#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CYP4A22	284541	ucsc.edu	37	1	47614339	47614339	+	Missense_Mutation	SNP	G	G	A	rs377247931		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr1:47614339G>A	ENST00000371891.3	+	12	1461	c.1430G>A	c.(1429-1431)cGc>cAc	p.R477H	CYP4A22_ENST00000485117.1_3'UTR|CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Missense_Mutation_p.R379H	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	477						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R477H(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACCCTGCTCCGCTTTGAGCTG	0.567																																					p.R477H	Pancreas(88;1240 1470 2099 14214 37557)												.	CYP4A22-139	1	Substitution - Missense(1)	endometrium(1)	c.G1430A						.	G	HIS/ARG	0,4406		0,0,2203	123.0	119.0	120.0		1430	0.7	0.9	1		120	1,8599	1.2+/-3.3	0,1,4299	no	missense	CYP4A22	NM_001010969.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	477/520	47614339	1,13005	2203	4300	6503	SO:0001583	missense	284541	exon12			TGCTCCGCTTTGA		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.1430G>A	1.37:g.47614339G>A	ENSP00000360958:p.Arg477His	Somatic	212	1		WXS	Illumina HiSeq		213	3	NM_001010969	0	0	32	69	37	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	37	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	g	15.03	2.713120	0.48517	0.0	1.16E-4	ENSG00000162365	ENST00000371890;ENST00000371891	T;T	0.70045	-0.45;-0.45	1.67	0.673	0.17941	.	0.280522	0.39146	N	0.001452	T	0.46288	0.1385	N	0.21324	0.655	0.39875	D	0.973561	B	0.27951	0.195	B	0.29524	0.103	T	0.18871	-1.0323	10	0.36615	T	0.2	.	6.4299	0.21790	0.2724:0.0:0.7276:0.0	.	477	Q5TCH4	CP4AM_HUMAN	H	379;477	ENSP00000360957:R379H;ENSP00000360958:R477H	ENSP00000360957:R379H	R	+	2	0	CYP4A22	47386926	0.000000	0.05858	0.930000	0.37139	0.888000	0.51559	0.420000	0.21263	0.056000	0.16144	0.405000	0.27470	CGC	.		0.567	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
SSBP3	23648	hgsc.bcm.edu	37	1	54694017	54694017	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr1:54694017T>G	ENST00000371320.3	-	17	1458	c.1048A>C	c.(1048-1050)Aac>Cac	p.N350H	SSBP3_ENST00000417664.2_Missense_Mutation_p.N240H|SSBP3_ENST00000357475.4_Missense_Mutation_p.N330H|SSBP3_ENST00000371319.3_Missense_Mutation_p.N323H|SSBP3_ENST00000326956.7_5'UTR	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	350	Gly-rich.				head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						CCACTTATGTTGTTAGGAGAA	0.567																																					p.N350H		.											.	SSBP3-90	0			c.A1048C						.						116.0	113.0	114.0					1																	54694017		2203	4300	6503	SO:0001583	missense	23648	exon17			TTATGTTGTTAGG		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.1048A>C	1.37:g.54694017T>G	ENSP00000360371:p.Asn350His	Somatic	69	1		WXS	Illumina HiSeq	Phase_I	104	8	NM_145716	0	0	0	0	0	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	37	CCDS591.1	.	.	.	.	.	.	.	.	.	.	T	19.96	3.923912	0.73213	.	.	ENSG00000157216	ENST00000417664;ENST00000371320;ENST00000371319;ENST00000357475	.	.	.	4.52	3.35	0.38373	.	0.000000	0.85682	U	0.000000	T	0.75102	0.3804	M	0.71206	2.165	0.58432	D	0.999999	D;D;D	0.89917	0.999;0.991;1.0	D;P;D	0.83275	0.996;0.891;0.996	T	0.74420	-0.3671	9	0.52906	T	0.07	-2.2147	10.5274	0.44957	0.1453:0.0:0.0:0.8547	.	323;330;350	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	H	240;350;323;330	.	ENSP00000350067:N330H	N	-	1	0	SSBP3	54466605	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.691000	0.84191	0.673000	0.31224	0.369000	0.22263	AAC	.		0.567	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022721.1	NM_018070	
ST6GALNAC5	81849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	77528824	77528824	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr1:77528824T>G	ENST00000477717.1	+	5	1179	c.944T>G	c.(943-945)tTt>tGt	p.F315C		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	315					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						AATATTCACTTTTTTCAACCA	0.438																																					p.F315C		.											.	ST6GALNAC5-92	0			c.T944G						.						116.0	110.0	112.0					1																	77528824		2203	4300	6503	SO:0001583	missense	81849	exon5			TTCACTTTTTTCA		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.944T>G	1.37:g.77528824T>G	ENSP00000417583:p.Phe315Cys	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	153	49	NM_030965	0	0	10	10	0	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	37	CCDS673.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359557	0.82353	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.58358	0.34	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.73210	0.3558	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79562	-0.1752	10	0.87932	D	0	-36.7448	16.3789	0.83431	0.0:0.0:0.0:1.0	.	315	Q9BVH7	SIA7E_HUMAN	C	315;225	ENSP00000417583:F315C	ENSP00000406658:F225C	F	+	2	0	ST6GALNAC5	77301412	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.649000	0.83500	2.267000	0.75376	0.533000	0.62120	TTT	.		0.438	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
ST6GALNAC5	81849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	77528835	77528835	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr1:77528835G>A	ENST00000477717.1	+	5	1190	c.955G>A	c.(955-957)Gac>Aac	p.D319N		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	319					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						TTTTCAACCAGACTGGAAACC	0.438																																					p.D319N		.											.	ST6GALNAC5-92	0			c.G955A						.						113.0	106.0	109.0					1																	77528835		2203	4300	6503	SO:0001583	missense	81849	exon5			CAACCAGACTGGA		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.955G>A	1.37:g.77528835G>A	ENSP00000417583:p.Asp319Asn	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	153	46	NM_030965	0	0	11	11	0	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	37	CCDS673.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.733083	0.48939	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.30714	1.52	5.93	2.92	0.33932	.	0.140018	0.64402	N	0.000006	T	0.12475	0.0303	L	0.49350	1.555	0.50467	D	0.999873	B	0.18166	0.026	B	0.16289	0.015	T	0.05022	-1.0911	10	0.23302	T	0.38	-15.1218	11.5508	0.50719	0.0636:0.2339:0.7025:0.0	.	319	Q9BVH7	SIA7E_HUMAN	N	319;229	ENSP00000417583:D319N	ENSP00000406658:D229N	D	+	1	0	ST6GALNAC5	77301423	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.553000	0.60753	0.830000	0.34757	0.655000	0.94253	GAC	.		0.438	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
PRPF18	8559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	13658431	13658431	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr10:13658431A>G	ENST00000378572.3	+	9	986	c.826A>G	c.(826-828)Aat>Gat	p.N276D		NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	276					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)			central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						GGCCATTGGAAATGCGCCTTG	0.413																																					p.N276D		.											.	PRPF18-90	0			c.A826G						.						152.0	141.0	145.0					10																	13658431		2203	4300	6503	SO:0001583	missense	8559	exon9			ATTGGAAATGCGC	U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.826A>G	10.37:g.13658431A>G	ENSP00000367835:p.Asn276Asp	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	159	46	NM_003675	0	0	16	25	9	Q5T9P9|Q9BUI9	Missense_Mutation	SNP	ENST00000378572.3	37	CCDS7100.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.790746	0.90367	.	.	ENSG00000165630	ENST00000378572;ENST00000298451	.	.	.	5.3	5.3	0.74995	Prp18 (3);	0.000000	0.85682	D	0.000000	D	0.86356	0.5913	H	0.94886	3.595	0.80722	D	1	D	0.65815	0.995	D	0.75020	0.985	D	0.90319	0.4343	9	0.87932	D	0	-32.2513	15.2507	0.73542	1.0:0.0:0.0:0.0	.	276	Q99633	PRP18_HUMAN	D	276;38	.	ENSP00000298451:N38D	N	+	1	0	PRPF18	13698437	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.320000	0.96346	2.006000	0.58801	0.528000	0.53228	AAT	.		0.413	PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046879.1		
ARHGEF17	9828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	73066676	73066676	+	Silent	SNP	C	C	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr11:73066676C>G	ENST00000263674.3	+	4	3902	c.3552C>G	c.(3550-3552)gcC>gcG	p.A1184A	AP002761.1_ENST00000582555.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1184	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CGAGGCCTGCCTTTCTCAAGT	0.557																																					p.A1184A		.											.	ARHGEF17-227	0			c.C3552G						.						92.0	88.0	90.0					11																	73066676		2200	4293	6493	SO:0001819	synonymous_variant	9828	exon4			GCCTGCCTTTCTC	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.3552C>G	11.37:g.73066676C>G		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	77	29	NM_014786	0	0	4	10	6	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	ENST00000263674.3	37	CCDS8221.1																																																																																			.		0.557	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
HEPHL1	341208	hgsc.bcm.edu	37	11	93806328	93806328	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr11:93806328T>C	ENST00000315765.9	+	7	1378	c.1370T>C	c.(1369-1371)cTt>cCt	p.L457P		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	457	Plastocyanin-like 3.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CTTGGAATTCTTGGTACAGTA	0.413																																					p.L457P		.											.	HEPHL1-71	0			c.T1370C						.						73.0	68.0	69.0					11																	93806328		1842	4090	5932	SO:0001583	missense	341208	exon7			GAATTCTTGGTAC	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.1370T>C	11.37:g.93806328T>C	ENSP00000313699:p.Leu457Pro	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_001098672	0	0	0	0	0	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.361954	0.82353	.	.	ENSG00000181333	ENST00000315765	D	0.99232	-5.6	5.62	5.62	0.85841	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.077703	0.52532	D	0.000065	D	0.98692	0.9561	L	0.28400	0.85	0.80722	D	1	D	0.59357	0.985	P	0.62560	0.904	D	0.99915	1.1222	10	0.62326	D	0.03	.	15.8229	0.78673	0.0:0.0:0.0:1.0	.	457	Q6MZM0	HPHL1_HUMAN	P	457	ENSP00000313699:L457P	ENSP00000313699:L457P	L	+	2	0	HEPHL1	93445976	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.209000	0.77916	2.126000	0.65437	0.528000	0.53228	CTT	.		0.413	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
AMOTL1	154810	broad.mit.edu;ucsc.edu	37	11	94532582	94532582	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr11:94532582T>G	ENST00000433060.2	+	3	367	c.226T>G	c.(226-228)Tcc>Gcc	p.S76A	AMOTL1_ENST00000317837.9_Missense_Mutation_p.S76A|AMOTL1_ENST00000317829.8_Missense_Mutation_p.S26A	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	76					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				TAACTTCCACTCCCCAAACTT	0.458																																					p.S76A													.	AMOTL1-91	0			c.T226G						.						32.0	29.0	30.0					11																	94532582		1874	4112	5986	SO:0001583	missense	154810	exon3			TTCCACTCCCCAA	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.226T>G	11.37:g.94532582T>G	ENSP00000387739:p.Ser76Ala	Somatic	10	0		WXS	Illumina HiSeq	Phase_I	13	8	NM_130847	0	0	2	2	0	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	T	4.114	0.019294	0.08006	.	.	ENSG00000166025	ENST00000299004;ENST00000317829;ENST00000542840;ENST00000317837;ENST00000433060	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	4.45	-4.86	0.03132	.	0.943557	0.08802	N	0.891653	T	0.24122	0.0584	L	0.47716	1.5	0.09310	N	0.999996	B;B	0.10296	0.0;0.003	B;B	0.09377	0.0;0.004	T	0.41574	-0.9501	10	0.02654	T	1	0.0906	4.364	0.11216	0.1378:0.5246:0.1397:0.1979	.	26;76	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	A	105;26;82;76;76	ENSP00000299004:S105A;ENSP00000320968:S26A;ENSP00000323474:S76A;ENSP00000387739:S76A	ENSP00000299004:S105A	S	+	1	0	AMOTL1	94172230	0.899000	0.30636	0.516000	0.27786	0.565000	0.35776	0.442000	0.21628	-1.080000	0.03109	-0.451000	0.05528	TCC	.		0.458	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
MCF2L	23263	bcgsc.ca	37	13	113728835	113728835	+	Silent	SNP	G	G	A	rs146333822	byFrequency	TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr13:113728835G>A	ENST00000375608.3	+	11	1222	c.1164G>A	c.(1162-1164)gaG>gaA	p.E388E	MCF2L_ENST00000375604.2_Silent_p.E415E|MCF2L_ENST00000442652.2_Silent_p.E388E|MCF2L_ENST00000421756.1_Silent_p.E362E|MCF2L_ENST00000423482.2_Silent_p.E356E|MCF2L_ENST00000375597.4_Silent_p.E356E|MCF2L_ENST00000397030.1_Silent_p.E391E|MCF2L_ENST00000535094.2_Silent_p.E358E|MCF2L_ENST00000375601.3_Silent_p.E362E|MCF2L_ENST00000434480.2_Silent_p.E364E			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	388					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				CGCATGTGGAGCACCTGCTGA	0.622																																					p.E358E													.	MCF2L-228	0			c.G1074A						.						73.0	72.0	73.0					13																	113728835		2203	4300	6503	SO:0001819	synonymous_variant	23263	exon10			TGTGGAGCACCTG	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.1164G>A	13.37:g.113728835G>A		Somatic	143	0		WXS	Illumina HiSeq	Phase_1	94	6	NM_001112732	0	0	13	14	1	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Silent	SNP	ENST00000375608.3	37		.	.	.	.	.	.	.	.	.	.	G	1.327	-0.597928	0.03771	.	.	ENSG00000126217	ENST00000397017	.	.	.	4.77	0.243	0.15503	.	.	.	.	.	T	0.50667	0.1629	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36625	-0.9740	4	.	.	.	.	5.0347	0.14428	0.436:0.1514:0.4126:0.0	.	.	.	.	T	19	.	.	A	+	1	0	MCF2L	112776836	0.997000	0.39634	0.454000	0.27019	0.068000	0.16541	0.371000	0.20450	0.090000	0.17273	-0.136000	0.14681	GCA	G|0.999;C|0.001		0.622	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		
FMN1	342184	hgsc.bcm.edu	37	15	33066522	33066522	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr15:33066522T>C	ENST00000559047.1	-	18	4248	c.4249A>G	c.(4249-4251)Acc>Gcc	p.T1417A	FMN1_ENST00000334528.9_Missense_Mutation_p.T1194A|FMN1_ENST00000561249.1_Missense_Mutation_p.T1319A			Q68DA7	FMN1_HUMAN	formin 1	1417					actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		TAGTTAGTGGTCACACTGGCT	0.408																																					p.T1194A		.											.	FMN1-23	0			c.A3580G						.						136.0	133.0	134.0					15																	33066522		2005	4181	6186	SO:0001583	missense	342184	exon17			TAGTGGTCACACT	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.4249A>G	15.37:g.33066522T>C	ENSP00000454047:p.Thr1417Ala	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	34	2	NM_001103184	0	0	0	0	0	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37		.	.	.	.	.	.	.	.	.	.	T	4.846	0.157183	0.09236	.	.	ENSG00000248905	ENST00000334528	T	0.38401	1.14	5.23	1.7	0.24286	.	0.480250	0.22809	N	0.055376	T	0.14960	0.0361	N	0.08118	0	.	.	.	B	0.25169	0.119	B	0.20184	0.028	T	0.26087	-1.0113	9	0.15499	T	0.54	.	7.2583	0.26189	0.0:0.2672:0.0:0.7328	.	1194	Q68DA7-5	.	A	1194	ENSP00000333950:T1194A	ENSP00000333950:T1194A	T	-	1	0	FMN1	30853814	1.000000	0.71417	0.992000	0.48379	0.412000	0.31113	0.782000	0.26788	0.122000	0.18314	-0.297000	0.09499	ACC	.		0.408	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
RAB11A	8766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	66180113	66180113	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr15:66180113G>C	ENST00000261890.2	+	5	714	c.586G>C	c.(586-588)Gtt>Ctt	p.V196L	RAB11A_ENST00000564910.1_Missense_Mutation_p.V126L|RAB11A_ENST00000569896.1_3'UTR|RAB11A_ENST00000565075.1_Missense_Mutation_p.V178L	NM_001206836.1|NM_004663.4	NP_001193765.1|NP_004654.1	P62491	RB11A_HUMAN	RAB11A, member RAS oncogene family	196					cytokinesis (GO:0000910)|establishment of protein localization to membrane (GO:0090150)|exosomal secretion (GO:1990182)|GTP catabolic process (GO:0006184)|melanosome transport (GO:0032402)|multivesicular body assembly (GO:0036258)|neuron projection development (GO:0031175)|plasma membrane to endosome transport (GO:0048227)|positive regulation of axon extension (GO:0045773)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of multivesicular body size (GO:0010796)|regulation of protein transport (GO:0051223)|small GTPase mediated signal transduction (GO:0007264)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	axon (GO:0030424)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|syntaxin binding (GO:0019905)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5						CAACAATGTGGTTCCTATTCA	0.428																																					p.V196L		.											.	RAB11A-227	0			c.G586C						.						137.0	123.0	128.0					15																	66180113		2201	4299	6500	SO:0001583	missense	8766	exon5			AATGTGGTTCCTA	X56740	CCDS10212.1, CCDS58373.1	15q22.31	2008-05-14			ENSG00000103769	ENSG00000103769		"""RAB, member RAS oncogene"""	9760	protein-coding gene	gene with protein product		605570				1704119, 9662449	Standard	NM_004663		Approved	YL8	uc002apk.3	P62491	OTTHUMG00000133162	ENST00000261890.2:c.586G>C	15.37:g.66180113G>C	ENSP00000261890:p.Val196Leu	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	130	15	NM_004663	0	0	147	178	31	B2R4B6|B4DT13|P24410|Q5TZN9|Q9JLX1	Missense_Mutation	SNP	ENST00000261890.2	37	CCDS10212.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783421	0.49891	.	.	ENSG00000103769	ENST00000261890	T	0.63744	-0.06	5.45	5.45	0.79879	.	0.056657	0.64402	D	0.000001	T	0.45316	0.1336	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29397	-1.0013	10	0.29301	T	0.29	.	19.3	0.94140	0.0:0.0:1.0:0.0	.	196	P62491	RB11A_HUMAN	L	196	ENSP00000261890:V196L	ENSP00000261890:V196L	V	+	1	0	RAB11A	63967167	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.547000	0.85894	0.655000	0.94253	GTT	.		0.428	RAB11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256864.1		
GSPT1	2935	hgsc.bcm.edu	37	16	12009529	12009529	+	Intron	SNP	T	T	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr16:12009529T>C	ENST00000420576.2	-	1	41				AC007216.1_ENST00000583357.1_RNA|GSPT1_ENST00000434724.2_Missense_Mutation_p.S17G|GSPT1_ENST00000439887.2_Missense_Mutation_p.S17G	NM_001130007.1	NP_001123479.1	P15170	ERF3A_HUMAN	G1 to S phase transition 1						G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)			breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						ccgctgctgctcccgccgccg	0.766																																					p.S17G		.											.	GSPT1-206	0			c.A49G						.						1.0	1.0	1.0					16																	12009529		301	1026	1327	SO:0001627	intron_variant	2935	exon1			TGCTGCTCCCGCC	BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000420576.2:c.61+369A>G	16.37:g.12009529T>C		Somatic	7	2		WXS	Illumina HiSeq	Phase_I	5	2	NM_001130006	0	0	1	1	0	J3KQG6|Q96GF2	Missense_Mutation	SNP	ENST00000420576.2	37	CCDS45414.1	.	.	.	.	.	.	.	.	.	.	t	9.437	1.087068	0.20390	.	.	ENSG00000103342	ENST00000434724;ENST00000439887	T;T	0.30981	1.51;1.51	1.67	-0.454	0.12197	.	1.131400	0.07067	N	0.834778	T	0.22781	0.0550	.	.	.	0.45962	D	0.998788	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.14309	-1.0477	9	0.59425	D	0.04	-0.002	5.2784	0.15663	0.0:0.6038:0.0:0.3962	.	17;14	E7EQZ3;Q96GF2	.;.	G	17	ENSP00000398131:S17G;ENSP00000408399:S17G	ENSP00000398131:S17G	S	-	1	0	GSPT1	11917030	0.084000	0.21492	0.006000	0.13384	0.324000	0.28378	0.156000	0.16382	0.016000	0.14998	0.166000	0.16787	AGC	.		0.766	GSPT1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421514.1	NM_002094	
RSPRY1	89970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57265132	57265132	+	Missense_Mutation	SNP	A	A	G	rs368309991		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr16:57265132A>G	ENST00000537866.1	+	13	2303	c.1430A>G	c.(1429-1431)aAt>aGt	p.N477S	RSPRY1_ENST00000394420.4_Missense_Mutation_p.N477S|RSPRY1_ENST00000563073.1_3'UTR			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	477	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular region (GO:0005576)	zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						TGTGAGTTCAATTTTGGAGCA	0.333																																					p.N477S		.											.	RSPRY1-91	0			c.A1430G						.	A	SER/ASN	1,4395	2.1+/-5.4	0,1,2197	108.0	104.0	105.0		1430	5.8	1.0	16		105	0,8600		0,0,4300	no	missense	RSPRY1	NM_133368.1	46	0,1,6497	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	477/577	57265132	1,12995	2198	4300	6498	SO:0001583	missense	89970	exon13			AGTTCAATTTTGG	AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1430A>G	16.37:g.57265132A>G	ENSP00000443176:p.Asn477Ser	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	89	27	NM_133368	0	0	5	13	8	Q6UX21|Q8ND53	Missense_Mutation	SNP	ENST00000537866.1	37	CCDS10775.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.863491	0.91511	2.27E-4	0.0	ENSG00000159579	ENST00000394420;ENST00000537866	T;T	0.75704	-0.96;-0.96	5.78	5.78	0.91487	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.89777	0.6813	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92360	0.5896	10	0.87932	D	0	.	16.1167	0.81309	1.0:0.0:0.0:0.0	.	477	Q96DX4	RSPRY_HUMAN	S	477	ENSP00000377942:N477S;ENSP00000443176:N477S	ENSP00000377942:N477S	N	+	2	0	RSPRY1	55822633	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.204000	0.70986	0.528000	0.53228	AAT	.		0.333	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1	NM_133368	
CLDN7	1366	broad.mit.edu	37	17	7163815	7163815	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:7163815A>C	ENST00000360325.7	-	4	948	c.514T>G	c.(514-516)Tct>Gct	p.S172A	CLDN7_ENST00000397317.4_Missense_Mutation_p.S172A|CLDN7_ENST00000573745.1_5'Flank|RP1-4G17.5_ENST00000577138.1_Intron|CLDN7_ENST00000538261.3_Silent_p.G143G	NM_001307.5	NP_001298.3	O95471	CLD7_HUMAN	claudin 7	172					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.S172A(1)		kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	6						ACTAGGGCAGACCCTGCCCAG	0.572																																					p.S172A													.	CLDN7-91	1	Substitution - Missense(1)	prostate(1)	c.T514G						.																																			SO:0001583	missense	1366	exon4			GGGCAGACCCTGC	AJ011497	CCDS11096.1, CCDS54081.1	17p13.1	2013-09-20			ENSG00000181885	ENSG00000181885		"""Claudins"""	2049	protein-coding gene	gene with protein product		609131		CEPTRL2, CPETRL2		9892664	Standard	NM_001307		Approved	Hs.84359	uc002gfm.4	O95471	OTTHUMG00000178005	ENST00000360325.7:c.514T>G	17.37:g.7163815A>C	ENSP00000353475:p.Ser172Ala	Somatic	29	5		WXS	Illumina HiSeq	Phase_I	34	20	NM_001307	0	0	442	454	12	B2R9X7|D3DTP0|Q6IPN3|Q7Z4Y7|Q9BVN0	Missense_Mutation	SNP	ENST00000360325.7	37	CCDS11096.1	.	.	.	.	.	.	.	.	.	.	A	3.194	-0.165202	0.06461	.	.	ENSG00000181885	ENST00000360325;ENST00000397317	D;D	0.87650	-2.28;-2.28	4.92	4.92	0.64577	.	0.115272	0.64402	D	0.000011	T	0.71962	0.3402	N	0.11651	0.15	0.80722	D	1	B	0.15141	0.012	B	0.17722	0.019	T	0.66532	-0.5900	10	0.02654	T	1	.	12.8138	0.57654	1.0:0.0:0.0:0.0	.	172	O95471	CLD7_HUMAN	A	172	ENSP00000353475:S172A;ENSP00000396638:S172A	ENSP00000353475:S172A	S	-	1	0	CLDN7	7104539	0.032000	0.19561	1.000000	0.80357	0.949000	0.60115	0.407000	0.21049	2.197000	0.70478	0.402000	0.26972	TCT	.		0.572	CLDN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440204.2	NM_001307	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	381	44		WXS	Illumina HiSeq		591	72	NM_145301	0	0	0	23	23	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
NCOR1	9611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	15935762	15935762	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:15935762G>C	ENST00000268712.3	-	46	7428	c.7171C>G	c.(7171-7173)Cgg>Ggg	p.R2391G	NCOR1_ENST00000395851.1_Missense_Mutation_p.R2288G|NCOR1_ENST00000395857.3_Missense_Mutation_p.R975G	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2391	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.R2391W(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CTGAGCATCCGCATAGTCAGA	0.468																																					p.R2391G		.											.	NCOR1-229	1	Substitution - Missense(1)	prostate(1)	c.C7171G						.						117.0	106.0	110.0					17																	15935762		2203	4300	6503	SO:0001583	missense	9611	exon46			GCATCCGCATAGT	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.7171C>G	17.37:g.15935762G>C	ENSP00000268712:p.Arg2391Gly	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	214	41	NM_006311	0	0	49	66	17	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596051	0.46318	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.61040	0.14;0.75;0.25	5.96	3.9	0.45041	.	0.048575	0.85682	D	0.000000	T	0.53367	0.1792	L	0.60455	1.87	0.58432	D	0.999992	B;B;B;B;B	0.29341	0.036;0.013;0.242;0.132;0.06	B;B;B;B;B	0.31614	0.022;0.01;0.133;0.089;0.05	T	0.52990	-0.8501	10	0.56958	D	0.05	-9.7742	10.6076	0.45402	0.0:0.1166:0.4874:0.3961	.	2294;2391;2288;910;404	E7EVK1;O75376;O75376-2;Q86YY1;Q86YY2	.;NCOR1_HUMAN;.;.;.	G	2391;2288;2294;975	ENSP00000268712:R2391G;ENSP00000379192:R2288G;ENSP00000379198:R975G	ENSP00000268712:R2391G	R	-	1	2	NCOR1	15876487	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.109000	0.50345	0.780000	0.33566	-0.181000	0.13052	CGG	.		0.468	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
RND2	8153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41180521	41180521	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:41180521G>A	ENST00000587250.2	+	5	615	c.508G>A	c.(508-510)Gtc>Atc	p.V170I	CTD-3199J23.4_ENST00000225973.5_lincRNA|RND2_ENST00000544533.1_Missense_Mutation_p.V171I			P52198	RND2_HUMAN	Rho family GTPase 2	170					GTP catabolic process (GO:0006184)|positive regulation of collateral sprouting (GO:0048672)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|skin(1)	2		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TGAGCGCAGCGTCAGGGATGT	0.622																																					p.V170I		.											.	RND2-227	0			c.G508A						.						67.0	63.0	65.0					17																	41180521		2203	4300	6503	SO:0001583	missense	8153	exon5			CGCAGCGTCAGGG	X95456	CCDS11452.1	17q21.31	2012-10-02	2005-01-24	2005-01-24	ENSG00000108830	ENSG00000108830			18315	protein-coding gene	gene with protein product		601555	"""ras homolog gene family, member N"""	ARHN			Standard	XM_005257706		Approved	Rho7, RhoN	uc002icn.3	P52198	OTTHUMG00000180817	ENST00000587250.2:c.508G>A	17.37:g.41180521G>A	ENSP00000466680:p.Val170Ile	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	113	30	NM_005440	0	0	1	4	3	A8K2D4|O00690|O00734|Q5U0P6|Q99535	Missense_Mutation	SNP	ENST00000587250.2	37	CCDS11452.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941209	0.92526	.	.	ENSG00000108830	ENST00000544533;ENST00000225973	T	0.80653	-1.4	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.81621	0.4861	L	0.36672	1.1	0.80722	D	1	P	0.41643	0.758	P	0.48704	0.587	T	0.82420	-0.0466	10	0.66056	D	0.02	.	19.2909	0.94098	0.0:0.0:1.0:0.0	.	170	P52198	RND2_HUMAN	I	171;170	ENSP00000439328:V171I	ENSP00000225973:V170I	V	+	1	0	RND2	38434047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.623000	0.98386	2.894000	0.99253	0.655000	0.94253	GTC	.		0.622	RND2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453111.2	NM_005440	
EVPL	2125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74005355	74005355	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:74005355T>G	ENST00000301607.3	-	22	4184	c.3931A>C	c.(3931-3933)Aag>Cag	p.K1311Q	EVPL_ENST00000586740.1_Missense_Mutation_p.K1333Q	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1311	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CTCACCGTCTTGGTCTCCACC	0.682																																					p.K1311Q		.											.	EVPL-93	0			c.A3931C						.						105.0	114.0	111.0					17																	74005355		2202	4300	6502	SO:0001583	missense	2125	exon22			CCGTCTTGGTCTC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.3931A>C	17.37:g.74005355T>G	ENSP00000301607:p.Lys1311Gln	Somatic	451	0		WXS	Illumina HiSeq	Phase_I	432	94	NM_001988	0	0	10	16	6	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	T	11.83	1.755797	0.31046	.	.	ENSG00000167880	ENST00000301607	T	0.56611	0.45	5.41	4.32	0.51571	.	0.092795	0.64402	D	0.000001	T	0.53384	0.1793	M	0.75777	2.31	0.37299	D	0.908594	P;B	0.39759	0.687;0.142	B;B	0.37731	0.257;0.048	T	0.63479	-0.6628	10	0.72032	D	0.01	-43.3057	12.5545	0.56246	0.0:0.0:0.1392:0.8608	.	1333;1311	B7ZLH8;Q92817	.;EVPL_HUMAN	Q	1311	ENSP00000301607:K1311Q	ENSP00000301607:K1311Q	K	-	1	0	EVPL	71516950	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	2.654000	0.46699	0.875000	0.35847	0.459000	0.35465	AAG	.		0.682	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
FASN	2194	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80053200	80053200	+	Silent	SNP	G	G	A	rs568118566		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:80053200G>A	ENST00000306749.2	-	3	494	c.276C>T	c.(274-276)gaC>gaT	p.D92D		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	92	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	ACCCACCTCCGTCCACGATGG	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		15101	0.0		0.0	False		,,,				2504	0.001				p.D92D	Colon(59;314 1043 11189 28578 32273)												.	FASN-90	0			c.C276T						.						73.0	60.0	64.0					17																	80053200		2202	4300	6502	SO:0001819	synonymous_variant	2194	exon3			ACCTCCGTCCACG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.276C>T	17.37:g.80053200G>A		Somatic	106	0		WXS	Illumina HiSeq	Phase_I	101	13	NM_004104	0	0	0	0	0	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	37	CCDS11801.1																																																																																			.		0.597	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
ZNF536	9745	broad.mit.edu	37	19	31039693	31039693	+	Missense_Mutation	SNP	C	C	T	rs375517415		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr19:31039693C>T	ENST00000355537.3	+	4	3314	c.3167C>T	c.(3166-3168)tCg>tTg	p.S1056L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1056					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CTGCTGCCCTCGTTACAATCA	0.532																																					p.S1056L													.	ZNF536-144	0			c.C3167T						.						71.0	68.0	69.0					19																	31039693		2203	4300	6503	SO:0001583	missense	9745	exon4			TGCCCTCGTTACA		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3167C>T	19.37:g.31039693C>T	ENSP00000347730:p.Ser1056Leu	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	120	7	NM_014717	0	0	0	0	0	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	9.152	1.016612	0.19355	.	.	ENSG00000198597	ENST00000355537	T	0.09073	3.02	5.74	5.74	0.90152	.	0.568976	0.17248	N	0.181300	T	0.08044	0.0201	L	0.27053	0.805	0.26134	N	0.980378	B;B	0.32781	0.384;0.384	B;B	0.16289	0.015;0.015	T	0.21621	-1.0240	10	0.72032	D	0.01	-2.9081	19.9212	0.97085	0.0:1.0:0.0:0.0	.	1056;1056	A7E228;O15090	.;ZN536_HUMAN	L	1056	ENSP00000347730:S1056L	ENSP00000347730:S1056L	S	+	2	0	ZNF536	35731533	0.982000	0.34865	0.026000	0.17262	0.021000	0.10359	5.246000	0.65411	2.697000	0.92050	0.655000	0.94253	TCG	.		0.532	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
MEGF8	1954	ucsc.edu;bcgsc.ca	37	19	42861619	42861619	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr19:42861619T>C	ENST00000251268.6	+	28	4894	c.4894T>C	c.(4894-4896)Tct>Cct	p.S1632P	MEGF8_ENST00000334370.4_Missense_Mutation_p.S1565P	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1632					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCGAGGCCTGTCTCTGCTCCT	0.657																																					p.S1632P													.	MEGF8-23	0			c.T4894C						.						62.0	63.0	63.0					19																	42861619		2203	4300	6503	SO:0001583	missense	1954	exon28			GGCCTGTCTCTGC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.4894T>C	19.37:g.42861619T>C	ENSP00000251268:p.Ser1632Pro	Somatic	131	2		WXS	Illumina HiSeq		100	33	NM_001271938	0	0	1	7	6	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	T	21.7	4.190737	0.78789	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.23147	1.93;1.92	5.21	4.19	0.49359	Galactose oxidase/kelch, beta-propeller (1);Kelch-type beta propeller (1);	0.157535	0.41938	D	0.000790	T	0.47284	0.1437	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.85130	0.997;0.981	T	0.35400	-0.9790	10	0.31617	T	0.26	-13.4688	10.5824	0.45263	0.1446:0.0:0.0:0.8554	.	1632;1565	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	P	1565;1632	ENSP00000334219:S1565P;ENSP00000251268:S1632P	ENSP00000251268:S1632P	S	+	1	0	MEGF8	47553459	1.000000	0.71417	0.995000	0.50966	0.850000	0.48378	5.666000	0.68059	0.814000	0.34374	0.460000	0.39030	TCT	.		0.657	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
NLRP5	126206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56539072	56539072	+	Silent	SNP	C	C	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr19:56539072C>T	ENST00000390649.3	+	7	1473	c.1473C>T	c.(1471-1473)gtC>gtT	p.V491V		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	491	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GGGAGAGCGTCGCCCCCTTCA	0.632																																					p.V491V		.											.	NLRP5-162	0			c.C1473T						.						31.0	34.0	33.0					19																	56539072		2140	4237	6377	SO:0001819	synonymous_variant	126206	exon7			GAGCGTCGCCCCC	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1473C>T	19.37:g.56539072C>T		Somatic	49	0		WXS	Illumina HiSeq	Phase_I	56	25	NM_153447	0	0	0	0	0	A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	37	CCDS12938.1																																																																																			.		0.632	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
CLASP1	23332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	122206659	122206659	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr2:122206659C>T	ENST00000263710.4	-	17	1950	c.1561G>A	c.(1561-1563)Gca>Aca	p.A521T	CLASP1_ENST00000397587.3_Missense_Mutation_p.A521T|CLASP1_ENST00000541377.1_Missense_Mutation_p.A521T|CLASP1_ENST00000541859.1_Missense_Mutation_p.A290T|CLASP1_ENST00000455322.2_Missense_Mutation_p.A521T|CLASP1_ENST00000545861.1_Missense_Mutation_p.A289T|CLASP1_ENST00000409078.3_Missense_Mutation_p.A521T	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	521					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					AAGTGCTCTGCTTCTCTGCTG	0.493																																					p.A521T		.											.	CLASP1-91	0			c.G1561A						.						100.0	99.0	99.0					2																	122206659		1961	4153	6114	SO:0001583	missense	23332	exon17			GCTCTGCTTCTCT	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.1561G>A	2.37:g.122206659C>T	ENSP00000263710:p.Ala521Thr	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	39	12	NM_001207051	0	0	3	4	1	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	37		.	.	.	.	.	.	.	.	.	.	C	36	5.877189	0.97055	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	6.04	6.04	0.98038	Armadillo-like helical (1);Armadillo-type fold (2);CLASP N-terminal domain (1);	0.000000	0.85682	D	0.000000	D	0.83889	0.5352	M	0.88377	2.95	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.999;0.999	D;D;D;D	0.91635	0.997;0.995;0.998;0.999	D	0.85446	0.1158	10	0.87932	D	0	-19.0221	20.5948	0.99439	0.0:1.0:0.0:0.0	.	521;521;521;521	E7EUA5;F5GWS0;B7ZLX3;Q7Z460	.;.;.;CLAP1_HUMAN	T	521;521;521;521;290;521;289	ENSP00000263710:A521T;ENSP00000389372:A521T;ENSP00000380717:A521T;ENSP00000441625:A521T;ENSP00000441770:A290T;ENSP00000386442:A521T;ENSP00000438620:A289T	ENSP00000263710:A521T	A	-	1	0	CLASP1	121923129	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.873000	0.98535	0.563000	0.77884	GCA	.		0.493	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
ZNF385B	151126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	180309603	180309603	+	Splice_Site	SNP	T	T	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr2:180309603T>A	ENST00000410066.1	-	9	1800	c.1197A>T	c.(1195-1197)gcA>gcT	p.A399A	ZNF385B_ENST00000409692.1_Splice_Site_p.A297A|ZNF385B_ENST00000409343.1_Splice_Site_p.A323A|ZNF385B_ENST00000336917.5_Splice_Site_p.A297A|ZNF385B_ENST00000466398.1_5'UTR	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	399	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			GTAAACTTACTGCTAGAATAC	0.502																																					p.A399A	Colon(155;204 2491 32774 51842)	.											.	ZNF385B-23	0			c.A1197T						.						199.0	193.0	195.0					2																	180309603		2203	4300	6503	SO:0001630	splice_region_variant	151126	exon9			ACTTACTGCTAGA	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.1197+1A>T	2.37:g.180309603T>A		Somatic	229	1		WXS	Illumina HiSeq	Phase_I	242	72	NM_152520	0	0	0	0	0	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Silent	SNP	ENST00000410066.1	37	CCDS33339.1																																																																																			.		0.502	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520	Silent
ALPP	250	hgsc.bcm.edu	37	2	233244230	233244230	+	Missense_Mutation	SNP	A	A	G	rs1130341		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr2:233244230A>G	ENST00000392027.2	+	4	586	c.317A>G	c.(316-318)aAt>aGt	p.N106S	AC068134.8_ENST00000441266.1_RNA|AC068134.8_ENST00000439072.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	106					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CAGACATACAATGTAGACAAA	0.577																																					p.N106S		.											.	ALPP-91	0			c.A317G						.	A	SER/ASN	1,4405		0,1,2202	56.0	51.0	52.0		317	-0.4	1.0	2	dbSNP_86	52	0,8600		0,0,4300	no	missense	ALPP	NM_001632.3	46	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign	106/536	233244230	1,13005	2203	4300	6503	SO:0001583	missense	250	exon4			CATACAATGTAGA	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.317A>G	2.37:g.233244230A>G	ENSP00000375881:p.Asn106Ser	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	28	3	NM_001632	0	0	0	0	0	P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	ENST00000392027.2	37	CCDS2490.1	.	.	.	.	.	.	.	.	.	.	.	2.668	-0.278125	0.05679	2.27E-4	0.0	ENSG00000163283	ENST00000392027	D	0.95103	-3.61	2.31	-0.39	0.12450	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.295720	0.40818	N	0.001001	D	0.83487	0.5265	N	0.12831	0.26	0.29049	N	0.884612	B	0.30889	0.299	B	0.25405	0.06	T	0.75230	-0.3391	10	0.30854	T	0.27	.	6.227	0.20714	0.7126:0.1707:0.1167:0.0	rs1130341;rs3189051;rs17412756	106	P05187	PPB1_HUMAN	S	106	ENSP00000375881:N106S	ENSP00000375881:N106S	N	+	2	0	ALPP	232952474	0.992000	0.36948	0.984000	0.44739	0.510000	0.34073	0.843000	0.27640	-0.220000	0.09988	-0.817000	0.03123	AAT	A|1.000;G|0.000		0.577	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632	
USP40	55230	hgsc.bcm.edu	37	2	234450984	234450984	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr2:234450984T>G	ENST00000427112.2	-	8	1027	c.992A>C	c.(991-993)aAt>aCt	p.N331T	USP40_ENST00000251722.6_Missense_Mutation_p.N331T|USP40_ENST00000450966.1_Missense_Mutation_p.N343T			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	331	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		ATCTTTCAGATTCACATCTGG	0.358																																					p.N343T		.											.	USP40-455	0			c.A1028C						.						120.0	108.0	112.0					2																	234450984		1837	4089	5926	SO:0001583	missense	55230	exon8			TTCAGATTCACAT	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.992A>C	2.37:g.234450984T>G	ENSP00000387898:p.Asn331Thr	Somatic	5	0		WXS	Illumina HiSeq	Phase_I	8	3	NM_018218	0	0	2	4	2	Q6NX38|Q70EL0	Missense_Mutation	SNP	ENST00000427112.2	37	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	T	7.815	0.716608	0.15306	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112	T;T;T	0.05025	3.51;3.51;3.51	4.76	3.61	0.41365	.	6.476770	0.00166	N	0.000001	T	0.04227	0.0117	N	0.08118	0	0.21220	N	0.999757	B	0.06786	0.001	B	0.09377	0.004	T	0.38993	-0.9635	10	0.15066	T	0.55	.	6.2681	0.20939	0.0:0.0871:0.16:0.753	.	343	Q9NVE5-3	.	T	343;331;331	ENSP00000415434:N343T;ENSP00000251722:N331T;ENSP00000387898:N331T	ENSP00000251722:N331T	N	-	2	0	USP40	234115723	0.007000	0.16637	0.954000	0.39281	0.861000	0.49209	-0.110000	0.10824	0.920000	0.36970	0.460000	0.39030	AAT	.		0.358	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
TRPC4AP	26133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	33591257	33591257	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr20:33591257G>T	ENST00000252015.2	-	18	2301	c.2212C>A	c.(2212-2214)Cag>Aag	p.Q738K	TRPC4AP_ENST00000432634.2_Missense_Mutation_p.Q699K|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.Q730K|TRPC4AP_ENST00000539834.1_Missense_Mutation_p.Q340K			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	738					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			AGGTAGTGCTGCTGCCAGAAG	0.632																																					p.Q738K		.											.	TRPC4AP-91	0			c.C2212A						.						59.0	59.0	59.0					20																	33591257		2203	4300	6503	SO:0001583	missense	26133	exon18			AGTGCTGCTGCCA	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.2212C>A	20.37:g.33591257G>T	ENSP00000252015:p.Gln738Lys	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	126	36	NM_015638	0	0	26	44	18	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	37	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	G	6.251	0.414503	0.11870	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	.	.	.	4.65	4.65	0.58169	.	0.189321	0.48767	D	0.000179	T	0.51517	0.1679	L	0.36672	1.1	0.50632	D	0.999882	B;B;B	0.20164	0.042;0.042;0.042	B;B;B	0.16289	0.015;0.015;0.015	T	0.47586	-0.9106	9	0.12766	T	0.61	.	17.7234	0.88358	0.0:0.0:1.0:0.0	.	699;730;738	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	K	738;730;340;699;723	.	ENSP00000252015:Q738K	Q	-	1	0	TRPC4AP	33054918	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.652000	0.83633	2.398000	0.81561	0.462000	0.41574	CAG	.		0.632	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
KCNQ2	3785	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	62078166	62078166	+	Silent	SNP	G	G	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr20:62078166G>C	ENST00000359125.2	-	2	495	c.321C>G	c.(319-321)ctC>ctG	p.L107L	KCNQ2_ENST00000354587.3_Silent_p.L107L|KCNQ2_ENST00000344425.5_Silent_p.L107L|KCNQ2_ENST00000360480.3_Silent_p.L107L|KCNQ2_ENST00000357249.2_Silent_p.L107L|KCNQ2_ENST00000344462.4_Silent_p.L107L|KCNQ2_ENST00000359689.1_Silent_p.L107L|RP11-358D14.2_ENST00000436263.1_RNA|KCNQ2_ENST00000370224.1_Silent_p.L107L	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	107					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CAGACAGCACGAGGCAGGAGA	0.632																																					p.L107L		.											.	KCNQ2-92	0			c.C321G						.						85.0	80.0	82.0					20																	62078166		2203	4300	6503	SO:0001819	synonymous_variant	3785	exon2			CAGCACGAGGCAG	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.321C>G	20.37:g.62078166G>C		Somatic	202	0		WXS	Illumina HiSeq	Phase_I	172	51	NM_172106	0	0	0	0	0	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Silent	SNP	ENST00000359125.2	37	CCDS13520.1																																																																																			.		0.632	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
RFPL2	10739	ucsc.edu	37	22	32598347	32598347	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr22:32598347G>A	ENST00000400237.1	-	2	1027	c.92C>T	c.(91-93)gCa>gTa	p.A31V	RFPL2_ENST00000400236.3_5'UTR|RFPL2_ENST00000248983.4_5'UTR|RP1-90G24.10_ENST00000434942.1_RNA			O75678	RFPL2_HUMAN	ret finger protein-like 2	31							zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						catcatgtctgcaaagtccca	0.517																																					p.A31V													.	RFPL2-91	0			c.C92T						.						91.0	82.0	85.0					22																	32598347		1568	3581	5149	SO:0001583	missense	10739	exon2			ATGTCTGCAAAGT	AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.92C>T	22.37:g.32598347G>A	ENSP00000383096:p.Ala31Val	Somatic	13	0		WXS	Illumina HiSeq		19	4	NM_001098527	0	0	0	0	0		Missense_Mutation	SNP	ENST00000400237.1	37	CCDS43009.2	.	.	.	.	.	.	.	.	.	.	G	10.44	1.351246	0.24512	.	.	ENSG00000128253	ENST00000400237	T	0.57107	0.42	.	.	.	.	.	.	.	.	T	0.33673	0.0871	N	0.08118	0	0.23936	N	0.996413	P	0.43392	0.805	P	0.45506	0.483	T	0.21177	-1.0253	7	0.87932	D	0	.	.	.	.	.	31	O75678	RFPL2_HUMAN	V	31	ENSP00000383096:A31V	ENSP00000383096:A31V	A	-	2	0	RFPL2	30928347	0.008000	0.16893	0.333000	0.25482	0.334000	0.28698	-0.112000	0.10791	0.088000	0.17205	0.089000	0.15464	GCA	.		0.517	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605	
CCDC174	51244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	14695999	14695999	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr3:14695999G>C	ENST00000383794.3	+	2	182	c.109G>C	c.(109-111)Gat>Cat	p.D37H	CCDC174_ENST00000303688.7_Missense_Mutation_p.D37H	NM_016474.4	NP_057558.3	Q6PII3	CC174_HUMAN	coiled-coil domain containing 174	37						cytoplasm (GO:0005737)|nucleus (GO:0005634)											ACTTCTAAAAGATTCTGGAGT	0.299																																					p.D37H		.											.	.	0			c.G109C						.						26.0	26.0	26.0					3																	14695999		1779	4049	5828	SO:0001583	missense	51244	exon2			CTAAAAGATTCTG	AF151046	CCDS2620.2	3p25.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000154781	ENSG00000154781			28033	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 19"""	C3orf19		11042152	Standard	NM_016474		Approved	FLJ33839	uc003byw.3	Q6PII3	OTTHUMG00000129837	ENST00000383794.3:c.109G>C	3.37:g.14695999G>C	ENSP00000373304:p.Asp37His	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	38	17	NM_016474	0	0	9	12	3	Q96CS5	Missense_Mutation	SNP	ENST00000383794.3	37	CCDS2620.2	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862642	0.51482	.	.	ENSG00000154781	ENST00000383794;ENST00000303688	T;T	0.46063	0.88;0.89	5.58	4.7	0.59300	.	0.057430	0.64402	D	0.000001	T	0.61048	0.2316	M	0.70275	2.135	0.46981	D	0.999278	D	0.89917	1.0	D	0.71184	0.972	T	0.63005	-0.6733	10	0.59425	D	0.04	-12.7651	12.8107	0.57637	0.08:0.0:0.92:0.0	.	37	Q6PII3	CC019_HUMAN	H	37	ENSP00000373304:D37H;ENSP00000302344:D37H	ENSP00000302344:D37H	D	+	1	0	C3orf19	14671003	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.367000	0.73099	2.620000	0.88729	0.491000	0.48974	GAT	.		0.299	CCDC174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252077.2	NM_016474	
DPH3	285381	hgsc.bcm.edu;bcgsc.ca	37	3	16302327	16302327	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr3:16302327C>G	ENST00000488423.1	-	3	288	c.193G>C	c.(193-195)Gtg>Ctg	p.V65L	DPH3_ENST00000285082.4_5'UTR|DPH3_ENST00000383775.4_Missense_Mutation_p.V40L	NM_206831.2	NP_996662.1	Q96FX2	DPH3_HUMAN	diphthamide biosynthesis 3	65					negative regulation of protein secretion (GO:0050709)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|positive regulation of binding (GO:0051099)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			large_intestine(2)	2						TCTCCACACACAAACTGATCC	0.388																																					p.V65L		.											.	DPH3-227	0			c.G193C						.						98.0	87.0	91.0					3																	16302327		2203	4300	6503	SO:0001583	missense	285381	exon3			CACACACAAACTG	BC010181	CCDS2629.1, CCDS43058.1	3p25.1	2013-06-19	2013-06-19	2006-10-25	ENSG00000154813	ENSG00000154813			27717	protein-coding gene	gene with protein product	"""DPH3A, KTI11 homolog A (S. cerevisiae)"""	608959	"""zinc finger, CSL-type containing 2"", ""DPH3 homolog (KTI11, S. cerevisiae)"", ""DPH3, KTI11 homolog (S. cerevisiae)"""	ZCSL2		14527407, 14980502, 15485916, 16648478	Standard	NM_001047434		Approved	DESR1, DELGIP1, MGC20197, KTI11, DELGIP, DPH3A	uc003cau.3	Q96FX2	OTTHUMG00000129866	ENST00000488423.1:c.193G>C	3.37:g.16302327C>G	ENSP00000419599:p.Val65Leu	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	68	4	NM_206831	0	0	1	1	0		Missense_Mutation	SNP	ENST00000488423.1	37	CCDS2629.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.311440	0.23821	.	.	ENSG00000154813	ENST00000488423;ENST00000383775	.	.	.	5.73	3.22	0.36961	.	0.175580	0.64402	D	0.000016	T	0.16128	0.0388	.	.	.	0.24129	N	0.995778	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.30563	-0.9974	8	0.07990	T	0.79	-32.8775	7.2848	0.26333	0.0:0.2036:0.0:0.7964	.	40;65	Q96FX2-2;Q96FX2	.;DPH3_HUMAN	L	65;40	.	ENSP00000373285:V40L	V	-	1	0	DPH3	16277331	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	1.606000	0.36826	0.362000	0.24319	0.491000	0.48974	GTG	.		0.388	DPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252108.2	NM_206831	
DDX60L	91351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	169337906	169337906	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr4:169337906G>A	ENST00000511577.1	-	20	2900	c.2653C>T	c.(2653-2655)Ctc>Ttc	p.L885F	DDX60L_ENST00000260184.7_Missense_Mutation_p.L885F|DDX60L_ENST00000505890.1_Missense_Mutation_p.L885F			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	885	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		ACAAGGAGGAGCTCCCAAAAT	0.343																																					p.L885F		.											.	DDX60L-69	0			c.C2653T						.						107.0	102.0	104.0					4																	169337906		1833	4116	5949	SO:0001583	missense	91351	exon20			GGAGGAGCTCCCA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.2653C>T	4.37:g.169337906G>A	ENSP00000422423:p.Leu885Phe	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	111	33	NM_001012967	0	0	3	6	3	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37		.	.	.	.	.	.	.	.	.	.	G	15.04	2.714600	0.48622	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.74526	-0.85;-0.85;1.2;1.2	3.42	3.42	0.39159	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.183055	0.25361	U	0.031226	T	0.69124	0.3076	L	0.49640	1.575	0.25638	N	0.986238	P;P;P	0.45283	0.855;0.769;0.855	B;B;B	0.41510	0.359;0.288;0.359	T	0.66164	-0.5992	10	0.66056	D	0.02	.	13.027	0.58821	0.0:0.0:1.0:0.0	.	885;885;885	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	F	885;885;885;581	ENSP00000260184:L885F;ENSP00000422423:L885F;ENSP00000422202:L885F;ENSP00000421026:L581F	ENSP00000260184:L885F	L	-	1	0	DDX60L	169574481	1.000000	0.71417	0.896000	0.35187	0.943000	0.58893	5.558000	0.67319	1.619000	0.50296	0.461000	0.40582	CTC	.		0.343	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
MAP3K1	4214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	56177037	56177037	+	Silent	SNP	T	T	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr5:56177037T>A	ENST00000399503.3	+	13	2307	c.2307T>A	c.(2305-2307)ccT>ccA	p.P769P		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	769					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TGGAATTTCCTGCTGAATTTT	0.348																																					p.P769P		.											.	MAP3K1-956	0			c.T2307A						.						164.0	147.0	152.0					5																	56177037		1836	4079	5915	SO:0001819	synonymous_variant	4214	exon13			ATTTCCTGCTGAA	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2307T>A	5.37:g.56177037T>A		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	76	25	NM_005921	0	0	2	5	3		Silent	SNP	ENST00000399503.3	37	CCDS43318.1																																																																																			.		0.348	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
C4A	720	hgsc.bcm.edu	37	6	31964785	31964785	+	Missense_Mutation	SNP	T	T	G	rs201016130	byFrequency	TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr6:31964785T>G	ENST00000428956.2	+	29	3940	c.3856T>G	c.(3856-3858)Tcg>Gcg	p.S1286A	C4A-AS1_ENST00000458633.1_RNA|C4A_ENST00000498271.1_Missense_Mutation_p.S1286A	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	1286			S -> A (in allotype C4A1, allotype C4A3a, allotype C4A6; dbSNP:rs201016130). {ECO:0000269|PubMed:14574404, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:1988494, ECO:0000269|PubMed:3696167, ECO:0000269|PubMed:6832377, ECO:0000269|Ref.3}.		complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	AGACCAGGCTTCGGCCTGGCT	0.667													G|||	3450	0.688898	0.7799	0.7075	5008	,	,		3447	0.6964		0.6064	False		,,,				2504	0.6299				p.A1286A		.											.	C4A-44	0			c.G3856G						.						9.0	21.0	18.0					6																	31964785		314	1148	1462	SO:0001583	missense	720	exon29			CAGGCTTCGGCCT	L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.3856T>G	6.37:g.31964785T>G	ENSP00000396688:p.Ser1286Ala	Somatic	4	1		WXS	Illumina HiSeq	Phase_I	2	2	NM_007293	0	1	0	502	501	A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Silent	SNP	ENST00000428956.2	37	CCDS47404.1	.	.	.	.	.	.	.	.	.	.	N	0.023	-1.400582	0.01165	.	.	ENSG00000244731	ENST00000428956;ENST00000498271	T;T	0.28895	1.59;1.59	3.27	3.27	0.37495	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	.	.	.	.	T	0.01287	0.0042	N	0.00084	-2.21	0.26565	P	0.973664	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46233	-0.9206	8	0.02654	T	1	.	7.9548	0.30035	0.0:0.0:0.7546:0.2454	.	1286;1286	A6H8M8;P0C0L4	.;CO4A_HUMAN	A	1286	ENSP00000396688:S1286A;ENSP00000420212:S1286A	ENSP00000396688:S1286A	S	+	1	0	C4A	32072763	0.956000	0.32656	0.019000	0.16419	0.401000	0.30781	4.385000	0.59613	0.717000	0.32145	-0.486000	0.04755	TCG	G|1.000;|0.000		0.667	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076364.3	NM_007293	
DUS4L	11062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	107216872	107216872	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr7:107216872T>A	ENST00000265720.3	+	7	903	c.541T>A	c.(541-543)Tca>Aca	p.S181T	DUS4L_ENST00000402620.1_Missense_Mutation_p.S60T	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	181							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						AACAGGAGTTTCATGGATTAC	0.353																																					p.S181T		.											.	DUS4L-90	0			c.T541A						.						81.0	76.0	78.0					7																	107216872		2203	4300	6503	SO:0001583	missense	11062	exon7			GGAGTTTCATGGA	U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.541T>A	7.37:g.107216872T>A	ENSP00000265720:p.Ser181Thr	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	114	30	NM_001270419	0	0	9	11	2	B4DLX0|Q2NKK1	Missense_Mutation	SNP	ENST00000265720.3	37	CCDS5745.1	.	.	.	.	.	.	.	.	.	.	T	8.361	0.833117	0.16820	.	.	ENSG00000105865	ENST00000265720;ENST00000402620	T;T	0.22539	1.95;1.95	6.01	3.59	0.41128	Aldolase-type TIM barrel (1);	0.166724	0.56097	D	0.000035	T	0.18130	0.0435	L	0.48935	1.535	0.51233	D	0.99991	B;B	0.16396	0.017;0.017	B;B	0.25291	0.059;0.059	T	0.05468	-1.0883	10	0.26408	T	0.33	.	8.1312	0.31029	0.1207:0.0651:0.0:0.8142	.	181;181	A4D0R5;O95620	.;DUS4L_HUMAN	T	181;60	ENSP00000265720:S181T;ENSP00000385274:S60T	ENSP00000265720:S181T	S	+	1	0	DUS4L	107004108	1.000000	0.71417	0.680000	0.29994	0.052000	0.14988	5.909000	0.69923	0.489000	0.27749	-0.297000	0.09499	TCA	.		0.353	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336967.2	NM_181581	
TRIM24	8805	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	138145434	138145434	+	Silent	SNP	G	G	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr7:138145434G>A	ENST00000343526.4	+	1	356	c.141G>A	c.(139-141)gcG>gcA	p.A47A	TRIM24_ENST00000415680.2_Silent_p.A47A			O15164	TIF1A_HUMAN	tripartite motif containing 24	47					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						GCGGCGAGGCGGCCCGGCTCA	0.746																																					p.A47A	Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)	.											.	TRIM24-1030	0			c.G141A						.						5.0	7.0	6.0					7																	138145434		1615	3579	5194	SO:0001819	synonymous_variant	8805	exon1			CGAGGCGGCCCGG	AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.141G>A	7.37:g.138145434G>A		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	29	12	NM_003852	0	0	1	1	0	A4D1R7|A4D1R8|O95854	Silent	SNP	ENST00000343526.4	37	CCDS5847.1																																																																																			.		0.746	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341814.1	NM_015905	
CLU	1191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	27457323	27457323	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr8:27457323C>G	ENST00000316403.10	-	7	1543	c.1138G>C	c.(1138-1140)Gac>Cac	p.D380H	CLU_ENST00000546343.1_Missense_Mutation_p.D391H|CLU_ENST00000405140.3_Missense_Mutation_p.D380H|CLU_ENST00000560366.1_Missense_Mutation_p.D432H|CLU_ENST00000523500.1_Missense_Mutation_p.D380H			P10909	CLUS_HUMAN	clusterin	380					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		TAGTACTGGTCTTCGCCTTGC	0.602																																					p.D380H		.											.	CLU-133	0			c.G1138C						.						71.0	57.0	62.0					8																	27457323		2203	4300	6503	SO:0001583	missense	1191	exon7			ACTGGTCTTCGCC	M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.1138G>C	8.37:g.27457323C>G	ENSP00000315130:p.Asp380His	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	27	10	NM_001831	2	8	7197	11724	4516	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Missense_Mutation	SNP	ENST00000316403.10	37	CCDS47832.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.93|17.93|17.93	3.509052|3.509052|3.509052	0.64410|0.64410|0.64410	.|.|.	.|.|.	ENSG00000120885|ENSG00000120885|ENSG00000120885	ENST00000316403;ENST00000546343;ENST00000405140;ENST00000523500;ENST00000380446;ENST00000520012|ENST00000521770|ENST00000522098	T;T;T|.|.	0.23754|.|.	1.89;1.89;1.89|.|.	5.62|5.62|5.62	3.57|3.57|3.57	0.40892|0.40892|0.40892	Clusterin, C-terminal (1);|.|.	0.252635|.|.	0.44688|.|.	D|.|.	0.000435|.|.	T|T|T	0.55768|0.55768|0.55768	0.1941|0.1941|0.1941	M|M|M	0.81942|0.81942|0.81942	2.565|2.565|2.565	0.19300|0.19300|0.19300	N|N|N	0.999975|0.999975|0.999975	D;D;D;D|.|.	0.89917|.|.	1.0;1.0;1.0;0.99|.|.	D;D;D;D|.|.	0.91635|.|.	0.995;0.999;0.999;0.912|.|.	T|T|T	0.51988|0.51988|0.51988	-0.8635|-0.8635|-0.8635	10|5|5	0.87932|.|.	D|.|.	0|.|.	-20.387|-20.387|-20.387	5.2925|5.2925|5.2925	0.15735|0.15735|0.15735	0.0:0.6574:0.0:0.3426|0.0:0.6574:0.0:0.3426|0.0:0.6574:0.0:0.3426	.|.|.	245;432;391;380|.|.	E7ETA7;P10909-2;P10909-5;P10909|.|.	.;.;.;CLUS_HUMAN|.|.	H|N|T	432;391;380;380;205;245|70|242	ENSP00000446413:D391H;ENSP00000385419:D380H;ENSP00000429620:D380H|.|.	ENSP00000315130:D432H|.|.	D|K|R	-|-|-	1|3|2	0|2|0	CLU|CLU|CLU	27513240|27513240|27513240	0.048000|0.048000|0.048000	0.20356|0.20356|0.20356	0.005000|0.005000|0.005000	0.12908|0.12908|0.12908	0.275000|0.275000|0.275000	0.26752|0.26752|0.26752	1.118000|1.118000|1.118000	0.31246|0.31246|0.31246	1.363000|1.363000|1.363000	0.46019|0.46019|0.46019	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAC|AAG|AGA	.		0.602	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219953.3	NM_001831	
FGFR1	2260	ucsc.edu	37	8	38287416	38287416	+	Missense_Mutation	SNP	C	C	T	rs121909640		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr8:38287416C>T	ENST00000447712.2	-	3	1083	c.142G>A	c.(142-144)Ggt>Agt	p.G48S	FGFR1_ENST00000397113.2_Missense_Mutation_p.G48S|FGFR1_ENST00000335922.5_Missense_Mutation_p.G40S|FGFR1_ENST00000341462.5_Missense_Mutation_p.G48S|FGFR1_ENST00000397103.1_Intron|FGFR1_ENST00000326324.6_Intron|FGFR1_ENST00000397091.5_Missense_Mutation_p.G48S|FGFR1_ENST00000356207.5_Intron|FGFR1_ENST00000425967.3_Missense_Mutation_p.G81S|FGFR1_ENST00000397108.4_Missense_Mutation_p.G48S|FGFR1_ENST00000532791.1_Missense_Mutation_p.G48S	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	48	Ig-like C2-type 1.		G -> S (in HH2; phenotype consistent with normosmic idiopathic hypogonadotropic hypogonadism). {ECO:0000269|PubMed:16882753}.		angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	AGCAGGTCACCGGGGTGGACC	0.682		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														p.G81S	Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	.	FGFR1-1793	0			c.G241A	GRCh37	CM063982	FGFR1	M	rs121909640	.						26.0	25.0	25.0					8																	38287416		2203	4299	6502	SO:0001583	missense	2260	exon4			GGTCACCGGGGTG	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.142G>A	8.37:g.38287416C>T	ENSP00000400162:p.Gly48Ser	Somatic	54	0		WXS	Illumina HiSeq		40	4	NM_001174067	0	0	3	3	0	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Missense_Mutation	SNP	ENST00000447712.2	37	CCDS6107.2	.	.	.	.	.	.	.	.	.	.	C	36	5.747835	0.96882	.	.	ENSG00000077782	ENST00000397091;ENST00000425967;ENST00000447712;ENST00000341462;ENST00000310729;ENST00000532791;ENST00000397113;ENST00000335922;ENST00000397108;ENST00000326296;ENST00000525001;ENST00000413133	T;T;T;T;T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	5.58	5.58	0.84498	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92047	0.7480	M	0.90425	3.115	0.80722	A	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.93129	0.6531	9	0.87932	D	0	.	19.6377	0.95744	0.0:1.0:0.0:0.0	.	48;81;48;40;48	P11362-7;P11362-21;P11362;P11362-20;P11362-2	.;.;FGFR1_HUMAN;.;.	S	48;81;48;48;48;48;48;40;48;48;48;48	ENSP00000380280:G48S;ENSP00000393312:G81S;ENSP00000400162:G48S;ENSP00000340636:G48S;ENSP00000432972:G48S;ENSP00000380302:G48S;ENSP00000337247:G40S;ENSP00000380297:G48S;ENSP00000434712:G48S;ENSP00000400708:G48S	ENSP00000311337:G48S	G	-	1	0	FGFR1	38406573	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	7.487000	0.81328	2.641000	0.89580	0.456000	0.33151	GGT	.		0.682	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
KAT6A	7994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	41791942	41791942	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr8:41791942T>G	ENST00000396930.3	-	18	4339	c.3796A>C	c.(3796-3798)Aag>Cag	p.K1266Q	KAT6A_ENST00000406337.1_Missense_Mutation_p.K1266Q|KAT6A_ENST00000265713.2_Missense_Mutation_p.K1266Q	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1266					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										tcAGGCTCCTTGGTTTCGGTC	0.582																																					p.K1266Q		.											.	.	0			c.A3796C						.						70.0	57.0	61.0					8																	41791942		2203	4300	6503	SO:0001583	missense	7994	exon18			GCTCCTTGGTTTC	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3796A>C	8.37:g.41791942T>G	ENSP00000380136:p.Lys1266Gln	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	12	4	NM_001099412	0	0	2	3	1	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	5.700	0.313720	0.10789	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.59772	0.24;0.24;0.24	5.95	5.95	0.96441	.	0.067727	0.64402	D	0.000010	T	0.59582	0.2204	L	0.27053	0.805	0.33409	D	0.578344	D	0.71674	0.998	P	0.59115	0.852	T	0.63382	-0.6650	10	0.18710	T	0.47	-26.6212	16.4159	0.83738	0.0:0.0:0.0:1.0	.	1266	Q92794	KAT6A_HUMAN	Q	1266	ENSP00000265713:K1266Q;ENSP00000385888:K1266Q;ENSP00000380136:K1266Q	ENSP00000265713:K1266Q	K	-	1	0	KAT6A	41911099	0.647000	0.27304	0.108000	0.21378	0.021000	0.10359	1.215000	0.32431	2.279000	0.76181	0.533000	0.62120	AAG	.		0.582	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
POP1	10940	hgsc.bcm.edu	37	8	99140760	99140760	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr8:99140760C>G	ENST00000401707.2	+	4	559	c.478C>G	c.(478-480)Cag>Gag	p.Q160E	POP1_ENST00000349693.3_Missense_Mutation_p.Q160E	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	160					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GGAGATTGCCCAGAAAGAGGT	0.413																																					p.Q160E		.											.	POP1-154	0			c.C478G						.						68.0	57.0	61.0					8																	99140760		2203	4300	6503	SO:0001583	missense	10940	exon4			ATTGCCCAGAAAG	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.478C>G	8.37:g.99140760C>G	ENSP00000385787:p.Gln160Glu	Somatic	70	1		WXS	Illumina HiSeq	Phase_I	79	4	NM_001145860	0	0	0	0	0	A8K5W9|Q15037	Missense_Mutation	SNP	ENST00000401707.2	37	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	C	9.868	1.198081	0.22037	.	.	ENSG00000104356	ENST00000522319;ENST00000401707;ENST00000349693	T;T;T	0.40476	1.03;1.03;1.03	5.95	5.06	0.68205	Ribonuclease P/MRP, subunit POP1 (1);	0.326421	0.32987	N	0.005418	T	0.23926	0.0579	N	0.14661	0.345	0.23519	N	0.997501	B	0.13594	0.008	B	0.23150	0.044	T	0.18178	-1.0345	10	0.05959	T	0.93	-13.3484	12.4936	0.55914	0.3844:0.6156:0.0:0.0	.	160	Q99575	POP1_HUMAN	E	160	ENSP00000428945:Q160E;ENSP00000385787:Q160E;ENSP00000339529:Q160E	ENSP00000339529:Q160E	Q	+	1	0	POP1	99209936	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	3.261000	0.51530	1.462000	0.47948	0.650000	0.86243	CAG	.		0.413	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
GPT	2875	broad.mit.edu;bcgsc.ca	37	8	145730807	145730807	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr8:145730807T>C	ENST00000528431.1	+	6	831	c.674T>C	c.(673-675)cTg>cCg	p.L225P	GPT_ENST00000394955.2_Missense_Mutation_p.L225P			P24298	ALAT1_HUMAN	glutamic-pyruvate transaminase (alanine aminotransferase)	225					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|Phenelzine(DB00780)	CACCGTGCACTGGGCCAGGCG	0.711																																					p.L225P													.	GPT-91	0			c.T674C						.						26.0	22.0	23.0					8																	145730807		2183	4285	6468	SO:0001583	missense	2875	exon5			GTGCACTGGGCCA		CCDS6430.1	8q24.3	2013-09-19			ENSG00000167701	ENSG00000167701	2.6.1.2		4552	protein-coding gene	gene with protein product		138200					Standard	NM_005309		Approved	ALT1, GPT1	uc003zdh.4	P24298	OTTHUMG00000165176	ENST00000528431.1:c.674T>C	8.37:g.145730807T>C	ENSP00000433586:p.Leu225Pro	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	16	4	NM_005309	0	0	10	20	10	B0YJ18|D3DWM7|P78398|Q93076	Missense_Mutation	SNP	ENST00000528431.1	37	CCDS6430.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.412967	0.42817	.	.	ENSG00000167701	ENST00000528431;ENST00000394955	D;D	0.94417	-3.42;-3.42	4.75	4.75	0.60458	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.252905	0.32819	N	0.005613	D	0.97657	0.9232	M	0.93283	3.4	0.39426	D	0.966998	D;D	0.76494	0.998;0.999	D;D	0.73380	0.979;0.98	D	0.99187	1.0869	10	0.87932	D	0	-16.1077	12.1812	0.54214	0.0:0.0:0.0:1.0	.	225;225	B4DPT5;P24298	.;ALAT1_HUMAN	P	225	ENSP00000433586:L225P;ENSP00000378408:L225P	ENSP00000378408:L225P	L	+	2	0	GPT	145701615	0.950000	0.32346	0.039000	0.18376	0.002000	0.02628	4.295000	0.59049	1.753000	0.51906	0.454000	0.30748	CTG	.		0.711	GPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382471.1		
ABL1	25	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	133759489	133759489	+	Silent	SNP	C	C	A	rs201725154		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr9:133759489C>A	ENST00000318560.5	+	11	2193	c.1812C>A	c.(1810-1812)atC>atA	p.I604I		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	604					actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	GCGCCTTGATCAAGAAGAAGA	0.607			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.I623I		.		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	.	ABL1-3810	0			c.C1869A						.						78.0	89.0	85.0					9																	133759489		2203	4300	6503	SO:0001819	synonymous_variant	25	exon11			CTTGATCAAGAAG	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1812C>A	9.37:g.133759489C>A		Somatic	258	2		WXS	Illumina HiSeq	Phase_I	257	89	NM_007313	0	0	10	20	10	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Silent	SNP	ENST00000318560.5	37	CCDS35166.1																																																																																			.		0.607	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20195138	20195138	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chrX:20195138T>C	ENST00000379565.3	-	11	1117	c.910A>G	c.(910-912)Aag>Gag	p.K304E	RPS6KA3_ENST00000544447.1_Missense_Mutation_p.K276E|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.K275E|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.K276E	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	304	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	GGATTTCGCTTGAAAAGCATT	0.318																																					p.K304E		.											.	RPS6KA3-1504	0			c.A910G						.						60.0	62.0	61.0					X																	20195138		2203	4300	6503	SO:0001583	missense	6197	exon11			TTCGCTTGAAAAG	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.910A>G	X.37:g.20195138T>C	ENSP00000368884:p.Lys304Glu	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	68	4	NM_004586	0	0	5	5	0	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	37	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.237629	0.58886	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	N	0.01817	-0.705	0.80722	D	1	B;B;P;B	0.52842	0.17;0.165;0.956;0.198	B;B;P;B	0.59546	0.134;0.034;0.859;0.084	T	0.55418	-0.8144	10	0.37606	T	0.19	.	14.8754	0.70491	0.0:0.0:0.0:1.0	.	276;275;276;304	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	E	304;276;275;276	ENSP00000368884:K304E;ENSP00000440220:K276E;ENSP00000368865:K275E;ENSP00000444837:K276E	ENSP00000368865:K275E	K	-	1	0	RPS6KA3	20105059	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.215000	0.72206	1.894000	0.54839	0.417000	0.27973	AAG	.		0.318	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
DNAJC16	23341	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	15890499	15890500	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr1:15890499_15890500delGA	ENST00000375847.3	+	10	1578_1579	c.1414_1415delGA	c.(1414-1416)gagfs	p.E472fs	DNAJC16_ENST00000375849.1_Frame_Shift_Del_p.E472fs|DNAJC16_ENST00000375838.1_Frame_Shift_Del_p.E472fs|DNAJC16_ENST00000483270.1_3'UTR|RP4-680D5.8_ENST00000606186.1_RNA	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	472					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GATTGGGAGTGAGAGTGACAAA	0.465																																					p.472_472del		.											.	DNAJC16-226	0			c.1414_1415del						.																																			SO:0001589	frameshift_variant	23341	exon10			.	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.1414_1415delGA	1.37:g.15890501_15890502delGA	ENSP00000365007:p.Glu472fs	Somatic	308	0		WXS	Illumina HiSeq	Phase_I	306	86	NM_015291	0	0	0	0	0	Q68D57|Q86X32|Q8N5P4	Frame_Shift_Del	DEL	ENST00000375847.3	37	CCDS30606.1																																																																																			.		0.465	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
PTPRCAP	5790	broad.mit.edu;bcgsc.ca	37	11	67203274	67203287	+	Frame_Shift_Del	DEL	GCAAAGGCGTGCAG	GCAAAGGCGTGCAG	-	rs377555679		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	GCAAAGGCGTGCAG	GCAAAGGCGTGCAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr11:67203274_67203287delGCAAAGGCGTGCAG	ENST00000326294.3	-	2	985_998	c.538_551delCTGCACGCCTTTGC	c.(538-552)ctgcacgcctttgctfs	p.LHAFA180fs	AP003419.16_ENST00000535922.1_RNA|CORO1B_ENST00000539724.1_5'Flank	NM_005608.2	NP_005599.1	Q14761	PTCA_HUMAN	protein tyrosine phosphatase, receptor type, C-associated protein	180					defense response (GO:0006952)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				skin(1)|upper_aerodigestive_tract(1)	2			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			TGCGCTGCCAGCAAAGGCGTGCAGGTCACTCAGC	0.682																																					p.180_184del													.	PTPRCAP-226	0			c.538_551del						.																																			SO:0001589	frameshift_variant	5790	exon2			CTGCCAGCAAAGG		CCDS8163.1	11q13.2	2011-06-09			ENSG00000213402	ENSG00000213402			9667	protein-coding gene	gene with protein product		601577					Standard	NM_005608		Approved	LPAP, CD45-AP	uc001oli.1	Q14761	OTTHUMG00000150325	ENST00000326294.3:c.538_551delCTGCACGCCTTTGC	11.37:g.67203274_67203287delGCAAAGGCGTGCAG	ENSP00000325589:p.Leu180fs	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	34	8	NM_005608	0	0	0	0	0	B2R512|O00643|Q6I9S6	Frame_Shift_Del	DEL	ENST00000326294.3	37	CCDS8163.1																																																																																			.		0.682	PTPRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317563.1	NM_005608	
TMEM131	23505	broad.mit.edu	37	2	98427639	98427639	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr2:98427639delT	ENST00000186436.5	-	18	2148	c.1920delA	c.(1918-1920)aaafs	p.K640fs		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	640						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						TCCCCTCTAATTTTTTTGCAG	0.393																																					p.K640fs													.	TMEM131-74	0			c.1920delA						.						277.0	265.0	269.0					2																	98427639		1831	4095	5926	SO:0001589	frameshift_variant	23505	exon18			CTCTAATTTTTTT	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1920delA	2.37:g.98427639delT	ENSP00000186436:p.Lys640fs	Somatic	309	0		WXS	Illumina HiSeq	Phase_I	426	10	NM_015348	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000186436.5	37	CCDS46368.1																																																																																			.		0.393	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	16957909	16957910	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr10:16957909_16957910insA	ENST00000377833.4	-	46	7185_7186	c.7120_7121insT	c.(7120-7122)tatfs	p.Y2374fs		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2374	CUB 17. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GATGGTGAGATAGTGTCCAGAG	0.436																																					p.Y2374fs		.											.	CUBN-166	0			c.7121_7122insT						.																																			SO:0001589	frameshift_variant	8029	exon46			.	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.7121dupT	10.37:g.16957910_16957910dupA	ENSP00000367064:p.Tyr2374fs	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	141	51	NM_001081	0	0	0	0	0	B0YIZ4|Q5VTA6|Q96RU9	Frame_Shift_Ins	INS	ENST00000377833.4	37	CCDS7113.1																																																																																			.		0.436	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
