#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AP4M1	9179	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	99700547	99700547	+	Silent	SNP	T	T	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr7:99700547T>C	ENST00000359593.4	+	4	473	c.315T>C	c.(313-315)aaT>aaC	p.N105N	AP4M1_ENST00000421755.1_Silent_p.N105N|AP4M1_ENST00000478501.1_3'UTR|AP4M1_ENST00000429084.1_Silent_p.N112N|MCM7_ENST00000343023.6_5'Flank|AP4M1_ENST00000422582.1_5'UTR|MCM7_ENST00000354230.3_5'Flank|MCM7_ENST00000303887.5_5'Flank	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	105					Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)	p.N105N(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCTCCCGCAATGTGGCTCTGG	0.542																																					Pancreas(174;1182 2812 29595 49511)												1	Substitution - coding silent(1)	kidney(1)											106.0	95.0	99.0					7																	99700547		2203	4300	6503	SO:0001819	synonymous_variant	9179			Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.315T>C	7.37:g.99700547T>C		Somatic		WXS	Illumina HiSeq	Phase_I	D6W5U1|Q8WV65|Q9UHK9	Silent	SNP	ENST00000359593.4	37	CCDS5685.1																																																																																				0.542	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336772.4		NM_004722	
ATG3	64422	broad.mit.edu;ucsc.edu	37	3	112256693	112256693	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr3:112256693T>G	ENST00000283290.5	-	9	989	c.555A>C	c.(553-555)aaA>aaC	p.K185N	ATG3_ENST00000402314.2_Missense_Mutation_p.K185N|ATG3_ENST00000495756.1_5'UTR	NM_022488.3	NP_071933.2	Q9NT62	ATG3_HUMAN	autophagy related 3	185					autophagic vacuole assembly (GO:0000045)|cellular protein modification process (GO:0006464)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)|protein targeting to membrane (GO:0006612)|protein ubiquitination (GO:0016567)|regulation of cilium assembly (GO:1902017)	cytoplasmic ubiquitin ligase complex (GO:0000153)|cytosol (GO:0005829)	Atg12 ligase activity (GO:0019777)|Atg8 ligase activity (GO:0019776)|enzyme binding (GO:0019899)|small conjugating protein ligase activity (GO:0019787)	p.K185N(1)		breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(3)	9						CAGCATCAGTTTTGGCTTTAC	0.343																																																	1	Substitution - Missense(1)	kidney(1)											94.0	89.0	91.0					3																	112256693		2203	4300	6503	SO:0001583	missense	64422				CCDS2966.1, CCDS63721.1	3q13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000144848	ENSG00000144848			20962	protein-coding gene	gene with protein product		609606	"""APG3 autophagy 3-like (S. cerevisiae)"", ""ATG3 autophagy related 3 homolog (S. cerevisiae)"""	APG3L		11825910	Standard	NM_022488		Approved	PC3-96, FLJ22125, MGC15201, DKFZp564M1178	uc003dzd.3	Q9NT62	OTTHUMG00000159260	ENST00000283290.5:c.555A>C	3.37:g.112256693T>G	ENSP00000283290:p.Lys185Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q6PKC5|Q9H6L9	Missense_Mutation	SNP	ENST00000283290.5	37	CCDS2966.1	.	.	.	.	.	.	.	.	.	.	T	13.84	2.357988	0.41801	.	.	ENSG00000144848	ENST00000283290;ENST00000402314	.	.	.	5.82	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.39545	0.1082	N	0.14661	0.345	0.58432	D	0.999997	B;B	0.14012	0.005;0.009	B;B	0.23852	0.029;0.049	T	0.12889	-1.0530	9	0.18276	T	0.48	8.141	12.1431	0.54008	0.0:0.0677:0.0:0.9323	.	185;185	Q9NT62;Q9NT62-2	ATG3_HUMAN;.	N	185	.	ENSP00000283290:K185N	K	-	3	2	ATG3	113739383	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.691000	0.54720	0.975000	0.38392	0.533000	0.62120	AAA		0.343	ATG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354147.1		NM_022488	
B4GALNT3	283358	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	667220	667220	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr12:667220C>A	ENST00000266383.5	+	17	2586	c.2573C>A	c.(2572-2574)tCa>tAa	p.S858*		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	858					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.S858*(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			TTTGAACGCTCAGCTGGACTT	0.552																																																	1	Substitution - Nonsense(1)	kidney(1)											83.0	80.0	81.0					12																	667220		2203	4300	6503	SO:0001587	stop_gained	283358			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.2573C>A	12.37:g.667220C>A	ENSP00000266383:p.Ser858*	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZNC1|Q8N7T6	Nonsense_Mutation	SNP	ENST00000266383.5	37	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	C	41	8.913157	0.99000	.	.	ENSG00000139044	ENST00000266383	.	.	.	4.97	4.97	0.65823	.	0.187153	0.48286	D	0.000189	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5938	18.6071	0.91271	0.0:1.0:0.0:0.0	.	.	.	.	X	858	.	ENSP00000266383:S858X	S	+	2	0	B4GALNT3	537481	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	7.440000	0.80464	2.454000	0.82982	0.561000	0.74099	TCA		0.552	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2		NM_173593	
BCLAF1	9774	broad.mit.edu;hgsc.bcm.edu	37	6	136599666	136599666	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr6:136599666C>A	ENST00000531224.1	-	4	605	c.353G>T	c.(352-354)aGa>aTa	p.R118I	BCLAF1_ENST00000527536.1_Missense_Mutation_p.R118I|BCLAF1_ENST00000527759.1_Missense_Mutation_p.R116I|BCLAF1_ENST00000353331.4_Missense_Mutation_p.R116I|BCLAF1_ENST00000392348.2_Missense_Mutation_p.R116I|BCLAF1_ENST00000530767.1_Missense_Mutation_p.R118I	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	118					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R118I(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AGAAACGGATCTTCTTTTTGG	0.468																																					Colon(142;1534 1789 5427 7063 28491)												1	Substitution - Missense(1)	kidney(1)											178.0	184.0	182.0					6																	136599666		2203	4300	6503	SO:0001583	missense	9774			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.353G>T	6.37:g.136599666C>A	ENSP00000435210:p.Arg118Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434793	0.62955	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06;0.06;0.06	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	T	0.74160	0.3680	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.64830	0.994;0.994;0.994;0.994	D;D;D;D	0.71870	0.975;0.975;0.975;0.975	T	0.75863	-0.3167	10	0.87932	D	0	-11.5288	19.6986	0.96043	0.0:1.0:0.0:0.0	.	116;116;118;118	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	I	118;116;118;118;116;116;118	ENSP00000435210:R118I;ENSP00000229446:R116I;ENSP00000435441:R118I;ENSP00000436501:R118I;ENSP00000434826:R116I;ENSP00000376159:R116I;ENSP00000431734:R118I	ENSP00000229446:R116I	R	-	2	0	BCLAF1	136641359	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.655000	0.67981	2.660000	0.90430	0.557000	0.71058	AGA		0.468	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2		NM_014739	
COLCA2	120376	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	111179126	111179126	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr11:111179126T>A	ENST00000398035.2	+	5	1187	c.429T>A	c.(427-429)taT>taA	p.Y143*	COLCA2_ENST00000526216.1_Nonsense_Mutation_p.Y143*	NM_001136105.2	NP_001129577.1	A8K830	COLC2_HUMAN	colorectal cancer associated 2	143						cytoplasm (GO:0005737)		p.Y143*(1)									GTGATTTCTATAAGAGGGAAA	0.458																																																	1	Substitution - Nonsense(1)	kidney(1)											32.0	31.0	31.0					11																	111179126		692	1591	2283	SO:0001587	stop_gained	120376			BC042557	CCDS44728.1, CCDS73378.1	11q23.1	2013-10-11	2013-08-22	2013-08-22	ENSG00000214290	ENSG00000214290			26978	protein-coding gene	gene with protein product	"""cancer susceptibility candidate 13"""	615694	"""chromosome 11 open reading frame 93"""	C11orf93		21071539	Standard	NM_001271457		Approved	CASC13	uc031qea.1	A8K830	OTTHUMG00000166657	ENST00000398035.2:c.429T>A	11.37:g.111179126T>A	ENSP00000381115:p.Tyr143*	Somatic		WXS	Illumina HiSeq	Phase_I	E9PMJ8|Q2TBJ3|V5LD62|V5LDI3|V5LDV1|V5LE09|V5LEU3	Nonsense_Mutation	SNP	ENST00000398035.2	37	CCDS44728.1	.	.	.	.	.	.	.	.	.	.	T	40	8.271209	0.98735	.	.	ENSG00000214290	ENST00000398035;ENST00000526216	.	.	.	6.02	-2.37	0.06643	.	0.654366	0.11563	U	0.551552	.	.	.	.	.	.	0.39948	D	0.974498	.	.	.	.	.	.	.	.	.	.	.	.	.	-32.0395	7.8437	0.29414	0.0:0.4785:0.1381:0.3833	.	.	.	.	X	143	.	.	Y	+	3	2	C11orf93	110684336	0.001000	0.12720	0.195000	0.23364	0.985000	0.73830	-0.453000	0.06778	-0.293000	0.08986	0.533000	0.62120	TAT		0.458	COLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390991.1		NM_001136105	
GAS8	2622	hgsc.bcm.edu;ucsc.edu	37	16	90095480	90095480	+	Intron	SNP	T	T	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr16:90095480T>A	ENST00000268699.4	+	2	212				C16orf3_ENST00000408886.2_Missense_Mutation_p.S91C|GAS8_ENST00000536122.1_Intron|GAS8_ENST00000540721.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		TGTGAGCTGCTGCCCGTCTCC	0.607																																																	0													90.0	49.0	63.0					16																	90095480		2081	4082	6163	SO:0001627	intron_variant	750			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1350T>A	16.37:g.90095480T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	37	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	T	10.10	1.257156	0.22965	.	.	ENSG00000221819	ENST00000408886	T	0.54675	0.56	1.68	1.68	0.24146	.	.	.	.	.	T	0.38214	0.1032	N	0.08118	0	0.09310	N	1	D	0.55605	0.972	P	0.53450	0.726	T	0.13335	-1.0513	8	.	.	.	.	5.4552	0.16586	0.0:0.0:0.0:1.0	.	99	O95177	CP003_HUMAN	C	91	ENSP00000386218:S91C	.	S	-	1	0	C16orf3	88622981	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.151000	0.16283	1.050000	0.40346	0.379000	0.24179	AGC		0.607	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2			
C1orf168	199920	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	57189298	57189298	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr1:57189298A>C	ENST00000343433.6	-	17	2017	c.1937T>G	c.(1936-1938)aTg>aGg	p.M646R	C1orf168_ENST00000484327.1_5'Flank	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	646								p.M646R(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						TTCTCTTTTCATTCTGTTCTT	0.303																																																	1	Substitution - Missense(1)	kidney(1)											60.0	55.0	57.0					1																	57189298		2199	4296	6495	SO:0001583	missense	199920			BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.1937T>G	1.37:g.57189298A>C	ENSP00000345972:p.Met646Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q63HM3|Q6ZUY6	Missense_Mutation	SNP	ENST00000343433.6	37	CCDS30729.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.546307	0.45383	.	.	ENSG00000187889	ENST00000343433	T	0.32515	1.45	4.18	4.18	0.49190	.	0.184919	0.37095	N	0.002247	T	0.39682	0.1087	L	0.60455	1.87	0.38642	D	0.951621	D	0.55605	0.972	P	0.52217	0.693	T	0.38351	-0.9665	10	0.46703	T	0.11	-0.9031	11.5971	0.50979	1.0:0.0:0.0:0.0	.	646	Q5VWT5	CA168_HUMAN	R	646	ENSP00000345972:M646R	ENSP00000345972:M646R	M	-	2	0	C1orf168	56961886	0.997000	0.39634	0.957000	0.39632	0.993000	0.82548	4.725000	0.61979	2.119000	0.64992	0.533000	0.62120	ATG		0.303	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2		NM_001004303	
ZBED8	63920	hgsc.bcm.edu;ucsc.edu	37	5	159821900	159821903	+	Frame_Shift_Del	DEL	TCTC	TCTC	-	rs368035720|rs533046734		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	TCTC	TCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr5:159821900_159821903delTCTC	ENST00000408953.3	-	2	1102_1105	c.595_598delGAGA	c.(595-600)gagatcfs	p.EI199fs	C5orf54_ENST00000523213.1_Frame_Shift_Del_p.EI199fs	NM_022090.3	NP_071373.2														breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	12						tcttctacgatctctctttctttt	0.407																																																	0																																										SO:0001589	frameshift_variant	63920																														ENST00000408953.3:c.595_598delGAGA	5.37:g.159821900_159821903delTCTC	ENSP00000386184:p.Glu199fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000408953.3	37	CCDS34283.1																																																																																				0.407	C5orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374143.1			
CCDC129	223075	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	31617614	31617614	+	Missense_Mutation	SNP	G	G	A	rs376757677		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr7:31617614G>A	ENST00000407970.3	+	8	774	c.736G>A	c.(736-738)Gcc>Acc	p.A246T	CCDC129_ENST00000409210.1_Missense_Mutation_p.A154T|CCDC129_ENST00000319386.3_Intron|CCDC129_ENST00000451887.2_Missense_Mutation_p.A272T	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	246								p.A246T(1)|p.?(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AGTGAGTGCCGCCAAAGAGCA	0.488																																																	2	Substitution - Missense(1)|Unknown(1)	kidney(2)						G	THR/ALA	3,4403	6.2+/-15.9	0,3,2200	74.0	65.0	68.0		736	-0.3	0.0	7		68	0,8600		0,0,4300	no	missense	CCDC129	NM_194300.2	58	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	246/1045	31617614	3,13003	2203	4300	6503	SO:0001583	missense	223075			AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.736G>A	7.37:g.31617614G>A	ENSP00000384416:p.Ala246Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	37	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	g	6.452	0.451480	0.12223	6.81E-4	0.0	ENSG00000180347	ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T	0.17854	2.52;2.52;2.25	5.38	-0.28	0.12886	.	.	.	.	.	T	0.15003	0.0362	M	0.62723	1.935	0.09310	N	1	B;B;B	0.15719	0.003;0.014;0.014	B;B;B	0.11329	0.003;0.006;0.006	T	0.31364	-0.9946	8	.	.	.	-24.9707	4.2638	0.10754	0.3693:0.0:0.4733:0.1574	.	272;256;246	F5H3V5;F5H2J8;Q6ZRS4	.;.;CC129_HUMAN	T	246;272;256;154	ENSP00000384416:A246T;ENSP00000395835:A272T;ENSP00000387214:A154T	.	A	+	1	0	CCDC129	31584139	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.003000	0.12901	0.075000	0.16796	-2.632000	0.00153	GCC		0.488	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1		NM_194300	
CCDC74A	90557	hgsc.bcm.edu	37	2	132288327	132288327	+	Silent	SNP	C	C	T	rs138376646	byFrequency	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr2:132288327C>T	ENST00000295171.6	+	3	609	c.471C>T	c.(469-471)gcC>gcT	p.A157A	CCDC74A_ENST00000467992.2_Silent_p.A259A|CCDC74A_ENST00000409856.3_Intron	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	157										endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						GCGGTAGCGCCGACACTGTGC	0.632																																																	0													87.0	85.0	85.0					2																	132288327		2202	4300	6502	SO:0001819	synonymous_variant	90557				CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.471C>T	2.37:g.132288327C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6P4I5	Silent	SNP	ENST00000295171.6	37	CCDS2167.1																																																																																				0.632	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254570.2		NM_138770	
CD163L1	283316	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7526111	7526111	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr12:7526111T>A	ENST00000313599.3	-	14	3592	c.3535A>T	c.(3535-3537)Att>Ttt	p.I1179F	CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000416109.2_Missense_Mutation_p.I1189F|CD163L1_ENST00000396630.1_Missense_Mutation_p.I1179F			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1179	SRCR 11. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.I1179F(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CTGCACACAATGCCTGCTATG	0.542																																																	1	Substitution - Missense(1)	kidney(1)											161.0	146.0	151.0					12																	7526111		2203	4300	6503	SO:0001583	missense	283316			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3535A>T	12.37:g.7526111T>A	ENSP00000315945:p.Ile1179Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.249858	0.39797	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.35605	1.3;1.3;1.3	2.28	-3.61	0.04556	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.820030	0.04169	U	0.324428	T	0.53384	0.1793	M	0.62723	1.935	0.09310	N	1	D;D	0.76494	0.992;0.999	P;D	0.71184	0.841;0.972	T	0.55952	-0.8059	10	0.87932	D	0	.	8.4413	0.32816	0.0:0.3013:0.0:0.6987	.	1189;1179	E7EVK4;Q9NR16	.;C163B_HUMAN	F	1179;1189;1179	ENSP00000315945:I1179F;ENSP00000393474:I1189F;ENSP00000379871:I1179F	ENSP00000315945:I1179F	I	-	1	0	CD163L1	7417378	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.618000	0.05578	-0.855000	0.04125	-0.385000	0.06624	ATT		0.542	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1		NM_174941	
CLCN6	1185	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	11896171	11896171	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr1:11896171G>A	ENST00000346436.6	+	18	1993	c.1941G>A	c.(1939-1941)atG>atA	p.M647I	CLCN6_ENST00000312413.6_3'UTR|CLCN6_ENST00000376487.3_Missense_Mutation_p.M625I|CLCN6_ENST00000376496.3_Missense_Mutation_p.M647I	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	647	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)	p.M647I(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AGGAGTTCATGAAGGGCAACC	0.567																																																	1	Substitution - Missense(1)	kidney(1)											110.0	91.0	97.0					1																	11896171		2203	4300	6503	SO:0001583	missense	1185			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.1941G>A	1.37:g.11896171G>A	ENSP00000234488:p.Met647Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	37	CCDS138.1	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188882	0.57909	.	.	ENSG00000011021	ENST00000346436;ENST00000376487;ENST00000376496	D;D;D	0.90844	-2.73;-2.73;-2.74	5.71	5.71	0.89125	Cystathionine beta-synthase, core (2);	0.000000	0.85682	D	0.000000	D	0.84831	0.5559	N	0.14661	0.345	0.80722	D	1	B;B	0.23650	0.073;0.089	B;B	0.24701	0.033;0.055	T	0.80788	-0.1226	10	0.54805	T	0.06	-41.1105	18.8314	0.92141	0.0:0.0:1.0:0.0	.	625;647	F8W9R3;P51797	.;CLCN6_HUMAN	I	647;625;647	ENSP00000234488:M647I;ENSP00000365670:M625I;ENSP00000365679:M647I	ENSP00000234488:M647I	M	+	3	0	CLCN6	11818758	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.700000	0.92200	0.462000	0.41574	ATG		0.567	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2		NM_001286	
CLDN10	9071	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	96230215	96230215	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr13:96230215G>C	ENST00000299339.2	+	5	663	c.634G>C	c.(634-636)Gat>Cat	p.D212H	CLDN10_ENST00000376873.3_Missense_Mutation_p.D210H	NM_006984.4	NP_008915.1	P78369	CLD10_HUMAN	claudin 10	212					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|ion transport (GO:0006811)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.D212H(1)|p.D210H(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			TGGTGGAGAAGATTTTAAAAC	0.378																																																	2	Substitution - Missense(2)	kidney(2)											106.0	103.0	104.0					13																	96230215		2203	4300	6503	SO:0001583	missense	9071			U89916	CCDS9475.1, CCDS9476.1	13q31-q34	2008-07-18			ENSG00000134873	ENSG00000134873		"""Claudins"""	2033	protein-coding gene	gene with protein product						18025272	Standard	NM_182848		Approved	OSP-L, CPETRL3	uc001vmh.2	P78369	OTTHUMG00000017217	ENST00000299339.2:c.634G>C	13.37:g.96230215G>C	ENSP00000299339:p.Asp212His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IBF9|Q96N78	Missense_Mutation	SNP	ENST00000299339.2	37	CCDS9476.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640021	0.67244	.	.	ENSG00000134873	ENST00000376873;ENST00000299339	D;D	0.92348	-3.02;-2.81	5.18	5.18	0.71444	.	0.750045	0.13250	N	0.402152	D	0.89424	0.6711	N	0.19112	0.55	0.80722	D	1	P;P;D	0.53885	0.902;0.902;0.963	P;P;P	0.48114	0.547;0.547;0.567	D	0.88924	0.3368	10	0.45353	T	0.12	.	16.8965	0.86102	0.0:0.0:1.0:0.0	.	212;212;210	Q6IBF9;P78369;Q96N78	.;CLD10_HUMAN;.	H	210;212	ENSP00000366069:D210H;ENSP00000299339:D212H	ENSP00000299339:D212H	D	+	1	0	CLDN10	95028216	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.433000	0.59929	2.403000	0.81681	0.650000	0.86243	GAT		0.378	CLDN10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045484.1		NM_006984	
ELTD1	64123	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	79387344	79387344	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr1:79387344T>C	ENST00000370742.3	-	9	1274	c.1211A>G	c.(1210-1212)aAt>aGt	p.N404S		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	404	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.N404S(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TGTCAGGTGATTACAGCGGCA	0.403																																																	1	Substitution - Missense(1)	kidney(1)											165.0	158.0	160.0					1																	79387344		1989	4159	6148	SO:0001583	missense	64123			AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1211A>G	1.37:g.79387344T>C	ENSP00000359778:p.Asn404Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	T	8.593	0.884973	0.17540	.	.	ENSG00000162618	ENST00000370742	T	0.73258	-0.73	5.32	4.2	0.49525	GPS domain (3);	0.134612	0.64402	N	0.000003	T	0.43389	0.1245	L	0.43554	1.36	0.38379	D	0.945079	B	0.12013	0.005	B	0.18263	0.021	T	0.34079	-0.9843	9	.	.	.	.	10.4925	0.44758	0.0:0.0777:0.0:0.9223	.	404	Q9HBW9	ELTD1_HUMAN	S	404	ENSP00000359778:N404S	.	N	-	2	0	ELTD1	79159932	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	4.923000	0.63412	0.975000	0.38392	0.477000	0.44152	AAT		0.403	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1		NM_022159	
CR1	1378	broad.mit.edu;hgsc.bcm.edu	37	1	207790124	207790124	+	Missense_Mutation	SNP	G	G	T	rs571422599		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr1:207790124G>T	ENST00000367049.4	+	41	6866	c.6866G>T	c.(6865-6867)cGc>cTc	p.R2289L	CR1_ENST00000367053.1_Missense_Mutation_p.R1839L|CR1_ENST00000367051.1_Missense_Mutation_p.R1839L|CR1_ENST00000400960.2_Missense_Mutation_p.R1839L|CR1_ENST00000367052.1_Missense_Mutation_p.R1839L	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1839					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.R2289L(1)|p.R1844L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CCTGCCCCTCGCTGTGAACTT	0.502																																																	2	Substitution - Missense(2)	kidney(2)											131.0	130.0	131.0					1																	207790124		1937	4137	6074	SO:0001583	missense	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6866G>T	1.37:g.207790124G>T	ENSP00000356016:p.Arg2289Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.680|6.680	0.494094|0.494094	0.12702|0.12702	.|.	.|.	ENSG00000203710|ENSG00000203710	ENST00000529814|ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	.|T;T;T;T;T	.|0.65178	.|-0.14;-0.14;-0.14;-0.14;-0.14	4.15|4.15	-4.03|-4.03	0.04021|0.04021	.|Complement control module (2);Sushi/SCR/CCP (3);	.|.	.|.	.|.	.|.	T|T	0.52125|0.52125	0.1715|0.1715	L|L	0.35793|0.35793	1.09|1.09	0.09310|0.09310	N|N	0.999998|0.999998	.|B;D	.|0.58620	.|0.003;0.983	.|B;P	.|0.59056	.|0.015;0.851	T|T	0.47935|0.47935	-0.9078|-0.9078	5|9	.|0.10902	.|T	.|0.67	.|.	0.2062|0.2062	0.00151|0.00151	0.2539:0.2583:0.2242:0.2635|0.2539:0.2583:0.2242:0.2635	.|.	.|1839;2289	.|P17927;E9PDY4	.|CR1_HUMAN;.	S|L	462|1839;1839;1839;1839;2289	.|ENSP00000356019:R1839L;ENSP00000356018:R1839L;ENSP00000356020:R1839L;ENSP00000383744:R1839L;ENSP00000356016:R2289L	.|ENSP00000356016:R2289L	A|R	+|+	1|2	0|0	CR1|CR1	205856747|205856747	0.013000|0.013000	0.17824|0.17824	0.085000|0.085000	0.20634|0.20634	0.035000|0.035000	0.12851|0.12851	-1.443000|-1.443000	0.02405|0.02405	-0.831000|-0.831000	0.04256|0.04256	-1.166000|-1.166000	0.01754|0.01754	GCT|CGC		0.502	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1		NM_000573	
GALNT11	63917	broad.mit.edu;hgsc.bcm.edu	37	7	151791383	151791383	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr7:151791383T>A	ENST00000434507.1	+	4	508	c.71T>A	c.(70-72)cTt>cAt	p.L24H	GALNT11_ENST00000430044.2_Missense_Mutation_p.L24H|GALNT11_ENST00000422997.2_Missense_Mutation_p.L24H|GALNT11_ENST00000482812.1_Intron|GALNT11_ENST00000320311.2_Missense_Mutation_p.L24H|GALNT11_ENST00000452146.2_Intron|GALNT11_ENST00000415421.1_Missense_Mutation_p.L24H			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	24					cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L24H(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		ACAGTTTTGCTTTTTGTTTAT	0.458																																																	1	Substitution - Missense(1)	kidney(1)											208.0	209.0	209.0					7																	151791383		2203	4300	6503	SO:0001583	missense	63917			AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.71T>A	7.37:g.151791383T>A	ENSP00000416787:p.Leu24His	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Missense_Mutation	SNP	ENST00000434507.1	37	CCDS5930.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.817958	0.90790	.	.	ENSG00000178234	ENST00000430044;ENST00000431668;ENST00000446096;ENST00000443352;ENST00000423337;ENST00000434507;ENST00000415421;ENST00000320311;ENST00000419245;ENST00000447796;ENST00000422997	T;T;T;T;T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.89354	0.6691	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70935	0.971;0.959	D	0.89962	0.4087	10	0.54805	T	0.06	.	16.1606	0.81704	0.0:0.0:0.0:1.0	.	24;24	Q8NCW6-2;Q8NCW6	.;GLT11_HUMAN	H	24	ENSP00000395122:L24H;ENSP00000395020:L24H;ENSP00000414890:L24H;ENSP00000393892:L24H;ENSP00000416787:L24H;ENSP00000410093:L24H;ENSP00000315835:L24H;ENSP00000397581:L24H;ENSP00000412142:L24H;ENSP00000389449:L24H	ENSP00000315835:L24H	L	+	2	0	GALNT11	151422316	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.971000	0.76105	2.227000	0.72691	0.460000	0.39030	CTT		0.458	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1		NM_022087	
GAR1	54433	broad.mit.edu;ucsc.edu	37	4	110737330	110737330	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr4:110737330C>T	ENST00000226796.6	+	2	274	c.10C>T	c.(10-12)Cga>Tga	p.R4*	RP11-602N24.3_ENST00000609440.1_lincRNA|GAR1_ENST00000394631.3_Nonsense_Mutation_p.R4*	NM_018983.3	NP_061856.1	Q9NY12	GAR1_HUMAN	GAR1 ribonucleoprotein	4	RGG-box 1.				cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|pseudouridine synthesis (GO:0001522)|rRNA processing (GO:0006364)	box H/ACA snoRNP complex (GO:0031429)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cation channel activity (GO:0005261)|poly(A) RNA binding (GO:0044822)	p.R4*(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	9						AATGTCTTTTCGAGGCGGAGG	0.567																																																	1	Substitution - Nonsense(1)	kidney(1)											79.0	88.0	85.0					4																	110737330		2203	4300	6503	SO:0001587	stop_gained	54433			AJ276003	CCDS34050.1	4q	2013-07-31	2013-07-31	2008-10-13	ENSG00000109534	ENSG00000109534			14264	protein-coding gene	gene with protein product		606468	"""nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs)"", ""GAR1 ribonucleoprotein homolog (yeast)"""	NOLA1		10757788	Standard	XM_005263069		Approved		uc003hzu.3	Q9NY12	OTTHUMG00000161108	ENST00000226796.6:c.10C>T	4.37:g.110737330C>T	ENSP00000226796:p.Arg4*	Somatic		WXS	Illumina GAIIx	Phase_I	Q5MJQ2	Nonsense_Mutation	SNP	ENST00000226796.6	37	CCDS34050.1	.	.	.	.	.	.	.	.	.	.	C	39	7.684859	0.98431	.	.	ENSG00000109534	ENST00000394631;ENST00000226796	.	.	.	4.8	4.8	0.61643	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.7993	0.85610	0.0:1.0:0.0:0.0	.	.	.	.	X	4	.	ENSP00000226796:R4X	R	+	1	2	GAR1	110956779	0.993000	0.37304	0.990000	0.47175	0.990000	0.78478	2.123000	0.41996	2.486000	0.83907	0.655000	0.94253	CGA		0.567	GAR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363810.2			
GUCY1A3	2982	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	156634339	156634339	+	Frame_Shift_Del	DEL	T	T	-	rs200830861		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr4:156634339delT	ENST00000296518.7	+	7	1385	c.1176delT	c.(1174-1176)gatfs	p.D392fs	GUCY1A3_ENST00000511507.1_Frame_Shift_Del_p.D392fs|GUCY1A3_ENST00000513574.1_Frame_Shift_Del_p.D392fs|GUCY1A3_ENST00000511108.1_Frame_Shift_Del_p.D392fs|GUCY1A3_ENST00000455639.2_Frame_Shift_Del_p.D392fs|GUCY1A3_ENST00000393832.3_Frame_Shift_Del_p.D134fs|GUCY1A3_ENST00000506455.1_Frame_Shift_Del_p.D392fs			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	392					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GATTAGAAGATTTTACAGGAC	0.463																																																	0													86.0	84.0	85.0					4																	156634339		2203	4300	6503	SO:0001589	frameshift_variant	2982				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1176delT	4.37:g.156634339delT	ENSP00000296518:p.Asp392fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DP19|D6RDW3|O43843|Q8TAH3	Frame_Shift_Del	DEL	ENST00000296518.7	37	CCDS34085.1																																																																																				0.463	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2			
KCND2	3751	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	119915447	119915447	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr7:119915447G>A	ENST00000331113.4	+	1	1726	c.761G>A	c.(760-762)cGt>cAt	p.R254H		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	254					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.R254H(2)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GCGCCTAGTCGTTACCGTTTT	0.532																																																	2	Substitution - Missense(2)	kidney(1)|endometrium(1)											189.0	156.0	168.0					7																	119915447		2203	4300	6503	SO:0001583	missense	3751			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.761G>A	7.37:g.119915447G>A	ENSP00000333496:p.Arg254His	Somatic		WXS	Illumina HiSeq	Phase_I	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283180	0.80803	.	.	ENSG00000184408	ENST00000331113	D	0.97831	-4.56	5.57	5.57	0.84162	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	M	0.93720	3.45	0.54753	D	0.999981	D	0.89917	1.0	D	0.79108	0.992	D	0.99349	1.0914	9	.	.	.	.	19.5635	0.95382	0.0:0.0:1.0:0.0	.	254	Q9NZV8	KCND2_HUMAN	H	254	ENSP00000333496:R254H	.	R	+	2	0	KCND2	119702683	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.062000	0.89475	2.636000	0.89361	0.557000	0.71058	CGT		0.532	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1		NM_012281	
KCNK5	8645	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	39162007	39162007	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr6:39162007A>G	ENST00000359534.3	-	4	910	c.572T>C	c.(571-573)aTc>aCc	p.I191T		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	191					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.I191T(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						GAGGCCCTCGATGTAGTTCCA	0.567																																																	1	Substitution - Missense(1)	kidney(1)											170.0	135.0	147.0					6																	39162007		2203	4300	6503	SO:0001583	missense	8645			AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.572T>C	6.37:g.39162007A>G	ENSP00000352527:p.Ile191Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAQ6|B5TJL2|Q5VV76	Missense_Mutation	SNP	ENST00000359534.3	37	CCDS4841.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.013226	0.75161	.	.	ENSG00000164626	ENST00000359534	T	0.31769	1.48	5.84	3.26	0.37387	Ion transport 2 (1);	0.102884	0.64402	D	0.000006	T	0.11367	0.0277	L	0.35542	1.07	0.58432	D	0.999999	B	0.32893	0.389	B	0.34590	0.186	T	0.05068	-1.0908	10	0.45353	T	0.12	.	8.8271	0.35061	0.7414:0.1323:0.0:0.1263	.	191	O95279	KCNK5_HUMAN	T	191	ENSP00000352527:I191T	ENSP00000352527:I191T	I	-	2	0	KCNK5	39269985	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.325000	0.79124	1.002000	0.39104	0.459000	0.35465	ATC		0.567	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040449.1		NM_003740	
KLHL32	114792	broad.mit.edu;ucsc.edu	37	6	97423877	97423877	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr6:97423877C>A	ENST00000369261.4	+	3	391	c.28C>A	c.(28-30)Caa>Aaa	p.Q10K	KLHL32_ENST00000539200.1_Missense_Mutation_p.Q10K|KLHL32_ENST00000536676.1_Missense_Mutation_p.Q10K|KLHL32_ENST00000544166.1_5'UTR	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	10								p.Q10K(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TTGTAGTATTCAAGAAATGCT	0.517																																																	1	Substitution - Missense(1)	kidney(1)											64.0	61.0	62.0					6																	97423877		2203	4300	6503	SO:0001583	missense	114792			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.28C>A	6.37:g.97423877C>A	ENSP00000358265:p.Gln10Lys	Somatic		WXS	Illumina GAIIx	Phase_I	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.119121	0.56505	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200;ENST00000369254	T;T;T;T	0.73681	-0.56;-0.6;-0.61;-0.77	5.14	5.14	0.70334	.	0.186130	0.49916	D	0.000140	T	0.55049	0.1896	N	0.14661	0.345	0.80722	D	1	P;B;B;B	0.44006	0.824;0.062;0.085;0.144	P;B;B;B	0.45610	0.487;0.01;0.01;0.035	T	0.57201	-0.7852	10	0.25751	T	0.34	.	18.7846	0.91949	0.0:1.0:0.0:0.0	.	10;10;10;10	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	K	10	ENSP00000358265:Q10K;ENSP00000440382:Q10K;ENSP00000441527:Q10K;ENSP00000358258:Q10K	ENSP00000358258:Q10K	Q	+	1	0	KLHL32	97530598	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.356000	0.59430	2.674000	0.91012	0.591000	0.81541	CAA		0.517	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1		NM_052904	
LPCAT3	10162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	7090783	7090783	+	Silent	SNP	A	A	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr12:7090783A>C	ENST00000261407.4	-	5	556	c.471T>G	c.(469-471)gtT>gtG	p.V157V	U47924.30_ENST00000606112.1_lincRNA|LPCAT3_ENST00000535021.1_5'Flank	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	157					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)	p.V157V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						CAAAGTAGTCAACAGCCAAAC	0.483																																																	1	Substitution - coding silent(1)	kidney(1)											118.0	116.0	117.0					12																	7090783		2203	4300	6503	SO:0001819	synonymous_variant	10162			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.471T>G	12.37:g.7090783A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Silent	SNP	ENST00000261407.4	37	CCDS8572.1																																																																																				0.483	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401812.1		NM_005768	
MAML3	55534	broad.mit.edu;ucsc.edu	37	4	140640694	140640694	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr4:140640694T>C	ENST00000509479.2	-	5	4056	c.3200A>G	c.(3199-3201)cAg>cGg	p.Q1067R	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)									p.Q1067R(2)		breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					TATCTGCTGCTGTGCTGGGGG	0.627																																																	2	Substitution - Missense(2)	kidney(2)											33.0	37.0	36.0					4																	140640694		2198	4296	6494	SO:0001583	missense	55534			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.3200A>G	4.37:g.140640694T>C	ENSP00000421180:p.Gln1067Arg	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.165781	0.38217	.	.	ENSG00000196782	ENST00000509479;ENST00000538400	T	0.25579	1.79	4.78	3.56	0.40772	.	0.194381	0.34853	N	0.003636	T	0.26557	0.0649	M	0.72118	2.19	0.80722	D	1	B;B	0.31730	0.337;0.337	B;B	0.29176	0.099;0.099	T	0.05683	-1.0870	10	0.62326	D	0.03	.	8.6781	0.34191	0.0:0.0:0.1934:0.8066	.	1067;1063	E7EVW8;Q96JK9	.;MAML3_HUMAN	R	1067;374	ENSP00000421180:Q1067R	ENSP00000421180:Q1067R	Q	-	2	0	MAML3	140860144	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.813000	0.62620	0.745000	0.32763	0.482000	0.46254	CAG		0.627	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2			
MARCH5	54708	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	94110949	94110949	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr10:94110949A>T	ENST00000358935.2	+	6	1154	c.822A>T	c.(820-822)gaA>gaT	p.E274D		NM_017824.4	NP_060294.1	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	274					negative regulation of cell aging (GO:0090344)|positive regulation of mitochondrial fission (GO:0090141)|protein autoubiquitination (GO:0051865)|protein localization to mitochondrion (GO:0070585)|protein polyubiquitination (GO:0000209)|regulation of mitochondrial fission (GO:0090140)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	GTPase binding (GO:0051020)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E274D(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						ATTATCCAGAACAAGAAGAAG	0.378																																																	1	Substitution - Missense(1)	kidney(1)											81.0	78.0	79.0					10																	94110949		2203	4300	6503	SO:0001583	missense	54708			BC015480	CCDS7420.1	10q23.32-q23.33	2013-01-09	2005-01-26	2005-01-27	ENSG00000198060	ENSG00000198060		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26025	protein-coding gene	gene with protein product		610637	"""ring finger protein 153"""	RNF153		14722266	Standard	XM_005269923		Approved	FLJ20445, MARCH-V	uc001khx.1	Q9NX47	OTTHUMG00000018757	ENST00000358935.2:c.822A>T	10.37:g.94110949A>T	ENSP00000351813:p.Glu274Asp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000358935.2	37	CCDS7420.1	.	.	.	.	.	.	.	.	.	.	A	10.74	1.435501	0.25813	.	.	ENSG00000198060	ENST00000358935	T	0.47869	0.83	5.48	3.43	0.39272	.	0.000000	0.85682	D	0.000000	T	0.31949	0.0813	L	0.28694	0.88	0.54753	D	0.999985	B	0.13594	0.008	B	0.18561	0.022	T	0.07868	-1.0750	10	0.23891	T	0.37	-7.864	8.3652	0.32382	0.3395:0.0:0.6605:0.0	.	274	Q9NX47	MARH5_HUMAN	D	274	ENSP00000351813:E274D	ENSP00000351813:E274D	E	+	3	2	MARCH5	94100929	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.736000	0.38187	1.112000	0.41740	-0.408000	0.06270	GAA		0.378	MARCH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049388.1		NM_017824	
MAX	4149	hgsc.bcm.edu;ucsc.edu	37	14	65560495	65560495	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr14:65560495delT	ENST00000358664.4	-	3	232	c.102delA	c.(100-102)aaafs	p.K34fs	MAX_ENST00000556443.1_Frame_Shift_Del_p.K25fs|MAX_ENST00000246163.2_Frame_Shift_Del_p.K34fs|RP11-840I19.3_ENST00000553633.1_RNA|RP11-840I19.3_ENST00000555261.1_RNA|MAX_ENST00000284165.6_Frame_Shift_Del_p.K34fs|MAX_ENST00000555667.1_Frame_Shift_Del_p.K25fs|MAX_ENST00000555419.1_Intron|MAX_ENST00000358402.4_Frame_Shift_Del_p.K25fs|MAX_ENST00000556979.1_Frame_Shift_Del_p.K34fs|MAX_ENST00000557277.1_5'UTR|RP11-840I19.3_ENST00000555898.1_RNA|MAX_ENST00000555932.1_Intron|MAX_ENST00000557746.1_Frame_Shift_Del_p.K25fs|RP11-840I19.3_ENST00000556127.1_RNA|MAX_ENST00000341653.2_Frame_Shift_Del_p.K34fs	NM_002382.4	NP_002373.3	P61244	MAX_HUMAN	MYC associated factor X	34	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular response to peptide hormone stimulus (GO:0071375)|cellular response to starvation (GO:0009267)|negative regulation of gene expression (GO:0010629)|neuron apoptotic process (GO:0051402)|protein complex assembly (GO:0006461)|response to axon injury (GO:0048678)|response to insulin (GO:0032868)|retina development in camera-type eye (GO:0060041)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)|PML body (GO:0016605)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	17				all cancers(60;0.000776)|OV - Ovarian serous cystadenocarcinoma(108;0.00359)|BRCA - Breast invasive adenocarcinoma(234;0.00999)		GGTCCCTACGTTTTCGTTCCA	0.483																																																	0													198.0	161.0	173.0					14																	65560495		2203	4300	6503	SO:0001589	frameshift_variant	4149				CCDS9770.1, CCDS9771.1, CCDS9772.1, CCDS9774.1, CCDS41965.1	14q23	2014-09-17	2005-02-08		ENSG00000125952	ENSG00000125952		"""Basic helix-loop-helix proteins"""	6913	protein-coding gene	gene with protein product		154950	"""MAX protein"""			1557420	Standard	NM_002382		Approved	bHLHd4, bHLHd5, bHLHd6, bHLHd7, bHLHd8	uc001xif.2	P61244	OTTHUMG00000142809	ENST00000358664.4:c.102delA	14.37:g.65560495delT	ENSP00000351490:p.Lys34fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NH73|A8K265|A8K4G4|A8K824|P25912|P52163|Q14803|Q96CY8	Frame_Shift_Del	DEL	ENST00000358664.4	37	CCDS9771.1																																																																																				0.483	MAX-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286386.1		NM_197957	
MUC6	4588	broad.mit.edu;ucsc.edu	37	11	1023622	1023622	+	Missense_Mutation	SNP	G	G	A	rs138887092	byFrequency	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr11:1023622G>A	ENST00000421673.2	-	26	3463	c.3413C>T	c.(3412-3414)aCg>aTg	p.T1138M		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1138					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.T1138M(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCCGTCCTGCGTGTGCGTGTT	0.667													G|||	11	0.00219649	0.0	0.0058	5008	,	,		19122	0.0		0.007	False		,,,				2504	0.0																2	Substitution - Missense(2)	kidney(2)						G	MET/THR	6,4336		0,6,2165	80.0	95.0	90.0		3413	-0.6	0.3	11	dbSNP_134	90	70,8462		1,68,4197	yes	missense	MUC6	NM_005961.2	81	1,74,6362	AA,AG,GG		0.8204,0.1382,0.5903	probably-damaging	1138/2440	1023622	76,12798	2171	4266	6437	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.3413C>T	11.37:g.1023622G>A	ENSP00000406861:p.Thr1138Met	Somatic		WXS	Illumina GAIIx	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	9	0.004120879120879121	0	0.0	4	0.011049723756906077	0	0.0	5	0.006596306068601583	G	6.661	0.490528	0.12702	0.001382	0.008204	ENSG00000184956	ENST00000421673	T	0.19394	2.15	4.1	-0.631	0.11526	.	0.683335	0.10981	U	0.612641	T	0.16896	0.0406	L	0.40543	1.245	0.09310	N	1	D	0.71674	0.998	P	0.56474	0.799	T	0.12319	-1.0552	10	0.51188	T	0.08	.	2.7872	0.05377	0.0913:0.3472:0.2138:0.3476	.	1138	Q6W4X9	MUC6_HUMAN	M	1138	ENSP00000406861:T1138M	ENSP00000406861:T1138M	T	-	2	0	MUC6	1013622	0.000000	0.05858	0.264000	0.24511	0.103000	0.19146	-0.010000	0.12743	0.284000	0.22305	-0.337000	0.08149	ACG		0.667	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2		XM_290540	
MMP8	4317	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	102595498	102595498	+	Missense_Mutation	SNP	G	G	T	rs201146217		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr11:102595498G>T	ENST00000236826.3	-	1	187	c.89C>A	c.(88-90)aCa>aAa	p.T30K		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	30					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.T30K(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	AACAGTTTTTGTATTTTTCTC	0.368																																																	1	Substitution - Missense(1)	kidney(1)											130.0	153.0	145.0					11																	102595498		2203	4299	6502	SO:0001583	missense	4317			J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.89C>A	11.37:g.102595498G>T	ENSP00000236826:p.Thr30Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q45F99	Missense_Mutation	SNP	ENST00000236826.3	37	CCDS8320.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.63|11.63	1.694975|1.694975	0.30052|0.30052	.|.	.|.	ENSG00000118113|ENSG00000118113	ENST00000236826|ENST00000438475	T|.	0.36157|.	1.27|.	5.09|5.09	-3.79|-3.79	0.04320|0.04320	Peptidoglycan binding-like (1);Metallopeptidase, catalytic domain (1);|.	2.332680|.	0.01575|.	N|.	0.020740|.	T|.	0.19366|.	0.0465|.	N|N	0.16602|0.16602	0.42|0.42	0.09310|0.09310	N|N	1|1	B|.	0.14805|.	0.011|.	B|.	0.19666|.	0.026|.	T|.	0.32640|.	-0.9899|.	10|.	0.30078|.	T|.	0.28|.	.|.	7.6567|7.6567	0.28379|0.28379	0.6592:0.1597:0.181:0.0|0.6592:0.1597:0.181:0.0	.|.	30|.	P22894|.	MMP8_HUMAN|.	K|X	30|5	ENSP00000236826:T30K|.	ENSP00000236826:T30K|.	T|Y	-|-	2|3	0|2	MMP8|MMP8	102100708|102100708	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.006000|0.006000	0.05464|0.05464	-1.138000|-1.138000	0.03216|0.03216	-0.541000|-0.541000	0.06257|0.06257	0.650000|0.650000	0.86243|0.86243	ACA|TAC		0.368	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1		NM_002424	
MMP12	4321	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	102736586	102736586	+	RNA	SNP	A	A	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr11:102736586A>C	ENST00000532855.1	-	0	1221							P39900	MMP12_HUMAN	matrix metallopeptidase 12 (macrophage elastase)						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|proteolysis (GO:0006508)|wound healing, spreading of epidermal cells (GO:0035313)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.F376V(1)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	26		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)|Marimastat(DB00786)	TTTTTCACAAAGTTAGGAAAA	0.343																																																	1	Substitution - Missense(1)	kidney(1)											69.0	68.0	69.0					11																	102736586		1797	4064	5861			4321			L23808	CCDS73375.1	11q22.3	2009-02-26	2005-08-08			ENSG00000262406			7158	protein-coding gene	gene with protein product		601046	"""matrix metalloproteinase 12 (macrophage elastase)"""				Standard	NM_002426		Approved	HME	uc001phk.3	P39900			11.37:g.102736586A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2R9X8|B7ZLF6|Q2M1L9	Silent	SNP	ENST00000532855.1	37																																																																																					0.343	MMP12-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000386646.1		NM_002426	
NLRP7	199713	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	55450708	55450708	+	Silent	SNP	G	G	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr19:55450708G>A	ENST00000590030.1	-	3	1519	c.1479C>T	c.(1477-1479)caC>caT	p.H493H	NLRP7_ENST00000592784.1_Silent_p.H493H|NLRP7_ENST00000588756.1_Silent_p.H493H|NLRP7_ENST00000340844.2_Silent_p.H493H|NLRP7_ENST00000448121.2_Silent_p.H493H|NLRP7_ENST00000328092.5_Silent_p.H493H|NLRP7_ENST00000446217.1_Silent_p.H521H			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	493							ATP binding (GO:0005524)	p.H493H(4)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TGTCCCAGGCGTGGCCGTCCC	0.567																																																	4	Substitution - coding silent(4)	large_intestine(2)|kidney(2)											65.0	63.0	64.0					19																	55450708		2203	4300	6503	SO:0001819	synonymous_variant	199713			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1479C>T	19.37:g.55450708G>A		Somatic		WXS	Illumina HiSeq	Phase_I	E9PE16|Q32MH8|Q7RTR1	Silent	SNP	ENST00000590030.1	37	CCDS33109.1																																																																																				0.567	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1		NM_139176	
NXNL2	158046	broad.mit.edu;hgsc.bcm.edu	37	9	91159434	91159434	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr9:91159434C>A	ENST00000375854.3	+	2	777	c.443C>A	c.(442-444)gCc>gAc	p.A148D	NXNL2_ENST00000375855.3_Intron|NXNL2_ENST00000487646.2_3'UTR	NM_001161625.1	NP_001155097.1	Q5VZ03	NXNL2_HUMAN	nucleoredoxin-like 2	148					photoreceptor cell maintenance (GO:0045494)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)			p.A148D(1)		lung(3)	3						GTGGAGGCGGCCGATATCTTC	0.577																																																	1	Substitution - Missense(1)	kidney(1)											50.0	56.0	54.0					9																	91159434		692	1591	2283	SO:0001583	missense	158046			BC022521	CCDS6679.1, CCDS55325.1	9q22.2	2008-02-05	2007-08-16	2007-08-16	ENSG00000130045	ENSG00000130045			30482	protein-coding gene	gene with protein product		615299	"""chromosome 9 open reading frame 121"""	C9orf121		12477932	Standard	NM_001161625		Approved		uc011ltj.2	Q5VZ03	OTTHUMG00000020170	ENST00000375854.3:c.443C>A	9.37:g.91159434C>A	ENSP00000365014:p.Ala148Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B1AMD0|Q8TBG6	Missense_Mutation	SNP	ENST00000375854.3	37	CCDS55325.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.853904	0.51270	.	.	ENSG00000130045	ENST00000375854	D	0.82344	-1.6	4.72	4.72	0.59763	Thioredoxin-like fold (1);	0.069148	0.56097	D	0.000028	T	0.82135	0.4971	L	0.27053	0.805	0.52501	D	0.999956	D	0.63880	0.993	P	0.56343	0.796	D	0.83870	0.0273	10	0.59425	D	0.04	-16.5596	13.5946	0.61982	0.0:0.8444:0.1556:0.0	.	148	Q5VZ03	NXNL2_HUMAN	D	148	ENSP00000365014:A148D	ENSP00000365014:A148D	A	+	2	0	NXNL2	90349254	1.000000	0.71417	0.061000	0.19648	0.002000	0.02628	5.214000	0.65236	2.439000	0.82584	0.555000	0.69702	GCC		0.577	NXNL2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_145283	
OR2J2	26707	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	29141585	29141585	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr6:29141585C>A	ENST00000377167.2	+	1	275	c.173C>A	c.(172-174)aCa>aAa	p.T58K		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T58K(1)		endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						CATCTCCACACACCAATGTAC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											166.0	158.0	161.0					6																	29141585		2045	4231	6276	SO:0001583	missense	26707				CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.173C>A	6.37:g.29141585C>A	ENSP00000366372:p.Thr58Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	ENST00000377167.2	37	CCDS43434.1	.	.	.	.	.	.	.	.	.	.	C	11.11	1.543420	0.27563	.	.	ENSG00000204700	ENST00000377167	T	0.00478	7.13	2.3	1.4	0.22301	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00608	0.0020	M	0.85542	2.76	0.32231	N	0.574038	D	0.89917	1.0	D	0.91635	0.999	T	0.48031	-0.9070	9	0.72032	D	0.01	.	7.707	0.28657	0.0:0.8586:0.0:0.1414	.	58	O76002	OR2J2_HUMAN	K	58	ENSP00000366372:T58K	ENSP00000366372:T58K	T	+	2	0	OR2J2	29249564	0.000000	0.05858	0.993000	0.49108	0.234000	0.25298	-0.162000	0.10012	0.280000	0.22209	0.205000	0.17691	ACA		0.473	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076131.2			
OR4S2	219431	broad.mit.edu;ucsc.edu	37	11	55418663	55418663	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr11:55418663G>T	ENST00000312422.2	+	1	284	c.284G>T	c.(283-285)tGc>tTc	p.C95F		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C95F(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				TATGTGGGGTGCATGTTGCAA	0.423																																																	1	Substitution - Missense(1)	kidney(1)											237.0	196.0	210.0					11																	55418663		2185	4045	6230	SO:0001583	missense	219431			BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.284G>T	11.37:g.55418663G>T	ENSP00000310337:p.Cys95Phe	Somatic		WXS	Illumina GAIIx	Phase_I	Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	37	CCDS31505.1	.	.	.	.	.	.	.	.	.	.	G	19.49	3.836713	0.71373	.	.	ENSG00000174982	ENST00000312422	T	0.00547	6.66	5.36	4.45	0.53987	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000017	T	0.05044	0.0135	H	0.98701	4.305	0.53688	D	0.999974	D	0.89917	1.0	D	0.91635	0.999	T	0.01078	-1.1459	10	0.87932	D	0	.	12.6497	0.56753	0.0811:0.0:0.9189:0.0	.	95	Q8NH73	OR4S2_HUMAN	F	95	ENSP00000310337:C95F	ENSP00000310337:C95F	C	+	2	0	OR4S2	55175239	1.000000	0.71417	0.940000	0.37924	0.986000	0.74619	4.409000	0.59768	1.267000	0.44247	0.549000	0.68633	TGC		0.423	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1		NM_001004059	
PLAUR	5329	hgsc.bcm.edu	37	19	44159685	44159686	+	Frame_Shift_Ins	INS	-	-	T	rs139338626|rs201463274		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr19:44159685_44159686insT	ENST00000340093.3	-	5	741_742	c.512_513insA	c.(511-513)tacfs	p.Y171fs	PLAUR_ENST00000601723.1_Frame_Shift_Ins_p.Y171fs|PLAUR_ENST00000221264.4_Intron|PLAUR_ENST00000339082.3_Frame_Shift_Ins_p.Y171fs	NM_002659.3	NP_002650.1	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	171	UPAR/Ly6 2.				attachment of GPI anchor to protein (GO:0016255)|blood coagulation (GO:0007596)|C-terminal protein lipidation (GO:0006501)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chemotaxis (GO:0006935)|fibrinolysis (GO:0042730)|post-translational protein modification (GO:0043687)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|urokinase plasminogen activator signaling pathway (GO:0038195)	anchored component of membrane (GO:0031225)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)|urokinase plasminogen activator receptor activity (GO:0030377)			endometrium(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|urinary_tract(3)	20		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	AGCCGGGAAGGTAGCCACAGCC	0.569																																																	0																																										SO:0001589	frameshift_variant	5329				CCDS12628.1, CCDS33041.1, CCDS33042.1, CCDS74386.1	19q13	2012-03-15			ENSG00000011422	ENSG00000011422		"""CD molecules"""	9053	protein-coding gene	gene with protein product	"""urokinase-type plasminogen activator (uPA) receptor"", ""urokinase plasminogen activator surface receptor"""	173391					Standard	NM_002659		Approved	URKR, UPAR, CD87	uc002oxf.2	Q03405		ENST00000340093.3:c.513dupA	19.37:g.44159686_44159686dupT	ENSP00000339328:p.Tyr171fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K409|Q12876|Q15845|Q16887|Q6IB52|Q9BWT0|Q9NYC8|Q9UD69|Q9UEA6|Q9UM92|Q9UMV0	Frame_Shift_Del	INS	ENST00000340093.3	37	CCDS12628.1																																																																																				0.569	PLAUR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463571.1		NM_002659	
PPP1R3A	5506	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	113518058	113518058	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr7:113518058C>A	ENST00000284601.3	-	4	3157	c.3089G>T	c.(3088-3090)gGa>gTa	p.G1030V		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1030					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.G1030V(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GCTTACTAATCCTTCATTTTC	0.403																																																	1	Substitution - Missense(1)	kidney(1)											195.0	190.0	192.0					7																	113518058		2203	4299	6502	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3089G>T	7.37:g.113518058C>A	ENSP00000284601:p.Gly1030Val	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	7.661	0.684967	0.14973	.	.	ENSG00000154415	ENST00000284601	T	0.19394	2.15	5.71	1.4	0.22301	.	0.453330	0.21283	N	0.077107	T	0.35970	0.0950	M	0.69823	2.125	0.27643	N	0.947641	D	0.71674	0.998	P	0.58721	0.844	T	0.15838	-1.0423	10	0.72032	D	0.01	-9.6112	9.7044	0.40207	0.0:0.5511:0.0:0.4489	.	1030	Q16821	PPR3A_HUMAN	V	1030	ENSP00000284601:G1030V	ENSP00000284601:G1030V	G	-	2	0	PPP1R3A	113305294	0.034000	0.19679	0.154000	0.22540	0.119000	0.20118	0.050000	0.14120	0.355000	0.24131	-0.145000	0.13849	GGA		0.403	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1		NM_002711	
PYROXD2	84795	hgsc.bcm.edu;ucsc.edu	37	10	100174841	100174841	+	Missense_Mutation	SNP	G	G	A	rs117431460	byFrequency	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr10:100174841G>A	ENST00000370575.4	-	1	100	c.52C>T	c.(52-54)Ccg>Tcg	p.P18S	HPS1_ENST00000467246.1_5'Flank	NM_032709.2	NP_116098.2	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 2	18							oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	12						CTCCACGCCGGGAAGGGAGAG	0.612																																																	0													124.0	113.0	117.0					10																	100174841		2203	4300	6503	SO:0001583	missense	84795			AK074429	CCDS7474.1	10q24.2	2009-04-22	2009-04-22	2009-04-22	ENSG00000119943	ENSG00000119943			23517	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 33"""	C10orf33			Standard	NM_032709		Approved	FLJ23849	uc001kpc.3	Q8N2H3	OTTHUMG00000018877	ENST00000370575.4:c.52C>T	10.37:g.100174841G>A	ENSP00000359607:p.Pro18Ser	Somatic		WXS	Illumina HiSeq	Phase_I	D3DR61|Q5TAA9|Q9BRQ1	Missense_Mutation	SNP	ENST00000370575.4	37	CCDS7474.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359621	0.41801	.	.	ENSG00000119943	ENST00000370575	T	0.22539	1.95	5.76	2.77	0.32553	.	0.699661	0.14917	N	0.290906	T	0.09642	0.0237	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.32052	-0.9921	10	0.24483	T	0.36	.	7.5834	0.27978	0.1546:0.2009:0.6445:0.0	.	18	Q8N2H3	PYRD2_HUMAN	S	18	ENSP00000359607:P18S	ENSP00000359607:P18S	P	-	1	0	PYROXD2	100164831	0.030000	0.19436	0.001000	0.08648	0.101000	0.19017	2.135000	0.42112	0.791000	0.33826	0.561000	0.74099	CCG		0.612	PYROXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049782.2		NM_032709	
RABL3	285282	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	120461341	120461341	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr3:120461341T>C	ENST00000273375.3	-	1	43	c.14A>G	c.(13-15)gAt>gGt	p.D5G	GTF2E1_ENST00000283875.5_5'Flank|RABL3_ENST00000483733.1_Missense_Mutation_p.D5G|RABL3_ENST00000491398.1_5'UTR	NM_173825.3	NP_776186.2	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3	5	Small GTPase-like.				small GTPase mediated signal transduction (GO:0007264)		GTP binding (GO:0005525)	p.D5G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)	17				GBM - Glioblastoma multiforme(114;0.151)		CTTCACCCGATCCAGGGACGC	0.552																																																	1	Substitution - Missense(1)	kidney(1)											134.0	106.0	115.0					3																	120461341		2203	4300	6503	SO:0001583	missense	285282			BC020832	CCDS3001.1	3q13.33	2008-02-05			ENSG00000144840	ENSG00000144840			18072	protein-coding gene	gene with protein product						12477932	Standard	NM_173825		Approved	MGC23920	uc003edx.3	Q5HYI8	OTTHUMG00000159668	ENST00000273375.3:c.14A>G	3.37:g.120461341T>C	ENSP00000273375:p.Asp5Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WUD3	Missense_Mutation	SNP	ENST00000273375.3	37	CCDS3001.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.074377	0.76415	.	.	ENSG00000144840	ENST00000273375;ENST00000483733	T;T	0.70869	-0.52;-0.49	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.69771	0.3148	L	0.53780	1.695	0.80722	D	1	P	0.34522	0.455	B	0.37198	0.243	T	0.71666	-0.4524	10	0.66056	D	0.02	-20.7838	15.6463	0.77055	0.0:0.0:0.0:1.0	.	5	Q5HYI8	RABL3_HUMAN	G	5	ENSP00000273375:D5G;ENSP00000419986:D5G	ENSP00000273375:D5G	D	-	2	0	RABL3	121944031	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.275000	0.72594	2.371000	0.80710	0.533000	0.62120	GAT		0.552	RABL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356776.1		NM_173825	
RFC4	5984	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	186508151	186508151	+	Silent	SNP	C	C	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr3:186508151C>T	ENST00000392481.2	-	9	1127	c.846G>A	c.(844-846)caG>caA	p.Q282Q	SNORA63_ENST00000363450.1_RNA|SNORA4_ENST00000584302.1_RNA|RFC4_ENST00000296273.2_Silent_p.Q282Q|RFC4_ENST00000433496.1_Intron	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	282					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.Q282Q(1)		breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		AAGAGCCACTCTGACAGGCAG	0.368																																																	1	Substitution - coding silent(1)	kidney(1)											110.0	110.0	110.0					3																	186508151		2203	4300	6503	SO:0001819	synonymous_variant	5984				CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.846G>A	3.37:g.186508151C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DM41|D3DNV2|Q6FHX7	Silent	SNP	ENST00000392481.2	37	CCDS3283.1																																																																																				0.368	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344471.1		NM_002916	
RPL26L1	51121	broad.mit.edu;hgsc.bcm.edu	37	5	172386880	172386880	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr5:172386880A>C	ENST00000521476.1	+	2	128	c.4A>C	c.(4-6)Aag>Cag	p.K2Q	CTC-308K20.1_ENST00000518894.1_RNA|RPL26L1_ENST00000519239.1_Missense_Mutation_p.K2Q|RPL26L1_ENST00000519974.1_Missense_Mutation_p.K2Q|RPL26L1_ENST00000265100.2_Missense_Mutation_p.K2Q|CTC-308K20.2_ENST00000519755.1_lincRNA|CTC-308K20.1_ENST00000518818.1_RNA|CTC-308K20.1_ENST00000520067.1_RNA			Q9UNX3	RL26L_HUMAN	ribosomal protein L26-like 1	2					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|large ribosomal subunit (GO:0015934)	structural constituent of ribosome (GO:0003735)	p.K2Q(1)		breast(1)|endometrium(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	7	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGTCACCATGAAGTTCAATCC	0.562											OREG0017052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											182.0	162.0	169.0					5																	172386880		2203	4300	6503	SO:0001583	missense	51121			AF083248	CCDS4382.1	5q35.2	2008-03-14	2001-12-07	2001-12-14	ENSG00000037241	ENSG00000037241		"""L ribosomal proteins"""	17050	protein-coding gene	gene with protein product			"""ribosomal protein L26 pseudogene 1"""	RPL26P1		11042152	Standard	NM_016093		Approved		uc003mcc.3	Q9UNX3	OTTHUMG00000130517	ENST00000521476.1:c.4A>C	5.37:g.172386880A>C	ENSP00000428223:p.Lys2Gln	Somatic	1900	WXS	Illumina HiSeq	Phase_I	B3KY82|D3DQM0	Missense_Mutation	SNP	ENST00000521476.1	37	CCDS4382.1	.	.	.	.	.	.	.	.	.	.	A	19.05	3.752888	0.69648	.	.	ENSG00000037241	ENST00000519974;ENST00000521476;ENST00000265100;ENST00000519239;ENST00000519522;ENST00000519156	.	.	.	4.67	3.46	0.39613	.	0.000000	0.85682	D	0.000000	T	0.63510	0.2517	M	0.81179	2.53	0.58432	D	0.999995	B	0.20368	0.044	B	0.21708	0.036	T	0.63699	-0.6578	9	0.66056	D	0.02	.	11.2164	0.48830	0.8461:0.1539:0.0:0.0	.	2	Q9UNX3	RL26L_HUMAN	Q	2	.	ENSP00000265100:K2Q	K	+	1	0	RPL26L1	172319486	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	6.906000	0.75719	0.775000	0.33450	0.448000	0.29417	AAG		0.562	RPL26L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372559.1		NM_016093	
SGIP1	84251	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	67161174	67161174	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr1:67161174A>G	ENST00000371037.4	+	18	1705	c.1628A>G	c.(1627-1629)gAa>gGa	p.E543G	SGIP1_ENST00000371039.1_Intron|SGIP1_ENST00000371035.3_Missense_Mutation_p.E333G|SGIP1_ENST00000371036.3_Intron|SGIP1_ENST00000435165.2_Missense_Mutation_p.E48G|SGIP1_ENST00000237247.6_Missense_Mutation_p.E574G	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	543					endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)	p.E543G(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						TTGACTTTTGAAGGTAAGTAG	0.413																																																	1	Substitution - Missense(1)	kidney(1)											140.0	130.0	133.0					1																	67161174		2203	4300	6503	SO:0001583	missense	84251			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1628A>G	1.37:g.67161174A>G	ENSP00000360076:p.Glu543Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	ENST00000371037.4	37	CCDS30744.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.843781	0.51164	.	.	ENSG00000118473	ENST00000237247;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371037;ENST00000435165	T;T;T;T	0.47528	2.48;2.5;2.44;0.84	5.53	5.53	0.82687	.	0.050673	0.85682	D	0.000000	T	0.29355	0.0731	L	0.47716	1.5	0.80722	D	1	B;B;B;B	0.20052	0.041;0.001;0.006;0.041	B;B;B;B	0.27796	0.083;0.003;0.004;0.013	T	0.11743	-1.0575	10	0.23891	T	0.37	-19.4387	15.9582	0.79902	1.0:0.0:0.0:0.0	.	573;48;333;543	A6NEV3;Q6ZV33;B7Z5H8;Q9BQI5	.;.;.;SGIP1_HUMAN	G	574;333;573;546;543;48	ENSP00000237247:E574G;ENSP00000360074:E333G;ENSP00000360076:E543G;ENSP00000395525:E48G	ENSP00000237247:E574G	E	+	2	0	SGIP1	66933762	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.870000	0.92336	2.219000	0.72066	0.533000	0.62120	GAA		0.413	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025395.4		NM_032291	
SLC34A1	6569	hgsc.bcm.edu;ucsc.edu	37	5	176815364	176815365	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr5:176815364_176815365insT	ENST00000324417.5	+	8	1018_1019	c.927_928insT	c.(928-930)tccfs	p.S310fs	SLC34A1_ENST00000512593.1_Frame_Shift_Ins_p.S310fs	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	310					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCACCCAGACTCCTTACAGGT	0.52																																																	0																																										SO:0001589	frameshift_variant	6569			L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.928dupT	5.37:g.176815365_176815365dupT	ENSP00000321424:p.Ser310fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPE3	Frame_Shift_Ins	INS	ENST00000324417.5	37	CCDS4418.1																																																																																				0.520	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1		NM_003052	
SLC3A1	6519	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	44547384	44547385	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr2:44547384_44547385insA	ENST00000260649.6	+	10	1740_1741	c.1664_1665insA	c.(1663-1668)ttaagtfs	p.S556fs	PREPL_ENST00000409411.1_3'UTR|PREPL_ENST00000409957.1_3'UTR|PREPL_ENST00000409936.1_3'UTR|PREPL_ENST00000541738.1_3'UTR|SLC3A1_ENST00000409740.3_Frame_Shift_Ins_p.S187fs|SLC3A1_ENST00000409380.1_Frame_Shift_Ins_p.S278fs	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	556					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	TATCAAGATTTAAGTCTACTTC	0.386																																																	0																																										SO:0001589	frameshift_variant	6519				CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.1666dupA	2.37:g.44547386_44547386dupA	ENSP00000260649:p.Ser556fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Frame_Shift_Ins	INS	ENST00000260649.6	37	CCDS1819.1																																																																																				0.386	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250676.1		NM_000341	
SLCO3A1	28232	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	92669422	92669422	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr15:92669422G>A	ENST00000318445.6	+	6	1520	c.1306G>A	c.(1306-1308)Gtc>Atc	p.V436I	SLCO3A1_ENST00000555549.1_3'UTR|SLCO3A1_ENST00000424469.2_Missense_Mutation_p.V436I	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	436					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.V436I(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	TGCTTGCTACGTCTCCTTCCT	0.587																																																	1	Substitution - Missense(1)	kidney(1)											212.0	157.0	176.0					15																	92669422		2198	4298	6496	SO:0001583	missense	28232			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.1306G>A	15.37:g.92669422G>A	ENSP00000320634:p.Val436Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	ENST00000318445.6	37	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.314534	0.23908	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000555549	T;T	0.80480	-1.38;-1.38	5.48	5.48	0.80851	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.69324	0.3098	N	0.15975	0.35	0.80722	D	1	B;B;B	0.15719	0.001;0.007;0.014	B;B;B	0.21917	0.001;0.007;0.037	T	0.63033	-0.6727	10	0.18276	T	0.48	.	19.3564	0.94416	0.0:0.0:1.0:0.0	.	378;436;436	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	I	436;436;155	ENSP00000320634:V436I;ENSP00000387846:V436I	ENSP00000320634:V436I	V	+	1	0	SLCO3A1	90470426	1.000000	0.71417	0.986000	0.45419	0.719000	0.41307	9.152000	0.94680	2.572000	0.86782	0.561000	0.74099	GTC		0.587	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1		NM_013272	
SRRT	51593	hgsc.bcm.edu;ucsc.edu	37	7	100479746	100479746	+	Silent	SNP	C	C	G	rs143241109	byFrequency	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr7:100479746C>G	ENST00000347433.4	+	5	629	c.471C>G	c.(469-471)ctC>ctG	p.L157L	SRRT_ENST00000388793.4_Silent_p.L157L|SRRT_ENST00000432932.1_Silent_p.L157L|SRRT_ENST00000457580.2_Silent_p.L157L			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	157					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						AGTTTCTCCTCTCCCTGGATG	0.582																																																	0													127.0	115.0	119.0					7																	100479746		2203	4300	6503	SO:0001819	synonymous_variant	51593				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.471C>G	7.37:g.100479746C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Silent	SNP	ENST00000347433.4	37	CCDS34709.1																																																																																				0.582	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1		NM_015908	
TMEM106A	113277	hgsc.bcm.edu	37	17	41365129	41365130	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr17:41365129_41365130insC	ENST00000331615.3	+	3	306_307	c.69_70insC	c.(70-72)ccafs	p.P24fs	TMEM106A_ENST00000541594.1_Intron|TMEM106A_ENST00000592564.1_Intron|TMEM106A_ENST00000588659.1_Frame_Shift_Ins_p.P24fs|TMEM106A_ENST00000536052.1_Frame_Shift_Ins_p.P24fs	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	24						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		TGTCCTCCAAACCAGCCATTGG	0.525																																																	0																																										SO:0001589	frameshift_variant	113277			AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.71dupC	17.37:g.41365131_41365131dupC	ENSP00000330774:p.Pro24fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2X2|B7Z698	Frame_Shift_Ins	INS	ENST00000331615.3	37	CCDS11462.1																																																																																				0.525	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453470.2		NM_145041	
TP53	7157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	7577124	7577124	+	Missense_Mutation	SNP	C	C	T	rs121912657		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr17:7577124C>T	ENST00000269305.4	-	8	1003	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	TP53_ENST00000445888.2_Missense_Mutation_p.V272M|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.V272M|TP53_ENST00000455263.2_Missense_Mutation_p.V272M|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.V272M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	272	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1737852}.|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V272M(82)|p.V272L(26)|p.0?(8)|p.V272fs*73(4)|p.?(2)|p.F270fs*72(1)|p.E271fs*73(1)|p.V272fs*34(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.G266_E271delGRNSFE(1)|p.V272fs*74(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAACACGCACCTCAAAGCTG	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	133	Substitution - Missense(108)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)	large_intestine(23)|ovary(16)|lung(14)|breast(14)|oesophagus(11)|upper_aerodigestive_tract(9)|haematopoietic_and_lymphoid_tissue(9)|central_nervous_system(7)|bone(5)|stomach(4)|pancreas(4)|liver(4)|kidney(3)|urinary_tract(3)|endometrium(2)|thyroid(1)|vulva(1)|soft_tissue(1)|testis(1)|skin(1)	GRCh37	CM920676	TP53	M	rs121912657						62.0	54.0	57.0					17																	7577124		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.814G>A	17.37:g.7577124C>T	ENSP00000269305:p.Val272Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318455	0.81469	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99833	-7.03;-7.03;-7.03;-7.03;-7.03;-7.03	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057604	0.64402	D	0.000002	D	0.99843	0.9928	M	0.90309	3.105	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.96721	0.9532	10	0.87932	D	0	-27.8222	16.1198	0.81342	0.0:1.0:0.0:0.0	.	272;272;272;272	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	M	272;272;272;272;272;261;140	ENSP00000352610:V272M;ENSP00000269305:V272M;ENSP00000398846:V272M;ENSP00000391127:V272M;ENSP00000391478:V272M;ENSP00000425104:V140M	ENSP00000269305:V272M	V	-	1	0	TP53	7517849	1.000000	0.71417	0.986000	0.45419	0.849000	0.48306	5.871000	0.69628	2.667000	0.90743	0.462000	0.41574	GTG		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1		NM_000546	
TMEM98	26022	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	31260288	31260288	+	Silent	SNP	C	C	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr17:31260288C>A	ENST00000579849.1	+	4	659	c.228C>A	c.(226-228)gcC>gcA	p.A76A	TMEM98_ENST00000578289.1_Silent_p.A76A|TMEM98_ENST00000394642.3_Silent_p.A76A	NM_015544.2	NP_056359.2	Q9Y2Y6	TMM98_HUMAN	transmembrane protein 98	76						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.A76A(1)		kidney(2)|large_intestine(1)	3		Ovarian(249;0.182)|Breast(31;0.244)	BRCA - Breast invasive adenocarcinoma(9;0.0769)			ACATTGAGGCCATTCTGGAGA	0.532																																																	1	Substitution - coding silent(1)	kidney(1)											167.0	148.0	155.0					17																	31260288		2203	4300	6503	SO:0001819	synonymous_variant	26022			CR605381	CCDS11274.1	17q11.2	2005-12-16			ENSG00000006042	ENSG00000006042			24529	protein-coding gene	gene with protein product		615949				11230166	Standard	NM_001301746		Approved	DKFZP564K1964	uc002hhr.3	Q9Y2Y6	OTTHUMG00000132882	ENST00000579849.1:c.228C>A	17.37:g.31260288C>A		Somatic		WXS	Illumina HiSeq	Phase_I	E1P631|Q9UFK2	Silent	SNP	ENST00000579849.1	37	CCDS11274.1																																																																																				0.532	TMEM98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256372.2		NM_015544	
TPR	7175	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	186286645	186286645	+	Silent	SNP	G	G	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr1:186286645G>T	ENST00000367478.4	-	49	7205	c.6909C>A	c.(6907-6909)acC>acA	p.T2303T		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	2303					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.T2290T(1)|p.T2303T(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GATCCTGGCTGGTGGAGGGGA	0.443			T	NTRK1	papillary thyroid																																			Dom	yes		1	1q25	7175	translocated promoter region		E	2	Substitution - coding silent(2)	kidney(2)											94.0	95.0	95.0					1																	186286645		1911	4125	6036	SO:0001819	synonymous_variant	7175			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.6909C>A	1.37:g.186286645G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	37	CCDS41446.1																																																																																				0.443	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2		NM_003292	
TPRN	286262	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	140093554	140093554	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr9:140093554A>T	ENST00000409012.4	-	1	1696	c.1610T>A	c.(1609-1611)cTc>cAc	p.L537H	TPRN_ENST00000541945.1_Intron|TPRN_ENST00000321773.2_Missense_Mutation_p.L476H	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	537					sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)		p.L231H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						GGGCCCCAGGAGGCAACTAGC	0.647																																																	1	Substitution - Missense(1)	kidney(1)											84.0	76.0	79.0					9																	140093554		2203	4300	6503	SO:0001583	missense	286262			AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1610T>A	9.37:g.140093554A>T	ENSP00000387100:p.Leu537His	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Missense_Mutation	SNP	ENST00000409012.4	37	CCDS56594.1	.	.	.	.	.	.	.	.	.	.	A	8.749	0.920834	0.17982	.	.	ENSG00000176058	ENST00000333046;ENST00000409012;ENST00000321773	.	.	.	3.44	-0.515	0.11954	.	1.578100	0.03841	N	0.270592	T	0.38532	0.1044	N	0.25647	0.755	0.09310	N	1	D	0.63046	0.992	P	0.60345	0.873	T	0.40478	-0.9561	9	0.12766	T	0.61	-0.1996	7.4792	0.27395	0.4767:0.0:0.5233:0.0	.	537	Q4KMQ1	TPRN_HUMAN	H	335;537;476	.	ENSP00000313704:L476H	L	-	2	0	TPRN	139213375	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.013000	0.13310	-0.170000	0.10816	0.459000	0.35465	CTC		0.647	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055323.3		NM_173691	
VANGL1	81839	broad.mit.edu;hgsc.bcm.edu	37	1	116226627	116226627	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr1:116226627G>T	ENST00000355485.2	+	6	1280	c.1009G>T	c.(1009-1011)Gac>Tac	p.D337Y	VANGL1_ENST00000474344.1_3'UTR|VANGL1_ENST00000369510.4_Missense_Mutation_p.D335Y|VANGL1_ENST00000369509.1_Missense_Mutation_p.D337Y|VANGL1_ENST00000310260.3_Missense_Mutation_p.D337Y	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	337					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)		p.D337Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TCGGCGCAGGGACTCAAGCCA	0.532																																																	1	Substitution - Missense(1)	kidney(1)											67.0	60.0	63.0					1																	116226627		2203	4300	6503	SO:0001583	missense	81839			AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.1009G>T	1.37:g.116226627G>T	ENSP00000347672:p.Asp337Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	ENST00000355485.2	37	CCDS883.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985248	0.74474	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	4.58	4.58	0.56647	.	0.048340	0.85682	D	0.000000	D	0.88206	0.6374	M	0.85542	2.76	0.80722	D	1	P;P	0.43542	0.773;0.81	B;B	0.44085	0.313;0.44	D	0.91025	0.4860	10	0.87932	D	0	0.0	17.6175	0.88071	0.0:0.0:1.0:0.0	.	335;337	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	Y	337;335;337;337	ENSP00000347672:D337Y;ENSP00000358523:D335Y;ENSP00000310800:D337Y;ENSP00000358522:D337Y	ENSP00000310800:D337Y	D	+	1	0	VANGL1	116028150	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	9.254000	0.95512	2.366000	0.80165	0.551000	0.68910	GAC		0.532	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033096.1			
VPS13C	54832	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	62214721	62214721	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr15:62214721G>C	ENST00000261517.5	-	54	6923	c.6850C>G	c.(6850-6852)Caa>Gaa	p.Q2284E	VPS13C_ENST00000395896.4_Missense_Mutation_p.Q2284E|VPS13C_ENST00000249837.3_Missense_Mutation_p.Q2241E|VPS13C_ENST00000395898.3_Missense_Mutation_p.Q2241E	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.Q2284E(2)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						AAGGTAACTTGAATGGATTCT	0.378																																																	2	Substitution - Missense(2)	kidney(2)											179.0	171.0	174.0					15																	62214721		2203	4300	6503	SO:0001583	missense	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.6850C>G	15.37:g.62214721G>C	ENSP00000261517:p.Gln2284Glu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860763	0.71834	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.46063	0.88;0.88;0.88	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.44871	0.1314	M	0.72118	2.19	0.80722	D	1	B;P;B;B	0.40360	0.012;0.714;0.377;0.374	B;B;B;B	0.36464	0.026;0.225;0.225;0.112	T	0.45891	-0.9230	10	0.31617	T	0.26	.	18.8268	0.92122	0.0:0.0:1.0:0.0	.	2241;2284;2241;2284	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	E	2241;2284;2284;2284	ENSP00000249837:Q2241E;ENSP00000261517:Q2284E;ENSP00000379233:Q2284E	ENSP00000249837:Q2241E	Q	-	1	0	VPS13C	60002013	1.000000	0.71417	0.990000	0.47175	0.957000	0.61999	8.783000	0.91813	2.519000	0.84933	0.650000	0.86243	CAA		0.378	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1		NM_017684	
ZMYM2	7750	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	20660011	20660011	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr13:20660011T>C	ENST00000382874.2	+	26	4181	c.3991T>C	c.(3991-3993)Tgc>Cgc	p.C1331R	ZMYM2_ENST00000382869.3_Missense_Mutation_p.C1331R|ZMYM2_ENST00000382871.2_Missense_Mutation_p.C1331R	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.C1331R(2)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GCAACCAGAATGCTCTAGTTC	0.393																																																	2	Substitution - Missense(2)	kidney(2)											89.0	84.0	85.0					13																	20660011		1834	4080	5914	SO:0001583	missense	7750			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3991T>C	13.37:g.20660011T>C	ENSP00000372327:p.Cys1331Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	T	5.695	0.312846	0.10789	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.14516	2.5	5.87	0.19	0.15125	.	0.405251	0.33110	N	0.005265	T	0.02047	0.0064	N	0.00510	-1.415	0.80722	D	1	B	0.22909	0.077	B	0.21360	0.034	T	0.39272	-0.9622	10	0.02654	T	1	-1.1351	1.1906	0.01864	0.24:0.1338:0.1245:0.5017	.	1331	Q9UBW7	ZMYM2_HUMAN	R	1331;1331;1329;1329;709	ENSP00000372322:C1331R	ENSP00000372322:C1331R	C	+	1	0	ZMYM2	19558011	0.998000	0.40836	0.997000	0.53966	0.995000	0.86356	0.507000	0.22675	0.104000	0.17725	0.482000	0.46254	TGC		0.393	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2		NM_003453	
ZC3H13	23091	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	46543242	46543242	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr13:46543242G>C	ENST00000242848.4	-	14	3785	c.3437C>G	c.(3436-3438)aCc>aGc	p.T1146S	ZC3H13_ENST00000282007.3_Missense_Mutation_p.T1146S|ZC3H13_ENST00000378921.2_Missense_Mutation_p.T102S			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1146							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.T1146S(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ATTATtggtggtattggtggg	0.488																																					Esophageal Squamous(187;747 2077 11056 31291 44172)												1	Substitution - Missense(1)	kidney(1)											114.0	111.0	112.0					13																	46543242		2203	4300	6503	SO:0001583	missense	23091			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.3437C>G	13.37:g.46543242G>C	ENSP00000242848:p.Thr1146Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	G	0.022	-1.418251	0.01136	.	.	ENSG00000123200	ENST00000242848;ENST00000378921;ENST00000282007	T;T;T	0.42900	2.56;0.96;1.56	3.47	-2.21	0.06973	.	1.250210	0.05678	N	0.589825	T	0.16514	0.0397	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.13361	-1.0512	10	0.09590	T	0.72	.	0.877	0.01226	0.2085:0.2823:0.3231:0.1862	.	1146;1146	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	S	1146;102;1146	ENSP00000242848:T1146S;ENSP00000368201:T102S;ENSP00000282007:T1146S	ENSP00000242848:T1146S	T	-	2	0	ZC3H13	45441243	0.011000	0.17503	0.000000	0.03702	0.172000	0.22775	-0.044000	0.12023	-0.532000	0.06332	0.655000	0.94253	ACC		0.488	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1		NM_015070	
ZMYND15	84225	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	4647403	4647403	+	Splice_Site	SNP	G	G	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr17:4647403G>T	ENST00000433935.1	+	8	1552		c.e8+1		ZMYND15_ENST00000573751.2_Splice_Site|ZMYND15_ENST00000269289.6_Intron|ZMYND15_ENST00000592813.1_Intron	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15						negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.?(1)		endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						CCCCAGTCCTGTAAGGAGAGC	0.597																																																	1	Unknown(1)	kidney(1)											60.0	59.0	59.0					17																	4647403		692	1591	2283	SO:0001630	splice_region_variant	84225			AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.1495+1G>T	17.37:g.4647403G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DXY5|I3L296	Splice_Site	SNP	ENST00000433935.1	37	CCDS45584.1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.691432	0.68271	.	.	ENSG00000141497	ENST00000433935	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2324	0.82356	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZMYND15	4594152	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.606000	0.67641	2.701000	0.92244	0.563000	0.77884	.		0.597	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1		NM_032265	Intron
ZNF609	23060	hgsc.bcm.edu;ucsc.edu	37	15	64967099	64967099	+	Silent	SNP	C	C	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr15:64967099C>A	ENST00000326648.3	+	4	2174	c.2046C>A	c.(2044-2046)ggC>ggA	p.G682G		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	682						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGAGCCCAGGCTCTTCCTCAG	0.582																																																	0													92.0	90.0	90.0					15																	64967099		2203	4299	6502	SO:0001819	synonymous_variant	23060			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.2046C>A	15.37:g.64967099C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q0D2I2	Silent	SNP	ENST00000326648.3	37	CCDS32270.1																																																																																				0.582	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1		XM_042833	
ZNF677	342926	broad.mit.edu;hgsc.bcm.edu	37	19	53740523	53740523	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr19:53740523G>T	ENST00000598513.1	-	5	1607	c.1457C>A	c.(1456-1458)cCt>cAt	p.P486H	ZNF677_ENST00000333952.4_Missense_Mutation_p.P486H	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	486					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P486H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		ACATTTGTAAGGTTTCTCTCC	0.363																																																	1	Substitution - Missense(1)	kidney(1)											72.0	72.0	72.0					19																	53740523		2203	4300	6503	SO:0001583	missense	342926			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1457C>A	19.37:g.53740523G>T	ENSP00000469391:p.Pro486His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000598513.1	37	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.360273	0.41801	.	.	ENSG00000197928	ENST00000333952	T	0.17528	2.27	2.21	2.21	0.28008	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.233852	0.22344	N	0.061281	T	0.25232	0.0613	M	0.91249	3.19	0.24673	N	0.993405	P	0.47409	0.895	B	0.37943	0.261	T	0.41270	-0.9518	10	0.87932	D	0	.	10.5214	0.44920	0.0:0.0:1.0:0.0	.	486	Q86XU0	ZN677_HUMAN	H	486	ENSP00000334394:P486H	ENSP00000334394:P486H	P	-	2	0	ZNF677	58432335	0.995000	0.38212	1.000000	0.80357	0.862000	0.49288	2.561000	0.45905	1.559000	0.49555	0.655000	0.94253	CCT		0.363	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1		NM_182609	
DNAJC10	54431	broad.mit.edu	37	2	183605974	183605974	+	Missense_Mutation	SNP	G	G	A	rs201121755		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr2:183605974G>A	ENST00000264065.7	+	13	1497	c.1082G>A	c.(1081-1083)cGt>cAt	p.R361H		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	361	Trxb 2.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)	p.R361H(1)		breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTTAAGGATCGTTTGGCTCAT	0.313																																					Pancreas(56;860 1183 25669 35822 48585)												1	Substitution - Missense(1)	kidney(1)											98.0	91.0	94.0					2																	183605974		2201	4299	6500	SO:0001583	missense	54431				CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.1082G>A	2.37:g.183605974G>A	ENSP00000264065:p.Arg361His	Somatic		WXS	Illumina GAIIx	Phase_I	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Missense_Mutation	SNP	ENST00000264065.7	37	CCDS33345.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059665	0.36373	.	.	ENSG00000077232	ENST00000264065;ENST00000392392	T	0.21543	2.0	4.76	3.89	0.44902	Thioredoxin-like fold (2);	0.234157	0.38272	N	0.001743	T	0.15305	0.0369	L	0.33485	1.01	0.80722	D	1	B;B	0.23540	0.087;0.086	B;B	0.14023	0.01;0.007	T	0.04781	-1.0927	10	0.41790	T	0.15	.	10.0191	0.42033	0.2171:0.0:0.7829:0.0	.	315;361	Q8IXB1-2;Q8IXB1	.;DJC10_HUMAN	H	361;315	ENSP00000264065:R361H	ENSP00000264065:R361H	R	+	2	0	DNAJC10	183314219	0.990000	0.36364	0.995000	0.50966	0.974000	0.67602	1.708000	0.37899	1.127000	0.42034	0.650000	0.86243	CGT		0.313	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2		NM_018981	
MED27	9442	broad.mit.edu	37	9	134955076	134955076	+	Silent	SNP	A	A	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr9:134955076A>G	ENST00000292035.5	-	1	219	c.156T>C	c.(154-156)ttT>ttC	p.F52F	MED27_ENST00000357028.2_Silent_p.F52F|MED27_ENST00000474263.1_Silent_p.F52F|RP11-32B11.2_ENST00000444872.2_RNA	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	52					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.F52F(3)		breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		AGTGCGCAATAAAGGCCTTCT	0.647																																					Colon(41;784 923 6932 42329 52483)												3	Substitution - coding silent(3)	endometrium(2)|kidney(1)											79.0	81.0	80.0					9																	134955076		2203	4300	6503	SO:0001819	synonymous_variant	9442			AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.156T>C	9.37:g.134955076A>G		Somatic		WXS	Illumina GAIIx	Phase_I	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Silent	SNP	ENST00000292035.5	37	CCDS6945.1																																																																																				0.647	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2		NM_004269	
MUC4	4585	broad.mit.edu	37	3	195505867	195505867	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr3:195505867A>T	ENST00000463781.3	-	2	13043	c.12584T>A	c.(12583-12585)gTc>gAc	p.V4195D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V4195D|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V4195D(6)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGTGTCGGTGACAGGAAGAGG	0.607																																																	6	Substitution - Missense(6)	endometrium(3)|kidney(3)																																								SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12584T>A	3.37:g.195505867A>T	ENSP00000417498:p.Val4195Asp	Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	0.384	-0.927152	0.02377	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36157	1.42;1.27	.	.	.	.	.	.	.	.	T	0.34513	0.0900	N	0.19112	0.55	0.29126	N	0.879938	D	0.67145	0.996	D	0.69479	0.964	T	0.27938	-1.0059	7	.	.	.	.	4.4413	0.11575	0.3374:0.0:0.6626:0.0	.	4067	E7ESK3	.	D	4195	ENSP00000417498:V4195D;ENSP00000420243:V4195D	.	V	-	2	0	MUC4	196990646	0.000000	0.05858	0.033000	0.17914	0.055000	0.15305	-2.347000	0.01095	-0.475000	0.06852	0.063000	0.15292	GTC		0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
TRIM51HP	440041	broad.mit.edu	37	11	55063168	55063168	+	RNA	SNP	T	T	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr11:55063168T>C	ENST00000526016.1	-	0	471					NR_038174.2				tripartite motif-containing 51H, pseudogene																		CACATAATCCTGCAGTGACAA	0.348																																																	0																																												0					11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55063168T>C		Somatic		WXS	Illumina GAIIx	Phase_I		Splice_Site	SNP	ENST00000526016.1	37																																																																																					0.348	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000391438.1			
ZNF462	58499	broad.mit.edu	37	9	109689490	109689490	+	Silent	SNP	A	A	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3732539b-eb77-485b-81a1-83be956a9a87	d9a813ec-eb29-45c1-9324-55d38bf59c12	g.chr9:109689490A>C	ENST00000277225.5	+	3	3586	c.3297A>C	c.(3295-3297)ccA>ccC	p.P1099P	ZNF462_ENST00000457913.1_Silent_p.P1099P|ZNF462_ENST00000441147.2_5'Flank			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1099					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P1099P(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TGGGTTCCCCACCCCCCCCAC	0.532																																																	1	Substitution - coding silent(1)	kidney(1)																																								SO:0001819	synonymous_variant	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3297A>C	9.37:g.109689490A>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q5T0T4|Q8N408	Silent	SNP	ENST00000277225.5	37	CCDS35096.1																																																																																				0.532	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2		NM_021224	
