#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CFAP74	85452	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	1887063	1887063	+	IGR	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:1887063C>T								TMEM52 (36351 upstream) : C1orf222 (32499 downstream)																							CCCCTCAGCCCCCTGGAATGC	0.597																																					p.G748E		.											.	KIAA1751-69	0			c.G2243A						.						61.0	67.0	65.0					1																	1887063		1913	4097	6010	SO:0001628	intergenic_variant	85452	exon18			TCAGCCCCCTGGA																													1.37:g.1887063C>T		Somatic	149	0		WXS	Illumina HiSeq	Phase_I	149	38	NM_001080484	0	0	0	0	0		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	C	11.65	1.701128	0.30142	.	.	ENSG00000142609	ENST00000270720	.	.	.	1.45	-0.582	0.11709	.	0.105878	0.36665	N	0.002476	T	0.14657	0.0354	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.11329	0.006	T	0.11494	-1.0585	9	0.87932	D	0	.	3.7893	0.08713	0.0:0.5066:0.0:0.4934	.	748	Q9C0B2	K1751_HUMAN	E	748	.	ENSP00000270720:G748E	G	-	2	0	C1orf222	1876923	0.000000	0.05858	0.001000	0.08648	0.193000	0.23685	0.050000	0.14120	-0.199000	0.10317	0.462000	0.41574	GGG	.	0	0.597								
CAMTA1	23261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	7721912	7721912	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:7721912G>C	ENST00000303635.7	+	8	998	c.791G>C	c.(790-792)tGc>tCc	p.C264S	CAMTA1_ENST00000439411.2_Missense_Mutation_p.C264S	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AACTGCCTCTGCACCGGCAGC	0.687			T	WWTR1	epitheliod hemangioendothelioma																																p.C264S		.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1-520	0			c.G791C						.						26.0	25.0	26.0					1																	7721912		2199	4298	6497	SO:0001583	missense	23261	exon8			GCCTCTGCACCGG	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.791G>C	1.37:g.7721912G>C	ENSP00000306522:p.Cys264Ser	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	23	9	NM_015215	0	0	0	0	0	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	g	18.00	3.526318	0.64860	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.52526	0.66;0.66	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.42539	0.1207	L	0.58101	1.795	0.80722	D	1	B	0.32573	0.376	B	0.27380	0.079	T	0.38112	-0.9676	10	0.10902	T	0.67	-19.7455	18.2029	0.89844	0.0:0.0:1.0:0.0	.	264	Q9Y6Y1	CMTA1_HUMAN	S	264	ENSP00000306522:C264S;ENSP00000402561:C264S	ENSP00000306522:C264S	C	+	2	0	CAMTA1	7644499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.654000	0.98509	2.382000	0.81193	0.543000	0.68304	TGC	.		0.687	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
RERE	473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	8424145	8424145	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:8424145T>A	ENST00000337907.3	-	16	2345	c.1711A>T	c.(1711-1713)Agc>Tgc	p.S571C	RERE_ENST00000460659.1_5'Flank|RERE_ENST00000377464.1_Missense_Mutation_p.S303C|RERE_ENST00000476556.1_Missense_Mutation_p.S17C|RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Missense_Mutation_p.S571C	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	571					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTCCTCATGCTATGCTTCCCA	0.602																																					p.S571C		.											.	RERE-515	0			c.A1711T						.						76.0	65.0	69.0					1																	8424145		2203	4300	6503	SO:0001583	missense	473	exon16			TCATGCTATGCTT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1711A>T	1.37:g.8424145T>A	ENSP00000338629:p.Ser571Cys	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	100	42	NM_012102	0	0	13	20	7	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	37	CCDS95.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.182080	0.78677	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908	T;T;T	0.06768	3.26;3.26;3.26	5.17	5.17	0.71159	.	.	.	.	.	T	0.26122	0.0637	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	T	0.00498	-1.1704	9	0.59425	D	0.04	-23.1488	14.3401	0.66619	0.0:0.0:0.0:1.0	.	303;571	B1AKN3;Q9P2R6	.;RERE_HUMAN	C	571;303;17;571	ENSP00000338629:S571C;ENSP00000366684:S303C;ENSP00000383700:S571C	ENSP00000338629:S571C	S	-	1	0	RERE	8346732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.520000	0.81821	2.171000	0.68590	0.459000	0.35465	AGC	.		0.602	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
ECE1	1889	hgsc.bcm.edu	37	1	21546592	21546592	+	Silent	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:21546592G>C	ENST00000374893.6	-	19	2243	c.2169C>G	c.(2167-2169)tcC>tcG	p.S723S	ECE1_ENST00000357071.4_Silent_p.S711S|ECE1_ENST00000436918.2_Silent_p.S691S|ECE1_ENST00000264205.6_Silent_p.S720S|ECE1_ENST00000415912.2_Silent_p.S707S	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	723					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		GGCCTTCGTGGGAGCTCTCAG	0.637																																					p.S723S		.											.	ECE1-93	0			c.C2169G						.						68.0	58.0	62.0					1																	21546592		2203	4300	6503	SO:0001819	synonymous_variant	1889	exon19			TTCGTGGGAGCTC	D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.2169C>G	1.37:g.21546592G>C		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	60	3	NM_001397	0	0	40	40	0	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Silent	SNP	ENST00000374893.6	37	CCDS215.1																																																																																			.		0.637	ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007470.2	NM_001397	
HMGCL	3155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	24147039	24147039	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:24147039A>C	ENST00000374490.3	-	2	148	c.105T>G	c.(103-105)atT>atG	p.I35M	HMGCL_ENST00000436439.2_Missense_Mutation_p.I35M|HMGCL_ENST00000374483.4_Missense_Mutation_p.I10M|HMGCL_ENST00000509389.1_5'UTR	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	35					acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		CAACTTCCACAATTTTCACCC	0.403																																					p.I35M		.											.	HMGCL-90	0			c.T105G						.						159.0	141.0	147.0					1																	24147039		2203	4300	6503	SO:0001583	missense	3155	exon2			TTCCACAATTTTC	BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.105T>G	1.37:g.24147039A>C	ENSP00000363614:p.Ile35Met	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	149	53	NM_000191	0	0	11	29	18	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Missense_Mutation	SNP	ENST00000374490.3	37	CCDS243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.82|14.82	2.650811|2.650811	0.47362|0.47362	.|.	.|.	ENSG00000117305|ENSG00000117305	ENST00000374490;ENST00000436439;ENST00000374483;ENST00000543166|ENST00000235958	D;D;D|.	0.98862|.	-5.19;-5.1;-5.19|.	5.27|5.27	0.302|0.302	0.15786|0.15786	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (1);|.	0.147080|.	0.64402|.	D|.	0.000011|.	T|T	0.30448|0.30448	0.0765|0.0765	N|N	0.08118|0.08118	0|0	0.41038|0.41038	D|D	0.985205|0.985205	P;B;B;B|.	0.37141|.	0.584;0.08;0.08;0.08|.	B;B;B;B|.	0.40741|.	0.338;0.339;0.232;0.339|.	T|T	0.04440|0.04440	-1.0951|-1.0951	10|5	0.66056|.	D|.	0.02|.	-0.2207|-0.2207	8.6087|8.6087	0.33789|0.33789	0.566:0.0:0.434:0.0|0.566:0.0:0.434:0.0	.|.	35;35;10;35|.	B4DUP4;Q6IBC0;B1AK13;P35914|.	.;.;.;HMGCL_HUMAN|.	M|W	35;35;10;10|31	ENSP00000363614:I35M;ENSP00000389281:I35M;ENSP00000363607:I10M|.	ENSP00000363607:I10M|.	I|L	-|-	3|2	3|0	HMGCL|HMGCL	24019626|24019626	0.519000|0.519000	0.26242|0.26242	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	-0.299000|-0.299000	0.08254|0.08254	0.132000|0.132000	0.18615|0.18615	-0.385000|-0.385000	0.06624|0.06624	ATT|TTG	.		0.403	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191	
RSRP1	57035	bcgsc.ca	37	1	25573160	25573160	+	Missense_Mutation	SNP	C	C	A	rs201238140		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:25573160C>A	ENST00000243189.7	-	2	571	c.295G>T	c.(295-297)Ggg>Tgg	p.G99W	RP3-465N24.6_ENST00000607698.1_lincRNA|C1orf63_ENST00000417642.2_Missense_Mutation_p.G92W|C1orf63_ENST00000431849.2_Missense_Mutation_p.G99W	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN		99	Arg/Ser-rich.									breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CTGGTGAACCCGTAGCGCCTC	0.672																																					p.G99W													.	C1orf63-91	0			c.G295T						.						39.0	36.0	37.0					1																	25573160		2203	4300	6503	SO:0001583	missense	57035	exon2			TGAACCCGTAGCG																												ENST00000243189.7:c.295G>T	1.37:g.25573160C>A	ENSP00000243189:p.Gly99Trp	Somatic	53	0		WXS	Illumina HiSeq	Phase_1	67	5	NM_020317	0	0	13	13	0	A8K917|Q49AA4|Q5TH71|Q9GZP6	Missense_Mutation	SNP	ENST00000243189.7	37	CCDS260.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.575558	0.45902	.	.	ENSG00000117616	ENST00000243189;ENST00000417642;ENST00000431849	T;T;T	0.45276	1.5;1.5;0.9	3.91	2.99	0.34606	.	1.048650	0.07579	N	0.919965	T	0.48429	0.1499	L	0.36672	1.1	0.09310	N	1	D	0.67145	0.996	D	0.63381	0.914	T	0.31447	-0.9943	10	0.66056	D	0.02	-2.3987	4.1231	0.10114	0.0:0.5882:0.1964:0.2154	.	99	Q9BUV0	CA063_HUMAN	W	99;92;99	ENSP00000243189:G99W;ENSP00000411631:G92W;ENSP00000391510:G99W	ENSP00000243189:G99W	G	-	1	0	C1orf63	25445747	0.000000	0.05858	0.004000	0.12327	0.058000	0.15608	-0.259000	0.08721	0.985000	0.38656	0.561000	0.74099	GGG	C|0.999;T|0.000		0.672	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101966.2		
PHACTR4	65979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	28785697	28785697	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:28785697T>C	ENST00000373839.3	+	3	379	c.118T>C	c.(118-120)Ttt>Ctt	p.F40L	PHACTR4_ENST00000373836.3_Missense_Mutation_p.F50L|PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	40					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		GTTCTCAGGCTTTGGCAAGAT	0.448																																					p.F50L		.											.	PHACTR4-90	0			c.T148C						.						87.0	84.0	85.0					1																	28785697		1904	4119	6023	SO:0001583	missense	65979	exon2			TCAGGCTTTGGCA	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.118T>C	1.37:g.28785697T>C	ENSP00000362945:p.Phe40Leu	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	84	28	NM_023923	0	0	1	5	4	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	ENST00000373839.3	37	CCDS41293.1	.	.	.	.	.	.	.	.	.	.	T	15.01	2.706660	0.48412	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.12465	2.68;2.69	5.28	5.28	0.74379	.	0.185233	0.48767	N	0.000178	T	0.06234	0.0161	N	0.04132	-0.27	0.36529	D	0.870593	B;B;B	0.14012	0.005;0.003;0.009	B;B;B	0.16722	0.009;0.004;0.016	T	0.13469	-1.0508	10	0.02654	T	1	-1.0711	14.6855	0.69047	0.0:0.0:0.0:1.0	.	50;40;24	Q8IZ21-2;Q8IZ21;Q8IZ21-3	.;PHAR4_HUMAN;.	L	40;50;39	ENSP00000362945:F40L;ENSP00000362942:F50L	ENSP00000362942:F50L	F	+	1	0	PHACTR4	28658284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.667000	0.37471	2.128000	0.65567	0.528000	0.53228	TTT	.		0.448	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	NM_023923	
PUM1	9698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	31406096	31406096	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:31406096A>T	ENST00000257075.5	-	22	3616	c.3523T>A	c.(3523-3525)Tta>Ata	p.L1175I	PUM1_ENST00000373741.4_Missense_Mutation_p.L1213I|SNORD103A_ENST00000363284.1_RNA|PUM1_ENST00000373742.2_Missense_Mutation_p.L1116I|PUM1_ENST00000440538.2_Missense_Mutation_p.L1151I|PUM1_ENST00000423018.2_Missense_Mutation_p.L1033I|PUM1_ENST00000424085.2_Missense_Mutation_p.L933I|PUM1_ENST00000426105.2_Missense_Mutation_p.L1177I|PUM1_ENST00000373747.3_Missense_Mutation_p.L1178I	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	1175					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		ATGGGCCCTAAGTCAACACCG	0.552																																					p.L1177I		.											.	PUM1-92	0			c.T3529A						.						187.0	165.0	173.0					1																	31406096		2203	4300	6503	SO:0001583	missense	9698	exon22			GCCCTAAGTCAAC	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.3523T>A	1.37:g.31406096A>T	ENSP00000257075:p.Leu1175Ile	Somatic	178	0		WXS	Illumina HiSeq	Phase_I	162	63	NM_001020658	0	0	28	46	18	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	37	CCDS338.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.95|17.95	3.512828|3.512828	0.64522|0.64522	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000525843;ENST00000498419|ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742	.|T;T;T;T;T;T;T;T	.|0.20332	.|2.14;2.08;2.34;2.34;2.42;2.33;2.44;2.1	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000002|0.000002	T|T	0.34658|0.34658	0.0905|0.0905	L|L	0.56396|0.56396	1.775|1.775	0.80722|0.80722	D|D	1|1	.|D;B;B;B;B;P;B;D	.|0.67145	.|0.991;0.125;0.259;0.33;0.374;0.58;0.374;0.996	.|D;B;B;B;B;B;B;D	.|0.65773	.|0.938;0.076;0.076;0.159;0.168;0.183;0.168;0.913	T|T	0.14172|0.14172	-1.0482|-1.0482	6|10	.|0.51188	.|T	.|0.08	-3.3845|-3.3845	5.2679|5.2679	0.15609|0.15609	0.7814:0.0:0.2186:0.0|0.7814:0.0:0.2186:0.0	.|.	.|1116;1033;1213;1151;1175;1177;1178;1177	.|B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.|.;.;.;.;PUM1_HUMAN;.;.;.	H|I	1113;888|933;1175;1178;915;1177;1151;1213;1033;1116	.|ENSP00000400141:L933I;ENSP00000257075:L1175I;ENSP00000362852:L1178I;ENSP00000391723:L1177I;ENSP00000401777:L1151I;ENSP00000362846:L1213I;ENSP00000399440:L1033I;ENSP00000362847:L1116I	.|ENSP00000257075:L1175I	L|L	-|-	2|1	0|2	PUM1|PUM1	31178683|31178683	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.430000|1.430000	0.34914|0.34914	2.095000|2.095000	0.63458|0.63458	0.454000|0.454000	0.30748|0.30748	CTT|TTA	.		0.552	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
INADL	10207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	62582269	62582269	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:62582269T>C	ENST00000371158.2	+	36	4835	c.4721T>C	c.(4720-4722)tTg>tCg	p.L1574S	INADL_ENST00000543708.1_Missense_Mutation_p.L388S	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1574	PDZ 9. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GATGGGAGATTGATTCAGGGA	0.493																																					p.L1574S		.											.	INADL-94	0			c.T4721C						.						75.0	78.0	77.0					1																	62582269		1945	4135	6080	SO:0001583	missense	10207	exon36			GGAGATTGATTCA	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.4721T>C	1.37:g.62582269T>C	ENSP00000360200:p.Leu1574Ser	Somatic	53	1		WXS	Illumina HiSeq	Phase_I	47	20	NM_176877	0	0	1	5	4	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	T	25.3	4.623798	0.87460	.	.	ENSG00000132849	ENST00000371158;ENST00000543708	T;T	0.50548	0.74;0.74	5.56	5.56	0.83823	PDZ/DHR/GLGF (4);	0.000000	0.52532	D	0.000075	T	0.81197	0.4772	H	0.98314	4.2	0.80722	D	1	D;D;D	0.89917	1.0;0.972;1.0	D;P;D	0.91635	0.998;0.88;0.999	D	0.88783	0.3272	10	0.87932	D	0	.	15.7125	0.77641	0.0:0.0:0.0:1.0	.	388;1033;1574	B4DE90;Q8NI35-5;Q8NI35	.;.;INADL_HUMAN	S	1574;388	ENSP00000360200:L1574S;ENSP00000445790:L388S	ENSP00000360200:L1574S	L	+	2	0	INADL	62354857	1.000000	0.71417	0.992000	0.48379	0.915000	0.54546	8.008000	0.88588	2.108000	0.64289	0.533000	0.62120	TTG	.		0.493	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
FNBP1L	54874	broad.mit.edu	37	1	93996339	93996339	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:93996339C>T	ENST00000271234.7	+	7	689	c.538C>T	c.(538-540)Cat>Tat	p.H180Y	FNBP1L_ENST00000260506.8_Missense_Mutation_p.H180Y|FNBP1L_ENST00000370253.2_Missense_Mutation_p.H180Y|FNBP1L_ENST00000604705.1_Missense_Mutation_p.H180Y|FNBP1L_ENST00000370256.4_Missense_Mutation_p.H180Y	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	180	F-BAR domain. {ECO:0000250}.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		TCTGCGTACGCATATGGCCGA	0.318																																					p.H180Y													.	FNBP1L-227	0			c.C538T						.						38.0	37.0	38.0					1																	93996339		1829	4087	5916	SO:0001583	missense	54874	exon7			CGTACGCATATGG		CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.538C>T	1.37:g.93996339C>T	ENSP00000271234:p.His180Tyr	Somatic	10	0		WXS	Illumina HiSeq	Phase_I	20	7	NM_001164473	0	0	1	4	3	J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Missense_Mutation	SNP	ENST00000271234.7	37	CCDS53343.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065606	0.76187	.	.	ENSG00000137942	ENST00000370256;ENST00000271234;ENST00000260506;ENST00000370253;ENST00000424449	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	M	0.62723	1.935	0.80722	D	1	D;D	0.69078	0.997;0.985	D;P	0.74348	0.983;0.714	T	0.01951	-1.1241	10	0.48119	T	0.1	-39.0929	19.0931	0.93235	0.0:1.0:0.0:0.0	.	180;180	Q5T0N5-4;Q5T0N5-3	.;.	Y	180;180;180;180;47	ENSP00000359278:H180Y;ENSP00000271234:H180Y;ENSP00000260506:H180Y;ENSP00000359275:H180Y	ENSP00000260506:H180Y	H	+	1	0	FNBP1L	93768927	1.000000	0.71417	0.973000	0.42090	0.528000	0.34623	7.487000	0.81328	2.527000	0.85204	0.655000	0.94253	CAT	.		0.318	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_017737	
RBM15	64783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110883658	110883658	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:110883658C>G	ENST00000369784.3	+	1	2531	c.1631C>G	c.(1630-1632)aCt>aGt	p.T544S	RBM15_ENST00000602849.1_Missense_Mutation_p.T544S|RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000487146.2_Missense_Mutation_p.T544S	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	544					negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGCCCTTGACTCATTATGAG	0.547			T	MKL1	acute megakaryocytic leukemia																																p.T544S		.		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	.	RBM15-661	0			c.C1631G						.						74.0	71.0	72.0					1																	110883658		2203	4300	6503	SO:0001583	missense	64783	exon1			CCTTGACTCATTA	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1631C>G	1.37:g.110883658C>G	ENSP00000358799:p.Thr544Ser	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	143	57	NM_022768	0	0	0	0	0	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	ENST00000369784.3	37	CCDS822.1	.	.	.	.	.	.	.	.	.	.	C	6.069	0.381059	0.11466	.	.	ENSG00000162775	ENST00000369784	T	0.15952	2.38	4.44	4.44	0.53790	.	0.000000	0.44688	D	0.000431	T	0.03915	0.0110	N	0.22421	0.69	0.27060	N	0.963566	B;B	0.24426	0.103;0.063	B;B	0.22386	0.039;0.017	T	0.31251	-0.9950	10	0.10636	T	0.68	-8.2962	13.8608	0.63559	0.0:0.8463:0.1537:0.0	.	544;544	Q96T37-3;Q96T37	.;RBM15_HUMAN	S	544	ENSP00000358799:T544S	ENSP00000358799:T544S	T	+	2	0	RBM15	110685181	0.985000	0.35326	1.000000	0.80357	0.993000	0.82548	2.270000	0.43355	2.306000	0.77630	0.655000	0.94253	ACT	.		0.547	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768	
ADCY10	55811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	167870956	167870956	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:167870956T>A	ENST00000367851.4	-	5	564	c.380A>T	c.(379-381)cAt>cTt	p.H127L	ADCY10_ENST00000545172.1_Intron|ADCY10_ENST00000367848.1_Missense_Mutation_p.H35L	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	127	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						AAACAATCCATGGATCTCCAG	0.478																																					p.H127L		.											.	ADCY10-493	0			c.A380T						.						170.0	167.0	168.0					1																	167870956		2203	4300	6503	SO:0001583	missense	55811	exon5			AATCCATGGATCT	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.380A>T	1.37:g.167870956T>A	ENSP00000356825:p.His127Leu	Somatic	198	0		WXS	Illumina HiSeq	Phase_I	237	83	NM_018417	0	0	0	0	0	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	T	19.61	3.859754	0.71834	.	.	ENSG00000143199	ENST00000367851;ENST00000367848	T;T	0.78003	-1.14;1.49	5.76	5.76	0.90799	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.177315	0.39985	N	0.001214	T	0.67468	0.2896	L	0.27053	0.805	0.35716	D	0.816771	D;D	0.61697	0.988;0.99	P;P	0.62491	0.844;0.903	T	0.66666	-0.5866	9	0.11794	T	0.64	-17.7472	12.4728	0.55797	0.0:0.0:0.0:1.0	.	35;127	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	L	127;35	ENSP00000356825:H127L;ENSP00000356822:H35L	ENSP00000356822:H35L	H	-	2	0	ADCY10	166137580	1.000000	0.71417	0.922000	0.36590	0.701000	0.40568	4.710000	0.61873	2.193000	0.70182	0.450000	0.29827	CAT	.		0.478	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
IKBKE	9641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	206651658	206651658	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:206651658A>G	ENST00000367120.3	+	9	1341	c.968A>G	c.(967-969)cAc>cGc	p.H323R	IKBKE_ENST00000537984.1_Missense_Mutation_p.H238R	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	323					immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					GTCCTGCACCACATCTATATC	0.572																																					p.H323R		.											.	IKBKE-1061	0			c.A968G						.						201.0	170.0	181.0					1																	206651658		2203	4300	6503	SO:0001583	missense	9641	exon9			TGCACCACATCTA	AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.968A>G	1.37:g.206651658A>G	ENSP00000356087:p.His323Arg	Somatic	247	0		WXS	Illumina HiSeq	Phase_I	241	66	NM_001193322	0	0	2	4	2	D3DT78|Q3B754|Q3KR43|Q5JTS6	Missense_Mutation	SNP	ENST00000367120.3	37	CCDS30996.1	.	.	.	.	.	.	.	.	.	.	a	6.092	0.385235	0.11524	.	.	ENSG00000143466	ENST00000367120;ENST00000537984	T;T	0.62105	0.05;0.2	5.31	2.99	0.34606	.	0.288882	0.40818	N	0.001016	T	0.39226	0.1070	N	0.17474	0.49	0.23351	N	0.997852	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.18871	-1.0323	10	0.11182	T	0.66	-5.285	8.6511	0.34035	0.7589:0.0:0.2411:0.0	.	238;323	Q3B754;Q14164	.;IKKE_HUMAN	R	323;238	ENSP00000356087:H323R;ENSP00000444529:H238R	ENSP00000356087:H323R	H	+	2	0	IKBKE	204718281	0.715000	0.27946	0.538000	0.28064	0.720000	0.41350	1.322000	0.33689	0.345000	0.23873	0.454000	0.30748	CAC	.		0.572	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1		
SYT14	255928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	210267875	210267875	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:210267875T>C	ENST00000472886.1	+	5	665	c.651T>C	c.(649-651)agT>agC	p.S217S	SYT14_ENST00000534859.1_Silent_p.S217S|SYT14_ENST00000422431.1_Silent_p.S262S|SYT14_ENST00000367015.1_Silent_p.S179S|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000399639.2_Silent_p.S217S|SYT14_ENST00000367019.1_Silent_p.S217S|SYT14_ENST00000537238.1_Silent_p.S179S			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	217					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		AAATAGAAAGTTTTCATAATA	0.393																																					p.S262S		.											.	SYT14-92	0			c.T786C						.						82.0	81.0	81.0					1																	210267875		2203	4300	6503	SO:0001819	synonymous_variant	255928	exon6			AGAAAGTTTTCAT	AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.651T>C	1.37:g.210267875T>C		Somatic	71	0		WXS	Illumina HiSeq	Phase_I	66	26	NM_001146264	0	0	0	0	0	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Silent	SNP	ENST00000472886.1	37	CCDS31014.1																																																																																			.		0.393	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
EPRS	2058	hgsc.bcm.edu	37	1	220180553	220180553	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:220180553T>G	ENST00000366923.3	-	14	2002	c.1733A>C	c.(1732-1734)aAa>aCa	p.K578T		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	578	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	CTTGTGTATTTTTGTAATGTT	0.318																																					p.K578T		.											.	EPRS-92	0			c.A1733C						.						54.0	54.0	54.0					1																	220180553		2203	4300	6503	SO:0001583	missense	2058	exon14			TGTATTTTTGTAA	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.1733A>C	1.37:g.220180553T>G	ENSP00000355890:p.Lys578Thr	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_004446	0	0	0	0	0	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	T	16.93	3.258740	0.59321	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.08370	3.1	5.81	3.5	0.40072	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain (1);Ribosomal protein L25/Gln-tRNA synthetase, beta-barrel domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain (1);	0.089451	0.85682	D	0.000000	T	0.18383	0.0441	M	0.81239	2.535	0.80722	D	1	P;B;P	0.38223	0.623;0.006;0.587	B;B;P	0.45577	0.401;0.183;0.486	T	0.00449	-1.1732	10	0.62326	D	0.03	-14.9339	10.2231	0.43209	0.0:0.1342:0.0:0.8658	.	602;585;578	E7EMN0;Q3KQZ8;P07814	.;.;SYEP_HUMAN	T	578;585;602	ENSP00000355890:K578T	ENSP00000355890:K578T	K	-	2	0	EPRS	218247176	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	3.386000	0.52492	0.477000	0.27464	0.473000	0.43528	AAA	.		0.318	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
KIAA1217	56243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	24835172	24835172	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:24835172T>C	ENST00000376454.3	+	21	5781	c.5751T>C	c.(5749-5751)caT>caC	p.H1917H	KIAA1217_ENST00000376451.2_3'UTR|KIAA1217_ENST00000376462.1_Silent_p.H1238H|KIAA1217_ENST00000376452.3_Silent_p.H1348H|KIAA1217_ENST00000396445.1_3'UTR|KIAA1217_ENST00000458595.1_Silent_p.H1323H	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1917					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GGACCATCCATACTCCCAGCC	0.532																																					p.H1917H		.											.	KIAA1217-98	0			c.T5751C						.						76.0	70.0	72.0					10																	24835172		2203	4300	6503	SO:0001819	synonymous_variant	56243	exon21			CATCCATACTCCC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.5751T>C	10.37:g.24835172T>C		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	99	51	NM_019590	0	0	26	57	31	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	ENST00000376454.3	37	CCDS31165.1																																																																																			.		0.532	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
ARMC4	55130	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	28270470	28270470	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:28270470T>C	ENST00000305242.5	-	7	953	c.861A>G	c.(859-861)aaA>aaG	p.K287K	ARMC4_ENST00000537576.1_5'UTR|ARMC4_ENST00000545014.1_5'UTR|ARMC4_ENST00000239715.3_Silent_p.K144K|ARMC4_ENST00000480504.1_5'UTR	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	287					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						AAATTGAACCTTTTCTCTCAT	0.294																																					p.K287K		.											.	ARMC4-96	0			c.A861G						.						99.0	104.0	102.0					10																	28270470		2202	4296	6498	SO:0001819	synonymous_variant	55130	exon7			TGAACCTTTTCTC	AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.861A>G	10.37:g.28270470T>C		Somatic	170	0		WXS	Illumina HiSeq	Phase_I	127	8	NM_018076	0	0	0	0	0	A8K906|B7Z7I1|Q9H0C0	Silent	SNP	ENST00000305242.5	37	CCDS7157.1																																																																																			.		0.294	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
CUL2	8453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	35324145	35324145	+	Silent	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:35324145G>T	ENST00000374748.1	-	11	1270	c.957C>A	c.(955-957)atC>atA	p.I319I	CUL2_ENST00000374746.1_Silent_p.I319I|CUL2_ENST00000602371.1_Silent_p.I262I|CUL2_ENST00000374749.3_Silent_p.I319I|CUL2_ENST00000374751.3_Silent_p.I319I|CUL2_ENST00000537177.1_Silent_p.I338I|CUL2_ENST00000374742.1_Silent_p.I319I			Q13617	CUL2_HUMAN	cullin 2	319					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						CCTCATCATGGATGTGGTTTT	0.473																																					p.I338I		.											.	CUL2-229	0			c.C1014A						.						155.0	126.0	136.0					10																	35324145		2203	4300	6503	SO:0001819	synonymous_variant	8453	exon10			ATCATGGATGTGG	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.957C>A	10.37:g.35324145G>T		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	63	21	NM_001198778	0	0	1	3	2	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Silent	SNP	ENST00000374748.1	37	CCDS7179.1																																																																																			.		0.473	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	
ALOX5	240	hgsc.bcm.edu;broad.mit.edu	37	10	45869784	45869784	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:45869784C>A	ENST00000374391.2	+	1	110	c.57C>A	c.(55-57)gaC>gaA	p.D19E	ALOX5_ENST00000542434.1_Missense_Mutation_p.D19E	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	19	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	CCGGCACTGACGACTACATCT	0.701																																					p.D19E		.											.	ALOX5-228	0			c.C57A						.						28.0	19.0	22.0					10																	45869784		2161	4260	6421	SO:0001583	missense	240	exon1			CACTGACGACTAC	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.57C>A	10.37:g.45869784C>A	ENSP00000363512:p.Asp19Glu	Somatic	10	0		WXS	Illumina HiSeq	Phase_I	12	6	NM_000698	0	0	5	9	4	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	c	13.35	2.210677	0.39102	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	T;T	0.66280	-0.2;-0.2	4.82	1.81	0.25067	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.051214	0.85682	D	0.000000	T	0.75042	0.3796	M	0.88310	2.945	0.49798	D	0.999823	D;D;D	0.76494	0.998;0.999;0.985	P;D;P	0.69142	0.757;0.962;0.554	T	0.70651	-0.4813	10	0.30854	T	0.27	-37.9305	4.7968	0.13276	0.0:0.5691:0.1591:0.2717	.	19;19;19	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	E	19	ENSP00000437634:D19E;ENSP00000363512:D19E	ENSP00000363512:D19E	D	+	3	2	ALOX5	45189790	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	1.011000	0.29911	0.420000	0.25954	-0.533000	0.04299	GAC	.		0.701	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		
GRID1	2894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	87407050	87407050	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:87407050T>C	ENST00000327946.7	-	13	2187	c.2102A>G	c.(2101-2103)cAg>cGg	p.Q701R	GRID1_ENST00000536331.1_Missense_Mutation_p.Q272R|RN7SKP238_ENST00000516483.1_RNA|RP11-93H12.4_ENST00000474115.2_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	701					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CGTGCTGTCCTGCTCCAGGGG	0.552										Multiple Myeloma(13;0.14)																											p.Q701R		.											.	GRID1-142	0			c.A2102G						.						271.0	252.0	259.0					10																	87407050		2203	4300	6503	SO:0001583	missense	2894	exon13			CTGTCCTGCTCCA	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2102A>G	10.37:g.87407050T>C	ENSP00000330148:p.Gln701Arg	Somatic	418	0		WXS	Illumina HiSeq	Phase_I	427	157	NM_017551	0	0	0	0	0	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	T	13.52	2.261225	0.39995	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.27402	1.67;1.67	5.7	5.7	0.88788	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.35248	0.0925	N	0.11106	0.095	0.80722	D	1	D	0.59357	0.985	D	0.74023	0.982	T	0.28650	-1.0037	10	0.26408	T	0.33	.	15.1462	0.72653	0.0:0.0:0.0:1.0	.	701	Q9ULK0	GRID1_HUMAN	R	701;272	ENSP00000330148:Q701R;ENSP00000444455:Q272R	ENSP00000330148:Q701R	Q	-	2	0	GRID1	87397030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.175000	0.68902	0.528000	0.53228	CAG	.		0.552	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
NRAP	4892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	115411657	115411657	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:115411657T>C	ENST00000359988.3	-	7	824	c.580A>G	c.(580-582)Aag>Gag	p.K194E	NRAP_ENST00000369360.3_Missense_Mutation_p.K194E|NRAP_ENST00000360478.3_Missense_Mutation_p.K194E|NRAP_ENST00000369358.4_Missense_Mutation_p.K194E	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGCCCTCTCTTATACTCCACC	0.547																																					p.K194E		.											.	NRAP-522	0			c.A580G						.						108.0	88.0	94.0					10																	115411657		2203	4300	6503	SO:0001583	missense	4892	exon7			CTCTCTTATACTC		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.580A>G	10.37:g.115411657T>C	ENSP00000353078:p.Lys194Glu	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	71	21	NM_001261463	0	0	0	0	0		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	T	18.89	3.719870	0.68844	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	6.03	6.03	0.97812	.	0.044427	0.85682	D	0.000000	D	0.82393	0.5027	M	0.87827	2.91	0.43988	D	0.996689	D;D;D	0.59357	0.985;0.982;0.985	P;P;D	0.64506	0.868;0.879;0.926	D	0.85146	0.0983	10	0.66056	D	0.02	.	12.952	0.58407	0.0:0.0:0.0:1.0	.	194;194;194	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	E	194	ENSP00000358365:K194E;ENSP00000358367:K194E;ENSP00000353078:K194E;ENSP00000353666:K194E	ENSP00000353078:K194E	K	-	1	0	NRAP	115401647	1.000000	0.71417	1.000000	0.80357	0.214000	0.24535	6.117000	0.71577	2.313000	0.78055	0.454000	0.30748	AAG	.		0.547	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
DMBT1	1755	bcgsc.ca	37	10	124351971	124351971	+	Missense_Mutation	SNP	G	G	A	rs199833346		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:124351971G>A	ENST00000338354.3	+	20	2466	c.2360G>A	c.(2359-2361)cGg>cAg	p.R787Q	DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000368909.3_Missense_Mutation_p.R787Q|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000344338.3_Missense_Mutation_p.R777Q|DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000368955.3_Missense_Mutation_p.R777Q			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	787	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GGAAATGCCCGGTTTGGCCAG	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		17838	0.0		0.001	False		,,,				2504	0.0				p.R787Q	Ovarian(182;93 2026 18125 22222 38972)												.	DMBT1-494	0			c.G2360A						.	G	,GLN/ARG,GLN/ARG	0,3976		0,0,1988	175.0	138.0	150.0		,2360,2330	-3.3	0.0	10		150	2,8224		0,2,4111	no	intron,missense,missense	DMBT1	NM_004406.2,NM_007329.2,NM_017579.2	,43,43	0,2,6099	AA,AG,GG		0.0243,0.0,0.0164	,probably-damaging,probably-damaging	,787/2414,777/2404	124351971	2,12200	1988	4113	6101	SO:0001583	missense	1755	exon20			ATGCCCGGTTTGG		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2360G>A	10.37:g.124351971G>A	ENSP00000342210:p.Arg787Gln	Somatic	318	1		WXS	Illumina HiSeq	Phase_1	363	10	NM_007329	0	0	0	0	0	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	5.842	0.339525	0.11069	0.0	2.43E-4	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000344338;ENST00000368909;ENST00000368955	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	3.86	-3.27	0.05048	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.16557	0.0398	N	0.12502	0.225	0.09310	N	1	P;B;B;B	0.37276	0.589;0.04;0.04;0.049	B;B;B;B	0.25987	0.065;0.006;0.006;0.01	T	0.14448	-1.0472	9	0.27082	T	0.32	.	6.8244	0.23874	0.6813:0.0:0.1778:0.1409	.	548;787;777;787	Q9UGM3-4;Q9UGM3-6;Q9UGM3-3;Q9UGM3	.;.;.;DMBT1_HUMAN	Q	787;787;787;787;787;787;777;787;777	ENSP00000342210:R787Q;ENSP00000343175:R777Q;ENSP00000357905:R787Q;ENSP00000357951:R777Q	ENSP00000342210:R787Q	R	+	2	0	DMBT1	124341961	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	-0.763000	0.04740	-0.732000	0.04856	-0.259000	0.10710	CGG	G|0.999;A|0.000		0.622	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
IFITM1	8519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	315058	315058	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:315058C>G	ENST00000408968.3	+	2	641	c.323C>G	c.(322-324)tCt>tGt	p.S108C	IFITM1_ENST00000328221.5_Missense_Mutation_p.S108C|IFITM1_ENST00000528780.1_Missense_Mutation_p.S108C	NM_003641.3	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1	108	Interaction with CAV1.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of immune response (GO:0050776)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			large_intestine(1)|lung(3)	4		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GTATTCGGCTCTGTGACAGTC	0.507																																					p.S108C		.											.	.	0			c.C323G						.						129.0	129.0	129.0					11																	315058		1942	4128	6070	SO:0001583	missense	8519	exon2			TCGGCTCTGTGAC	J04164	CCDS41584.1	11p15.5	2012-03-15	2012-03-13		ENSG00000185885	ENSG00000185885		"""CD molecules"""	5412	protein-coding gene	gene with protein product	"""interferon-induced transmembrane protein 1"""	604456	"""interferon induced transmembrane protein 1 (9-27)"""	IFI17		7559564	Standard	NM_003641		Approved	9-27, CD225	uc001loy.4	P13164		ENST00000408968.3:c.323C>G	11.37:g.315058C>G	ENSP00000386187:p.Ser108Cys	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	122	35	NM_003641	0	0	20	22	2	Q15322|Q53XZ0	Missense_Mutation	SNP	ENST00000408968.3	37	CCDS41584.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150346	0.37923	.	.	ENSG00000185885	ENST00000528780;ENST00000328221;ENST00000408968	T;T;T	0.80304	-1.36;-1.36;-1.36	3.73	-0.746	0.11095	.	.	.	.	.	T	0.61578	0.2358	N	0.24115	0.695	0.09310	N	1	B	0.14012	0.009	B	0.15870	0.014	T	0.45571	-0.9252	9	0.38643	T	0.18	.	0.8934	0.01259	0.1942:0.4108:0.1719:0.2231	.	108	P13164	IFM1_HUMAN	C	108	ENSP00000437057:S108C;ENSP00000330825:S108C;ENSP00000386187:S108C	ENSP00000330825:S108C	S	+	2	0	IFITM1	305058	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.419000	0.02460	-0.422000	0.07405	0.313000	0.20887	TCT	.		0.507	IFITM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383595.1	NM_003641	
SIGIRR	59307	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	407548	407548	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:407548A>G	ENST00000431843.2	-	6	808	c.502T>C	c.(502-504)Tac>Cac	p.Y168H	SIGIRR_ENST00000529486.1_5'UTR|SIGIRR_ENST00000397632.3_Missense_Mutation_p.Y168H|SIGIRR_ENST00000382520.2_Missense_Mutation_p.Y168H|SIGIRR_ENST00000531205.1_Missense_Mutation_p.Y168H|SIGIRR_ENST00000332725.3_Missense_Mutation_p.Y168H	NM_001135054.1	NP_001128526.1	Q6IA17	SIGIR_HUMAN	single immunoglobulin and toll-interleukin 1 receptor (TIR) domain	168	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				acute-phase response (GO:0006953)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(2)|endometrium(1)|liver(1)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	13		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TAGGAGACGTAGGCGTCGTAG	0.647																																					p.Y168H		.											.	SIGIRR-90	0			c.T502C						.						26.0	27.0	27.0					11																	407548		2189	4291	6480	SO:0001583	missense	59307	exon6			AGACGTAGGCGTC		CCDS31325.1	11p15.5	2013-01-11	2005-10-10					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30575	protein-coding gene	gene with protein product	"""single immunoglobulin domain IL1R1 related"""	605478				10346978	Standard	NM_021805		Approved	TIR8	uc001lpe.1	Q6IA17		ENST00000431843.2:c.502T>C	11.37:g.407548A>G	ENSP00000403104:p.Tyr168His	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	40	10	NM_001135053	0	0	18	30	12	Q3KQY2|Q6UXI3|Q9H733	Missense_Mutation	SNP	ENST00000431843.2	37	CCDS31325.1	.	.	.	.	.	.	.	.	.	.	a	17.94	3.510696	0.64522	.	.	ENSG00000185187	ENST00000431843;ENST00000397632;ENST00000332725;ENST00000531205;ENST00000382520;ENST00000528209	T;T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71;2.71	2.75	2.75	0.32379	Toll/interleukin-1 receptor homology (TIR) domain (3);	0.240626	0.36303	N	0.002663	T	0.36082	0.0954	M	0.83118	2.625	0.58432	D	0.999999	D;D	0.76494	0.999;0.987	D;D	0.72625	0.978;0.944	T	0.30001	-0.9993	10	0.87932	D	0	.	10.2759	0.43510	1.0:0.0:0.0:0.0	.	168;168	C9JFX4;Q6IA17	.;SIGIR_HUMAN	H	168;168;168;168;168;64	ENSP00000403104:Y168H;ENSP00000380756:Y168H;ENSP00000333656:Y168H;ENSP00000433022:Y168H;ENSP00000371960:Y168H;ENSP00000435135:Y64H	ENSP00000333656:Y168H	Y	-	1	0	SIGIRR	397548	1.000000	0.71417	1.000000	0.80357	0.238000	0.25445	4.453000	0.60061	1.525000	0.49052	0.240000	0.17902	TAC	.		0.647	SIGIRR-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383884.3	NM_021805	
TRIM3	10612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6479061	6479061	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:6479061C>T	ENST00000525074.1	-	4	774	c.380G>A	c.(379-381)tGt>tAt	p.C127Y	TRIM3_ENST00000536344.1_Missense_Mutation_p.C8Y|TRIM3_ENST00000359518.3_Missense_Mutation_p.C127Y|TRIM3_ENST00000529058.1_5'Flank|TRIM3_ENST00000537602.1_Missense_Mutation_p.C127Y|TRIM3_ENST00000345851.3_Missense_Mutation_p.C127Y	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	127					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACAGGCCTCACAGTAAAACTC	0.612																																					p.C127Y	Melanoma(6;5 510 1540 25169 29084)	.											.	TRIM3-714	0			c.G380A						.						90.0	80.0	84.0					11																	6479061		2201	4296	6497	SO:0001583	missense	10612	exon4			GCCTCACAGTAAA	AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.380G>A	11.37:g.6479061C>T	ENSP00000433102:p.Cys127Tyr	Somatic	123	1		WXS	Illumina HiSeq	Phase_I	118	41	NM_001248006	0	0	1	1	0	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	ENST00000525074.1	37	CCDS7764.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349821	0.61183	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000536344;ENST00000528227	D;D;D;D;D;D	0.99080	-5.4;-5.4;-5.4;-5.4;-5.4;-5.4	5.06	4.15	0.48705	Zinc finger, B-box (3);	0.000000	0.85682	D	0.000000	D	0.99489	0.9818	H	0.97131	3.945	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98378	1.0557	10	0.87932	D	0	-8.0526	12.1727	0.54167	0.0:0.9156:0.0:0.0844	.	8;8;127	F5H2Q8;D3DQT4;O75382	.;.;TRIM3_HUMAN	Y	127;127;127;127;127;127;127;8;127	ENSP00000433102:C127Y;ENSP00000340797:C127Y;ENSP00000441091:C127Y;ENSP00000352508:C127Y;ENSP00000445460:C8Y;ENSP00000433070:C127Y	ENSP00000337094:C127Y	C	-	2	0	TRIM3	6435637	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.440000	0.80464	1.129000	0.42072	0.462000	0.41574	TGT	.		0.612	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2	NM_006458	
ALKBH3	221120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	43905565	43905565	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:43905565T>C	ENST00000302708.4	+	4	627	c.216T>C	c.(214-216)atT>atC	p.I72I	ALKBH3_ENST00000378840.4_Silent_p.I72I|ALKBH3_ENST00000532410.1_3'UTR	NM_139178.3	NP_631917.1	Q96Q83	ALKB3_HUMAN	alkB, alkylation repair homolog 3 (E. coli)	72					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)|oxidative single-stranded DNA demethylation (GO:0035552)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)			endometrium(2)|kidney(1)|lung(4)|prostate(1)	8					Vitamin C(DB00126)	CACGAGTGATTGAGTAAGTAA	0.433								Direct reversal of damage																													p.I72I		.											.	ALKBH3-90	0			c.T216C						.						256.0	225.0	236.0					11																	43905565		2203	4300	6503	SO:0001819	synonymous_variant	221120	exon4			AGTGATTGAGTAA	AB042029	CCDS7906.1	11p11.2	2013-10-11			ENSG00000166199	ENSG00000166199		"""Alkylation repair homologs"""	30141	protein-coding gene	gene with protein product		610603				22055184	Standard	NM_139178		Approved	DEPC-1	uc001mxs.2	Q96Q83	OTTHUMG00000166417	ENST00000302708.4:c.216T>C	11.37:g.43905565T>C		Somatic	233	0		WXS	Illumina HiSeq	Phase_I	214	83	NM_139178	0	0	0	0	0	A6NDJ1|Q3SYI0|Q6NX57|Q96BU8	Silent	SNP	ENST00000302708.4	37	CCDS7906.1																																																																																			.		0.433	ALKBH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389693.1	NM_139178	
RCE1	9986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66613413	66613413	+	Silent	SNP	A	A	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:66613413A>C	ENST00000309657.3	+	8	881	c.837A>C	c.(835-837)ccA>ccC	p.P279P	PC_ENST00000528224.1_5'Flank|RCE1_ENST00000525356.1_Silent_p.P156P|RCE1_ENST00000524506.1_Silent_p.P258P	NM_001032279.1|NM_005133.2	NP_001027450.1|NP_005124.1	Q9Y256	FACE2_HUMAN	Ras converting CAAX endopeptidase 1	279					CAAX-box protein processing (GO:0071586)|proteolysis (GO:0006508)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|metalloendopeptidase activity (GO:0004222)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10						TGGAGCACCCACAGAGGCGGC	0.622																																					p.P279P		.											.	RCE1-290	0			c.A837C						.						96.0	93.0	94.0					11																	66613413		2200	4295	6495	SO:0001819	synonymous_variant	9986	exon8			GCACCCACAGAGG	AF121951	CCDS8151.1	11q13	2013-10-18	2013-10-18	2001-06-29	ENSG00000173653	ENSG00000173653			13721	protein-coding gene	gene with protein product	"""farnesylated protein-converting enzyme 2"", ""prenyl protein-specific endoprotease 2"", ""RCE1 homolog, prenyl protein protease"", ""CAAX prenyl protease 2"""	605385	"""RCE1 (S. Cerevisiae) homolog, prenyl protein protease"", ""RCE1 homolog, prenyl protein peptidase (S. cerevisiae)"", ""RCE1 homolog, prenyl protein protease (S. cerevisiae)"""	RCE1A, RCE1B		10085068, 10373325	Standard	NM_005133		Approved	hRCE1, FACE-2, FACE2	uc001ojk.1	Q9Y256	OTTHUMG00000167098	ENST00000309657.3:c.837A>C	11.37:g.66613413A>C		Somatic	199	1		WXS	Illumina HiSeq	Phase_I	190	73	NM_005133	0	0	18	35	17	Q52LZ9	Silent	SNP	ENST00000309657.3	37	CCDS8151.1																																																																																			.		0.622	RCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393105.1	NM_005133	
PC	5091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66620716	66620716	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:66620716A>T	ENST00000393958.2	-	12	1600	c.1507T>A	c.(1507-1509)Tac>Aac	p.Y503N	PC_ENST00000393955.2_Missense_Mutation_p.Y503N|PC_ENST00000393960.1_Missense_Mutation_p.Y503N|PC_ENST00000529047.1_5'Flank	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	503					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	AGACCGAGGTAGTGCAACAGC	0.622																																					p.Y503N		.											.	PC-228	0			c.T1507A						.						122.0	92.0	102.0					11																	66620716		2200	4295	6495	SO:0001583	missense	5091	exon12			CGAGGTAGTGCAA	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1507T>A	11.37:g.66620716A>T	ENSP00000377530:p.Tyr503Asn	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	88	28	NM_000920	0	0	0	0	0	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370348	0.61624	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960	D;D;D	0.96745	-4.11;-4.11;-4.11	4.15	4.15	0.48705	.	0.000000	0.85682	D	0.000000	D	0.98435	0.9479	H	0.95780	3.72	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.98985	1.0806	10	0.87932	D	0	-24.4033	11.2003	0.48736	1.0:0.0:0.0:0.0	.	503	P11498	PYC_HUMAN	N	503	ENSP00000377527:Y503N;ENSP00000377530:Y503N;ENSP00000377532:Y503N	ENSP00000377527:Y503N	Y	-	1	0	PC	66377292	1.000000	0.71417	1.000000	0.80357	0.264000	0.26372	8.288000	0.89921	1.744000	0.51775	0.379000	0.24179	TAC	.		0.622	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
UVRAG	7405	hgsc.bcm.edu	37	11	75526481	75526481	+	Missense_Mutation	SNP	C	C	A	rs386755092|rs7118567	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:75526481C>A	ENST00000356136.3	+	1	270	c.29C>A	c.(28-30)cCc>cAc	p.P10H	RP11-535A19.2_ENST00000533590.1_RNA|RP11-535A19.2_ENST00000529719.1_RNA|RP11-535A19.2_ENST00000533945.1_RNA|RP11-535A19.2_ENST00000527219.1_RNA|RP11-535A19.2_ENST00000531263.1_RNA	NM_003369.3	NP_003360.2	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	10			P -> H (in dbSNP:rs7118567).		DNA repair (GO:0006281)|positive regulation of autophagy (GO:0010508)|SNARE complex assembly (GO:0035493)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|protein complex (GO:0043234)				central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(1)|large_intestine(2)|lung(15)|skin(5)|urinary_tract(2)	32						GTCGGGGGCCCCGTCCCCCAG	0.776													A|||	971	0.19389	0.3389	0.1153	5008	,	,		9602	0.2401		0.0815	False		,,,				2504	0.1217				p.P10H		.											.	UVRAG-229	0			c.C29A						.						1.0	1.0	1.0					11																	75526481		706	1693	2399	SO:0001583	missense	7405	exon1			GGGGCCCCGTCCC	X99050, AB012958	CCDS8241.1	11q13	2012-11-15	2012-11-15		ENSG00000198382	ENSG00000198382			12640	protein-coding gene	gene with protein product	"""beclin 1 binding protein"""	602493	"""UV radiation resistance associated gene"""			9169138, 16799551, 18843052	Standard	NM_003369		Approved	VPS38	uc001oxc.3	Q9P2Y5	OTTHUMG00000165319	ENST00000356136.3:c.29C>A	11.37:g.75526481C>A	ENSP00000348455:p.Pro10His	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	4	4	NM_003369	0	0	0	0	0	B3KTC1|O00392	Missense_Mutation	SNP	ENST00000356136.3	37	CCDS8241.1	377	0.17261904761904762	147	0.29878048780487804	48	0.13259668508287292	116	0.20279720279720279	66	0.0870712401055409	A	10.69	1.420343	0.25552	.	.	ENSG00000198382	ENST00000356136	T	0.54479	0.57	5.01	2.06	0.26882	C2 calcium/lipid-binding domain, CaLB (1);	0.244913	0.34853	N	0.003637	T	0.00012	0.0000	N	0.14661	0.345	0.09310	P	0.99999999749761	B	0.32693	0.38	B	0.31547	0.132	T	0.29150	-1.0021	9	0.72032	D	0.01	-1.9932	7.7013	0.28625	0.2862:0.6307:0.0:0.0831	rs7118567	10	Q9P2Y5	UVRAG_HUMAN	H	10	ENSP00000348455:P10H	ENSP00000348455:P10H	P	+	2	0	UVRAG	75204129	0.480000	0.25933	0.967000	0.41034	0.005000	0.04900	0.039000	0.13884	0.382000	0.24878	-3.014000	0.00075	CCC	C|0.828;A|0.172		0.776	UVRAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383430.1	NM_003369	
PHLDB1	23187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	118513026	118513026	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:118513026A>T	ENST00000361417.2	+	14	3202	c.2791A>T	c.(2791-2793)Atg>Ttg	p.M931L	PHLDB1_ENST00000524713.1_Missense_Mutation_p.M74L|PHLDB1_ENST00000534672.1_Intron|PHLDB1_ENST00000356063.5_Intron|PHLDB1_ENST00000527898.1_Intron	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	931										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCAGGAGCTGATGGCCGGGCT	0.642																																					p.M931L		.											.	PHLDB1-90	0			c.A2791T						.						76.0	79.0	78.0					11																	118513026		2200	4295	6495	SO:0001583	missense	23187	exon13			GAGCTGATGGCCG		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2791A>T	11.37:g.118513026A>T	ENSP00000354498:p.Met931Leu	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	155	53	NM_001144758	0	0	1	1	0	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	A	15.56	2.870388	0.51588	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000524713	T;T	0.50813	1.52;0.73	5.14	5.14	0.70334	.	0.543120	0.21674	N	0.070828	T	0.34832	0.0911	L	0.40543	1.245	0.26911	N	0.966889	B;B;B	0.24576	0.106;0.039;0.01	B;B;B	0.25614	0.062;0.019;0.011	T	0.27706	-1.0066	10	0.02654	T	1	-9.3743	12.3456	0.55119	1.0:0.0:0.0:0.0	.	69;74;931	B7Z2B9;B4DK17;Q86UU1	.;.;PHLB1_HUMAN	L	931;690;295;74	ENSP00000354498:M931L;ENSP00000434905:M74L	ENSP00000350921:M295L	M	+	1	0	PHLDB1	118018236	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.723000	0.54955	1.925000	0.55765	0.379000	0.24179	ATG	.		0.642	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
LRP6	4040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	12334248	12334248	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:12334248C>T	ENST00000261349.4	-	6	1178	c.1102G>A	c.(1102-1104)Gat>Aat	p.D368N	LRP6_ENST00000543091.1_Missense_Mutation_p.D368N	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	368	Beta-propeller 2.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TCCACAGGATCGTAATCTATG	0.453																																					p.D368N		.											.	LRP6-661	0			c.G1102A						.						199.0	170.0	180.0					12																	12334248		2203	4300	6503	SO:0001583	missense	4040	exon6			CAGGATCGTAATC	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1102G>A	12.37:g.12334248C>T	ENSP00000261349:p.Asp368Asn	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	295	162	NM_002336	0	0	0	0	0	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.848081	0.91277	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.92545	-3.06;-3.06	5.82	5.82	0.92795	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000006	D	0.96396	0.8824	M	0.89534	3.04	0.80722	D	1	D;D	0.67145	0.994;0.996	P;P	0.57960	0.79;0.83	D	0.96559	0.9414	10	0.72032	D	0.01	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	368;368	F5H7J9;O75581	.;LRP6_HUMAN	N	368	ENSP00000261349:D368N;ENSP00000442472:D368N	ENSP00000261349:D368N	D	-	1	0	LRP6	12225515	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	5.999000	0.70665	2.752000	0.94435	0.655000	0.94253	GAT	.		0.453	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
PPFIA2	8499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	81671123	81671123	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:81671123G>A	ENST00000549396.1	-	28	3443	c.3283C>T	c.(3283-3285)Cgg>Tgg	p.R1095W	PPFIA2_ENST00000333447.7_Missense_Mutation_p.R1083W|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R1095W|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R990W|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R1074W|RP11-121G22.3_ENST00000549161.1_lincRNA|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R994W|PPFIA2_ENST00000541017.1_Missense_Mutation_p.R281W|PPFIA2_ENST00000548586.1_Missense_Mutation_p.R1089W|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R1080W|PPFIA2_ENST00000550359.2_Missense_Mutation_p.R942W|PPFIA2_ENST00000541570.2_Missense_Mutation_p.R631W	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1095					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CTTGCTTCCCGTCTTCTTTCT	0.274																																					p.R1095W		.											.	PPFIA2-231	0			c.C3283T						.						130.0	117.0	121.0					12																	81671123		1797	4055	5852	SO:0001583	missense	8499	exon27			CTTCCCGTCTTCT	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3283C>T	12.37:g.81671123G>A	ENSP00000450337:p.Arg1095Trp	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	20	12	NM_001220473	0	0	0	0	0	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686642	0.68157	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T;T;T	0.38240	1.92;1.93;1.55;1.15;1.5;1.92;1.92;1.6;1.85	5.71	3.83	0.44106	Sterile alpha motif/pointed domain (1);	0.131846	0.49916	D	0.000132	T	0.69178	0.3082	H	0.94847	3.59	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.77705	-0.2488	10	0.87932	D	0	-12.2793	13.6442	0.62270	0.0:0.0:0.4348:0.5652	.	1095	O75334	LIPA2_HUMAN	W	1095;1080;631;281;994;1106;1083;1089;990;1074	ENSP00000450337:R1095W;ENSP00000450298:R1080W;ENSP00000438337:R631W;ENSP00000445532:R281W;ENSP00000385093:R994W;ENSP00000327416:R1083W;ENSP00000449338:R1089W;ENSP00000388373:R990W;ENSP00000447868:R1074W	ENSP00000327416:R1083W	R	-	1	2	PPFIA2	80195254	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.119000	0.50422	0.721000	0.32231	-0.181000	0.13052	CGG	.		0.274	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
RASSF9	9182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	86199543	86199543	+	Missense_Mutation	SNP	T	T	C	rs367564230		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:86199543T>C	ENST00000361228.3	-	2	613	c.245A>G	c.(244-246)aAg>aGg	p.K82R		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	82	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GCCTCTCCACTTCTCTATGAT	0.473																																					p.K82R		.											.	RASSF9-23	0			c.A245G						.						95.0	95.0	95.0					12																	86199543		1885	4121	6006	SO:0001583	missense	9182	exon2			CTCCACTTCTCTA		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.245A>G	12.37:g.86199543T>C	ENSP00000354884:p.Lys82Arg	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	216	53	NM_005447	0	0	0	0	0	B3KMQ4|Q8N5U8	Missense_Mutation	SNP	ENST00000361228.3	37	CCDS44950.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.084459	0.55861	.	.	ENSG00000198774	ENST00000361228	T	0.46451	0.87	4.82	4.82	0.62117	Ras-association (2);	0.139782	0.47852	D	0.000216	T	0.30479	0.0766	L	0.33485	1.01	0.37061	D	0.898052	P	0.46784	0.884	B	0.39152	0.292	T	0.22487	-1.0215	10	0.16420	T	0.52	-5.5864	14.68	0.69009	0.0:0.0:0.0:1.0	.	82	O75901	RASF9_HUMAN	R	82	ENSP00000354884:K82R	ENSP00000354884:K82R	K	-	2	0	RASSF9	84723674	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.997000	0.40786	1.941000	0.56285	0.421000	0.28195	AAG	.		0.473	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		
ANKS1B	56899	hgsc.bcm.edu	37	12	100048989	100048989	+	Splice_Site	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:100048989C>G	ENST00000547776.2	-	9	1128		c.e9-1		ANKS1B_ENST00000547010.1_Splice_Site|ANKS1B_ENST00000329257.7_Splice_Site	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B							cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		ATGAGGTTCTCTGAAATTAAA	0.323																																					.		.											.	.	0			c.1129-1G>C						.						68.0	61.0	63.0					12																	100048989		1821	4073	5894	SO:0001630	splice_region_variant	56899	exon10			GGTTCTCTGAAAT	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1129-1G>C	12.37:g.100048989C>G		Somatic	10	0		WXS	Illumina HiSeq	Phase_I	23	2	NM_152788	0	0	0	0	0	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Splice_Site	SNP	ENST00000547776.2	37	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.802946	0.70682	.	.	ENSG00000185046	ENST00000547776;ENST00000329257;ENST00000549866	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4502	0.83977	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKS1B	98573120	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.743000	0.62110	2.616000	0.88540	0.650000	0.86243	.	.		0.323	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	Intron
TDG	6996	hgsc.bcm.edu	37	12	104378526	104378526	+	Splice_Site	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:104378526G>T	ENST00000392872.3	+	8	1026		c.e8-1		TDG_ENST00000542036.1_Splice_Site|TDG_ENST00000544861.1_Splice_Site|TDG_ENST00000266775.9_Splice_Site|AC078819.1_ENST00000401157.1_RNA	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		TGTGATTCTAGCTCTGCTATG	0.323								Base excision repair (BER), DNA glycosylases																													.		.											.	TDG-661	0			c.793-1G>T						.						45.0	42.0	43.0					12																	104378526		2203	4300	6503	SO:0001630	splice_region_variant	6996	exon8			ATTCTAGCTCTGC	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.793-1G>T	12.37:g.104378526G>T		Somatic	36	1		WXS	Illumina HiSeq	Phase_I	77	4	NM_003211	0	0	0	0	0	Q8IUZ6|Q8IZM3	Splice_Site	SNP	ENST00000392872.3	37	CCDS9095.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099218	0.76983	.	.	ENSG00000139372	ENST00000392872;ENST00000266775;ENST00000544861;ENST00000542036	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TDG	102902656	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	9.869000	0.99810	2.840000	0.97914	0.655000	0.94253	.	.		0.323	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2		Intron
NCOR2	9612	hgsc.bcm.edu	37	12	124829474	124829474	+	Silent	SNP	G	G	A	rs61241227	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:124829474G>A	ENST00000405201.1	-	32	4383	c.4383C>T	c.(4381-4383)acC>acT	p.T1461T	NCOR2_ENST00000397355.1_Silent_p.T1452T|NCOR2_ENST00000404621.1_Silent_p.T1451T|NCOR2_ENST00000429285.2_Silent_p.T1451T|NCOR2_ENST00000356219.3_Silent_p.T1468T|NCOR2_ENST00000404121.2_Silent_p.T1022T			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1469					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TGGACGCGCCGGTGTCGTACT	0.667													G|||	16	0.00319489	0.0121	0.0	5008	,	,		15692	0.0		0.0	False		,,,				2504	0.0				p.T1461T		.											.	NCOR2-229	0			c.C4383T						.	G	,,	43,4243		0,43,2100	50.0	61.0	57.0		4353,4353,4383	-4.7	0.0	12	dbSNP_129	57	2,8472		0,2,4235	no	coding-synonymous,coding-synonymous,coding-synonymous	NCOR2	NM_001077261.3,NM_001206654.1,NM_006312.5	,,	0,45,6335	AA,AG,GG		0.0236,1.0033,0.3527	,,	1451/2459,1451/2505,1461/2515	124829474	45,12715	2143	4237	6380	SO:0001819	synonymous_variant	9612	exon34			CGCGCCGGTGTCG	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.4383C>T	12.37:g.124829474G>A		Somatic	5	1		WXS	Illumina HiSeq	Phase_I	11	5	NM_006312	0	0	0	14	14	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																			A|0.000;C|0.003;G|0.996		0.667	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
SCARB1	949	hgsc.bcm.edu	37	12	125348148	125348148	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:125348148A>G	ENST00000415380.2	-	1	244	c.119T>C	c.(118-120)gTc>gCc	p.V40A	SCARB1_ENST00000376788.1_Missense_Mutation_p.V40A|SCARB1_ENST00000546215.1_Missense_Mutation_p.V40A|SCARB1_ENST00000339570.5_Missense_Mutation_p.V40A|SCARB1_ENST00000535005.1_Intron|SCARB1_ENST00000261693.6_Missense_Mutation_p.V40A			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	40					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	CACCTTAAGGACCTGCTGCTT	0.731																																					p.V40A		.											.	SCARB1-226	0			c.T119C						.						25.0	22.0	23.0					12																	125348148		2201	4300	6501	SO:0001583	missense	949	exon1			TTAAGGACCTGCT	Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.119T>C	12.37:g.125348148A>G	ENSP00000414979:p.Val40Ala	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_005505	0	0	0	0	0	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Missense_Mutation	SNP	ENST00000415380.2	37		.	.	.	.	.	.	.	.	.	.	A	18.80	3.701743	0.68501	.	.	ENSG00000073060	ENST00000339570;ENST00000415380;ENST00000261693;ENST00000376788;ENST00000546215;ENST00000545493	T;T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.39;-0.81;-0.81	3.48	3.48	0.39840	.	0.070854	0.56097	U	0.000034	T	0.81432	0.4821	M	0.76002	2.32	0.80722	D	1	P;D;D;P;D	0.58268	0.951;0.982;0.982;0.775;0.977	P;P;P;B;P	0.60236	0.755;0.871;0.871;0.425;0.725	T	0.82744	-0.0306	10	0.87932	D	0	-21.358	8.9206	0.35610	1.0:0.0:0.0:0.0	.	40;40;40;40;40	B7ZKQ9;B4E3I1;Q8WTV0;F8W8N0;Q8WTV0-2	.;.;SCRB1_HUMAN;.;.	A	40	ENSP00000343795:V40A;ENSP00000414979:V40A;ENSP00000261693:V40A;ENSP00000365984:V40A;ENSP00000442862:V40A;ENSP00000443454:V40A	ENSP00000261693:V40A	V	-	2	0	SCARB1	123914101	1.000000	0.71417	1.000000	0.80357	0.285000	0.27093	4.239000	0.58694	1.528000	0.49103	0.358000	0.22013	GTC	.		0.731	SCARB1-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000400165.1	NM_005505	
POLE	5426	hgsc.bcm.edu	37	12	133235892	133235892	+	Silent	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:133235892A>G	ENST00000320574.5	-	26	3307	c.3264T>C	c.(3262-3264)ccT>ccC	p.P1088P	POLE_ENST00000535270.1_Silent_p.P1061P	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1088					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	TCTCCGTGACAGGGGAGCCCT	0.657								DNA polymerases (catalytic subunits)																													p.P1088P		.											.	POLE-233	0			c.T3264C						.						40.0	38.0	39.0					12																	133235892		2203	4300	6503	SO:0001819	synonymous_variant	5426	exon26			CGTGACAGGGGAG		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.3264T>C	12.37:g.133235892A>G		Somatic	48	2		WXS	Illumina HiSeq	Phase_I	84	7	NM_006231	0	0	0	0	0	Q13533|Q86VH9	Silent	SNP	ENST00000320574.5	37	CCDS9278.1																																																																																			.		0.657	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
NPAP1	23742	hgsc.bcm.edu	37	15	24921074	24921074	+	Silent	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:24921074A>G	ENST00000329468.2	+	1	534	c.60A>G	c.(58-60)ccA>ccG	p.P20P		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	20					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TGCCAGGGCCAGGGCGTGGCG	0.682																																					p.P20P		.											.	.	0			c.A60G						.						6.0	8.0	7.0					15																	24921074		1783	3773	5556	SO:0001819	synonymous_variant	23742	exon1			AGGGCCAGGGCGT	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.60A>G	15.37:g.24921074A>G		Somatic	21	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_018958	0	0	0	0	0		Silent	SNP	ENST00000329468.2	37	CCDS10015.1																																																																																			.		0.682	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
TRPM1	4308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	31362391	31362391	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:31362391G>T	ENST00000256552.6	-	4	269	c.122C>A	c.(121-123)cCt>cAt	p.P41H	TRPM1_ENST00000397795.2_Missense_Mutation_p.P19H|TRPM1_ENST00000542188.1_Missense_Mutation_p.P58H|TRPM1_ENST00000559179.1_Missense_Mutation_p.P19H	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		ACTTGGCAGAGGGGGGATATG	0.507																																					p.P58H		.											.	TRPM1-94	0			c.C173A						.						243.0	229.0	234.0					15																	31362391		1976	4162	6138	SO:0001583	missense	4308	exon3			GGCAGAGGGGGGA	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.122C>A	15.37:g.31362391G>T	ENSP00000256552:p.Pro41His	Somatic	370	1		WXS	Illumina HiSeq	Phase_I	382	147	NM_001252020	0	0	0	0	0		Missense_Mutation	SNP	ENST00000256552.6	37	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336399	0.24253	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.55760	0.5;0.5;0.5	6.03	5.12	0.69794	.	0.408600	0.22654	U	0.057296	T	0.60340	0.2261	L	0.36672	1.1	0.33691	D	0.613333	D;D	0.71674	0.998;0.983	D;P	0.73708	0.981;0.827	T	0.71192	-0.4665	10	0.72032	D	0.01	-15.4292	9.4507	0.38725	0.2106:0.0:0.7894:0.0	.	19;19	Q6PE48;Q7Z4N2	.;TRPM1_HUMAN	H	19;58;41;19	ENSP00000380897:P19H;ENSP00000437849:P58H;ENSP00000256552:P41H	ENSP00000256552:P41H	P	-	2	0	TRPM1	29149683	1.000000	0.71417	0.918000	0.36340	0.307000	0.27823	3.722000	0.54948	1.541000	0.49316	0.655000	0.94253	CCT	.		0.507	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
SLC12A1	6557	hgsc.bcm.edu	37	15	48584051	48584051	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:48584051A>G	ENST00000558405.1	+	23	2964	c.2950A>G	c.(2950-2952)Aac>Gac	p.N984D	SLC12A1_ENST00000396577.3_Missense_Mutation_p.N984D|SLC12A1_ENST00000380993.3_Missense_Mutation_p.N984D			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	984					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	CATTAGGCCAAACAAAGAGAG	0.323																																					p.N984D		.											.	SLC12A1-24	0			c.A2950G						.						51.0	50.0	50.0					15																	48584051		2195	4290	6485	SO:0001583	missense	6557	exon24			AGGCCAAACAAAG		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.2950A>G	15.37:g.48584051A>G	ENSP00000453409:p.Asn984Asp	Somatic	5	0		WXS	Illumina HiSeq	Phase_I	12	2	NM_001184832	0	0	0	0	0	A8JYA2|E9PDW4	Missense_Mutation	SNP	ENST00000558405.1	37	CCDS10129.2	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341269	0.41498	.	.	ENSG00000074803	ENST00000380993;ENST00000396577	D;D	0.84516	-1.86;-1.86	5.44	5.44	0.79542	.	0.202548	0.51477	D	0.000096	T	0.76428	0.3986	L	0.27053	0.805	0.29554	N	0.851145	B;B	0.28820	0.224;0.147	B;B	0.24701	0.055;0.045	T	0.68981	-0.5266	10	0.23891	T	0.37	.	15.1563	0.72746	1.0:0.0:0.0:0.0	.	984;984	E9PDW4;Q13621	.;S12A1_HUMAN	D	984	ENSP00000370381:N984D;ENSP00000379822:N984D	ENSP00000370381:N984D	N	+	1	0	SLC12A1	46371343	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.657000	0.67996	2.057000	0.61298	0.533000	0.62120	AAC	.		0.323	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		
ANKDD1A	348094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65223120	65223120	+	Splice_Site	SNP	T	T	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:65223120T>G	ENST00000380230.3	+	7	698		c.e7+2		ANKDD1A_ENST00000395723.1_Splice_Site|ANKDD1A_ENST00000395720.1_Splice_Site|ANKDD1A_ENST00000491145.1_Splice_Site|ANKDD1A_ENST00000357698.3_Splice_Site|ANKDD1A_ENST00000496660.1_Splice_Site|ANKDD1A_ENST00000319580.8_Splice_Site	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A						signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						CAGAATGCGGTGAGTCACCGC	0.607																																					.		.											.	ANKDD1A-69	0			c.669+2T>G						.						68.0	54.0	59.0					15																	65223120		2202	4299	6501	SO:0001630	splice_region_variant	348094	exon7			ATGCGGTGAGTCA		CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.669+2T>G	15.37:g.65223120T>G		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	33	14	NM_182703	0	0	0	0	0	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Splice_Site	SNP	ENST00000380230.3	37	CCDS10197.2	.	.	.	.	.	.	.	.	.	.	T	17.32	3.360134	0.61403	.	.	ENSG00000166839	ENST00000380230;ENST00000357698;ENST00000395720;ENST00000319597;ENST00000496660;ENST00000483400;ENST00000395723	.	.	.	4.01	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.27	0.37666	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANKDD1A	63010173	1.000000	0.71417	0.940000	0.37924	0.376000	0.30014	5.235000	0.65348	1.699000	0.51192	0.459000	0.35465	.	.		0.607	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256705.2	NM_182703	Intron
IGDCC4	57722	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	65684505	65684505	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:65684505T>A	ENST00000352385.2	-	11	2298	c.2089A>T	c.(2089-2091)Aag>Tag	p.K697*		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	697	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TTCACTTTCTTCTTGAGCCGG	0.632																																					p.K697X		.											.	IGDCC4-93	0			c.A2089T						.						32.0	39.0	37.0					15																	65684505		2184	4286	6470	SO:0001587	stop_gained	57722	exon11			CTTTCTTCTTGAG		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.2089A>T	15.37:g.65684505T>A	ENSP00000319623:p.Lys697*	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	112	44	NM_020962	0	0	0	0	0	Q9HCE4	Nonsense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	T	41	8.769097	0.98948	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	.	.	.	5.49	4.38	0.52667	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-23.8407	10.907	0.47086	0.0:0.0731:0.0:0.9269	.	.	.	.	X	697;426	.	ENSP00000319623:K697X	K	-	1	0	IGDCC4	63471558	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	5.434000	0.66526	0.947000	0.37659	0.533000	0.62120	AAG	.		0.632	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
MAP2K5	5607	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	67985904	67985904	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:67985904G>T	ENST00000178640.5	+	15	1597	c.970G>T	c.(970-972)Gcg>Tcg	p.A324S	MAP2K5_ENST00000340972.4_Missense_Mutation_p.A134S|MAP2K5_ENST00000395476.2_Missense_Mutation_p.A324S|MAP2K5_ENST00000354498.5_Missense_Mutation_p.A288S	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5	324	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						TGCTTATATGGCGGTAAGTAA	0.303																																					p.A324S		.											.	MAP2K5-546	0			c.G970T						.						132.0	126.0	128.0					15																	67985904		2200	4297	6497	SO:0001583	missense	5607	exon15			TATATGGCGGTAA	U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.970G>T	15.37:g.67985904G>T	ENSP00000178640:p.Ala324Ser	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	95	30	NM_145160	0	0	0	0	0	B4DE43|Q92961|Q92962	Missense_Mutation	SNP	ENST00000178640.5	37	CCDS10224.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.107121	0.37145	.	.	ENSG00000137764	ENST00000541298;ENST00000395476;ENST00000178640;ENST00000354498;ENST00000340972	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	5.58	5.58	0.84498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	L	0.31752	0.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.02728	-1.1118	10	0.28530	T	0.3	-16.1519	19.5552	0.95342	0.0:0.0:1.0:0.0	.	134;324;324	A6NK28;Q13163-2;Q13163	.;.;MP2K5_HUMAN	S	324;324;324;288;134	ENSP00000378859:A324S;ENSP00000178640:A324S;ENSP00000346493:A288S;ENSP00000342101:A134S	ENSP00000178640:A324S	A	+	1	0	MAP2K5	65772958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.968000	0.93407	2.630000	0.89119	0.585000	0.79938	GCG	.		0.303	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257041.1	NM_145162	
ACSBG1	23205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	78485857	78485857	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:78485857C>G	ENST00000258873.4	-	5	859	c.654G>C	c.(652-654)aaG>aaC	p.K218N	ACSBG1_ENST00000558828.1_5'Flank|ACSBG1_ENST00000541759.1_Intron|ACSBG1_ENST00000560817.1_Intron	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	218					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CCTTCAGGATCTTTTCCAGCT	0.577																																					p.K218N		.											.	ACSBG1-91	0			c.G654C						.						114.0	111.0	112.0					15																	78485857		2196	4293	6489	SO:0001583	missense	23205	exon5			CAGGATCTTTTCC	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.654G>C	15.37:g.78485857C>G	ENSP00000258873:p.Lys218Asn	Somatic	124	1		WXS	Illumina HiSeq	Phase_I	148	62	NM_015162	0	0	0	0	0	B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	37	CCDS10298.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409343	0.62399	.	.	ENSG00000103740	ENST00000258873	T	0.44482	0.92	4.49	3.56	0.40772	AMP-dependent synthetase/ligase (1);	0.062950	0.64402	D	0.000012	T	0.66025	0.2748	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.984	T	0.68104	-0.5497	10	0.66056	D	0.02	-37.6924	7.8278	0.29326	0.0:0.8072:0.0:0.1928	.	214;218	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	N	218	ENSP00000258873:K218N	ENSP00000258873:K218N	K	-	3	2	ACSBG1	76272912	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.007000	0.29860	0.871000	0.35750	0.655000	0.94253	AAG	.		0.577	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162	
RASGRF1	5923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	79254568	79254568	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:79254568T>C	ENST00000419573.3	-	28	4014	c.3740A>G	c.(3739-3741)tAt>tGt	p.Y1247C	RASGRF1_ENST00000394745.3_Missense_Mutation_p.Y463C|RASGRF1_ENST00000558480.2_Missense_Mutation_p.Y1231C	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	1247	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GTCCAGTAAATATTGCGTTAC	0.468																																					p.Y1247C		.											.	RASGRF1-662	0			c.A3740G						.						58.0	56.0	56.0					15																	79254568		2196	4290	6486	SO:0001583	missense	5923	exon28			AGTAAATATTGCG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3740A>G	15.37:g.79254568T>C	ENSP00000405963:p.Tyr1247Cys	Somatic	11	0		WXS	Illumina HiSeq	Phase_I	13	5	NM_002891	0	0	0	0	0	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.169141	0.57584	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.34472	1.36;1.36	3.96	3.96	0.45880	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.64402	D	0.000003	T	0.56381	0.1981	M	0.78801	2.425	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.68483	0.867;0.958	T	0.60826	-0.7186	10	0.87932	D	0	.	9.5252	0.39160	0.0:0.0:0.0:1.0	.	1249;1231	Q13972;F8VPA5	RGRF1_HUMAN;.	C	1247;1231;463	ENSP00000405963:Y1247C;ENSP00000378228:Y463C	ENSP00000378224:Y1231C	Y	-	2	0	RASGRF1	77041623	1.000000	0.71417	0.170000	0.22879	0.948000	0.59901	6.883000	0.75595	1.545000	0.49373	0.402000	0.26972	TAT	.		0.468	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
PKD1	5310	broad.mit.edu	37	16	2142548	2142548	+	Silent	SNP	G	G	A	rs555704322		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr16:2142548G>A	ENST00000262304.4	-	39	11410	c.11202C>T	c.(11200-11202)taC>taT	p.Y3734Y	MIR1225_ENST00000408729.1_RNA|RP11-304L19.3_ENST00000565937.1_RNA|PKD1_ENST00000423118.1_Silent_p.Y3733Y|RP11-304L19.1_ENST00000570072.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3734					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TCCCGTGGACGTAGGGCAGCA	0.672													g|||	1	0.000199681	0.0	0.0	5008	,	,		16033	0.001		0.0	False		,,,				2504	0.0				p.Y3734Y													.	PKD1-91	0			c.C11202T						.						35.0	37.0	36.0					16																	2142548		2195	4296	6491	SO:0001819	synonymous_variant	5310	exon39			GTGGACGTAGGGC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.11202C>T	16.37:g.2142548G>A		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	53	4	NM_001009944	0	0	10	10	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.		0.672	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
SENP3	26168	broad.mit.edu	37	17	7470323	7470323	+	Splice_Site	SNP	G	G	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr17:7470323G>A	ENST00000429205.2	+	8	1390		c.e8+1		SENP3_ENST00000578868.1_Splice_Site|SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000321337.7_Splice_Site			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3							cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				GACCAAAAACGTGAGTTTTGA	0.408																																					.													.	SENP3-659	0			c.1341+1G>A						.						194.0	207.0	203.0					17																	7470323		1015	2129	3144	SO:0001630	splice_region_variant	26168	exon8			AAAAACGTGAGTT	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.1341+1G>A	17.37:g.7470323G>A		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	15	3	NM_015670	0	0	0	0	0	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Splice_Site	SNP	ENST00000429205.2	37		.	.	.	.	.	.	.	.	.	.	G	20.3	3.967950	0.74131	.	.	ENSG00000161956	ENST00000321337;ENST00000429205	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4768	0.84134	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SENP3	7411047	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.891000	0.87319	2.550000	0.86006	0.514000	0.50259	.	.		0.408	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015670	Intron
MYH8	4626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10312636	10312636	+	Silent	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr17:10312636A>T	ENST00000403437.2	-	16	1951	c.1857T>A	c.(1855-1857)acT>acA	p.T619T	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	619	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GACTGGCTAGAGTCTTCATTG	0.423									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.T619T		.											.	MYH8-101	0			c.T1857A						.						67.0	69.0	68.0					17																	10312636		2203	4300	6503	SO:0001819	synonymous_variant	4626	exon16	Familial Cancer Database	Carney Complex Variant	GGCTAGAGTCTTC		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.1857T>A	17.37:g.10312636A>T		Somatic	124	0		WXS	Illumina HiSeq	Phase_I	147	77	NM_002472	0	0	0	0	0	Q14910	Silent	SNP	ENST00000403437.2	37	CCDS11153.1																																																																																			.		0.423	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
AATK	9625	hgsc.bcm.edu	37	17	79096272	79096272	+	Missense_Mutation	SNP	C	C	A	rs371390882	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr17:79096272C>A	ENST00000326724.4	-	11	1488	c.1464G>T	c.(1462-1464)gaG>gaT	p.E488D	AATK_ENST00000572339.1_5'Flank|MIR657_ENST00000385003.1_RNA|AATK_ENST00000417379.1_Missense_Mutation_p.E385D	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	488					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCGGGAAGGCCTCCGCGCCGC	0.746													C|||	13	0.00259585	0.0098	0.0	5008	,	,		6046	0.0		0.0	False		,,,				2504	0.0				p.E488D		.											.	AATK-933	0			c.G1464T						.	C	ASP/GLU,ASP/GLU	17,2637		0,17,1310	2.0	3.0	3.0		1464,1155	-0.8	0.0	17		3	0,5580		0,0,2790	no	missense,missense	AATK	NM_001080395.2,NM_004920.2	45,45	0,17,4100	AA,AC,CC		0.0,0.6405,0.2065	probably-damaging,probably-damaging	488/1375,385/1272	79096272	17,8217	1327	2790	4117	SO:0001583	missense	9625	exon11			GAAGGCCTCCGCG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1464G>T	17.37:g.79096272C>A	ENSP00000324196:p.Glu488Asp	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	6	3	NM_001080395	0	0	1	1	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.968|8.968	0.972137|0.972137	0.18736|0.18736	0.006405|0.006405	0.0|0.0	ENSG00000181409|ENSG00000181409	ENST00000326724|ENST00000417379	T|.	0.78595|.	-1.19|.	3.88|3.88	-0.75|-0.75	0.11080|0.11080	.|.	0.224693|.	0.37669|.	N|.	0.001994|.	T|T	0.24967|0.24967	0.0606|0.0606	L|L	0.43923|0.43923	1.385|1.385	0.09310|0.09310	N|N	1|1	P|.	0.36144|.	0.539|.	B|.	0.33254|.	0.16|.	T|T	0.26018|0.26018	-1.0115|-1.0115	10|5	0.62326|.	D|.	0.03|.	.|.	3.6985|3.6985	0.08374|0.08374	0.2648:0.3981:0.2583:0.0788|0.2648:0.3981:0.2583:0.0788	.|.	488|.	Q6ZMQ8|.	LMTK1_HUMAN|.	D|M	488|441	ENSP00000324196:E488D|.	ENSP00000324196:E488D|.	E|R	-|-	3|2	2|0	AATK|AATK	76710867|76710867	0.305000|0.305000	0.24481|0.24481	0.018000|0.018000	0.16275|0.16275	0.125000|0.125000	0.20455|0.20455	0.342000|0.342000	0.19926|0.19926	-0.284000|-0.284000	0.09102|0.09102	-0.304000|-0.304000	0.09214|0.09214	GAG|AGG	.		0.746	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
MISP	126353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	758211	758211	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:758211C>A	ENST00000215582.6	+	2	1368	c.1265C>A	c.(1264-1266)cCt>cAt	p.P422H		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	422					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CGCATCCCACCTGATGCCTAC	0.652																																					p.P422H		.											.	C19orf21-91	0			c.C1265A						.						25.0	20.0	22.0					19																	758211		2201	4298	6499	SO:0001583	missense	126353	exon2			TCCCACCTGATGC	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1265C>A	19.37:g.758211C>A	ENSP00000215582:p.Pro422His	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	47	25	NM_173481	0	0	2	5	3		Missense_Mutation	SNP	ENST00000215582.6	37	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819234	0.50633	.	.	ENSG00000099812	ENST00000215582	T	0.35421	1.31	4.11	-1.68	0.08212	.	2.124670	0.02785	N	0.121388	T	0.47173	0.1431	L	0.54323	1.7	0.09310	N	1	D	0.69078	0.997	P	0.57548	0.823	T	0.41875	-0.9484	10	0.59425	D	0.04	-0.009	5.8678	0.18786	0.0:0.4423:0.1475:0.4102	.	422	Q8IVT2	CS021_HUMAN	H	422	ENSP00000215582:P422H	ENSP00000215582:P422H	P	+	2	0	C19orf21	709211	0.000000	0.05858	0.001000	0.08648	0.398000	0.30690	-0.883000	0.04170	-0.165000	0.10908	0.491000	0.48974	CCT	.		0.652	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
TUBB4A	10382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	6501326	6501326	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:6501326C>A	ENST00000264071.2	-	3	620	c.249G>T	c.(247-249)caG>caT	p.Q83H	TUBB4A_ENST00000598006.1_Missense_Mutation_p.R69I|TUBB4A_ENST00000540257.1_Missense_Mutation_p.Q83H|TUBB4A_ENST00000596926.1_Missense_Mutation_p.Q83H|TUBB4A_ENST00000601152.1_Missense_Mutation_p.R58I			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	83					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										GCCGAAAGATCTGACCGAAGG	0.577																																					p.Q83H		.											.	.	0			c.G249T						.						49.0	44.0	46.0					19																	6501326		2203	4300	6503	SO:0001583	missense	10382	exon3			AAAGATCTGACCG	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.249G>T	19.37:g.6501326C>A	ENSP00000264071:p.Gln83His	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	53	27	NM_006087	0	0	4	9	5	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	C	5.184	0.219490	0.09863	.	.	ENSG00000104833	ENST00000264071;ENST00000540257;ENST00000412858	T;T	0.70164	-0.46;-0.46	3.83	1.13	0.20643	.	0.000000	0.64402	D	0.000003	T	0.65491	0.2696	M	0.82923	2.615	0.40614	D	0.981708	B	0.10296	0.003	B	0.08055	0.003	T	0.67039	-0.5771	10	0.87932	D	0	.	9.7907	0.40704	0.0:0.7717:0.0:0.2283	.	83	P04350	TBB4A_HUMAN	H	83	ENSP00000264071:Q83H;ENSP00000443590:Q83H	ENSP00000264071:Q83H	Q	-	3	2	TUBB4	6452326	1.000000	0.71417	1.000000	0.80357	0.432000	0.31715	2.026000	0.41069	0.592000	0.29728	0.313000	0.20887	CAG	.		0.577	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
ZNF557	79230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7083599	7083599	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:7083599T>C	ENST00000439035.2	+	8	1356	c.1116T>C	c.(1114-1116)agT>agC	p.S372S	ZNF557_ENST00000414706.1_Silent_p.S379S|ZNF557_ENST00000252840.6_Silent_p.S379S			Q8N988	ZN557_HUMAN	zinc finger protein 557	372					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17				Lung(535;0.179)		ATGAGTGCAGTGATTGTGGAA	0.368																																					p.S379S		.											.	ZNF557-92	0			c.T1137C						.						64.0	68.0	67.0					19																	7083599		2125	4254	6379	SO:0001819	synonymous_variant	79230	exon8			GTGCAGTGATTGT	AK095524	CCDS42485.1, CCDS45945.1	19p13.2	2013-09-20			ENSG00000130544	ENSG00000130544		"""Zinc fingers, C2H2-type"", ""-"""	28632	protein-coding gene	gene with protein product						12477932	Standard	NM_024341		Approved	MGC4054	uc002mgc.3	Q8N988	OTTHUMG00000181977	ENST00000439035.2:c.1116T>C	19.37:g.7083599T>C		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	65	16	NM_001044387	0	0	0	1	1	Q6PEJ3|Q9BTZ1	Silent	SNP	ENST00000439035.2	37	CCDS45945.1																																																																																			.		0.368	ZNF557-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458502.1	NM_024341	
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11135092	11135092	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:11135092A>G	ENST00000429416.3	+	22	3340	c.3059A>G	c.(3058-3060)gAt>gGt	p.D1020G	SMARCA4_ENST00000590574.1_Missense_Mutation_p.D1020G|SMARCA4_ENST00000589677.1_Missense_Mutation_p.D1020G|SMARCA4_ENST00000358026.2_Missense_Mutation_p.D1020G|SMARCA4_ENST00000344626.4_Missense_Mutation_p.D1020G|SMARCA4_ENST00000541122.2_Missense_Mutation_p.D1020G|SMARCA4_ENST00000413806.3_Missense_Mutation_p.D1020G|SMARCA4_ENST00000444061.3_Missense_Mutation_p.D1020G|SMARCA4_ENST00000450717.3_Missense_Mutation_p.D1020G	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1020					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CTGCTGACTGATGGCTCCGAG	0.632			"""F, N, Mis"""		NSCLC																																p.D1020G		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4-1523	1	Unknown(1)	lung(1)	c.A3059G						.						73.0	58.0	63.0					19																	11135092		2203	4300	6503	SO:0001583	missense	6597	exon21			TGACTGATGGCTC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3059A>G	19.37:g.11135092A>G	ENSP00000395654:p.Asp1020Gly	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	66	21	NM_003072	0	0	18	31	13	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	A	16.59	3.166378	0.57476	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	4.76	4.76	0.60689	SNF2-related (1);	0.000000	0.85682	D	0.000000	T	0.82130	0.4970	L	0.37897	1.145	0.58432	D	0.999994	D;B;P;B;D;B;P;P	0.56287	0.975;0.418;0.78;0.002;0.975;0.0;0.78;0.78	P;B;B;B;P;B;P;P	0.57720	0.826;0.304;0.377;0.007;0.826;0.014;0.531;0.531	D	0.84375	0.0546	10	0.87932	D	0	-36.5944	13.3812	0.60768	1.0:0.0:0.0:0.0	.	1020;1020;1020;1020;1020;240;1020;1020	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	G	1020;1020;1084;1020;1020;1020;1020;1020	ENSP00000395654:D1020G;ENSP00000350720:D1020G;ENSP00000343896:D1020G;ENSP00000445036:D1020G;ENSP00000392837:D1020G;ENSP00000397783:D1020G;ENSP00000414727:D1020G	ENSP00000343896:D1020G	D	+	2	0	SMARCA4	10996092	1.000000	0.71417	0.922000	0.36590	0.498000	0.33706	8.908000	0.92640	1.997000	0.58415	0.533000	0.62120	GAT	.		0.632	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
ZNF443	10224	hgsc.bcm.edu;broad.mit.edu	37	19	12541116	12541116	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:12541116C>T	ENST00000301547.5	-	4	2067	c.1870G>A	c.(1870-1872)Gca>Aca	p.A624T	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	624					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						GAAGCAAATGCTTTCCCACAT	0.408																																					p.A624T		.											.	ZNF443-91	0			c.G1870A						.						62.0	68.0	66.0					19																	12541116		2200	4292	6492	SO:0001583	missense	10224	exon4			CAAATGCTTTCCC	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1870G>A	19.37:g.12541116C>T	ENSP00000301547:p.Ala624Thr	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	218	64	NM_005815	0	0	3	4	1		Missense_Mutation	SNP	ENST00000301547.5	37	CCDS32918.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473549	0.26423	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	T	0.13778	2.56	1.36	-0.965	0.10323	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09686	0.0238	L	0.28504	0.86	0.09310	N	1	B	0.30664	0.289	B	0.37888	0.26	T	0.39231	-0.9624	9	0.38643	T	0.18	.	1.9484	0.03361	0.2638:0.3516:0.0:0.3846	.	624	Q9Y2A4	ZN443_HUMAN	T	624;596	ENSP00000301547:A624T	ENSP00000301547:A624T	A	-	1	0	ZNF443	12402116	0.000000	0.05858	0.001000	0.08648	0.586000	0.36452	-1.775000	0.01783	-0.214000	0.10078	0.454000	0.30748	GCA	.		0.408	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815	
NOSIP	51070	hgsc.bcm.edu	37	19	50060443	50060443	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:50060443G>C	ENST00000596358.1	-	5	380	c.322C>G	c.(322-324)Cag>Gag	p.Q108E	NOSIP_ENST00000339093.3_Missense_Mutation_p.Q108E|NOSIP_ENST00000391853.3_Missense_Mutation_p.Q108E	NM_001270960.1	NP_001257889.1	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	108					negative regulation of catalytic activity (GO:0043086)|negative regulation of nitric-oxide synthase activity (GO:0051001)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|skin(2)|urinary_tract(1)	11		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		ACATGGTCCTGCGAGGCCGCC	0.682																																					p.Q108E		.											.	NOSIP-91	0			c.C322G						.						24.0	25.0	25.0					19																	50060443		2203	4300	6503	SO:0001583	missense	51070	exon6			GGTCCTGCGAGGC	AF132959	CCDS12772.1	19q13.3	2008-02-05				ENSG00000142546			17946	protein-coding gene	gene with protein product						11149895, 10810093	Standard	NM_015953		Approved	CGI-25	uc002pol.4	Q9Y314		ENST00000596358.1:c.322C>G	19.37:g.50060443G>C	ENSP00000470034:p.Gln108Glu	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	21	2	NM_015953	0	0	36	36	0	Q96FD2	Missense_Mutation	SNP	ENST00000596358.1	37	CCDS12772.1	.	.	.	.	.	.	.	.	.	.	G	3.928	-0.016700	0.07681	.	.	ENSG00000142546	ENST00000339093;ENST00000391853	T;T	0.75938	-0.98;-0.98	5.15	2.91	0.33838	.	0.386687	0.27214	N	0.020382	T	0.47192	0.1432	N	0.11673	0.155	0.32994	D	0.525399	B	0.09022	0.002	B	0.08055	0.003	T	0.47262	-0.9131	10	0.02654	T	1	-32.2216	7.9334	0.29916	0.0:0.158:0.5163:0.3258	.	108	Q9Y314	NOSIP_HUMAN	E	108	ENSP00000343497:Q108E;ENSP00000375726:Q108E	ENSP00000343497:Q108E	Q	-	1	0	NOSIP	54752255	0.887000	0.30362	0.516000	0.27786	0.517000	0.34286	1.364000	0.34171	0.501000	0.28013	0.462000	0.41574	CAG	.		0.682	NOSIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465423.1		
ZSCAN5A	79149	bcgsc.ca	37	19	56733626	56733626	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:56733626T>C	ENST00000587340.1	-	7	1504	c.809A>G	c.(808-810)gAc>gGc	p.D270G	ZSCAN5A_ENST00000254165.3_Missense_Mutation_p.D153G|ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.D269G|ZSCAN5A_ENST00000587492.1_Missense_Mutation_p.D124G|ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.D270G			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	270					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGAAGGTGTGTCAGCATCCAC	0.512																																					p.D270G													.	ZSCAN5A-155	0			c.A809G						.						98.0	99.0	98.0					19																	56733626		2203	4300	6503	SO:0001583	missense	79149	exon5			GGTGTGTCAGCAT	AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.809A>G	19.37:g.56733626T>C	ENSP00000467631:p.Asp270Gly	Somatic	178	3		WXS	Illumina HiSeq	Phase_1	176	7	NM_024303	0	0	2	2	0	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	ENST00000587340.1	37	CCDS12941.1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.784761	0.31593	.	.	ENSG00000131848	ENST00000391713;ENST00000254165	T;T	0.06768	3.28;3.26	1.94	-2.12	0.07165	.	.	.	.	.	T	0.20495	0.0493	M	0.78916	2.43	0.09310	N	1	D;D	0.89917	1.0;0.997	D;D	0.83275	0.996;0.989	T	0.09885	-1.0654	9	0.40728	T	0.16	.	2.5813	0.04819	0.4024:0.1449:0.0:0.4527	.	153;270	B4DX98;Q9BUG6	.;ZSA5A_HUMAN	G	270;153	ENSP00000375593:D270G;ENSP00000254165:D153G	ENSP00000254165:D153G	D	-	2	0	ZSCAN5A	61425438	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.127000	0.10547	-0.687000	0.05162	-0.496000	0.04628	GAC	.		0.512	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458110.1	NM_024303	
SLC30A6	55676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32422810	32422810	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:32422810T>A	ENST00000282587.5	+	10	617	c.580T>A	c.(580-582)Ttc>Atc	p.F194I	SLC30A6_ENST00000357055.3_5'UTR|SLC30A6_ENST00000435660.1_Missense_Mutation_p.F194I|SLC30A6_ENST00000406369.1_Missense_Mutation_p.F120I|SLC30A6_ENST00000379343.2_Missense_Mutation_p.F234I|SLC30A6_ENST00000538303.1_Missense_Mutation_p.F165I	NM_017964.3	NP_060434.2	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter), member 6	194					cellular protein metabolic process (GO:0044267)|Golgi to endosome transport (GO:0006895)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(4)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TAGCAGTATCTTCCTTCCCCG	0.348																																					p.F234I		.											.	SLC30A6-90	0			c.T700A						.						195.0	185.0	188.0					2																	32422810		2203	4300	6503	SO:0001583	missense	55676	exon11			AGTATCTTCCTTC	AK055663	CCDS1780.1, CCDS54341.1, CCDS54342.1, CCDS54343.1	2p22.3	2013-05-22			ENSG00000152683	ENSG00000152683		"""Solute carriers"""	19305	protein-coding gene	gene with protein product		611148					Standard	NM_017964		Approved	FLJ31101, ZNT6	uc002rof.2	Q6NXT4	OTTHUMG00000128456	ENST00000282587.5:c.580T>A	2.37:g.32422810T>A	ENSP00000282587:p.Phe194Ile	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	151	58	NM_001193513	0	0	0	1	1	A5YM45|B7Z901|Q8N5C9|Q96NC3	Missense_Mutation	SNP	ENST00000282587.5	37	CCDS1780.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.093791	0.76870	.	.	ENSG00000152683	ENST00000379343;ENST00000440718;ENST00000282587;ENST00000435660;ENST00000538303;ENST00000406369	T;T;T;T;T;T	0.62105	0.07;0.05;0.07;0.07;0.07;0.07	6.07	6.07	0.98685	.	0.101567	0.64402	D	0.000002	T	0.57051	0.2027	L	0.34521	1.04	0.80722	D	1	B;B;B;B	0.34399	0.367;0.452;0.202;0.31	B;B;B;B	0.40702	0.338;0.164;0.205;0.113	T	0.53457	-0.8436	10	0.23302	T	0.38	-14.6144	15.6102	0.76710	0.0:0.0:0.0:1.0	.	165;194;234;194	B7Z901;Q6NXT4-3;Q6NXT4-2;Q6NXT4	.;.;.;ZNT6_HUMAN	I	234;165;194;194;165;120	ENSP00000368648:F234I;ENSP00000393946:F165I;ENSP00000282587:F194I;ENSP00000399005:F194I;ENSP00000440678:F165I;ENSP00000384041:F120I	ENSP00000282587:F194I	F	+	1	0	SLC30A6	32276314	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.462000	0.66707	2.330000	0.79161	0.528000	0.53228	TTC	.		0.348	SLC30A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250254.2		
MTIF2	4528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55470636	55470636	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:55470636A>G	ENST00000263629.4	-	12	1795	c.1480T>C	c.(1480-1482)Ttt>Ctt	p.F494L	MTIF2_ENST00000403721.1_Missense_Mutation_p.F494L|MTIF2_ENST00000394600.3_Missense_Mutation_p.F494L	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	494					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CTTTCTAAAAACCGTAGAATT	0.338																																					p.F494L		.											.	MTIF2-91	0			c.T1480C						.						146.0	146.0	146.0					2																	55470636		2203	4300	6503	SO:0001583	missense	4528	exon12			CTAAAAACCGTAG	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1480T>C	2.37:g.55470636A>G	ENSP00000263629:p.Phe494Leu	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	145	48	NM_002453	0	0	9	14	5	D6W5D0	Missense_Mutation	SNP	ENST00000263629.4	37	CCDS1853.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.584682	0.28268	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000418823	T;T;T;T	0.56275	0.47;0.47;0.47;1.05	5.6	5.6	0.85130	Translation initiation factor IF- 2, domain 3 (1);	0.270733	0.37577	N	0.002040	T	0.41766	0.1173	L	0.38175	1.15	0.42010	D	0.990935	B	0.02656	0.0	B	0.01281	0.0	T	0.33394	-0.9870	10	0.09084	T	0.74	-2.2567	15.7861	0.78304	1.0:0.0:0.0:0.0	.	494	P46199	IF2M_HUMAN	L	494;494;494;172	ENSP00000384481:F494L;ENSP00000263629:F494L;ENSP00000378099:F494L;ENSP00000403492:F172L	ENSP00000263629:F494L	F	-	1	0	MTIF2	55324140	1.000000	0.71417	0.207000	0.23584	0.007000	0.05969	6.152000	0.71812	2.136000	0.66102	0.533000	0.62120	TTT	.		0.338	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453	
USP34	9736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	61493234	61493234	+	Silent	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:61493234C>T	ENST00000398571.2	-	42	5578	c.5502G>A	c.(5500-5502)aaG>aaA	p.K1834K		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1834					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GTGATTTGCACTTTGGCTGTT	0.408																																					p.K1834K		.											.	USP34-579	0			c.G5502A						.						123.0	111.0	115.0					2																	61493234		1848	4096	5944	SO:0001819	synonymous_variant	9736	exon42			TTTGCACTTTGGC	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5502G>A	2.37:g.61493234C>T		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	82	33	NM_014709	0	0	3	4	1	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1																																																																																			.		0.408	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
RAB3GAP1	22930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	135891507	135891507	+	Missense_Mutation	SNP	A	A	G	rs578182809		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:135891507A>G	ENST00000264158.8	+	15	1446	c.1403A>G	c.(1402-1404)aAt>aGt	p.N468S	RAB3GAP1_ENST00000487003.1_3'UTR|ZRANB3_ENST00000412849.1_5'Flank|RAB3GAP1_ENST00000539493.1_Missense_Mutation_p.N424S|SNORA40_ENST00000385573.1_RNA|RAB3GAP1_ENST00000442034.1_Missense_Mutation_p.N468S	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	468					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		TGTATGATCAATTTTTACCAT	0.383													A|||	1	0.000199681	0.0008	0.0	5008	,	,		16221	0.0		0.0	False		,,,				2504	0.0				p.N468S		.											.	RAB3GAP1-92	0			c.A1403G						.						134.0	133.0	133.0					2																	135891507		2203	4300	6503	SO:0001583	missense	22930	exon15			TGATCAATTTTTA	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.1403A>G	2.37:g.135891507A>G	ENSP00000264158:p.Asn468Ser	Somatic	157	0		WXS	Illumina HiSeq	Phase_I	128	46	NM_001172435	0	0	7	11	4	A6H8Z3|C9J837|Q659F5|Q8TBB4	Missense_Mutation	SNP	ENST00000264158.8	37	CCDS33294.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421038	0.83559	.	.	ENSG00000115839	ENST00000264158;ENST00000539493;ENST00000442034	T;T;T	0.48522	0.81;0.81;0.81	4.95	4.95	0.65309	.	0.043485	0.85682	D	0.000000	T	0.58337	0.2115	L	0.50333	1.59	0.58432	D	0.999995	D;D	0.76494	0.999;0.999	D;P	0.63283	0.913;0.883	T	0.53570	-0.8420	10	0.22109	T	0.4	-20.1443	14.9142	0.70781	1.0:0.0:0.0:0.0	.	468;468	C9J837;Q15042	.;RB3GP_HUMAN	S	468;424;468	ENSP00000264158:N468S;ENSP00000444306:N424S;ENSP00000411418:N468S	ENSP00000264158:N468S	N	+	2	0	RAB3GAP1	135607977	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.127000	0.94417	1.992000	0.58205	0.482000	0.46254	AAT	.		0.383	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233	
TNS1	7145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	218713668	218713668	+	Silent	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:218713668C>G	ENST00000171887.4	-	17	1649	c.1197G>C	c.(1195-1197)acG>acC	p.T399T	TNS1_ENST00000419504.1_Silent_p.T399T|TNS1_ENST00000430930.1_Silent_p.T399T|TNS1_ENST00000480665.1_5'UTR	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	399					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TCACAGAAAGCGTGTGTTCCA	0.612																																					p.T399T		.											.	TNS1-156	0			c.G1197C						.						143.0	137.0	139.0					2																	218713668		2203	4300	6503	SO:0001819	synonymous_variant	7145	exon17			AGAAAGCGTGTGT	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1197G>C	2.37:g.218713668C>G		Somatic	195	1		WXS	Illumina HiSeq	Phase_I	226	95	NM_022648	0	0	3	3	0	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	37	CCDS2407.1																																																																																			.		0.612	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
DNMT3B	1789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31374365	31374365	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr20:31374365C>G	ENST00000328111.2	+	5	685	c.364C>G	c.(364-366)Cgt>Ggt	p.R122G	DNMT3B_ENST00000456297.2_Intron|DNMT3B_ENST00000201963.3_Missense_Mutation_p.R134G|DNMT3B_ENST00000344505.4_Missense_Mutation_p.R122G|DNMT3B_ENST00000353855.2_Missense_Mutation_p.R122G|DNMT3B_ENST00000348286.2_Missense_Mutation_p.R122G|DNMT3B_ENST00000375623.4_Intron|DNMT3B_ENST00000443239.3_Intron	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	122	Interaction with DNMT1 and DNMT3A.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)	p.R134C(1)|p.R122C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCCTTCCCCACGTTCCACCCG	0.632																																					p.R134G		.											.	DNMT3B-660	2	Substitution - Missense(2)	lung(2)	c.C400G						.						68.0	66.0	66.0					20																	31374365		2203	4300	6503	SO:0001583	missense	1789	exon5			TCCCCACGTTCCA		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.364C>G	20.37:g.31374365C>G	ENSP00000328547:p.Arg122Gly	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	123	54	NM_175850	0	0	0	1	1	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	37	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.465264	0.26335	.	.	ENSG00000088305	ENST00000328111;ENST00000537219;ENST00000353855;ENST00000348286;ENST00000344505;ENST00000201963	D;D;D;D;D	0.98400	-4.67;-4.89;-4.82;-4.77;-4.91	4.84	3.86	0.44501	.	0.246993	0.38326	N	0.001738	D	0.97219	0.9091	L	0.27053	0.805	0.23070	N	0.998346	D;P;P;P	0.71674	0.998;0.811;0.804;0.752	D;B;B;B	0.80764	0.994;0.309;0.28;0.191	D	0.92382	0.5914	10	0.26408	T	0.33	-6.5354	9.8664	0.41145	0.2125:0.7875:0.0:0.0	.	134;122;122;122	Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;DNM3B_HUMAN	G	122;208;122;122;122;134	ENSP00000328547:R122G;ENSP00000313397:R122G;ENSP00000337764:R122G;ENSP00000345105:R122G;ENSP00000201963:R134G	ENSP00000201963:R134G	R	+	1	0	DNMT3B	30838026	0.456000	0.25744	0.018000	0.16275	0.031000	0.12232	1.919000	0.40015	1.211000	0.43351	0.561000	0.74099	CGT	.		0.632	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
MMP24	10893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	33851627	33851627	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr20:33851627T>C	ENST00000246186.6	+	5	936	c.851T>C	c.(850-852)cTg>cCg	p.L284P	MMP24-AS1_ENST00000438751.1_RNA|MMP24-AS1_ENST00000454184.1_RNA|MMP24-AS1_ENST00000456350.1_RNA|MMP24-AS1_ENST00000433764.1_RNA|MMP24-AS1_ENST00000566203.2_RNA|EDEM2_ENST00000540582.1_Intron|MMP24-AS1_ENST00000453892.1_RNA	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)	284					cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	GTGCATGAGCTGGGCCACGCG	0.622																																					p.L284P		.											.	.	0			c.T851C						.						24.0	24.0	24.0					20																	33851627		2203	4300	6503	SO:0001583	missense	10893	exon5			ATGAGCTGGGCCA	AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330	ENST00000246186.6:c.851T>C	20.37:g.33851627T>C	ENSP00000246186:p.Leu284Pro	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	23	10	NM_006690	0	0	7	10	3	B7ZBG8|Q9H440	Missense_Mutation	SNP	ENST00000246186.6	37	CCDS46593.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546808	0.86022	.	.	ENSG00000125966	ENST00000246186;ENST00000540655	T	0.35605	1.3	5.05	5.05	0.67936	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.64402	D	0.000004	T	0.72145	0.3424	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82337	-0.0507	10	0.87932	D	0	.	14.1037	0.65075	0.0:0.0:0.0:1.0	.	284	Q9Y5R2	MMP24_HUMAN	P	284;232	ENSP00000246186:L284P	ENSP00000246186:L284P	L	+	2	0	MMP24	33315043	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.819000	0.86621	2.105000	0.64084	0.533000	0.62120	CTG	.		0.622	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078851.4	NM_006690	
KRTAP10-12	386685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	46117131	46117131	+	Silent	SNP	C	C	T	rs554572469|rs372249758	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr21:46117131C>T	ENST00000400365.3	+	1	45	c.15C>T	c.(13-15)tcC>tcT	p.S5S	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	5						keratin filament (GO:0045095)				large_intestine(1)|lung(8)	9						CCGTCTGCTCCAGCGACCTGA	0.632																																					p.S5S		.											.	KRTAP10-12-90	0			c.C15T						.	C	,	0,4330		0,0,2165	83.0	95.0	91.0		,15	2.2	1.0	21		91	1,8545		0,1,4272	no	intron,coding-synonymous	TSPEAR,KRTAP10-12	NM_144991.2,NM_198699.1	,	0,1,6437	TT,TC,CC		0.0117,0.0,0.0078	,	,5/246	46117131	1,12875	2165	4273	6438	SO:0001819	synonymous_variant	386685	exon1			CTGCTCCAGCGAC	AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	ENST00000400365.3:c.15C>T	21.37:g.46117131C>T		Somatic	217	0		WXS	Illumina HiSeq	Phase_I	188	70	NM_198699	0	0	0	0	0	B2RPA3	Silent	SNP	ENST00000400365.3	37	CCDS42967.1																																																																																			.		0.632	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699	
C21orf58	54058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47731374	47731374	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr21:47731374C>A	ENST00000291691.7	-	6	1853	c.717G>T	c.(715-717)aaG>aaT	p.K239N	C21orf58_ENST00000472607.1_5'UTR|C21orf58_ENST00000397679.1_Missense_Mutation_p.K133N|C21orf58_ENST00000397680.1_Missense_Mutation_p.K133N|C21orf58_ENST00000397683.1_Missense_Mutation_p.K133N|C21orf58_ENST00000397682.3_Missense_Mutation_p.K133N	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	239										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		ACTTACCTTCCTTAATACTTC	0.488																																					p.K239N		.											.	C21orf58-91	0			c.G717T						.						109.0	90.0	97.0					21																	47731374		2202	4299	6501	SO:0001583	missense	54058	exon6			ACCTTCCTTAATA		CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.717G>T	21.37:g.47731374C>A	ENSP00000291691:p.Lys239Asn	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	19	9	NM_058180	0	0	0	0	0	B3KPI1	Missense_Mutation	SNP	ENST00000291691.7	37	CCDS13735.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.674609	0.47781	.	.	ENSG00000160298	ENST00000397683;ENST00000417060;ENST00000397682;ENST00000291691;ENST00000397679;ENST00000397680	T;T;T;T;T;T	0.68903	0.21;-0.34;0.21;-0.36;0.21;0.21	5.46	1.62	0.23740	.	0.148272	0.42548	D	0.000695	T	0.69806	0.3152	L	0.39898	1.24	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.79784	0.993;0.993;0.985	T	0.68911	-0.5284	10	0.87932	D	0	-21.1468	7.2122	0.25939	0.0:0.6518:0.0:0.3482	.	239;133;239	P58505;Q8N7N9;P58505-2	CU058_HUMAN;.;.	N	133;201;133;239;133;133	ENSP00000380799:K133N;ENSP00000402356:K201N;ENSP00000380798:K133N;ENSP00000291691:K239N;ENSP00000380796:K133N;ENSP00000380797:K133N	ENSP00000291691:K239N	K	-	3	2	C21orf58	46555802	0.998000	0.40836	1.000000	0.80357	0.392000	0.30506	0.249000	0.18216	0.711000	0.32018	-0.199000	0.12753	AAG	.		0.488	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207283.1	NM_058180	
ZNRF3	84133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	29445939	29445939	+	Silent	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr22:29445939C>G	ENST00000544604.2	+	8	1945	c.1770C>G	c.(1768-1770)ctC>ctG	p.L590L	ZNRF3_ENST00000406323.3_Silent_p.L490L|ZNRF3_ENST00000402174.1_Silent_p.L490L|ZNRF3_ENST00000332811.4_Silent_p.L490L	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	590					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						GCAGCTCCCTCAGCAGCGACT	0.672																																					p.L590L		.											.	ZNRF3-69	0			c.C1770G						.						54.0	62.0	59.0					22																	29445939		2076	4222	6298	SO:0001819	synonymous_variant	84133	exon8			CTCCCTCAGCAGC	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.1770C>G	22.37:g.29445939C>G		Somatic	220	0		WXS	Illumina HiSeq	Phase_I	235	81	NM_001206998	0	0	6	6	0	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Silent	SNP	ENST00000544604.2	37	CCDS56225.1																																																																																			.		0.672	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	
C3orf22	152065	ucsc.edu;bcgsc.ca	37	3	126268739	126268739	+	Missense_Mutation	SNP	G	G	A	rs373190783		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr3:126268739G>A	ENST00000318225.2	-	4	776	c.398C>T	c.(397-399)gCg>gTg	p.A133V		NM_152533.1	NP_689746.1	Q8N5N4	CC022_HUMAN	chromosome 3 open reading frame 22	133										large_intestine(1)|lung(3)|ovary(2)|prostate(1)	7				GBM - Glioblastoma multiforme(114;0.147)		CAGCCCTGCCGCCTTGCTGGT	0.627																																					p.A133V													.	C3orf22-90	0			c.C398T						.	G	VAL/ALA	0,4406		0,0,2203	55.0	53.0	54.0		398	-0.5	0.0	3		54	1,8599	1.2+/-3.3	0,1,4299	no	missense	C3orf22	NM_152533.1	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	133/142	126268739	1,13005	2203	4300	6503	SO:0001583	missense	152065	exon4			CCTGCCGCCTTGC		CCDS3040.1	3q21.3	2011-09-30			ENSG00000180697	ENSG00000180697			28534	protein-coding gene	gene with protein product						12477932	Standard	NM_152533		Approved	MGC34728	uc003ejb.3	Q8N5N4	OTTHUMG00000162731	ENST00000318225.2:c.398C>T	3.37:g.126268739G>A	ENSP00000316644:p.Ala133Val	Somatic	54	0		WXS	Illumina HiSeq		34	4	NM_152533	0	0	0	0	0	B3KUS9	Missense_Mutation	SNP	ENST00000318225.2	37	CCDS3040.1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228530	0.39399	0.0	1.16E-4	ENSG00000180697	ENST00000318225	.	.	.	1.92	-0.536	0.11876	.	.	.	.	.	T	0.09818	0.0241	N	0.19112	0.55	0.09310	N	1	P	0.41188	0.741	B	0.25405	0.06	T	0.22730	-1.0208	8	0.02654	T	1	6.4871	4.5161	0.11935	0.4702:0.0:0.5298:0.0	.	133	Q8N5N4	CC022_HUMAN	V	133	.	ENSP00000316644:A133V	A	-	2	0	C3orf22	127751429	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.292000	0.08332	-0.154000	0.11118	0.313000	0.20887	GCG	.		0.627	C3orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370231.2	NM_152533	
ABTB1	80325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	127396051	127396051	+	Silent	SNP	C	C	A	rs368024563		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr3:127396051C>A	ENST00000232744.8	+	8	770	c.684C>A	c.(682-684)atC>atA	p.I228I	ABTB1_ENST00000453791.2_Silent_p.I86I|ABTB1_ENST00000393363.3_Silent_p.I86I|ABTB1_ENST00000468137.1_Silent_p.I86I					ankyrin repeat and BTB (POZ) domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						TGCTGACCATCGAGCCCCCAC	0.682																																					p.I228I		.											.	ABTB1-90	0			c.C684A						.						36.0	32.0	33.0					3																	127396051		2201	4297	6498	SO:0001819	synonymous_variant	80325	exon8			GACCATCGAGCCC	AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.684C>A	3.37:g.127396051C>A		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	19	8	NM_172027	0	0	18	27	9		Silent	SNP	ENST00000232744.8	37	CCDS3045.1																																																																																			.		0.682	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356595.1	NM_172027	
LSG1	55341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	194379786	194379786	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr3:194379786T>G	ENST00000265245.5	-	7	973	c.659A>C	c.(658-660)gAg>gCg	p.E220A		NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	220	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		ACTCCGCTGCTCAGCAGTCAG	0.458																																					p.E220A		.											.	LSG1-90	0			c.A659C						.						160.0	168.0	165.0					3																	194379786		2203	4300	6503	SO:0001583	missense	55341	exon7			CGCTGCTCAGCAG		CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.659A>C	3.37:g.194379786T>G	ENSP00000265245:p.Glu220Ala	Somatic	263	0		WXS	Illumina HiSeq	Phase_I	265	96	NM_018385	0	0	0	4	4	A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	ENST00000265245.5	37	CCDS33922.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.586546	0.66105	.	.	ENSG00000041802	ENST00000265245	D	0.91631	-2.88	6.17	2.65	0.31530	.	0.224693	0.45867	D	0.000326	D	0.88028	0.6327	L	0.35288	1.05	0.58432	D	0.999998	P	0.41498	0.752	P	0.46208	0.507	D	0.83890	0.0284	10	0.26408	T	0.33	.	9.937	0.41556	0.0:0.1846:0.0:0.8154	.	220	Q9H089	LSG1_HUMAN	A	220	ENSP00000265245:E220A	ENSP00000265245:E220A	E	-	2	0	LSG1	195861075	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	3.985000	0.56930	1.160000	0.42584	0.533000	0.62120	GAG	.		0.458	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342740.1	NM_018385	
CEP135	9662	hgsc.bcm.edu;bcgsc.ca	37	4	56874494	56874494	+	Splice_Site	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:56874494A>G	ENST00000257287.4	+	18	2406	c.2282A>G	c.(2281-2283)gAa>gGa	p.E761G		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	761					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					TTTCTATAGGAAAAAGCTGTT	0.289																																					p.E761G		.											.	CEP135-94	0			c.A2282G						.						60.0	64.0	63.0					4																	56874494		2201	4299	6500	SO:0001630	splice_region_variant	9662	exon18			TATAGGAAAAAGC	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2281-1A>G	4.37:g.56874494A>G		Somatic	91	0		WXS	Illumina HiSeq	Phase_I	84	5	NM_025009	0	0	0	0	0	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.463771	0.43736	.	.	ENSG00000174799	ENST00000257287	T	0.35048	1.33	5.48	5.48	0.80851	.	0.043970	0.85682	D	0.000000	T	0.50137	0.1598	M	0.78049	2.395	0.54753	D	0.999988	D	0.56287	0.975	P	0.51385	0.668	T	0.55341	-0.8156	10	0.54805	T	0.06	.	12.2418	0.54546	1.0:0.0:0.0:0.0	.	761	Q66GS9	CP135_HUMAN	G	761	ENSP00000257287:E761G	ENSP00000257287:E761G	E	+	2	0	CEP135	56569251	1.000000	0.71417	1.000000	0.80357	0.043000	0.13939	5.412000	0.66392	2.182000	0.69389	0.528000	0.53228	GAA	.		0.289	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	Missense_Mutation
RCHY1	25898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	76415883	76415883	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:76415883A>C	ENST00000324439.5	-	8	963	c.565T>G	c.(565-567)Tct>Gct	p.S189A	RCHY1_ENST00000514021.1_5'Flank|RCHY1_ENST00000513257.1_Missense_Mutation_p.S180A|RCHY1_ENST00000451788.1_Missense_Mutation_p.L188R|RCHY1_ENST00000512706.1_Missense_Mutation_p.S167A|RCHY1_ENST00000380840.2_Missense_Mutation_p.S149A	NM_001278536.1|NM_001278538.1|NM_001278539.1	NP_001265465.1|NP_001265467.1|NP_001265468.1	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase	189					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(2)|pancreas(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TCTAAAGCAGAGTGCATACAT	0.373																																					p.S189A		.											.	RCHY1-228	0			c.T565G						.						133.0	113.0	120.0					4																	76415883		2203	4300	6503	SO:0001583	missense	25898	exon8			AAGCAGAGTGCAT	AF255666	CCDS3567.1, CCDS34012.1, CCDS63990.1, CCDS63991.1, CCDS63992.1	4q21.1-q21.3	2014-02-17	2012-02-23	2004-03-30	ENSG00000163743	ENSG00000163743		"""RING-type (C3HC4) zinc fingers"""	17479	protein-coding gene	gene with protein product	"""androgen-receptor N-terminal-interacting protein"", ""p53-induced protein with a RING-H2 domain"", ""zinc finger, CHY-type"""	607680	"""zinc finger protein 363"", ""ring finger and CHY zinc finger domain containing 1"""	ZNF363		12654245	Standard	NM_015436		Approved	CHIMP, DKFZp586C1620, PRO1996, RNF199, ARNIP, PIRH2, ZCHY	uc003hik.3	Q96PM5	OTTHUMG00000130105	ENST00000324439.5:c.565T>G	4.37:g.76415883A>C	ENSP00000321239:p.Ser189Ala	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	80	26	NM_015436	0	0	10	16	6	B3KRG3|C7E541|C7E542|C7E543|D3YRV2|E7EMC8|E7ETW5|J3KPI0|Q2KN33|Q59GN7|Q86X26|Q96PR5	Missense_Mutation	SNP	ENST00000324439.5	37	CCDS3567.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.67|14.67	2.604259|2.604259	0.46423|0.46423	.|.	.|.	ENSG00000163743|ENSG00000163743	ENST00000451788|ENST00000324439;ENST00000380840;ENST00000512706;ENST00000513257;ENST00000507014	.|T;T;T	.|0.35048	.|1.38;1.33;1.38	5.87|5.87	5.87|5.87	0.94306|0.94306	.|Zinc finger, RING/FYVE/PHD-type (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.60235|0.60235	0.2253|0.2253	.|.	.|.	.|.	0.32406|0.32406	N|N	0.551239|0.551239	.|D;D;D;D	.|0.89917	.|0.996;0.997;0.996;1.0	.|D;D;D;D	.|0.79108	.|0.987;0.992;0.987;0.987	T|T	0.71721|0.71721	-0.4507|-0.4507	5|9	0.22706|0.66056	T|D	0.39|0.02	-9.2258|-9.2258	14.2238|14.2238	0.65845|0.65845	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|140;167;180;189	.|E7EMC8;E7ETW5;Q96PM5-2;Q96PM5	.|.;.;.;ZN363_HUMAN	R|A	188|189;149;167;180;140	.|ENSP00000321239:S189A;ENSP00000370220:S149A;ENSP00000423976:S167A	ENSP00000401041:L188R|ENSP00000321239:S189A	L|S	-|-	2|1	0|0	RCHY1|RCHY1	76634907|76634907	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	7.352000|7.352000	0.79404|0.79404	2.239000|2.239000	0.73571|0.73571	0.528000|0.528000	0.53228|0.53228	CTC|TCT	.		0.373	RCHY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252411.2	NM_015436	
BMP2K	55589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	79786783	79786783	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:79786783T>C	ENST00000335016.5	+	10	1306	c.1140T>C	c.(1138-1140)acT>acC	p.T380T	BMP2K_ENST00000502871.1_Silent_p.T380T	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	380					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						ACTCTGCTACTACTGCCACTC	0.418																																					p.T380T		.											.	BMP2K-383	0			c.T1140C						.						122.0	110.0	114.0					4																	79786783		2203	4300	6503	SO:0001819	synonymous_variant	55589	exon10			TGCTACTACTGCC	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1140T>C	4.37:g.79786783T>C		Somatic	104	0		WXS	Illumina HiSeq	Phase_I	104	44	NM_017593	0	0	1	1	0	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Silent	SNP	ENST00000335016.5	37	CCDS47083.1	.	.	.	.	.	.	.	.	.	.	T	7.526	0.657778	0.14645	.	.	ENSG00000138756	ENST00000502613	.	.	.	5.26	-0.259	0.12971	.	.	.	.	.	T	0.56156	0.1966	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50800	-0.8785	4	.	.	.	-3.7779	9.9454	0.41604	0.0:0.4316:0.0:0.5684	.	.	.	.	H	73	.	.	Y	+	1	0	BMP2K	80005807	0.986000	0.35501	0.891000	0.34965	0.665000	0.39181	0.684000	0.25364	0.047000	0.15862	-0.290000	0.09829	TAC	.		0.418	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593	
CENPE	1062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	104081805	104081805	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:104081805C>T	ENST00000265148.3	-	21	2352	c.2263G>A	c.(2263-2265)Gaa>Aaa	p.E755K	CENPE_ENST00000380026.3_Missense_Mutation_p.E730K	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	755					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTTTCTACTTCAGAAGGTAAA	0.318																																					p.E755K		.											.	CENPE-277	0			c.G2263A						.						65.0	69.0	67.0					4																	104081805		2201	4291	6492	SO:0001583	missense	1062	exon21			CTACTTCAGAAGG	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.2263G>A	4.37:g.104081805C>T	ENSP00000265148:p.Glu755Lys	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	85	39	NM_001813	0	0	0	0	0	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761920	0.49468	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	T;T;T	0.71817	3.8;-0.6;3.8	4.58	4.58	0.56647	.	.	.	.	.	T	0.77631	0.4159	L	0.54323	1.7	0.51767	D	0.999931	D;D	0.76494	0.974;0.999	P;D	0.65987	0.726;0.94	T	0.78155	-0.2314	9	0.54805	T	0.06	.	10.406	0.44256	0.0:0.8981:0.0:0.1019	.	730;755	Q02224-3;Q02224	.;CENPE_HUMAN	K	755;755;730;755	ENSP00000265148:E755K;ENSP00000369365:E730K;ENSP00000423981:E755K	ENSP00000265148:E755K	E	-	1	0	CENPE	104301254	0.998000	0.40836	0.762000	0.31397	0.169000	0.22640	2.456000	0.44997	2.254000	0.74563	0.650000	0.86243	GAA	.		0.318	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
LRBA	987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	151821345	151821345	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:151821345G>T	ENST00000357115.3	-	14	2023	c.1780C>A	c.(1780-1782)Ctg>Atg	p.L594M	LRBA_ENST00000510413.1_Missense_Mutation_p.L594M|LRBA_ENST00000507224.1_Missense_Mutation_p.L594M|LRBA_ENST00000535741.1_Missense_Mutation_p.L594M	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	594						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TCCGTGGACAGATAAGTATAG	0.413																																					p.L594M		.											.	LRBA-157	0			c.C1780A						.						108.0	100.0	103.0					4																	151821345		2203	4300	6503	SO:0001583	missense	987	exon14			TGGACAGATAAGT	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1780C>A	4.37:g.151821345G>T	ENSP00000349629:p.Leu594Met	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	68	24	NM_006726	0	0	0	0	0	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255995	0.59321	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.59	2.91	0.33838	Armadillo-type fold (1);	0.000000	0.52532	D	0.000071	T	0.22589	0.0545	L	0.58669	1.825	0.44380	D	0.997282	P;P;P	0.46277	0.802;0.776;0.875	B;B;B	0.40825	0.122;0.282;0.341	T	0.02352	-1.1172	10	0.54805	T	0.06	.	5.799	0.18403	0.3233:0.0:0.5523:0.1244	.	594;594;594	E9PEM5;P50851;P50851-2	.;LRBA_HUMAN;.	M	594	ENSP00000446299:L594M;ENSP00000421552:L594M;ENSP00000349629:L594M;ENSP00000422180:L594M	ENSP00000349629:L594M	L	-	1	2	LRBA	152040795	1.000000	0.71417	0.984000	0.44739	0.998000	0.95712	1.337000	0.33862	0.714000	0.32081	0.655000	0.94253	CTG	.		0.413	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
WWC2	80014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	184182067	184182067	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:184182067T>A	ENST00000403733.3	+	11	1490	c.1291T>A	c.(1291-1293)Tct>Act	p.S431T	WWC2_ENST00000504005.1_Missense_Mutation_p.S113T|WWC2_ENST00000378925.3_Missense_Mutation_p.S333T|WWC2_ENST00000513834.1_Missense_Mutation_p.S431T|WWC2_ENST00000448232.2_Missense_Mutation_p.S431T	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	431	Ser-rich.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		TTTCAGCCTCTCTGCCAGCAC	0.507																																					p.S431T		.											.	WWC2-93	0			c.T1291A						.						29.0	29.0	29.0					4																	184182067		2203	4300	6503	SO:0001583	missense	80014	exon11			AGCCTCTCTGCCA	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.1291T>A	4.37:g.184182067T>A	ENSP00000384222:p.Ser431Thr	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	36	18	NM_024949	0	0	0	0	0	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	ENST00000403733.3	37	CCDS34109.2	.	.	.	.	.	.	.	.	.	.	T	24.6	4.551586	0.86127	.	.	ENSG00000151718	ENST00000403733;ENST00000378925;ENST00000513834;ENST00000448232;ENST00000504005	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	4.86	4.86	0.63082	.	0.000000	0.64402	D	0.000002	T	0.65207	0.2669	M	0.80183	2.485	0.58432	D	0.999996	D	0.69078	0.997	D	0.75020	0.985	T	0.68864	-0.5296	10	0.49607	T	0.09	-16.2476	14.628	0.68635	0.0:0.0:0.0:1.0	.	431	Q6AWC2	WWC2_HUMAN	T	431;333;431;431;113	ENSP00000384222:S431T;ENSP00000368205:S333T;ENSP00000425054:S431T;ENSP00000398577:S431T;ENSP00000427569:S113T	ENSP00000368205:S333T	S	+	1	0	WWC2	184419061	1.000000	0.71417	0.993000	0.49108	0.935000	0.57460	7.833000	0.86765	2.046000	0.60703	0.528000	0.53228	TCT	.		0.507	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
ICE1	23379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	5461992	5461992	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:5461992A>T	ENST00000296564.7	+	13	2767	c.2545A>T	c.(2545-2547)Acc>Tcc	p.T849S		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		849					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGAATTCAAGACCACTGCATC	0.413																																					p.T849S		.											.	KIAA0947-48	0			c.A2545T						.						92.0	87.0	89.0					5																	5461992		1888	4110	5998	SO:0001583	missense	23379	exon13			TTCAAGACCACTG																												ENST00000296564.7:c.2545A>T	5.37:g.5461992A>T	ENSP00000296564:p.Thr849Ser	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	96	41	NM_015325	0	0	1	2	1	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	a	5.614	0.297970	0.10622	.	.	ENSG00000164151	ENST00000296564	T	0.09445	2.98	4.94	0.61	0.17580	.	0.400941	0.21055	N	0.080924	T	0.04407	0.0121	N	0.08118	0	0.09310	N	1	B	0.20780	0.048	B	0.14023	0.01	T	0.43750	-0.9372	10	0.20046	T	0.44	-7.0261	7.5819	0.27970	0.1086:0.5191:0.3723:0.0	.	849	Q9Y2F5	K0947_HUMAN	S	849	ENSP00000296564:T849S	ENSP00000296564:T849S	T	+	1	0	KIAA0947	5514992	0.000000	0.05858	0.000000	0.03702	0.233000	0.25261	0.042000	0.13949	-0.216000	0.10048	0.378000	0.23410	ACC	.		0.413	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
ITGA1	3672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	52211309	52211309	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:52211309G>T	ENST00000282588.6	+	15	2331	c.1873G>T	c.(1873-1875)Ggg>Tgg	p.G625W		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	625					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TCCATCAGGTGGGGATGGTAA	0.388																																					p.G625W		.											.	ITGA1-228	0			c.G1873T						.						146.0	147.0	147.0					5																	52211309		2203	4300	6503	SO:0001583	missense	3672	exon15			TCAGGTGGGGATG	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.1873G>T	5.37:g.52211309G>T	ENSP00000282588:p.Gly625Trp	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	157	62	NM_181501	0	0	1	1	0	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	37	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672050	0.88348	.	.	ENSG00000213949	ENST00000282588	T	0.56103	0.48	5.53	5.53	0.82687	.	0.053424	0.85682	D	0.000000	T	0.69557	0.3124	L	0.56769	1.78	0.80722	D	1	D	0.71674	0.998	D	0.68192	0.956	T	0.65693	-0.6106	10	0.38643	T	0.18	.	19.8228	0.96604	0.0:0.0:1.0:0.0	.	625	P56199	ITA1_HUMAN	W	625	ENSP00000282588:G625W	ENSP00000282588:G625W	G	+	1	0	ITGA1	52247066	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.066000	0.93949	2.759000	0.94783	0.650000	0.86243	GGG	.		0.388	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
LHFPL2	10184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	77784725	77784725	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:77784725G>A	ENST00000515007.2	-	3	992	c.682C>T	c.(682-684)Ctt>Ttt	p.L228F	LHFPL2_ENST00000380345.2_Missense_Mutation_p.L228F			Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2	228						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	6		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		CCAAACTAAAGGAGGCAGATC	0.408																																					p.L228F		.											.	LHFPL2-90	0			c.C682T						.						128.0	127.0	127.0					5																	77784725		2203	4300	6503	SO:0001583	missense	10184	exon5			ACTAAAGGAGGCA	D86961	CCDS4042.1	5q13	2008-02-05			ENSG00000145685	ENSG00000145685			6588	protein-coding gene	gene with protein product		609718				10329012	Standard	NM_005779		Approved	KIAA0206	uc003kfo.3	Q6ZUX7	OTTHUMG00000107579	ENST00000515007.2:c.682C>T	5.37:g.77784725G>A	ENSP00000425906:p.Leu228Phe	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	124	52	NM_005779	0	0	0	0	0	B2RMQ6|Q7Z5P0|Q92605	Missense_Mutation	SNP	ENST00000515007.2	37	CCDS4042.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026712	0.93518	.	.	ENSG00000145685	ENST00000380345;ENST00000515007	T;T	0.78924	-1.22;-1.22	5.94	5.94	0.96194	.	0.055945	0.64402	D	0.000001	D	0.84115	0.5401	M	0.72118	2.19	0.80722	D	1	P	0.50272	0.933	P	0.51193	0.662	D	0.85187	0.1007	10	0.72032	D	0.01	.	19.3618	0.94442	0.0:0.0:1.0:0.0	.	228	Q6ZUX7	LHPL2_HUMAN	F	228	ENSP00000369702:L228F;ENSP00000425906:L228F	ENSP00000369702:L228F	L	-	1	0	LHFPL2	77820481	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.476000	0.97823	2.820000	0.97059	0.650000	0.86243	CTT	.		0.408	LHFPL2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369098.2	NM_005779	
SLCO6A1	133482	hgsc.bcm.edu;broad.mit.edu	37	5	101735268	101735268	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:101735268G>A	ENST00000506729.1	-	10	1976	c.1805C>T	c.(1804-1806)gCc>gTc	p.A602V	SLCO6A1_ENST00000379810.1_Missense_Mutation_p.A349V|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.A540V|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.A349V|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.A602V			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	602						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CCGCGTCATGGCCAAGACGAT	0.284																																					p.A602V		.											.	SLCO6A1-96	0			c.C1805T						.						66.0	63.0	64.0					5																	101735268		2203	4300	6503	SO:0001583	missense	133482	exon10			GTCATGGCCAAGA	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1805C>T	5.37:g.101735268G>A	ENSP00000421339:p.Ala602Val	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	60	3	NM_173488	0	0	0	0	0	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.414291	0.25465	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37	5.42	0.231	0.15377	Major facilitator superfamily domain, general substrate transporter (1);	1.303550	0.05317	N	0.525853	T	0.30135	0.0755	L	0.43152	1.355	0.09310	N	1	B;B;B	0.30361	0.135;0.277;0.1	B;B;B	0.39935	0.054;0.314;0.083	T	0.24548	-1.0157	10	0.02654	T	1	.	4.3381	0.11095	0.4699:0.195:0.3351:0.0	.	540;349;602	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	V	602;602;540;349;349	ENSP00000421339:A602V;ENSP00000369135:A602V;ENSP00000373671:A540V;ENSP00000421990:A349V;ENSP00000369138:A349V	ENSP00000369135:A602V	A	-	2	0	SLCO6A1	101763167	0.013000	0.17824	0.000000	0.03702	0.000000	0.00434	-0.072000	0.11486	-0.156000	0.11079	-0.150000	0.13652	GCC	.		0.284	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
PCDHB14	56122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140605207	140605207	+	Silent	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:140605207G>C	ENST00000239449.4	+	1	2130	c.2130G>C	c.(2128-2130)gcG>gcC	p.A710A	PCDHB14_ENST00000515856.2_Silent_p.A557A	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	710					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTTCGTGGCGGTGCGGCTGT	0.701																																					p.A710A	Ovarian(141;50 1831 27899 33809 37648)	.											.	PCDHB14-91	0			c.G2130C						.						68.0	84.0	79.0					5																	140605207		2184	4245	6429	SO:0001819	synonymous_variant	56122	exon1			CGTGGCGGTGCGG	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2130G>C	5.37:g.140605207G>C		Somatic	391	0		WXS	Illumina HiSeq	Phase_I	333	109	NM_018934	3	0	18	21	0	B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	ENST00000239449.4	37	CCDS4256.1																																																																																			.		0.701	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
SOX30	11063	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	157078648	157078648	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:157078648C>T	ENST00000265007.6	-	1	780	c.439G>A	c.(439-441)Gat>Aat	p.D147N	SOX30_ENST00000519442.1_Intron|SOX30_ENST00000311371.5_Missense_Mutation_p.D147N	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	147					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACTGACTGATCCAGGCTGGGC	0.687																																					p.D147N	Esophageal Squamous(31;525 799 19355 21125 41744)	.											.	SOX30-91	0			c.G439A						.						13.0	15.0	14.0					5																	157078648		2180	4260	6440	SO:0001583	missense	11063	exon1			ACTGATCCAGGCT	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.439G>A	5.37:g.157078648C>T	ENSP00000265007:p.Asp147Asn	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	48	20	NM_178424	0	0	0	0	0	O94995|Q8IYX6	Missense_Mutation	SNP	ENST00000265007.6	37	CCDS4339.1	.	.	.	.	.	.	.	.	.	.	C	8.733	0.917147	0.17982	.	.	ENSG00000039600	ENST00000311371;ENST00000265007	D;D	0.98221	-4.8;-4.41	4.62	4.62	0.57501	.	0.851364	0.09951	N	0.734643	D	0.94503	0.8230	N	0.24115	0.695	0.20196	N	0.999926	B;B	0.29037	0.231;0.039	B;B	0.27715	0.082;0.017	D	0.88993	0.3416	10	0.27785	T	0.31	.	7.1995	0.25873	0.0:0.6448:0.2614:0.0938	.	147;147	O94993-2;O94993	.;SOX30_HUMAN	N	147	ENSP00000309343:D147N;ENSP00000265007:D147N	ENSP00000265007:D147N	D	-	1	0	SOX30	157011226	0.125000	0.22332	0.395000	0.26283	0.028000	0.11728	3.076000	0.50081	2.098000	0.63641	0.305000	0.20034	GAT	.		0.687	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017	
NKX2-5	1482	hgsc.bcm.edu	37	5	172659920	172659920	+	Silent	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:172659920C>G	ENST00000329198.4	-	2	900	c.627G>C	c.(625-627)ccG>ccC	p.P209P	NKX2-5_ENST00000521848.1_3'UTR|NKX2-5_ENST00000424406.2_3'UTR	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	209	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			gcggcggcggcgggggcAGCC	0.701																																					p.P209P	Esophageal Squamous(72;810 1219 2387 13420 44943)	.											.	NKX2-5-90	0			c.G627C						.						5.0	6.0	6.0					5																	172659920		1935	3790	5725	SO:0001819	synonymous_variant	1482	exon2			CGGCGGCGGGGGC	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.627G>C	5.37:g.172659920C>G		Somatic	10	1		WXS	Illumina HiSeq	Phase_I	18	2	NM_004387	0	0	0	0	0	A8K3K0|B4DNB6|E9PBU6	Silent	SNP	ENST00000329198.4	37	CCDS4387.1																																																																																			.		0.701	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2		
NOTCH4	4855	hgsc.bcm.edu	37	6	32191691	32191691	+	Silent	SNP	T	T	C	rs372487717		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:32191691T>C	ENST00000375023.3	-	1	153	c.15A>G	c.(13-15)tcA>tcG	p.S5S		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	5					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						gcagcagcagTGAAGGGGGCT	0.642																																					p.S5S		.											.	NOTCH4-1321	0			c.A15G						.						53.0	39.0	44.0					6																	32191691		1511	2708	4219	SO:0001819	synonymous_variant	4855	exon1			CAGCAGTGAAGGG		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.15A>G	6.37:g.32191691T>C		Somatic	38	1		WXS	Illumina HiSeq	Phase_I	57	4	NM_004557	0	0	1	1	0	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	37	CCDS34420.1																																																																																			.		0.642	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
BRD2	6046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32945538	32945538	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:32945538T>C	ENST00000374825.4	+	9	3035	c.1334T>C	c.(1333-1335)gTa>gCa	p.V445A	BRD2_ENST00000395289.2_Missense_Mutation_p.V445A|BRD2_ENST00000443797.2_Missense_Mutation_p.V325A|BRD2_ENST00000395287.1_Missense_Mutation_p.V445A|BRD2_ENST00000374831.4_Missense_Mutation_p.V445A|BRD2_ENST00000449085.2_Missense_Mutation_p.V398A	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	445					chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						TTGTAGGATGTATTTGAGTTC	0.463																																					p.V445A		.											.	BRD2-398	0			c.T1334C						.						118.0	132.0	127.0					6																	32945538		1509	2709	4218	SO:0001583	missense	6046	exon9			AGGATGTATTTGA	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1334T>C	6.37:g.32945538T>C	ENSP00000363958:p.Val445Ala	Somatic	180	1		WXS	Illumina HiSeq	Phase_I	155	82	NM_005104	0	0	0	0	0	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	ENST00000374825.4	37	CCDS4762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.5|22.5	4.302909|4.302909	0.81136|0.81136	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085|ENST00000449025	T;T;T;T;T;T|.	0.19250|.	2.16;2.16;2.16;2.16;2.16;2.16|.	5.63|5.63	5.63|5.63	0.86233|0.86233	Bromodomain (3);|.	0.000000|.	0.45606|.	D|.	0.000350|.	T|T	0.76814|0.76814	0.4040|0.4040	M|M	0.89785|0.89785	3.06|3.06	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.997|.	D;D|.	0.70716|.	0.97;0.97|.	T|T	0.81758|0.81758	-0.0786|-0.0786	10|5	0.87932|.	D|.	0|.	-14.8434|-14.8434	13.8401|13.8401	0.63432|0.63432	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	445;445|.	A2AAU0;P25440|.	.;BRD2_HUMAN|.	A|H	445;445;445;325;445;398|451	ENSP00000363958:V445A;ENSP00000363964:V445A;ENSP00000378704:V445A;ENSP00000413495:V325A;ENSP00000378702:V445A;ENSP00000409145:V398A|.	ENSP00000363958:V445A|.	V|Y	+|+	2|1	0|0	BRD2|BRD2	33053516|33053516	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.982000|0.982000	0.71751|0.71751	7.753000|7.753000	0.85153|0.85153	2.363000|2.363000	0.80096|0.80096	0.523000|0.523000	0.50628|0.50628	GTA|TAT	.		0.463	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
SLC22A7	10864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43267444	43267444	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:43267444T>C	ENST00000372585.5	+	4	678	c.583T>C	c.(583-585)Tat>Cat	p.Y195H	SLC22A7_ENST00000372574.3_Missense_Mutation_p.Y193H|SLC22A7_ENST00000372589.3_Missense_Mutation_p.Y193H|SLC22A7_ENST00000487175.1_3'UTR	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	195					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	CTCCGTCAGCTATGTAATGTT	0.602																																					p.Y195H		.											.	SLC22A7-90	0			c.T583C						.						91.0	89.0	89.0					6																	43267444		2203	4300	6503	SO:0001583	missense	10864	exon3			GTCAGCTATGTAA	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.583T>C	6.37:g.43267444T>C	ENSP00000361666:p.Tyr195His	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	178	68	NM_153320	0	0	6	12	6	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	37	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	T	26.8	4.776980	0.90195	.	.	ENSG00000137204	ENST00000451757;ENST00000449231;ENST00000372589;ENST00000372585;ENST00000372574	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	5.56	5.56	0.83823	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.068530	0.64402	D	0.000011	T	0.73273	0.3566	M	0.92077	3.27	0.45295	D	0.998297	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.99;0.986	T	0.80795	-0.1223	10	0.72032	D	0.01	.	13.2267	0.59919	0.0:0.0:0.0:1.0	.	195;193;193	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	H	64;254;193;195;193	ENSP00000416052:Y64H;ENSP00000411818:Y254H;ENSP00000361670:Y193H;ENSP00000361666:Y195H;ENSP00000361655:Y193H	ENSP00000361655:Y193H	Y	+	1	0	SLC22A7	43375422	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	4.783000	0.62403	2.109000	0.64355	0.379000	0.24179	TAT	.		0.602	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		
EPHA7	2045	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	93969151	93969151	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:93969151C>A	ENST00000369303.4	-	10	2029	c.1845G>T	c.(1843-1845)gaG>gaT	p.E615D		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	615					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TATTTGGGTCCTCATAGGTTT	0.428																																					p.E615D		.											.	EPHA7-1453	0			c.G1845T						.						221.0	199.0	206.0					6																	93969151		2203	4300	6503	SO:0001583	missense	2045	exon10			TGGGTCCTCATAG	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1845G>T	6.37:g.93969151C>A	ENSP00000358309:p.Glu615Asp	Somatic	172	0		WXS	Illumina HiSeq	Phase_I	168	72	NM_004440	0	0	4	9	5	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622257	0.28889	.	.	ENSG00000135333	ENST00000369303	T	0.22336	1.96	5.9	5.9	0.94986	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.37320	0.0999	M	0.91972	3.26	0.80722	D	1	B;B;B	0.33755	0.424;0.002;0.001	P;B;B	0.46419	0.516;0.002;0.001	T	0.26538	-1.0100	10	0.59425	D	0.04	.	14.4356	0.67279	0.0:0.93:0.0:0.07	.	611;610;615	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	D	615	ENSP00000358309:E615D	ENSP00000358309:E615D	E	-	3	2	EPHA7	94025872	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.753000	0.38359	2.786000	0.95864	0.563000	0.77884	GAG	.		0.428	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
OSTM1	28962	hgsc.bcm.edu	37	6	108395713	108395713	+	Missense_Mutation	SNP	G	G	C	rs201176284	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:108395713G>C	ENST00000193322.3	-	1	228	c.143C>G	c.(142-144)tCg>tGg	p.S48W		NM_014028.3	NP_054747.2	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	48					ion transmembrane transport (GO:0034220)|osteoclast differentiation (GO:0030316)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		CTGCTGCTCCGACAGGAGGTC	0.711													G|||	5	0.000998403	0.0038	0.0	5008	,	,		12709	0.0		0.0	False		,,,				2504	0.0				p.S48W	Melanoma(162;1427 1909 3096 17430 21396)	.											.	OSTM1-68	0			c.C143G						.	G	TRP/SER	12,4304		0,12,2146	7.0	7.0	7.0		143	4.1	1.0	6		7	0,8426		0,0,4213	yes	missense	OSTM1	NM_014028.3	177	0,12,6359	CC,CG,GG		0.0,0.278,0.0942	probably-damaging	48/335	108395713	12,12730	2158	4213	6371	SO:0001583	missense	28962	exon1			TGCTCCGACAGGA	AF533891	CCDS5062.1	6q21	2014-06-17			ENSG00000081087	ENSG00000081087			21652	protein-coding gene	gene with protein product	"""CLCN7 accessory beta subunit"""	607649				12627228, 21527911	Standard	NM_014028		Approved	HSPC019, GL	uc003psd.3	Q86WC4	OTTHUMG00000015317	ENST00000193322.3:c.143C>G	6.37:g.108395713G>C	ENSP00000193322:p.Ser48Trp	Somatic	3	0		WXS	Illumina HiSeq	Phase_I	12	4	NM_014028	0	0	1	1	0	E1P5E3|Q5R391|Q6PCA7|Q7RTW6|Q8NC29|Q8TC82|Q9Y2S9	Missense_Mutation	SNP	ENST00000193322.3	37	CCDS5062.1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.828523	0.71258	0.00278	0.0	ENSG00000081087	ENST00000193322	T	0.55234	0.53	4.96	4.08	0.47627	.	0.095194	0.43110	D	0.000605	T	0.37865	0.1019	M	0.70595	2.14	0.44627	D	0.9976	B	0.16166	0.016	B	0.14023	0.01	T	0.48281	-0.9049	10	0.87932	D	0	-17.7201	12.5335	0.56128	0.0:0.1806:0.8194:0.0	.	48	Q86WC4	OSTM1_HUMAN	W	48	ENSP00000193322:S48W	ENSP00000193322:S48W	S	-	2	0	OSTM1	108502406	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	5.376000	0.66178	1.199000	0.43173	0.655000	0.94253	TCG	.		0.711	OSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041709.3	NM_014028	
MAP3K4	4216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	161470014	161470014	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:161470014C>A	ENST00000392142.4	+	3	858	c.710C>A	c.(709-711)tCa>tAa	p.S237*	MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.S237*|MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.S237*|MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.S237*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	237					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.S237L(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AAGCTTACCTCAGTCTCAAAG	0.433																																					p.S237X		.											.	MAP3K4-548	2	Substitution - Missense(2)	cervix(2)	c.C710A						.						41.0	41.0	41.0					6																	161470014		2203	4300	6503	SO:0001587	stop_gained	4216	exon3			TTACCTCAGTCTC	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.710C>A	6.37:g.161470014C>A	ENSP00000375986:p.Ser237*	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	54	23	NM_006724	0	0	0	0	0	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	C	38	6.894608	0.97916	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	6.14	6.14	0.99180	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.6238	20.819	0.99723	0.0:1.0:0.0:0.0	.	.	.	.	X	237	.	ENSP00000297332:S237X	S	+	2	0	MAP3K4	161390004	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.454000	0.80714	2.927000	0.99377	0.637000	0.83480	TCA	.		0.433	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
HEATR2	54919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	803456	803456	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:803456T>G	ENST00000297440.6	+	8	1648	c.1628T>G	c.(1627-1629)aTg>aGg	p.M543R	HEATR2_ENST00000313147.5_Missense_Mutation_p.M543R	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	543						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		CAGGAGACGATGGACTCACTG	0.607																																					p.M543R		.											.	HEATR2-69	0			c.T1628G						.						132.0	110.0	117.0					7																	803456		2202	4300	6502	SO:0001583	missense	54919	exon8			AGACGATGGACTC	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.1628T>G	7.37:g.803456T>G	ENSP00000297440:p.Met543Arg	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	261	44	NM_017802	0	0	17	23	6	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	ENST00000297440.6	37	CCDS34580.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.28|14.28	2.488084|2.488084	0.44249|0.44249	.|.	.|.	ENSG00000164818|ENSG00000164818	ENST00000440747|ENST00000297440;ENST00000313147;ENST00000537862	.|T;T	.|0.67523	.|-0.27;-0.27	5.03|5.03	5.03|5.03	0.67393|0.67393	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.303789	.|0.36893	.|N	.|0.002346	T|T	0.70055|0.70055	0.3180|0.3180	M|M	0.68317|0.68317	2.08|2.08	0.09310|0.09310	N|N	0.999993|0.999993	.|P;P	.|0.45715	.|0.788;0.865	.|B;P	.|0.45610	.|0.272;0.487	T|T	0.68070|0.68070	-0.5506|-0.5506	5|10	.|0.72032	.|D	.|0.01	-30.0578|-30.0578	15.0356|15.0356	0.71744|0.71744	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|543;289	.|Q86Y56;F5H8D4	.|HEAT2_HUMAN;.	E|R	344|543;543;289	.|ENSP00000297440:M543R;ENSP00000321451:M543R	.|ENSP00000297440:M543R	D|M	+|+	3|2	2|0	HEATR2|HEATR2	769982|769982	0.998000|0.998000	0.40836|0.40836	0.021000|0.021000	0.16686|0.16686	0.005000|0.005000	0.04900|0.04900	2.733000|2.733000	0.47360|0.47360	2.008000|2.008000	0.58898|0.58898	0.459000|0.459000	0.35465|0.35465	GAT|ATG	.		0.607	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802	
TMEM184A	202915	hgsc.bcm.edu	37	7	1589783	1589783	+	Silent	SNP	G	G	A	rs139449337	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:1589783G>A	ENST00000297477.5	-	5	844	c.528C>T	c.(526-528)atC>atT	p.I176I		NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	176					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)		p.I176I(1)		endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		GCAGGAACCCGATGGAGTAGG	0.721													g|||	14	0.00279553	0.0098	0.0014	5008	,	,		12338	0.0		0.0	False		,,,				2504	0.0				p.I176I		.											.	TMEM184A-90	1	Substitution - coding silent(1)	lung(1)	c.C528T						.			34,4162		0,34,2064	12.0	15.0	14.0		528	-4.1	0.1	7	dbSNP_134	14	2,8474		0,2,4236	no	coding-synonymous	TMEM184A	NM_001097620.1		0,36,6300	AA,AG,GG		0.0236,0.8103,0.2841		176/414	1589783	36,12636	2098	4238	6336	SO:0001819	synonymous_variant	202915	exon5			GAACCCGATGGAG		CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.528C>T	7.37:g.1589783G>A		Somatic	14	2		WXS	Illumina HiSeq	Phase_I	37	26	NM_001097620	0	0	3	3	0	Q8TBQ6	Silent	SNP	ENST00000297477.5	37	CCDS43537.1																																																																																			G|0.997;A|0.003		0.721	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239229.4	NM_152689	
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	47870900	47870900	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:47870900G>C	ENST00000289672.2	-	42	6438	c.6388C>G	c.(6388-6390)Cag>Gag	p.Q2130E		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2130					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CACCAAGGCTGAAGGGCCCTT	0.562																																					p.Q2130E		.											.	PKD1L1-145	0			c.C6388G						.						93.0	83.0	86.0					7																	47870900		2203	4300	6503	SO:0001583	missense	168507	exon42			AAGGCTGAAGGGC	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6388C>G	7.37:g.47870900G>C	ENSP00000289672:p.Gln2130Glu	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	211	48	NM_138295	0	0	0	0	0	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	8.099	0.776205	0.16051	.	.	ENSG00000158683	ENST00000289672	T	0.18960	2.18	5.1	2.25	0.28309	.	1.969070	0.02438	N	0.084314	T	0.13157	0.0319	N	0.22421	0.69	0.09310	N	1	B	0.13145	0.007	B	0.14578	0.011	T	0.23655	-1.0182	10	0.06625	T	0.88	1.9044	4.372	0.11253	0.1915:0.0:0.629:0.1795	.	2130	Q8TDX9	PK1L1_HUMAN	E	2130	ENSP00000289672:Q2130E	ENSP00000289672:Q2130E	Q	-	1	0	PKD1L1	47837425	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.141000	0.16076	0.166000	0.19597	0.563000	0.77884	CAG	.		0.562	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
COL1A2	1278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	94057039	94057039	+	Missense_Mutation	SNP	G	G	T	rs145541630		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:94057039G>T	ENST00000297268.6	+	49	3839	c.3368G>T	c.(3367-3369)cGc>cTc	p.R1123L		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1123				Missing (in Ref. 17; CAA23761). {ECO:0000305}.	blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GACCAGCCTCGCTCAGCACCT	0.547										HNSCC(75;0.22)																											p.R1123L		.											.	COL1A2-521	0			c.G3368T						.						98.0	97.0	98.0					7																	94057039		2203	4300	6503	SO:0001583	missense	1278	exon49			AGCCTCGCTCAGC	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3368G>T	7.37:g.94057039G>T	ENSP00000297268:p.Arg1123Leu	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	261	53	NM_000089	0	0	64	75	11	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.401592	0.62288	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.89552	-2.53	5.71	5.71	0.89125	.	0.000000	0.56097	D	0.000040	D	0.88757	0.6523	N	0.14661	0.345	0.34308	D	0.68511	D	0.60160	0.987	D	0.67725	0.953	D	0.90766	0.4668	10	0.41790	T	0.15	.	15.7376	0.77859	0.0:0.0:1.0:0.0	.	1123	P08123	CO1A2_HUMAN	L	1123;1124	ENSP00000297268:R1123L	ENSP00000297268:R1123L	R	+	2	0	COL1A2	93894975	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.489000	0.60309	2.873000	0.98535	0.561000	0.74099	CGC	G|1.000;A|0.000		0.547	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
DOCK4	9732	hgsc.bcm.edu;broad.mit.edu	37	7	111629106	111629106	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:111629106T>C	ENST00000437633.1	-	6	684	c.428A>G	c.(427-429)aAg>aGg	p.K143R	DOCK4_ENST00000428084.1_Missense_Mutation_p.K143R|DOCK4_ENST00000476846.1_5'UTR	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	143					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				AATGTGGCGCTTCACGTCCTT	0.572																																					p.K143R		.											.	DOCK4-26	0			c.A428G						.						66.0	68.0	67.0					7																	111629106		2077	4198	6275	SO:0001583	missense	9732	exon6			TGGCGCTTCACGT		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.428A>G	7.37:g.111629106T>C	ENSP00000404179:p.Lys143Arg	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	63	12	NM_014705	0	0	0	0	0	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	33|33	5.207833|5.207833	0.95033|0.95033	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250|ENST00000445943	T;T|.	0.03358|.	3.96;3.97|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73753|0.73753	0.3627|0.3627	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.987;0.997;0.997;0.999|.	P;D;D;D|.	0.70935|.	0.834;0.952;0.952;0.971|.	T|T	0.73783|0.73783	-0.3874|-0.3874	10|5	0.72032|.	D|.	0.01|.	.|.	15.2728|15.2728	0.73717|0.73717	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	143;143;143;143|.	A4D0S8;Q149N6;Q149N5;Q8N1I0|.	.;.;.;DOCK4_HUMAN|.	R|G	131;143;143;131;142|131	ENSP00000410746:K143R;ENSP00000404179:K143R|.	ENSP00000345432:K131R|.	K|S	-|-	2|1	0|0	DOCK4|DOCK4	111416342|111416342	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.988000|7.988000	0.88194|0.88194	2.186000|2.186000	0.69663|0.69663	0.533000|0.533000	0.62120|0.62120	AAG|AGC	.		0.572	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
GPR37	2861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	124404923	124404923	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:124404923G>C	ENST00000303921.2	-	1	758	c.108C>G	c.(106-108)aaC>aaG	p.N36K		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	36					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GACAAGTTTCGTTTCTGGACG	0.652																																					p.N36K		.											.	GPR37-523	0			c.C108G						.						23.0	24.0	24.0					7																	124404923		2203	4300	6503	SO:0001583	missense	2861	exon1			AGTTTCGTTTCTG		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.108C>G	7.37:g.124404923G>C	ENSP00000306449:p.Asn36Lys	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	86	61	NM_005302	0	0	0	0	0	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	G	6.209	0.406650	0.11754	.	.	ENSG00000170775	ENST00000303921	T	0.08896	3.04	5.31	-0.565	0.11771	.	0.220305	0.48286	N	0.000186	T	0.04861	0.0131	L	0.27053	0.805	0.09310	N	0.999998	B	0.09022	0.002	B	0.06405	0.002	T	0.30001	-0.9993	10	0.49607	T	0.09	-16.1704	4.5608	0.12160	0.2984:0.3038:0.3978:0.0	.	36	O15354	GPR37_HUMAN	K	36	ENSP00000306449:N36K	ENSP00000306449:N36K	N	-	3	2	GPR37	124192159	0.000000	0.05858	0.005000	0.12908	0.024000	0.10985	0.501000	0.22578	-0.292000	0.08999	0.655000	0.94253	AAC	.		0.652	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
KMT2C	58508	hgsc.bcm.edu;bcgsc.ca	37	7	151962168	151962168	+	Missense_Mutation	SNP	C	C	G	rs138908625	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:151962168C>G	ENST00000262189.6	-	8	1357	c.1139G>C	c.(1138-1140)cGt>cCt	p.R380P	KMT2C_ENST00000355193.2_Missense_Mutation_p.R380P	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	380					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R380L(4)									CCAACCTGCACGTTTTAATGG	0.443																																					p.R380P		.											.	MLL3-1398	4	Substitution - Missense(4)	skin(4)	c.G1139C						.						410.0	369.0	383.0					7																	151962168		2203	4300	6503	SO:0001583	missense	58508	exon8			CCTGCACGTTTTA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1139G>C	7.37:g.151962168C>G	ENSP00000262189:p.Arg380Pro	Somatic	771	0		WXS	Illumina HiSeq	Phase_I	901	146	NM_170606	0	0	2	2	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.337586	0.41398	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98849	-5.18;-5.18	4.65	4.65	0.58169	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38548	U	0.001645	D	0.98701	0.9564	L	0.52759	1.655	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.99905	1.1175	10	0.66056	D	0.02	.	17.9157	0.88950	0.0:1.0:0.0:0.0	.	380	Q8NEZ4	MLL3_HUMAN	P	380	ENSP00000262189:R380P;ENSP00000347325:R380P	ENSP00000262189:R380P	R	-	2	0	MLL3	151593101	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	6.039000	0.70972	2.271000	0.75665	0.557000	0.71058	CGT	C|0.500;A|0.500		0.443	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
PRSS3	5646	bcgsc.ca	37	9	33796657	33796657	+	Silent	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr9:33796657C>T	ENST00000361005.5	+	2	228	c.228C>T	c.(226-228)gaC>gaT	p.D76D	RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000342836.4_Silent_p.D33D|PRSS3_ENST00000379405.3_Silent_p.D19D|PRSS3_ENST00000429677.3_Silent_p.D12D	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	76					cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			TCCCCTTTGACGATGATGACA	0.547																																					p.D76D													.	PRSS3-90	0			c.C228T						.						192.0	180.0	184.0					9																	33796657		2203	4300	6503	SO:0001819	synonymous_variant	5646	exon2			CTTTGACGATGAT		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.228C>T	9.37:g.33796657C>T		Somatic	319	15		WXS	Illumina HiSeq	Phase_1	310	34	NM_007343	0	0	0	0	0	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	ENST00000361005.5	37	CCDS47958.1																																																																																			.		0.547	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
UCK1	83549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	134404931	134404931	+	Silent	SNP	G	G	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr9:134404931G>A	ENST00000372215.4	-	3	402	c.309C>T	c.(307-309)aaC>aaT	p.N103N	UCK1_ENST00000459858.1_5'UTR|UCK1_ENST00000372211.3_Silent_p.N108N|UCK1_ENST00000372210.3_Silent_p.N94N|UCK1_ENST00000372208.3_Silent_p.N103N	NM_001261450.1|NM_001261451.1|NM_031432.2	NP_001248379.1|NP_001248380.1|NP_113620.1	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1	103					CTP salvage (GO:0044211)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		CCTCCACGATGTTCTTCAGAG	0.547																																					p.N108N	Melanoma(42;523 1129 28385 43975 48113)	.											.	UCK1-90	0			c.C324T						.						278.0	229.0	246.0					9																	134404931		2203	4300	6503	SO:0001819	synonymous_variant	83549	exon3			CACGATGTTCTTC	AF237290	CCDS6944.1, CCDS48046.1, CCDS59151.1, CCDS59152.1	9q34.1	2008-02-05			ENSG00000130717	ENSG00000130717	2.7.1.48		14859	protein-coding gene	gene with protein product		609328				11306702	Standard	NM_031432		Approved	URK1, FLJ12255	uc031tfj.1	Q9HA47	OTTHUMG00000020823	ENST00000372215.4:c.309C>T	9.37:g.134404931G>A		Somatic	192	1		WXS	Illumina HiSeq	Phase_I	179	79	NM_001261451	0	0	28	55	27	Q5JT09|Q5JT10|Q5JT12|Q5JT13|Q6IA74|Q96BJ0	Silent	SNP	ENST00000372215.4	37	CCDS6944.1																																																																																			.		0.547	UCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054726.1	NM_031432	
SETX	23064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	135156906	135156906	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr9:135156906T>C	ENST00000224140.5	-	20	6784	c.6602A>G	c.(6601-6603)aAg>aGg	p.K2201R	SETX_ENST00000393220.1_Missense_Mutation_p.K2201R|SETX_ENST00000372169.2_Missense_Mutation_p.K2201R	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	2201					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TAGGATGAGCTTATTGCAGCG	0.418																																					p.K2201R		.											.	SETX-93	0			c.A6602G						.						127.0	117.0	121.0					9																	135156906		2203	4300	6503	SO:0001583	missense	23064	exon20			ATGAGCTTATTGC	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.6602A>G	9.37:g.135156906T>C	ENSP00000224140:p.Lys2201Arg	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	118	53	NM_015046	0	0	2	4	2	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.263460	0.59431	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57	5.56	5.56	0.83823	.	0.148494	0.47455	D	0.000240	D	0.85141	0.5629	N	0.25825	0.765	0.37682	D	0.923524	B;D;D	0.69078	0.123;0.99;0.997	B;D;D	0.77557	0.42;0.956;0.99	D	0.86395	0.1738	10	0.36615	T	0.2	.	14.907	0.70727	0.0:0.0:0.0:1.0	.	2201;2201;2201	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	R	2201;443;2201;2201	ENSP00000224140:K2201R;ENSP00000409143:K443R;ENSP00000361242:K2201R;ENSP00000376913:K2201R	ENSP00000224140:K2201R	K	-	2	0	SETX	134146727	1.000000	0.71417	1.000000	0.80357	0.457000	0.32468	3.550000	0.53691	2.123000	0.65237	0.528000	0.53228	AAG	.		0.418	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
TSC1	7248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	135781374	135781374	+	Missense_Mutation	SNP	C	C	T	rs377279170		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr9:135781374C>T	ENST00000298552.3	-	15	1812	c.1591G>A	c.(1591-1593)Gtg>Atg	p.V531M	TSC1_ENST00000545250.1_Missense_Mutation_p.V480M|TSC1_ENST00000440111.2_Missense_Mutation_p.V531M	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	531					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TCAGGGTTCACGCTGGCGCCC	0.587			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.V531M		.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1-1906	1	Unknown(1)	bone(1)	c.G1591A						.	C	MET/VAL,MET/VAL,MET/VAL	0,4406		0,0,2203	70.0	69.0	69.0		1591,1588,1438	1.0	0.0	9		69	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TSC1	NM_000368.4,NM_001162426.1,NM_001162427.1	21,21,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	531/1165,530/1164,480/1114	135781374	1,13005	2203	4300	6503	SO:0001583	missense	7248	exon15	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GGTTCACGCTGGC	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.1591G>A	9.37:g.135781374C>T	ENSP00000298552:p.Val531Met	Somatic	74	1		WXS	Illumina HiSeq	Phase_I	89	32	NM_000368	0	0	0	0	0	B7Z897|Q5VVN5	Missense_Mutation	SNP	ENST00000298552.3	37	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	C	5.777	0.327722	0.10956	0.0	1.16E-4	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250	D;D;T	0.82167	-1.58;-1.58;-1.39	6.05	0.967	0.19674	.	0.902905	0.09848	N	0.748020	T	0.67135	0.2861	N	0.22421	0.69	0.09310	N	1	B;B	0.23937	0.045;0.094	B;B	0.20767	0.022;0.031	T	0.52555	-0.8560	10	0.33141	T	0.24	-7.0E-4	2.3538	0.04291	0.1018:0.4483:0.1801:0.2698	.	480;531	B7Z897;Q92574	.;TSC1_HUMAN	M	531;531;480	ENSP00000298552:V531M;ENSP00000394524:V531M;ENSP00000444017:V480M	ENSP00000298552:V531M	V	-	1	0	TSC1	134771195	0.000000	0.05858	0.001000	0.08648	0.266000	0.26442	0.364000	0.20325	0.137000	0.18759	-0.897000	0.02905	GTG	.		0.587	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
TXLNG	55787	hgsc.bcm.edu	37	X	16804661	16804661	+	Silent	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chrX:16804661A>G	ENST00000380122.5	+	1	112	c.51A>G	c.(49-51)gaA>gaG	p.E17E	TXLNG_ENST00000398155.4_Silent_p.E17E	NM_018360.2	NP_060830.2	Q9NUQ3	TXLNG_HUMAN	taxilin gamma	17					cell cycle (GO:0007049)|regulation of bone mineralization (GO:0030500)|regulation of cell cycle (GO:0051726)|regulation of cell cycle process (GO:0010564)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)	protein heterodimerization activity (GO:0046982)			breast(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	15						GCGGCGCCGAAGAGGCGACTG	0.706													A|||	23	0.00609272	0.0166	0.0014	3775	,	,		6753	0.0		0.0	False		,,,				2504	0.0				p.E17E		.											.	TXLNG-130	0			c.A51G						.						3.0	4.0	4.0					X																	16804661		1550	2886	4436	SO:0001819	synonymous_variant	55787	exon1			CGCCGAAGAGGCG	AK002071	CCDS14178.1, CCDS55373.1	Xp22.2	2014-05-07	2010-04-20	2010-04-20	ENSG00000086712	ENSG00000086712			18578	protein-coding gene	gene with protein product	"""lipopolysaccharide specific response-5 protein"", ""factor inhibiting activating transcription factor 4 (ATF4)-mediated transcription"""	300677	"""chromosome X open reading frame 15"""	CXorf15		15911876, 15184072, 16831913	Standard	NM_018360		Approved	FLJ11209, LSR5, FIAT, MGC126621, MGC126625, TXLNGX	uc004cxq.2	Q9NUQ3	OTTHUMG00000021196	ENST00000380122.5:c.51A>G	X.37:g.16804661A>G		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	3	3	NM_018360	0	0	0	2	2	Q2KQ75|Q5JNZ7|Q9P0X1	Silent	SNP	ENST00000380122.5	37	CCDS14178.1																																																																																			.		0.706	TXLNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055912.1	NM_018360	
SH3KBP1	30011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	19626146	19626146	+	Silent	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chrX:19626146G>T	ENST00000397821.3	-	9	1205	c.915C>A	c.(913-915)ggC>ggA	p.G305G	SH3KBP1_ENST00000477102.1_5'UTR|SH3KBP1_ENST00000379698.4_Silent_p.G268G|SH3KBP1_ENST00000541422.1_Silent_p.G44G|SH3KBP1_ENST00000379716.1_Silent_p.G67G|SH3KBP1_ENST00000379697.3_Silent_p.G349G	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	305	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						CTTCCCACCAGCCTACGTCGA	0.537																																					p.G305G		.											.	SH3KBP1-130	0			c.C915A						.						82.0	64.0	70.0					X																	19626146		2203	4300	6503	SO:0001819	synonymous_variant	30011	exon9			CCACCAGCCTACG	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.915C>A	X.37:g.19626146G>T		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	50	40	NM_031892	0	0	2	4	2	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Silent	SNP	ENST00000397821.3	37	CCDS14193.1																																																																																			.		0.537	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892	
MAGEB4	4115	broad.mit.edu	37	X	30261230	30261230	+	Silent	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chrX:30261230C>A	ENST00000378982.2	+	1	1174	c.978C>A	c.(976-978)ggC>ggA	p.G326G	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	326										breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						CCAGGCGTGGCACTACAGCCA	0.512																																					p.G326G													.	MAGEB4-131	0			c.C978A						.						50.0	43.0	46.0					X																	30261230		2202	4300	6502	SO:0001819	synonymous_variant	4115	exon1			GCGTGGCACTACA		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.978C>A	X.37:g.30261230C>A		Somatic	31	0		WXS	Illumina HiSeq	Phase_I	23	3	NM_002367	0	0	0	0	0	B2R9G0|Q6FHH4|Q8IZ00	Silent	SNP	ENST00000378982.2	37	CCDS14221.1																																																																																			.		0.512	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
KDM5C	8242	bcgsc.ca	37	X	53239616	53239616	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chrX:53239616G>T	ENST00000375401.3	-	12	2258	c.1726C>A	c.(1726-1728)Ctc>Atc	p.L576I	KDM5C_ENST00000375383.3_Missense_Mutation_p.L535I|KDM5C_ENST00000452825.3_Missense_Mutation_p.L509I|KDM5C_ENST00000375379.3_Missense_Mutation_p.L576I|KDM5C_ENST00000465402.1_5'UTR|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000404049.3_Missense_Mutation_p.L575I	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	576	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TGGGACATGAGGGTGTTGGGA	0.512			"""N, F, S"""		clear cell renal carcinoma																																p.L576I				Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	KDM5C-1272	0			c.C1726A						.						181.0	152.0	162.0					X																	53239616		2203	4300	6503	SO:0001583	missense	8242	exon12			ACATGAGGGTGTT	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1726C>A	X.37:g.53239616G>T	ENSP00000364550:p.Leu576Ile	Somatic	52	0		WXS	Illumina HiSeq	Phase_1	46	4	NM_004187	0	0	12	12	0	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420223	0.83559	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28	5.62	5.62	0.85841	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.90779	0.7105	M	0.86740	2.835	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.991;0.995;0.995	D	0.92296	0.5845	10	0.87932	D	0	-13.9148	15.8643	0.79052	0.0:0.0:1.0:0.0	.	509;575;576	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	I	509;576;575;576;535	ENSP00000445176:L509I;ENSP00000364550:L576I;ENSP00000385394:L575I;ENSP00000364528:L576I;ENSP00000364532:L535I	ENSP00000364528:L576I	L	-	1	0	KDM5C	53256341	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.792000	0.69052	2.344000	0.79699	0.600000	0.82982	CTC	.		0.512	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
PCDH11X	27328	ucsc.edu;bcgsc.ca	37	X	91456392	91456392	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chrX:91456392C>T	ENST00000373094.1	+	3	3897	c.3052C>T	c.(3052-3054)Cga>Tga	p.R1018*	PCDH11X_ENST00000406881.1_Nonsense_Mutation_p.R1018*|PCDH11X_ENST00000504220.2_Nonsense_Mutation_p.R1018*|PCDH11X_ENST00000298274.8_Intron|PCDH11X_ENST00000361655.2_Nonsense_Mutation_p.R1018*|PCDH11X_ENST00000373088.1_Intron|PCDH11X_ENST00000373097.1_Nonsense_Mutation_p.R1018*	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1018			R -> Q (in dbSNP:rs4252205).		homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R1018*(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GGAGGTTGTGCGATCTTGCAC	0.398																																					p.R1018X	NSCLC(38;925 1092 2571 38200 45895)												.	PCDH11X-193	2	Substitution - Nonsense(2)	large_intestine(2)	c.C3052T						.						84.0	74.0	77.0					X																	91456392		2203	4300	6503	SO:0001587	stop_gained	27328	exon3			GTTGTGCGATCTT	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3052C>T	X.37:g.91456392C>T	ENSP00000362186:p.Arg1018*	Somatic	35	0		WXS	Illumina HiSeq		36	4	NM_001168363	0	0	0	0	0	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Nonsense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	c	22.2	4.264023	0.80358	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934	.	.	.	4.18	-6.23	0.02052	.	0.372941	0.19414	U	0.114870	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9714	0.41757	0.7199:0.1664:0.1137:0.0	.	.	.	.	X	1018	.	ENSP00000349408:R1018X	R	+	1	2	PCDH11X	91343048	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.837000	0.04377	-0.980000	0.03524	-0.341000	0.08007	CGA	.		0.398	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
DCAF12L1	139170	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	125685498	125685498	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chrX:125685498A>C	ENST00000371126.1	-	1	1336	c.1094T>G	c.(1093-1095)gTg>gGg	p.V365G		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	365										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						ACCGGTGCCCACAGTGATGAT	0.632																																					p.V365G		.											.	DCAF12L1-132	0			c.T1094G						.						35.0	38.0	37.0					X																	125685498		2203	4299	6502	SO:0001583	missense	139170	exon1			GTGCCCACAGTGA	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1094T>G	X.37:g.125685498A>C	ENSP00000360167:p.Val365Gly	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	66	55	NM_178470	0	0	0	0	0	Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	37	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.414963	0.42817	.	.	ENSG00000198889	ENST00000371126	T	0.66099	-0.19	3.64	3.64	0.41730	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.343553	0.17248	N	0.181261	T	0.65491	0.2696	M	0.73962	2.25	0.58432	D	0.999996	D	0.54397	0.966	P	0.47299	0.543	T	0.70691	-0.4802	10	0.87932	D	0	.	9.8475	0.41037	1.0:0.0:0.0:0.0	.	365	Q5VU92	DC121_HUMAN	G	365	ENSP00000360167:V365G	ENSP00000360167:V365G	V	-	2	0	DCAF12L1	125513179	1.000000	0.71417	0.124000	0.21820	0.171000	0.22731	5.855000	0.69510	1.683000	0.51011	0.350000	0.21858	GTG	.		0.632	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470	
TCF7L2	6934	broad.mit.edu	37	10	114925317	114925317	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:114925317delA	ENST00000355995.4	+	15	1953	c.1446delA	c.(1444-1446)agafs	p.R482fs	TCF7L2_ENST00000355717.4_Frame_Shift_Del_p.E465fs|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000543371.1_Frame_Shift_Del_p.R465fs|TCF7L2_ENST00000538897.1_Frame_Shift_Del_p.E458fs|TCF7L2_ENST00000369389.1_Frame_Shift_Del_p.E152fs|TCF7L2_ENST00000369397.4_Frame_Shift_Del_p.R459fs|TCF7L2_ENST00000542695.1_Frame_Shift_Del_p.R198fs|TCF7L2_ENST00000545257.1_Frame_Shift_Del_p.R482fs|TCF7L2_ENST00000369386.1_3'UTR|TCF7L2_ENST00000352065.5_3'UTR|TCF7L2_ENST00000536810.1_Frame_Shift_Del_p.R465fs			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	482	Promoter-specific activation domain.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TTTCTAGGAGAAAAAAAAAGT	0.522			T	VTI1A	colorectal																																p.R465fs				Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	TCF7L2-586	0			c.1395delA						.						94.0	102.0	99.0					10																	114925317		2203	4300	6503	SO:0001589	frameshift_variant	6934	exon14			TAGGAGAAAAAAA	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1446delA	10.37:g.114925317delA	ENSP00000348274:p.Arg482fs	Somatic	197	0		WXS	Illumina HiSeq	Phase_I	255	7	NM_001146274	0	0	0	0	0	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Frame_Shift_Del	DEL	ENST00000355995.4	37																																																																																				.		0.522	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
ATP2A2	488	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	110765478	110765478	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:110765478delC	ENST00000539276.2	+	8	860	c.751delC	c.(751-753)caafs	p.Q251fs	ATP2A2_ENST00000308664.6_Frame_Shift_Del_p.Q251fs|ATP2A2_ENST00000395494.2_Frame_Shift_Del_p.Q224fs			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	251					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						ACCCCTTCAGCAAAAACTAGA	0.453																																					p.Q251fs		.											.	ATP2A2-94	0			c.751delC						.						166.0	166.0	166.0					12																	110765478		2203	4300	6503	SO:0001589	frameshift_variant	488	exon8			.		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.751delC	12.37:g.110765478delC	ENSP00000440045:p.Gln251fs	Somatic	237	0		WXS	Illumina HiSeq	Phase_I	346	90	NM_001681	0	0	0	0	0	A6NDN7|B4DF05|P16614|Q86VJ2	Frame_Shift_Del	DEL	ENST00000539276.2	37	CCDS9144.1																																																																																			.		0.453	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
ZNF814	730051	broad.mit.edu	37	19	58386399	58386399	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:58386399delT	ENST00000435989.2	-	3	593	c.359delA	c.(358-360)cacfs	p.H120fs	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	120					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CTCACACCTGTGCAGTTTCTG	0.502																																					p.H120fs													.	.	0			c.359delA						.						18.0	14.0	15.0					19																	58386399		692	1568	2260	SO:0001589	frameshift_variant	730051	exon3			CACCTGTGCAGTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.359delA	19.37:g.58386399delT	ENSP00000410545:p.His120fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	116	16	NM_001144989	0	0	0	0	0	A6NF35	Frame_Shift_Del	DEL	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.502	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
IL36RN	26525	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	113820191	113820191	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:113820191delG	ENST00000393200.2	+	5	566	c.405delG	c.(403-405)cagfs	p.Q135fs	IL36RN_ENST00000346807.3_Frame_Shift_Del_p.Q135fs	NM_012275.2	NP_036407.1	Q9UBH0	I36RA_HUMAN	interleukin 36 receptor antagonist	135					antifungal humoral response (GO:0019732)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of interferon-gamma secretion (GO:1902714)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)	extracellular space (GO:0005615)	interleukin-1 receptor antagonist activity (GO:0005152)			large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GACTCACCCAGCTTCCCGAGA	0.632																																					p.Q135fs		.											.	IL36RN-91	0			c.405delG						.						50.0	48.0	49.0					2																	113820191		2203	4300	6503	SO:0001589	frameshift_variant	26525	exon5			.	AF201830	CCDS2111.1	2q14	2014-09-17	2011-06-06	2011-06-06	ENSG00000136695	ENSG00000136695		"""Interleukins and interleukin receptors"""	15561	protein-coding gene	gene with protein product	"""family of interleukin 1-delta"", ""interleukin-1 receptor antagonist homolog 1"", ""interleukin-1 HY1"", ""IL-1 related protein 3"""	605507	"""interleukin 1 family, member 5 (delta)"""	IL1F5		10625660, 10512743, 11574262	Standard	NM_012275		Approved	FIL1, FIL1(DELTA), FIL1D, IL1HY1, IL1RP3, IL1L1, IL-1F5, IL36RA, MGC29840	uc002tit.3	Q9UBH0	OTTHUMG00000131337	ENST00000393200.2:c.405delG	2.37:g.113820191delG	ENSP00000376896:p.Gln135fs	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	71	18	NM_012275	0	0	0	0	0	A8K2I4|Q56AT9|Q7RTZ6	Frame_Shift_Del	DEL	ENST00000393200.2	37	CCDS2111.1																																																																																			.		0.632	IL36RN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330729.1	NM_173170	
SGK2	10110	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	42203603	42203603	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr20:42203603delT	ENST00000341458.4	+	9	1051	c.832delT	c.(832-834)tggfs	p.W278fs	SGK2_ENST00000373092.3_Frame_Shift_Del_p.W218fs|SGK2_ENST00000426287.1_Frame_Shift_Del_p.W244fs|SGK2_ENST00000423407.3_Frame_Shift_Del_p.W218fs|SGK2_ENST00000373100.1_Frame_Shift_Del_p.W218fs|SGK2_ENST00000373077.1_Frame_Shift_Del_p.W217fs	NM_016276.3	NP_057360.2	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2	278	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transmembrane transport (GO:0034220)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGTGGACTGGTGGTGCTTGGG	0.512																																					p.W278fs		.											.	SGK2-990	0			c.832delT						.						114.0	103.0	107.0					20																	42203603		2203	4300	6503	SO:0001589	frameshift_variant	10110	exon9			.	AF169034	CCDS13320.1, CCDS13321.1	20q13.2	2008-07-04			ENSG00000101049	ENSG00000101049			13900	protein-coding gene	gene with protein product		607589				10548550	Standard	NM_016276		Approved		uc002xkv.3	Q9HBY8	OTTHUMG00000033054	ENST00000341458.4:c.832delT	20.37:g.42203603delT	ENSP00000340608:p.Trp278fs	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	48	21	NM_016276	0	0	0	0	0	Q52PK5|Q5H8Y6|Q5H8Z1|Q5TZR3|Q9UKG6	Frame_Shift_Del	DEL	ENST00000341458.4	37	CCDS13320.1																																																																																			.		0.512	SGK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080383.1		
RFPL3	10738	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	32754385	32754386	+	Frame_Shift_Del	DEL	GC	GC	-	rs9621427	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr22:32754385_32754386delGC	ENST00000249007.4	+	1	532_533	c.327_328delGC	c.(325-330)aagctgfs	p.KL109fs	RFPL3_ENST00000397468.1_Frame_Shift_Del_p.KL80fs|RFPL3_ENST00000382088.3_Frame_Shift_Del_p.KL80fs|RFPL3S_ENST00000461833.1_5'Flank	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	109	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						TGGAGCCCAAGCTGAAGAAGAT	0.5																																					p.109_110del		.											.	RFPL3-91	0			c.327_328del						.																																			SO:0001589	frameshift_variant	10738	exon1			.	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.327_328delGC	22.37:g.32754385_32754386delGC	ENSP00000249007:p.Lys109fs	Somatic	174	0		WXS	Illumina HiSeq	Phase_I	184	72	NM_001098535	0	0	0	0	0	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Frame_Shift_Del	DEL	ENST00000249007.4	37	CCDS43011.1																																																																																			.		0.500	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
EP300	2033	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	41574164	41574176	+	Frame_Shift_Del	DEL	CACAGCAGCAACT	CACAGCAGCAACT	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	CACAGCAGCAACT	CACAGCAGCAACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr22:41574164_41574176delCACAGCAGCAACT	ENST00000263253.7	+	31	7668_7680	c.6449_6461delCACAGCAGCAACT	c.(6448-6462)ccacagcagcaactcfs	p.PQQQL2150fs	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2150	Interaction with HTLV-1 Tax.|Interaction with NCOA2.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CAGCAGCAACCACAGCAGCAACTCCAGCCACCC	0.582			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.2150_2154del		.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300-2011	0			c.6449_6461del						.																																			SO:0001589	frameshift_variant	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	.	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.6449_6461delCACAGCAGCAACT	22.37:g.41574164_41574176delCACAGCAGCAACT	ENSP00000263253:p.Pro2150fs	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	106	42	NM_001429	0	0	0	0	0	B1AKC2	Frame_Shift_Del	DEL	ENST00000263253.7	37	CCDS14010.1																																																																																			.		0.582	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
ADTRP	84830	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	11723657	11723657	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:11723657delC	ENST00000414691.3	-	5	993	c.583delG	c.(583-585)gctfs	p.A195fs	ADTRP_ENST00000379413.2_Frame_Shift_Del_p.A195fs|ADTRP_ENST00000514824.1_5'UTR|ADTRP_ENST00000229583.5_Frame_Shift_Del_p.A213fs	NM_032744.3	NP_116133.1	Q96IZ2	ADTRP_HUMAN	androgen-dependent TFPI-regulating protein	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GAGAAGAAAGCTGCTAGACCC	0.483																																					p.A213fs		.											.	.	0			c.637delG						.						209.0	208.0	209.0					6																	11723657		2203	4300	6503	SO:0001589	frameshift_variant	84830	exon6			.	AJ420520	CCDS4521.1, CCDS47374.1	6p24.1	2012-01-30	2012-01-27	2012-01-27	ENSG00000111863	ENSG00000111863			21214	protein-coding gene	gene with protein product	"""androgen-induced 1-like"""	614348	"""chromosome 6 open reading frame 105"""	C6orf105		21868574	Standard	NM_032744		Approved	dJ413H6.1, AIG1L	uc011dip.2	Q96IZ2	OTTHUMG00000014260	ENST00000414691.3:c.583delG	6.37:g.11723657delC	ENSP00000404416:p.Ala195fs	Somatic	246	0		WXS	Illumina HiSeq	Phase_I	259	92	NM_001143948	0	0	0	0	0	B2R7T9|B4DV39|Q5THW1	Frame_Shift_Del	DEL	ENST00000414691.3	37	CCDS4521.1																																																																																			.		0.483	ADTRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039864.3	NM_032744	
AIM1	202	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	106967843	106967843	+	Frame_Shift_Del	DEL	T	T	-	rs551716379		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:106967843delT	ENST00000369066.3	+	2	2023	c.1536delT	c.(1534-1536)aatfs	p.N512fs		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GTCAGAACAATGAGAAAATGC	0.453																																					p.N512fs		.											.	AIM1-139	0			c.1536delT						.						82.0	90.0	87.0					6																	106967843		2203	4300	6503	SO:0001589	frameshift_variant	202	exon2			.	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1536delT	6.37:g.106967843delT	ENSP00000358062:p.Asn512fs	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	150	60	NM_001624	0	0	0	0	0	Q6P2P0|Q9BTM3	Frame_Shift_Del	DEL	ENST00000369066.3	37	CCDS34506.1																																																																																			.		0.453	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
SOBP	55084	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	107827597	107827597	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:107827597delT	ENST00000317357.5	+	3	1046	c.387delT	c.(385-387)cctfs	p.P129fs		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		TTATTGTACCTTTAATTCCAC	0.423																																					p.P129fs		.											.	SOBP-91	0			c.387delT						.						204.0	194.0	197.0					6																	107827597		1912	4142	6054	SO:0001589	frameshift_variant	55084	exon3			.	AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.387delT	6.37:g.107827597delT	ENSP00000318900:p.Pro129fs	Somatic	256	0		WXS	Illumina HiSeq	Phase_I	300	100	NM_018013	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000317357.5	37	CCDS43488.1																																																																																			.		0.423	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041693.2	NM_018013	
SRRT	51593	broad.mit.edu;bcgsc.ca	37	7	100485469	100485473	+	Frame_Shift_Del	DEL	GCCCC	GCCCC	-	rs568329863		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	GCCCC	GCCCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:100485469_100485473delGCCCC	ENST00000347433.4	+	17	2473_2477	c.2315_2319delGCCCC	c.(2314-2319)ggccccfs	p.GP772fs	SRRT_ENST00000457580.2_Frame_Shift_Del_p.GP772fs|SRRT_ENST00000432932.1_Frame_Shift_Del_p.GP771fs|SRRT_ENST00000388793.4_Frame_Shift_Del_p.GP771fs			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	772	Pro-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CAGCCACCTGGCCCCGCCCAGAGTA	0.512																																					p.772_773del													.	SRRT-92	0			c.2315_2319del						.																																			SO:0001589	frameshift_variant	51593	exon17			CACCTGGCCCCGC		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2315_2319delGCCCC	7.37:g.100485469_100485473delGCCCC	ENSP00000314491:p.Gly772fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	224	18	NM_001128853	0	0	0	0	0	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Frame_Shift_Del	DEL	ENST00000347433.4	37	CCDS34709.1																																																																																			.		0.512	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
PC	5091	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	66617140	66617141	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:66617140_66617141insG	ENST00000393958.2	-	20	3181_3182	c.3088_3089insC	c.(3088-3090)ctgfs	p.L1030fs	PC_ENST00000393955.2_Frame_Shift_Ins_p.L1030fs|PC_ENST00000528224.1_5'UTR|PC_ENST00000393960.1_Frame_Shift_Ins_p.L1030fs|PC_ENST00000529047.1_Frame_Shift_Ins_p.L150fs	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	1030					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CAGGCTATCCAGGGGGCCAAAG	0.604																																					p.L1030fs		.											.	PC-228	0			c.3089_3090insC						.																																			SO:0001589	frameshift_variant	5091	exon19			.	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.3089dupC	11.37:g.66617145_66617145dupG	ENSP00000377530:p.Leu1030fs	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	77	18	NM_022172	0	0	0	0	0	B4DN00|Q16705	Frame_Shift_Ins	INS	ENST00000393958.2	37	CCDS8152.1																																																																																			.		0.604	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
LRFN4	78999	broad.mit.edu	37	11	66625888	66625889	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:66625888_66625889insC	ENST00000309602.4	+	1	916_917	c.673_674insC	c.(673-675)gccfs	p.A225fs	PC_ENST00000393955.2_Intron|LRFN4_ENST00000393952.3_Frame_Shift_Ins_p.A225fs|PC_ENST00000393960.1_Intron|PC_ENST00000393958.2_Intron	NM_024036.4	NP_076941.2	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III domain containing 4	225						integral component of membrane (GO:0016021)				breast(1)|lung(1)|prostate(1)	3						GGCCTCTCCCGCCCCCCTGGTG	0.698																																					p.A225fs													.	LRFN4-90	0			c.673_674insC						.																																			SO:0001589	frameshift_variant	78999	exon1			TCTCCCGCCCCCC	BC007718	CCDS8153.1	11q13.1	2013-02-11				ENSG00000173621		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28456	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 6"""	612810				16495444, 16828986	Standard	NM_024036		Approved	MGC3103, SALM3., FIGLER6	uc001ojr.3	Q6PJG9		ENST00000309602.4:c.679dupC	11.37:g.66625894_66625894dupC	ENSP00000312535:p.Ala225fs	Somatic	7	0		WXS	Illumina HiSeq	Phase_I	8	3	NM_024036	0	0	0	0	0	Q4VBZ3|Q59GV4|Q8N644|Q9BWJ0	Frame_Shift_Ins	INS	ENST00000309602.4	37	CCDS8153.1																																																																																			.		0.698	LRFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393127.1	NM_024036	
DSPP	1834	hgsc.bcm.edu	37	4	88535323	88535324	+	In_Frame_Ins	INS	-	-	GGCAGTGACTCAAAAGGAGCAGAA			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:88535323_88535324insGGCAGTGACTCAAAAGGAGCAGAA	ENST00000282478.7	+	4	1542_1543	c.1509_1510insGGCAGTGACTCAAAAGGAGCAGAA	c.(1510-1512)ggc>GGCAGTGACTCAAAAGGAGCAGAAggc	p.504_504G>GSDSKGAEG	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_In_Frame_Ins_p.504_504G>GSDSKGAEG			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	504	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		ATAATGGCAATGGCAGTGACTC	0.381																																					p.N503delinsNGSDSKGAE		.											.	DSPP-90	0			c.1509_1510insGGCAGTGACTCAAAAGGAGCAGAA						.																																			SO:0001652	inframe_insertion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1510_1533dupGGCAGTGACTCAAAAGGAGCAGAA	4.37:g.88535323_88535324insGGCAGTGACTCAAAAGGAGCAGAA	Exception_encountered	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	115	19	NM_014208	0	0	0	0	0	A8MUI0|O95815	In_Frame_Ins	INS	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.381	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
SUV39H2	79723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	14939337	14939338	+	Missense_Mutation	DNP	AC	AC	TT			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:14939337_14939338AC>TT	ENST00000354919.6	+	3	670_671	c.670_671AC>TT	c.(670-672)ACt>TTt	p.T224F	SUV39H2_ENST00000313519.5_Missense_Mutation_p.T164F|SUV39H2_ENST00000378325.3_Intron	NM_001193424.1	NP_001180353.1	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2 (Drosophila)	224	Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				cell differentiation (GO:0030154)|chromatin assembly or disassembly (GO:0006333)|chromatin remodeling (GO:0006338)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|male meiosis (GO:0007140)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nuclear heterochromatin (GO:0005720)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)	19						CCCACCTGGTACTCCCATCTAT	0.396																																					p.T224F		.											.	SUV39H2	0			c.C671T						.																																			SO:0001583	missense	79723	exon3			CTGGTACTCCCAT	AK027067	CCDS7104.1, CCDS53493.1, CCDS53494.1	10p13	2011-07-01			ENSG00000152455	ENSG00000152455		"""Chromatin-modifying enzymes / K-methyltransferases"""	17287	protein-coding gene	gene with protein product		606503				11094092	Standard	NM_001193424		Approved	FLJ23414, KMT1B	uc021png.1	Q9H5I1	OTTHUMG00000017718	Exception_encountered	10.37:g.14939337_14939338delinsTT	ENSP00000346997:p.Thr224Phe	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	49.0		0	0	0	0	0	D3DRT4|Q5JSS4|Q5JSS5|Q6I9Y3|Q8ND06	Missense_Mutation	DNP	ENST00000354919.6	37	CCDS53494.1																																																																																			.		0.396	SUV39H2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046947.2	NM_024670	
TECPR2	9895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102906785	102906786	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr14:102906785_102906786GG>TT	ENST00000359520.7	+	11	2817_2818	c.2591_2592GG>TT	c.(2590-2592)tGG>tTT	p.W864F	TECPR2_ENST00000558678.1_Missense_Mutation_p.W864F	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	864					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GCCCTTCTCTGGAAGATTGAAC	0.446																																					p.W864F		.											.	TECPR2	0			c.G2592T						.																																			SO:0001583	missense	9895	exon11			TCTCTGGAAGATT	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		Exception_encountered	14.37:g.102906785_102906786delinsTT	ENSP00000352510:p.Trp864Phe	Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	63.0		0	0	0	0	0	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	DNP	ENST00000359520.7	37	CCDS32162.1																																																																																			.		0.446	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
TFRC	7037	hgsc.bcm.edu;bcgsc.ca	37	3	195782165	195782166	+	Missense_Mutation	DNP	TC	TC	AG			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr3:195782165_195782166TC>AG	ENST00000360110.4	-	17	1853_1854	c.1684_1685GA>CT	c.(1684-1686)GAt>CTt	p.D562L	TFRC_ENST00000465288.1_5'Flank|TFRC_ENST00000392396.3_Missense_Mutation_p.D562L|TFRC_ENST00000420415.1_Missense_Mutation_p.D481L|TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000535031.1_Missense_Mutation_p.D280L	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	562					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	ATAAGGATAATCTGTGTCCTGC	0.5			T	BCL6	NHL																																p.D562L		.		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	.	TFRC	0			c.G1684C						.																																			SO:0001583	missense	7037	exon17			GATAATCTGTGTC	X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1684_1685delinsAG	3.37:g.195782165_195782166delinsAG	ENSP00000353224:p.Asp562Leu	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	25.0		0	0	0	0	0	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	DNP	ENST00000360110.4	37	CCDS3312.1																																																																																			.		0.500	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341346.1		
