q9H874	Missense_Mutation	SNP	ENST00000295704.2	37	CCDS2420.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781898	0.90282	.	.	ENSG00000163481	ENST00000295704	T	0.22134	1.97	5.25	5.25	0.73442	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.000000	0.85682	D	0.000000	T	0.47395	0.1443	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.36261	-0.9755	10	0.54805	T	0.06	-10.987	19.0937	0.93240	0.0:0.0:1.0:0.0	.	86	Q96BH1	RNF25_HUMAN	L	86	ENSP00000295704:P86L	ENSP00000295704:P86L	P	-	2	0	RNF25	219241076	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.126000	0.89592	2.753000	0.94483	0.456000	0.33151	CCC		0.522	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1		NM_022453	
RYR3	6263	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	33873834	33873834	+	Silent	SNP	C	C	T			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr15:33873834C>T	ENST00000389232.4	+	14	1633	c.1563C>T	c.(1561-1563)taC>taT	p.Y521Y	RYR3_ENST00000415757.3_Silent_p.Y521Y	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	521					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.Y521Y(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACCTCCTCTACAAATTGCTGG	0.458																																																	1	Substitution - coding silent(1)	kidney(1)											112.0	115.0	114.0					15																	33873834		1915	4134	6049	SO:0001819	synonymous_variant	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1563C>T	15.37:g.33873834C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																				0.458	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			
SLC35A5	55032	broad.mit.edu;ucsc.edu	37	3	112300127	112300127	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr3:112300127A>G	ENST00000492406.1	+	6	1446	c.1163A>G	c.(1162-1164)gAa>gGa	p.E388G	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	388					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)	p.E388G(1)		endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						CCTAGGCAAGAAAGGATCCGA	0.448																																																	1	Substitution - Missense(1)	kidney(1)											46.0	51.0	49.0					3																	112300127		2182	4240	6422	SO:0001583	missense	55032			AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.1163A>G	3.37:g.112300127A>G	ENSP00000417654:p.Glu388Gly	Somatic		WXS	Illumina GAIIx	Phase_I	D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Missense_Mutation	SNP	ENST00000492406.1	37	CCDS2967.1	.	.	.	.	.	.	.	.	.	.	A	7.227	0.598579	0.13939	.	.	ENSG00000138459	ENST00000492406	T	0.47869	0.83	5.77	5.77	0.91146	.	0.178864	0.64402	D	0.000015	T	0.42921	0.1224	M	0.63843	1.955	0.53005	D	0.999966	P	0.38922	0.651	B	0.30943	0.122	T	0.37314	-0.9711	10	0.22109	T	0.4	-6.7776	16.3892	0.83528	1.0:0.0:0.0:0.0	.	388	Q9BS91	S35A5_HUMAN	G	388	ENSP00000417654:E388G	ENSP00000417654:E388G	E	+	2	0	SLC35A5	113782817	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.592000	0.67543	2.330000	0.79161	0.477000	0.44152	GAA		0.448	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354184.1		NM_017945	
SPTA1	6708	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	158644146	158644146	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr1:158644146A>T	ENST00000368147.4	-	10	1503	c.1323T>A	c.(1321-1323)caT>caA	p.H441Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	441					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.H441Q(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CAGAGGCTTCATGATTGGCAT	0.378																																																	1	Substitution - Missense(1)	kidney(1)											206.0	194.0	197.0					1																	158644146		1889	4107	5996	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1323T>A	1.37:g.158644146A>T	ENSP00000357129:p.His441Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.782153	0.70222	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.37915	1.17;1.17	5.28	2.51	0.30379	.	0.000000	0.33180	N	0.005187	T	0.46737	0.1408	M	0.85462	2.755	0.38791	D	0.954977	D	0.89917	1.0	D	0.85130	0.997	T	0.48969	-0.8987	10	0.54805	T	0.06	.	6.8104	0.23801	0.656:0.0:0.344:0.0	.	441	P02549	SPTA1_HUMAN	Q	441	ENSP00000357130:H441Q;ENSP00000357129:H441Q	ENSP00000357129:H441Q	H	-	3	2	SPTA1	156910770	0.746000	0.28272	0.996000	0.52242	0.962000	0.63368	-0.191000	0.09601	0.298000	0.22638	0.533000	0.62120	CAT		0.378	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3		NM_003126	
STAT2	6773	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	56748290	56748290	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr12:56748290T>C	ENST00000314128.4	-	8	765	c.742A>G	c.(742-744)Aga>Gga	p.R248G	RNU7-40P_ENST00000516397.1_RNA|STAT2_ENST00000557235.1_Missense_Mutation_p.R244G|STAT2_ENST00000418572.2_Missense_Mutation_p.R244G			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	248					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.R248G(1)		NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						ATGGGAGCTCTGATGCAGGCT	0.552																																																	1	Substitution - Missense(1)	kidney(1)											151.0	119.0	130.0					12																	56748290		2203	4300	6503	SO:0001583	missense	6773			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.742A>G	12.37:g.56748290T>C	ENSP00000315768:p.Arg248Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	ENST00000314128.4	37	CCDS8917.1	.	.	.	.	.	.	.	.	.	.	T	2.940	-0.219167	0.06101	.	.	ENSG00000170581	ENST00000314128;ENST00000557235;ENST00000418572	T;T;T	0.09817	2.94;2.94;2.94	5.05	4.12	0.48240	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.054192	0.64402	N	0.000001	T	0.01489	0.0048	N	0.00021	-2.75	0.36140	D	0.84671	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40098	-0.9581	10	0.02654	T	1	-8.6175	12.7439	0.57268	0.0:0.9182:0.0:0.0818	.	244;244;248	B4DLC8;G3V2M6;P52630	.;.;STAT2_HUMAN	G	248;244;244	ENSP00000315768:R248G;ENSP00000450751:R244G;ENSP00000387354:R244G	ENSP00000315768:R248G	R	-	1	2	STAT2	55034557	1.000000	0.71417	1.000000	0.80357	0.421000	0.31385	5.101000	0.64566	1.486000	0.48398	-0.285000	0.09966	AGA		0.552	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410277.1		NM_005419	
TBC1D3F	84218	hgsc.bcm.edu	37	17	36294433	36294434	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr17:36294433_36294434insC	ENST00000327454.6	+	14	1629_1630	c.1483_1484insC	c.(1483-1485)gctfs	p.A495fs	TBC1D3F_ENST00000378174.5_3'UTR|TBC1D3F_ENST00000539424.1_Frame_Shift_Ins_p.A415fs|TBC1D3F_ENST00000505415.1_Frame_Shift_Ins_p.A473fs	NM_032258.2	NP_115634.2	A6NER0	TBC3F_HUMAN	TBC1 domain family, member 3F	495						plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			liver(1)|pancreas(1)	2						CTGCTGGCAGGCTGAACACCCT	0.629																																																	0																																										SO:0001589	frameshift_variant	729873					17q12	2014-09-16				ENSG00000275954			18257	protein-coding gene	gene with protein product		610809				16863688	Standard	NM_032258		Approved			A6NER0	OTTHUMG00000188428	ENST00000327454.6:c.1484dupC	17.37:g.36294434_36294434dupC	ENSP00000329256:p.Ala495fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000327454.6	37	CCDS45657.1																																																																																				0.629	TBC1D3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256100.3		NM_032258.2	
TRA2B	6434	broad.mit.edu;ucsc.edu	37	3	185643314	185643314	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr3:185643314G>C	ENST00000453386.2	-	3	546	c.271C>G	c.(271-273)Cgt>Ggt	p.R91G	TRA2B_ENST00000471134.1_5'Flank|TRA2B_ENST00000382191.4_De_novo_Start_OutOfFrame	NM_004593.2	NP_004584.1	P62995	TRA2B_HUMAN	transformer 2 beta homolog (Drosophila)	91	Arg/Ser-rich (RS1 domain).				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R91G(1)		breast(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	18						TGCCGTCTACGATAATCTCGA	0.522																																																	1	Substitution - Missense(1)	kidney(1)											128.0	113.0	118.0					3																	185643314		2203	4300	6503	SO:0001583	missense	6434			AF057159	CCDS33905.1, CCDS58872.1	3q26.2-q27	2014-06-13	2009-02-27	2009-02-27	ENSG00000136527	ENSG00000136527		"""RNA binding motif (RRM) containing"""	10781	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 156"""	602719	"""splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)"""	SFRS10		9790768	Standard	NM_004593		Approved	Htra2-beta, PPP1R156	uc003fpv.3	P62995	OTTHUMG00000156641	ENST00000453386.2:c.271C>G	3.37:g.185643314G>C	ENSP00000416959:p.Arg91Gly	Somatic		WXS	Illumina GAIIx	Phase_I	B4DVK2|D3DNU3|O15449|Q15815|Q64283	Missense_Mutation	SNP	ENST00000453386.2	37	CCDS33905.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502847	0.64298	.	.	ENSG00000136527	ENST00000453386	T	0.22539	1.95	6.17	5.28	0.74379	.	0.052689	0.85682	D	0.000000	T	0.23649	0.0572	M	0.80616	2.505	0.80722	D	1	P;P	0.42584	0.56;0.784	B;B	0.31390	0.129;0.129	T	0.09907	-1.0653	10	0.29301	T	0.29	-3.4995	13.4677	0.61266	0.0:0.0:0.7156:0.2844	.	91;91	B2RDQ3;P62995	.;TRA2B_HUMAN	G	91	ENSP00000416959:R91G	ENSP00000416959:R91G	R	-	1	0	TRA2B	187126008	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.483000	0.66838	1.575000	0.49775	0.655000	0.94253	CGT		0.522	TRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344984.1		NM_004593	
UBE3C	9690	broad.mit.edu;ucsc.edu	37	7	157018150	157018150	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr7:157018150G>A	ENST00000348165.5	+	17	2510	c.2150G>A	c.(2149-2151)gGt>gAt	p.G717D		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	717					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G717D(1)		central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		CAAGGAGATGGTCCATTTCTG	0.318																																																	1	Substitution - Missense(1)	kidney(1)											107.0	106.0	106.0					7																	157018150		2203	4298	6501	SO:0001583	missense	9690			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2150G>A	7.37:g.157018150G>A	ENSP00000309198:p.Gly717Asp	Somatic		WXS	Illumina GAIIx	Phase_I	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	37	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.971654	0.74246	.	.	ENSG00000009335	ENST00000348165	T	0.46451	0.87	5.3	5.3	0.74995	HECT (1);	0.092642	0.85682	D	0.000000	T	0.33294	0.0858	N	0.22421	0.69	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.003	T	0.05037	-1.0910	10	0.31617	T	0.26	-14.3529	19.3668	0.94466	0.0:0.0:1.0:0.0	.	717;570	Q15386;B4DHJ9	UBE3C_HUMAN;.	D	717	ENSP00000309198:G717D	ENSP00000309198:G717D	G	+	2	0	UBE3C	156710911	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.442000	0.97566	2.654000	0.90174	0.551000	0.68910	GGT		0.318	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1		NM_014671	
UNC50	25972	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	99232913	99232913	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr2:99232913C>G	ENST00000357765.2	+	5	712	c.560C>G	c.(559-561)aCa>aGa	p.T187R	UNC50_ENST00000409347.1_Missense_Mutation_p.T204R|UNC50_ENST00000409975.1_Missense_Mutation_p.T204R	NM_014044.5	NP_054763.2	Q53HI1	UNC50_HUMAN	unc-50 homolog (C. elegans)	187					cell surface receptor signaling pathway (GO:0007166)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)	RNA binding (GO:0003723)	p.T187R(1)		breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)	10						CTGACAGACACATTTATTGGA	0.363																																																	1	Substitution - Missense(1)	kidney(1)											193.0	189.0	190.0					2																	99232913		2203	4300	6503	SO:0001583	missense	25972				CCDS2035.1	2q12.2	2008-02-05			ENSG00000115446	ENSG00000115446			16046	protein-coding gene	gene with protein product						10980252	Standard	NM_014044		Approved	URP, UNCL, GMH1	uc002szc.4	Q53HI1	OTTHUMG00000130562	ENST00000357765.2:c.560C>G	2.37:g.99232913C>G	ENSP00000350409:p.Thr187Arg	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVH4|Q53S98|Q53TD6|Q5U5U2|Q6X7B9|Q9UQF4|Q9Y4S6	Missense_Mutation	SNP	ENST00000357765.2	37	CCDS2035.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.79|12.79	2.044541|2.044541	0.36085|0.36085	.|.	.|.	ENSG00000115446|ENSG00000115446	ENST00000393493|ENST00000357765;ENST00000409975;ENST00000409347	.|.	.|.	.|.	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.214580	.|0.50627	.|D	.|0.000108	T|T	0.45094|0.45094	0.1325|0.1325	N|N	0.14661|0.14661	0.345|0.345	0.43195|0.43195	D|D	0.995036|0.995036	.|B	.|0.24043	.|0.096	.|B	.|0.35607	.|0.206	T|T	0.34601|0.34601	-0.9822|-0.9822	5|9	.|0.24483	.|T	.|0.36	-4.2649|-4.2649	13.8559|13.8559	0.63527|0.63527	0.0:0.8474:0.1526:0.0|0.0:0.8474:0.1526:0.0	.|.	.|187	.|Q53HI1	.|UNC50_HUMAN	D|R	54|187;204;204	.|.	.|ENSP00000350409:T187R	H|T	+|+	1|2	0|0	UNC50|UNC50	98599345|98599345	0.997000|0.997000	0.39634|0.39634	0.979000|0.979000	0.43373|0.43373	0.924000|0.924000	0.55760|0.55760	3.449000|3.449000	0.52950|0.52950	2.773000|2.773000	0.95371|0.95371	0.585000|0.585000	0.79938|0.79938	CAT|ACA		0.363	UNC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252987.1		NM_014044	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10188240	10188240	+	Missense_Mutation	SNP	T	T	A	rs5030649		TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr3:10188240T>A	ENST00000256474.2	+	2	1223	c.383T>A	c.(382-384)cTt>cAt	p.L128H	VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	128	Involved in binding to CCT complex.		L -> F (in VHLD; type II).		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.L128H(4)|p.L128P(4)|p.L128R(2)|p.H125fs*27(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CACGATGGGCTTCTGGTTAAC	0.488		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	11	Substitution - Missense(10)|Deletion - Frameshift(1)	kidney(11)	GRCh37	CM040270	VHL	M							204.0	188.0	194.0					3																	10188240		2203	4300	6503	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.383T>A	3.37:g.10188240T>A	ENSP00000256474:p.Leu128His	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	14.98	2.697069	0.48202	.	.	ENSG00000134086	ENST00000256474;ENST00000450183	D	0.99848	-7.14	5.07	5.07	0.68467	von Hippel-Lindau disease tumor suppressor,  beta domain (1);von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);	0.070012	0.64402	D	0.000019	D	0.99739	0.9897	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97011	0.9736	10	0.87932	D	0	-11.7092	13.0887	0.59156	0.0:0.0:0.0:1.0	.	128	P40337	VHL_HUMAN	H	128;46	ENSP00000256474:L128H	ENSP00000256474:L128H	L	+	2	0	VHL	10163240	1.000000	0.71417	1.000000	0.80357	0.171000	0.22731	5.965000	0.70387	2.047000	0.60756	0.460000	0.39030	CTT		0.488	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
GOLGA6L17P	642402	broad.mit.edu	37	15	85053188	85053188	+	RNA	SNP	C	C	G	rs201559925	byFrequency	TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr15:85053188C>G	ENST00000414190.2	-	0	264					NR_003246.2																						CCCTGTTCTCCGCAGCCCGAA	0.488																																																	0																																												374650																															15.37:g.85053188C>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000414190.2	37																																																																																					0.488	GOLGA6L5-003	KNOWN	mRNA_end_NF|basic	processed_transcript	pseudogene	OTTHUMT00000418579.1			
MBOAT4	619373	broad.mit.edu	37	8	29994916	29994916	+	Intron	SNP	T	T	G			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr8:29994916T>G	ENST00000320542.3	-	2	429				LEPROTL1_ENST00000523116.1_Silent_p.T136T|LEPROTL1_ENST00000442880.2_3'UTR	NM_001100916.1	NP_001094386.1	Q96T53	MBOA4_HUMAN	membrane bound O-acyltransferase domain containing 4						cellular protein metabolic process (GO:0044267)|peptidyl-serine octanoylation (GO:0018191)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	serine O-acyltransferase activity (GO:0016412)	p.T136T(1)		endometrium(1)	1						GAGTGTCCACTCAACCCGTGC	0.567																																																	1	Substitution - coding silent(1)	kidney(1)											46.0	41.0	43.0					8																	29994916		692	1591	2283	SO:0001627	intron_variant	23484			AF359269	CCDS47835.1	8p12	2008-08-04	2006-06-29	2006-06-29	ENSG00000177669	ENSG00000177669			32311	protein-coding gene	gene with protein product	"""ghrelin O-acyltransferase"""	611940	"""O-acyltransferase (membrane bound) domain containing 4"""	OACT4		18443287	Standard	NM_001100916		Approved	FKSG89, GOAT	uc010lvg.3	Q96T53	OTTHUMG00000163824	ENST00000320542.3:c.344+1131A>C	8.37:g.29994916T>G		Somatic		WXS	Illumina GAIIx	Phase_I	B1Q003	Silent	SNP	ENST00000320542.3	37	CCDS47835.1																																																																																				0.567	MBOAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375795.1			
Unknown	0	broad.mit.edu	37	1	16973855	16973855	+	IGR	SNP	G	G	A			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr1:16973855G>A								CROCCP2 (12801 upstream) : RNU1-3 (19424 downstream)																							CCGGGCTAGGGAAGGTCCAGG	0.692																																																	0																																										SO:0001628	intergenic_variant	11209																															1.37:g.16973855G>A		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP		37																																																																																				0	0.692									
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	G	C	rs369326402	byFrequency	TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr3:195505836G>C	ENST00000463781.3	-	2	13074	c.12615C>G	c.(12613-12615)caC>caG	p.H4205Q	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H4205Q	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H4205Q(10)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597																																																	10	Substitution - Missense(10)	kidney(4)|prostate(3)|urinary_tract(2)|endometrium(1)											15.0	14.0	14.0					3																	195505836		687	1573	2260	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12615C>G	3.37:g.195505836G>C	ENSP00000417498:p.His4205Gln	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	0.099	-1.155501	0.01686	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.55;1.53	.	.	.	.	.	.	.	.	T	0.17619	0.0423	N	0.19112	0.55	0.21950	N	0.999454	P	0.35208	0.49	B	0.40038	0.317	T	0.24368	-1.0162	6	.	.	.	.	.	.	.	.	4077	E7ESK3	.	Q	4205	ENSP00000417498:H4205Q;ENSP00000420243:H4205Q	.	H	-	3	2	MUC4	196990615	.	.	0.016000	0.15963	0.046000	0.14306	.	.	-0.849000	0.04158	0.074000	0.15403	CAC		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
SLC1A4	6509	broad.mit.edu	37	2	65217245	65217245	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chr2:65217245G>C	ENST00000234256.3	+	1	711	c.468G>C	c.(466-468)gaG>gaC	p.E156D	SLC1A4_ENST00000531327.1_Intron|SLC1A4_ENST00000493121.1_Intron	NM_003038.4	NP_003029.2	P43007	SATT_HUMAN	solute carrier family 1 (glutamate/neutral amino acid transporter), member 4	156					amino acid transport (GO:0006865)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|cognition (GO:0050890)|glutamine transport (GO:0006868)|hydroxyproline transport (GO:0034589)|ion transport (GO:0006811)|L-alanine transport (GO:0015808)|L-cystine transport (GO:0015811)|L-serine transport (GO:0015825)|proline transmembrane transport (GO:0035524)|proline transport (GO:0015824)|synaptic transmission, glutamatergic (GO:0035249)|threonine transport (GO:0015826)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|centrosome (GO:0005813)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament (GO:0005882)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|L-alanine transmembrane transporter activity (GO:0015180)|L-cystine transmembrane transporter activity (GO:0015184)|L-glutamine transmembrane transporter activity (GO:0015186)|L-hydroxyproline transmembrane transporter activity (GO:0034590)|L-proline transmembrane transporter activity (GO:0015193)|L-serine transmembrane transporter activity (GO:0015194)|L-threonine transmembrane transporter activity (GO:0015195)|sodium:dicarboxylate symporter activity (GO:0017153)	p.E156D(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|urinary_tract(1)	13					L-Alanine(DB00160)	TGGGGCTGGAGGACTCGGGGC	0.652																																																	1	Substitution - Missense(1)	kidney(1)											23.0	24.0	24.0					2																	65217245		2202	4300	6502	SO:0001583	missense	6509				CCDS1879.1, CCDS54362.1	2p15-p13	2013-05-22			ENSG00000115902	ENSG00000115902		"""Solute carriers"""	10942	protein-coding gene	gene with protein product	"""alanine/serine/cysteine/threonine transporter"""	600229				7896285, 8910405	Standard	NM_003038		Approved	SATT, ASCT1	uc010yqa.2	P43007	OTTHUMG00000129537	ENST00000234256.3:c.468G>C	2.37:g.65217245G>C	ENSP00000234256:p.Glu156Asp	Somatic		WXS	Illumina GAIIx	Phase_I	B7Z3C0|D6W5F0	Missense_Mutation	SNP	ENST00000234256.3	37	CCDS1879.1	.	.	.	.	.	.	.	.	.	.	G	8.274	0.814026	0.16537	.	.	ENSG00000115902	ENST00000448784;ENST00000234256	T	0.59224	0.28	4.59	-0.731	0.11151	.	0.317981	0.37955	N	0.001872	T	0.27765	0.0683	N	0.12502	0.225	0.27693	N	0.946037	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.04307	-1.0961	10	0.30854	T	0.27	-7.0673	0.7864	0.01049	0.2855:0.1526:0.3866:0.1754	.	156;156	P43007;B2R7N6	SATT_HUMAN;.	D	76;156	ENSP00000234256:E156D	ENSP00000234256:E156D	E	+	3	2	SLC1A4	65070749	0.086000	0.21541	0.053000	0.19242	0.555000	0.35460	-0.238000	0.08977	-0.241000	0.09681	0.555000	0.69702	GAG		0.652	SLC1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251726.2		NM_003038	
WASH6P	653440	broad.mit.edu	37	X	155252987	155252988	+	RNA	INS	-	-	CAGCACCAC			TCGA-CZ-5458-01A-01D-1501-10	TCGA-CZ-5458-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1737382a-a1c9-45e1-b009-a29be1d93749	3accf146-13ec-4425-8326-31363f8c1234	g.chrX:155252987_155252988insCAGCACCAC	ENST00000461007.1	+	0	1903_1904				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										TGGGGTactaacaccaccccca	0.658														2815	0.562101	0.5726	0.585	5008	,	,		4013	0.4742		0.6402	False		,,,				2504	0.5419																0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252987_155252988insCAGCACCAC		Somatic		WXS	Illumina GAIIx	Phase_I	A6NGF1|Q8N305	In_Frame_Ins	INS	ENST00000461007.1	37																																																																																					0.658	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1		NG_008380	
