#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FBXO2	26232	hgsc.bcm.edu	37	1	11710791	11710791	+	Silent	SNP	C	C	G	rs61749273		TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr1:11710791C>G	ENST00000354287.4	-	2	464	c.123G>C	c.(121-123)gcG>gcC	p.A41A	FBXO2_ENST00000475961.1_5'Flank	NM_012168.5	NP_036300.2	Q9UK22	FBX2_HUMAN	F-box protein 2	41					cellular protein modification process (GO:0006464)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of protein ubiquitination (GO:0031396)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|SCF ubiquitin ligase complex (GO:0019005)	beta-amyloid binding (GO:0001540)|carbohydrate binding (GO:0030246)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(1)|lung(4)	6	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		CGGCGGCGGccgccgcctcct	0.756																																					p.A41A		.											.	FBXO2-226	0			c.G123C						.						2.0	2.0	2.0					1																	11710791		1408	2892	4300	SO:0001819	synonymous_variant	26232	exon2			GGCGGCCGCCGCC	AF174594	CCDS130.1	1p36.21	2010-04-21	2004-06-15		ENSG00000116661	ENSG00000116661		"""F-boxes /  ""other"""""	13581	protein-coding gene	gene with protein product		607112	"""F-box only protein 2"", ""organ of Corti protein 1"""	OCP1		10531035, 10531037	Standard	NM_012168		Approved	FBX2, Nfb42, Fbs1, Fbg1	uc001asj.3	Q9UK22	OTTHUMG00000002072	ENST00000354287.4:c.123G>C	1.37:g.11710791C>G		Somatic	1	0		WXS	Illumina HiSeq	Phase_I	4	2	NM_012168	0	0	0	0	0	B2R7K7|Q5TGY0|Q6FGJ7|Q8TB29|Q9UKC6	Silent	SNP	ENST00000354287.4	37	CCDS130.1																																																																																			.		0.756	FBXO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005764.1	NM_012168	
SYDE2	84144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	85648788	85648788	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr1:85648788T>C	ENST00000341460.5	-	3	1586	c.1537A>G	c.(1537-1539)Aat>Gat	p.N513D		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	513					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		AATGACCAATTAATTGAACTG	0.383																																					p.N513D		.											.	SYDE2-70	0			c.A1537G						.						118.0	120.0	119.0					1																	85648788		1831	4083	5914	SO:0001583	missense	84144	exon3			ACCAATTAATTGA	AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.1537A>G	1.37:g.85648788T>C	ENSP00000340594:p.Asn513Asp	Somatic	154	0		WXS	Illumina HiSeq	Phase_I	156	9	NM_032184	0	0	0	0	0	Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	ENST00000341460.5	37	CCDS44169.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.237512	0.58886	.	.	ENSG00000097096	ENST00000341460	T	0.09073	3.02	5.41	3.06	0.35304	.	0.205916	0.48767	D	0.000174	T	0.04770	0.0129	M	0.68952	2.095	0.28339	N	0.921432	D;P	0.52996	0.957;0.787	B;B	0.44278	0.445;0.295	T	0.20207	-1.0282	10	0.56958	D	0.05	.	8.1975	0.31405	0.0:0.0701:0.1349:0.795	.	513;513	Q5VT97;Q5VT97-2	SYDE2_HUMAN;.	D	513	ENSP00000340594:N513D	ENSP00000340594:N513D	N	-	1	0	SYDE2	85421376	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	3.969000	0.56816	0.359000	0.24239	0.528000	0.53228	AAT	.		0.383	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127989.2		
LAMB3	3914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	209800244	209800244	+	Missense_Mutation	SNP	C	C	T	rs144249951		TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr1:209800244C>T	ENST00000356082.4	-	13	1699	c.1565G>A	c.(1564-1566)cGg>cAg	p.R522Q	LAMB3_ENST00000391911.1_Missense_Mutation_p.R522Q|LAMB3_ENST00000367030.3_Missense_Mutation_p.R522Q	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	522	Laminin EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00460}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TCCATAGGTCCGGTCTGGACA	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		20065	0.0		0.001	False		,,,				2504	0.0				p.R522Q		.											.	LAMB3-156	0			c.G1565A						.	C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	54.0	45.0	48.0		1565,1565,1565	-0.5	0.1	1	dbSNP_134	48	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	LAMB3	NM_000228.2,NM_001017402.1,NM_001127641.1	43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	522/1173,522/1173,522/1173	209800244	1,13005	2203	4300	6503	SO:0001583	missense	3914	exon13			TAGGTCCGGTCTG	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1565G>A	1.37:g.209800244C>T	ENSP00000348384:p.Arg522Gln	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	73	15	NM_000228	0	0	2	6	4	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.471943	0.26423	0.0	1.16E-4	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.61158	0.13;0.13;0.13	5.7	-0.461	0.12172	EGF-like, laminin (3);	0.489478	0.22676	N	0.057015	T	0.41305	0.1153	L	0.35854	1.095	0.09310	N	1	B	0.28082	0.2	B	0.27076	0.076	T	0.24548	-1.0157	10	0.21540	T	0.41	.	10.3743	0.44073	0.0:0.6147:0.0:0.3853	.	522	Q13751	LAMB3_HUMAN	Q	522	ENSP00000375778:R522Q;ENSP00000348384:R522Q;ENSP00000355997:R522Q	ENSP00000348384:R522Q	R	-	2	0	LAMB3	207866867	0.000000	0.05858	0.055000	0.19348	0.114000	0.19823	0.138000	0.16016	-0.213000	0.10094	0.650000	0.86243	CGG	C|1.000;T|0.000		0.672	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228	
FBXO28	23219	hgsc.bcm.edu;broad.mit.edu	37	1	224302059	224302059	+	Silent	SNP	C	C	G			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr1:224302059C>G	ENST00000366862.5	+	1	271	c.228C>G	c.(226-228)ctC>ctG	p.L76L	FBXO28_ENST00000424254.2_Silent_p.L76L	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	76	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.									endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		AGAACATCCTCAGCTTTATGT	0.647																																					p.L76L		.											.	FBXO28-661	0			c.C228G						.						30.0	31.0	31.0					1																	224302059		2202	4298	6500	SO:0001819	synonymous_variant	23219	exon1			CATCCTCAGCTTT	AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.228C>G	1.37:g.224302059C>G		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	25	3	NM_001136115	0	0	4	4	0	E9PEM8|O75070	Silent	SNP	ENST00000366862.5	37	CCDS1539.1																																																																																			.		0.647	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091283.2	NM_015176	
SBF2	81846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	10011061	10011061	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr11:10011061C>T	ENST00000256190.8	-	13	1515	c.1378G>A	c.(1378-1380)Gag>Aag	p.E460K		NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	460					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		AATAGTTGCTCAGCAAGTTCC	0.303																																					p.E460K		.											.	SBF2-93	0			c.G1378A						.						99.0	101.0	100.0					11																	10011061		2200	4292	6492	SO:0001583	missense	81846	exon13			GTTGCTCAGCAAG	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.1378G>A	11.37:g.10011061C>T	ENSP00000256190:p.Glu460Lys	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	61	15	NM_030962	0	0	2	2	0	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.489124	0.84962	.	.	ENSG00000133812	ENST00000256190	D	0.85629	-2.01	6.04	6.04	0.98038	.	0.230274	0.43416	D	0.000562	D	0.90539	0.7035	L	0.48986	1.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86724	0.1944	10	0.25106	T	0.35	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	460	Q86WG5	MTMRD_HUMAN	K	460	ENSP00000256190:E460K	ENSP00000256190:E460K	E	-	1	0	SBF2	9967637	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.324000	0.65863	2.873000	0.98535	0.563000	0.77884	GAG	.		0.303	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
SLCO2B1	11309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	74880776	74880776	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr11:74880776C>A	ENST00000289575.5	+	6	1143	c.748C>A	c.(748-750)Cgc>Agc	p.R250S	SLCO2B1_ENST00000531756.1_Intron|SLCO2B1_ENST00000454962.2_Intron|SLCO2B1_ENST00000341411.4_Intron|SLCO2B1_ENST00000525650.1_Missense_Mutation_p.R106S|SLCO2B1_ENST00000526660.1_Intron|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.R228S|SLCO2B1_ENST00000532236.1_Missense_Mutation_p.R134S	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	250					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.R250C(1)		breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	CCTCATGCTGCGCCTTTATGT	0.542																																					p.R250S		.											.	SLCO2B1-154	1	Substitution - Missense(1)	large_intestine(1)	c.C748A						.						128.0	120.0	123.0					11																	74880776		2200	4293	6493	SO:0001583	missense	11309	exon6			ATGCTGCGCCTTT	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.748C>A	11.37:g.74880776C>A	ENSP00000289575:p.Arg250Ser	Somatic	158	0		WXS	Illumina HiSeq	Phase_I	155	43	NM_007256	0	0	10	11	1	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	37	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.010553	0.54361	.	.	ENSG00000137491	ENST00000289575;ENST00000532236;ENST00000525650;ENST00000428359;ENST00000526839	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	4.83	2.77	0.32553	Major facilitator superfamily domain, general substrate transporter (1);	0.060626	0.64402	N	0.000004	T	0.41558	0.1164	L	0.39566	1.225	0.80722	D	1	P;P	0.49358	0.812;0.923	B;P	0.51170	0.425;0.661	T	0.15838	-1.0423	10	0.29301	T	0.29	.	11.6849	0.51481	0.326:0.674:0.0:0.0	.	106;250	E9PPU8;O94956	.;SO2B1_HUMAN	S	250;134;106;228;126	ENSP00000289575:R250S;ENSP00000434112:R134S;ENSP00000436324:R106S;ENSP00000388912:R228S;ENSP00000434742:R126S	ENSP00000289575:R250S	R	+	1	0	SLCO2B1	74558424	0.932000	0.31603	0.996000	0.52242	0.937000	0.57800	1.528000	0.35985	1.218000	0.43458	0.650000	0.86243	CGC	.		0.542	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	
BAZ2A	11176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57005874	57005874	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr12:57005874G>A	ENST00000551812.1	-	6	1491	c.1298C>T	c.(1297-1299)aCc>aTc	p.T433I	BAZ2A_ENST00000179765.5_Missense_Mutation_p.T401I|BAZ2A_ENST00000549884.1_Missense_Mutation_p.T431I|BAZ2A_ENST00000379441.3_Missense_Mutation_p.T403I	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	433					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						TGCTGGGGAGGTTGTTGGCGA	0.542																																					p.T433I		.											.	BAZ2A-22	0			c.C1298T						.						101.0	115.0	110.0					12																	57005874		2101	4218	6319	SO:0001583	missense	11176	exon6			GGGGAGGTTGTTG	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.1298C>T	12.37:g.57005874G>A	ENSP00000446880:p.Thr433Ile	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	73	55	NM_013449	0	0	4	14	10	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	37	CCDS44924.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.854|6.854	0.526813|0.526813	0.13066|0.13066	.|.	.|.	ENSG00000076108|ENSG00000076108	ENST00000551996|ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549884	.|T;T;T;T	.|0.58210	.|0.35;0.35;0.35;0.35	5.45|5.45	-0.694|-0.694	0.11294|0.11294	.|.	.|1.012260	.|0.07909	.|N	.|0.973899	T|T	0.29355|0.29355	0.0731|0.0731	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999997|0.999997	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.23048|0.23048	-1.0199|-1.0199	5|10	.|0.72032	.|D	.|0.01	.|.	5.0786|5.0786	0.14644|0.14644	0.2123:0.0:0.5335:0.2543|0.2123:0.0:0.5335:0.2543	.|.	.|431;433	.|F8VU39;Q9UIF9	.|.;BAZ2A_HUMAN	S|I	81|403;401;433;431	.|ENSP00000368754:T403I;ENSP00000179765:T401I;ENSP00000446880:T433I;ENSP00000447941:T431I	.|ENSP00000179765:T401I	P|T	-|-	1|2	0|0	BAZ2A|BAZ2A	55292141|55292141	0.835000|0.835000	0.29415|0.29415	0.009000|0.009000	0.14445|0.14445	0.194000|0.194000	0.23727|0.23727	0.260000|0.260000	0.18424|0.18424	-0.209000|-0.209000	0.10156|0.10156	-0.182000|-0.182000	0.12963|0.12963	CCT|ACC	.		0.542	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
ASCL1	429	hgsc.bcm.edu	37	12	103352211	103352211	+	Silent	SNP	G	G	C	rs376318467	byFrequency	TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr12:103352211G>C	ENST00000266744.3	+	1	748	c.189G>C	c.(187-189)gcG>gcC	p.A63A		NM_004316.3	NP_004307.2	P50553	ASCL1_HUMAN	achaete-scute family bHLH transcription factor 1	63					adrenal chromaffin cell differentiation (GO:0061104)|carotid body glomus cell differentiation (GO:0061103)|cell maturation (GO:0048469)|cellular response to magnetism (GO:0071259)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|lung epithelial cell differentiation (GO:0060487)|lung neuroendocrine cell differentiation (GO:0061100)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroblast fate determination (GO:0007400)|neuroblast proliferation (GO:0007405)|neurogenesis (GO:0022008)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron fate commitment (GO:0003359)|Notch signaling pathway (GO:0007219)|olfactory pit development (GO:0060166)|oligodendrocyte development (GO:0014003)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial cell differentiation (GO:0030856)|regulation of gene expression (GO:0010468)|regulation of mitotic cell cycle (GO:0007346)|regulation of timing of subpallium neuron differentiation (GO:0060165)|response to epidermal growth factor (GO:0070849)|response to folic acid (GO:0051593)|response to lithium ion (GO:0010226)|response to retinoic acid (GO:0032526)|spinal cord association neuron differentiation (GO:0021527)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|stomach neuroendocrine cell differentiation (GO:0061102)|subpallium neuron fate commitment (GO:0060163)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)|vestibular nucleus development (GO:0021750)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			NS(3)|large_intestine(1)|lung(1)	5						agcagcagGCGCCGCAGCTGA	0.721													g|||	62	0.0123802	0.0446	0.0043	5008	,	,		10181	0.0		0.0	False		,,,				2504	0.0				p.A63A		.											.	ASCL1-90	0			c.G189C						.			59,2685		1,57,1314	3.0	3.0	3.0		189	3.6	1.0	12		3	2,5798		0,2,2898	no	coding-synonymous	ASCL1	NM_004316.3		1,59,4212	CC,CG,GG		0.0345,2.1501,0.714		63/237	103352211	61,8483	1372	2900	4272	SO:0001819	synonymous_variant	429	exon1			GCAGGCGCCGCAG	L08424	CCDS31886.1	12q22-q23	2013-10-17	2013-10-17			ENSG00000139352		"""Basic helix-loop-helix proteins"""	738	protein-coding gene	gene with protein product		100790	"""achaete-scute complex (Drosophila) homolog-like 1"", ""achaete-scute complex-like 1 (Drosophila)"", ""achaete-scute complex homolog 1 (Drosophila)"""			8390674	Standard	NM_004316		Approved	ASH1, HASH1, bHLHa46	uc001tjr.4	P50553		ENST00000266744.3:c.189G>C	12.37:g.103352211G>C		Somatic	7	2		WXS	Illumina HiSeq	Phase_I	14	5	NM_004316	0	0	0	0	0	A8K3C4|Q9BQ30	Silent	SNP	ENST00000266744.3	37	CCDS31886.1																																																																																			.		0.721	ASCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406707.1		
KBTBD7	84078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	41767953	41767953	+	Silent	SNP	G	G	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr13:41767953G>A	ENST00000379483.3	-	1	749	c.441C>T	c.(439-441)gcC>gcT	p.A147A		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	147										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		GCATGTCGGAGGCCGCGTACA	0.587																																					p.A147A		.											.	KBTBD7-91	0			c.C441T						.						109.0	91.0	97.0					13																	41767953		2203	4300	6503	SO:0001819	synonymous_variant	84078	exon1			GTCGGAGGCCGCG	AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.441C>T	13.37:g.41767953G>A		Somatic	115	0		WXS	Illumina HiSeq	Phase_I	105	31	NM_032138	0	0	2	3	1	B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Silent	SNP	ENST00000379483.3	37	CCDS9377.1																																																																																			.		0.587	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044660.1	NM_032138	
TDRD3	81550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	61103190	61103190	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr13:61103190G>A	ENST00000196169.3	+	11	2340	c.1552G>A	c.(1552-1554)Gct>Act	p.A518T	TDRD3_ENST00000377894.2_Missense_Mutation_p.A518T|TDRD3_ENST00000535286.1_Missense_Mutation_p.A611T|TDRD3_ENST00000377881.2_Missense_Mutation_p.A518T	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	518					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		ACCTGTCACAGCTGTACCCTG	0.398																																					p.A611T	Colon(36;164 906 35820 50723)	.											.	TDRD3-516	0			c.G1831A						.						54.0	54.0	54.0					13																	61103190		2203	4300	6503	SO:0001583	missense	81550	exon11			GTCACAGCTGTAC	AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.1552G>A	13.37:g.61103190G>A	ENSP00000196169:p.Ala518Thr	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	84	32	NM_001146070	0	0	12	15	3	B2MWP9|Q53XA6|Q6P992	Missense_Mutation	SNP	ENST00000196169.3	37	CCDS9441.1	.	.	.	.	.	.	.	.	.	.	G	0.227	-1.023813	0.02061	.	.	ENSG00000083544	ENST00000196169;ENST00000377881;ENST00000377894;ENST00000535286	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.26	5.84	-1.01	0.10169	.	0.741305	0.14224	N	0.333183	D	0.85974	0.5822	L	0.47716	1.5	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.68911	-0.5284	10	0.12103	T	0.63	-1.2106	3.7879	0.08707	0.4174:0.0981:0.3852:0.0994	.	611;517;518	Q9H7E2-3;Q9H7E2-2;Q9H7E2	.;.;TDRD3_HUMAN	T	518;518;518;611	ENSP00000196169:A518T;ENSP00000367113:A518T;ENSP00000367126:A518T;ENSP00000440190:A611T	ENSP00000196169:A518T	A	+	1	0	TDRD3	60001191	0.000000	0.05858	0.000000	0.03702	0.389000	0.30415	0.087000	0.14958	-0.343000	0.08351	-0.813000	0.03139	GCT	.		0.398	TDRD3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045175.2	NM_030794	
SLC7A8	23428	hgsc.bcm.edu	37	14	23597353	23597353	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr14:23597353A>G	ENST00000316902.7	-	10	2041	c.1316T>C	c.(1315-1317)gTc>gCc	p.V439A	SLC7A8_ENST00000422941.2_Missense_Mutation_p.V215A|SLC7A8_ENST00000453702.1_Missense_Mutation_p.V236A|SLC7A8_ENST00000529705.2_Missense_Mutation_p.V334A|SLC7A8_ENST00000469263.1_Intron	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	439					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	CAGGCTGAAGACCAGCAGGAA	0.562																																					p.V439A		.											.	SLC7A8-91	0			c.T1316C						.						153.0	129.0	137.0					14																	23597353		2203	4300	6503	SO:0001583	missense	23428	exon10			CTGAAGACCAGCA	Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.1316T>C	14.37:g.23597353A>G	ENSP00000320378:p.Val439Ala	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	47	3	NM_012244	0	0	4	4	0	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000316902.7	37	CCDS9590.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.628933	0.46944	.	.	ENSG00000092068	ENST00000316902;ENST00000453702;ENST00000529705;ENST00000422941;ENST00000206514	D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7	5.53	5.53	0.82687	Amino acid permease domain (1);	0.329841	0.34460	N	0.003958	D	0.84529	0.5492	N	0.25380	0.74	0.37260	D	0.906967	B;B;B	0.20368	0.044;0.02;0.001	B;B;B	0.25614	0.062;0.034;0.013	T	0.81466	-0.0920	10	0.16896	T	0.51	.	14.6571	0.68841	1.0:0.0:0.0:0.0	.	334;215;439	B4DKT4;B4DTV6;Q9UHI5	.;.;LAT2_HUMAN	A	439;236;334;215;236	ENSP00000320378:V439A;ENSP00000391577:V236A;ENSP00000434345:V334A;ENSP00000416398:V215A	ENSP00000206514:V236A	V	-	2	0	SLC7A8	22667193	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.214000	0.77958	2.109000	0.64355	0.459000	0.35465	GTC	.		0.562	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3		
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	45650876	45650876	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr14:45650876G>A	ENST00000267430.5	+	16	4439	c.4354G>A	c.(4354-4356)Gct>Act	p.A1452T	FANCM_ENST00000555013.1_3'UTR|FANCM_ENST00000542564.2_Missense_Mutation_p.A1426T	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1452					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TCCACTTCATGCTGTCAAAAA	0.318								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.A1452T		.											.	FANCM-569	0			c.G4354A						.						59.0	60.0	60.0					14																	45650876		2203	4296	6499	SO:0001583	missense	57697	exon16	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CTTCATGCTGTCA	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4354G>A	14.37:g.45650876G>A	ENSP00000267430:p.Ala1452Thr	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	50	13	NM_020937	0	0	1	2	1	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.81|19.81	3.897408|3.897408	0.72639|0.72639	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250|ENST00000554809	T;T;T|.	0.20069|.	2.7;2.7;2.1|.	5.25|5.25	4.36|4.36	0.52297|0.52297	.|.	0.807093|.	0.11373|.	N|.	0.570657|.	T|T	0.39600|0.39600	0.1084|0.1084	L|L	0.43152|0.43152	1.355|1.355	0.29859|0.29859	N|N	0.827775|0.827775	D;P|.	0.65815|.	0.995;0.953|.	P;P|.	0.53760|.	0.734;0.631|.	T|T	0.35051|0.35051	-0.9804|-0.9804	10|5	0.14656|.	T|.	0.56|.	.|.	8.1721|8.1721	0.31260|0.31260	0.1826:0.0:0.8174:0.0|0.1826:0.0:0.8174:0.0	.|.	1426;1452|.	B2RTQ9;Q8IYD8|.	.;FANCM_HUMAN|.	T|Y	1452;1426;968|384	ENSP00000267430:A1452T;ENSP00000442493:A1426T;ENSP00000452033:A968T|.	ENSP00000267430:A1452T|.	A|C	+|+	1|2	0|0	FANCM|FANCM	44720626|44720626	0.997000|0.997000	0.39634|0.39634	0.995000|0.995000	0.50966|0.50966	0.985000|0.985000	0.73830|0.73830	3.470000|3.470000	0.53100|0.53100	1.348000|1.348000	0.45733|0.45733	0.467000|0.467000	0.42956|0.42956	GCT|TGC	.		0.318	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
TBPL2	387332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	55890942	55890942	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr14:55890942A>C	ENST00000247219.5	-	6	1056	c.986T>G	c.(985-987)aTt>aGt	p.I329S		NM_199047.2	NP_950248.1			TATA box binding protein like 2											endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8						CATTCTATAAATAAGACCAGG	0.348																																					p.I329S		.											.	TBPL2-90	0			c.T986G						.						110.0	102.0	105.0					14																	55890942		2203	4298	6501	SO:0001583	missense	387332	exon6			CTATAAATAAGAC	AY457923	CCDS9724.1	14q22.2	2004-06-03			ENSG00000182521	ENSG00000182521			19841	protein-coding gene	gene with protein product		608964				14634207	Standard	NM_199047		Approved	TRF3, TBP2	uc001xby.3	Q6SJ96	OTTHUMG00000140313	ENST00000247219.5:c.986T>G	14.37:g.55890942A>C	ENSP00000247219:p.Ile329Ser	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	142	40	NM_199047	0	0	0	0	0		Missense_Mutation	SNP	ENST00000247219.5	37	CCDS9724.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.464312	0.84425	.	.	ENSG00000182521	ENST00000247219	T	0.57273	0.41	5.41	5.41	0.78517	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.054773	0.64402	D	0.000001	T	0.75889	0.3911	M	0.93939	3.475	0.80722	D	1	D	0.63880	0.993	P	0.57776	0.827	T	0.83328	-0.0014	10	0.87932	D	0	-12.6468	14.6315	0.68660	1.0:0.0:0.0:0.0	.	329	Q6SJ96	TBPL2_HUMAN	S	329	ENSP00000247219:I329S	ENSP00000247219:I329S	I	-	2	0	TBPL2	54960695	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.138000	0.94501	2.050000	0.60909	0.528000	0.53228	ATT	.		0.348	TBPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276916.1	NM_199047	
GPR135	64582	hgsc.bcm.edu	37	14	59931931	59931931	+	Missense_Mutation	SNP	T	T	G	rs1752428	byFrequency	TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr14:59931931T>G	ENST00000395116.1	-	1	129	c.14A>C	c.(13-15)cAg>cCg	p.Q5P		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	5			Q -> P (in dbSNP:rs1752428).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		GCGGGGCGGCTGCGGCTCCTC	0.781													G|||	2695	0.538139	0.8767	0.5821	5008	,	,		8009	0.2063		0.4722	False		,,,				2504	0.4591				p.Q5P		.											.	GPR135-90	0			c.A14C						.						1.0	1.0	1.0					14																	59931931		555	1498	2053	SO:0001583	missense	64582	exon1			GGCGGCTGCGGCT	AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.14A>C	14.37:g.59931931T>G	ENSP00000378548:p.Gln5Pro	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	3	3	NM_022571	0	0	0	0	0	Q7Z604|Q86SM3|Q8NH39	Missense_Mutation	SNP	ENST00000395116.1	37	CCDS9738.1	1023	0.4684065934065934	376	0.7642276422764228	199	0.5497237569060773	107	0.18706293706293706	341	0.449868073878628	G	12.20	1.867217	0.32977	.	.	ENSG00000181619	ENST00000395116	T	0.62941	-0.01	3.25	3.25	0.37280	.	.	.	.	.	T	0.00012	0.0000	N	0.03608	-0.345	0.09310	P	0.9999999999999688	B	0.02656	0.0	B	0.01281	0.0	T	0.36311	-0.9753	8	0.35671	T	0.21	-4.9918	9.4599	0.38778	0.0:0.0:0.7862:0.2138	rs1752428;rs3742644	5	Q8IZ08	GP135_HUMAN	P	5	ENSP00000378548:Q5P	ENSP00000378548:Q5P	Q	-	2	0	GPR135	59001684	0.007000	0.16637	0.970000	0.41538	0.076000	0.17211	-0.908000	0.04063	0.581000	0.29539	-0.677000	0.03784	CAG	T|0.531;G|0.469		0.781	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276941.1	NM_022571	
KCNH5	27133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	63447722	63447722	+	Missense_Mutation	SNP	G	G	T	rs376391048		TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr14:63447722G>T	ENST00000322893.7	-	6	1078	c.810C>A	c.(808-810)ttC>ttA	p.F270L	KCNH5_ENST00000394964.2_Missense_Mutation_p.F212L|KCNH5_ENST00000394968.1_Missense_Mutation_p.F212L|KCNH5_ENST00000420622.2_Missense_Mutation_p.F270L	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	270					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CGGGCCCCACGAAAGTCGTGT	0.433																																					p.F270L		.											.	KCNH5-98	0			c.C810A						.						61.0	63.0	62.0					14																	63447722		2203	4300	6503	SO:0001583	missense	27133	exon6			CCCCACGAAAGTC	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.810C>A	14.37:g.63447722G>T	ENSP00000321427:p.Phe270Leu	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	81	35	NM_172375	0	0	0	0	0	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.505267	0.64410	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	5.54	1.95	0.26073	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.95401	0.8507	M	0.64404	1.975	0.80722	D	1	P;P;D;D	0.61080	0.893;0.899;0.963;0.989	P;P;P;D	0.66084	0.602;0.603;0.603;0.941	D	0.93621	0.6948	10	0.87932	D	0	.	8.8508	0.35199	0.7805:0.0:0.2195:0.0	.	212;212;270;270	Q86XI1;Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;.;KCNH5_HUMAN	L	270;270;212;212	ENSP00000321427:F270L;ENSP00000395439:F270L;ENSP00000378419:F212L;ENSP00000378415:F212L	ENSP00000321427:F270L	F	-	3	2	KCNH5	62517475	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	1.301000	0.33447	0.086000	0.17137	-0.482000	0.04802	TTC	.		0.433	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	33603296	33603296	+	Splice_Site	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr15:33603296C>T	ENST00000389232.4	+	1	120	c.50C>T	c.(49-51)aCt>aTt	p.T17I	RP11-489D6.2_ENST00000559457.1_RNA|RP11-489D6.2_ENST00000561458.1_RNA|RYR3_ENST00000415757.3_Splice_Site_p.T17I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	17					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTTCTGAGGACTGTGAGTCTC	0.756																																					p.T17I		.											.	RYR3-520	0			c.C50T						.						25.0	32.0	30.0					15																	33603296		1919	4113	6032	SO:0001630	splice_region_variant	6263	exon1			TGAGGACTGTGAG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.51+1C>T	15.37:g.33603296C>T		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	47	16	NM_001243996	0	0	0	0	0	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.077125	0.55753	.	.	ENSG00000198838	ENST00000389232;ENST00000415757	D;D	0.98090	-4.71;-4.71	4.63	3.7	0.42460	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);	1.170300	0.06443	U	0.726384	D	0.96987	0.9016	L	0.49126	1.545	0.38096	D	0.937129	B;B	0.29253	0.144;0.239	B;B	0.38264	0.126;0.269	D	0.90850	0.4730	10	0.54805	T	0.06	.	12.9534	0.58413	0.1639:0.8361:0.0:0.0	.	17;17	Q15413-2;Q15413	.;RYR3_HUMAN	I	17	ENSP00000373884:T17I;ENSP00000399610:T17I	ENSP00000373884:T17I	T	+	2	0	RYR3	31390588	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.045000	0.64220	1.130000	0.42092	0.462000	0.41574	ACT	.		0.756	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		Missense_Mutation
ADPGK	83440	hgsc.bcm.edu	37	15	73045222	73045222	+	Silent	SNP	C	C	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr15:73045222C>A	ENST00000311669.8	-	7	1044	c.951G>T	c.(949-951)gcG>gcT	p.A317A	ADPGK_ENST00000567733.1_5'Flank|ADPGK_ENST00000456471.2_Silent_p.A43A	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	318	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						GGGAAGTCACCGCGGGAAAGA	0.478																																					p.A317A		.											.	ADPGK-90	0			c.G951T						.						36.0	36.0	36.0					15																	73045222		1925	4115	6040	SO:0001819	synonymous_variant	83440	exon7			AGTCACCGCGGGA	AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.951G>T	15.37:g.73045222C>A		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	71	4	NM_031284	0	0	21	22	1	Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Silent	SNP	ENST00000311669.8	37	CCDS42057.1																																																																																			.		0.478	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420434.1	NM_031284	
CSPG4	1464	hgsc.bcm.edu	37	15	75982391	75982391	+	Missense_Mutation	SNP	G	G	A	rs200187536		TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr15:75982391G>A	ENST00000308508.5	-	3	1107	c.1015C>T	c.(1015-1017)Cgc>Tgc	p.R339C		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	339	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						AGGCCCAGGCGGTGTTCCTGG	0.642																																					p.R339C		.											.	CSPG4-229	0			c.C1015T						.						17.0	15.0	16.0					15																	75982391		2192	4283	6475	SO:0001583	missense	1464	exon3			CCAGGCGGTGTTC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1015C>T	15.37:g.75982391G>A	ENSP00000312506:p.Arg339Cys	Somatic	33	1		WXS	Illumina HiSeq	Phase_I	41	5	NM_001897	0	0	3	3	0	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	15.76	2.927450	0.52759	.	.	ENSG00000173546	ENST00000308508	T	0.19938	2.11	5.26	4.26	0.50523	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.181054	0.36815	N	0.002398	T	0.34803	0.0910	L	0.40543	1.245	0.43593	D	0.995946	D	0.89917	1.0	D	0.65987	0.94	T	0.02553	-1.1142	10	0.37606	T	0.19	.	15.6861	0.77411	0.0:0.0:0.8538:0.1462	.	339	Q6UVK1	CSPG4_HUMAN	C	339	ENSP00000312506:R339C	ENSP00000312506:R339C	R	-	1	0	CSPG4	73769446	0.996000	0.38824	1.000000	0.80357	0.667000	0.39255	2.026000	0.41069	2.463000	0.83235	0.555000	0.69702	CGC	G|0.999;A|0.001		0.642	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
WDR90	197335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	716291	716291	+	Missense_Mutation	SNP	C	C	A	rs143767432	byFrequency	TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr16:716291C>A	ENST00000293879.4	+	37	4681	c.4681C>A	c.(4681-4683)Cgt>Agt	p.R1561S	WDR90_ENST00000315764.4_Missense_Mutation_p.R160S|RHOT2_ENST00000315082.4_5'Flank|WDR90_ENST00000549091.1_Missense_Mutation_p.R1563S|WDR90_ENST00000547944.1_Missense_Mutation_p.R160S|WDR90_ENST00000547543.1_3'UTR			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1561										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GACAACCTTCCGTGTGCTGAG	0.627																																					p.R1561S		.											.	WDR90-92	0			c.C4681A						.						46.0	55.0	52.0					16																	716291		2025	4175	6200	SO:0001583	missense	197335	exon37			ACCTTCCGTGTGC	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.4681C>A	16.37:g.716291C>A	ENSP00000293879:p.Arg1561Ser	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	98	27	NM_145294	0	0	20	35	15	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532400	0.64972	.	.	ENSG00000161996	ENST00000549091;ENST00000293879;ENST00000547944;ENST00000315764	T;T;T;T	0.66099	3.39;1.54;-0.19;1.59	3.96	3.0	0.34707	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.649291	0.16302	N	0.220408	T	0.74898	0.3777	M	0.84433	2.695	0.49051	D	0.999749	D;D;D;D	0.89917	0.999;1.0;0.98;0.998	D;D;P;P	0.71184	0.972;0.968;0.671;0.892	T	0.73981	-0.3811	10	0.08837	T	0.75	.	9.2755	0.37696	0.0:0.8986:0.0:0.1014	.	160;160;160;1561	Q96KV7-10;Q96KV7-7;G3V201;Q96KV7	.;.;.;WDR90_HUMAN	S	1563;1561;160;160	ENSP00000448122:R1563S;ENSP00000293879:R1561S;ENSP00000449576:R160S;ENSP00000322808:R160S	ENSP00000293879:R1561S	R	+	1	0	WDR90	656292	0.083000	0.21467	0.303000	0.25071	0.729000	0.41735	1.907000	0.39897	0.877000	0.35895	0.561000	0.74099	CGT	C|0.996;T|0.004		0.627	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
TMC5	79838	hgsc.bcm.edu	37	16	19498618	19498618	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr16:19498618T>C	ENST00000396229.2	+	17	3292	c.2543T>C	c.(2542-2544)gTc>gCc	p.V848A	TMC5_ENST00000564959.1_Missense_Mutation_p.V531A|TMC5_ENST00000219821.5_Missense_Mutation_p.V602A|TMC5_ENST00000542583.2_Missense_Mutation_p.V848A|TMC5_ENST00000561503.1_Missense_Mutation_p.V489A|TMC5_ENST00000541464.1_Missense_Mutation_p.V796A|CTA-363E6.6_ENST00000561762.1_RNA|TMC5_ENST00000381414.4_Missense_Mutation_p.V848A	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	848					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TTCACCGGGGTCTTGTGCACC	0.522																																					p.V848A		.											.	TMC5-91	0			c.T2543C						.						67.0	58.0	61.0					16																	19498618		2197	4300	6497	SO:0001583	missense	79838	exon17			CCGGGGTCTTGTG	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2543T>C	16.37:g.19498618T>C	ENSP00000379531:p.Val848Ala	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	77	4	NM_001105249	0	0	0	0	0	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	37	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	T	16.51	3.144011	0.57044	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T;T	0.67523	-0.11;-0.09;-0.13;-0.13;-0.27	5.72	3.48	0.39840	.	0.235749	0.43110	N	0.000604	T	0.43010	0.1228	N	0.13299	0.325	0.37439	D	0.914337	B;B;B;B;B;B	0.26120	0.142;0.001;0.025;0.014;0.019;0.018	B;B;B;B;B;B	0.24006	0.05;0.003;0.05;0.022;0.022;0.034	T	0.28073	-1.0055	10	0.08837	T	0.75	-19.7366	9.3727	0.38264	0.0:0.148:0.0:0.852	.	796;531;602;602;848;848	F5GYU8;E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2	.;.;.;.;TMC5_HUMAN;.	A	796;848;848;848;602;531	ENSP00000441227:V796A;ENSP00000370822:V848A;ENSP00000379531:V848A;ENSP00000446274:V848A;ENSP00000219821:V602A	ENSP00000219821:V602A	V	+	2	0	TMC5	19406119	1.000000	0.71417	0.948000	0.38648	0.985000	0.73830	3.080000	0.50112	0.443000	0.26582	0.533000	0.62120	GTC	.		0.522	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
GTF3C1	2975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	27519910	27519910	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr16:27519910A>G	ENST00000356183.4	-	8	1208	c.1193T>C	c.(1192-1194)cTa>cCa	p.L398P	GTF3C1_ENST00000561623.1_Missense_Mutation_p.L398P	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	398					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						TCTTGCTTCTAGTTTTCCCAC	0.468																																					p.L398P		.											.	GTF3C1-94	0			c.T1193C						.						195.0	159.0	171.0					16																	27519910		2197	4300	6497	SO:0001583	missense	2975	exon8			GCTTCTAGTTTTC	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1193T>C	16.37:g.27519910A>G	ENSP00000348510:p.Leu398Pro	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	118	36	NM_001520	0	0	2	2	0	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.353988	0.82243	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.32272	1.46	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000002	T	0.45597	0.1350	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.45190	-0.9278	10	0.72032	D	0.01	-4.7197	15.1534	0.72720	1.0:0.0:0.0:0.0	.	398;398	Q12789;Q12789-3	TF3C1_HUMAN;.	P	398;396	ENSP00000348510:L398P	ENSP00000348510:L398P	L	-	2	0	GTF3C1	27427411	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.677000	0.91203	2.054000	0.61138	0.528000	0.53228	CTA	.		0.468	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
PELP1	27043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	4575082	4575082	+	Silent	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:4575082C>T	ENST00000574876.1	-	16	3221	c.3204G>A	c.(3202-3204)gaG>gaA	p.E1068E	PELP1_ENST00000301396.4_Silent_p.E1212E|PELP1_ENST00000269230.7_Silent_p.E978E|PELP1_ENST00000572293.1_Silent_p.E1118E|PELP1_ENST00000436683.2_Silent_p.E844E			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	1068	Glu-rich.|Pro-rich.				cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						CATCCTCAGTCTCCTCTTCCA	0.602																																					p.E1068E		.											.	PELP1-24	0			c.G3204A						.						27.0	28.0	27.0					17																	4575082		1913	4111	6024	SO:0001819	synonymous_variant	27043	exon16			CTCAGTCTCCTCT		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.3204G>A	17.37:g.4575082C>T		Somatic	49	0		WXS	Illumina HiSeq	Phase_I	67	12	NM_014389	0	0	74	109	35	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Silent	SNP	ENST00000574876.1	37	CCDS58503.1																																																																																			.		0.602	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
SOX15	6665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7492754	7492754	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:7492754T>C	ENST00000250055.2	-	1	734	c.241A>G	c.(241-243)Aag>Gag	p.K81E	SOX15_ENST00000538513.2_Missense_Mutation_p.K81E|SOX15_ENST00000570788.1_Missense_Mutation_p.K81E|FXR2_ENST00000573057.1_5'Flank|MPDU1_ENST00000423172.2_Intron	NM_006942.1	NP_008873.1	O60248	SOX15_HUMAN	SRY (sex determining region Y)-box 15	81					cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|male gonad development (GO:0008584)|myoblast development (GO:0048627)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue regeneration (GO:0043403)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)	2						CCCAGGCGCTTGGAGATCTCG	0.667											OREG0024139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K81E		.											.	SOX15-135	0			c.A241G						.						31.0	34.0	33.0					17																	7492754		2203	4300	6503	SO:0001583	missense	6665	exon1			GGCGCTTGGAGAT	AJ006222	CCDS32549.1	17p13.1	2014-08-12	2002-07-22	2002-07-26	ENSG00000129194	ENSG00000129194		"""SRY (sex determining region Y)-boxes"""	11196	protein-coding gene	gene with protein product		601297	"""SRY (sex determining region Y)-box 20"""	SOX20		8978787, 9730625	Standard	NM_006942		Approved	SOX27, SOX26	uc002ghz.1	O60248	OTTHUMG00000178146	ENST00000250055.2:c.241A>G	17.37:g.7492754T>C	ENSP00000355354:p.Lys81Glu	Somatic	52	0	642	WXS	Illumina HiSeq	Phase_I	58	22	NM_006942	0	0	0	1	1	B4DWU7|D3DTQ0|P35717|Q9Y6W7	Missense_Mutation	SNP	ENST00000250055.2	37	CCDS32549.1	.	.	.	.	.	.	.	.	.	.	T	35	5.577422	0.96565	.	.	ENSG00000129194	ENST00000250055;ENST00000538513	D;D	0.98717	-5.09;-5.09	5.38	5.38	0.77491	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.111127	0.41097	D	0.000944	D	0.99414	0.9793	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98487	1.0608	10	0.87932	D	0	.	13.4332	0.61068	0.0:0.0:0.0:1.0	.	81	O60248	SOX15_HUMAN	E	81	ENSP00000355354:K81E;ENSP00000439311:K81E	ENSP00000355354:K81E	K	-	1	0	SOX15	7433478	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.098000	0.71458	2.276000	0.75962	0.454000	0.30748	AAG	.		0.667	SOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440757.1	NM_006942	
TMEM88	92162	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7758402	7758402	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:7758402G>T	ENST00000301599.6	+	1	20	c.10G>T	c.(10-12)Gtc>Ttc	p.V4F	CYB5D1_ENST00000570446.1_5'Flank|TMEM88_ENST00000574668.1_Missense_Mutation_p.V4F|LSMD1_ENST00000570555.1_5'Flank|CYB5D1_ENST00000571846.1_5'Flank|CYB5D1_ENST00000332439.4_5'Flank	NM_203411.1	NP_981956.1	Q6PEY1	TMM88_HUMAN	transmembrane protein 88	4					multicellular organismal development (GO:0007275)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				lung(1)	1		all_cancers(10;0.00528)|Prostate(122;0.202)				CATGGCGGATGTCCCCGGGGC	0.697																																					p.V4F		.											.	TMEM88-68	0			c.G10T						.						26.0	29.0	28.0					17																	7758402		2200	4296	6496	SO:0001583	missense	92162	exon1			GCGGATGTCCCCG	BC057812	CCDS11121.1	17p13.1	2005-12-13				ENSG00000167874			32371	protein-coding gene	gene with protein product							Standard	NM_203411		Approved	MGC71744, FLJ20025	uc002giy.3	Q6PEY1		ENST00000301599.6:c.10G>T	17.37:g.7758402G>T	ENSP00000301599:p.Val4Phe	Somatic	33	1		WXS	Illumina HiSeq	Phase_I	43	11	NM_203411	0	0	6	6	0		Missense_Mutation	SNP	ENST00000301599.6	37	CCDS11121.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.814355	0.32053	.	.	ENSG00000167874	ENST00000301599	T	0.49720	0.77	5.8	2.79	0.32731	.	0.447252	0.22406	N	0.060477	T	0.31702	0.0805	N	0.22421	0.69	0.09310	N	0.999998	B	0.18968	0.032	B	0.16289	0.015	T	0.26292	-1.0107	10	0.87932	D	0	-2.4095	8.5767	0.33603	0.2397:0.0:0.7603:0.0	.	4	Q6PEY1	TMM88_HUMAN	F	4	ENSP00000301599:V4F	ENSP00000301599:V4F	V	+	1	0	TMEM88	7699127	0.031000	0.19500	0.984000	0.44739	0.916000	0.54674	1.620000	0.36976	0.388000	0.25054	0.561000	0.74099	GTC	.		0.697	TMEM88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440252.1	NM_203411	
TLCD1	116238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27052951	27052951	+	Silent	SNP	G	G	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:27052951G>T	ENST00000292090.3	-	1	275	c.165C>A	c.(163-165)tcC>tcA	p.S55S	SNORD42A_ENST00000459584.1_RNA|NEK8_ENST00000268766.6_5'Flank|SNORD4B_ENST00000459083.1_RNA|AC010761.14_ENST00000587898.1_RNA|TLCD1_ENST00000394933.3_Intron	NM_138463.3	NP_612472.1	Q96CP7	TLCD1_HUMAN	TLC domain containing 1	55	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(2)|lung(2)	7	Lung NSC(42;0.00431)					CCGACACAATGGAGTGAGCGA	0.682																																					p.S55S		.											.	TLCD1-68	0			c.C165A						.						25.0	24.0	24.0					17																	27052951		2203	4300	6503	SO:0001819	synonymous_variant	116238	exon1			CACAATGGAGTGA	BC014072	CCDS11242.1, CCDS54102.1	17q11.2	2007-03-23			ENSG00000160606	ENSG00000160606			25177	protein-coding gene	gene with protein product						12151215	Standard	NM_138463		Approved		uc002hco.3	Q96CP7	OTTHUMG00000132683	ENST00000292090.3:c.165C>A	17.37:g.27052951G>T		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	82	31	NM_138463	0	0	6	9	3	A8MYP9	Silent	SNP	ENST00000292090.3	37	CCDS11242.1																																																																																			.		0.682	TLCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255973.1	NM_138463	
DDX52	11056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	36003445	36003445	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:36003445T>C	ENST00000349699.2	-	1	48	c.5A>G	c.(4-6)gAc>gGc	p.D2G	DDX52_ENST00000394367.3_5'UTR|RP11-697E22.2_ENST00000586950.1_RNA|RP11-697E22.2_ENST00000586163.1_RNA	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	2						membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				ATCGTGGACGTCCATCTTTAC	0.622																																					p.D2G		.											.	DDX52-228	0			c.A5G						.						43.0	43.0	43.0					17																	36003445		2203	4300	6503	SO:0001583	missense	11056	exon1			TGGACGTCCATCT	AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.5A>G	17.37:g.36003445T>C	ENSP00000268854:p.Asp2Gly	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	85	17	NM_007010	0	0	0	1	1	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	ENST00000349699.2	37	CCDS11323.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.847823	0.91277	.	.	ENSG00000141141	ENST00000349699	T	0.18960	2.18	5.26	5.26	0.73747	.	37.662000	0.00397	N	0.000053	T	0.40196	0.1107	L	0.54323	1.7	0.80722	D	1	D	0.61697	0.99	P	0.54140	0.743	T	0.03545	-1.1026	10	0.87932	D	0	.	11.4972	0.50415	0.0:0.0:0.0:1.0	.	2	Q9Y2R4	DDX52_HUMAN	G	2	ENSP00000268854:D2G	ENSP00000268854:D2G	D	-	2	0	DDX52	33077558	0.996000	0.38824	0.931000	0.37212	0.923000	0.55619	3.812000	0.55628	2.218000	0.71995	0.533000	0.62120	GAC	.		0.622	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256795.1	NM_152300	
KRT27	342574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38933310	38933310	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:38933310T>C	ENST00000301656.3	-	8	1361	c.1321A>G	c.(1321-1323)Act>Gct	p.T441A	KRT27_ENST00000540723.1_5'UTR	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				TCTTCCACAGTGTGAACTCTG	0.413																																					p.T441A		.											.	KRT27-90	0			c.A1321G						.						118.0	121.0	120.0					17																	38933310		2203	4300	6503	SO:0001583	missense	342574	exon8			CCACAGTGTGAAC	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.1321A>G	17.37:g.38933310T>C	ENSP00000301656:p.Thr441Ala	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	133	28	NM_181537	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301656.3	37	CCDS11375.1	.	.	.	.	.	.	.	.	.	.	T	12.82	2.053696	0.36277	.	.	ENSG00000171446	ENST00000301656	D	0.82081	-1.57	5.66	1.64	0.23874	.	0.290739	0.30260	N	0.010040	T	0.63534	0.2519	N	0.19112	0.55	0.19945	N	0.999941	B	0.02656	0.0	B	0.01281	0.0	T	0.47849	-0.9085	10	0.36615	T	0.2	.	0.5754	0.00702	0.2019:0.1756:0.1465:0.4761	.	441	Q7Z3Y8	K1C27_HUMAN	A	441	ENSP00000301656:T441A	ENSP00000301656:T441A	T	-	1	0	KRT27	36186836	0.000000	0.05858	0.645000	0.29479	0.941000	0.58515	-0.027000	0.12371	0.471000	0.27319	0.528000	0.53228	ACT	.		0.413	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
KRTAP4-6	81871	broad.mit.edu;bcgsc.ca	37	17	39296291	39296291	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:39296291C>A	ENST00000345847.4	-	1	448	c.449G>T	c.(448-450)tGc>tTc	p.C150F		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	150	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						agaggggcggcagcagctgga	0.672																																					p.C150F													.	.	0			c.G449T						.																																			SO:0001583	missense	81871	exon1			GGGCGGCAGCAGC	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.449G>T	17.37:g.39296291C>A	ENSP00000328270:p.Cys150Phe	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	60	6	NM_030976	0	0	0	0	0	Q9BYR1	Missense_Mutation	SNP	ENST00000345847.4	37	CCDS54125.1	.	.	.	.	.	.	.	.	.	.	.	12.29	1.893641	0.33442	.	.	ENSG00000198090	ENST00000345847	T	0.02606	4.23	5.08	3.01	0.34805	.	.	.	.	.	T	0.12774	0.0310	M	0.92649	3.33	0.35717	D	0.816837	.	.	.	.	.	.	T	0.02031	-1.1226	7	0.72032	D	0.01	.	4.1956	0.10441	0.1594:0.5981:0.1547:0.0877	.	.	.	.	F	150	ENSP00000328270:C150F	ENSP00000328270:C150F	C	-	2	0	KRTAP4-6	36549817	0.744000	0.28250	0.547000	0.28179	0.447000	0.32167	0.915000	0.28638	1.145000	0.42336	0.638000	0.83543	TGC	.		0.672	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
FOXJ1	2302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74134123	74134123	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:74134123C>A	ENST00000322957.6	-	3	931	c.577G>T	c.(577-579)Ggc>Tgc	p.G193C	RNF157-AS1_ENST00000585542.1_RNA|RNF157-AS1_ENST00000590137.1_RNA	NM_001454.3	NP_001445.2	Q92949	FOXJ1_HUMAN	forkhead box J1	193					actin cytoskeleton organization (GO:0030036)|activation of Rho GTPase activity (GO:0032862)|brain development (GO:0007420)|central tolerance induction (GO:0002508)|cilium assembly (GO:0042384)|epithelium development (GO:0060429)|establishment of apical/basal cell polarity (GO:0035089)|glomerular parietal epithelial cell development (GO:0072016)|humoral immune response (GO:0006959)|left/right pattern formation (GO:0060972)|leukocyte migration (GO:0050900)|lung epithelium development (GO:0060428)|metanephric part of ureteric bud development (GO:0035502)|negative regulation of B cell activation (GO:0050869)|negative regulation of germinal center formation (GO:0002635)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pattern specification process (GO:0007389)|positive regulation of central B cell tolerance induction (GO:0002897)|positive regulation of lung ciliated cell differentiation (GO:1901248)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(1)|liver(1)|pancreas(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(166;0.187)			CGCCAGAAGCCCCCCTTGCCT	0.607																																					p.G193C		.											.	FOXJ1-227	0			c.G577T						.						39.0	43.0	41.0					17																	74134123		2203	4300	6503	SO:0001583	missense	2302	exon3			AGAAGCCCCCCTT	X99349	CCDS32739.1	17q25.1	2008-05-14				ENSG00000129654		"""Forkhead boxes"""	3816	protein-coding gene	gene with protein product		602291		FKHL13		9073514, 16518568	Standard	NM_001454		Approved	HFH-4, HFH4	uc002jqx.3	Q92949		ENST00000322957.6:c.577G>T	17.37:g.74134123C>A	ENSP00000323880:p.Gly193Cys	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	58	19	NM_001454	0	0	5	14	9	O00630	Missense_Mutation	SNP	ENST00000322957.6	37	CCDS32739.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986309	0.74589	.	.	ENSG00000129654	ENST00000322957	D	0.95482	-3.72	4.68	4.68	0.58851	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.96580	0.8884	L	0.42581	1.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97558	1.0096	10	0.87932	D	0	.	17.5787	0.87958	0.0:1.0:0.0:0.0	.	193	Q92949	FOXJ1_HUMAN	C	193	ENSP00000323880:G193C	ENSP00000323880:G193C	G	-	1	0	FOXJ1	71645718	1.000000	0.71417	0.999000	0.59377	0.602000	0.36980	5.893000	0.69798	2.153000	0.67306	0.561000	0.74099	GGC	.		0.607	FOXJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449856.1	NM_001454	
ARID3A	1820	hgsc.bcm.edu	37	19	971936	971936	+	Silent	SNP	C	C	G	rs138086881	byFrequency	TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr19:971936C>G	ENST00000263620.3	+	9	1980	c.1653C>G	c.(1651-1653)ggC>ggG	p.G551G		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	551	Gly-rich.|Important for cytoplasmic localization. {ECO:0000250}.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAAAGGAggcggcggcggcg	0.657																																					p.G551G	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.C1653G						.						25.0	33.0	30.0					19																	971936		2196	4289	6485	SO:0001819	synonymous_variant	1820	exon9			AGGAGGCGGCGGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.1653C>G	19.37:g.971936C>G		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	89	5	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			C|0.999;T|0.001		0.657	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
HNRNPM	4670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	8551158	8551158	+	Missense_Mutation	SNP	G	G	A	rs199749036		TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr19:8551158G>A	ENST00000325495.4	+	14	1887	c.1846G>A	c.(1846-1848)Ggt>Agt	p.G616S	HNRNPM_ENST00000348943.3_Missense_Mutation_p.G577S	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	616	Poly-Gly.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						TGGCGGTGGCGGTGCCAGCTT	0.682													G|||	1	0.000199681	0.0	0.0	5008	,	,		16026	0.001		0.0	False		,,,				2504	0.0				p.G616S		.											.	HNRNPM-68	0			c.G1846A						.						33.0	37.0	36.0					19																	8551158		2202	4300	6502	SO:0001583	missense	4670	exon14			GGTGGCGGTGCCA	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1846G>A	19.37:g.8551158G>A	ENSP00000325376:p.Gly616Ser	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	74	28	NM_005968	0	0	56	91	35	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.91	2.379400	0.42207	.	.	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159;ENST00000539473	T;T	0.18960	2.18;2.52	4.52	2.41	0.29592	.	0.100454	0.64402	N	0.000002	T	0.35856	0.0946	M	0.62723	1.935	0.52501	D	0.999953	P;P;D;P	0.89917	0.907;0.906;1.0;0.774	B;B;D;B	0.69479	0.205;0.126;0.964;0.074	T	0.05801	-1.0863	10	0.51188	T	0.08	.	6.939	0.24483	0.2022:0.0:0.7978:0.0	.	456;616;577;501	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	S	616;577;501;173	ENSP00000325376:G616S;ENSP00000325732:G577S	ENSP00000325376:G616S	G	+	1	0	HNRNPM	8457158	1.000000	0.71417	0.953000	0.39169	1.000000	0.99986	4.448000	0.60027	0.839000	0.34971	0.655000	0.94253	GGT	G|0.999;A|0.000		0.682	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
ZNF497	162968	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58867603	58867603	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr19:58867603C>A	ENST00000311044.3	-	3	1587	c.1399G>T	c.(1399-1401)Gag>Tag	p.E467*	A1BG-AS1_ENST00000593960.1_RNA|CTD-2619J13.9_ENST00000599952.1_RNA|A1BG_ENST00000263100.3_5'Flank|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|ZNF497_ENST00000425453.3_Nonsense_Mutation_p.E467*|A1BG-AS1_ENST00000593374.1_RNA	NM_198458.2	NP_940860.2	Q6ZNH5	ZN497_HUMAN	zinc finger protein 497	467					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|lung(3)|skin(2)	7		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0278)		TAGGGCCTCTCGCCCGTGTGC	0.692																																					p.E467X		.											.	ZNF497-90	0			c.G1399T						.						15.0	17.0	16.0					19																	58867603		2194	4293	6487	SO:0001587	stop_gained	162968	exon2			GCCTCTCGCCCGT	AK126727	CCDS12977.1	19q13.43	2013-01-08			ENSG00000174586	ENSG00000174586		"""Zinc fingers, C2H2-type"""	23714	protein-coding gene	gene with protein product							Standard	NM_198458		Approved	FLJ44773	uc002qsi.2	Q6ZNH5		ENST00000311044.3:c.1399G>T	19.37:g.58867603C>A	ENSP00000311183:p.Glu467*	Somatic	17	0		WXS	Illumina HiSeq	Phase_I	30	9	NM_001207009	0	0	3	8	5	Q05AG8|Q0VF48|Q6ZTD2|Q9UIA8	Nonsense_Mutation	SNP	ENST00000311044.3	37	CCDS12977.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257589	0.80246	.	.	ENSG00000174586	ENST00000311044;ENST00000425453	.	.	.	1.24	0.059	0.14330	.	.	.	.	.	.	.	.	.	.	.	0.53005	D	0.999969	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.3137	0.32086	0.0:0.7513:0.2487:0.0	.	.	.	.	X	467	.	ENSP00000311183:E467X	E	-	1	0	ZNF497	63559415	0.568000	0.26635	0.001000	0.08648	0.280000	0.26924	2.887000	0.48586	0.066000	0.16515	0.195000	0.17529	GAG	.		0.692	ZNF497-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466942.2	NM_198458	
LRPPRC	10128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44207047	44207047	+	Silent	SNP	A	A	G			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr2:44207047A>G	ENST00000260665.7	-	3	444	c.387T>C	c.(385-387)agT>agC	p.S129S	LRPPRC_ENST00000409659.1_Silent_p.S129S|LRPPRC_ENST00000409946.1_Silent_p.S129S	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	129					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GAGAACCACAACTACGTAGTA	0.368																																					p.S129S		.											.	LRPPRC-93	0			c.T387C						.						86.0	79.0	82.0					2																	44207047		2203	4300	6503	SO:0001819	synonymous_variant	10128	exon3			ACCACAACTACGT	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.387T>C	2.37:g.44207047A>G		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	75	23	NM_133259	0	0	6	8	2	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Silent	SNP	ENST00000260665.7	37	CCDS33189.1																																																																																			.		0.368	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
SCN7A	6332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	167284362	167284362	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr2:167284362A>T	ENST00000409855.1	-	17	2915	c.2789T>A	c.(2788-2790)aTt>aAt	p.I930N		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	930					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GTTCTCTACAATCTTGCAGCA	0.458																																					p.I930N		.											.	SCN7A-67	0			c.T2789A						.						134.0	128.0	130.0					2																	167284362		1885	4118	6003	SO:0001583	missense	6332	exon17			TCTACAATCTTGC	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2789T>A	2.37:g.167284362A>T	ENSP00000386796:p.Ile930Asn	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	46	15	NM_002976	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.242192	0.79912	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.89617	-2.54	5.02	5.02	0.67125	Sodium ion transport-associated (1);	0.000000	0.64402	D	0.000008	D	0.94932	0.8361	M	0.89904	3.07	0.52501	D	0.99995	D	0.76494	0.999	D	0.72338	0.977	D	0.95644	0.8701	10	0.87932	D	0	.	12.9965	0.58650	1.0:0.0:0.0:0.0	.	930	Q01118	SCN7A_HUMAN	N	930	ENSP00000386796:I930N	ENSP00000259060:I930N	I	-	2	0	SCN7A	166992608	1.000000	0.71417	0.999000	0.59377	0.861000	0.49209	7.324000	0.79115	2.228000	0.72767	0.482000	0.46254	ATT	.		0.458	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
CTCFL	140690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	56090837	56090837	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr20:56090837C>G	ENST00000608263.1	-	5	1774	c.1113G>C	c.(1111-1113)caG>caC	p.Q371H	CTCFL_ENST00000539382.1_Missense_Mutation_p.Q166H|CTCFL_ENST00000609232.1_Missense_Mutation_p.Q371H|CTCFL_ENST00000423479.3_Missense_Mutation_p.Q371H|CTCFL_ENST00000432255.2_Intron|CTCFL_ENST00000433949.3_Missense_Mutation_p.Q166H|CTCFL_ENST00000608425.1_Missense_Mutation_p.Q371H|CTCFL_ENST00000608903.1_Missense_Mutation_p.Q109H|CTCFL_ENST00000371196.2_Missense_Mutation_p.Q371H|CTCFL_ENST00000502686.2_Missense_Mutation_p.Q109H|CTCFL_ENST00000608440.1_Missense_Mutation_p.Q371H|CTCFL_ENST00000429804.3_Missense_Mutation_p.Q371H|CTCFL_ENST00000608858.1_5'UTR|CTCFL_ENST00000243914.3_Missense_Mutation_p.Q371H|CTCFL_ENST00000422869.2_Missense_Mutation_p.Q371H	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	371					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			ACTGGCAACACTGAAAGGGGC	0.473																																					p.Q371H		.											.	CTCFL-292	0			c.G1113C						.						173.0	164.0	167.0					20																	56090837		2203	4300	6503	SO:0001583	missense	140690	exon5			GCAACACTGAAAG		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1113G>C	20.37:g.56090837C>G	ENSP00000476783:p.Gln371His	Somatic	247	0		WXS	Illumina HiSeq	Phase_I	296	139	NM_001269044	0	0	0	0	0	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	ENST00000608263.1	37	CCDS13459.1	.	.	.	.	.	.	.	.	.	.	C	12.79	2.042881	0.36085	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000502686;ENST00000422109;ENST00000426658;ENST00000539382;ENST00000422869	T;T;T;T;T;T;T;T;T;T	0.19394	2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15;2.15	5.24	3.07	0.35406	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.342601	0.21292	N	0.076960	T	0.15869	0.0382	L	0.37466	1.105	0.39176	D	0.962686	B;B;B;B;B	0.25390	0.025;0.077;0.03;0.077;0.125	B;B;B;B;B	0.28011	0.05;0.045;0.082;0.045;0.085	T	0.09271	-1.0682	10	0.72032	D	0.01	-35.7918	5.7172	0.17966	0.0:0.5692:0.2418:0.1889	.	371;371;371;371;371	A6XGM9;A6XGM2;E7EUE3;A6XGL8;Q8NI51	.;.;.;.;CTCFL_HUMAN	H	371;371;371;371;371;109;371;371;166;371	ENSP00000415579:Q371H;ENSP00000243914:Q371H;ENSP00000360239:Q371H;ENSP00000415329:Q371H;ENSP00000392034:Q371H;ENSP00000437999:Q109H;ENSP00000413713:Q371H;ENSP00000403369:Q371H;ENSP00000439998:Q166H;ENSP00000399061:Q371H	ENSP00000243914:Q371H	Q	-	3	2	CTCFL	55524243	1.000000	0.71417	0.998000	0.56505	0.813000	0.45954	1.660000	0.37397	1.327000	0.45338	0.650000	0.86243	CAG	.		0.473	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
MICAL3	57553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	18293564	18293564	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr22:18293564C>T	ENST00000441493.2	-	28	5813	c.5461G>A	c.(5461-5463)Gag>Aag	p.E1821K	MICAL3_ENST00000580469.1_5'UTR|XXbac-B461K10.4_ENST00000476405.1_RNA	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1821					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		AGTTCCTCCTCCGTGTAGGTT	0.602																																					p.E1821K		.											.	MICAL3-68	0			c.G5461A						.						78.0	81.0	80.0					22																	18293564		2181	4279	6460	SO:0001583	missense	57553	exon28			CCTCCTCCGTGTA	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.5461G>A	22.37:g.18293564C>T	ENSP00000416015:p.Glu1821Lys	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	93	21	NM_015241	0	0	8	17	9	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305044	0.60305	.	.	ENSG00000093100	ENST00000441493	T	0.65178	-0.14	4.81	4.81	0.61882	.	0.182495	0.46442	D	0.000288	T	0.66519	0.2797	L	0.34521	1.04	0.80722	D	1	D	0.67145	0.996	P	0.60415	0.874	T	0.62407	-0.6861	10	0.21540	T	0.41	.	17.8904	0.88870	0.0:1.0:0.0:0.0	.	1821	Q7RTP6	MICA3_HUMAN	K	1821	ENSP00000416015:E1821K	ENSP00000416015:E1821K	E	-	1	0	XXbac-B461K10.4	16673564	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	7.818000	0.86416	2.215000	0.71742	0.462000	0.41574	GAG	.		0.602	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
AP1B1	162	hgsc.bcm.edu	37	22	29738275	29738275	+	Splice_Site	SNP	T	T	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr22:29738275T>C	ENST00000405198.1	-	11	1566	c.1535A>G	c.(1534-1536)cAg>cGg	p.Q512R	AP1B1_ENST00000415447.1_Splice_Site_p.Q512R|AP1B1_ENST00000356015.2_Splice_Site_p.Q512R|AP1B1_ENST00000472057.1_5'Flank|AP1B1_ENST00000402502.1_Splice_Site_p.Q512R|AP1B1_ENST00000432560.2_Splice_Site_p.Q512R|AP1B1_ENST00000317368.7_Splice_Site_p.Q512R|AP1B1_ENST00000357586.2_Splice_Site_p.Q512R			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	512					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GGCACCCACCTGAGTGGCCAA	0.587																																					p.Q512R		.											.	AP1B1-92	0			c.A1535G						.						55.0	49.0	51.0					22																	29738275		2203	4300	6503	SO:0001630	splice_region_variant	162	exon12			CCCACCTGAGTGG	L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.1536+1A>G	22.37:g.29738275T>C		Somatic	29	0		WXS	Illumina HiSeq	Phase_I	38	3	NM_001127	0	0	0	0	0	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	ENST00000405198.1	37	CCDS13855.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.949549	0.53186	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447;ENST00000421126	T;T;T;T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63	5.64	5.64	0.86602	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.30135	0.0755	L	0.55990	1.75	0.80722	D	1	P;B;B;P;P	0.47302	0.486;0.037;0.033;0.893;0.638	P;B;B;P;B	0.58331	0.837;0.145;0.035;0.801;0.387	T	0.00653	-1.1625	10	0.54805	T	0.06	-21.1529	15.5235	0.75885	0.0:0.0:0.0:1.0	.	65;512;512;512;512	B4DS79;F8WDL0;Q10567-2;Q10567;Q10567-3	.;.;.;AP1B1_HUMAN;.	R	512	ENSP00000350199:Q512R;ENSP00000348297:Q512R;ENSP00000400065:Q512R;ENSP00000384194:Q512R;ENSP00000319361:Q512R;ENSP00000386071:Q512R;ENSP00000387612:Q512R;ENSP00000400022:Q512R	ENSP00000319361:Q512R	Q	-	2	0	AP1B1	28068275	1.000000	0.71417	0.999000	0.59377	0.363000	0.29612	7.961000	0.87903	2.145000	0.66743	0.460000	0.39030	CAG	.		0.587	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127	Missense_Mutation
MEI1	150365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	42154472	42154472	+	Silent	SNP	A	A	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr22:42154472A>C	ENST00000401548.3	+	18	2095	c.2055A>C	c.(2053-2055)ggA>ggC	p.G685G	MEI1_ENST00000540880.1_Silent_p.G3G|MEI1_ENST00000400107.1_Silent_p.G53G|MEI1_ENST00000540833.1_Silent_p.G425G|MEI1_ENST00000300398.4_5'UTR	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						ACATGGAGGGAGCTGCTCGCC	0.582																																					p.G685G		.											.	MEI1-70	0			c.A2055C						.						56.0	58.0	57.0					22																	42154472		2038	4190	6228	SO:0001819	synonymous_variant	150365	exon18			GGAGGGAGCTGCT	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.2055A>C	22.37:g.42154472A>C		Somatic	36	0		WXS	Illumina HiSeq	Phase_I	36	12	NM_152513	0	0	0	0	0		Silent	SNP	ENST00000401548.3	37	CCDS46718.1																																																																																			.		0.582	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000074937.3	NM_152513	
POLDIP3	84271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	43010826	43010826	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr22:43010826C>T	ENST00000252115.5	-	1	142	c.38G>A	c.(37-39)cGc>cAc	p.R13H	POLDIP3_ENST00000339677.6_Missense_Mutation_p.R13H|POLDIP3_ENST00000348657.2_Missense_Mutation_p.R13H|RNU12_ENST00000362512.1_lincRNA	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	13					poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						CGCCGCCCCGCGCTTCCTGAT	0.667																																					p.R13H	Ovarian(52;967 1128 5875 19997 42537)	.											.	POLDIP3-90	0			c.G38A						.						45.0	50.0	48.0					22																	43010826		2203	4300	6503	SO:0001583	missense	84271	exon1			GCCCCGCGCTTCC		CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.38G>A	22.37:g.43010826C>T	ENSP00000252115:p.Arg13His	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	110	26	NM_178136	0	0	5	7	2	A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Missense_Mutation	SNP	ENST00000252115.5	37	CCDS14038.1	.	.	.	.	.	.	.	.	.	.	C	34	5.316914	0.95682	.	.	ENSG00000100227	ENST00000348657;ENST00000252115;ENST00000415122;ENST00000339677;ENST00000452567	.	.	.	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.76506	0.3997	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.974;0.998;0.992;0.965	T	0.79654	-0.1713	9	0.87932	D	0	-17.6392	17.5459	0.87861	0.0:1.0:0.0:0.0	.	13;13;13;13	B4E0L0;Q6R954;Q9BY77-2;Q9BY77	.;.;.;PDIP3_HUMAN	H	13	.	ENSP00000252115:R13H	R	-	2	0	POLDIP3	41340770	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.800000	0.69108	2.439000	0.82584	0.557000	0.71058	CGC	.		0.667	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320433.1	NM_032311	
MCAT	27349	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	43533107	43533107	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr22:43533107C>T	ENST00000290429.6	-	3	754	c.709G>A	c.(709-711)Gtg>Atg	p.V237M	MCAT_ENST00000327555.5_Intron	NM_173467.4	NP_775738.3	Q8IVS2	FABD_HUMAN	malonyl CoA:ACP acyltransferase (mitochondrial)	237					fatty acid biosynthetic process (GO:0006633)|metabolic process (GO:0008152)	mitochondrion (GO:0005739)	[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			breast(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	11		Ovarian(80;0.0694)				CCTGAAATCACCCTGCAATCT	0.532											OREG0026613	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V237M		.											.	MCAT-91	0			c.G709A						.						194.0	185.0	188.0					22																	43533107		2203	4300	6503	SO:0001583	missense	27349	exon3			AAATCACCCTGCA	AL359401	CCDS14045.1, CCDS33660.1	22q13.2	2010-04-27			ENSG00000100294	ENSG00000100294	2.3.1.39		29622	protein-coding gene	gene with protein product		614479				12882974	Standard	NM_173467		Approved	MT, MCT, fabD, FASN2C, NET62	uc003bdl.1	Q8IVS2	OTTHUMG00000150704	ENST00000290429.6:c.709G>A	22.37:g.43533107C>T	ENSP00000290429:p.Val237Met	Somatic	211	0	917	WXS	Illumina HiSeq	Phase_I	245	62	NM_173467	0	0	30	54	24	B0QY72|O95510|O95511	Missense_Mutation	SNP	ENST00000290429.6	37	CCDS33660.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667793	0.88348	.	.	ENSG00000100294	ENST00000290429	T	0.52295	0.67	5.13	5.13	0.70059	Acyl transferase/acyl hydrolase/lysophospholipase (1);Malonyl-CoA ACP transacylase, ACP-binding (1);Acyl transferase (1);	0.000000	0.85682	D	0.000000	T	0.80859	0.4704	H	0.97365	3.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88241	0.2910	10	0.87932	D	0	-25.5062	18.5829	0.91178	0.0:1.0:0.0:0.0	.	237	Q8IVS2	FABD_HUMAN	M	237	ENSP00000290429:V237M	ENSP00000290429:V237M	V	-	1	0	MCAT	41863051	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.277000	0.78572	2.387000	0.81309	0.591000	0.81541	GTG	.		0.532	MCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319677.2	NM_173467	
SHISA5	51246	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	48510782	48510782	+	Silent	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr3:48510782C>T	ENST00000296444.2	-	5	957	c.621G>A	c.(619-621)ccG>ccA	p.P207P	SHISA5_ENST00000442747.1_Silent_p.P176P|SHISA5_ENST00000426002.1_Silent_p.P104P|SHISA5_ENST00000443308.2_Silent_p.P200P|SHISA5_ENST00000444115.1_Silent_p.P176P|SHISA5_ENST00000465449.1_5'UTR	NM_001272065.1|NM_016479.3	NP_001258994.1|NP_057563.3	Q8N114	SHSA5_HUMAN	shisa family member 5	207	Pro-rich.				intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			large_intestine(1)|lung(1)	2						CGTGGTAGGCCGGTGGGCCCA	0.657																																					p.P207P		.											.	SHISA5-68	0			c.G621A						.						97.0	95.0	96.0					3																	48510782		2203	4300	6503	SO:0001819	synonymous_variant	51246	exon5			GTAGGCCGGTGGG	AF520698	CCDS2770.1, CCDS63621.1, CCDS63622.1, CCDS63623.1	3p21.31	2013-07-31	2013-07-31		ENSG00000164054	ENSG00000164054		"""Shisa homologs"""	30376	protein-coding gene	gene with protein product		607290	"""shisa homolog 5 (Xenopus laevis)"""			11042152, 12135983	Standard	NM_016479		Approved	SCOTIN, hShisa5	uc011bbk.1	Q8N114	OTTHUMG00000133529	ENST00000296444.2:c.621G>A	3.37:g.48510782C>T		Somatic	148	0		WXS	Illumina HiSeq	Phase_I	135	30	NM_016479	0	0	102	139	37	B3KW99|F8W9N8|Q69YY9|Q7Z433|Q8NHL9|Q96MW8|Q9BV58	Silent	SNP	ENST00000296444.2	37	CCDS2770.1	.	.	.	.	.	.	.	.	.	.	C	3.542	-0.093509	0.07053	.	.	ENSG00000164054	ENST00000536074	.	.	.	5.05	-10.1	0.00402	.	.	.	.	.	T	0.47563	0.1452	.	.	.	0.42593	D	0.993257	.	.	.	.	.	.	T	0.60895	-0.7172	5	0.87932	D	0	-31.2522	1.378	0.02225	0.2716:0.1192:0.152:0.4572	.	.	.	.	Q	28	.	ENSP00000445956:R28Q	R	-	2	0	SHISA5	48485786	0.000000	0.05858	0.031000	0.17742	0.469000	0.32828	-4.182000	0.00278	-2.526000	0.00494	-0.251000	0.11542	CGG	.		0.657	SHISA5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257504.3	NM_016479	
KPNA4	3840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	160249310	160249310	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr3:160249310T>C	ENST00000334256.4	-	6	628	c.323A>G	c.(322-324)gAt>gGt	p.D108G		NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)	108					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TATTAAGTCATCAATTGGTGG	0.269																																					p.D108G		.											.	KPNA4-226	0			c.A323G						.						86.0	97.0	93.0					3																	160249310		2203	4293	6496	SO:0001583	missense	3840	exon6			AAGTCATCAATTG	AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.323A>G	3.37:g.160249310T>C	ENSP00000334373:p.Asp108Gly	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	139	31	NM_002268	0	0	18	23	5	A8K4S6|D3DNM2|O00190	Missense_Mutation	SNP	ENST00000334256.4	37	CCDS3191.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.773313	0.90108	.	.	ENSG00000186432	ENST00000334256	T	0.32272	1.46	5.44	5.44	0.79542	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65688	0.2715	M	0.93328	3.405	0.80722	D	1	D	0.67145	0.996	D	0.72075	0.976	T	0.75769	-0.3201	10	0.72032	D	0.01	.	15.6624	0.77197	0.0:0.0:0.0:1.0	.	108	O00629	IMA4_HUMAN	G	108	ENSP00000334373:D108G	ENSP00000334373:D108G	D	-	2	0	KPNA4	161732004	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.797000	0.85911	2.284000	0.76573	0.528000	0.53228	GAT	.		0.269	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352960.1	NM_002268	
SLC30A9	10463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	42037333	42037333	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr4:42037333T>G	ENST00000264451.7	+	7	832	c.652T>G	c.(652-654)Ttc>Gtc	p.F218V		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	218					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F218V(1)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ATACAGAGATTTCTTGGGAAA	0.299																																					p.F218V		.											.	SLC30A9-91	1	Substitution - Missense(1)	kidney(1)	c.T652G						.						56.0	62.0	60.0					4																	42037333		2200	4282	6482	SO:0001583	missense	10463	exon7			AGAGATTTCTTGG	AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.652T>G	4.37:g.42037333T>G	ENSP00000264451:p.Phe218Val	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	139	33	NM_006345	0	0	4	10	6	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	ENST00000264451.7	37	CCDS3465.1	.	.	.	.	.	.	.	.	.	.	T	9.461	1.093124	0.20471	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.54866	0.55	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.37732	0.1014	L	0.34521	1.04	0.58432	D	0.999996	P	0.43352	0.804	B	0.38842	0.283	T	0.13872	-1.0493	10	0.16420	T	0.52	-12.6044	11.5359	0.50636	0.0:0.0:0.0:1.0	.	218	Q6PML9	ZNT9_HUMAN	V	218;46	ENSP00000264451:F218V	ENSP00000264451:F218V	F	+	1	0	SLC30A9	41732090	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	4.876000	0.63079	2.003000	0.58678	0.397000	0.26171	TTC	.		0.299	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216842.3		
PRDM9	56979	hgsc.bcm.edu	37	5	23526915	23526915	+	Missense_Mutation	SNP	T	T	C	rs199686868		TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr5:23526915T>C	ENST00000296682.3	+	11	1900	c.1718T>C	c.(1717-1719)aTa>aCa	p.I573T		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	573					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CACCAGAGGATACACACAGGG	0.567										HNSCC(3;0.000094)																											p.I573T		.											.	PRDM9-139	0			c.T1718C						.						73.0	81.0	78.0					5																	23526915		2190	4296	6486	SO:0001583	missense	56979	exon11			AGAGGATACACAC	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1718T>C	5.37:g.23526915T>C	ENSP00000296682:p.Ile573Thr	Somatic	133	1		WXS	Illumina HiSeq	Phase_I	153	8	NM_020227	0	0	0	0	0	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-2.000672	0.00431	.	.	ENSG00000164256	ENST00000296682	T	0.04015	3.73	2.31	1.41	0.22369	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.249761	0.20968	N	0.082442	T	0.02119	0.0066	N	0.12422	0.21	0.18873	N	0.999989	B	0.02656	0.0	B	0.06405	0.002	T	0.48043	-0.9069	10	0.06891	T	0.86	-2.9928	5.0646	0.14576	0.0:0.5362:0.0:0.4638	.	573	Q9NQV7	PRDM9_HUMAN	T	573	ENSP00000296682:I573T	ENSP00000296682:I573T	I	+	2	0	PRDM9	23562672	0.000000	0.05858	0.999000	0.59377	0.648000	0.38561	-0.775000	0.04679	0.078000	0.16900	-0.511000	0.04467	ATA	.		0.567	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
ZCCHC9	84240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	80600585	80600585	+	Silent	SNP	G	G	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr5:80600585G>A	ENST00000254037.2	+	1	3164	c.9G>A	c.(7-9)agG>agA	p.R3R	ZCCHC9_ENST00000438268.2_Silent_p.R3R|ZCCHC9_ENST00000506458.1_Intron|ZCCHC9_ENST00000380199.5_Silent_p.R3R|ZCCHC9_ENST00000407610.3_Silent_p.R3R			Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	3					negative regulation of phosphatase activity (GO:0010923)		poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)	13		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		TTATGACCAGGTGGGCCCGAG	0.423																																					p.R3R		.											.	ZCCHC9-91	0			c.G9A						.						81.0	76.0	77.0					5																	80600585		2203	4300	6503	SO:0001819	synonymous_variant	84240	exon2			GACCAGGTGGGCC	BC014841	CCDS4054.1	5q14.1	2013-01-09			ENSG00000131732	ENSG00000131732		"""Zinc fingers, CCHC domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25424	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 41"""					12477932	Standard	NM_032280		Approved	DKFZp761J139, PPP1R41	uc003khi.3	Q8N567	OTTHUMG00000119014	ENST00000254037.2:c.9G>A	5.37:g.80600585G>A		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	124	34	NM_001131036	0	0	5	6	1	B2RAE7|Q9H027	Silent	SNP	ENST00000254037.2	37	CCDS4054.1																																																																																			.		0.423	ZCCHC9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239213.1	NM_032280	
PCDHGA6	56109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140753888	140753888	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr5:140753888C>T	ENST00000517434.1	+	1	238	c.238C>T	c.(238-240)Cga>Tga	p.R80*	PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	80	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTGAATCCGCGAAACGGCAG	0.577																																					p.R80X		.											.	PCDHGA6-67	0			c.C238T						.						51.0	58.0	55.0					5																	140753888		2200	4300	6500	SO:0001587	stop_gained	56109	exon1			AATCCGCGAAACG	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.238C>T	5.37:g.140753888C>T	ENSP00000429601:p.Arg80*	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	103	36	NM_018919	0	0	1	1	0	A6H8K7|B2RN55|Q9Y5D1	Nonsense_Mutation	SNP	ENST00000517434.1	37	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	12.46	1.943892	0.34283	.	.	ENSG00000253731	ENST00000517434	.	.	.	5.09	-0.279	0.12890	.	0.000000	0.29253	U	0.012681	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.6064	0.02684	0.3336:0.2219:0.2969:0.1477	.	.	.	.	X	80	.	ENSP00000429601:R80X	R	+	1	2	PCDHGA6	140734072	0.000000	0.05858	0.001000	0.08648	0.189000	0.23516	-0.696000	0.05104	0.091000	0.17302	0.650000	0.86243	CGA	.		0.577	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
PWWP2A	114825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	159520919	159520919	+	Silent	SNP	G	G	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr5:159520919G>A	ENST00000307063.7	-	2	772	c.738C>T	c.(736-738)gtC>gtT	p.V246V	PWWP2A_ENST00000523662.1_Silent_p.V246V|PWWP2A_ENST00000456329.3_Silent_p.V246V	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	246	Pro-rich.									kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGGGATGCGGGACAGGAGAAG	0.512																																					p.V246V		.											.	PWWP2A-68	0			c.C738T						.						115.0	114.0	114.0					5																	159520919		1983	4144	6127	SO:0001819	synonymous_variant	114825	exon2			ATGCGGGACAGGA		CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.738C>T	5.37:g.159520919G>A		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	116	33	NM_052927	0	0	3	5	2	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Silent	SNP	ENST00000307063.7	37	CCDS47332.1																																																																																			.		0.512	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374092.1		
RPL10A	4736	broad.mit.edu	37	6	35436591	35436591	+	Silent	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr6:35436591C>T	ENST00000322203.6	+	2	48	c.21C>T	c.(19-21)cgC>cgT	p.R7R	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	7					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(2)|ovary(1)	4						AAGTCTCTCGCGACACCCTGT	0.697																																					p.R7R													.	RPL10A-91	0			c.C21T						.						11.0	12.0	12.0					6																	35436591		2197	4293	6490	SO:0001819	synonymous_variant	4736	exon2			CTCTCGCGACACC	U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.21C>T	6.37:g.35436591C>T		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	21	4	NM_007104	2	0	991	1569	576	B2R801|P52859|P53025|Q5TZT6|Q8J013	Silent	SNP	ENST00000322203.6	37	CCDS4806.1																																																																																			.		0.697	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1	NM_007104	
TNFAIP3	7128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	138200108	138200108	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr6:138200108C>T	ENST00000237289.4	+	7	1592	c.1526C>T	c.(1525-1527)gCc>gTc	p.A509V		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	509	Interaction with TNIP1. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.A506fs*21(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		GCCAGCCACGCCCCAGACCAC	0.562			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.A509V	GBM(130;153 1739 22295 28918 47987)	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	TNFAIP3-1498	26	Whole gene deletion(25)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(26)	c.C1526T						.						53.0	57.0	56.0					6																	138200108		2203	4300	6503	SO:0001583	missense	7128	exon7			GCCACGCCCCAGA	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1526C>T	6.37:g.138200108C>T	ENSP00000237289:p.Ala509Val	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	73	17	NM_001270507	0	0	40	44	4	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	C	8.783	0.928799	0.18131	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000544646	T	0.23950	1.88	5.88	0.17	0.15021	.	2.360930	0.01293	N	0.010090	T	0.06005	0.0156	L	0.29908	0.895	0.09310	N	1	B	0.20671	0.047	B	0.19148	0.024	T	0.21690	-1.0238	10	0.31617	T	0.26	-3.2172	3.4733	0.07575	0.336:0.2854:0.3007:0.078	.	509	P21580	TNAP3_HUMAN	V	509	ENSP00000237289:A509V	ENSP00000237289:A509V	A	+	2	0	TNFAIP3	138241801	0.000000	0.05858	0.001000	0.08648	0.055000	0.15305	0.071000	0.14594	0.072000	0.16694	0.655000	0.94253	GCC	.		0.562	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
CBX3	11335	hgsc.bcm.edu	37	7	26251700	26251700	+	Splice_Site	SNP	A	A	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr7:26251700A>T	ENST00000337620.4	+	6	853		c.e6-1		CBX3_ENST00000409747.1_Splice_Site|CBX3_ENST00000396386.2_Splice_Site	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3						chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)			endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						TTCTTAAAACAGGAAAGATTC	0.358																																					.		.											.	CBX3-227	0			c.426-2A>T						.						49.0	50.0	50.0					7																	26251700		2203	4300	6503	SO:0001630	splice_region_variant	11335	exon6			TAAAACAGGAAAG	U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.426-1A>T	7.37:g.26251700A>T		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	68	5	NM_007276	0	0	0	0	0	Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Splice_Site	SNP	ENST00000337620.4	37	CCDS5398.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.397838	0.62177	.	.	ENSG00000122565	ENST00000337620;ENST00000396386	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9596	0.79918	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CBX3	26218225	1.000000	0.71417	0.985000	0.45067	0.622000	0.37654	9.240000	0.95396	2.231000	0.72958	0.533000	0.62120	.	.		0.358	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214117.1	NM_007276	Intron
FAM91A1	157769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	124787418	124787418	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr8:124787418C>A	ENST00000334705.7	+	3	435	c.189C>A	c.(187-189)taC>taA	p.Y63*	FAM91A1_ENST00000521166.1_Nonsense_Mutation_p.Y63*	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	63										breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			AACGCAGATACTATGAGGAAC	0.363																																					p.Y63X		.											.	FAM91A1-91	0			c.C189A						.						91.0	80.0	84.0					8																	124787418		1882	4109	5991	SO:0001587	stop_gained	157769	exon3			CAGATACTATGAG	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.189C>A	8.37:g.124787418C>A	ENSP00000335082:p.Tyr63*	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	74	33	NM_144963	0	0	1	1	0	B6YY23|Q658T5|Q8TE89	Nonsense_Mutation	SNP	ENST00000334705.7	37	CCDS6346.2	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892276	0.91889	.	.	ENSG00000176853	ENST00000521166;ENST00000334705;ENST00000395537	.	.	.	5.33	3.52	0.40303	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0665	0.42306	0.0:0.7624:0.0:0.2376	.	.	.	.	X	63	.	ENSP00000335082:Y63X	Y	+	3	2	FAM91A1	124856599	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	1.080000	0.30779	0.619000	0.30197	0.655000	0.94253	TAC	.		0.363	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963	
SUSD1	64420	hgsc.bcm.edu;bcgsc.ca	37	9	114820888	114820888	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr9:114820888A>T	ENST00000374270.3	-	14	2101	c.1929T>A	c.(1927-1929)ttT>ttA	p.F643L	SUSD1_ENST00000374263.3_Missense_Mutation_p.F643L|SUSD1_ENST00000374264.2_Missense_Mutation_p.F643L	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	643						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						AGGCGTTGCTAAAGAAGGAGG	0.478																																					p.F643L		.											.	SUSD1-90	0			c.T1929A						.						113.0	110.0	111.0					9																	114820888		2203	4300	6503	SO:0001583	missense	64420	exon14			GTTGCTAAAGAAG	AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.1929T>A	9.37:g.114820888A>T	ENSP00000363388:p.Phe643Leu	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	146	36	NM_022486	0	0	3	3	0	A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Missense_Mutation	SNP	ENST00000374270.3	37	CCDS6783.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.65|17.65	3.441634|3.441634	0.63067|0.63067	.|.	.|.	ENSG00000106868|ENSG00000106868	ENST00000374270;ENST00000374263;ENST00000374264|ENST00000355396	T;T;T|.	0.51817|.	0.69;0.69;0.69|.	5.44|5.44	1.84|1.84	0.25277|0.25277	.|.	0.000000|.	0.49305|.	D|.	0.000147|.	T|.	0.55369|.	0.1916|.	M|M	0.64630|0.64630	1.985|1.985	0.31889|0.31889	N|N	0.617461|0.617461	D;D;D|.	0.71674|.	0.998;0.998;0.997|.	D;D;D|.	0.80764|.	0.987;0.994;0.985|.	T|.	0.58918|.	-0.7551|.	10|.	0.62326|.	D|.	0.03|.	-9.2496|-9.2496	9.0743|9.0743	0.36511|0.36511	0.7896:0.0:0.2104:0.0|0.7896:0.0:0.2104:0.0	.|.	643;643;643|.	F8WAQ1;Q6UWL2-2;Q6UWL2|.	.;.;SUSD1_HUMAN|.	L|K	643|627	ENSP00000363388:F643L;ENSP00000363381:F643L;ENSP00000363382:F643L|.	ENSP00000363381:F643L|.	F|X	-|-	3|1	2|0	SUSD1|SUSD1	113860709|113860709	1.000000|1.000000	0.71417|0.71417	0.911000|0.911000	0.35937|0.35937	0.551000|0.551000	0.35334|0.35334	1.139000|1.139000	0.31504|0.31504	0.066000|0.066000	0.16515|0.16515	-0.411000|-0.411000	0.06167|0.06167	TTT|TAG	.		0.478	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053668.3	NM_022486	
BSPRY	54836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	116132384	116132384	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr9:116132384T>A	ENST00000374183.4	+	6	1210	c.1171T>A	c.(1171-1173)Ttt>Att	p.F391I	BSPRY_ENST00000462085.1_3'UTR	NM_017688.2	NP_060158.2	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	391	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)	cell leading edge (GO:0031252)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						CTTCCCAGTCTTTGCTGTGGC	0.597																																					p.F391I		.											.	BSPRY-135	0			c.T1171A						.						50.0	55.0	53.0					9																	116132384		1936	4110	6046	SO:0001583	missense	54836	exon6			CCAGTCTTTGCTG	AJ276691	CCDS43868.1	9q33.1	2008-02-05			ENSG00000119411	ENSG00000119411			18232	protein-coding gene	gene with protein product						10978534, 11099500	Standard	NM_017688		Approved	FLJ20150	uc004bhg.4	Q5W0U4	OTTHUMG00000021006	ENST00000374183.4:c.1171T>A	9.37:g.116132384T>A	ENSP00000363298:p.Phe391Ile	Somatic	156	1		WXS	Illumina HiSeq	Phase_I	118	37	NM_017688	0	0	7	10	3	B3KS19|Q96DJ2|Q9H4E4|Q9NXN0	Missense_Mutation	SNP	ENST00000374183.4	37	CCDS43868.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.943124	0.92526	.	.	ENSG00000119411	ENST00000374183	T	0.33216	1.42	5.69	5.69	0.88448	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.094068	0.85682	D	0.000000	T	0.62768	0.2455	M	0.90309	3.105	0.54753	D	0.999988	D	0.76494	0.999	D	0.74674	0.984	T	0.70766	-0.4783	10	0.62326	D	0.03	-8.7766	15.1216	0.72447	0.0:0.0:0.0:1.0	.	391	Q5W0U4	BSPRY_HUMAN	I	391	ENSP00000363298:F391I	ENSP00000363298:F391I	F	+	1	0	BSPRY	115172205	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.686000	0.68211	2.171000	0.68590	0.459000	0.35465	TTT	.		0.597	BSPRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055399.1	NM_017688	
DFNB31	25861	hgsc.bcm.edu	37	9	117170277	117170277	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr9:117170277T>C	ENST00000362057.3	-	8	1816	c.1648A>G	c.(1648-1650)Act>Gct	p.T550A	DFNB31_ENST00000374059.3_Missense_Mutation_p.T199A|DFNB31_ENST00000265134.6_Missense_Mutation_p.T167A	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	550					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCCTCGCCAGTTTCCTCCAGG	0.537																																					p.T550A		.											.	DFNB31-95	0			c.A1648G						.						89.0	75.0	80.0					9																	117170277		2203	4300	6503	SO:0001583	missense	25861	exon8			CGCCAGTTTCCTC	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1648A>G	9.37:g.117170277T>C	ENSP00000354623:p.Thr550Ala	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	15	2	NM_001173425	0	0	8	8	0	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	T	9.254	1.041483	0.19669	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.07908	4.04;4.01;3.15	5.53	5.53	0.82687	.	0.379172	0.27227	N	0.020331	T	0.09468	0.0233	M	0.62723	1.935	0.25402	N	0.988439	B;B;B	0.23058	0.003;0.002;0.079	B;B;B	0.22386	0.007;0.007;0.039	T	0.24512	-1.0158	10	0.24483	T	0.36	-12.0315	6.7837	0.23662	0.0:0.1301:0.0:0.8699	.	550;550;199	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	A	167;199;550	ENSP00000265134:T167A;ENSP00000363172:T199A;ENSP00000354623:T550A	ENSP00000265134:T167A	T	-	1	0	DFNB31	116210098	0.157000	0.22836	0.041000	0.18516	0.209000	0.24338	2.043000	0.41231	2.099000	0.63709	0.460000	0.39030	ACT	.		0.537	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
RPL7A	6130	ucsc.edu	37	9	136216909	136216909	+	Splice_Site	SNP	T	T	A			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr9:136216909T>A	ENST00000323345.6	+	4	445		c.e4+2		SNORD36B_ENST00000363961.1_RNA|MED22_ENST00000491289.1_5'Flank|MED22_ENST00000471524.1_5'Flank|SURF1_ENST00000495952.1_5'Flank|RPL7A_ENST00000315731.4_Splice_Site|SNORD36C_ENST00000516733.1_RNA|RPL7A_ENST00000463740.1_Splice_Site|MED22_ENST00000476080.1_5'Flank|MED22_ENST00000371999.1_5'Flank|SNORD36A_ENST00000362874.1_RNA|SNORD24_ENST00000383884.1_RNA|MED22_ENST00000344469.5_5'Flank|MED22_ENST00000343730.5_5'Flank	NM_000972.2	NP_000963.1	P62424	RL7A_HUMAN	ribosomal protein L7a						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(145;4.93e-07)|Epithelial(140;4.09e-06)|all cancers(34;3.78e-05)		TTCGAGCAGGTGAGTAGGCCC	0.532																																					.													.	RPL7A-90	0			c.415+2T>A						.						56.0	60.0	59.0					9																	136216909		2203	4300	6503	SO:0001630	splice_region_variant	6130	exon4			AGCAGGTGAGTAG	BC005128	CCDS6965.1	9q34	2011-04-06			ENSG00000148303	ENSG00000148303		"""L ribosomal proteins"""	10364	protein-coding gene	gene with protein product	"""surfeit 3"", ""PLA-X polypeptide"", ""surfeit locus protein 3"", ""60S ribosomal protein L7a"", "";"", ""thyroid hormone receptor uncoupling protein"""	185640				2403926, 2966065	Standard	NM_000972		Approved	SURF3, TRUP, L7A	uc004cde.1	P62424	OTTHUMG00000020864	ENST00000323345.6:c.415+2T>A	9.37:g.136216909T>A		Somatic	105	1		WXS	Illumina HiSeq		116	1	NM_000972	0	0	1	1	0	P11518|Q5T8U4	Splice_Site	SNP	ENST00000323345.6	37	CCDS6965.1	.	.	.	.	.	.	.	.	.	.	T	18.21	3.574485	0.65878	.	.	ENSG00000148303	ENST00000323345;ENST00000426651;ENST00000315731	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0455	0.64702	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RPL7A	135206730	1.000000	0.71417	0.983000	0.44433	0.667000	0.39255	7.104000	0.77024	1.911000	0.55334	0.482000	0.46254	.	.		0.532	RPL7A-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054869.1	NM_000972	Intron
C9orf172	389813	broad.mit.edu	37	9	139739071	139739071	+	Missense_Mutation	SNP	G	G	C	rs375666127	byFrequency	TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr9:139739071G>C	ENST00000436881.1	+	1	205	c.205G>C	c.(205-207)Gag>Cag	p.E69Q		NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	69	Pro-rich.									endometrium(2)|large_intestine(1)|lung(6)	9						GACCCTGCCGGAGCCACCGCC	0.781																																					p.E69Q													.	.	0			c.G205C						.						3.0	3.0	3.0					9																	139739071		1641	3660	5301	SO:0001583	missense	389813	exon1			CTGCCGGAGCCAC		CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.205G>C	9.37:g.139739071G>C	ENSP00000412388:p.Glu69Gln	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	8	3	NM_001080482	0	0	1	2	1		Missense_Mutation	SNP	ENST00000436881.1	37	CCDS48059.1	.	.	.	.	.	.	.	.	.	.	.	3.908	-0.020622	0.07634	.	.	ENSG00000232434	ENST00000436881	.	.	.	3.45	2.52	0.30459	.	.	.	.	.	T	0.21718	0.0523	N	0.14661	0.345	0.18873	N	0.999982	B	0.30281	0.275	B	0.35688	0.208	T	0.29212	-1.0019	8	0.19590	T	0.45	.	7.5628	0.27862	0.0:0.1825:0.6295:0.188	.	69	C9J069	CI172_HUMAN	Q	69	.	ENSP00000412388:E69Q	E	+	1	0	C9orf172	138858892	0.069000	0.21087	0.114000	0.21550	0.093000	0.18481	2.111000	0.41883	0.718000	0.32166	-0.521000	0.04368	GAG	.		0.781	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
ERRFI1	54206	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	8075357	8075374	+	Splice_Site	DEL	AGAATACATACCAAGTGG	AGAATACATACCAAGTGG	-	rs147802351	byFrequency	TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	AGAATACATACCAAGTGG	AGAATACATACCAAGTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr1:8075357_8075374delAGAATACATACCAAGTGG	ENST00000377482.5	-	3	419_426	c.196_203delCCACTTGGTATGTATTCT	c.(196-204)ccacttggt>t	p.PLG66del	ERRFI1_ENST00000474874.1_Intron|ERRFI1_ENST00000469499.1_Intron|ERRFI1_ENST00000467067.1_In_Frame_Del_p.PLGMYS66del	NM_018948.3	NP_061821.1	Q9UJM3	ERRFI_HUMAN	ERBB receptor feedback inhibitor 1	66					lung alveolus development (GO:0048286)|lung epithelium development (GO:0060428)|lung vasculature development (GO:0060426)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of protein autophosphorylation (GO:0031953)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of keratinocyte differentiation (GO:0045616)|response to stress (GO:0006950)|skin morphogenesis (GO:0043589)	cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(3)|ovary(1)|prostate(1)|skin(2)	16	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.33e-70)|GBM - Glioblastoma multiforme(8;8.05e-37)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;6.9e-06)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		TCAGATTTTCAGAATACATACCAAGTGGTATTAGGCGC	0.404																																					p.66_68del		.											.	ERRFI1-91	0			c.196_202del						.																																			SO:0001630	splice_region_variant	54206	exon3			.	BC025337	CCDS94.1	1p36.23	2008-02-05			ENSG00000116285	ENSG00000116285			18185	protein-coding gene	gene with protein product		608069				10749885, 2780291, 12226756, 11003669	Standard	NM_018948		Approved	MIG-6, GENE-33, RALT	uc001aoz.3	Q9UJM3	OTTHUMG00000001221	ENST00000377482.5:c.202+1CCACTTGGTATGTATTCT>-	1.37:g.8075357_8075374delAGAATACATACCAAGTGG		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	80	12	NM_018948	0	0	0	0	0	B2RDX9|Q9NTG9|Q9UD05	Frame_Shift_Del	DEL	ENST00000377482.5	37	CCDS94.1																																																																																			.		0.404	ERRFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003617.1	NM_018948	In_Frame_Del
COL17A1	1308	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	105793785	105793785	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr10:105793785delG	ENST00000353479.5	-	52	4364	c.4074delC	c.(4072-4074)ggcfs	p.G1358fs	COL17A1_ENST00000369733.3_Frame_Shift_Del_p.G1276fs	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1358	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GTCCGCCATTGCCAGCATACA	0.572																																					p.G1358fs		.											.	COL17A1-95	0			c.4074delC						.						98.0	95.0	96.0					10																	105793785		2203	4300	6503	SO:0001589	frameshift_variant	1308	exon52			.	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.4074delC	10.37:g.105793785delG	ENSP00000340937:p.Gly1358fs	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	99	17	NM_000494	0	0	0	0	0	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Frame_Shift_Del	DEL	ENST00000353479.5	37	CCDS7554.1																																																																																			.		0.572	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
MICALCL	84953	broad.mit.edu	37	11	12316384	12316389	+	In_Frame_Del	DEL	CTCCTA	CTCCTA	-	rs3812754|rs542581403|rs199786165	byFrequency	TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	CTCCTA	CTCCTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr11:12316384_12316389delCTCCTA	ENST00000256186.2	+	3	1697_1702	c.1406_1411delCTCCTA	c.(1405-1413)cctcctaca>cca	p.PT470del		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	470	Poly-Pro.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)	p.T471delT(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		cctcctcctcctcctACAGCGGGAGG	0.573																																					p.469_471del													.	MICALCL-91	2	Deletion - In frame(2)	upper_aerodigestive_tract(1)|skin(1)	c.1406_1411del						.			494,2594		71,352,1121						-0.7	0.0		dbSNP_107	5	1955,4965		272,1411,1777	no	coding	MICALCL	NM_032867.2		343,1763,2898	A1A1,A1R,RR		28.2514,15.9974,24.4704				2449,7559				SO:0001651	inframe_deletion	84953	exon3			CTCCTCCTCCTAC	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1406_1411delCTCCTA	11.37:g.12316384_12316389delCTCCTA	ENSP00000256186:p.Pro470_Thr471del	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	9	5	NM_032867	0	0	0	0	0	Q7RTP7|Q96JU6	In_Frame_Del	DEL	ENST00000256186.2	37	CCDS41620.1																																																																																			.		0.573	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
ERCC5	2073	broad.mit.edu	37	13	103524612	103524612	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr13:103524612delA	ENST00000355739.4	+	13	4166	c.2743delA	c.(2743-2745)aaafs	p.K917fs	ERCC5_ENST00000375954.1_Frame_Shift_Del_p.K150fs|BIVM-ERCC5_ENST00000602836.1_Frame_Shift_Del_p.E1340fs	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	917					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CACCAAAGTGAAAAAAAAATT	0.428			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.K1369fs			yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	0			c.4105delA						.						79.0	77.0	77.0					13																	103524612		2203	4300	6503	SO:0001589	frameshift_variant	0	exon21	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AAAGTGAAAAAAA	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2743delA	13.37:g.103524612delA	ENSP00000347978:p.Lys917fs	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	72	7	NM_001204425	0	0	0	0	0	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Frame_Shift_Del	DEL	ENST00000355739.4	37	CCDS32004.1																																																																																			.		0.428	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
PIPOX	51268	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	27380072	27380083	+	In_Frame_Del	DEL	GGTTGCCCAGGG	GGTTGCCCAGGG	-	rs148024165	byFrequency	TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	GGTTGCCCAGGG	GGTTGCCCAGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:27380072_27380083delGGTTGCCCAGGG	ENST00000323372.4	+	3	724_735	c.398_409delGGTTGCCCAGGG	c.(397-411)cggttgcccagggga>cga	p.LPRG134del	PIPOX_ENST00000583215.1_3'UTR	NM_016518.2	NP_057602.2	Q9P0Z9	SOX_HUMAN	pipecolic acid oxidase	134					L-lysine catabolic process to acetyl-CoA via L-pipecolate (GO:0033514)|oxidation-reduction process (GO:0055114)|tetrahydrofolate metabolic process (GO:0046653)	peroxisome (GO:0005777)	L-pipecolate oxidase activity (GO:0050031)|receptor binding (GO:0005102)|sarcosine oxidase activity (GO:0008115)			endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10	Lung NSC(42;0.015)		Epithelial(11;9.87e-06)|BRCA - Breast invasive adenocarcinoma(11;3.92e-05)|all cancers(11;5.59e-05)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Glycine(DB00145)	CCAAATATTCGGTTGCCCAGGGGAGAAGTGGG	0.495																																					p.133_137del		.											.	PIPOX-90	0			c.398_409del						.																																			SO:0001651	inframe_deletion	51268	exon3			.	AF134593	CCDS11248.1	17p13.2	2008-07-18			ENSG00000179761	ENSG00000179761			17804	protein-coding gene	gene with protein product	"""L-pipecolic acid oxidase"""					10772957, 10642506	Standard	NM_016518		Approved	LPIPOX	uc002hdr.1	Q9P0Z9	OTTHUMG00000132679	ENST00000323372.4:c.398_409delGGTTGCCCAGGG	17.37:g.27380072_27380083delGGTTGCCCAGGG	ENSP00000317721:p.Leu134_Gly137del	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	126	27	NM_016518	0	0	0	0	0	B3KNH0|Q96H28|Q9C070	In_Frame_Del	DEL	ENST00000323372.4	37	CCDS11248.1																																																																																			.		0.495	PIPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255954.1	NM_016518	
C17orf70	80233	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	79514289	79514299	+	Frame_Shift_Del	DEL	TGAGACTGTAG	TGAGACTGTAG	-			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	TGAGACTGTAG	TGAGACTGTAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr17:79514289_79514299delTGAGACTGTAG	ENST00000327787.8	-	5	1855_1865	c.1809_1819delCTACAGTCTCA	c.(1807-1821)ttctacagtctcaggfs	p.FYSLR603fs	C17orf70_ENST00000537152.1_Frame_Shift_Del_p.FYSLR452fs|C17orf70_ENST00000425898.2_Frame_Shift_Del_p.FYSLR252fs			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	603					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			ACCACCTCCCTGAGACTGTAGAACAGCGTGC	0.682																																					p.603_607del		.											.	C17orf70-92	0			c.1809_1819del						.																																			SO:0001589	frameshift_variant	80233	exon5			.	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.1809_1819delCTACAGTCTCA	17.37:g.79514289_79514299delTGAGACTGTAG	ENSP00000333283:p.Phe603fs	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	90	31	NM_025161	0	0	0	0	0	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Frame_Shift_Del	DEL	ENST00000327787.8	37	CCDS32765.2																																																																																			.		0.682	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161	
ACVR2A	92	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	148684830	148684834	+	Frame_Shift_Del	DEL	AATCT	AATCT	-			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	AATCT	AATCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr2:148684830_148684834delAATCT	ENST00000241416.7	+	11	2165_2169	c.1529_1533delAATCT	c.(1528-1533)gaatctfs	p.ES510fs	ACVR2A_ENST00000404590.1_Frame_Shift_Del_p.ES510fs|ACVR2A_ENST00000495775.1_3'UTR|ACVR2A_ENST00000535787.1_Frame_Shift_Del_p.ES402fs	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	510					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		CCTCCCAAAGAATCTAGTCTATGAT	0.395																																					p.510_511del		.											.	ACVR2A-831	0			c.1529_1533del						.																																			SO:0001589	frameshift_variant	92	exon11			.		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1529_1533delAATCT	2.37:g.148684830_148684834delAATCT	ENSP00000241416:p.Glu510fs	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	80	17	NM_001616	0	0	0	0	0	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Frame_Shift_Del	DEL	ENST00000241416.7	37	CCDS33301.1																																																																																			.		0.395	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
SLC35A5	55032	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	112282282	112282290	+	In_Frame_Del	DEL	TATGCTCCT	TATGCTCCT	-	rs201886373|rs377335674|rs369182750		TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	TATGCTCCT	TATGCTCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr3:112282282_112282290delTATGCTCCT	ENST00000492406.1	+	2	315_323	c.32_40delTATGCTCCT	c.(31-42)atatgctccttg>atg	p.11_14ICSL>M	ATG3_ENST00000495756.1_5'Flank|ATG3_ENST00000402314.2_5'Flank|ATG3_ENST00000283290.5_5'Flank	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	11					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						CATCCTGTAATATGCTCCTTGTCAACAAT	0.378																																					p.11_14del		.											.	SLC35A5-91	0			c.32_40del						.																																			SO:0001651	inframe_deletion	55032	exon2			.	AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.32_40delTATGCTCCT	3.37:g.112282282_112282290delTATGCTCCT	ENSP00000417654:p.Ile11_Leu14delinsMet	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	89	19	NM_017945	0	0	0	0	0	D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	In_Frame_Del	DEL	ENST00000492406.1	37	CCDS2967.1																																																																																			.		0.378	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354184.1	NM_017945	
SUSD1	64420	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	114820886	114820886	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr9:114820886delC	ENST00000374270.3	-	14	2103	c.1931delG	c.(1930-1932)agcfs	p.S644fs	SUSD1_ENST00000374263.3_Frame_Shift_Del_p.S644fs|SUSD1_ENST00000374264.2_Frame_Shift_Del_p.S644fs	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	644						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						AGAGGCGTTGCTAAAGAAGGA	0.473																																					p.S644fs		.											.	SUSD1-90	0			c.1931delG						.						114.0	111.0	112.0					9																	114820886		2203	4300	6503	SO:0001589	frameshift_variant	64420	exon14			.	AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.1931delG	9.37:g.114820886delC	ENSP00000363388:p.Ser644fs	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	144	34	NM_022486	0	0	0	0	0	A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Frame_Shift_Del	DEL	ENST00000374270.3	37	CCDS6783.1																																																																																			.		0.473	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053668.3	NM_022486	
SUSD1	64420	hgsc.bcm.edu	37	9	114820890	114820890	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr9:114820890delA	ENST00000374270.3	-	14	2099	c.1927delT	c.(1927-1929)tttfs	p.F643fs	SUSD1_ENST00000374263.3_Frame_Shift_Del_p.F643fs|SUSD1_ENST00000374264.2_Frame_Shift_Del_p.F643fs	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	643						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						GCGTTGCTAAAGAAGGAGGAA	0.478																																					p.F643fs		.											.	SUSD1-90	0			c.1927delT						.						113.0	110.0	111.0					9																	114820890		2203	4300	6503	SO:0001589	frameshift_variant	64420	exon14			.	AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.1927delT	9.37:g.114820890delA	ENSP00000363388:p.Phe643fs	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	142	26	NM_022486	0	0	0	0	0	A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Frame_Shift_Del	DEL	ENST00000374270.3	37	CCDS6783.1																																																																																			.		0.478	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053668.3	NM_022486	
PCDH8	5100	broad.mit.edu	37	13	53421017	53421018	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr13:53421017_53421018insAT	ENST00000377942.3	-	1	1757_1758	c.1554_1555insAT	c.(1552-1557)acggtgfs	p.V519fs	PCDH8_ENST00000338862.4_Frame_Shift_Ins_p.V519fs	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	519	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CGGGCGGCCACCGTGGCCAGGT	0.723																																					p.V519fs	GBM(36;25 841 9273 49207)												.	PCDH8-153	0			c.1555_1556insAT						.																																			SO:0001589	frameshift_variant	5100	exon1			CGGCCACCGTGGC	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.1554_1555insAT	13.37:g.53421017_53421018insAT	ENSP00000367177:p.Val519fs	Somatic	13	0		WXS	Illumina HiSeq	Phase_I	7	3	NM_032949	0	0	0	0	0	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Frame_Shift_Ins	INS	ENST00000377942.3	37	CCDS9438.1																																																																																			.		0.723	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
PDE9A	5152	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	44185564	44185565	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr21:44185564_44185565insG	ENST00000291539.6	+	15	1376_1377	c.1316_1317insG	c.(1315-1320)atggagfs	p.E440fs	PDE9A_ENST00000398234.3_Frame_Shift_Ins_p.E339fs|PDE9A_ENST00000539837.1_Frame_Shift_Ins_p.E312fs|PDE9A_ENST00000398229.3_Frame_Shift_Ins_p.E306fs|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000328862.6_Frame_Shift_Ins_p.E414fs|PDE9A_ENST00000398225.3_Frame_Shift_Ins_p.E399fs|PDE9A_ENST00000398227.3_Frame_Shift_Ins_p.E280fs|PDE9A_ENST00000398236.3_Frame_Shift_Ins_p.E354fs|PDE9A_ENST00000398224.3_Frame_Shift_Ins_p.E313fs|PDE9A_ENST00000349112.3_Frame_Shift_Ins_p.E312fs|PDE9A_ENST00000335440.6_Frame_Shift_Ins_p.E338fs|PDE9A_ENST00000335512.4_Frame_Shift_Ins_p.E380fs|PDE9A_ENST00000398232.3_Frame_Shift_Ins_p.E373fs|PDE9A_ENST00000380328.2_Frame_Shift_Ins_p.E387fs	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	440	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	AAAGAGAAAATGGAGAATTTTG	0.48																																					p.M439fs		.											.	PDE9A-92	0			c.1316_1317insG						.																																			SO:0001589	frameshift_variant	5152	exon15			.	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.1318dupG	21.37:g.44185566_44185566dupG	ENSP00000291539:p.Glu440fs	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	41	16	NM_002606	0	0	0	0	0	B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Frame_Shift_Ins	INS	ENST00000291539.6	37	CCDS13690.1																																																																																			.		0.480	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1		
SEC14L2	23541	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	30805476	30805477	+	Splice_Site	INS	-	-	T			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr22:30805476_30805477insT	ENST00000312932.9	+	7	840		c.e7+1		SEC14L2_ENST00000402592.3_Splice_Site|SEC14L2_ENST00000405717.3_Splice_Site|RP4-539M6.19_ENST00000439838.1_Splice_Site|SEC14L2_ENST00000403484.1_Splice_Site	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)						positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	GTTGTTAAAGGTAAGTTGGGAA	0.436																																					.		.											.	SEC14L2-90	0			c.580+1->T						.																																			SO:0001630	splice_region_variant	23541	exon7			.	AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.580+1->T	22.37:g.30805477_30805477dupT		Somatic	136	0		WXS	Illumina HiSeq	Phase_I	122	33	NM_033382	0	0	0	0	0	B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	Splice_Site	INS	ENST00000312932.9	37	CCDS13876.1																																																																																			.		0.436	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321018.4	NM_012429	Intron
ADAM9	8754	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	38880710	38880711	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr8:38880710_38880711insGG	ENST00000487273.2	+	9	858_859	c.780_781insGG	c.(781-783)ggafs	p.G261fs		NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	261	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			TTGTGCTAGTTGGACTGGAGAT	0.376																																					p.V260fs		.											.	ADAM9-227	0			c.780_781insGG						.																																			SO:0001589	frameshift_variant	8754	exon9			.	U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.781_782dupGG	8.37:g.38880711_38880712dupGG	ENSP00000419446:p.Gly261fs	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	80	26	NM_003816	0	0	0	0	0	B7ZLN7|Q10718|Q8NFM6	Frame_Shift_Ins	INS	ENST00000487273.2	37	CCDS6112.1																																																																																			.		0.376	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2		
COL17A1	1308	bcgsc.ca	37	10	105793785	105793786	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-DW-7841-01A-11D-2136-08	TCGA-DW-7841-10A-01D-2136-08	GC	GC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	aa4db950-5986-4268-9554-23eeace63f53	77e5cfbb-e4ce-45f5-98d2-46ee8a5598ea	g.chr10:105793785_105793786GC>AA	ENST00000353479.5	-	52	4363_4364	c.4073_4074GC>TT	c.(4072-4074)gGC>gTT	p.G1358V	COL17A1_ENST00000369733.3_Missense_Mutation_p.G1276V	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1358	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GTCCGCCATTGCCAGCATACAT	0.574																																					p.G1358V													.	COL17A1-95	0			c.G4073T						.																																			SO:0001583	missense	1308	exon52			CCATTGCCAGCAT	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.4073_4074delinsAA	10.37:g.105793785_105793786delinsAA	ENSP00000340937:p.Gly1358Val	Somatic	100	0		WXS	Illumina HiSeq	Phase_1	88	17	NM_000494	0	0	0	0	0	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	DNP	ENST00000353479.5	37	CCDS7554.1																																																																																			.		0.574	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
