#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABHD15	116236	hgsc.bcm.edu;ucsc.edu	37	17	27889659	27889659	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr17:27889659C>A	ENST00000307201.4	-	2	1497	c.1327G>T	c.(1327-1329)Gga>Tga	p.G443*	RP11-68I3.2_ENST00000581474.1_RNA	NM_198147.2	NP_937790.2	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15	443						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	10						TGCAAGGCTCCCCCACGACGA	0.572																																																	0													68.0	72.0	71.0					17																	27889659		2203	4300	6503	SO:0001587	stop_gained	116236			AK056717	CCDS32602.1	17q11.2	2009-11-20			ENSG00000168792	ENSG00000168792		"""Abhydrolase domain containing"""	26971	protein-coding gene	gene with protein product						12975309	Standard	NM_198147		Approved		uc002hed.2	Q6UXT9		ENST00000307201.4:c.1327G>T	17.37:g.27889659C>A	ENSP00000302657:p.Gly443*	Somatic		WXS	Illumina HiSeq	Phase_I	Q96EC5	Nonsense_Mutation	SNP	ENST00000307201.4	37	CCDS32602.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.844122	0.51164	.	.	ENSG00000168792	ENST00000307201	.	.	.	5.77	4.73	0.59995	.	0.299674	0.30020	N	0.010610	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-9.1195	10.3669	0.44030	0.1467:0.7745:0.0:0.0788	.	.	.	.	X	443	.	ENSP00000302657:G443X	G	-	1	0	ABHD15	24913785	0.965000	0.33210	0.996000	0.52242	0.038000	0.13279	3.789000	0.55454	2.745000	0.94114	0.655000	0.94253	GGA		0.572	ABHD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447796.2		NM_198147	
AFF1	4299	hgsc.bcm.edu;ucsc.edu	37	4	88029399	88029399	+	Missense_Mutation	SNP	G	G	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr4:88029399G>T	ENST00000307808.6	+	10	1864	c.1444G>T	c.(1444-1446)Gac>Tac	p.D482Y	AFF1_ENST00000544085.1_Missense_Mutation_p.D120Y|AFF1_ENST00000395146.4_Missense_Mutation_p.D489Y	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	482					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		CAGTTCCTCAGACTCAGAGAG	0.547																																																	0													109.0	101.0	104.0					4																	88029399		2203	4300	6503	SO:0001583	missense	4299			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1444G>T	4.37:g.88029399G>T	ENSP00000305689:p.Asp482Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B4DTU1|E9PBM3	Missense_Mutation	SNP	ENST00000307808.6	37	CCDS3616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.309352|4.309352	0.81247|0.81247	.|.	.|.	ENSG00000172493|ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000511722;ENST00000544085;ENST00000514970|ENST00000541943	T;T;T;T;T|.	0.79454|.	-1.27;-1.27;-1.27;-1.27;-1.27|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.128506|.	0.53938|.	D|.	0.000060|.	D|D	0.84170|0.84170	0.5413|0.5413	M|M	0.85197|0.85197	2.74|2.74	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.85276|0.85276	0.1059|0.1059	10|6	0.72032|0.66056	D|D	0.01|0.02	-18.8568|-18.8568	20.2985|20.2985	0.98592|0.98592	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	489;482;482|.	E9PBM3;Q14C88;P51825|.	.;.;AFF1_HUMAN|.	Y|H	489;482;120;120;173|141	ENSP00000378578:D489Y;ENSP00000305689:D482Y;ENSP00000424766:D120Y;ENSP00000440843:D120Y;ENSP00000424881:D173Y|.	ENSP00000305689:D482Y|ENSP00000446349:Q141H	D|Q	+|+	1|3	0|2	AFF1|AFF1	88248423|88248423	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.979000|0.979000	0.70002|0.70002	6.917000|6.917000	0.75782|0.75782	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GAC|CAG		0.547	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3		NM_005935	
AKAP9	10142	hgsc.bcm.edu;ucsc.edu	37	7	91722542	91722542	+	Missense_Mutation	SNP	C	C	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr7:91722542C>A	ENST00000359028.2	+	39	9727	c.9502C>A	c.(9502-9504)Ctg>Atg	p.L3168M	AKAP9_ENST00000358100.2_Missense_Mutation_p.L3114M|AKAP9_ENST00000356239.3_Missense_Mutation_p.L3164M			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3168					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GGTTGCTGAACTGAAGAGTGA	0.463			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													114.0	107.0	109.0					7																	91722542		2203	4300	6503	SO:0001583	missense	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.9502C>A	7.37:g.91722542C>A	ENSP00000351922:p.Leu3168Met	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	C	12.27	1.886764	0.33348	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.18338	2.35;2.35;2.44;2.22	5.77	5.77	0.91146	.	0.000000	0.32068	N	0.006624	T	0.42245	0.1194	M	0.71296	2.17	0.50171	D	0.999855	D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0	P;D;D;D;D	0.81914	0.849;0.995;0.988;0.995;0.995	T	0.13548	-1.0505	10	0.72032	D	0.01	.	15.8031	0.78471	0.0:0.8647:0.1353:0.0	.	439;3168;3168;3164;3156	B3KQF9;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	M	3164;3168;3114;3168;1010	ENSP00000348573:L3164M;ENSP00000351922:L3168M;ENSP00000350813:L3114M;ENSP00000378042:L1010M	ENSP00000348573:L3164M	L	+	1	2	AKAP9	91560478	0.936000	0.31750	0.989000	0.46669	0.093000	0.18481	1.487000	0.35540	2.885000	0.99019	0.655000	0.94253	CTG		0.463	AKAP9-202	KNOWN	basic	protein_coding	protein_coding			NM_005751	
ANKRD12	23253	hgsc.bcm.edu	37	18	9254693	9254693	+	Silent	SNP	G	G	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr18:9254693G>A	ENST00000262126.4	+	9	1668	c.1428G>A	c.(1426-1428)ttG>ttA	p.L476L	ANKRD12_ENST00000383440.2_Silent_p.L453L|ANKRD12_ENST00000400020.3_Silent_p.L453L	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	476						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						aaagaaaattgaaaaatcaga	0.318																																																	0													23.0	26.0	25.0					18																	9254693		2185	4283	6468	SO:0001819	synonymous_variant	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.1428G>A	18.37:g.9254693G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	37	CCDS11843.1																																																																																				0.318	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2		NM_015208	
ANKRD17	26057	hgsc.bcm.edu;ucsc.edu	37	4	74017194	74017194	+	Missense_Mutation	SNP	C	C	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr4:74017194C>T	ENST00000358602.4	-	7	1398	c.1282G>A	c.(1282-1284)Gag>Aag	p.E428K	ANKRD17_ENST00000509867.2_Missense_Mutation_p.E315K|ANKRD17_ENST00000514252.1_5'UTR|ANKRD17_ENST00000330838.6_Missense_Mutation_p.E428K	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	428					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GTTTTATGCTCTTGATCCGCG	0.358																																																	0													95.0	89.0	91.0					4																	74017194		2203	4300	6503	SO:0001583	missense	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.1282G>A	4.37:g.74017194C>T	ENSP00000351416:p.Glu428Lys	Somatic		WXS	Illumina HiSeq	Phase_I	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	C	37	6.089089	0.97271	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.15952	2.38;2.38;2.38	5.66	5.66	0.87406	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000003	T	0.36524	0.0970	L	0.45228	1.405	0.48762	D	0.999703	P;P;P;P;D	0.55605	0.677;0.863;0.931;0.944;0.972	B;P;P;D;D	0.68353	0.15;0.881;0.66;0.957;0.956	T	0.01309	-1.1389	10	0.51188	T	0.08	.	19.7417	0.96234	0.0:1.0:0.0:0.0	.	13;428;428;428;315	B4DR08;O75179-2;G5E964;O75179;E7EUV3	.;.;.;ANR17_HUMAN;.	K	428;428;428;315;428	ENSP00000351416:E428K;ENSP00000332265:E428K;ENSP00000427151:E315K	ENSP00000332265:E428K	E	-	1	0	ANKRD17	74236058	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.667000	0.90743	0.563000	0.77884	GAG		0.358	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1		NM_032217	
ATP2C2	9914	hgsc.bcm.edu;ucsc.edu	37	16	84472822	84472822	+	Missense_Mutation	SNP	C	C	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr16:84472822C>T	ENST00000262429.4	+	12	1126	c.1037C>T	c.(1036-1038)aCg>aTg	p.T346M	ATP2C2_ENST00000416219.2_Missense_Mutation_p.T346M|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	346					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						GTCATGGTGACGCTGGTCCTG	0.562																																																	0													75.0	81.0	79.0					16																	84472822		2107	4229	6336	SO:0001583	missense	9914			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1037C>T	16.37:g.84472822C>T	ENSP00000262429:p.Thr346Met	Somatic		WXS	Illumina HiSeq	Phase_I	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	ENST00000262429.4	37	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220405	0.58560	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	D;D	0.91996	-2.95;-2.95	4.91	4.91	0.64330	ATPase, P-type, ATPase-associated domain (1);	0.188384	0.37304	N	0.002158	D	0.97074	0.9044	M	0.94101	3.495	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.988;0.992;0.995	D	0.98274	1.0505	10	0.87932	D	0	.	17.0508	0.86518	0.0:1.0:0.0:0.0	.	346;195;363;346	E7ES94;F8WAA5;O75185-2;O75185	.;.;.;AT2C2_HUMAN	M	346;346;195	ENSP00000397925:T346M;ENSP00000262429:T346M	ENSP00000262429:T346M	T	+	2	0	ATP2C2	83030323	1.000000	0.71417	0.624000	0.29186	0.049000	0.14656	7.192000	0.77771	2.255000	0.74692	0.561000	0.74099	ACG		0.562	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1		NM_014861	
NOA1	84273	hgsc.bcm.edu	37	4	57842799	57842800	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr4:57842799_57842800delGC	ENST00000264230.4	-	1	2189_2190	c.952_953delGC	c.(952-954)gccfs	p.A318fs	POLR2B_ENST00000314595.5_5'Flank|POLR2B_ENST00000381227.1_5'Flank|POLR2B_ENST00000441246.2_5'Flank|POLR2B_ENST00000431623.2_5'Flank	NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	318	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										GCCGGTCTTGGCGCTGATCAGC	0.644																																																	0																																										SO:0001589	frameshift_variant	0			AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.952_953delGC	4.37:g.57842801_57842802delGC	ENSP00000264230:p.Ala318fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N7L6|Q9BSQ9	Frame_Shift_Del	DEL	ENST00000264230.4	37	CCDS3510.1																																																																																				0.644	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250694.2		NM_032313	
TDRP	157695	hgsc.bcm.edu;ucsc.edu	37	8	444511	444511	+	Silent	SNP	T	T	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr8:444511T>C	ENST00000324079.6	-	2	435	c.195A>G	c.(193-195)aaA>aaG	p.K65K	TDRP_ENST00000523656.1_Silent_p.K65K|TDRP_ENST00000427263.2_Silent_p.K65K|TDRP_ENST00000524229.1_5'UTR			Q86YL5	TDRP_HUMAN	testis development related protein	65					spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											ACTTGGGAGATTTACATCTTT	0.413																																																	0													143.0	130.0	134.0					8																	444511		1952	4137	6089	SO:0001819	synonymous_variant	157695			AY194292	CCDS47759.1, CCDS59090.1	8p23.3	2013-06-03	2013-06-03	2013-06-03	ENSG00000180190	ENSG00000180190			26951	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 42"""	C8orf42		20170638	Standard	NM_175075		Approved	INM01, TDRP1, TDRP2		Q86YL5	OTTHUMG00000163593	ENST00000324079.6:c.195A>G	8.37:g.444511T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B6VF03|B9EG53	Silent	SNP	ENST00000324079.6	37	CCDS47759.1																																																																																				0.413	TDRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374442.1		NM_175075	
CCDC171	203238	hgsc.bcm.edu;ucsc.edu	37	9	15723685	15723685	+	Missense_Mutation	SNP	G	G	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr9:15723685G>A	ENST00000380701.3	+	13	1760	c.1432G>A	c.(1432-1434)Gca>Aca	p.A478T	CCDC171_ENST00000297641.3_Missense_Mutation_p.A478T	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	478																	TAAGGAAAAGGCATGTAATGA	0.269																																																	0													43.0	45.0	44.0					9																	15723685		2199	4264	6463	SO:0001583	missense	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.1432G>A	9.37:g.15723685G>A	ENSP00000370077:p.Ala478Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	ENST00000380701.3	37	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	G	4.929	0.172549	0.09391	.	.	ENSG00000164989	ENST00000297641;ENST00000380701	T;T	0.43294	0.95;0.95	5.77	-8.39	0.00969	.	0.982293	0.08349	N	0.959527	T	0.12008	0.0292	N	0.01874	-0.695	0.09310	N	0.999995	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.30504	-0.9976	10	0.13470	T	0.59	3.9239	7.0966	0.25313	0.5646:0.0802:0.2743:0.0809	.	486;478;478	B7ZM22;Q6TFL3-3;Q6TFL3	.;.;CI093_HUMAN	T	478	ENSP00000297641:A478T;ENSP00000370077:A478T	ENSP00000297641:A478T	A	+	1	0	C9orf93	15713685	0.001000	0.12720	0.018000	0.16275	0.908000	0.53690	-0.276000	0.08514	-1.553000	0.01702	-0.140000	0.14226	GCA		0.269	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4		NM_173550	
CDHR5	53841	hgsc.bcm.edu;ucsc.edu	37	11	619336	619336	+	Missense_Mutation	SNP	G	G	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr11:619336G>C	ENST00000358353.3	-	13	1670	c.1348C>G	c.(1348-1350)Caa>Gaa	p.Q450E	CDHR5_ENST00000397542.2_Missense_Mutation_p.Q450E|CDHR5_ENST00000349570.7_Missense_Mutation_p.Q450E			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	450	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043, ECO:0000305}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						TCGGAAACTTGTATCTCAATG	0.602																																																	0													59.0	59.0	59.0					11																	619336		2203	4299	6502	SO:0001583	missense	53841			AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1348C>G	11.37:g.619336G>C	ENSP00000351118:p.Gln450Glu	Somatic		WXS	Illumina HiSeq	Phase_I	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	37	CCDS7707.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.122940	0.37436	.	.	ENSG00000099834	ENST00000397542;ENST00000358353;ENST00000349570	T;T;T	0.40756	1.11;1.11;1.02	3.84	2.92	0.33932	Cadherin (2);	.	.	.	.	T	0.36248	0.0960	L	0.32530	0.975	0.09310	N	1	P;P;P	0.50943	0.94;0.94;0.94	P;P;P	0.50659	0.546;0.465;0.647	T	0.09618	-1.0666	9	0.16420	T	0.52	-0.2733	7.2289	0.26030	0.1229:0.0:0.8771:0.0	.	450;450;450	Q9HBB8-4;Q9HBB8-2;Q9HBB8	.;.;CDHR5_HUMAN	E	450	ENSP00000380676:Q450E;ENSP00000351118:Q450E;ENSP00000345726:Q450E	ENSP00000345726:Q450E	Q	-	1	0	CDHR5	609336	0.001000	0.12720	0.001000	0.08648	0.097000	0.18754	0.789000	0.26886	0.974000	0.38366	0.462000	0.41574	CAA		0.602	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2		NM_021924	
CCDC15	80071	hgsc.bcm.edu;ucsc.edu	37	11	124910539	124910539	+	Missense_Mutation	SNP	A	A	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr11:124910539A>T	ENST00000344762.5	+	16	3047	c.2788A>T	c.(2788-2790)Aat>Tat	p.N930Y	CCDC15_ENST00000529051.1_Missense_Mutation_p.N941Y|CCDC15_ENST00000530061.1_3'UTR	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	930						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		CCCTGGGGGTAATTCAACTCT	0.368																																																	0													57.0	56.0	56.0					11																	124910539		1837	4084	5921	SO:0001583	missense	80071			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.2788A>T	11.37:g.124910539A>T	ENSP00000341684:p.Asn930Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H8U7	Missense_Mutation	SNP	ENST00000344762.5	37	CCDS44756.1	.	.	.	.	.	.	.	.	.	.	A	10.53	1.377265	0.24944	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.36157	1.27;1.27	5.13	2.67	0.31697	.	.	.	.	.	T	0.39989	0.1099	L	0.50333	1.59	0.09310	N	1	D	0.53462	0.96	P	0.51918	0.684	T	0.18335	-1.0340	9	0.59425	D	0.04	-3.5557	6.2753	0.20977	0.6079:0.3107:0.0814:0.0	.	930	Q0P6D6	CCD15_HUMAN	Y	941;930	ENSP00000435403:N941Y;ENSP00000341684:N930Y	ENSP00000341684:N930Y	N	+	1	0	CCDC15	124415749	0.140000	0.22579	0.202000	0.23494	0.122000	0.20287	1.055000	0.30467	0.361000	0.24292	0.533000	0.62120	AAT		0.368	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387131.1		NM_025004	
CLTCL1	8218	hgsc.bcm.edu;ucsc.edu	37	22	19175147	19175147	+	Missense_Mutation	SNP	T	T	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr22:19175147T>A	ENST00000263200.10	-	29	4600	c.4528A>T	c.(4528-4530)Att>Ttt	p.I1510F	CLTCL1_ENST00000442042.2_Intron|CLTCL1_ENST00000427926.1_Missense_Mutation_p.I1510F|CLTCL1_ENST00000353891.5_Intron	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1510	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					TAGGCCGCAATGCACCTGAAC	0.537			T	?	ALCL																																			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													98.0	101.0	100.0					22																	19175147		2077	4215	6292	SO:0001583	missense	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.4528A>T	22.37:g.19175147T>A	ENSP00000445677:p.Ile1510Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.086397	0.36855	.	.	ENSG00000070371	ENST00000263200;ENST00000427926	T;T	0.31510	1.49;1.49	3.97	1.79	0.24919	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.214218	0.39146	N	0.001457	T	0.55721	0.1938	M	0.91038	3.17	0.58432	D	0.999999	D	0.61080	0.989	D	0.70227	0.968	T	0.53521	-0.8427	10	0.72032	D	0.01	-3.0596	5.6555	0.17640	0.1504:0.0847:0.0:0.7649	.	1510	P53675	CLH2_HUMAN	F	1510	ENSP00000445677:I1510F;ENSP00000441158:I1510F	ENSP00000445677:I1510F	I	-	1	0	CLTCL1	17555147	1.000000	0.71417	0.656000	0.29637	0.005000	0.04900	3.484000	0.53201	0.124000	0.18369	-1.158000	0.01797	ATT		0.537	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5		NM_007098	
COL27A1	85301	hgsc.bcm.edu;ucsc.edu	37	9	116931547	116931547	+	Missense_Mutation	SNP	T	T	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr9:116931547T>A	ENST00000356083.3	+	3	2103	c.1712T>A	c.(1711-1713)cTg>cAg	p.L571Q		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	571	Pro-rich.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						TTGAGCGATCTGACAACCAGG	0.672																																																	0													70.0	88.0	82.0					9																	116931547		2203	4300	6503	SO:0001583	missense	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.1712T>A	9.37:g.116931547T>A	ENSP00000348385:p.Leu571Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	T	4.306	0.056142	0.08291	.	.	ENSG00000196739	ENST00000356083;ENST00000357257;ENST00000374106;ENST00000451716	D;D	0.92348	-2.62;-3.02	5.41	-5.42	0.02640	.	.	.	.	.	T	0.80989	0.4730	N	0.19112	0.55	0.09310	N	1	B;B	0.16166	0.003;0.016	B;B	0.12156	0.002;0.007	T	0.66685	-0.5861	9	0.13108	T	0.6	.	8.6863	0.34240	0.1252:0.1359:0.0:0.7389	.	571;518	Q8IZC6;Q5T1U7	CORA1_HUMAN;.	Q	571;571;518;518	ENSP00000348385:L571Q;ENSP00000391328:L518Q	ENSP00000348385:L571Q	L	+	2	0	COL27A1	115971368	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.668000	0.01959	-0.875000	0.04022	0.460000	0.39030	CTG		0.672	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1		NM_032888	
DPYS	1807	hgsc.bcm.edu;ucsc.edu	37	8	105440278	105440278	+	Missense_Mutation	SNP	T	T	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr8:105440278T>C	ENST00000351513.2	-	6	1154	c.1022A>G	c.(1021-1023)gAt>gGt	p.D341G	AP003471.2_ENST00000410226.1_RNA	NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	341					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTGGTAAAATCATCCTTCCC	0.458																																																	0													158.0	153.0	155.0					8																	105440278		2203	4300	6503	SO:0001583	missense	1807			D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.1022A>G	8.37:g.105440278T>C	ENSP00000276651:p.Asp341Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000351513.2	37	CCDS6302.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.908238	0.92107	.	.	ENSG00000147647	ENST00000351513	D	0.91180	-2.8	5.95	5.95	0.96441	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.045624	0.85682	D	0.000000	D	0.95881	0.8659	M	0.86651	2.83	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.96443	0.9328	10	0.87932	D	0	-27.8086	16.4237	0.83790	0.0:0.0:0.0:1.0	.	341	Q14117	DPYS_HUMAN	G	341	ENSP00000276651:D341G	ENSP00000276651:D341G	D	-	2	0	DPYS	105509454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	GAT		0.458	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1		NM_001385	
EMR2	30817	hgsc.bcm.edu;ucsc.edu	37	19	14854320	14854320	+	Missense_Mutation	SNP	C	C	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr19:14854320C>A	ENST00000315576.3	-	20	2826	c.2375G>T	c.(2374-2376)tGg>tTg	p.W792L	EMR2_ENST00000353005.1_Missense_Mutation_p.W650L|EMR2_ENST00000601345.1_Missense_Mutation_p.W781L|EMR2_ENST00000392967.2_Missense_Mutation_p.W781L|EMR2_ENST00000392965.3_Missense_Mutation_p.W734L|EMR2_ENST00000594294.1_Missense_Mutation_p.W743L|EMR2_ENST00000346057.1_Missense_Mutation_p.W743L|EMR2_ENST00000595839.1_Missense_Mutation_p.W650L|EMR2_ENST00000596991.2_Missense_Mutation_p.W781L|EMR2_ENST00000353876.1_Missense_Mutation_p.W699L|EMR2_ENST00000594076.1_Missense_Mutation_p.W699L	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	792					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						CCCTTTGGACCATTTCCCATA	0.542																																																	0													370.0	344.0	353.0					19																	14854320		2203	4300	6503	SO:0001583	missense	30817			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.2375G>T	19.37:g.14854320C>A	ENSP00000319883:p.Trp792Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	ENST00000315576.3	37	CCDS32935.1	.	.	.	.	.	.	.	.	.	.	c	14.08	2.427421	0.43122	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965	T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59	5.02	3.97	0.46021	.	.	.	.	.	T	0.40297	0.1111	L	0.49455	1.56	0.45354	D	0.998346	B;B;P;B;P;B;B;D	0.65815	0.402;0.254;0.908;0.165;0.835;0.216;0.365;0.995	B;B;P;B;B;B;B;P	0.58520	0.109;0.272;0.468;0.083;0.272;0.115;0.098;0.84	T	0.10222	-1.0639	9	0.24483	T	0.36	.	10.8425	0.46724	0.1887:0.8113:0.0:0.0	.	734;699;792;650;743;792;792;781	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	L	792;781;743;699;650;734	ENSP00000319883:W792L;ENSP00000376694:W781L;ENSP00000263380:W743L;ENSP00000319454:W699L;ENSP00000319838:W650L;ENSP00000376692:W734L	ENSP00000319883:W792L	W	-	2	0	EMR2	14715320	0.346000	0.24844	0.019000	0.16419	0.066000	0.16364	1.184000	0.32053	1.095000	0.41419	0.598000	0.82781	TGG		0.542	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2			
ENY2	56943	hgsc.bcm.edu;ucsc.edu	37	8	110355657	110355657	+	Missense_Mutation	SNP	A	A	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr8:110355657A>C	ENST00000521662.1	+	5	326	c.238A>C	c.(238-240)Aag>Cag	p.K80Q	ENY2_ENST00000521688.1_Missense_Mutation_p.K85Q|ENY2_ENST00000520147.1_3'UTR|ENY2_ENST00000522407.1_3'UTR					enhancer of yellow 2 homolog (Drosophila)											endometrium(2)|large_intestine(1)|lung(1)	4	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;9.05e-13)			CAGTGTAAAGAAGGAGCTCCT	0.333																																																	0													156.0	150.0	152.0					8																	110355657		1832	4081	5913	SO:0001583	missense	56943				CCDS43762.1, CCDS55270.1	8q23.1	2005-08-16			ENSG00000120533	ENSG00000120533			24449	protein-coding gene	gene with protein product						11438676	Standard	NM_020189		Approved	DC6, FLJ20480	uc003ynd.3	Q9NPA8	OTTHUMG00000164933	ENST00000521662.1:c.238A>C	8.37:g.110355657A>C	ENSP00000429713:p.Lys80Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000521662.1	37	CCDS55270.1	.	.	.	.	.	.	.	.	.	.	A	13.42	2.233237	0.39498	.	.	ENSG00000120533	ENST00000521662;ENST00000521688	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.51398	0.1672	L	0.33668	1.02	0.80722	D	1	B	0.15473	0.013	B	0.20577	0.03	T	0.46373	-0.9196	9	0.15499	T	0.54	-4.488	15.2309	0.73386	1.0:0.0:0.0:0.0	.	85	Q9NPA8	ENY2_HUMAN	Q	80;85	.	ENSP00000429713:K80Q	K	+	1	0	ENY2	110424833	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.927000	0.87577	2.272000	0.75746	0.460000	0.39030	AAG		0.333	ENY2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381002.1		NM_020189	
NUTM2F	54754	hgsc.bcm.edu	37	9	97080947	97080948	+	Frame_Shift_Del	DEL	AA	AA	-	rs150455117|rs112857574|rs199550948	byFrequency	TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr9:97080947_97080948delAA	ENST00000253262.4	-	7	2090_2091	c.2070_2071delTT	c.(2068-2073)ccttctfs	p.S691fs	NUTM2F_ENST00000341207.4_Frame_Shift_Del_p.S676fs|NUTM2F_ENST00000335456.7_Intron	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	691				Missing (in Ref. 2; AAI30391 and 3; CAB61394). {ECO:0000305}.				p.P556P(1)|p.S557delS(1)									CTGGCAGGAGAAGGTGATGGGC	0.619																																																	2	Substitution - coding silent(1)|Deletion - In frame(1)	prostate(1)|central_nervous_system(1)																																								SO:0001589	frameshift_variant	54754				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.2070_2071delTT	9.37:g.97080947_97080948delAA	ENSP00000253262:p.Ser691fs	Somatic		WXS	Illumina HiSeq	Phase_I	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Frame_Shift_Del	DEL	ENST00000253262.4	37	CCDS47994.1																																																																																				0.619	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053173.2		NM_017561	
FBN2	2201	hgsc.bcm.edu;ucsc.edu	37	5	127613688	127613688	+	Missense_Mutation	SNP	T	T	G			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr5:127613688T>G	ENST00000508053.1	-	64	8329	c.7355A>C	c.(7354-7356)gAa>gCa	p.E2452A	FBN2_ENST00000262464.4_Missense_Mutation_p.E2452A			P35556	FBN2_HUMAN	fibrillin 2	2452	EGF-like 41; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TACCTTACATTCATCAATATC	0.403																																																	0													146.0	123.0	131.0					5																	127613688		2203	4300	6503	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.7355A>C	5.37:g.127613688T>G	ENSP00000424571:p.Glu2452Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.654162	0.88056	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.98849	-5.18;-5.18	5.16	5.16	0.70880	Matrix fibril-associated (1);EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.348665	0.25310	N	0.031596	D	0.99296	0.9754	M	0.92317	3.295	0.58432	D	0.999996	D	0.69078	0.997	D	0.80764	0.994	D	0.99084	1.0838	10	0.72032	D	0.01	.	15.4374	0.75157	0.0:0.0:0.0:1.0	.	2452	P35556	FBN2_HUMAN	A	2452	ENSP00000262464:E2452A;ENSP00000424571:E2452A	ENSP00000262464:E2452A	E	-	2	0	FBN2	127641587	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	7.825000	0.86693	2.289000	0.77006	0.482000	0.46254	GAA		0.403	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2		NM_001999	
FOXRED2	80020	hgsc.bcm.edu;ucsc.edu	37	22	36894108	36894108	+	Missense_Mutation	SNP	G	G	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr22:36894108G>A	ENST00000397224.4	-	6	1405	c.1312C>T	c.(1312-1314)Cgg>Tgg	p.R438W	FOXRED2_ENST00000366463.3_5'UTR|FOXRED2_ENST00000216187.6_Missense_Mutation_p.R438W|FOXRED2_ENST00000397223.4_Missense_Mutation_p.R438W	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	438					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TTCACGCGCCGCACGATGGAG	0.632																																																	0													82.0	74.0	77.0					22																	36894108		2203	4300	6503	SO:0001583	missense	80020			BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.1312C>T	22.37:g.36894108G>A	ENSP00000380401:p.Arg438Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Missense_Mutation	SNP	ENST00000397224.4	37	CCDS13929.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479755	0.84747	.	.	ENSG00000100350	ENST00000397224;ENST00000216187;ENST00000397223	T;T;T	0.15603	2.41;2.41;2.41	5.07	5.07	0.68467	.	0.111307	0.64402	D	0.000019	T	0.35008	0.0917	M	0.72118	2.19	0.41670	D	0.989231	D	0.71674	0.998	P	0.58970	0.849	T	0.12967	-1.0527	10	0.87932	D	0	-34.1805	11.8244	0.52259	0.0:0.0:0.6992:0.3008	.	438	Q8IWF2	FXRD2_HUMAN	W	438	ENSP00000380401:R438W;ENSP00000216187:R438W;ENSP00000380400:R438W	ENSP00000216187:R438W	R	-	1	2	FOXRED2	35224054	1.000000	0.71417	0.998000	0.56505	0.900000	0.52787	6.208000	0.72165	2.358000	0.79984	0.650000	0.86243	CGG		0.632	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104098.2		NM_024955	
HMMR	3161	hgsc.bcm.edu	37	5	162917425	162917426	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr5:162917425_162917426insA	ENST00000358715.3	+	17	2025_2026	c.1989_1990insA	c.(1990-1992)aaafs	p.K664fs	HMMR_ENST00000353866.3_Frame_Shift_Ins_p.K649fs|HMMR_ENST00000432118.2_Frame_Shift_Ins_p.K578fs|RP11-80G7.1_ENST00000521666.1_RNA|RP11-80G7.1_ENST00000514724.2_RNA|HMMR_ENST00000393915.4_Frame_Shift_Ins_p.K665fs			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	664	Hyaluronic acid-binding. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	GTCAGCTTGCTAAAAAAAAACA	0.307																																																	0																																										SO:0001589	frameshift_variant	3161			U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.1998dupA	5.37:g.162917434_162917434dupA	ENSP00000351554:p.Lys664fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Frame_Shift_Ins	INS	ENST00000358715.3	37	CCDS4362.1																																																																																				0.307	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252752.1		NM_012484	
IFNA6	3443	hgsc.bcm.edu;ucsc.edu	37	9	21350656	21350656	+	Silent	SNP	G	G	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr9:21350656G>T	ENST00000380210.1	-	1	721	c.231C>A	c.(229-231)atC>atA	p.I77I		NM_021002.2	NP_066282.1	P05013	IFNA6_HUMAN	interferon, alpha 6	77					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(3)|lung(7)|skin(1)	11				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		GGAGGACAGAGATGGCTTCAG	0.478																																																	0													109.0	106.0	107.0					9																	21350656		2203	4300	6503	SO:0001819	synonymous_variant	3443				CCDS6504.1	9p22	2010-12-10			ENSG00000120235	ENSG00000120235		"""Interferons"""	5427	protein-coding gene	gene with protein product		147566				1385305	Standard	NM_021002		Approved	IFN-alphaK	uc011lni.2	P05013	OTTHUMG00000019676	ENST00000380210.1:c.231C>A	9.37:g.21350656G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VYQ1	Silent	SNP	ENST00000380210.1	37	CCDS6504.1																																																																																				0.478	IFNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051905.1		NM_021002	
IL10	3586	hgsc.bcm.edu;ucsc.edu	37	1	206944318	206944318	+	Silent	SNP	G	G	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr1:206944318G>A	ENST00000423557.1	-	3	370	c.312C>T	c.(310-312)gaC>gaT	p.D104D	IL10_ENST00000471071.1_5'UTR	NM_000572.2	NP_000563.1	P22301	IL10_HUMAN	interleukin 10	104					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|defense response to bacterium (GO:0042742)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|leukocyte chemotaxis (GO:0030595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of chronic inflammatory response to antigenic stimulus (GO:0002875)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interferon-alpha biosynthetic process (GO:0045355)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of myeloid dendritic cell activation (GO:0030886)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor biosynthetic process (GO:0032800)|regulation of gene expression (GO:0010468)|regulation of isotype switching (GO:0045191)|regulation of sensory perception of pain (GO:0051930)|response to activity (GO:0014823)|response to carbon monoxide (GO:0034465)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to inactivity (GO:0014854)|response to insulin (GO:0032868)|response to molecule of bacterial origin (GO:0002237)|type 2 immune response (GO:0042092)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-10 receptor binding (GO:0005141)			endometrium(1)|large_intestine(6)|lung(4)|prostate(1)	12	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GCGCCTTGATGTCTGGGTCTT	0.552																																																	0													153.0	145.0	148.0					1																	206944318		2203	4300	6503	SO:0001819	synonymous_variant	3586			M57627	CCDS1467.1	1q31-q32	2011-07-14			ENSG00000136634	ENSG00000136634		"""Interleukins and interleukin receptors"""	5962	protein-coding gene	gene with protein product	"""cytokine synthesis inhibitory factor"", ""T-cell growth inhibitory factor"""	124092				9162098	Standard	NM_000572		Approved	CSIF, TGIF, IL10A, IL-10	uc001hen.1	P22301	OTTHUMG00000036386	ENST00000423557.1:c.312C>T	1.37:g.206944318G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000423557.1	37	CCDS1467.1																																																																																				0.552	IL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088564.3		NM_000572	
IL36B	27177	hgsc.bcm.edu;ucsc.edu	37	2	113788714	113788714	+	Missense_Mutation	SNP	G	G	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr2:113788714G>C	ENST00000259213.4	-	3	139	c.32C>G	c.(31-33)tCc>tGc	p.S11C	IL36B_ENST00000327407.2_Missense_Mutation_p.S11C	NM_014438.3	NP_055253.2	Q9NZH7	IL36B_HUMAN	interleukin 36, beta	11					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)			kidney(1)|ovary(1)|pancreas(1)	3						AATAGCATAGGATTTGGGTGC	0.463																																																	0													100.0	89.0	93.0					2																	113788714		2203	4300	6503	SO:0001583	missense	0			AF201833	CCDS2109.1, CCDS2110.1	2q14	2011-07-14	2011-06-06	2011-06-06	ENSG00000136696	ENSG00000136696		"""Interleukins and interleukin receptors"""	15564	protein-coding gene	gene with protein product		605508	"""interleukin 1 family, member 8 (eta)"""	IL1F8		10625660, 10512743, 16646978	Standard	NM_173178		Approved	FIL1, IL-1H2, IL-1F8, FILI-(ETA), IL1-ETA, IL1H2, MGC126880, MGC126882	uc002tiq.1	Q9NZH7	OTTHUMG00000131338	ENST00000259213.4:c.32C>G	2.37:g.113788714G>C	ENSP00000259213:p.Ser11Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q3MIH0|Q53SR6|Q7RTZ7|Q9UHA5	Missense_Mutation	SNP	ENST00000259213.4	37	CCDS2109.1	.	.	.	.	.	.	.	.	.	.	g	9.030	0.986960	0.18889	.	.	ENSG00000136696	ENST00000259213;ENST00000327407	T;T	0.17528	2.27;2.27	3.21	-6.43	0.01926	.	5.467410	0.00166	N	0.000003	T	0.18964	0.0455	L	0.34521	1.04	0.09310	N	1	P;B	0.46512	0.879;0.0	P;B	0.55161	0.77;0.001	T	0.38265	-0.9669	10	0.40728	T	0.16	.	1.4437	0.02360	0.1639:0.126:0.3105:0.3997	.	11;11	Q9NZH7-2;Q9NZH7	.;IL36B_HUMAN	C	11	ENSP00000259213:S11C;ENSP00000328420:S11C	ENSP00000259213:S11C	S	-	2	0	IL36B	113505185	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.366000	0.01078	-2.607000	0.00447	-1.318000	0.01297	TCC		0.463	IL36B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254110.1		NM_014438	
KDM5B	10765	hgsc.bcm.edu;ucsc.edu	37	1	202710756	202710756	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr1:202710756delT	ENST00000367265.3	-	19	3848	c.2684delA	c.(2683-2685)gatfs	p.D895fs	KDM5B_ENST00000367264.2_Frame_Shift_Del_p.D931fs	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	895					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						AAAGCTGACATCTAGCAAGTC	0.463																																																	0													89.0	82.0	85.0					1																	202710756		2203	4300	6503	SO:0001589	frameshift_variant	10765			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.2684delA	1.37:g.202710756delT	ENSP00000356234:p.Asp895fs	Somatic		WXS	Illumina HiSeq	Phase_I	O95811|Q15752|Q9Y3Q5	Frame_Shift_Del	DEL	ENST00000367265.3	37	CCDS30974.1																																																																																				0.463	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2		NM_006618	
EPG5	57724	hgsc.bcm.edu;ucsc.edu	37	18	43440143	43440143	+	Missense_Mutation	SNP	G	G	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr18:43440143G>T	ENST00000282041.5	-	40	6969	c.6935C>A	c.(6934-6936)gCc>gAc	p.A2312D	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2312					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GCTCTGGCAGGCTGCTGTTAA	0.547																																																	0													70.0	74.0	73.0					18																	43440143		1974	4156	6130	SO:0001583	missense	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.6935C>A	18.37:g.43440143G>T	ENSP00000282041:p.Ala2312Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.417680	0.83449	.	.	ENSG00000152223	ENST00000282041;ENST00000540322;ENST00000308403	T	0.14893	2.47	5.59	5.59	0.84812	.	.	.	.	.	T	0.32315	0.0825	L	0.59436	1.845	0.54753	D	0.999982	P	0.44478	0.836	P	0.49922	0.626	T	0.01504	-1.1338	9	0.72032	D	0.01	-9.4549	19.5918	0.95518	0.0:0.0:1.0:0.0	.	2312	Q9HCE0	EPG5_HUMAN	D	2312;240;1187	ENSP00000282041:A2312D	ENSP00000282041:A2312D	A	-	2	0	EPG5	41694141	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	5.510000	0.67018	2.608000	0.88229	0.655000	0.94253	GCC		0.547	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1		NM_020964	
KIF3B	9371	hgsc.bcm.edu;ucsc.edu	37	20	30898460	30898460	+	Missense_Mutation	SNP	G	G	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr20:30898460G>T	ENST00000375712.3	+	2	1047	c.880G>T	c.(880-882)Gac>Tac	p.D294Y	KIF3B_ENST00000418717.2_5'UTR	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	294	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TCCATATCGGGACTCAAAGCT	0.502																																																	0													78.0	72.0	74.0					20																	30898460		2203	4300	6503	SO:0001583	missense	9371			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.880G>T	20.37:g.30898460G>T	ENSP00000364864:p.Asp294Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RMP4|B4DSR5|E1P5M5	Missense_Mutation	SNP	ENST00000375712.3	37	CCDS13200.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759877	0.69763	.	.	ENSG00000101350	ENST00000375712	T	0.81330	-1.48	4.52	4.52	0.55395	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.94358	0.8186	H	0.99286	4.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.97053	0.9765	10	0.87932	D	0	.	17.4488	0.87586	0.0:0.0:1.0:0.0	.	294;294	B4DYF2;O15066	.;KIF3B_HUMAN	Y	294	ENSP00000364864:D294Y	ENSP00000364864:D294Y	D	+	1	0	KIF3B	30362121	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.657000	0.98554	2.336000	0.79503	0.462000	0.41574	GAC		0.502	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078619.1		NM_004798	
LAMC1	3915	hgsc.bcm.edu;ucsc.edu	37	1	183094629	183094629	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr1:183094629delC	ENST00000258341.4	+	15	3002	c.2745delC	c.(2743-2745)gacfs	p.D915fs	LAMC1_ENST00000466964.1_3'UTR	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	915	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						CTGGCCAGGACTGTGGTGCTT	0.512																																																	0													159.0	119.0	133.0					1																	183094629		2203	4300	6503	SO:0001589	frameshift_variant	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2745delC	1.37:g.183094629delC	ENSP00000258341:p.Asp915fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VYE7	Frame_Shift_Del	DEL	ENST00000258341.4	37	CCDS1351.1																																																																																				0.512	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2		NM_002293	
LEP	3952	hgsc.bcm.edu;ucsc.edu	37	7	127894682	127894682	+	Missense_Mutation	SNP	G	G	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr7:127894682G>A	ENST00000308868.4	+	3	421	c.370G>A	c.(370-372)Ggc>Agc	p.G124S		NM_000230.2	NP_000221.1	P41159	LEP_HUMAN	leptin	124					adipose tissue development (GO:0060612)|adult feeding behavior (GO:0008343)|bile acid metabolic process (GO:0008206)|bone mineralization involved in bone maturation (GO:0035630)|cellular response to L-ascorbic acid (GO:0071298)|cellular response to retinoic acid (GO:0071300)|central nervous system neuron development (GO:0021954)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|eating behavior (GO:0042755)|energy reserve metabolic process (GO:0006112)|fatty acid beta-oxidation (GO:0006635)|female pregnancy (GO:0007565)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process (GO:0006114)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|leptin-mediated signaling pathway (GO:0033210)|leukocyte tethering or rolling (GO:0050901)|negative regulation of apoptotic process (GO:0043066)|negative regulation of appetite (GO:0032099)|negative regulation of cartilage development (GO:0061037)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of glutamine transport (GO:2000486)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vasoconstriction (GO:0045906)|ovulation from ovarian follicle (GO:0001542)|placenta development (GO:0001890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of developmental growth (GO:0048639)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of ion transport (GO:0043270)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of blood pressure (GO:0008217)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis (GO:0006111)|regulation of insulin secretion (GO:0050796)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of lipoprotein lipid oxidation (GO:0060587)|regulation of steroid biosynthetic process (GO:0050810)|response to dietary excess (GO:0002021)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to vitamin E (GO:0033197)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)				endometrium(1)|large_intestine(2)|lung(5)	8						CTGGGCCAGTGGCCTGGAGAC	0.592																																																	0													48.0	49.0	49.0					7																	127894682		2203	4300	6503	SO:0001583	missense	3952				CCDS5800.1	7q31	2008-03-06	2008-03-06		ENSG00000174697	ENSG00000174697			6553	protein-coding gene	gene with protein product		164160	"""leptin (murine obesity homolog)"", ""leptin (obesity homolog, mouse)"""	OBS, OB		1686014, 16932309	Standard	NM_000230		Approved		uc003vml.2	P41159	OTTHUMG00000157564	ENST00000308868.4:c.370G>A	7.37:g.127894682G>A	ENSP00000312652:p.Gly124Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O15158|Q56A88	Missense_Mutation	SNP	ENST00000308868.4	37	CCDS5800.1	.	.	.	.	.	.	.	.	.	.	G	8.603	0.887267	0.17540	.	.	ENSG00000174697	ENST00000308868	T	0.72167	-0.63	5.76	2.82	0.32997	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.716733	0.13112	N	0.412877	T	0.63295	0.2499	L	0.54323	1.7	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.21546	0.035;0.035	T	0.52223	-0.8604	10	0.33940	T	0.23	-28.7053	7.2538	0.26164	0.2964:0.0:0.7036:0.0	.	124;124	A4D0Y8;P41159	.;LEP_HUMAN	S	124	ENSP00000312652:G124S	ENSP00000312652:G124S	G	+	1	0	LEP	127681918	0.010000	0.17322	0.000000	0.03702	0.106000	0.19336	1.235000	0.32671	0.287000	0.22375	0.655000	0.94253	GGC		0.592	LEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349174.1			
MIER1	57708	hgsc.bcm.edu;ucsc.edu	37	1	67442342	67442342	+	Missense_Mutation	SNP	A	A	G	rs566119936		TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr1:67442342A>G	ENST00000355356.3	+	11	1156	c.1007A>G	c.(1006-1008)tAt>tGt	p.Y336C	MIER1_ENST00000357692.2_Missense_Mutation_p.Y353C|MIER1_ENST00000355977.6_Missense_Mutation_p.Y273C|MIER1_ENST00000371016.1_Missense_Mutation_p.Y353C|MIER1_ENST00000401042.3_Missense_Mutation_p.Y336C|MIER1_ENST00000401041.1_Missense_Mutation_p.Y389C|MIER1_ENST00000371018.3_Missense_Mutation_p.Y353C|MIER1_ENST00000371014.1_Missense_Mutation_p.Y389C	NM_001077701.2|NM_001077704.2	NP_001071169.1|NP_001071172.1	Q8N108	MIER1_HUMAN	mesoderm induction early response 1, transcriptional regulator	336					positive regulation of chromatin silencing (GO:0031937)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(3)	15						TCTGAACGTTATGATTTCTTT	0.338																																																	0													104.0	101.0	102.0					1																	67442342		1877	4130	6007	SO:0001583	missense	57708				CCDS41347.1, CCDS41348.1, CCDS53325.1, CCDS53326.1, CCDS53327.1, CCDS53328.1, CCDS53329.1, CCDS53330.1, CCDS60163.1	1p31.2	2013-07-23	2013-07-23		ENSG00000198160	ENSG00000198160			29657	protein-coding gene	gene with protein product			"""mesoderm induction early response 1 homolog (Xenopus laevis)"""			12242014, 12482978	Standard	NM_020948		Approved	hMI-ER1, MI-ER1, KIAA1610	uc001dde.2	Q8N108	OTTHUMG00000009194	ENST00000355356.3:c.1007A>G	1.37:g.67442342A>G	ENSP00000347514:p.Tyr336Cys	Somatic		WXS	Illumina HiSeq	Phase_I	C9JFD4|Q08AE0|Q32NC4|Q5T104|Q5TAD1|Q5TAD2|Q5TAD4|Q5TAD5|Q6AHY8|Q86TB4|Q8N156|Q8N161|Q8NC37|Q8NES4|Q8NES5|Q8NES6|Q8WWG2|Q9HCG2	Missense_Mutation	SNP	ENST00000355356.3	37	CCDS41348.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.423270	0.83559	.	.	ENSG00000198160	ENST00000371017;ENST00000371018;ENST00000355977;ENST00000357692;ENST00000401041;ENST00000371016;ENST00000371014;ENST00000401042;ENST00000355356	T;T;T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2	5.53	5.53	0.82687	Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.74665	0.3746	M	0.85197	2.74	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.96;0.997;0.998;0.997;0.994;0.997;0.999;0.96;0.971	T	0.79974	-0.1577	10	0.87932	D	0	-42.8571	15.9763	0.80066	1.0:0.0:0.0:0.0	.	353;353;336;336;273;360;353;389;389	Q5TAD2;Q32NC4;Q8N108-3;Q8N108-6;Q08AE0;Q8N108;Q8N108-10;Q5TAD5;Q5TAD4	.;.;.;.;.;MIER1_HUMAN;.;.;.	C	357;353;273;353;389;353;389;336;336	ENSP00000360057:Y353C;ENSP00000348253:Y273C;ENSP00000350321:Y353C;ENSP00000383820:Y389C;ENSP00000360055:Y353C;ENSP00000360053:Y389C;ENSP00000383821:Y336C;ENSP00000347514:Y336C	ENSP00000347514:Y336C	Y	+	2	0	MIER1	67214930	1.000000	0.71417	0.928000	0.36995	0.975000	0.68041	7.000000	0.76290	2.237000	0.73441	0.528000	0.53228	TAT		0.338	MIER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025491.2		NM_020948	
MYBL2	4605	hgsc.bcm.edu;ucsc.edu	37	20	42340179	42340179	+	Missense_Mutation	SNP	G	G	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr20:42340179G>T	ENST00000217026.4	+	11	1784	c.1657G>T	c.(1657-1659)Gct>Tct	p.A553S	MYBL2_ENST00000396863.4_Missense_Mutation_p.A529S	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	553					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GCGTTCTGAGGCTGGCATCGA	0.642																																																	0													76.0	62.0	66.0					20																	42340179		2203	4300	6503	SO:0001583	missense	4605				CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1657G>T	20.37:g.42340179G>T	ENSP00000217026:p.Ala553Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	37	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.388177	0.25118	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.28454	1.61;1.61	3.63	3.63	0.41609	C-myb, C-terminal (1);	0.246632	0.41605	D	0.000843	T	0.09949	0.0244	N	0.03608	-0.345	0.44085	D	0.996842	B;B	0.32526	0.191;0.374	B;B	0.27796	0.069;0.083	T	0.13926	-1.0491	10	0.18710	T	0.47	-23.598	4.6268	0.12482	0.1108:0.0:0.6693:0.22	.	529;553	F8W6N6;P10244	.;MYBB_HUMAN	S	529;553	ENSP00000380072:A529S;ENSP00000217026:A553S	ENSP00000217026:A553S	A	+	1	0	MYBL2	41773593	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	3.389000	0.52516	2.323000	0.78572	0.655000	0.94253	GCT		0.642	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1		NM_002466	
MYT1	4661	hgsc.bcm.edu;ucsc.edu	37	20	62839567	62839567	+	Missense_Mutation	SNP	T	T	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr20:62839567T>A	ENST00000328439.1	+	7	1382	c.1018T>A	c.(1018-1020)Tac>Aac	p.Y340N	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Missense_Mutation_p.Y340N	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					CAAGCCTGAGTACTCTGTTAT	0.572																																					GBM(59;481 1041 20555 21139 33705)												0													111.0	115.0	113.0					20																	62839567		2203	4300	6503	SO:0001583	missense	4661			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1018T>A	20.37:g.62839567T>A	ENSP00000327465:p.Tyr340Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	t	8.853	0.945088	0.18356	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.21361	2.01;2.01	4.6	4.6	0.57074	.	0.293386	0.28754	N	0.014259	T	0.19127	0.0459	M	0.62723	1.935	0.80722	D	1	P	0.40000	0.698	B	0.28709	0.093	T	0.05699	-1.0869	10	0.28530	T	0.3	-16.7149	14.0215	0.64558	0.0:0.0:0.0:1.0	.	340	Q01538	MYT1_HUMAN	N	340	ENSP00000327465:Y340N;ENSP00000442412:Y340N	ENSP00000327465:Y340N	Y	+	1	0	MYT1	62310011	.	.	0.917000	0.36280	0.211000	0.24417	.	.	1.724000	0.51502	0.451000	0.29950	TAC		0.572	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1		NM_004535	
NARS2	79731	hgsc.bcm.edu	37	11	78277313	78277313	+	Missense_Mutation	SNP	G	G	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr11:78277313G>T	ENST00000281038.5	-	4	753	c.378C>A	c.(376-378)ttC>ttA	p.F126L	NARS2_ENST00000528850.1_5'UTR	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	126					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	ATTTGATGGGGAAATCCTGCC	0.373																																																	0													48.0	49.0	49.0					11																	78277313		2200	4291	6491	SO:0001583	missense	79731			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.378C>A	11.37:g.78277313G>T	ENSP00000281038:p.Phe126Leu	Somatic		WXS	Illumina HiSeq	Phase_I	G3V178	Missense_Mutation	SNP	ENST00000281038.5	37	CCDS8261.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865146	0.71949	.	.	ENSG00000137513	ENST00000281038;ENST00000529880	T;T	0.74526	-0.85;1.08	5.13	4.2	0.49525	.	0.000000	0.85682	D	0.000000	D	0.84005	0.5377	M	0.86805	2.84	0.80722	D	1	D	0.69078	0.997	P	0.59171	0.853	D	0.85713	0.1320	10	0.87932	D	0	-12.8612	9.6633	0.39969	0.1659:0.0:0.8341:0.0	.	126	Q96I59	SYNM_HUMAN	L	126	ENSP00000281038:F126L;ENSP00000432240:F126L	ENSP00000281038:F126L	F	-	3	2	NARS2	77954961	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.590000	0.36654	1.259000	0.44117	0.655000	0.94253	TTC		0.373	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391138.2		NM_024678	
OR1G1	8390	hgsc.bcm.edu;ucsc.edu	37	17	3030271	3030271	+	Missense_Mutation	SNP	G	G	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr17:3030271G>C	ENST00000328890.2	-	1	604	c.575C>G	c.(574-576)cCc>cGc	p.P192R		NM_003555.1	NP_003546.1	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G, member 1	192					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(3)|skin(3)	11						ATTGGTGAAGGGGTCTGTGCA	0.498																																					Colon(127;1481 1654 8243 19426 50557)												0													124.0	120.0	121.0					17																	3030271		2203	4300	6503	SO:0001583	missense	8390			U04689	CCDS11020.1	17p13.3	2012-08-09			ENSG00000183024	ENSG00000183024		"""GPCR / Class A : Olfactory receptors"""	8204	protein-coding gene	gene with protein product				OR1G2		8004088, 9500546	Standard	NM_003555		Approved	OR17-209	uc002fvc.1	P47890	OTTHUMG00000090618	ENST00000328890.2:c.575C>G	17.37:g.3030271G>C	ENSP00000331545:p.Pro192Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VBM1|Q6IFL9|Q9UM76	Missense_Mutation	SNP	ENST00000328890.2	37	CCDS11020.1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.581734	0.28180	.	.	ENSG00000183024	ENST00000328890	T	0.00115	8.71	4.53	2.43	0.29744	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.26092	0.79	0.09310	N	1	B	0.22604	0.072	B	0.16722	0.016	T	0.25152	-1.0140	9	0.87932	D	0	.	5.6205	0.17455	0.0952:0.0:0.56:0.3447	.	192	P47890	OR1G1_HUMAN	R	192	ENSP00000331545:P192R	ENSP00000331545:P192R	P	-	2	0	OR1G1	2977021	0.001000	0.12720	0.005000	0.12908	0.380000	0.30137	0.851000	0.27751	1.132000	0.42129	0.523000	0.50628	CCC		0.498	OR1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207206.2			
OR1M1	125963	hgsc.bcm.edu;ucsc.edu	37	19	9203934	9203934	+	Missense_Mutation	SNP	A	A	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr19:9203934A>T	ENST00000429566.3	+	1	80	c.14A>T	c.(13-15)aAc>aTc	p.N5I		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	5						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						GAACCAAGAAACCAAACCAGT	0.478																																																	0													82.0	76.0	78.0					19																	9203934		2203	4300	6503	SO:0001583	missense	125963				CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.14A>T	19.37:g.9203934A>T	ENSP00000401966:p.Asn5Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	ENST00000429566.3	37	CCDS32896.1	.	.	.	.	.	.	.	.	.	.	a	12.90	2.076221	0.36662	.	.	ENSG00000170929	ENST00000305465;ENST00000429566	T	0.02197	4.4	3.31	3.31	0.37934	.	0.000000	0.64402	D	0.000010	T	0.18257	0.0438	H	0.96720	3.87	0.09310	N	0.999999	D	0.71674	0.998	D	0.78314	0.991	T	0.13150	-1.0520	10	0.87932	D	0	.	9.9536	0.41653	1.0:0.0:0.0:0.0	.	5	Q8NGA1	OR1M1_HUMAN	I	8;5	ENSP00000401966:N5I	ENSP00000303195:N8I	N	+	2	0	OR1M1	9064934	0.249000	0.23941	0.048000	0.18961	0.008000	0.06430	1.687000	0.37680	1.502000	0.48669	0.329000	0.21502	AAC		0.478	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448993.1			
OVGP1	5016	hgsc.bcm.edu	37	1	111957523	111957524	+	In_Frame_Ins	INS	-	-	GGTCAGGGTCTTCTGTCCAGT	rs3767608|rs201350653		TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr1:111957523_111957524insGGTCAGGGTCTTCTGTCCAGT	ENST00000369732.3	-	11	1654_1655	c.1599_1600insACTGGACAGAAGACCCTGACC	c.(1597-1602)acccct>accACTGGACAGAAGACCCTGACCcct	p.532_533insTTGQKTL		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	532					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)	p.T597_V604delTPVSHQSV(2)|p.T533_V540delTPVSHQSV(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		TGACTCACAGGGGTCACAGACT	0.535																																																	4	Deletion - In frame(4)	haematopoietic_and_lymphoid_tissue(2)|stomach(2)																																								SO:0001652	inframe_insertion	5016			U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1599_1600insACTGGACAGAAGACCCTGACC	1.37:g.111957523_111957524insGGTCAGGGTCTTCTGTCCAGT	ENSP00000358747:p.Val532_Thr533insThrThrGlyGlnLysThrLeu	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV19|B9EGE1|Q15841	In_Frame_Ins	INS	ENST00000369732.3	37	CCDS834.1																																																																																				0.535	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1		NM_002557	
PABPC3	5042	hgsc.bcm.edu;ucsc.edu	37	13	25670499	25670499	+	Missense_Mutation	SNP	G	G	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr13:25670499G>A	ENST00000281589.3	+	1	200	c.163G>A	c.(163-165)Gcg>Acg	p.A55T		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	55	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		CTCCAACTACGCGTATGTGAA	0.547																																																	0													85.0	79.0	81.0					13																	25670499		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.163G>A	13.37:g.25670499G>A	ENSP00000281589:p.Ala55Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971112	0.53614	.	.	ENSG00000151846	ENST00000281589	T	0.14640	2.49	0.546	-0.466	0.12153	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.39341	U	0.001394	T	0.35189	0.0923	H	0.94808	3.585	0.42444	D	0.992721	D	0.62365	0.991	P	0.59424	0.857	T	0.12708	-1.0537	10	0.87932	D	0	.	4.571	0.12210	0.3012:0.0:0.6988:0.0	.	55	Q9H361	PABP3_HUMAN	T	55	ENSP00000281589:A55T	ENSP00000281589:A55T	A	+	1	0	PABPC3	24568499	1.000000	0.71417	0.111000	0.21465	0.125000	0.20455	6.590000	0.74085	-0.264000	0.09365	0.305000	0.20034	GCG		0.547	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2		NM_030979	
PAK6	56924	hgsc.bcm.edu;ucsc.edu	37	15	40568170	40568170	+	Missense_Mutation	SNP	C	C	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr15:40568170C>T	ENST00000542403.2	+	9	2032	c.1921C>T	c.(1921-1923)Cgg>Tgg	p.R641W	RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000455577.2_Missense_Mutation_p.R596W|PAK6_ENST00000453867.1_Missense_Mutation_p.R641W|PAK6_ENST00000260404.4_Missense_Mutation_p.R641W|PAK6_ENST00000560346.1_Missense_Mutation_p.R641W|PAK6_ENST00000441369.1_Missense_Mutation_p.R641W	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	641	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		GATGCTGGTGCGGGACCCCCA	0.612																																																	0													101.0	104.0	103.0					15																	40568170		2203	4300	6503	SO:0001583	missense	56924			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.1921C>T	15.37:g.40568170C>T	ENSP00000439597:p.Arg641Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	ENST00000542403.2	37	CCDS10054.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860804	0.91433	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.40476	2.5;2.5;1.03;2.5;2.5	4.48	4.48	0.54585	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60025	0.2237	L	0.51914	1.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	T	0.64466	-0.6401	10	0.87932	D	0	.	17.3691	0.87371	0.0:1.0:0.0:0.0	.	641;596	Q9NQU5;G5E9R2	PAK6_HUMAN;.	W	641;641;596;641;641	ENSP00000406873:R641W;ENSP00000401153:R641W;ENSP00000409465:R596W;ENSP00000260404:R641W;ENSP00000439597:R641W	ENSP00000260404:R641W	R	+	1	2	PAK6	38355462	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.700000	0.61803	2.322000	0.78497	0.561000	0.74099	CGG		0.612	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1			
PDCL	5082	hgsc.bcm.edu;ucsc.edu	37	9	125585437	125585437	+	Missense_Mutation	SNP	T	T	G			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr9:125585437T>G	ENST00000259467.4	-	3	377	c.212A>C	c.(211-213)cAg>cCg	p.Q71P		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	71					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						TGTCTCCAACTGCTTGAAGCG	0.542																																																	0													187.0	169.0	175.0					9																	125585437		2203	4300	6503	SO:0001583	missense	5082			AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.212A>C	9.37:g.125585437T>G	ENSP00000259467:p.Gln71Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Missense_Mutation	SNP	ENST00000259467.4	37	CCDS6845.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.790767	0.90367	.	.	ENSG00000136940	ENST00000259467	T	0.14640	2.49	5.98	5.98	0.97165	Thioredoxin-like fold (1);Phosducin, thioredoxin-like domain (1);Phosducin, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.40119	0.1104	M	0.79123	2.44	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.995	T	0.27088	-1.0084	10	0.87932	D	0	-25.6362	15.6496	0.77081	0.0:0.0:0.0:1.0	.	71;71	Q4VXB6;Q13371	.;PHLP_HUMAN	P	71	ENSP00000259467:Q71P	ENSP00000259467:Q71P	Q	-	2	0	PDCL	124625258	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.601000	0.82783	2.289000	0.77006	0.460000	0.39030	CAG		0.542	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053956.1		NM_005388	
PLB1	151056	hgsc.bcm.edu;ucsc.edu	37	2	28851970	28851970	+	Missense_Mutation	SNP	G	G	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr2:28851970G>A	ENST00000327757.5	+	53	3780	c.3736G>A	c.(3736-3738)Gct>Act	p.A1246T	PLB1_ENST00000541605.1_Missense_Mutation_p.A211T|PLB1_ENST00000422425.2_Missense_Mutation_p.A1235T	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	1246	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GCTCCCAAGGGCTTTCGTCAA	0.592																																																	0													87.0	69.0	75.0					2																	28851970		2203	4300	6503	SO:0001583	missense	151056				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.3736G>A	2.37:g.28851970G>A	ENSP00000330442:p.Ala1246Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	G	2.460	-0.324390	0.05350	.	.	ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000541605	T;T;T	0.12147	2.71;2.71;2.71	5.75	0.213	0.15244	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);	0.627834	0.15720	N	0.247923	T	0.06371	0.0164	N	0.17474	0.49	0.09310	N	1	B;B	0.29590	0.25;0.243	B;B	0.28709	0.093;0.078	T	0.42241	-0.9463	10	0.07644	T	0.81	-3.4934	8.6368	0.33953	0.4883:0.0:0.5117:0.0	.	1235;1246	Q6P1J6-3;Q6P1J6	.;PLB1_HUMAN	T	1246;1235;211	ENSP00000330442:A1246T;ENSP00000416440:A1235T;ENSP00000437426:A211T	ENSP00000330442:A1246T	A	+	1	0	PLB1	28705474	0.001000	0.12720	0.022000	0.16811	0.356000	0.29392	-0.396000	0.07278	-0.010000	0.14271	-1.193000	0.01689	GCT		0.592	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2			
PLCG1	5335	hgsc.bcm.edu;ucsc.edu	37	20	39802104	39802104	+	Silent	SNP	G	G	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr20:39802104G>A	ENST00000373271.1	+	28	3729	c.3324G>A	c.(3322-3324)gtG>gtA	p.V1108V	PLCG1_ENST00000373272.2_Silent_p.V1108V|PLCG1_ENST00000244007.3_Silent_p.V1108V|PLCG1_ENST00000608689.1_3'UTR	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	1108	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				GAGGCATTGTGTGTCCTTTTG	0.552											OREG0025953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													125.0	109.0	114.0					20																	39802104		2203	4300	6503	SO:0001819	synonymous_variant	5335			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.3324G>A	20.37:g.39802104G>A		Somatic	888	WXS	Illumina HiSeq	Phase_I	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Silent	SNP	ENST00000373271.1	37	CCDS13314.1																																																																																				0.552	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3		NM_182811	
PRUNE2	158471	hgsc.bcm.edu;ucsc.edu	37	9	79324116	79324116	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr9:79324116G>C	ENST00000376718.3	-	8	3197	c.3074C>G	c.(3073-3075)tCa>tGa	p.S1025*	PRUNE2_ENST00000428286.1_Nonsense_Mutation_p.S666*	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1025					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CCCAGGACCTGAACTGATTCG	0.443																																																	0													131.0	104.0	112.0					9																	79324116		1568	3582	5150	SO:0001587	stop_gained	158471			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.3074C>G	9.37:g.79324116G>C	ENSP00000365908:p.Ser1025*	Somatic		WXS	Illumina HiSeq	Phase_I	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Nonsense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.464743|6.464743	0.97590|0.97590	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000426088|ENST00000376718;ENST00000428286;ENST00000422033	.|.	.|.	.|.	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	.|0.000000	.|0.46442	.|D	.|0.000291	T|.	0.78227|.	0.4250|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.79398|.	-0.1820|.	4|.	.|0.87932	.|D	.|0	-13.9129|-13.9129	18.5438|18.5438	0.91039|0.91039	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	346|1025;666;1024	.|.	.|ENSP00000365908:S1025X	F|S	-|-	3|2	2|0	PRUNE2|PRUNE2	78513936|78513936	0.980000|0.980000	0.34600|0.34600	0.977000|0.977000	0.42913|0.42913	0.709000|0.709000	0.40893|0.40893	3.640000|3.640000	0.54350|0.54350	2.826000|2.826000	0.97356|0.97356	0.561000|0.561000	0.74099|0.74099	TTC|TCA		0.443	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2		NM_138818	
QSER1	79832	hgsc.bcm.edu;ucsc.edu	37	11	32953537	32953537	+	Missense_Mutation	SNP	G	G	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr11:32953537G>C	ENST00000399302.2	+	4	681	c.346G>C	c.(346-348)Gag>Cag	p.E116Q	QSER1_ENST00000527250.1_3'UTR|QSER1_ENST00000527788.1_Missense_Mutation_p.E116Q	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	116										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TTTGGCATTTGAGCGCCTGGG	0.423																																																	0													129.0	124.0	126.0					11																	32953537		1893	4121	6014	SO:0001583	missense	79832			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.346G>C	11.37:g.32953537G>C	ENSP00000382241:p.Glu116Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.045696	0.55110	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.48201	0.82;0.82	5.48	4.54	0.55810	.	0.000000	0.64402	D	0.000004	T	0.60728	0.2291	L	0.60455	1.87	0.18873	N	0.999988	D;D	0.67145	0.996;0.993	P;P	0.61477	0.889;0.777	T	0.53443	-0.8438	10	0.36615	T	0.2	.	15.6904	0.77446	0.0:0.0:0.8627:0.1373	.	116;116	Q2KHR3-2;Q2KHR3	.;QSER1_HUMAN	Q	116	ENSP00000382241:E116Q;ENSP00000432766:E116Q	ENSP00000078652:E116Q	E	+	1	0	QSER1	32910113	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.703000	0.68340	2.579000	0.87056	0.655000	0.94253	GAG		0.423	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1		NM_024774	
RAD51AP2	729475	hgsc.bcm.edu;ucsc.edu	37	2	17697759	17697759	+	Missense_Mutation	SNP	T	T	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr2:17697759T>A	ENST00000399080.2	-	1	1947	c.1924A>T	c.(1924-1926)Aat>Tat	p.N642Y		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	642										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GGTTTCATATTATCTTCTAAT	0.269																																																	0													18.0	16.0	17.0					2																	17697759		1755	3986	5741	SO:0001583	missense	729475			AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.1924A>T	2.37:g.17697759T>A	ENSP00000382030:p.Asn642Tyr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000399080.2	37	CCDS42656.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.849795	0.32699	.	.	ENSG00000214842	ENST00000399080	T	0.28895	1.59	4.19	3.03	0.35002	.	.	.	.	.	T	0.24851	0.0603	L	0.27053	0.805	0.09310	N	1	D	0.54207	0.965	P	0.47981	0.563	T	0.06516	-1.0822	9	0.48119	T	0.1	-0.0803	5.8469	0.18671	0.1477:0.0866:0.0:0.7657	.	642	Q09MP3	R51A2_HUMAN	Y	642	ENSP00000382030:N642Y	ENSP00000382030:N642Y	N	-	1	0	RAD51AP2	17561240	0.001000	0.12720	0.001000	0.08648	0.883000	0.51084	0.602000	0.24134	0.738000	0.32606	0.378000	0.23410	AAT		0.269	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3		NM_001099218	
RLF	6018	hgsc.bcm.edu;ucsc.edu	37	1	40705015	40705015	+	Silent	SNP	A	A	G	rs1044739		TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr1:40705015A>G	ENST00000372771.4	+	8	4668	c.4641A>G	c.(4639-4641)acA>acG	p.T1547T		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1547				HTQ -> LSL (in Ref. 1; AAC50396). {ECO:0000305}.	chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			CTGAGCACACACAGTACCCCT	0.443																																																	0													99.0	104.0	102.0					1																	40705015		2202	4298	6500	SO:0001819	synonymous_variant	6018				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.4641A>G	1.37:g.40705015A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q14CQ1|Q9NU60	Silent	SNP	ENST00000372771.4	37	CCDS448.1																																																																																				0.443	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1		NM_012421	
RTTN	25914	hgsc.bcm.edu;ucsc.edu	37	18	67684795	67684795	+	Missense_Mutation	SNP	T	T	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr18:67684795T>A	ENST00000255674.6	-	46	6555	c.6269A>T	c.(6268-6270)gAt>gTt	p.D2090V	RTTN_ENST00000579986.1_5'Flank|RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	2090					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				TTGTTGCCCATCTTCTCCAGA	0.393																																																	0													148.0	142.0	144.0					18																	67684795		1893	4121	6014	SO:0001583	missense	25914			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.6269A>T	18.37:g.67684795T>A	ENSP00000255674:p.Asp2090Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	ENST00000255674.6	37	CCDS42443.1	.	.	.	.	.	.	.	.	.	.	T	15.99	2.996552	0.54147	.	.	ENSG00000176225	ENST00000255674	T	0.52057	0.68	5.52	5.52	0.82312	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62417	0.2426	L	0.48642	1.525	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.65307	-0.6200	10	0.87932	D	0	.	15.932	0.79668	0.0:0.0:0.0:1.0	.	2090	Q86VV8	RTTN_HUMAN	V	2090	ENSP00000255674:D2090V	ENSP00000255674:D2090V	D	-	2	0	RTTN	65835775	1.000000	0.71417	0.976000	0.42696	0.155000	0.21991	6.910000	0.75741	2.222000	0.72286	0.455000	0.32223	GAT		0.393	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1		NM_173630	
SIPA1L3	23094	hgsc.bcm.edu;ucsc.edu	37	19	38609984	38609984	+	Missense_Mutation	SNP	G	G	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr19:38609984G>C	ENST00000222345.6	+	9	2839	c.2330G>C	c.(2329-2331)gGc>gCc	p.G777A		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	777	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)	p.G777A(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCTCCTTTCGGCCCCCCCATC	0.532																																																	1	Substitution - Missense(1)	kidney(1)											66.0	73.0	71.0					19																	38609984		2203	4300	6503	SO:0001583	missense	23094			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.2330G>C	19.37:g.38609984G>C	ENSP00000222345:p.Gly777Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	37	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736543	0.89482	.	.	ENSG00000105738	ENST00000222345	D	0.94966	-3.57	5.22	5.22	0.72569	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.97623	0.9221	M	0.91561	3.22	0.80722	D	1	P	0.50617	0.937	P	0.62298	0.9	D	0.98212	1.0473	10	0.72032	D	0.01	-44.3645	17.7273	0.88369	0.0:0.0:1.0:0.0	.	777	O60292	SI1L3_HUMAN	A	777	ENSP00000222345:G777A	ENSP00000222345:G777A	G	+	2	0	SIPA1L3	43301824	1.000000	0.71417	0.992000	0.48379	0.980000	0.70556	7.717000	0.84732	2.725000	0.93324	0.655000	0.94253	GGC		0.532	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2		XM_032278	
SLC37A4	2542	hgsc.bcm.edu;ucsc.edu	37	11	118899998	118899998	+	Missense_Mutation	SNP	G	G	A	rs193302882		TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr11:118899998G>A	ENST00000545985.1	-	3	838	c.82C>T	c.(82-84)Cgc>Tgc	p.R28C	SLC37A4_ENST00000357590.5_Missense_Mutation_p.R28C|SLC37A4_ENST00000525102.1_5'UTR|SLC37A4_ENST00000330775.7_Missense_Mutation_p.R28C|SLC37A4_ENST00000538950.1_Intron	NM_001164277.1|NM_001467.5	NP_001157749.1|NP_001458.1	O43826	G6PT1_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 4	28			R -> C (in GSD1B; dbSNP:rs193302882). {ECO:0000269|PubMed:9758626}.|R -> H (in GSD1B; inactive glucose-6- phosphate transport; dbSNP:rs121908978). {ECO:0000269|PubMed:10026167, ECO:0000269|PubMed:11949931}.		carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphate transmembrane transporter activity (GO:0015152)|transporter activity (GO:0005215)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|prostate(1)	6	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		AAGGTCTTGCGATTGAAGTAA	0.522																																																	0													96.0	96.0	96.0					11																	118899998		2047	4191	6238	SO:0001583	missense	2542			Y15409		11q23.3	2014-09-17	2007-03-28	2003-09-10		ENSG00000137700		"""Solute carriers"""	4061	protein-coding gene	gene with protein product		602671	"""glucose-6-phosphatase, transport (glucose-6-phosphate) protein 1"""	G6PT1, G6PT2, G6PT3		9428641, 9463334	Standard	NM_001164277		Approved	GSD1b, GSD1c, GSD1d	uc010ryt.1	O43826		ENST00000545985.1:c.82C>T	11.37:g.118899998G>A	ENSP00000475241:p.Arg28Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O96016|Q5J7V4|Q9UI19|Q9UNS4	Missense_Mutation	SNP	ENST00000545985.1	37																																																																																					0.522	SLC37A4-204	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001467	
SNX29	92017	hgsc.bcm.edu;ucsc.edu	37	16	12155455	12155455	+	Missense_Mutation	SNP	T	T	C			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr16:12155455T>C	ENST00000566228.1	+	9	1264	c.1195T>C	c.(1195-1197)Tcc>Ccc	p.S399P	SNX29_ENST00000323433.4_Missense_Mutation_p.S14P|SNX29_ENST00000306030.3_Missense_Mutation_p.S14P	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	399						extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						GCACAATGACTCCGACATCCT	0.567																																																	0													43.0	48.0	46.0					16																	12155455		2189	4290	6479	SO:0001583	missense	92017			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.1195T>C	16.37:g.12155455T>C	ENSP00000456480:p.Ser399Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	ENST00000566228.1	37	CCDS10553.2	.	.	.	.	.	.	.	.	.	.	T	11.16	1.556101	0.27827	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	.	.	.	5.7	-9.61	0.00550	.	.	.	.	.	T	0.23926	0.0579	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	8	0.66056	D	0.02	0.0649	0.5636	0.00683	0.3189:0.1594:0.1365:0.3852	.	399	Q8TEQ0	SNX29_HUMAN	P	14	.	ENSP00000306940:S14P	S	+	1	0	SNX29	12062956	0.000000	0.05858	0.000000	0.03702	0.160000	0.22226	-0.349000	0.07731	-1.338000	0.02233	0.533000	0.62120	TCC		0.567	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422622.1			
STX1A	6804	hgsc.bcm.edu;ucsc.edu	37	7	73123410	73123410	+	Missense_Mutation	SNP	C	C	G			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr7:73123410C>G	ENST00000222812.3	-	2	99	c.73G>C	c.(73-75)Gac>Cac	p.D25H	STX1A_ENST00000395156.3_Missense_Mutation_p.D25H|STX1A_ENST00000395154.3_Missense_Mutation_p.D25H|STX1A_ENST00000395155.3_Missense_Mutation_p.D25H|MIR4284_ENST00000578924.1_RNA	NM_004603.3	NP_004594.1	Q16623	STX1A_HUMAN	syntaxin 1A (brain)	25					calcium ion-dependent exocytosis (GO:0017156)|cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|neurotransmitter secretion (GO:0007269)|positive regulation of exocytosis (GO:0045921)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of insulin secretion (GO:0050796)|response to gravity (GO:0009629)|secretion by cell (GO:0032940)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)	actomyosin (GO:0042641)|cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|SNARE complex (GO:0031201)|synaptic vesicle membrane (GO:0030672)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin II complex (GO:0070033)	calcium channel inhibitor activity (GO:0019855)			large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(55;0.0908)|all_lung(88;0.198)				CGGTCTCGGTCCACGGTGACA	0.587																																																	0													201.0	162.0	175.0					7																	73123410		2203	4300	6503	SO:0001583	missense	6804				CCDS34655.1, CCDS55120.1	7q11.2	2008-07-18			ENSG00000106089	ENSG00000106089			11433	protein-coding gene	gene with protein product		186590		STX1		1321498	Standard	NM_001165903		Approved	HPC-1, p35-1	uc003tyx.3	Q16623	OTTHUMG00000137422	ENST00000222812.3:c.73G>C	7.37:g.73123410C>G	ENSP00000222812:p.Asp25His	Somatic		WXS	Illumina HiSeq	Phase_I	O15447|O15448|Q12936|Q75MD9|Q7Z5K3|Q9BPZ6	Missense_Mutation	SNP	ENST00000222812.3	37	CCDS34655.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238449	0.79800	.	.	ENSG00000106089	ENST00000428377;ENST00000222812;ENST00000395156;ENST00000395154;ENST00000395155	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.87	4.87	0.63330	Syntaxin, N-terminal (1);	0.180500	0.46758	D	0.000269	T	0.57784	0.2077	M	0.71581	2.175	0.54753	D	0.999989	D;D;D	0.71674	0.998;0.987;0.998	P;P;P	0.57468	0.747;0.821;0.747	T	0.59161	-0.7506	10	0.40728	T	0.16	-48.3025	15.5246	0.75894	0.0:1.0:0.0:0.0	.	25;25;25	Q7Z5K3;Q16623-3;Q16623	.;.;STX1A_HUMAN	H	25	ENSP00000222812:D25H;ENSP00000378585:D25H;ENSP00000378583:D25H;ENSP00000378584:D25H	ENSP00000222812:D25H	D	-	1	0	STX1A	72761346	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.868000	0.69605	2.258000	0.74832	0.561000	0.74099	GAC		0.587	STX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268422.1		NM_004603	
ST7	7982	hgsc.bcm.edu;ucsc.edu	37	7	116849867	116849867	+	Missense_Mutation	SNP	C	C	G			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr7:116849867C>G	ENST00000393446.2	+	12	1515	c.1212C>G	c.(1210-1212)atC>atG	p.I404M	ST7_ENST00000393451.3_Missense_Mutation_p.I404M|ST7_ENST00000393447.4_Missense_Mutation_p.I384M|ST7_ENST00000432298.1_Missense_Mutation_p.I381M|ST7_ENST00000323984.3_Missense_Mutation_p.I427M|ST7_ENST00000393444.3_Missense_Mutation_p.I361M|ST7_ENST00000265437.5_Missense_Mutation_p.I427M|ST7_ENST00000422922.1_Missense_Mutation_p.I358M|ST7_ENST00000393449.1_Missense_Mutation_p.I427M|ST7_ENST00000393443.1_Missense_Mutation_p.I354M			Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		AAAGCTTAATCCTACCCCCAG	0.378																																																	0													77.0	69.0	72.0					7																	116849867		2203	4300	6503	SO:0001583	missense	7982			AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000393446.2:c.1212C>G	7.37:g.116849867C>G	ENSP00000377092:p.Ile404Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000393446.2	37		.	.	.	.	.	.	.	.	.	.	C	15.97	2.989920	0.54041	.	.	ENSG00000004866	ENST00000393446;ENST00000265437;ENST00000393451;ENST00000323984;ENST00000393449;ENST00000446490;ENST00000432298;ENST00000422922;ENST00000393443;ENST00000393447;ENST00000393444;ENST00000490039	T;T;T;T;T;T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84	5.14	3.34	0.38264	.	0.000000	0.85682	D	0.000000	T	0.46678	0.1405	M	0.80422	2.495	0.80722	D	1	D;D;D;D;D;D;D	0.67145	0.996;0.994;0.996;0.993;0.981;0.988;0.979	D;D;D;D;D;D;P	0.78314	0.991;0.973;0.991;0.923;0.936;0.977;0.905	T	0.39563	-0.9608	10	0.72032	D	0.01	-12.1332	5.3292	0.15922	0.1434:0.6127:0.0:0.2438	.	375;384;404;354;381;404;427	C9JU30;B7Z4L1;B7Z573;Q9NRC1-6;B7Z4U3;Q9NRC1-2;Q9NRC1	.;.;.;.;.;.;ST7_HUMAN	M	404;427;404;427;427;404;381;358;354;384;361;375	ENSP00000377092:I404M;ENSP00000265437:I427M;ENSP00000377097:I404M;ENSP00000325673:I427M;ENSP00000377095:I427M;ENSP00000402934:I404M;ENSP00000411118:I381M;ENSP00000414031:I358M;ENSP00000377089:I354M;ENSP00000377093:I384M;ENSP00000377090:I361M;ENSP00000419516:I375M	ENSP00000265437:I427M	I	+	3	3	ST7	116637103	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	0.546000	0.23284	0.566000	0.29273	0.561000	0.74099	ATC		0.378	ST7-013	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000319687.1		NM_021908	
TTN	7273	hgsc.bcm.edu;ucsc.edu	37	2	179667069	179667069	+	Splice_Site	SNP	C	C	T			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr2:179667069C>T	ENST00000591111.1	-	3	316		c.e3-1		TTN_ENST00000460472.2_Splice_Site|TTN_ENST00000360870.5_Splice_Site|TTN_ENST00000359218.5_Splice_Site|TTN_ENST00000342175.6_Splice_Site|TTN_ENST00000342992.6_Splice_Site|TTN_ENST00000589042.1_Splice_Site			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTGGAAAACCTGAAGAGCAA	0.502																																																	0													57.0	48.0	51.0					2																	179667069		2203	4300	6503	SO:0001630	splice_region_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.92-1G>A	2.37:g.179667069C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Splice_Site	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	26.9	4.783037	0.90282	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000412264	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.919	0.97077	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTN	179375314	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	7.629000	0.83207	2.707000	0.92482	0.655000	0.94253	.		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	Intron
UBASH3A	53347	hgsc.bcm.edu;ucsc.edu	37	21	43867186	43867186	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr21:43867186delG	ENST00000319294.6	+	15	1899	c.1868delG	c.(1867-1869)tgcfs	p.C623fs	UBASH3A_ENST00000291535.6_Frame_Shift_Del_p.C585fs|UBASH3A_ENST00000398367.1_Frame_Shift_Del_p.A513fs	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	623	Phosphatase-like.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						CTGGGCATGTGCTTCTGTGAA	0.463																																																	0													118.0	123.0	121.0					21																	43867186		2203	4300	6503	SO:0001589	frameshift_variant	53347			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.1868delG	21.37:g.43867186delG	ENSP00000317327:p.Cys623fs	Somatic		WXS	Illumina HiSeq	Phase_I	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Frame_Shift_Del	DEL	ENST00000319294.6	37	CCDS13687.1																																																																																				0.463	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195382.1		NM_001001895	
UBB	7314	hgsc.bcm.edu	37	17	16285911	16285911	+	Silent	SNP	A	A	G	rs368225113		TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr17:16285911A>G	ENST00000395837.1	+	2	871	c.690A>G	c.(688-690)taA>taG	p.*230*	UBB_ENST00000302182.3_Silent_p.*230*|RP11-138I1.4_ENST00000583934.1_RNA|UBB_ENST00000578649.1_3'UTR|UBB_ENST00000395839.1_Silent_p.*230*|UBB_ENST00000535788.1_Silent_p.*154*	NM_001281718.1|NM_001281720.1	NP_001268647.1|NP_001268649.1	P0CG47	UBB_HUMAN	ubiquitin B	0					activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		GTGGCTGTTAATTCTTCAGTC	0.488																																					Melanoma(163;1126 3406 34901)												0													28.0	27.0	27.0					17																	16285911		2203	4300	6503	SO:0001819	synonymous_variant	7314				CCDS11177.1	17p12-p11.2	2010-11-25			ENSG00000170315	ENSG00000170315			12463	protein-coding gene	gene with protein product	"""polyubiquitin B"""	191339				2154095	Standard	NM_018955		Approved	MGC8385, FLJ25987	uc002gpx.3	P0CG47	OTTHUMG00000058987	ENST00000395837.1:c.690A>G	17.37:g.16285911A>G		Somatic		WXS	Illumina HiSeq	Phase_I	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	ENST00000395837.1	37	CCDS11177.1																																																																																				0.488	UBB-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000130459.1		NM_018955	
ZNF302	55900	hgsc.bcm.edu	37	19	35175650	35175650	+	Silent	SNP	G	G	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr19:35175650G>A	ENST00000446502.2	+	6	1048	c.840G>A	c.(838-840)aaG>aaA	p.K280K	ZNF302_ENST00000505242.1_Silent_p.K236K|ZNF302_ENST00000505365.2_3'UTR|ZNF302_ENST00000423823.2_Silent_p.K236K|ZNF302_ENST00000457781.2_Silent_p.K236K			Q9NR11	ZN302_HUMAN	zinc finger protein 302	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	all_lung(56;6.16e-07)|Lung NSC(56;9.71e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			AATGTGGGAAGACTTTTAGCC	0.463																																																	0													92.0	96.0	95.0					19																	35175650		2202	4300	6502	SO:0001819	synonymous_variant	55900			AF155656	CCDS46042.1, CCDS74330.1, CCDS74331.1, CCDS74332.1, CCDS74333.1	19q13.2	2013-01-08			ENSG00000089335	ENSG00000089335		"""Zinc fingers, C2H2-type"", ""-"""	13848	protein-coding gene	gene with protein product							Standard	NM_018675		Approved	ZNF327, ZNF135L, ZNF140L	uc002nvq.1	Q9NR11	OTTHUMG00000163329	ENST00000446502.2:c.840G>A	19.37:g.35175650G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q658J3|Q9BZD8|Q9P0J4	Silent	SNP	ENST00000446502.2	37																																																																																					0.463	ZNF302-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000372731.1			
ZNF860	344787	hgsc.bcm.edu;ucsc.edu	37	3	32031883	32031883	+	Missense_Mutation	SNP	C	C	A			TCGA-DV-5565-01A-01D-1534-10	TCGA-DV-5565-10A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ee24d408-6043-4ca0-8bde-f29e798cc479	aa2bc3bd-65b8-4cc1-b6e5-ece86aa84888	g.chr3:32031883C>A	ENST00000360311.4	+	2	1861	c.1312C>A	c.(1312-1314)Cgt>Agt	p.R438S		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(4)|ovary(1)	8						TTTTAGACGTCGTTCATATCT	0.378																																																	0													122.0	109.0	113.0					3																	32031883		692	1591	2283	SO:0001583	missense	344787			AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.1312C>A	3.37:g.32031883C>A	ENSP00000373274:p.Arg438Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DFA4	Missense_Mutation	SNP	ENST00000360311.4	37	CCDS46784.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.977690	0.00452	.	.	ENSG00000197385	ENST00000360311	T	0.14391	2.51	0.131	-0.261	0.12963	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05686	0.0149	N	0.11845	0.185	0.09310	N	1	B	0.28667	0.219	B	0.19666	0.026	T	0.41197	-0.9522	8	.	.	.	.	4.7517	0.13064	0.0:0.6653:0.0:0.3347	.	438	A6NHJ4	ZN860_HUMAN	S	438	ENSP00000373274:R438S	.	R	+	1	0	ZNF860	32006887	0.000000	0.05858	0.010000	0.14722	0.010000	0.07245	-0.062000	0.11674	-1.204000	0.02648	-1.197000	0.01672	CGT		0.378	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341957.1			
