#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	hgsc.bcm.edu	37	1	2160390	2160390	+	Missense_Mutation	SNP	C	C	G	rs28384811	byFrequency	TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:2160390C>G	ENST00000378536.4	+	1	257	c.185C>G	c.(184-186)gCg>gGg	p.A62G		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	62					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		gcggtgccggcgccggTGCCC	0.776													C|||	229	0.0457268	0.0234	0.0576	5008	,	,		4535	0.0079		0.0706	False		,,,				2504	0.0808				p.A62G	Ovarian(177;144 1678 13697 20086 27838 40755)	.											.	SKI-838	0			c.C185G						.						1.0	1.0	1.0					1																	2160390		788	1840	2628	SO:0001583	missense	6497	exon1			TGCCGGCGCCGGT	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.185C>G	1.37:g.2160390C>G	ENSP00000367797:p.Ala62Gly	Somatic	3	2		WXS	Illumina HiSeq	Phase_I	6	3	NM_003036	0	0	0	0	0	Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	37	CCDS39.1	102	0.046703296703296704	20	0.04065040650406504	28	0.07734806629834254	3	0.005244755244755245	51	0.06728232189973615	C	9.688	1.151208	0.21371	.	.	ENSG00000157933	ENST00000378536	D	0.95821	-3.82	2.3	2.3	0.28687	.	.	.	.	.	T	0.47857	0.1468	N	0.08118	0	0.45733	P	0.001363000000000003	D	0.57899	0.981	P	0.58520	0.84	T	0.76271	-0.3020	8	0.20519	T	0.43	-11.9718	7.7374	0.28823	0.0:1.0:0.0:0.0	rs28384811	62	P12755	SKI_HUMAN	G	62	ENSP00000367797:A62G	ENSP00000367797:A62G	A	+	2	0	SKI	2150250	0.994000	0.37717	0.998000	0.56505	0.971000	0.66376	0.878000	0.28126	1.104000	0.41587	0.185000	0.17295	GCG	C|0.953;G|0.047		0.776	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
SLC2A5	6518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	9097752	9097752	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:9097752T>C	ENST00000377424.4	-	12	1578	c.1399A>G	c.(1399-1401)Acg>Gcg	p.T467A	SLC2A5_ENST00000535586.1_Missense_Mutation_p.T352A|SLC2A5_ENST00000536305.1_Missense_Mutation_p.T408A	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	467					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		TCTATGAACGTCTTGGCCTTG	0.512																																					p.T467A		.											.	SLC2A5-517	0			c.A1399G						.						127.0	131.0	130.0					1																	9097752		2203	4300	6503	SO:0001583	missense	6518	exon12			TGAACGTCTTGGC	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1399A>G	1.37:g.9097752T>C	ENSP00000366641:p.Thr467Ala	Somatic	209	0		WXS	Illumina HiSeq	Phase_I	181	30	NM_003039	0	0	97	97	0	Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	ENST00000377424.4	37	CCDS99.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.661340	0.67700	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586	T;T;T	0.76448	-1.02;-1.02;-1.02	5.53	5.53	0.82687	Major facilitator superfamily domain, general substrate transporter (1);	0.047424	0.85682	D	0.000000	D	0.89842	0.6832	M	0.93197	3.39	0.53005	D	0.999969	D;D;D	0.61080	0.971;0.971;0.989	P;P;D	0.64042	0.872;0.872;0.921	D	0.92195	0.5763	10	0.87932	D	0	.	13.3288	0.60475	0.0:0.0:0.0:1.0	.	423;408;467	B4DG19;B4DU31;P22732	.;.;GTR5_HUMAN	A	467;450;408;352	ENSP00000366641:T467A;ENSP00000440688:T408A;ENSP00000442744:T352A	ENSP00000366641:T467A	T	-	1	0	SLC2A5	9020339	1.000000	0.71417	0.853000	0.33588	0.611000	0.37282	3.992000	0.56980	2.220000	0.72140	0.533000	0.62120	ACG	.		0.512	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039	
ALPL	249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	21902288	21902288	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:21902288G>A	ENST00000374840.3	+	10	1310	c.1060G>A	c.(1060-1062)Gag>Aag	p.E354K	ALPL_ENST00000425315.2_Missense_Mutation_p.E354K|ALPL_ENST00000374829.1_5'UTR|ALPL_ENST00000539907.1_Missense_Mutation_p.E277K|ALPL_ENST00000540617.1_Missense_Mutation_p.E299K|ALPL_ENST00000374830.1_5'UTR|ALPL_ENST00000374832.1_Missense_Mutation_p.E354K	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	354			E -> D (in HOPS).		cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	TGAGGCGGTGGAGATGGACCG	0.612																																					p.E354K		.											.	ALPL-94	0			c.G1060A						.						142.0	136.0	138.0					1																	21902288		2203	4300	6503	SO:0001583	missense	249	exon10			GCGGTGGAGATGG	BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.1060G>A	1.37:g.21902288G>A	ENSP00000363973:p.Glu354Lys	Somatic	278	0		WXS	Illumina HiSeq	Phase_I	186	25	NM_000478	0	0	3	3	0	A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Missense_Mutation	SNP	ENST00000374840.3	37	CCDS217.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371272	0.42003	.	.	ENSG00000162551	ENST00000539907;ENST00000540617;ENST00000374840;ENST00000374832;ENST00000425315	D;D;D;D;D	0.96716	-4.1;-4.1;-4.1;-4.1;-4.1	4.91	3.99	0.46301	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.056236	0.64402	D	0.000001	D	0.96796	0.8954	M	0.83852	2.665	0.51233	D	0.999917	B;P	0.52692	0.407;0.955	P;P	0.54544	0.507;0.755	D	0.95649	0.8705	10	0.52906	T	0.07	-8.6255	7.1413	0.25558	0.0934:0.1721:0.7345:0.0	.	277;354	B7Z387;P05186	.;PPBT_HUMAN	K	277;299;354;354;354	ENSP00000437674:E277K;ENSP00000442672:E299K;ENSP00000363973:E354K;ENSP00000363965:E354K;ENSP00000394765:E354K	ENSP00000363965:E354K	E	+	1	0	ALPL	21774875	1.000000	0.71417	0.892000	0.35008	0.007000	0.05969	5.646000	0.67916	1.071000	0.40834	-0.291000	0.09656	GAG	.		0.612	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008202.1	NM_000478	
WASF2	10163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27739179	27739179	+	Silent	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:27739179A>G	ENST00000430629.2	-	7	926	c.711T>C	c.(709-711)tgT>tgC	p.C237C	WASF2_ENST00000536657.1_Silent_p.C237C	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	237					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		CGTTTTCAACACAGCCAATGC	0.488																																					p.C237C		.											.	WASF2-228	0			c.T711C						.						153.0	137.0	142.0					1																	27739179		2203	4300	6503	SO:0001819	synonymous_variant	10163	exon7			TTCAACACAGCCA	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.711T>C	1.37:g.27739179A>G		Somatic	147	0		WXS	Illumina HiSeq	Phase_I	128	22	NM_006990	0	0	55	85	30	B4DZN0|O60794|Q9UDY7	Silent	SNP	ENST00000430629.2	37	CCDS304.1																																																																																			.		0.488	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009516.1	NM_006990	
MACF1	23499	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	39888512	39888512	+	Silent	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:39888512C>T	ENST00000372915.3	+	59	16191	c.16104C>T	c.(16102-16104)gcC>gcT	p.A5368A	MACF1_ENST00000317713.7_Silent_p.A3301A|MACF1_ENST00000545844.1_Silent_p.A3301A|MACF1_ENST00000361689.2_Silent_p.A3301A|MACF1_ENST00000289893.4_Silent_p.A3803A|MACF1_ENST00000564288.1_Silent_p.A5363A|MACF1_ENST00000539005.1_Silent_p.A3280A|MACF1_ENST00000567887.1_Silent_p.A5400A			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5368					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGCTCATAGCCAATCAGAAAC	0.468																																					p.A3301A													.	MACF1-165	0			c.C9903T						.						100.0	95.0	97.0					1																	39888512		2203	4300	6503	SO:0001819	synonymous_variant	23499	exon56			CATAGCCAATCAG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16104C>T	1.37:g.39888512C>T		Somatic	116	0		WXS	Illumina HiSeq	Phase_I	115	11	NM_012090	0	0	36	43	7	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	C	9.928	1.213943	0.22289	.	.	ENSG00000127603	ENST00000372925	.	.	.	5.96	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8185	0.40867	0.1407:0.7902:0.0:0.0691	.	.	.	.	X	2414	.	.	Q	+	1	0	MACF1	39661099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.321000	0.51999	1.481000	0.48307	0.650000	0.86243	CAA	.		0.468	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
TESK2	10420	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	45813333	45813333	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:45813333G>A	ENST00000372086.3	-	7	1056	c.656C>T	c.(655-657)tCc>tTc	p.S219F	TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_Missense_Mutation_p.S219F|TESK2_ENST00000538496.1_Missense_Mutation_p.S136F|TESK2_ENST00000341771.6_Missense_Mutation_p.S219F	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	219	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					CCAGAATGGGGAACCCACCAC	0.473																																					p.S219F		.											.	TESK2-624	0			c.C656T						.						112.0	113.0	113.0					1																	45813333		1904	4153	6057	SO:0001583	missense	10420	exon7			AATGGGGAACCCA	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.656C>T	1.37:g.45813333G>A	ENSP00000361158:p.Ser219Phe	Somatic	217	0		WXS	Illumina HiSeq	Phase_I	175	38	NM_007170	0	0	3	3	0	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Missense_Mutation	SNP	ENST00000372086.3	37	CCDS41323.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874832	0.91664	.	.	ENSG00000070759	ENST00000372084;ENST00000372086;ENST00000372083;ENST00000341771;ENST00000538496	T;T;T;T	0.69926	-0.44;-0.12;-0.44;-0.12	5.98	5.98	0.97165	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.104533	0.43110	N	0.000604	D	0.84933	0.5582	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86499	0.1802	10	0.87932	D	0	-17.2903	18.6171	0.91306	0.0:0.0:1.0:0.0	.	219;219	Q96S53-3;Q96S53	.;TESK2_HUMAN	F	219;219;203;219;136	ENSP00000361156:S219F;ENSP00000361158:S219F;ENSP00000343940:S219F;ENSP00000441746:S136F	ENSP00000343940:S219F	S	-	2	0	TESK2	45585920	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	7.907000	0.87430	2.843000	0.97960	0.585000	0.79938	TCC	.		0.473	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020523.1	NM_007170	
TMEM69	51249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	46159260	46159260	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:46159260A>G	ENST00000372025.4	+	3	1584	c.427A>G	c.(427-429)Atc>Gtc	p.I143V	TMEM69_ENST00000496366.1_3'UTR|RP11-767N6.7_ENST00000430643.1_RNA	NM_016486.3	NP_057570.2	Q5SWH9	TMM69_HUMAN	transmembrane protein 69	143						integral component of membrane (GO:0016021)				kidney(3)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)					CTTGGGTGGGATCAGATGGGG	0.438																																					p.I143V		.											.	TMEM69-91	0			c.A427G						.						89.0	87.0	88.0					1																	46159260		1859	4090	5949	SO:0001583	missense	51249	exon3			GGTGGGATCAGAT	BC040289, BC013608	CCDS41325.1	1p34.1	2008-02-05	2005-08-17	2005-08-17	ENSG00000159596	ENSG00000159596			28035	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 154"""	C1orf154			Standard	NM_016486		Approved	FLJ21029	uc001cor.1	Q5SWH9	OTTHUMG00000040993	ENST00000372025.4:c.427A>G	1.37:g.46159260A>G	ENSP00000361095:p.Ile143Val	Somatic	196	0		WXS	Illumina HiSeq	Phase_I	176	31	NM_016486	0	0	32	48	16	Q3SWW5|Q7Z2G0|Q9P0P9	Missense_Mutation	SNP	ENST00000372025.4	37	CCDS41325.1	.	.	.	.	.	.	.	.	.	.	A	4.400	0.073919	0.08485	.	.	ENSG00000159596	ENST00000372025	.	.	.	5.83	-1.16	0.09678	.	0.588234	0.19061	N	0.123779	T	0.23330	0.0564	N	0.20357	0.565	0.19575	N	0.999966	B	0.10296	0.003	B	0.10450	0.005	T	0.25745	-1.0123	9	0.11794	T	0.64	-0.7606	12.6228	0.56614	0.7619:0.0:0.2381:0.0	.	143	Q5SWH9	TMM69_HUMAN	V	143	.	ENSP00000361095:I143V	I	+	1	0	TMEM69	45931847	0.218000	0.23608	0.138000	0.22173	0.907000	0.53573	0.632000	0.24583	-0.248000	0.09583	-0.415000	0.06103	ATC	.		0.438	TMEM69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098390.1	NM_016486	
ZFYVE9	9372	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	52704507	52704507	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:52704507A>G	ENST00000371591.1	+	3	1549	c.1418A>G	c.(1417-1419)tAt>tGt	p.Y473C	ZFYVE9_ENST00000287727.3_Missense_Mutation_p.Y473C|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.Y473C	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	473					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GCAGCAAATTATCTATCTAAT	0.378																																					p.Y473C		.											.	ZFYVE9-230	0			c.A1418G						.						95.0	101.0	99.0					1																	52704507		2203	4299	6502	SO:0001583	missense	9372	exon4			CAAATTATCTATC	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.1418A>G	1.37:g.52704507A>G	ENSP00000360647:p.Tyr473Cys	Somatic	173	0		WXS	Illumina HiSeq	Phase_I	176	32	NM_007324	0	0	3	4	1	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	37	CCDS563.1	.	.	.	.	.	.	.	.	.	.	A	7.890	0.732073	0.15507	.	.	ENSG00000157077	ENST00000357206;ENST00000361625;ENST00000287727;ENST00000371591	T;T;T;T	0.51574	1.19;0.7;1.19;1.19	5.69	4.78	0.61160	.	0.445610	0.20824	N	0.085019	T	0.25005	0.0607	N	0.08118	0	0.20764	N	0.99985	B;B;B	0.33512	0.415;0.01;0.0	B;B;B	0.33392	0.163;0.002;0.0	T	0.09662	-1.0664	10	0.38643	T	0.18	.	6.1713	0.20418	0.1413:0.6538:0.1348:0.0701	.	473;473;473	O95405-2;O95405;O95405-3	.;ZFYV9_HUMAN;.	C	473	ENSP00000349737:Y473C;ENSP00000355358:Y473C;ENSP00000287727:Y473C;ENSP00000360647:Y473C	ENSP00000287727:Y473C	Y	+	2	0	ZFYVE9	52477095	1.000000	0.71417	0.843000	0.33291	0.920000	0.55202	1.818000	0.39012	1.420000	0.47138	-0.132000	0.14878	TAT	.		0.378	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	
ZYG11B	79699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	53262039	53262039	+	Silent	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:53262039T>C	ENST00000294353.6	+	7	1555	c.1410T>C	c.(1408-1410)gcT>gcC	p.A470A	ZYG11B_ENST00000443756.2_Silent_p.A470A|ZYG11B_ENST00000545132.1_Silent_p.A470A	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	470										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						TGGCAGTTGCTATCATTTCTA	0.433																																					p.A470A		.											.	ZYG11B-94	0			c.T1410C						.						82.0	76.0	78.0					1																	53262039		2203	4300	6503	SO:0001819	synonymous_variant	79699	exon7			AGTTGCTATCATT	AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.1410T>C	1.37:g.53262039T>C		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	71	10	NM_024646	0	0	9	15	6	Q8N2X3|Q9H8L8	Silent	SNP	ENST00000294353.6	37	CCDS30717.1																																																																																			.		0.433	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646	
ODF2L	57489	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	86851227	86851227	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:86851227G>A	ENST00000359242.3	-	3	441	c.160C>T	c.(160-162)Ctt>Ttt	p.L54F	ODF2L_ENST00000370566.3_Missense_Mutation_p.L54F|ODF2L_ENST00000394731.1_Intron|ODF2L_ENST00000317336.7_Missense_Mutation_p.L54F|ODF2L_ENST00000294678.2_Missense_Mutation_p.L54F|ODF2L_ENST00000370567.1_Missense_Mutation_p.L54F	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	54						centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		GCTTCCTTAAGTGTTGCTTCC	0.323																																					p.L54F		.											.	ODF2L-69	0			c.C160T						.						87.0	84.0	85.0					1																	86851227		2203	4298	6501	SO:0001583	missense	57489	exon3			CCTTAAGTGTTGC		CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.160C>T	1.37:g.86851227G>A	ENSP00000359600:p.Leu54Phe	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	53	12	NM_001007022	0	0	1	1	0	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Missense_Mutation	SNP	ENST00000359242.3	37	CCDS41354.2	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718586	0.30503	.	.	ENSG00000122417	ENST00000441121;ENST00000370566;ENST00000359242;ENST00000317336;ENST00000370567;ENST00000294678;ENST00000465959	T;T;T;T;T	0.39056	1.1;1.1;1.15;1.15;1.12	5.4	0.554	0.17241	.	0.523188	0.20488	N	0.091342	T	0.06280	0.0162	N	0.04768	-0.165	0.44417	D	0.997339	B;B;B;B;B	0.24043	0.001;0.027;0.008;0.011;0.096	B;B;B;B;B	0.21360	0.004;0.013;0.012;0.009;0.034	T	0.15752	-1.0426	10	0.38643	T	0.18	0.4325	1.1465	0.01776	0.2214:0.1715:0.4328:0.1743	.	54;54;54;54;54	B4E037;Q9ULJ1-2;Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1	.;.;.;.;ODF2L_HUMAN	F	54	ENSP00000359597:L54F;ENSP00000359600:L54F;ENSP00000320165:L54F;ENSP00000359598:L54F;ENSP00000294678:L54F	ENSP00000294678:L54F	L	-	1	0	ODF2L	86623815	0.325000	0.24660	0.872000	0.34217	0.966000	0.64601	0.460000	0.21924	0.196000	0.20367	0.650000	0.86243	CTT	.		0.323	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2		
ABCA4	24	broad.mit.edu	37	1	94522330	94522330	+	Silent	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:94522330A>G	ENST00000370225.3	-	15	2295	c.2209T>C	c.(2209-2211)Ttg>Ctg	p.L737L	ABCA4_ENST00000535735.1_Intron	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	737					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AAAGCCAACAAGAACAGGAAG	0.522																																					p.L737L													.	ABCA4-162	0			c.T2209C						.						107.0	96.0	100.0					1																	94522330		2203	4300	6503	SO:0001819	synonymous_variant	24	exon15			CCAACAAGAACAG	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.2209T>C	1.37:g.94522330A>G		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	14	3	NM_000350	0	0	0	0	0	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																			.		0.522	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
ARHGAP29	9411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94639942	94639942	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:94639942A>G	ENST00000260526.6	-	23	3451	c.3269T>C	c.(3268-3270)cTa>cCa	p.L1090P	ARHGAP29_ENST00000482481.1_5'Flank	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	1090					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CTTGGCAGTTAGGCTGTTTTG	0.418																																					p.L1090P		.											.	ARHGAP29-296	0			c.T3269C						.						228.0	214.0	218.0					1																	94639942		2203	4300	6503	SO:0001583	missense	9411	exon23			GCAGTTAGGCTGT		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.3269T>C	1.37:g.94639942A>G	ENSP00000260526:p.Leu1090Pro	Somatic	428	0		WXS	Illumina HiSeq	Phase_I	341	56	NM_004815	0	0	104	182	78	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	37	CCDS748.1	.	.	.	.	.	.	.	.	.	.	A	14.86	2.660169	0.47572	.	.	ENSG00000137962	ENST00000260526	T	0.24723	1.84	5.73	-1.98	0.07480	.	1.632400	0.04169	N	0.324470	T	0.04497	0.0123	L	0.29908	0.895	0.09310	N	1	P	0.50710	0.938	B	0.33799	0.17	T	0.21827	-1.0234	10	0.48119	T	0.1	3.2259	2.7638	0.05314	0.5497:0.1174:0.2307:0.1023	.	1090	Q52LW3	RHG29_HUMAN	P	1090	ENSP00000260526:L1090P	ENSP00000260526:L1090P	L	-	2	0	ARHGAP29	94412530	0.041000	0.20044	0.000000	0.03702	0.391000	0.30476	0.816000	0.27267	-0.171000	0.10797	0.482000	0.46254	CTA	.		0.418	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
GSTM1	2944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110233169	110233169	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:110233169T>G	ENST00000309851.5	+	7	604	c.550T>G	c.(550-552)Ttc>Gtc	p.F184V	GSTM1_ENST00000483399.2_Intron|GSTM1_ENST00000349334.3_Intron|GSTM1_ENST00000369823.2_Missense_Mutation_p.F203V|GSTM2_ENST00000369831.2_Intron|GSTM1_ENST00000490021.2_Intron|GSTM2_ENST00000460717.3_Intron|GSTM1_ENST00000369819.2_Intron|AC000032.2_ENST00000562538.1_RNA	NM_000561.3	NP_000552.2	P09488	GSTM1_HUMAN	glutathione S-transferase mu 1	184	GST C-terminal.				cellular detoxification of nitrogen compound (GO:0070458)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|nitrobenzene metabolic process (GO:0018916)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(1)|ovary(1)	3		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Azathioprine(DB00993)|Busulfan(DB01008)|Carboplatin(DB00958)|Cisplatin(DB00515)|Glutathione(DB00143)|Oxaliplatin(DB00526)	TCTGAAGGACTTCATCTCCCG	0.488									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.F184V		.											.	GSTM1-44	0			c.T550G						.						209.0	116.0	148.0					1																	110233169		2158	4209	6367	SO:0001583	missense	2944	exon7	Familial Cancer Database	incl.: Familial Head and Neck Cancer; ;AIMAH, Cushing disease, Adrenal, Familial	AAGGACTTCATCT	BC036805	CCDS809.1, CCDS810.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134184	ENSG00000134184	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4632	protein-coding gene	gene with protein product		138350	"""glutathione S-transferase M1"""	GST1			Standard	NM_000561		Approved	MU, H-B	uc001dyk.3	P09488	OTTHUMG00000011635	ENST00000309851.5:c.550T>G	1.37:g.110233169T>G	ENSP00000311469:p.Phe184Val	Somatic	317	0		WXS	Illumina HiSeq	Phase_I	240	72	NM_000561	0	0	77	93	16	Q5GHG0|Q6FH88|Q8TC98|Q9UC96	Missense_Mutation	SNP	ENST00000309851.5	37	CCDS809.1	.	.	.	.	.	.	.	.	.	.	T	12.77	2.037761	0.35989	.	.	ENSG00000134184	ENST00000369823;ENST00000309851	T;T	0.02345	4.33;4.33	3.53	3.53	0.40419	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.149445	0.43416	U	0.000564	T	0.14056	0.0340	H	0.96269	3.795	0.80722	D	1	D	0.71674	0.998	D	0.87578	0.998	T	0.01810	-1.1269	10	0.87932	D	0	.	9.98	0.41809	0.0:0.0:0.0:1.0	.	184	P09488	GSTM1_HUMAN	V	203;184	ENSP00000358838:F203V;ENSP00000311469:F184V	ENSP00000311469:F184V	F	+	1	0	GSTM1	110034692	1.000000	0.71417	0.979000	0.43373	0.246000	0.25737	3.033000	0.49743	1.594000	0.50039	0.459000	0.35465	TTC	.		0.488	GSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032151.2	NM_000561	
INSRR	3645	ucsc.edu	37	1	156821562	156821562	+	Silent	SNP	G	G	A	rs531765692		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:156821562G>A	ENST00000368195.3	-	4	1356	c.960C>T	c.(958-960)tgC>tgT	p.C320C	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	320					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACAGCCCCTCGCACTTGTGGC	0.612																																					p.C320C													.	INSRR-1403	0			c.C960T						.						91.0	74.0	80.0					1																	156821562		2203	4300	6503	SO:0001819	synonymous_variant	3645	exon4			CCCCTCGCACTTG	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.960C>T	1.37:g.156821562G>A		Somatic	48	0		WXS	Illumina HiSeq		54	6	NM_014215	0	0	0	0	0	O60724|Q5VZS3	Silent	SNP	ENST00000368195.3	37	CCDS1160.1																																																																																			.		0.612	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
ATP1A2	477	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	160105252	160105252	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:160105252G>A	ENST00000361216.3	+	16	2233	c.2144G>A	c.(2143-2145)gGg>gAg	p.G715E	ATP1A2_ENST00000392233.3_Missense_Mutation_p.G715E	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	715			G -> R (in FHM2; de novo mutation in a sporadic case). {ECO:0000269|PubMed:21352219}.		adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			ACGGGTGACGGGGTGAACGAC	0.602																																					p.G715E		.											.	ATP1A2-518	0			c.G2144A						.						170.0	123.0	139.0					1																	160105252		2203	4300	6503	SO:0001583	missense	477	exon16			GTGACGGGGTGAA	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2144G>A	1.37:g.160105252G>A	ENSP00000354490:p.Gly715Glu	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	73	12	NM_000702	0	0	1	1	0	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	37	CCDS1196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.5|25.5	4.642964|4.642964	0.87859|0.87859	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866|ENST00000447527	D;D|D	0.99483|0.99499	-5.99;-5.99|-6.02	4.31|4.31	4.31|4.31	0.51392|0.51392	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.99806|0.99806	0.9916|0.9916	H|H	0.99182|0.99182	4.46|4.46	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.96615|0.96615	0.9455|0.9455	10|8	0.87932|0.87932	D|D	0|0	.|.	16.0832|16.0832	0.81020|0.81020	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	615;715|.	F5GXJ7;P50993|.	.;AT1A2_HUMAN|.	E|R	715;715;418|426	ENSP00000354490:G715E;ENSP00000376066:G715E|ENSP00000411705:G426R	ENSP00000354490:G715E|ENSP00000411705:G426R	G|G	+|+	2|1	0|0	ATP1A2|ATP1A2	158371876|158371876	1.000000|1.000000	0.71417|0.71417	0.897000|0.897000	0.35233|0.35233	0.889000|0.889000	0.51656|0.51656	9.593000|9.593000	0.98250|0.98250	2.383000|2.383000	0.81215|0.81215	0.561000|0.561000	0.74099|0.74099	GGG|GGG	.		0.602	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
USP21	27005	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161134645	161134645	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:161134645T>A	ENST00000289865.8	+	11	1626	c.1405T>A	c.(1405-1407)Tcc>Acc	p.S469T	PPOX_ENST00000544598.1_5'Flank|PPOX_ENST00000432542.2_5'Flank|USP21_ENST00000368001.1_Missense_Mutation_p.S469T|PPOX_ENST00000367999.4_5'Flank|PPOX_ENST00000352210.5_5'Flank|USP21_ENST00000368002.3_Missense_Mutation_p.S469T|USP21_ENST00000493054.1_3'UTR|PPOX_ENST00000535223.1_5'Flank	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	469	USP.				histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			ATTTTCTGCCTCCCGAGGCTC	0.527																																					p.S469T													.	USP21-660	0			c.T1405A						.						73.0	74.0	74.0					1																	161134645		2203	4300	6503	SO:0001583	missense	27005	exon11			TCTGCCTCCCGAG	AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.1405T>A	1.37:g.161134645T>A	ENSP00000289865:p.Ser469Thr	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	96	21	NM_012475	0	0	13	21	8	Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	ENST00000289865.8	37	CCDS30920.1	.	.	.	.	.	.	.	.	.	.	T	7.634	0.679545	0.14907	.	.	ENSG00000143258	ENST00000368002;ENST00000289865;ENST00000368001	T;T;T	0.31769	1.48;1.48;1.48	5.23	5.23	0.72850	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.060634	0.64402	D	0.000002	T	0.07728	0.0194	N	0.17345	0.48	0.40024	D	0.975449	B	0.13594	0.008	B	0.14023	0.01	T	0.16424	-1.0403	10	0.23891	T	0.37	.	8.278	0.31883	0.2751:0.0:0.0:0.7249	.	469	Q9UK80	UBP21_HUMAN	T	469	ENSP00000356981:S469T;ENSP00000289865:S469T;ENSP00000356980:S469T	ENSP00000289865:S469T	S	+	1	0	USP21	159401269	0.032000	0.19561	1.000000	0.80357	0.985000	0.73830	1.537000	0.36083	2.197000	0.70478	0.454000	0.30748	TCC	.		0.527	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080801.1		
NME7	29922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	169102046	169102046	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:169102046A>G	ENST00000367811.3	-	12	1364	c.1108T>C	c.(1108-1110)Ttc>Ctc	p.F370L	NME7_ENST00000472647.1_Missense_Mutation_p.F334L	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	370					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					ATCTTGAAGAAGTATTGAACC	0.388																																					p.F370L		.											.	NME7-514	0			c.T1108C						.						122.0	110.0	114.0					1																	169102046		2203	4300	6503	SO:0001583	missense	29922	exon12			TGAAGAAGTATTG	AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.1108T>C	1.37:g.169102046A>G	ENSP00000356785:p.Phe370Leu	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	66	7	NM_013330	0	0	1	1	0	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	ENST00000367811.3	37	CCDS1277.1	.	.	.	.	.	.	.	.	.	.	A	15.81	2.943147	0.53079	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.55234	0.53;0.53	6.17	6.17	0.99709	.	0.557913	0.21023	N	0.081462	T	0.50837	0.1639	M	0.84683	2.71	0.45995	D	0.998806	B	0.20988	0.05	B	0.31686	0.134	T	0.54132	-0.8339	9	0.34782	T	0.22	-13.3948	16.8222	0.85835	1.0:0.0:0.0:0.0	.	370	Q9Y5B8	NDK7_HUMAN	L	334;370	ENSP00000433341:F334L;ENSP00000356785:F370L	ENSP00000356785:F370L	F	-	1	0	NME7	167368670	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.416000	0.90244	2.371000	0.80710	0.533000	0.62120	TTC	.		0.388	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083688.1	NM_013330	
PPFIA4	8497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	203036824	203036824	+	Splice_Site	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:203036824A>G	ENST00000447715.2	+	31	3427	c.2986A>G	c.(2986-2988)Acc>Gcc	p.T996A	PPFIA4_ENST00000599966.1_Splice_Site_p.T503A|PPFIA4_ENST00000414050.2_Splice_Site_p.T725A|PPFIA4_ENST00000272198.6_Splice_Site_p.T512A|PPFIA4_ENST00000295706.4_Splice_Site_p.T503A|PPFIA4_ENST00000367240.2_Splice_Site_p.T997A			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	996	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						TGCCTGCAGAACCAGTCTTCA	0.552																																					p.T512A		.											.	PPFIA4-230	0			c.A1534G						.						78.0	84.0	82.0					1																	203036824		2156	4266	6422	SO:0001630	splice_region_variant	8497	exon13			TGCAGAACCAGTC	AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.2985-1A>G	1.37:g.203036824A>G		Somatic	94	0		WXS	Illumina HiSeq	Phase_I	67	8	NM_015053	0	0	0	0	0	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	ENST00000447715.2	37		.	.	.	.	.	.	.	.	.	.	A	10.88	1.474689	0.26511	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000295706;ENST00000414050;ENST00000272198	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	3.89	2.72	0.32119	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.349867	0.20011	U	0.101127	T	0.27933	0.0688	N	0.11892	0.195	0.80722	D	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.001;0.0;0.0;0.001	T	0.04930	-1.0917	10	0.44086	T	0.13	-16.0337	9.5608	0.39369	0.9138:0.0:0.0862:0.0	.	725;996;198;503;512	B4DIS5;B1N949;B3KN22;O75335-2;O75335	.;.;.;.;LIPA4_HUMAN	A	997;996;503;725;512	ENSP00000356209:T997A;ENSP00000402576:T996A;ENSP00000295706:T503A;ENSP00000400379:T725A;ENSP00000272198:T512A	ENSP00000272198:T512A	T	+	1	0	PPFIA4	201303447	0.971000	0.33674	1.000000	0.80357	0.968000	0.65278	2.234000	0.43035	0.618000	0.30179	0.397000	0.26171	ACC	.		0.552	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053	Missense_Mutation
PIGR	5284	ucsc.edu	37	1	207106513	207106513	+	Splice_Site	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:207106513T>C	ENST00000356495.4	-	7	1889		c.e7-2		PIGR_ENST00000487208.1_5'Flank	NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor						detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CGCGGGACCCTGCAGCAGGGA	0.537																																					.													.	PIGR-92	0			c.1706-2A>G						.						42.0	44.0	43.0					1																	207106513		2203	4300	6503	SO:0001630	splice_region_variant	5284	exon8			GGACCCTGCAGCA		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1706-2A>G	1.37:g.207106513T>C		Somatic	66	0		WXS	Illumina HiSeq		39	1	NM_002644	0	0	3	3	0	Q68D81|Q8IZY7	Splice_Site	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	T	11.33	1.605504	0.28623	.	.	ENSG00000162896	ENST00000356495	.	.	.	4.11	4.11	0.48088	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8393	0.40989	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PIGR	205173136	0.714000	0.27936	0.033000	0.17914	0.057000	0.15508	1.743000	0.38258	2.096000	0.63516	0.454000	0.30748	.	.		0.537	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	Intron
LRIT1	26103	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	85997318	85997318	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr10:85997318C>T	ENST00000372105.3	-	2	268	c.247G>A	c.(247-249)Ggc>Agc	p.G83S		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	83						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						TCCAGGCGGCCCAGGGGCCTG	0.726																																					p.G83S													.	LRIT1-90	0			c.G247A						.						16.0	20.0	18.0					10																	85997318		2140	4199	6339	SO:0001583	missense	26103	exon2			GGCGGCCCAGGGG	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.247G>A	10.37:g.85997318C>T	ENSP00000361177:p.Gly83Ser	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	48	10	NM_015613	0	0	0	0	0	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	37	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	C	9.281	1.048267	0.19827	.	.	ENSG00000148602	ENST00000372105	T	0.47869	0.83	5.42	-0.434	0.12283	.	1.087950	0.06798	N	0.788142	T	0.20659	0.0497	N	0.05554	-0.025	0.23685	N	0.997112	B	0.06786	0.001	B	0.06405	0.002	T	0.21415	-1.0246	10	0.08837	T	0.75	.	2.4799	0.04585	0.145:0.2466:0.4241:0.1842	.	83	Q9P2V4	LRIT1_HUMAN	S	83	ENSP00000361177:G83S	ENSP00000361177:G83S	G	-	1	0	LRIT1	85987298	0.002000	0.14202	0.742000	0.31022	0.964000	0.63967	-0.057000	0.11768	0.247000	0.21414	-0.126000	0.14955	GGC	.		0.726	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613	
ZNF143	7702	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	9519250	9519250	+	Silent	SNP	T	T	G	rs373920789		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:9519250T>G	ENST00000396602.2	+	10	989	c.870T>G	c.(868-870)acT>acG	p.T290T	ZNF143_ENST00000530463.1_Silent_p.T289T|ZNF143_ENST00000396597.3_Silent_p.T259T|ZNF143_ENST00000299606.2_Silent_p.T262T|ZNF143_ENST00000396604.1_Silent_p.T289T	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	290					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		ACGTCAGAACTCATACAGGAG	0.328																																					p.T290T		.											.	ZNF143-90	0			c.T870G						.	T		3,4399	6.2+/-15.9	0,3,2198	65.0	66.0	66.0		870	2.7	1.0	11		66	0,8588		0,0,4294	no	coding-synonymous	ZNF143	NM_003442.5		0,3,6492	GG,GT,TT		0.0,0.0682,0.0231		290/639	9519250	3,12987	2201	4294	6495	SO:0001819	synonymous_variant	7702	exon10			CAGAACTCATACA	U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.870T>G	11.37:g.9519250T>G		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	56	8	NM_003442	0	0	10	17	7	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Silent	SNP	ENST00000396602.2	37	CCDS7799.2																																																																																			.		0.328	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
RAPSN	5913	ucsc.edu;bcgsc.ca	37	11	47469615	47469615	+	Nonsense_Mutation	SNP	C	C	A	rs200550567		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:47469615C>A	ENST00000298854.2	-	2	493	c.280G>T	c.(280-282)Gag>Tag	p.E94*	RAPSN_ENST00000529341.1_Nonsense_Mutation_p.E94*|RAPSN_ENST00000352508.3_Nonsense_Mutation_p.E94*|RAPSN_ENST00000524487.1_Nonsense_Mutation_p.E94*	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse	94					positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						CACAGCTTCTCGTTGCTGCGT	0.622																																					p.E94X													.	RAPSN-91	0			c.G280T						.						96.0	74.0	82.0					11																	47469615		2201	4298	6499	SO:0001587	stop_gained	5913	exon2			GCTTCTCGTTGCT		CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.280G>T	11.37:g.47469615C>A	ENSP00000298854:p.Glu94*	Somatic	70	0		WXS	Illumina HiSeq		56	12	NM_032645	0	0	0	0	0	Q8TDF3|Q9BTD9	Nonsense_Mutation	SNP	ENST00000298854.2	37	CCDS7936.1	.	.	.	.	.	.	.	.	.	.	C	38	6.680264	0.97755	.	.	ENSG00000165917	ENST00000298854;ENST00000352508;ENST00000524487;ENST00000529341	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-42.0177	18.9738	0.92725	0.0:1.0:0.0:0.0	.	.	.	.	X	94	.	ENSP00000298854:E94X	E	-	1	0	RAPSN	47426191	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.302000	0.78861	2.565000	0.86533	0.557000	0.71058	GAG	C|0.999;T|0.001		0.622	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391726.1		
GIF	2694	hgsc.bcm.edu;bcgsc.ca	37	11	59610049	59610049	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:59610049G>C	ENST00000257248.2	-	4	425	c.378C>G	c.(376-378)aaC>aaG	p.N126K	GIF_ENST00000541311.1_Missense_Mutation_p.N101K	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	126					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	ATGCTTCAGCGTTGGGGCCTC	0.522																																					p.N126K	NSCLC(53;1139 1245 16872 38474 42853)	.											.	GIF-92	0			c.C378G						.						68.0	61.0	63.0					11																	59610049		2201	4295	6496	SO:0001583	missense	2694	exon4			TTCAGCGTTGGGG	X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.378C>G	11.37:g.59610049G>C	ENSP00000257248:p.Asn126Lys	Somatic	81	1		WXS	Illumina HiSeq	Phase_I	58	9	NM_005142	0	0	0	0	0	B2RAN8|B4DVZ1	Missense_Mutation	SNP	ENST00000257248.2	37	CCDS7977.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417564	0.25552	.	.	ENSG00000134812	ENST00000257248;ENST00000541311	T;T	0.35973	1.28;1.28	5.63	-11.3	0.00108	.	1.313500	0.04767	N	0.427342	T	0.21590	0.0520	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.22208	-1.0223	10	0.48119	T	0.1	1.5143	8.9085	0.35539	0.1072:0.0807:0.5605:0.2515	.	126	P27352	IF_HUMAN	K	126;101	ENSP00000257248:N126K;ENSP00000440427:N101K	ENSP00000257248:N126K	N	-	3	2	GIF	59366625	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-3.689000	0.00392	-2.813000	0.00347	-2.048000	0.00412	AAC	.		0.522	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394497.1	NM_005142	
FADS1	3992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	61578255	61578255	+	Missense_Mutation	SNP	A	A	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:61578255A>C	ENST00000350997.7	-	5	1115	c.883T>G	c.(883-885)Ttc>Gtc	p.F295V	FADS2_ENST00000574708.1_Intron|FADS1_ENST00000433932.1_Missense_Mutation_p.F154V|FADS1_ENST00000542506.1_Missense_Mutation_p.F154V	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	238					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AAGGCAAAGAAGAAGGGATGC	0.567																																					p.F295V		.											.	FADS1-90	0			c.T883G						.						137.0	150.0	145.0					11																	61578255		2112	4243	6355	SO:0001583	missense	3992	exon5			CAAAGAAGAAGGG		CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.883T>G	11.37:g.61578255A>C	ENSP00000322229:p.Phe295Val	Somatic	218	0		WXS	Illumina HiSeq	Phase_I	146	26	NM_013402	0	0	8	14	6	A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Missense_Mutation	SNP	ENST00000350997.7	37	CCDS8011.2	.	.	.	.	.	.	.	.	.	.	A	10.51	1.369315	0.24771	.	.	ENSG00000149485	ENST00000543488;ENST00000350997;ENST00000412725;ENST00000433932;ENST00000542506;ENST00000539999;ENST00000540767;ENST00000545245	T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	5.06	2.75	0.32379	Fatty acid desaturase, type 1 (1);	0.000000	0.50627	U	0.000109	T	0.35248	0.0925	N	0.02973	-0.45	0.42328	D	0.992286	B	0.27192	0.171	B	0.27500	0.08	T	0.06770	-1.0808	10	0.25106	T	0.35	-29.7375	4.9109	0.13821	0.7052:0.0:0.1563:0.1385	.	238	O60427	FADS1_HUMAN	V	171;295;154;154;154;24;154;154	ENSP00000322229:F295V;ENSP00000405087:F154V;ENSP00000441403:F154V;ENSP00000443587:F24V;ENSP00000441871:F154V;ENSP00000442170:F154V	ENSP00000322229:F295V	F	-	1	0	FADS1	61334831	0.998000	0.40836	1.000000	0.80357	0.986000	0.74619	3.525000	0.53502	0.893000	0.36288	-0.250000	0.11733	TTC	.		0.567	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347648.2	NM_013402	
SIDT2	51092	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117052793	117052793	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:117052793G>A	ENST00000324225.4	+	4	1019	c.488G>A	c.(487-489)aGc>aAc	p.S163N	SIDT2_ENST00000530948.1_Intron|SIDT2_ENST00000431081.2_Missense_Mutation_p.S163N	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	163					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		GAGCAGTTCAGCTTCAATACC	0.602																																					p.S163N													.	SIDT2-90	0			c.G488A						.						43.0	45.0	44.0					11																	117052793		2201	4296	6497	SO:0001583	missense	51092	exon4			AGTTCAGCTTCAA	AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.488G>A	11.37:g.117052793G>A	ENSP00000314023:p.Ser163Asn	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	28	8	NM_001040455	0	0	22	27	5	Q8NBY7|Q9Y357	Missense_Mutation	SNP	ENST00000324225.4	37	CCDS31682.1	.	.	.	.	.	.	.	.	.	.	G	9.954	1.220862	0.22457	.	.	ENSG00000149577	ENST00000324225;ENST00000278951;ENST00000431081;ENST00000524842;ENST00000531353	T;T;T	0.16743	2.32;2.32;2.33	5.14	4.21	0.49690	.	0.142496	0.64402	D	0.000009	T	0.09468	0.0233	N	0.17082	0.46	0.35238	D	0.77751	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.06405	0.001;0.001;0.002;0.001	T	0.12656	-1.0539	10	0.02654	T	1	-29.1739	13.9161	0.63899	0.0:0.2987:0.7013:0.0	.	163;163;163;163	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	N	163;163;163;13;62	ENSP00000314023:S163N;ENSP00000278951:S163N;ENSP00000399635:S163N	ENSP00000278951:S163N	S	+	2	0	SIDT2	116558003	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.319000	0.59197	1.358000	0.45922	0.561000	0.74099	AGC	.		0.602	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996	
ARHGEF12	23365	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	120302543	120302543	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:120302543A>T	ENST00000397843.2	+	11	1013	c.847A>T	c.(847-849)Aca>Tca	p.T283S	ARHGEF12_ENST00000356641.3_Missense_Mutation_p.T264S|ARHGEF12_ENST00000532993.1_Missense_Mutation_p.T180S	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	283					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TGAGGCAGAAACAGATCCTGG	0.473			T	MLL	AML																																p.T283S				Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12-661	0			c.A847T						.						118.0	116.0	117.0					11																	120302543		1938	4128	6066	SO:0001583	missense	23365	exon11			GCAGAAACAGATC	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.847A>T	11.37:g.120302543A>T	ENSP00000380942:p.Thr283Ser	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	63	7	NM_015313	0	0	27	52	25	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.029964	0.35797	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.63913	0.03;-0.07;0.03	5.54	0.332	0.15938	.	1.053350	0.07512	N	0.908973	T	0.49457	0.1558	L	0.36672	1.1	0.20926	N	0.999825	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.08055	0.001;0.003;0.001	T	0.31081	-0.9956	10	0.19147	T	0.46	0.5688	9.8555	0.41084	0.3444:0.0:0.6556:0.0	.	180;264;283	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	S	283;264;180	ENSP00000380942:T283S;ENSP00000349056:T264S;ENSP00000432984:T180S	ENSP00000349056:T264S	T	+	1	0	ARHGEF12	119807753	0.955000	0.32602	0.204000	0.23530	0.953000	0.61014	0.177000	0.16801	0.083000	0.17047	-0.462000	0.05337	ACA	.		0.473	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
FKBP4	2288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	2910312	2910312	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:2910312G>T	ENST00000001008.4	+	9	1249	c.1062G>T	c.(1060-1062)aaG>aaT	p.K354N	RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	354	Interaction with tubulin. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			ACAACGAGAAGGGCCTCTTCC	0.562																																					p.K354N		.											.	FKBP4-226	0			c.G1062T						.						63.0	67.0	65.0					12																	2910312		2203	4300	6503	SO:0001583	missense	2288	exon9			CGAGAAGGGCCTC	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.1062G>T	12.37:g.2910312G>T	ENSP00000001008:p.Lys354Asn	Somatic	155	1		WXS	Illumina HiSeq	Phase_I	108	30	NM_002014	0	0	61	115	54	D3DUQ1|Q9UCP1|Q9UCV7	Missense_Mutation	SNP	ENST00000001008.4	37	CCDS8512.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.450364	0.43531	.	.	ENSG00000004478	ENST00000001008	T	0.76709	-1.04	5.57	-2.51	0.06365	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.88366	0.6417	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88372	0.2995	10	0.87932	D	0	-31.4957	12.5158	0.56032	0.5845:0.0:0.4155:0.0	.	354	Q02790	FKBP4_HUMAN	N	354	ENSP00000001008:K354N	ENSP00000001008:K354N	K	+	3	2	FKBP4	2780573	1.000000	0.71417	0.977000	0.42913	0.029000	0.11900	0.864000	0.27926	-0.395000	0.07715	0.561000	0.74099	AAG	.		0.562	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206861.1		
STYK1	55359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	10780290	10780290	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:10780290G>C	ENST00000075503.3	-	7	1187	c.667C>G	c.(667-669)Ctc>Gtc	p.L223V		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	223	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						TTTTCTGTGAGATCATAGAGA	0.398										HNSCC(73;0.22)																											p.L223V		.											.	STYK1-1379	0			c.C667G						.						209.0	145.0	167.0					12																	10780290		2203	4300	6503	SO:0001583	missense	55359	exon7			CTGTGAGATCATA	AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.667C>G	12.37:g.10780290G>C	ENSP00000075503:p.Leu223Val	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	77	24	NM_018423	0	0	0	0	0	B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Missense_Mutation	SNP	ENST00000075503.3	37	CCDS8629.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.34|13.34	2.207320|2.207320	0.39003|0.39003	.|.	.|.	ENSG00000060140|ENSG00000060140	ENST00000542924|ENST00000075503	.|T	.|0.74106	.|-0.81	5.11|5.11	3.25|3.25	0.37280|0.37280	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.092391	.|0.47093	.|D	.|0.000250	T|T	0.73305|0.73305	0.3570|0.3570	L|L	0.56340|0.56340	1.77|1.77	0.40939|0.40939	D|D	0.984457|0.984457	.|B	.|0.22080	.|0.064	.|B	.|0.35727	.|0.209	T|T	0.72640|0.72640	-0.4232|-0.4232	5|10	.|0.87932	.|D	.|0	-6.5489|-6.5489	12.1571|12.1571	0.54083|0.54083	0.0:0.0:0.6901:0.3098|0.0:0.0:0.6901:0.3098	.|.	.|223	.|Q6J9G0	.|STYK1_HUMAN	M|V	66|223	.|ENSP00000075503:L223V	.|ENSP00000075503:L223V	I|L	-|-	3|1	3|0	STYK1|STYK1	10671557|10671557	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.014000|2.014000	0.40951|0.40951	0.706000|0.706000	0.31912|0.31912	-0.181000|-0.181000	0.13052|0.13052	ATC|CTC	.		0.398	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399622.1	NM_018423	
BCL2L14	79370	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	12232370	12232370	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:12232370C>T	ENST00000308721.5	+	2	337	c.131C>T	c.(130-132)tCa>tTa	p.S44L	BCL2L14_ENST00000266434.4_Missense_Mutation_p.S44L|BCL2L14_ENST00000589718.1_Missense_Mutation_p.S44L|BCL2L14_ENST00000586576.1_Missense_Mutation_p.S77L|BCL2L14_ENST00000396369.1_Missense_Mutation_p.S44L|BCL2L14_ENST00000396367.1_Missense_Mutation_p.S44L	NM_138723.1	NP_620049.1	Q9BZR8	B2L14_HUMAN	BCL2-like 14 (apoptosis facilitator)	44					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular organelle (GO:0043229)|membrane (GO:0016020)	protein kinase binding (GO:0019901)			large_intestine(1)|lung(2)|skin(3)	6		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		GCTCTCTTCTCACCAAAGCTG	0.478																																					p.S44L													.	BCL2L14-227	0			c.C131T						.						76.0	72.0	73.0					12																	12232370		2203	4300	6503	SO:0001583	missense	79370	exon2			TCTTCTCACCAAA	AF281254	CCDS8645.1, CCDS8646.1	12p13-p12	2014-03-07			ENSG00000121380	ENSG00000121380			16657	protein-coding gene	gene with protein product		606126				11054413	Standard	NM_030766		Approved	BCLG, BCL-G	uc001rac.3	Q9BZR8	OTTHUMG00000159528	ENST00000308721.5:c.131C>T	12.37:g.12232370C>T	ENSP00000309132:p.Ser44Leu	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	72	9	NM_138723	0	0	0	0	0	A8KAD0|Q96QR5|Q9BZR7	Missense_Mutation	SNP	ENST00000308721.5	37	CCDS8645.1	.	.	.	.	.	.	.	.	.	.	C	19.87	3.907145	0.72868	.	.	ENSG00000121380	ENST00000464885;ENST00000461264;ENST00000308721;ENST00000266434;ENST00000396369;ENST00000396367	.	.	.	4.11	4.11	0.48088	.	0.287741	0.28317	N	0.015794	T	0.69958	0.3169	M	0.73962	2.25	0.30374	N	0.782577	D;D	0.89917	0.999;1.0	D;D	0.85130	0.982;0.997	T	0.69731	-0.5066	9	0.87932	D	0	-5.2904	12.1533	0.54062	0.0:1.0:0.0:0.0	.	44;44	Q9BZR8-2;Q9BZR8	.;B2L14_HUMAN	L	44;47;44;44;44;44	.	ENSP00000266434:S44L	S	+	2	0	BCL2L14	12123637	0.920000	0.31207	0.739000	0.30968	0.062000	0.15995	2.922000	0.48860	2.590000	0.87494	0.563000	0.77884	TCA	.		0.478	BCL2L14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355994.3	NM_030766	
PLEKHA5	54477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	19506893	19506893	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:19506893A>G	ENST00000299275.6	+	20	2603	c.2597A>G	c.(2596-2598)tAt>tGt	p.Y866C	PLEKHA5_ENST00000355397.3_Missense_Mutation_p.Y924C|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.Y810C|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.Y929C|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.Y848C|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.Y924C|PLEKHA5_ENST00000539256.1_Missense_Mutation_p.Y624C|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.Y855C|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.Y1032C	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	866					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					ATAGCTTCCTATGTAACCTTG	0.368																																					p.Y1032C	Pancreas(196;329 2193 11246 14234 19524)	.											.	PLEKHA5-227	0			c.A3095G						.						125.0	119.0	121.0					12																	19506893		2203	4300	6503	SO:0001583	missense	54477	exon26			CTTCCTATGTAAC	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2597A>G	12.37:g.19506893A>G	ENSP00000299275:p.Tyr866Cys	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	112	25	NM_001256470	0	0	8	20	12	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	37	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.845797	0.71603	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000542828;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000536974;ENST00000538972	T;T;T;T;T;T;T;T;T;T;T	0.31247	2.93;2.93;1.5;2.93;2.93;2.93;2.93;2.93;2.93;2.93;1.5	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.57227	0.2039	M	0.80746	2.51	0.50813	D	0.999898	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.992;0.998;0.996;0.997;0.999;0.994;0.959;0.982	T	0.60105	-0.7328	10	0.41790	T	0.15	-12.8632	14.8567	0.70344	1.0:0.0:0.0:0.0	.	929;848;855;1027;810;1032;866;924	Q9HAU0-4;F5H0I0;E7EME8;B4DHK5;Q9HAU0-5;E9PHQ3;Q9HAU0;Q9HAU0-2	.;.;.;.;.;.;PKHA5_HUMAN;.	C	929;924;810;1028;1032;866;624;924;855;848;821;147	ENSP00000325155:Y929C;ENSP00000347560:Y924C;ENSP00000352104:Y810C;ENSP00000404296:Y1032C;ENSP00000299275:Y866C;ENSP00000440611:Y624C;ENSP00000439673:Y924C;ENSP00000400411:Y855C;ENSP00000439837:Y848C;ENSP00000440371:Y821C;ENSP00000443553:Y147C	ENSP00000299275:Y866C	Y	+	2	0	PLEKHA5	19398160	1.000000	0.71417	0.690000	0.30148	0.968000	0.65278	6.016000	0.70798	1.890000	0.54733	0.372000	0.22366	TAT	.		0.368	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
SLC38A4	55089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	47178364	47178364	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:47178364T>A	ENST00000447411.1	-	6	660	c.454A>T	c.(454-456)Att>Ttt	p.I152F	SLC38A4_ENST00000266579.4_Missense_Mutation_p.I152F	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	152					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					AAAGCTCCAATTTTTCCCGGC	0.333																																					p.I152F		.											.	SLC38A4-93	0			c.A454T						.						109.0	107.0	107.0					12																	47178364		2203	4300	6503	SO:0001583	missense	55089	exon6			CTCCAATTTTTCC	AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.454A>T	12.37:g.47178364T>A	ENSP00000389843:p.Ile152Phe	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	175	26	NM_001143824	0	0	0	0	0	A8K553	Missense_Mutation	SNP	ENST00000447411.1	37	CCDS8750.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.242201	0.39598	.	.	ENSG00000139209	ENST00000395426;ENST00000447411;ENST00000266579;ENST00000547477;ENST00000546940	T;T;T;T	0.02421	4.3;4.3;4.3;4.3	6.07	4.9	0.64082	.	0.311957	0.37906	N	0.001896	T	0.03053	0.0090	L	0.33624	1.015	0.50813	D	0.999895	B	0.09022	0.002	B	0.15870	0.014	T	0.50898	-0.8773	10	0.27785	T	0.31	-8.8755	11.1795	0.48620	0.2577:0.0:0.0:0.7423	.	152	Q969I6	S38A4_HUMAN	F	152	ENSP00000389843:I152F;ENSP00000266579:I152F;ENSP00000450071:I152F;ENSP00000448543:I152F	ENSP00000266579:I152F	I	-	1	0	SLC38A4	45464631	1.000000	0.71417	0.996000	0.52242	0.736000	0.42039	3.555000	0.53727	1.067000	0.40740	0.533000	0.62120	ATT	.		0.333	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404574.1		
EIF4B	1975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53416313	53416313	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:53416313G>C	ENST00000262056.9	+	6	895	c.569G>C	c.(568-570)cGg>cCg	p.R190P	EIF4B_ENST00000416762.3_Missense_Mutation_p.R151P|RP11-983P16.4_ENST00000552905.1_RNA|EIF4B_ENST00000420463.3_Missense_Mutation_p.R190P	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	190	Arg-rich.|Asp-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						GATAGAAATCGGGATTCTGAC	0.418																																					p.R190P		.											.	EIF4B-568	0			c.G569C						.						133.0	112.0	119.0					12																	53416313		1863	4102	5965	SO:0001583	missense	1975	exon6			GAAATCGGGATTC	X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.569G>C	12.37:g.53416313G>C	ENSP00000262056:p.Arg190Pro	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	114	16	NM_001417	2	0	445	555	108	Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Missense_Mutation	SNP	ENST00000262056.9	37	CCDS41788.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124924	0.56613	.	.	ENSG00000063046	ENST00000262056;ENST00000551002;ENST00000420463;ENST00000430205;ENST00000416762;ENST00000552490	T;D;D;D;D	0.94232	0.54;-3.36;-3.36;-3.38;-3.36	3.59	2.7	0.31948	.	0.065726	0.53938	D	0.000044	D	0.87993	0.6318	L	0.27053	0.805	0.58432	D	0.999999	B;B;B	0.33807	0.426;0.301;0.301	B;B;B	0.36504	0.226;0.113;0.113	D	0.86321	0.1692	10	0.56958	D	0.05	.	10.7402	0.46149	0.0982:0.0:0.9018:0.0	.	151;190;190	B4DS13;E7EX17;P23588	.;.;IF4B_HUMAN	P	190;144;190;190;151;190	ENSP00000262056:R190P;ENSP00000447192:R144P;ENSP00000388806:R190P;ENSP00000412530:R151P;ENSP00000450324:R190P	ENSP00000262056:R190P	R	+	2	0	EIF4B	51702580	1.000000	0.71417	0.979000	0.43373	0.935000	0.57460	6.380000	0.73158	1.077000	0.40990	0.650000	0.86243	CGG	.		0.418	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404852.2	NM_001417	
RAB5B	5869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56385887	56385887	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:56385887A>T	ENST00000360299.5	+	6	760	c.539A>T	c.(538-540)aAg>aTg	p.K180M	RAB5B_ENST00000448789.2_Missense_Mutation_p.K139M|RAB5B_ENST00000553116.1_Missense_Mutation_p.K180M	NM_002868.3	NP_002859.1	P61020	RAB5B_HUMAN	RAB5B, member RAS oncogene family	180					antigen processing and presentation (GO:0019882)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|plasma membrane to endosome transport (GO:0048227)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|liver(2)|lung(4)|upper_aerodigestive_tract(1)	9			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.235)			CTAGCTAAGAAGTTGCCAAAG	0.507																																					p.K180M		.											.	RAB5B-227	0			c.A539T						.						59.0	60.0	60.0					12																	56385887		2203	4300	6503	SO:0001583	missense	5869	exon6			CTAAGAAGTTGCC		CCDS8900.1, CCDS58244.1	12q13	2008-07-30						"""RAB, member RAS oncogene"""	9784	protein-coding gene	gene with protein product		179514				1541686, 10403367	Standard	NM_001252037		Approved		uc001siw.3	P61020		ENST00000360299.5:c.539A>T	12.37:g.56385887A>T	ENSP00000353444:p.Lys180Met	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	105	35	NM_002868	0	0	1	1	0	A8K982|B4DKD7|P35239|P35277|Q6PIK9|Q86TH0|Q8IXL2	Missense_Mutation	SNP	ENST00000360299.5	37	CCDS8900.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.65|16.65	3.183016|3.183016	0.57800|0.57800	.|.	.|.	ENSG00000111540|ENSG00000111540	ENST00000549218|ENST00000553116;ENST00000360299;ENST00000448789	.|T;T;T	.|0.80033	.|-1.17;-1.17;-1.33	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	.|0.080850	.|0.49916	.|D	.|0.000138	D|D	0.84710|0.84710	0.5532|0.5532	L|L	0.54863|0.54863	1.705|1.705	0.58432|0.58432	D|D	0.999999|0.999999	.|D;P;P	.|0.53619	.|0.961;0.55;0.911	.|P;P;P	.|0.57548	.|0.823;0.575;0.69	D|D	0.86486|0.86486	0.1794|0.1794	5|10	.|0.87932	.|D	.|0	-7.6032|-7.6032	14.1258|14.1258	0.65219|0.65219	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|139;180;180	.|B4DKD7;Q6FI54;P61020	.|.;.;RAB5B_HUMAN	D|M	99|180;180;139	.|ENSP00000450168:K180M;ENSP00000353444:K180M;ENSP00000391319:K139M	.|ENSP00000353444:K180M	E|K	+|+	3|2	2|0	RAB5B|RAB5B	54672154|54672154	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.605000|5.605000	0.67634|0.67634	2.236000|2.236000	0.73375|0.73375	0.529000|0.529000	0.55759|0.55759	GAA|AAG	.		0.507	RAB5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405396.1		
FGD6	55785	broad.mit.edu	37	12	95603626	95603626	+	Silent	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:95603626A>G	ENST00000343958.4	-	2	1657	c.1434T>C	c.(1432-1434)ccT>ccC	p.P478P	FGD6_ENST00000550368.1_5'Flank|FGD6_ENST00000546711.1_Silent_p.P478P|FGD6_ENST00000549499.1_Silent_p.P478P	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	478					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						TTTGCATTTGAGGGGCAGAAA	0.393																																					p.P478P													.	FGD6-137	0			c.T1434C						.						64.0	68.0	66.0					12																	95603626		2203	4300	6503	SO:0001819	synonymous_variant	55785	exon2			CATTTGAGGGGCA	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.1434T>C	12.37:g.95603626A>G		Somatic	137	0		WXS	Illumina HiSeq	Phase_I	119	3	NM_018351	0	0	5	5	0	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Silent	SNP	ENST00000343958.4	37	CCDS31878.1																																																																																			.		0.393	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	
CCDC38	120935	hgsc.bcm.edu;broad.mit.edu	37	12	96273432	96273432	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:96273432G>A	ENST00000344280.3	-	12	1689	c.1132C>T	c.(1132-1134)Cag>Tag	p.Q378*	SNRPF_ENST00000553192.1_Intron|SNRPF_ENST00000552085.1_Intron	NM_182496.2	NP_872302.2	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	378										breast(1)|endometrium(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTTTTATCCTGTATAACTTTT	0.368																																					p.Q378X		.											.	CCDC38-91	0			c.C1132T						.						156.0	150.0	152.0					12																	96273432		2203	4300	6503	SO:0001587	stop_gained	120935	exon12			TATCCTGTATAAC	AK097408	CCDS9056.1	12q23.1	2005-11-02				ENSG00000165972			26843	protein-coding gene	gene with protein product							Standard	NM_182496		Approved	FLJ40089	uc001tek.2	Q502W7	OTTHUMG00000170352	ENST00000344280.3:c.1132C>T	12.37:g.96273432G>A	ENSP00000345470:p.Gln378*	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	100	19	NM_182496	0	0	0	0	0	Q8N835	Nonsense_Mutation	SNP	ENST00000344280.3	37	CCDS9056.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.889426	0.91889	.	.	ENSG00000165972	ENST00000344280	.	.	.	5.99	2.85	0.33270	.	0.690505	0.14783	N	0.298696	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-11.1569	11.1809	0.48627	0.0:0.1217:0.6268:0.2514	.	.	.	.	X	378	.	ENSP00000345470:Q378X	Q	-	1	0	CCDC38	94797563	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.645000	0.37238	1.549000	0.49425	-0.330000	0.08379	CAG	.		0.368	CCDC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408634.1	NM_182496	
TRPC4	7223	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	38237841	38237841	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr13:38237841G>T	ENST00000379705.3	-	6	2257	c.1400C>A	c.(1399-1401)tCa>tAa	p.S467*	TRPC4_ENST00000494529.1_5'UTR|TRPC4_ENST00000379679.1_Nonsense_Mutation_p.S294*|TRPC4_ENST00000379673.2_Nonsense_Mutation_p.S467*|TRPC4_ENST00000379681.3_Nonsense_Mutation_p.S467*|TRPC4_ENST00000355779.2_Nonsense_Mutation_p.S467*|TRPC4_ENST00000358477.2_Nonsense_Mutation_p.S467*|TRPC4_ENST00000426868.2_Intron|TRPC4_ENST00000447043.1_Nonsense_Mutation_p.S467*|TRPC4_ENST00000338947.5_Nonsense_Mutation_p.S294*			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	467					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.S467L(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CATGTCCCATGATTCTCGTGG	0.423																																					p.S467X													.	TRPC4-159	2	Substitution - Missense(2)	lung(2)	c.C1400A						.						43.0	43.0	43.0					13																	38237841		2203	4300	6503	SO:0001587	stop_gained	7223	exon6			TCCCATGATTCTC	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1400C>A	13.37:g.38237841G>T	ENSP00000369027:p.Ser467*	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	34	7	NM_003306	0	0	1	1	0	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Nonsense_Mutation	SNP	ENST00000379705.3	37	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	G	37	6.446819	0.97572	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	.	.	.	5.45	4.55	0.56014	.	0.671651	0.16287	N	0.221062	.	.	.	.	.	.	0.19300	N	0.99997	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-11.8501	8.9999	0.36074	0.0:0.2072:0.6524:0.1405	.	.	.	.	X	467;467;294;294;467;467;467;467	.	ENSP00000342580:S294X	S	-	2	0	TRPC4	37135841	0.000000	0.05858	0.954000	0.39281	0.956000	0.61745	0.946000	0.29069	2.706000	0.92434	0.655000	0.94253	TCA	.		0.423	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
RCBTB1	55213	bcgsc.ca	37	13	50115837	50115837	+	Silent	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr13:50115837G>A	ENST00000378302.2	-	11	1559	c.1299C>T	c.(1297-1299)gtC>gtT	p.V433V	RCBTB1_ENST00000471984.1_5'Flank|RCBTB1_ENST00000258646.3_Silent_p.V433V	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	433	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		GCGGCAGGTCGACTGTGTCTG	0.458																																					p.V433V													.	RCBTB1-91	0			c.C1299T						.						156.0	117.0	130.0					13																	50115837		2203	4300	6503	SO:0001819	synonymous_variant	55213	exon11			CAGGTCGACTGTG	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.1299C>T	13.37:g.50115837G>A		Somatic	83	0		WXS	Illumina HiSeq	Phase_1	84	17	NM_018191	0	0	11	11	0	Q8IY29|Q969U9	Silent	SNP	ENST00000378302.2	37	CCDS9418.1																																																																																			.		0.458	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044912.2	NM_018191	
GPR180	160897	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	95271585	95271585	+	Splice_Site	SNP	G	G	A	rs138676753		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr13:95271585G>A	ENST00000376958.4	+	4	711		c.e4+1			NM_180989.5	NP_851320.1	Q86V85	GP180_HUMAN	G protein-coupled receptor 180						G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	10	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					ATTTCTCCAGGTAACTCAAAA	0.338																																					.													.	GPR180-153	0			c.686+1G>A						.						125.0	122.0	123.0					13																	95271585		2203	4300	6503	SO:0001630	splice_region_variant	160897	exon4			CTCCAGGTAACTC	AF339823	CCDS9472.1	13q32.1	2006-04-05			ENSG00000152749	ENSG00000152749			28899	protein-coding gene	gene with protein product	"""intimal thickness related receptor"""	607787				12538434	Standard	NM_180989		Approved	ITR	uc001vly.3	Q86V85	OTTHUMG00000017207	ENST00000376958.4:c.686+1G>A	13.37:g.95271585G>A		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	83	9	NM_180989	0	0	0	0	0	A8K1D5	Splice_Site	SNP	ENST00000376958.4	37	CCDS9472.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575779	0.86645	.	.	ENSG00000152749	ENST00000376958	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPR180	94069586	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.048000	0.93830	2.736000	0.93811	0.655000	0.94253	.	G|1.000;C|0.000		0.338	GPR180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045465.3	NM_180989	Intron
BIVM	54841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	103492131	103492131	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr13:103492131C>G	ENST00000257336.1	+	11	2107	c.1428C>G	c.(1426-1428)gaC>gaG	p.D476E	BIVM_ENST00000419638.1_3'UTR|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.L448V|BIVM_ENST00000448849.2_Missense_Mutation_p.D254E	NM_017693.3	NP_060163.2	Q86UB2	BIVM_HUMAN	basic, immunoglobulin-like variable motif containing	476						cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|skin(2)|urinary_tract(1)	25	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TCCATCAGGACTCGGCATGGA	0.468																																					p.D476E		.											.	.	0			c.C1428G						.						154.0	144.0	147.0					13																	103492131		2203	4300	6503	SO:0001583	missense	0	exon9			TCAGGACTCGGCA	AF411385	CCDS9505.1, CCDS53879.1	13q33.1	2008-05-14			ENSG00000134897	ENSG00000134897			16034	protein-coding gene	gene with protein product						12036287	Standard	NM_017693		Approved	FLJ20159		Q86UB2	OTTHUMG00000017309	ENST00000257336.1:c.1428C>G	13.37:g.103492131C>G	ENSP00000257336:p.Asp476Glu	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	164	30	NM_001204425	0	0	50	87	37	Q2M1J2|Q9NXM4	Missense_Mutation	SNP	ENST00000257336.1	37	CCDS9505.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.437445	0.01098	.	.	ENSG00000134897;ENSG00000134897;ENSG00000134899	ENST00000257336;ENST00000448849;ENST00000418659	.	.	.	5.4	-0.762	0.11034	.	0.188352	0.45606	D	0.000360	T	0.03651	0.0104	N	0.00347	-1.61	0.19300	N	0.999976	B;B;B	0.21606	0.0;0.058;0.005	B;B;B	0.17098	0.001;0.017;0.004	T	0.35624	-0.9781	9	0.02654	T	1	-13.3799	2.8027	0.05419	0.0935:0.3232:0.301:0.2823	.	254;447;476	Q86UB2-2;Q59FZ7;Q86UB2	.;.;BIVM_HUMAN	E	476;254;447	.	ENSP00000257336:D476E	D	+	3	2	ERCC5;BIVM	102290132	0.097000	0.21791	0.768000	0.31515	0.791000	0.44710	-0.250000	0.08830	-0.183000	0.10585	-1.255000	0.01485	GAC	.		0.468	BIVM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045704.2		
KTN1	3895	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	56079010	56079010	+	Silent	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr14:56079010C>A	ENST00000395314.3	+	2	312	c.244C>A	c.(244-246)Cga>Aga	p.R82R	KTN1_ENST00000395309.3_Silent_p.R82R|KTN1_ENST00000438792.2_Silent_p.R82R|KTN1_ENST00000395311.1_Silent_p.R82R|KTN1_ENST00000416613.1_Silent_p.R82R|KTN1_ENST00000413890.2_Silent_p.R82R|KTN1_ENST00000395308.1_Silent_p.R82R	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	82					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						GAGTGTACCTCGAGACTTTAA	0.363			T	RET	papillary thryoid																																p.R82R				Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	KTN1-1147	0			c.C244A						.						74.0	78.0	77.0					14																	56079010		2203	4300	6503	SO:0001819	synonymous_variant	3895	exon2			GTACCTCGAGACT		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.244C>A	14.37:g.56079010C>A		Somatic	93	0		WXS	Illumina HiSeq	Phase_I	92	19	NM_004986	0	0	20	54	34	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Silent	SNP	ENST00000395314.3	37	CCDS41957.1																																																																																			.		0.363	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
ANPEP	290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	90349567	90349567	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr15:90349567T>C	ENST00000300060.6	-	2	561	c.248A>G	c.(247-249)gAt>gGt	p.D83G		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	83	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	CCGGTAGGAATCGGGTTTCAG	0.617																																					p.D83G	NSCLC(30;827 977 2459 19669 26125)	.											.	ANPEP-94	0			c.A248G						.						126.0	102.0	110.0					15																	90349567		2200	4299	6499	SO:0001583	missense	290	exon2			TAGGAATCGGGTT	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.248A>G	15.37:g.90349567T>C	ENSP00000300060:p.Asp83Gly	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	85	18	NM_001150	0	0	94	95	1	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	T	6.216	0.408075	0.11754	.	.	ENSG00000166825	ENST00000300060	T	0.02631	4.22	4.74	0.264	0.15607	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	2.111890	0.01982	N	0.044922	T	0.06096	0.0158	M	0.73962	2.25	0.09310	N	1	B	0.26672	0.156	B	0.33121	0.158	T	0.46359	-0.9197	10	0.23891	T	0.37	.	4.6468	0.12575	0.3933:0.0958:0.0:0.5109	.	83	P15144	AMPN_HUMAN	G	83	ENSP00000300060:D83G	ENSP00000300060:D83G	D	-	2	0	ANPEP	88150571	0.000000	0.05858	0.011000	0.14972	0.152000	0.21847	0.560000	0.23500	0.163000	0.19507	0.383000	0.25322	GAT	.		0.617	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
SV2B	9899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	91769497	91769497	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr15:91769497G>C	ENST00000394232.1	+	2	474	c.4G>C	c.(4-6)Gat>Cat	p.D2H	SV2B_ENST00000545111.2_Intron|SV2B_ENST00000330276.4_Missense_Mutation_p.D2H|SV2B_ENST00000557291.1_Intron	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	2					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			CCAAGGAATGGATGACTACAA	0.478																																					p.D2H		.											.	SV2B-97	0			c.G4C						.						72.0	58.0	63.0					15																	91769497		2198	4298	6496	SO:0001583	missense	9899	exon3			GGAATGGATGACT	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.4G>C	15.37:g.91769497G>C	ENSP00000377779:p.Asp2His	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	44	12	NM_014848	0	0	1	1	0	B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	ENST00000394232.1	37	CCDS10370.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469419	0.63625	.	.	ENSG00000185518	ENST00000394232;ENST00000330276	T;T	0.64803	-0.12;-0.12	5.71	4.79	0.61399	.	0.237482	0.42821	D	0.000651	T	0.65249	0.2673	M	0.68317	2.08	0.48830	D	0.999714	P	0.37015	0.578	B	0.41988	0.372	T	0.69007	-0.5259	10	0.72032	D	0.01	-15.0004	13.3113	0.60382	0.077:0.0:0.923:0.0	.	2	Q7L1I2	SV2B_HUMAN	H	2	ENSP00000377779:D2H;ENSP00000332818:D2H	ENSP00000332818:D2H	D	+	1	0	SV2B	89570501	1.000000	0.71417	0.999000	0.59377	0.874000	0.50279	7.523000	0.81856	1.411000	0.46957	0.563000	0.77884	GAT	.		0.478	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848	
LMF1	64788	hgsc.bcm.edu	37	16	1004476	1004476	+	Missense_Mutation	SNP	C	C	G	rs115313199	byFrequency	TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr16:1004476C>G	ENST00000262301.11	-	2	402	c.384G>C	c.(382-384)ttG>ttC	p.L128F	LMF1_ENST00000399843.2_Missense_Mutation_p.L128F|LMF1_ENST00000539379.1_Missense_Mutation_p.L121F|LMF1_ENST00000543238.1_Intron|LMF1_ENST00000568897.1_5'UTR	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	128					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				GAAGAGCCAGCAAGTCCAGGT	0.572													C|||	17	0.00339457	0.0129	0.0	5008	,	,		20549	0.0		0.0	False		,,,				2504	0.0				p.L128F		.											.	LMF1-90	0			c.G384C						.	C	PHE/LEU	39,4147		0,39,2054	53.0	56.0	55.0		384	-6.8	0.0	16	dbSNP_132	55	0,8430		0,0,4215	yes	missense	LMF1	NM_022773.2	22	0,39,6269	GG,GC,CC		0.0,0.9317,0.3091	benign	128/568	1004476	39,12577	2093	4215	6308	SO:0001583	missense	64788	exon2			AGCCAGCAAGTCC	AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.384G>C	16.37:g.1004476C>G	ENSP00000262301:p.Leu128Phe	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	24	6	NM_022773	0	0	20	31	11	Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Missense_Mutation	SNP	ENST00000262301.11	37	CCDS45373.1	8	0.003663003663003663	8	0.016260162601626018	0	0.0	0	0.0	0	0.0	C	0.528	-0.859205	0.02610	0.009317	0.0	ENSG00000103227	ENST00000262301;ENST00000399843;ENST00000539151;ENST00000539379	T;T;T	0.51817	2.3;2.29;0.69	5.56	-6.78	0.01721	.	1.259970	0.05289	N	0.520773	T	0.14098	0.0341	L	0.43701	1.375	0.09310	N	1	P	0.36392	0.551	B	0.30179	0.112	T	0.16188	-1.0411	10	0.10111	T	0.7	-23.3338	4.3889	0.11330	0.1188:0.3332:0.3649:0.183	.	128	Q96S06	LMF1_HUMAN	F	128;128;128;121	ENSP00000262301:L128F;ENSP00000382737:L128F;ENSP00000446322:L121F	ENSP00000262301:L128F	L	-	3	2	LMF1	944477	0.031000	0.19500	0.000000	0.03702	0.001000	0.01503	0.367000	0.20382	-0.830000	0.04262	-0.165000	0.13383	TTG	C|0.996;G|0.004		0.572	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109071.3	NM_022773	
RBBP6	5930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	24582943	24582943	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr16:24582943G>C	ENST00000319715.4	+	18	4988	c.4556G>C	c.(4555-4557)aGa>aCa	p.R1519T	RBBP6_ENST00000348022.2_Missense_Mutation_p.R1485T|RBBP6_ENST00000381039.3_Missense_Mutation_p.R679T	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1519	Interaction with p53. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AGGGAAGAGAGAGATTTGCCT	0.358																																					p.R1519T		.											.	RBBP6-230	0			c.G4556C						.						40.0	39.0	39.0					16																	24582943		2197	4298	6495	SO:0001583	missense	5930	exon18			AAGAGAGAGATTT		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4556G>C	16.37:g.24582943G>C	ENSP00000317872:p.Arg1519Thr	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	45	8	NM_006910	0	0	18	24	6	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	37	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805084	0.50315	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.19105	2.17;2.4;2.41	6.03	1.9	0.25705	.	0.190657	0.41396	D	0.000897	T	0.12475	0.0303	L	0.27053	0.805	0.27887	N	0.939455	P;B;B	0.39480	0.675;0.241;0.155	B;B;B	0.35550	0.205;0.148;0.071	T	0.12502	-1.0545	10	0.30078	T	0.28	-17.338	10.6299	0.45530	0.2533:0.0:0.7467:0.0	.	679;1485;1519	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	T	679;1519;1485	ENSP00000370427:R679T;ENSP00000317872:R1519T;ENSP00000316291:R1485T	ENSP00000317872:R1519T	R	+	2	0	RBBP6	24490444	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	3.017000	0.49615	0.428000	0.26173	0.557000	0.71058	AGA	.		0.358	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
RPGRIP1L	23322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	53691402	53691402	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr16:53691402A>G	ENST00000379925.3	-	13	1594	c.1544T>C	c.(1543-1545)aTg>aCg	p.M515T	RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.M515T|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.M515T|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.M515T	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	515					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CATAATTAGCATGTTTCTTGT	0.313																																					p.M515T		.											.	RPGRIP1L-91	0			c.T1544C						.						88.0	81.0	83.0					16																	53691402		2196	4300	6496	SO:0001583	missense	23322	exon13			ATTAGCATGTTTC		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.1544T>C	16.37:g.53691402A>G	ENSP00000369257:p.Met515Thr	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	89	17	NM_001127897	0	0	3	5	2	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138906	0.77775	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;D	0.81579	-0.02;-1.51	6.04	6.04	0.98038	.	0.099515	0.64402	D	0.000001	D	0.87834	0.6277	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.76494	0.972;0.972;0.972;0.999	P;P;P;D	0.68765	0.632;0.706;0.706;0.96	D	0.86184	0.1608	10	0.30078	T	0.28	-18.3503	14.8183	0.70052	1.0:0.0:0.0:0.0	.	515;515;515;515	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	T	515	ENSP00000369257:M515T;ENSP00000262135:M515T	ENSP00000262135:M515T	M	-	2	0	RPGRIP1L	52248903	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.353000	0.90077	2.317000	0.78254	0.460000	0.39030	ATG	.		0.313	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
AP2B1	163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	33966737	33966737	+	Missense_Mutation	SNP	A	A	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:33966737A>C	ENST00000262325.7	+	11	1948	c.1395A>C	c.(1393-1395)ttA>ttC	p.L465F	AP2B1_ENST00000537622.2_Missense_Mutation_p.L465F|AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000538556.1_Missense_Mutation_p.L408F|AP2B1_ENST00000312678.8_Missense_Mutation_p.L465F|AP2B1_ENST00000592545.1_Missense_Mutation_p.L427F|AP2B1_ENST00000589344.1_Missense_Mutation_p.L465F	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	465					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CAGATGAGTTACTAGAAAGCT	0.433																																					p.L465F		.											.	AP2B1-91	0			c.A1395C						.						113.0	110.0	111.0					17																	33966737		2203	4300	6503	SO:0001583	missense	163	exon11			TGAGTTACTAGAA	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.1395A>C	17.37:g.33966737A>C	ENSP00000262325:p.Leu465Phe	Somatic	97	1		WXS	Illumina HiSeq	Phase_I	117	28	NM_001282	0	0	69	131	62	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	A	20.0	3.930330	0.73327	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.46	1.82	0.25136	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47060	0.1425	M	0.81942	2.565	0.80722	D	1	D;P;P;P	0.89917	1.0;0.576;0.905;0.613	D;P;B;B	0.81914	0.995;0.457;0.397;0.153	T	0.45687	-0.9244	10	0.51188	T	0.08	-0.0246	1.588	0.02648	0.5463:0.168:0.1231:0.1627	.	202;427;465;465	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	F	465;465;408;465;202	ENSP00000262325:L465F;ENSP00000314414:L465F;ENSP00000440563:L408F;ENSP00000437413:L465F	ENSP00000262325:L465F	L	+	3	2	AP2B1	30990850	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.991000	0.40727	0.954000	0.37851	0.533000	0.62120	TTA	.		0.433	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		
CBX1	10951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	46152378	46152378	+	Silent	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:46152378G>A	ENST00000393408.3	-	4	883	c.403C>T	c.(403-405)Ctg>Ttg	p.L135L	CBX1_ENST00000225603.4_Silent_p.L135L|CBX1_ENST00000495350.1_Silent_p.L135L	NM_006807.4	NP_006798.1	P83916	CBX1_HUMAN	chromobox homolog 1	135	Chromo 2; shadow subtype. {ECO:0000255|PROSITE-ProRule:PRU00053}.				negative regulation of transcription, DNA-templated (GO:0045892)	chromatin (GO:0000785)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|pericentric heterochromatin (GO:0005721)|spindle (GO:0005819)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)			breast(1)|central_nervous_system(1)|kidney(1)|prostate(1)	4						CATTTCATCAGGAACATGAGC	0.483																																					p.L135L	NSCLC(136;694 2497 38792 39034)	.											.	CBX1-226	0			c.C403T						.						137.0	138.0	138.0					17																	46152378		2203	4300	6503	SO:0001819	synonymous_variant	10951	exon4			TCATCAGGAACAT	U35451	CCDS11525.1	17q21.32	2010-07-06	2010-06-24		ENSG00000108468	ENSG00000108468			1551	protein-coding gene	gene with protein product	"""HP1 beta homolog (Drosophila )"""	604511	"""chromobox homolog 1 (Drosophila HP1 beta)"""			9169582	Standard	NM_001127228		Approved	HP1Hs-beta, M31, MOD1, CBX, HP1-BETA	uc002ind.4	P83916	OTTHUMG00000150417	ENST00000393408.3:c.403C>T	17.37:g.46152378G>A		Somatic	273	0		WXS	Illumina HiSeq	Phase_I	268	62	NM_006807	0	0	0	0	0	P23197	Silent	SNP	ENST00000393408.3	37	CCDS11525.1																																																																																			.		0.483	CBX1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318016.1	NM_006807	
MTMR4	9110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	56572475	56572475	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:56572475C>T	ENST00000323456.5	-	16	3152	c.3028G>A	c.(3028-3030)Gat>Aat	p.D1010N	MTMR4_ENST00000579925.1_Missense_Mutation_p.D953N	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	1010					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCATCATCATCCAAATACAGA	0.512																																					p.D1010N		.											.	MTMR4-91	0			c.G3028A						.						204.0	179.0	187.0					17																	56572475		2203	4300	6503	SO:0001583	missense	9110	exon16			CATCATCCAAATA	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.3028G>A	17.37:g.56572475C>T	ENSP00000325285:p.Asp1010Asn	Somatic	205	0		WXS	Illumina HiSeq	Phase_I	214	58	NM_004687	0	0	8	12	4	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	37	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689025	0.88735	.	.	ENSG00000108389	ENST00000323456	D	0.96885	-4.16	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.97626	0.9222	L	0.58101	1.795	0.48452	D	0.999659	D	0.89917	1.0	D	0.85130	0.997	D	0.98181	1.0457	10	0.66056	D	0.02	.	18.5538	0.91075	0.0:1.0:0.0:0.0	.	1010	Q9NYA4	MTMR4_HUMAN	N	1010	ENSP00000325285:D1010N	ENSP00000325285:D1010N	D	-	1	0	MTMR4	53927474	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.104000	0.77024	2.627000	0.88993	0.555000	0.69702	GAT	.		0.512	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687	
CLTC	1213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	57771125	57771125	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:57771125T>C	ENST00000269122.3	+	32	5214	c.4940T>C	c.(4939-4941)gTt>gCt	p.V1647A	CLTC_ENST00000579456.1_Missense_Mutation_p.V584A	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1647	Heavy chain arm.|Proximal segment.|Trimerization. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GGACCCAGTGTTGCCGTCCCT	0.557			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.V1647A		.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC-835	0			c.T4940C						.						144.0	116.0	125.0					17																	57771125		2203	4300	6503	SO:0001583	missense	1213	exon32			CCAGTGTTGCCGT	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.4940T>C	17.37:g.57771125T>C	ENSP00000269122:p.Val1647Ala	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	144	55	NM_004859	0	0	180	293	113	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	T	12.39	1.923961	0.34002	.	.	ENSG00000141367	ENST00000269122	T	0.10668	2.85	6.08	6.08	0.98989	.	0.052581	0.85682	D	0.000000	T	0.07728	0.0194	N	0.14661	0.345	0.80722	D	1	B	0.13145	0.007	B	0.12156	0.007	T	0.36212	-0.9757	10	0.14252	T	0.57	.	16.6438	0.85155	0.0:0.0:0.0:1.0	.	1647	Q00610	CLH1_HUMAN	A	1647	ENSP00000269122:V1647A	ENSP00000269122:V1647A	V	+	2	0	CLTC	55125907	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.162000	0.71874	2.333000	0.79357	0.533000	0.62120	GTT	.		0.557	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
ACE	1636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	61570904	61570904	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:61570904G>T	ENST00000290866.4	+	20	3044	c.3020G>T	c.(3019-3021)aGg>aTg	p.R1007M	ACE_ENST00000428043.1_Missense_Mutation_p.R1007M|ACE_ENST00000421982.2_Missense_Mutation_p.R253M|ACE_ENST00000577647.1_Missense_Mutation_p.R433M|ACE_ENST00000290863.6_Missense_Mutation_p.R433M|ACE_ENST00000490216.2_Missense_Mutation_p.R433M|ACE_ENST00000413513.3_Missense_Mutation_p.R433M	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	1007	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GTGGCCTTGAGGGAGGGTGCC	0.582																																					p.R1007M		.											.	ACE-94	0			c.G3020T						.						80.0	74.0	76.0					17																	61570904		2203	4300	6503	SO:0001583	missense	1636	exon20			CCTTGAGGGAGGG	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.3020G>T	17.37:g.61570904G>T	ENSP00000290866:p.Arg1007Met	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	87	18	NM_000789	0	0	23	24	1	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.618950	0.46736	.	.	ENSG00000159640	ENST00000290866;ENST00000428043;ENST00000290863;ENST00000413513;ENST00000421982	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.80628	0.4659	H	0.97340	3.985	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;0.999;1.0	D;D;D;D	0.97110	0.992;0.976;0.986;1.0	D	0.88380	0.3001	10	0.87932	D	0	-34.8796	18.0898	0.89471	0.0:0.0:1.0:0.0	.	253;433;433;1007	F6X3S4;B4DXI3;P12821-3;P12821	.;.;.;ACE_HUMAN	M	1007;1007;433;433;253	ENSP00000290866:R1007M;ENSP00000397593:R1007M;ENSP00000290863:R433M;ENSP00000392247:R433M;ENSP00000387760:R253M	ENSP00000290863:R433M	R	+	2	0	ACE	58924636	1.000000	0.71417	0.966000	0.40874	0.792000	0.44763	7.975000	0.88055	2.262000	0.75019	0.561000	0.74099	AGG	.		0.582	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
TMC8	147138	broad.mit.edu;bcgsc.ca	37	17	76133812	76133812	+	Silent	SNP	C	C	T	rs375990572		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:76133812C>T	ENST00000318430.5	+	11	1640	c.1266C>T	c.(1264-1266)tcC>tcT	p.S422S	TMC8_ENST00000589691.1_Silent_p.S199S	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	422					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			GGGAGAACTCCGTGGGGGAGG	0.642																																					p.S422S													.	TMC8-90	0			c.C1266T						.	C		2,4404	4.2+/-10.8	0,2,2201	114.0	100.0	104.0		1266	-8.6	0.9	17		104	0,8600		0,0,4300	no	coding-synonymous	TMC8	NM_152468.4		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		422/727	76133812	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	147138	exon11			GAACTCCGTGGGG	AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.1266C>T	17.37:g.76133812C>T		Somatic	136	0		WXS	Illumina HiSeq	Phase_I	102	14	NM_152468	0	0	18	18	0	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Silent	SNP	ENST00000318430.5	37	CCDS32749.1																																																																																			.		0.642	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436900.3		
DYM	54808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	46956680	46956680	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr18:46956680T>G	ENST00000269445.6	-	2	542	c.85A>C	c.(85-87)Aat>Cat	p.N29H	DYM_ENST00000442713.2_Missense_Mutation_p.N29H|DYM_ENST00000584977.1_5'UTR|RP11-110H1.9_ENST00000583579.1_RNA	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	29					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						AACGGGTCATTCTCAGAGATA	0.423																																					p.N29H		.											.	DYM-226	0			c.A85C						.						147.0	146.0	146.0					18																	46956680		2203	4300	6503	SO:0001583	missense	54808	exon2			GGTCATTCTCAGA	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.85A>C	18.37:g.46956680T>G	ENSP00000269445:p.Asn29His	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	171	29	NM_017653	0	0	12	18	6	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	ENST00000269445.6	37	CCDS11937.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.571437	0.45798	.	.	ENSG00000141627	ENST00000442713;ENST00000269445	D;D	0.82893	-1.66;-1.66	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.90841	0.7123	M	0.78801	2.425	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.78314	0.991;0.983	D	0.91823	0.5469	10	0.87932	D	0	-23.1803	15.1469	0.72662	0.0:0.0:0.0:1.0	.	29;29	Q7RTS9-2;Q7RTS9	.;DYM_HUMAN	H	29	ENSP00000395942:N29H;ENSP00000269445:N29H	ENSP00000269445:N29H	N	-	1	0	DYM	45210678	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.007000	0.76335	2.371000	0.80710	0.533000	0.62120	AAT	.		0.423	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653	
SERPINB2	5055	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	61562567	61562567	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr18:61562567G>T	ENST00000299502.4	+	3	318	c.238G>T	c.(238-240)Ggg>Tgg	p.G80W	SERPINB2_ENST00000482254.1_3'UTR|SERPINB2_ENST00000457692.1_Missense_Mutation_p.G80W	NM_002575.2	NP_002566.1	P05120	PAI2_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 2	80					blood coagulation (GO:0007596)|fibrinolysis (GO:0042730)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G80W(1)		NS(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|liver(1)|lung(12)|prostate(2)|skin(2)|stomach(1)	32		Esophageal squamous(42;0.131)			Tenecteplase(DB00031)|Urokinase(DB00013)	TACCAGCTGTGGGTTCATGCA	0.428																																					p.G80W		.											.	SERPINB2-226	1	Substitution - Missense(1)	lung(1)	c.G238T						.						182.0	179.0	180.0					18																	61562567		2203	4300	6503	SO:0001583	missense	5055	exon3			AGCTGTGGGTTCA	Y00630	CCDS11989.1	18q21.3	2014-02-18	2005-08-18		ENSG00000197632	ENSG00000197632		"""Serine (or cysteine) peptidase inhibitors"""	8584	protein-coding gene	gene with protein product		173390	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2"""	PLANH2, PAI2		24172014	Standard	NM_002575		Approved	HsT1201	uc002ljo.3	P05120	OTTHUMG00000060592	ENST00000299502.4:c.238G>T	18.37:g.61562567G>T	ENSP00000299502:p.Gly80Trp	Somatic	231	1		WXS	Illumina HiSeq	Phase_I	205	35	NM_002575	0	0	0	0	0	Q96E96	Missense_Mutation	SNP	ENST00000299502.4	37	CCDS11989.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.706601	0.30232	.	.	ENSG00000197632	ENST00000404622;ENST00000299502;ENST00000457692;ENST00000413956;ENST00000443281	D;D;D;D;T	0.84370	-1.69;-1.84;-1.84;-1.66;-1.22	5.93	3.15	0.36227	Serpin domain (3);	423.867000	0.00589	U	0.000342	D	0.82889	0.5135	N	0.22421	0.69	0.09310	N	0.999995	P	0.48407	0.91	P	0.49887	0.625	T	0.68830	-0.5305	10	0.66056	D	0.02	.	6.0059	0.19547	0.1669:0.1564:0.6767:0.0	.	80	P05120	PAI2_HUMAN	W	80	ENSP00000385397:G80W;ENSP00000299502:G80W;ENSP00000401645:G80W;ENSP00000402386:G80W;ENSP00000397096:G80W	ENSP00000299502:G80W	G	+	1	0	SERPINB2	59713547	0.006000	0.16342	0.053000	0.19242	0.146000	0.21551	-0.154000	0.10130	0.391000	0.25143	0.655000	0.94253	GGG	.		0.428	SERPINB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134009.1	NM_002575	
HNRNPM	4670	ucsc.edu	37	19	8527467	8527467	+	Splice_Site	SNP	T	T	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:8527467T>G	ENST00000325495.4	+	3	377		c.e3+2		HNRNPM_ENST00000348943.3_Splice_Site	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						AAGTCAAGGGTAAGTGTCTGA	0.428																																					.													.	HNRNPM-68	0			c.336+2T>G						.						241.0	220.0	227.0					19																	8527467		2203	4300	6503	SO:0001630	splice_region_variant	4670	exon3			CAAGGGTAAGTGT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.336+2T>G	19.37:g.8527467T>G		Somatic	111	3		WXS	Illumina HiSeq		156	2	NM_031203	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Splice_Site	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.580056	0.65992	.	.	ENSG00000099783	ENST00000325495;ENST00000348943	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0018	0.71479	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNRNPM	8433467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.225000	0.72522	0.459000	0.35465	.	.		0.428	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		Intron
ZNF699	374879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9406673	9406673	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:9406673G>C	ENST00000591998.1	-	6	1635	c.1407C>G	c.(1405-1407)caC>caG	p.H469Q	CTC-325H20.4_ENST00000591336.1_RNA|ZNF699_ENST00000308650.3_Missense_Mutation_p.H469Q			Q32M78	ZN699_HUMAN	zinc finger protein 699	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCTTTCCAGTGTGATCTCTCA	0.458																																					p.H469Q		.											.	ZNF699-68	0			c.C1407G						.						60.0	64.0	63.0					19																	9406673		2200	4296	6496	SO:0001583	missense	374879	exon5			TCCAGTGTGATCT	BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.1407C>G	19.37:g.9406673G>C	ENSP00000467723:p.His469Gln	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	55	8	NM_198535	0	0	4	5	1	Q8N9A1	Missense_Mutation	SNP	ENST00000591998.1	37	CCDS42495.1	.	.	.	.	.	.	.	.	.	.	g	13.65	2.301105	0.40694	.	.	ENSG00000196110	ENST00000308650	T	0.66995	-0.24	3.28	-0.0525	0.13822	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39407	N	0.001377	T	0.80008	0.4545	M	0.90425	3.115	0.24473	N	0.994389	D	0.71674	0.998	D	0.75484	0.986	T	0.68796	-0.5314	10	0.87932	D	0	.	5.9659	0.19325	0.4949:0.0:0.5051:0.0	.	469	Q32M78	ZN699_HUMAN	Q	469	ENSP00000311596:H469Q	ENSP00000311596:H469Q	H	-	3	2	ZNF699	9267673	0.909000	0.30893	0.019000	0.16419	0.771000	0.43674	0.275000	0.18698	0.085000	0.17107	0.550000	0.68814	CAC	.		0.458	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449010.1	NM_198535	
ICAM5	7087	ucsc.edu	37	19	10402464	10402464	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:10402464C>A	ENST00000221980.4	+	3	715	c.652C>A	c.(652-654)Ccc>Acc	p.P218T	CTD-2369P2.8_ENST00000589379.1_RNA	NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	218	Ig-like C2-type 2.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			CAGCTCGGCCCCCAGAGAGCT	0.602																																					p.P218T													.	ICAM5-153	0			c.C652A						.						19.0	24.0	22.0					19																	10402464		2096	4145	6241	SO:0001583	missense	7087	exon3			TCGGCCCCCAGAG	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.652C>A	19.37:g.10402464C>A	ENSP00000221980:p.Pro218Thr	Somatic	89	1		WXS	Illumina HiSeq		42	6	NM_003259	0	0	0	0	0	Q9Y6F3	Missense_Mutation	SNP	ENST00000221980.4	37	CCDS12233.1	.	.	.	.	.	.	.	.	.	.	c	14.53	2.561648	0.45590	.	.	ENSG00000105376	ENST00000221980	T	0.07908	3.15	5.29	3.17	0.36434	Intercellular adhesion molecule (1);Immunoglobulin-like fold (1);	0.068731	0.56097	D	0.000021	T	0.09423	0.0232	M	0.72479	2.2	0.34597	D	0.716099	B	0.10296	0.003	B	0.17098	0.017	T	0.10753	-1.0616	10	0.13853	T	0.58	-12.7672	7.3688	0.26790	0.0:0.8052:0.0:0.1948	.	218	Q9UMF0	ICAM5_HUMAN	T	218	ENSP00000221980:P218T	ENSP00000221980:P218T	P	+	1	0	ICAM5	10263464	0.005000	0.15991	1.000000	0.80357	0.996000	0.88848	0.423000	0.21313	1.252000	0.44001	0.466000	0.42574	CCC	.		0.602	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259	
PIK3R2	5296	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	18274091	18274091	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:18274091G>A	ENST00000593731.1	+	11	1869	c.1309G>A	c.(1309-1311)Gac>Aac	p.D437N	PIK3R2_ENST00000222254.8_Missense_Mutation_p.D437N			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	437					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	TGTCAAGGAGGACAGCGTGGA	0.577																																					p.D437N		.											.	PIK3R2-1311	0			c.G1309A						.						125.0	107.0	113.0					19																	18274091		2203	4300	6503	SO:0001583	missense	5296	exon11			AAGGAGGACAGCG		CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.1309G>A	19.37:g.18274091G>A	ENSP00000471914:p.Asp437Asn	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	75	13	NM_005027	0	0	65	111	46	Q5EAT5|Q9UPH9	Missense_Mutation	SNP	ENST00000593731.1	37	CCDS12371.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.719551	0.48728	.	.	ENSG00000105647	ENST00000222254	T	0.47869	0.83	4.08	4.08	0.47627	.	0.102115	0.64402	D	0.000002	T	0.40171	0.1106	L	0.43152	1.355	0.42153	D	0.991565	B	0.19583	0.037	B	0.15052	0.012	T	0.38950	-0.9637	10	0.52906	T	0.07	-47.255	12.9549	0.58421	0.0:0.0:0.8377:0.1623	.	437	O00459	P85B_HUMAN	N	437	ENSP00000222254:D437N	ENSP00000222254:D437N	D	+	1	0	PIK3R2	18135091	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.262000	0.65501	2.216000	0.71823	0.561000	0.74099	GAC	.		0.577	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000466386.2	NM_005027	
ZNF85	7639	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	21132080	21132080	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:21132080G>A	ENST00000328178.8	+	4	873	c.760G>A	c.(760-762)Gga>Aga	p.G254R	ZNF85_ENST00000345030.6_Missense_Mutation_p.G221R|ZNF85_ENST00000601023.1_Missense_Mutation_p.G195R	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	254					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						AATTCATACTGGAGAGAAACC	0.353																																					p.G284R													.	ZNF85-514	0			c.G850A						.						26.0	29.0	28.0					19																	21132080		2163	4272	6435	SO:0001583	missense	7639	exon5			CATACTGGAGAGA	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.760G>A	19.37:g.21132080G>A	ENSP00000329793:p.Gly254Arg	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	33	8	NM_001256171	0	0	91	100	9	B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	37	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	11.63	1.695005	0.30052	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	T;T	0.01629	4.72;4.72	1.35	1.35	0.21983	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05135	0.0137	L	0.41632	1.29	0.80722	D	1	P;D;D	0.89917	0.523;1.0;0.993	B;D;D	0.97110	0.134;1.0;0.953	T	0.47560	-0.9108	9	0.54805	T	0.06	.	9.5712	0.39429	0.0:0.0:1.0:0.0	.	221;195;254	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	R	254;221;129	ENSP00000329793:G254R;ENSP00000342340:G221R	ENSP00000329793:G254R	G	+	1	0	ZNF85	20923920	0.998000	0.40836	0.108000	0.21378	0.096000	0.18686	2.982000	0.49337	0.681000	0.31386	0.462000	0.41574	GGA	.		0.353	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
ZNF85	7639	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	21132138	21132138	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:21132138T>C	ENST00000328178.8	+	4	931	c.818T>C	c.(817-819)cTt>cCt	p.L273P	ZNF85_ENST00000345030.6_Missense_Mutation_p.L240P|ZNF85_ENST00000601023.1_Missense_Mutation_p.L214P	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	273					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						TTCTCAACTCTTACTACCCAT	0.348																																					p.L303P		.											.	ZNF85-514	0			c.T908C						.						26.0	29.0	28.0					19																	21132138		2193	4286	6479	SO:0001583	missense	7639	exon5			CAACTCTTACTAC	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.818T>C	19.37:g.21132138T>C	ENSP00000329793:p.Leu273Pro	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	32	4	NM_001256171	0	0	1	1	0	B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	37	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	11.50	1.657272	0.29425	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	T;T	0.53857	0.6;0.6	1.35	1.35	0.21983	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.76263	0.3963	H	0.94620	3.56	0.25920	N	0.983126	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.63350	-0.6657	9	0.87932	D	0	.	7.5498	0.27790	0.0:0.0:0.0:1.0	.	240;214;273	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	P	273;240;148	ENSP00000329793:L273P;ENSP00000342340:L240P	ENSP00000329793:L273P	L	+	2	0	ZNF85	20923978	0.117000	0.22190	0.004000	0.12327	0.013000	0.08279	2.803000	0.47924	0.569000	0.29329	0.379000	0.24179	CTT	.		0.348	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
LGI4	163175	broad.mit.edu;ucsc.edu	37	19	35617765	35617765	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:35617765T>A	ENST00000310123.3	-	7	1304	c.785A>T	c.(784-786)gAg>gTg	p.E262V	LGI4_ENST00000493050.1_5'UTR|LGI4_ENST00000392225.3_Missense_Mutation_p.E262V	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	262					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			ACCGGGCAGCTCTTCCTCGGG	0.687																																					p.E262V													.	LGI4-91	0			c.A785T						.						19.0	23.0	22.0					19																	35617765		2202	4298	6500	SO:0001583	missense	163175	exon7			GGCAGCTCTTCCT	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.785A>T	19.37:g.35617765T>A	ENSP00000312273:p.Glu262Val	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	31	5	NM_139284	0	0	0	0	0	B2RN53|B9EGS7|Q5M8T1	Missense_Mutation	SNP	ENST00000310123.3	37	CCDS12444.1	.	.	.	.	.	.	.	.	.	.	T	18.47	3.631916	0.67015	.	.	ENSG00000153902	ENST00000310123;ENST00000392225;ENST00000437421	T;T	0.64803	-0.12;-0.03	4.1	4.1	0.47936	.	0.551988	0.17037	N	0.189479	T	0.64811	0.2632	L	0.40543	1.245	0.80722	D	1	D;D	0.65815	0.995;0.995	P;P	0.57911	0.829;0.795	T	0.60944	-0.7162	10	0.33141	T	0.24	.	11.0719	0.48008	0.0:0.0:0.0:1.0	.	173;262	Q658V8;Q8N135	.;LGI4_HUMAN	V	262	ENSP00000312273:E262V;ENSP00000376059:E262V	ENSP00000312273:E262V	E	-	2	0	LGI4	40309605	0.998000	0.40836	0.993000	0.49108	0.583000	0.36354	2.147000	0.42226	1.709000	0.51313	0.260000	0.18958	GAG	.		0.687	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1		
SUPT5H	6829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	39964723	39964723	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:39964723C>A	ENST00000599117.1	+	27	2980	c.2613C>A	c.(2611-2613)aaC>aaA	p.N871K	SUPT5H_ENST00000402194.2_Missense_Mutation_p.N867K|SUPT5H_ENST00000432763.2_Missense_Mutation_p.N871K|SUPT5H_ENST00000359191.6_Missense_Mutation_p.N867K|SUPT5H_ENST00000598725.1_Missense_Mutation_p.N871K			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	871	10 X 8 AA approximate tandem repeats of P-[TS]-P-S-P-[QA]-[SG]-Y, motif CTR2.|Pro-rich.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CACAGGTCAACCCACAATACA	0.647											OREG0025462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N871K		.											.	SUPT5H-94	0			c.C2613A						.						84.0	89.0	87.0					19																	39964723		2203	4300	6503	SO:0001583	missense	6829	exon25			GGTCAACCCACAA	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.2613C>A	19.37:g.39964723C>A	ENSP00000470252:p.Asn871Lys	Somatic	121	0	889	WXS	Illumina HiSeq	Phase_I	66	11	NM_003169	0	0	103	144	41	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	37	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910409	0.52439	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.36	3.19	0.36642	.	0.043680	0.85682	D	0.000000	T	0.51652	0.1687	L	0.53249	1.67	0.58432	D	0.999995	B;B;B	0.34200	0.367;0.387;0.441	B;B;B	0.37550	0.253;0.131;0.206	T	0.48736	-0.9009	8	.	.	.	-34.0435	10.5839	0.45271	0.0:0.8333:0.0:0.1667	.	663;867;871	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	K	871;867;849;871	.	.	N	+	3	2	SUPT5H	44656563	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	2.352000	0.44080	1.235000	0.43724	0.462000	0.41574	AAC	.		0.647	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
LGALS13	29124	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40095901	40095901	+	Missense_Mutation	SNP	G	G	T	rs138148689		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:40095901G>T	ENST00000221797.4	+	3	221	c.176G>T	c.(175-177)gGc>gTc	p.G59V		NM_013268.2	NP_037400.1	Q9UHV8	PP13_HUMAN	lectin, galactoside-binding, soluble, 13	59	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|phospholipid metabolic process (GO:0006644)		carbohydrate binding (GO:0030246)|lysophospholipase activity (GO:0004622)			lung(5)|ovary(1)|urinary_tract(1)	7	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)		Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			GTGCACTTTGGCAATCATGTG	0.498																																					p.G59V													.	LGALS13-91	0			c.G176T						.	G	VAL/GLY	0,4406		0,0,2203	251.0	185.0	207.0		176	0.7	0.0	19	dbSNP_134	207	2,8598		0,2,4298	yes	missense	LGALS13	NM_013268.2	109	0,2,6501	TT,TG,GG		0.0233,0.0,0.0154	probably-damaging	59/140	40095901	2,13004	2203	4300	6503	SO:0001583	missense	29124	exon3			ACTTTGGCAATCA	AF117383	CCDS33024.1	19q13.2	2014-03-19	2008-07-25		ENSG00000105198	ENSG00000105198		"""Lectins, galactoside-binding"""	15449	protein-coding gene	gene with protein product	"""galectin 13"""	608717				6856484, 10527825	Standard	NM_013268		Approved	PP13, PLAC8	uc002omb.3	Q9UHV8	OTTHUMG00000183073	ENST00000221797.4:c.176G>T	19.37:g.40095901G>T	ENSP00000221797:p.Gly59Val	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	77	14	NM_013268	0	0	0	0	0	C5HZ15	Missense_Mutation	SNP	ENST00000221797.4	37	CCDS33024.1	.	.	.	.	.	.	.	.	.	.	.	10.64	1.407134	0.25378	0.0	2.33E-4	ENSG00000105198	ENST00000221797	T	0.19532	2.14	0.744	0.744	0.18353	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.51092	0.1654	M	0.92077	3.27	0.19300	N	0.999973	D	0.89917	1.0	D	0.87578	0.998	T	0.31364	-0.9946	8	0.87932	D	0	.	.	.	.	.	59	Q9UHV8	PP13_HUMAN	V	59	ENSP00000221797:G59V	ENSP00000221797:G59V	G	+	2	0	LGALS13	44787741	0.562000	0.26586	0.027000	0.17364	0.039000	0.13416	1.393000	0.34497	0.658000	0.30925	0.305000	0.20034	GGC	G|1.000;T|0.000		0.498	LGALS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464968.1	NM_013268	
LIPE	3991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42907053	42907053	+	Silent	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:42907053G>A	ENST00000244289.4	-	9	2949	c.2673C>T	c.(2671-2673)acC>acT	p.T891T	LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000597203.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	891					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				ACATCTCGGGGGTGTCCGACG	0.612																																					p.T891T		.											.	LIPE-154	0			c.C2673T						.						92.0	73.0	79.0					19																	42907053		2203	4300	6503	SO:0001819	synonymous_variant	3991	exon9			CTCGGGGGTGTCC	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.2673C>T	19.37:g.42907053G>A		Somatic	121	1		WXS	Illumina HiSeq	Phase_I	88	21	NM_005357	0	0	2	2	0	Q3LRT2|Q6NSL7	Silent	SNP	ENST00000244289.4	37	CCDS12607.1																																																																																			.		0.612	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357	
ZNF223	7766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44570872	44570872	+	Silent	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:44570872C>T	ENST00000434772.3	+	5	1146	c.891C>T	c.(889-891)ttC>ttT	p.F297F	ZNF223_ENST00000591793.1_Silent_p.F407F	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	297					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				GTGTGAGCTTCCGTCTTAGGT	0.448																																					p.F297F		.											.	ZNF223-91	0			c.C891T						.						131.0	126.0	128.0					19																	44570872		2203	4300	6503	SO:0001819	synonymous_variant	7766	exon5			GAGCTTCCGTCTT	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.891C>T	19.37:g.44570872C>T		Somatic	148	0		WXS	Illumina HiSeq	Phase_I	107	15	NM_013361	0	0	1	5	4	Q15736|Q8TBJ3|Q9HCA9	Silent	SNP	ENST00000434772.3	37	CCDS12635.1																																																																																			.		0.448	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460469.2		
PIH1D1	55011	broad.mit.edu	37	19	49950353	49950353	+	Silent	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:49950353A>G	ENST00000262265.5	-	7	850	c.615T>C	c.(613-615)ccT>ccC	p.P205P	PIH1D1_ENST00000596049.1_Silent_p.P205P|PIH1D1_ENST00000602226.1_5'Flank	NM_017916.2	NP_060386.1	Q9NWS0	PIHD1_HUMAN	PIH1 domain containing 1	205					box C/D snoRNP assembly (GO:0000492)|epithelial cell differentiation (GO:0030855)	pre-snoRNP complex (GO:0070761)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	11		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		GAGGCTTTTCAGGCCTGAGGA	0.607																																					p.P205P													.	PIH1D1-90	0			c.T615C						.						84.0	86.0	85.0					19																	49950353		2203	4300	6503	SO:0001819	synonymous_variant	55011	exon7			CTTTTCAGGCCTG	AK000650	CCDS12765.1	19q13.33	2012-07-18	2007-01-31	2007-01-31	ENSG00000104872	ENSG00000104872			26075	protein-coding gene	gene with protein product		611480		NOP17		12477932	Standard	NM_017916		Approved	FLJ20643	uc002pns.2	Q9NWS0		ENST00000262265.5:c.615T>C	19.37:g.49950353A>G		Somatic	127	0		WXS	Illumina HiSeq	Phase_I	93	4	NM_017916	0	0	0	0	0	B4DGN7|B4E2X7|Q9BVL0	Silent	SNP	ENST00000262265.5	37	CCDS12765.1																																																																																			.		0.607	PIH1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465389.2	NM_017916	
FCGRT	2217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	50017313	50017313	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:50017313A>G	ENST00000221466.5	+	3	734	c.248A>G	c.(247-249)tAt>tGt	p.Y83C	FCGRT_ENST00000594823.1_3'UTR|FCGRT_ENST00000426395.3_Missense_Mutation_p.Y83C|FCGRT_ENST00000599988.1_Intron|FCGRT_ENST00000596975.1_Missense_Mutation_p.Y83C	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	83	Alpha-1.				antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		GTGTCCTGGTATTGGGAGAAA	0.582																																					p.Y83C		.											.	FCGRT-91	0			c.A248G						.						41.0	47.0	45.0					19																	50017313		2203	4300	6503	SO:0001583	missense	2217	exon3			CCTGGTATTGGGA	U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.248A>G	19.37:g.50017313A>G	ENSP00000221466:p.Tyr83Cys	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	49	19	NM_001136019	1	0	331	388	56	Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	ENST00000221466.5	37	CCDS12770.1	.	.	.	.	.	.	.	.	.	.	A	16.54	3.150611	0.57151	.	.	ENSG00000104870	ENST00000221466;ENST00000426395;ENST00000415900;ENST00000452439	T;T	0.01185	5.21;5.21	4.83	2.61	0.31194	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.374848	0.19651	N	0.109214	T	0.07369	0.0186	M	0.93197	3.39	0.41878	D	0.990305	D	0.89917	1.0	D	0.83275	0.996	T	0.00662	-1.1621	10	0.87932	D	0	.	3.4456	0.07480	0.6789:0.0:0.1082:0.2129	.	83	P55899	FCGRN_HUMAN	C	83	ENSP00000221466:Y83C;ENSP00000410798:Y83C	ENSP00000221466:Y83C	Y	+	2	0	FCGRT	54709125	0.976000	0.34144	0.999000	0.59377	0.876000	0.50452	2.603000	0.46266	0.868000	0.35678	0.459000	0.35465	TAT	.		0.582	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465267.1		
ZNF473	25888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	50549983	50549983	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:50549983G>C	ENST00000595661.1	+	6	2778	c.2283G>C	c.(2281-2283)caG>caC	p.Q761H	ZNF473_ENST00000601364.1_Intron|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000270617.3_Missense_Mutation_p.Q761H|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000391821.2_Missense_Mutation_p.Q761H|ZNF473_ENST00000445728.3_Missense_Mutation_p.Q749H			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	761					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		ATGTTTGTCAGGAATGCGGGA	0.522											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q761H		.											.	ZNF473-91	0			c.G2283C						.						80.0	80.0	80.0					19																	50549983		2203	4300	6503	SO:0001583	missense	25888	exon5			TTGTCAGGAATGC	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2283G>C	19.37:g.50549983G>C	ENSP00000472808:p.Gln761His	Somatic	136	0	970	WXS	Illumina HiSeq	Phase_I	111	26	NM_015428	0	0	4	6	2	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	37	CCDS33077.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.247320	0.39697	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.07800	3.16;3.16;3.16	3.84	1.72	0.24424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.611213	0.13601	N	0.375867	T	0.07007	0.0178	N	0.02916	-0.46	0.25928	N	0.983026	D	0.61080	0.989	P	0.60173	0.87	T	0.30446	-0.9978	10	0.44086	T	0.13	-0.3948	5.7557	0.18172	0.3335:0.0:0.6665:0.0	.	761	Q8WTR7	ZN473_HUMAN	H	761;761;749	ENSP00000270617:Q761H;ENSP00000375697:Q761H;ENSP00000388961:Q749H	ENSP00000270617:Q761H	Q	+	3	2	ZNF473	55241795	0.000000	0.05858	0.978000	0.43139	0.764000	0.43329	-1.663000	0.01968	0.603000	0.29913	0.650000	0.86243	CAG	.		0.522	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390	
TTYH1	57348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54937848	54937848	+	Splice_Site	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:54937848A>G	ENST00000376530.3	+	5	741		c.e5-1		TTYH1_ENST00000489425.1_Splice_Site|TTYH1_ENST00000376531.3_Splice_Site|TTYH1_ENST00000301194.4_Splice_Site|TTYH1_ENST00000391739.3_Splice_Site	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1						cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)	p.?(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		CTCCCCTCCCAGGTGGCTGGC	0.652																																					.		.											.	TTYH1-90	1	Unknown(1)	upper_aerodigestive_tract(1)	c.639-2A>G						.						96.0	79.0	85.0					19																	54937848		2203	4300	6503	SO:0001630	splice_region_variant	57348	exon5			CCTCCCAGGTGGC	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.639-1A>G	19.37:g.54937848A>G		Somatic	162	1		WXS	Illumina HiSeq	Phase_I	116	21	NM_001005367	0	0	0	0	0	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Splice_Site	SNP	ENST00000376530.3	37	CCDS12893.1	.	.	.	.	.	.	.	.	.	.	A	17.80	3.478123	0.63849	.	.	ENSG00000167614	ENST00000301194;ENST00000376530;ENST00000445095;ENST00000391739;ENST00000376531	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2014	0.54328	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TTYH1	59629660	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	4.433000	0.59929	1.836000	0.53414	0.459000	0.35465	.	.		0.652	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140498.1		Intron
KIR3DL1	3811	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	55324637	55324637	+	Intron	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:55324637C>T	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000396284.2_Missense_Mutation_p.T253I|KIR2DL4_ENST00000359085.4_Missense_Mutation_p.T255I|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000396293.1_Intron|KIR2DL4_ENST00000357494.4_Intron|KIR2DL4_ENST00000345540.5_Intron|KIR2DL4_ENST00000346587.4_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		ATCCTCTTTACCATCCTTCCC	0.502																																					p.T255I		.											.	KIR2DL4-70	0			c.C764T						.						120.0	185.0	164.0					19																	55324637		2009	4160	6169	SO:0001627	intron_variant	3805	exon6			TCTTTACCATCCT	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-4352C>T	19.37:g.55324637C>T		Somatic	57	0		WXS	Illumina HiSeq	Phase_I	63	25	NM_001080772	0	0	0	0	0	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37		.	.	.	.	.	.	.	.	.	.	c	0	-2.781565	0.00079	.	.	ENSG00000189013	ENST00000396284;ENST00000359085;ENST00000396289	T;T;T	0.00454	7.39;7.32;7.4	0.569	-1.14	0.09741	.	6.239890	0.01410	N	0.013962	T	0.00271	0.0008	N	0.25060	0.705	0.09310	N	1	B;B;B	0.16802	0.019;0.0;0.001	B;B;B	0.23852	0.049;0.002;0.016	T	0.46596	-0.9180	9	0.28530	T	0.3	.	.	.	.	.	255;253;238	Q99706;E7EST5;Q99706-2	KI2L4_HUMAN;.;.	I	253;255;253	ENSP00000379580:T253I;ENSP00000351988:T255I;ENSP00000379584:T253I	ENSP00000351988:T255I	T	+	2	0	KIR2DL4	60016449	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.795000	0.00764	-1.106000	0.03008	-1.140000	0.01884	ACC	.		0.502	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
ANAPC1	64682	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	112608404	112608404	+	Silent	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr2:112608404A>G	ENST00000341068.3	-	14	2371	c.1599T>C	c.(1597-1599)gaT>gaC	p.D533D		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	533					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						TACTAACGCCATCTAGTGGAG	0.433																																					p.D533D		.											.	ANAPC1-228	0			c.T1599C						.						99.0	96.0	97.0					2																	112608404		2203	4300	6503	SO:0001819	synonymous_variant	64682	exon14			AACGCCATCTAGT	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1599T>C	2.37:g.112608404A>G		Somatic	118	0		WXS	Illumina HiSeq	Phase_I	131	28	NM_022662	0	0	11	16	5	Q2M3H8|Q9BSE6|Q9H8D0	Silent	SNP	ENST00000341068.3	37	CCDS2093.1	.	.	.	.	.	.	.	.	.	.	A	0.541	-0.853802	0.02630	.	.	ENSG00000153107	ENST00000427997	.	.	.	4.57	0.462	0.16695	.	.	.	.	.	T	0.50633	0.1627	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33085	-0.9882	4	.	.	.	-11.202	5.0048	0.14282	0.5191:0.0:0.3355:0.1455	.	.	.	.	R	68	.	.	W	-	1	0	ANAPC1	112324875	0.014000	0.17966	0.005000	0.12908	0.123000	0.20343	-0.736000	0.04882	-0.234000	0.09782	-1.528000	0.00924	TGG	.		0.433	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2	NM_022662	
LRP1B	53353	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	141762906	141762906	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr2:141762906G>T	ENST00000389484.3	-	15	3472	c.2501C>A	c.(2500-2502)aCa>aAa	p.T834K		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	834	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAACTTACATGTGCAAGTTGT	0.413										TSP Lung(27;0.18)																											p.T834K	Colon(99;50 2074 2507 20106)												.	LRP1B-311	0			c.C2501A						.						63.0	61.0	62.0					2																	141762906		2203	4299	6502	SO:0001583	missense	53353	exon15			TTACATGTGCAAG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2501C>A	2.37:g.141762906G>T	ENSP00000374135:p.Thr834Lys	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	66	14	NM_018557	0	0	0	0	0	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	4.180	0.032042	0.08101	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.29397	1.57	5.79	0.917	0.19380	.	0.435292	0.23614	U	0.046306	T	0.12902	0.0313	N	0.11341	0.13	0.27373	N	0.955635	B	0.02656	0.0	B	0.04013	0.001	T	0.33420	-0.9869	10	0.06099	T	0.92	.	11.3061	0.49336	0.5028:0.0:0.4972:0.0	.	834	Q9NZR2	LRP1B_HUMAN	K	834;772	ENSP00000374135:T834K	ENSP00000374135:T834K	T	-	2	0	LRP1B	141479376	0.992000	0.36948	0.985000	0.45067	0.853000	0.48598	0.917000	0.28665	0.100000	0.17581	-0.140000	0.14226	ACA	.		0.413	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
FAP	2191	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	163074641	163074641	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr2:163074641A>T	ENST00000188790.4	-	9	824	c.617T>A	c.(616-618)cTt>cAt	p.L206H	FAP_ENST00000443424.1_Missense_Mutation_p.L181H	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						TTTTGTAGCAAGCATTTCCTC	0.294																																					p.L206H													.	FAP-93	0			c.T617A						.						75.0	77.0	76.0					2																	163074641		2203	4299	6502	SO:0001583	missense	2191	exon9			GTAGCAAGCATTT	U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.617T>A	2.37:g.163074641A>T	ENSP00000188790:p.Leu206His	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	97	14	NM_004460	0	0	0	0	0		Missense_Mutation	SNP	ENST00000188790.4	37	CCDS33311.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.208352	0.79240	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	T;T	0.44881	0.91;0.91	5.74	5.74	0.90152	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.059030	0.64402	D	0.000001	T	0.67353	0.2884	M	0.82323	2.585	0.52501	D	0.999954	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.979;0.986	T	0.72301	-0.4334	10	0.72032	D	0.01	-15.9727	14.9132	0.70773	1.0:0.0:0.0:0.0	.	181;206;206	B4DLR2;B2RD89;Q12884	.;.;SEPR_HUMAN	H	206;181	ENSP00000188790:L206H;ENSP00000411391:L181H	ENSP00000188790:L206H	L	-	2	0	FAP	162782887	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.571000	0.90752	2.317000	0.78254	0.460000	0.39030	CTT	.		0.294	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2		
EEF1B2	1933	broad.mit.edu	37	2	207025358	207025358	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr2:207025358A>G	ENST00000392222.2	+	2	502	c.127A>G	c.(127-129)Agc>Ggc	p.S43G	EEF1B2_ENST00000236957.5_Missense_Mutation_p.S43G|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000455934.2_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.S43G|NDUFS1_ENST00000440274.1_5'Flank|NDUFS1_ENST00000423725.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000449699.1_5'Flank|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000457011.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	43	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.S43G(4)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						AGCCGTGTCCAGCCCACCGCC	0.468																																					p.S43G													.	EEF1B2-227	4	Substitution - Missense(4)	endometrium(2)|lung(1)|kidney(1)	c.A127G						.						109.0	99.0	102.0					2																	207025358		2203	4300	6503	SO:0001583	missense	1933	exon3			GTGTCCAGCCCAC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.127A>G	2.37:g.207025358A>G	ENSP00000376056:p.Ser43Gly	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	129	4	NM_021121	2	0	1022	1026	2	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.585588	0.00872	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.47	0.911	0.19343	Glutathione S-transferase, C-terminal-like (2);	0.442134	0.26800	N	0.022437	T	0.19846	0.0477	N	0.16098	0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18745	-1.0327	10	0.17832	T	0.49	-2.1703	6.3337	0.21285	0.2348:0.0:0.6384:0.1268	.	43	P24534	EF1B_HUMAN	G	43	ENSP00000236957:S43G;ENSP00000376055:S43G;ENSP00000376056:S43G;ENSP00000407730:S43G	ENSP00000236957:S43G	S	+	1	0	EEF1B2	206733603	0.049000	0.20398	0.145000	0.22337	0.051000	0.14879	0.879000	0.28146	-0.027000	0.13873	-0.252000	0.11476	AGC	.		0.468	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
TNS1	7145	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	218678433	218678433	+	Silent	SNP	T	T	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr2:218678433T>A	ENST00000171887.4	-	26	4976	c.4524A>T	c.(4522-4524)ccA>ccT	p.P1508P	TNS1_ENST00000430930.1_Silent_p.P1487P|TNS1_ENST00000419504.1_Silent_p.P1495P	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1508	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GCATGATGGTTGGAGGTGGCG	0.582																																					p.P1508P													.	TNS1-156	0			c.A4524T						.						135.0	133.0	134.0					2																	218678433		2203	4300	6503	SO:0001819	synonymous_variant	7145	exon26			GATGGTTGGAGGT	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.4524A>T	2.37:g.218678433T>A		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	92	10	NM_022648	0	0	83	112	29	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	37	CCDS2407.1																																																																																			.		0.582	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
FAM134A	79137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220047044	220047044	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr2:220047044T>C	ENST00000430297.2	+	9	1461	c.1325T>C	c.(1324-1326)cTc>cCc	p.L442P		NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	442						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGTGGTGGCCTCACTGCTCTG	0.622																																					p.L442P		.											.	FAM134A-91	0			c.T1325C						.						99.0	104.0	102.0					2																	220047044		2203	4300	6503	SO:0001583	missense	79137	exon9			GTGGCCTCACTGC	AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.1325T>C	2.37:g.220047044T>C	ENSP00000395249:p.Leu442Pro	Somatic	251	1		WXS	Illumina HiSeq	Phase_I	183	40	NM_024293	0	0	138	199	61	Q6P1P5|Q9H0K7	Missense_Mutation	SNP	ENST00000430297.2	37	CCDS2434.1	.	.	.	.	.	.	.	.	.	.	T	8.099	0.776228	0.16051	.	.	ENSG00000144567	ENST00000430297	T	0.36520	1.25	5.26	4.06	0.47325	.	0.184716	0.38058	N	0.001826	T	0.30978	0.0782	L	0.57536	1.79	0.58432	D	0.999997	B	0.11235	0.004	B	0.06405	0.002	T	0.08617	-1.0713	9	.	.	.	-2.2718	7.7924	0.29127	0.0:0.1733:0.0:0.8267	.	442	Q8NC44	F134A_HUMAN	P	442	ENSP00000395249:L442P	.	L	+	2	0	FAM134A	219755288	1.000000	0.71417	0.720000	0.30636	0.138000	0.21146	4.189000	0.58358	0.960000	0.38005	0.533000	0.62120	CTC	.		0.622	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336147.2	NM_024293	
GMPPA	29926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220370077	220370077	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr2:220370077T>C	ENST00000358215.3	+	8	1117	c.748T>C	c.(748-750)Tcc>Ccc	p.S250P	GMPPA_ENST00000341142.3_Missense_Mutation_p.S250P|GMPPA_ENST00000373917.3_Missense_Mutation_p.S250P|GMPPA_ENST00000313597.5_Missense_Mutation_p.S250P|GMPPA_ENST00000373908.1_Missense_Mutation_p.S250P|AC053503.11_ENST00000429882.1_RNA	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	250					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		TCAGATCAAGTCCGCAGGGTA	0.607																																					p.S250P		.											.	GMPPA-90	0			c.T748C						.						64.0	65.0	65.0					2																	220370077		2203	4300	6503	SO:0001583	missense	29926	exon8			ATCAAGTCCGCAG	AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.748T>C	2.37:g.220370077T>C	ENSP00000350949:p.Ser250Pro	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	120	22	NM_205847	0	0	1	1	0	A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	ENST00000358215.3	37	CCDS2441.1	.	.	.	.	.	.	.	.	.	.	t	25.4	4.632235	0.87660	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000435316;ENST00000341142	D;D;D;D;T;D	0.94650	-3.48;-3.48;-3.48;-3.48;1.84;-3.48	4.9	4.9	0.64082	.	0.271361	0.37530	N	0.002048	D	0.96592	0.8888	M	0.73962	2.25	0.80722	D	1	D;D	0.71674	0.998;0.97	D;P	0.66847	0.947;0.737	D	0.96980	0.9714	10	0.66056	D	0.02	-23.7265	14.211	0.65764	0.0:0.0:0.0:1.0	.	250;250	Q96IJ6-2;Q96IJ6	.;GMPPA_HUMAN	P	250;250;250;250;215;250	ENSP00000315925:S250P;ENSP00000363027:S250P;ENSP00000350949:S250P;ENSP00000363016:S250P;ENSP00000411060:S215P;ENSP00000340760:S250P	ENSP00000315925:S250P	S	+	1	0	GMPPA	220078321	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	7.745000	0.85046	1.828000	0.53243	0.529000	0.55759	TCC	.		0.607	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130230.1	NM_013335	
STAU1	6780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47741019	47741019	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr20:47741019T>A	ENST00000371856.2	-	7	1125	c.715A>T	c.(715-717)Aaa>Taa	p.K239*	STAU1_ENST00000371802.1_Nonsense_Mutation_p.K164*|STAU1_ENST00000371792.1_Nonsense_Mutation_p.K158*|STAU1_ENST00000360426.4_Nonsense_Mutation_p.K158*|STAU1_ENST00000347458.5_Nonsense_Mutation_p.K158*|STAU1_ENST00000371828.3_Nonsense_Mutation_p.K164*|STAU1_ENST00000340954.7_Nonsense_Mutation_p.K158*	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	239	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			GCGGCATTTTTCTTTGAAATC	0.483																																					p.K239X		.											.	STAU1-230	0			c.A715T						.						150.0	167.0	161.0					20																	47741019		2203	4300	6503	SO:0001587	stop_gained	6780	exon7			CATTTTTCTTTGA		CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.715A>T	20.37:g.47741019T>A	ENSP00000360922:p.Lys239*	Somatic	248	0		WXS	Illumina HiSeq	Phase_I	268	78	NM_017453	0	0	67	71	4	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Nonsense_Mutation	SNP	ENST00000371856.2	37	CCDS13414.1	.	.	.	.	.	.	.	.	.	.	T	39	7.406203	0.98265	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792;ENST00000437404	.	.	.	5.33	5.33	0.75918	.	0.087311	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.3231	15.3236	0.74141	0.0:0.0:0.0:1.0	.	.	.	.	X	164;158;239;158;158;158;164;158;164	.	ENSP00000345425:K158X	K	-	1	0	STAU1	47174426	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	8.036000	0.88901	2.017000	0.59298	0.528000	0.53228	AAA	.		0.483	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079633.1	NM_017453	
SMDT1	91689	ucsc.edu	37	22	42475836	42475836	+	Missense_Mutation	SNP	G	G	A	rs369810620		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr22:42475836G>A	ENST00000331479.3	+	1	138	c.64G>A	c.(64-66)Ggg>Agg	p.G22R		NM_033318.4	NP_201575.3	Q9H4I9	EMRE_HUMAN	single-pass membrane protein with aspartate-rich tail 1	22					calcium ion transmembrane import into mitochondrion (GO:0036444)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)	integral component of mitochondrial inner membrane (GO:0031305)|uniplex complex (GO:1990246)											TCTCCGGAGCGGGCCTAGCTT	0.706																																					p.G22R													.	.	0			c.G64A						.	G	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	44.0	47.0	46.0		64	0.4	0.0	22		46	0,8600		0,0,4300	no	missense	C22orf32	NM_033318.4	125	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	22/108	42475836	1,13005	2203	4300	6503	SO:0001583	missense	0	exon1			CGGAGCGGGCCTA	BC024237	CCDS14031.1	22q13.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000183172	ENSG00000183172			25055	protein-coding gene	gene with protein product		615588	"""chromosome 22 open reading frame 32"""	C22orf32		12477932	Standard	NM_033318		Approved	dJ186O1.1, DDDD	uc003bca.3	Q9H4I9	OTTHUMG00000151286	ENST00000331479.3:c.64G>A	22.37:g.42475836G>A	ENSP00000327467:p.Gly22Arg	Somatic	102	0		WXS	Illumina HiSeq		74	4	NM_033318	0	0	91	103	12	B2R5D1|Q8TAB9	Missense_Mutation	SNP	ENST00000331479.3	37	CCDS14031.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.904611	0.52333	2.27E-4	0.0	ENSG00000183172	ENST00000331479	T	0.53423	0.62	6.17	0.409	0.16382	.	0.716188	0.14806	N	0.297349	T	0.35770	0.0943	M	0.64997	1.995	0.09310	N	1	B	0.16802	0.019	B	0.09377	0.004	T	0.24012	-1.0172	10	0.26408	T	0.33	-0.8714	2.2371	0.04011	0.146:0.132:0.4489:0.273	.	22	Q9H4I9	CV032_HUMAN	R	22	ENSP00000327467:G22R	ENSP00000327467:G22R	G	+	1	0	C22orf32	40805782	0.032000	0.19561	0.001000	0.08648	0.049000	0.14656	1.145000	0.31577	-0.039000	0.13602	0.655000	0.94253	GGG	.		0.706	SMDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322086.1	NM_033318	
CAMK1	8536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9801228	9801228	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:9801228T>C	ENST00000256460.3	-	10	1033	c.856A>G	c.(856-858)Atc>Gtc	p.I286V	OGG1_ENST00000383826.5_Intron|OGG1_ENST00000449570.2_Intron|OGG1_ENST00000302008.8_Intron|OGG1_ENST00000349503.5_Intron|OGG1_ENST00000302036.7_Intron	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	286	Autoinhibitory domain.				cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		GACTGGTGGATATTCTTATCT	0.537																																					p.I286V		.											.	CAMK1-335	0			c.A856G						.						179.0	171.0	174.0					3																	9801228		2203	4300	6503	SO:0001583	missense	8536	exon10			GGTGGATATTCTT	L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.856A>G	3.37:g.9801228T>C	ENSP00000256460:p.Ile286Val	Somatic	250	0		WXS	Illumina HiSeq	Phase_I	204	42	NM_003656	0	0	57	78	21	Q3KPF6	Missense_Mutation	SNP	ENST00000256460.3	37	CCDS2582.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.4|23.4	4.415377|4.415377	0.83449|0.83449	.|.	.|.	ENSG00000134072|ENSG00000134072	ENST00000256460|ENST00000421120	T|.	0.39056|.	1.1|.	5.95|5.95	5.95|5.95	0.96441|0.96441	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80407|0.80407	0.4617|0.4617	M|M	0.87038|0.87038	2.855|2.855	0.80722|0.80722	D|D	1|1	P;P|.	0.48162|.	0.906;0.906|.	P;P|.	0.45099|.	0.469;0.469|.	T|T	0.83025|0.83025	-0.0165|-0.0165	10|5	0.59425|.	D|.	0.04|.	-11.1309|-11.1309	16.0971|16.0971	0.81132|0.81132	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	286;286|.	Q14012;B0YIY3|.	KCC1A_HUMAN;.|.	V|C	286|132	ENSP00000256460:I286V|.	ENSP00000256460:I286V|.	I|Y	-|-	1|2	0|0	CAMK1|CAMK1	9776228|9776228	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.589000|7.589000	0.82641|0.82641	2.279000|2.279000	0.76181|0.76181	0.533000|0.533000	0.62120|0.62120	ATC|TAT	.		0.537	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1	NM_003656	
GPD1L	23171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	32169609	32169609	+	Missense_Mutation	SNP	A	A	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:32169609A>C	ENST00000282541.5	+	2	290	c.89A>C	c.(88-90)aAa>aCa	p.K30T		NM_015141.3	NP_055956.1	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like	30					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophospholipid biosynthetic process (GO:0046474)|NAD metabolic process (GO:0019674)|NADH metabolic process (GO:0006734)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase C signaling (GO:0090038)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|ventricular cardiac muscle cell action potential (GO:0086005)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|plasma membrane (GO:0005886)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|ion channel binding (GO:0044325)|NAD binding (GO:0051287)|sodium channel regulator activity (GO:0017080)			large_intestine(4)|lung(7)|ovary(1)	12						AATGTCAAGAAACTTCAGAAA	0.368																																					p.K30T		.											.	GPD1L-90	0			c.A89C						.						59.0	59.0	59.0					3																	32169609		2203	4300	6503	SO:0001583	missense	23171	exon2			TCAAGAAACTTCA	D42047	CCDS33729.1	3p22.3	2014-09-17			ENSG00000152642	ENSG00000152642			28956	protein-coding gene	gene with protein product		611778				7788527	Standard	NM_015141		Approved	KIAA0089	uc003cew.3	Q8N335	OTTHUMG00000155846	ENST00000282541.5:c.89A>C	3.37:g.32169609A>C	ENSP00000282541:p.Lys30Thr	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	49	9	NM_015141	0	0	3	7	4	A8K9U3|Q14702|Q9BRM5	Missense_Mutation	SNP	ENST00000282541.5	37	CCDS33729.1	.	.	.	.	.	.	.	.	.	.	A	12.00	1.807729	0.31961	.	.	ENSG00000152642	ENST00000282541;ENST00000425459	T;T	0.58652	0.32;1.2	4.8	3.62	0.41486	Glycerol-3-phosphate dehydrogenase, NAD-dependent, N-terminal (1);NAD(P)-binding domain (1);	0.435694	0.28257	N	0.016007	T	0.52917	0.1764	M	0.70595	2.14	0.29089	N	0.882201	B	0.06786	0.001	B	0.20184	0.028	T	0.52697	-0.8541	10	0.46703	T	0.11	-9.553	6.5277	0.22310	0.6226:0.3005:0.0769:0.0	.	30	Q8N335	GPD1L_HUMAN	T	30	ENSP00000282541:K30T;ENSP00000408770:K30T	ENSP00000282541:K30T	K	+	2	0	GPD1L	32144613	0.036000	0.19791	0.834000	0.33040	0.984000	0.73092	2.830000	0.48136	0.938000	0.37419	0.459000	0.35465	AAA	.		0.368	GPD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341975.2	NM_015141	
NXPE3	91775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	101540473	101540473	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:101540473C>G	ENST00000491511.2	+	8	2311	c.1355C>G	c.(1354-1356)cCt>cGt	p.P452R	NXPE3_ENST00000273347.5_Missense_Mutation_p.P452R|NXPE3_ENST00000477909.1_Missense_Mutation_p.P452R|RP11-49I4.3_ENST00000490324.2_RNA|NXPE3_ENST00000422132.1_Missense_Mutation_p.P452R	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	452						extracellular region (GO:0005576)											AGCACCTTCCCTTTGGAAGTG	0.552																																					p.P452R		.											.	.	0			c.C1355G						.						113.0	99.0	104.0					3																	101540473		2203	4300	6503	SO:0001583	missense	91775	exon8			CCTTCCCTTTGGA	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.1355C>G	3.37:g.101540473C>G	ENSP00000417485:p.Pro452Arg	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	64	11	NM_145037	0	0	20	28	8	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	C	31	5.070163	0.93950	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	6.03	6.03	0.97812	.	0.044822	0.85682	D	0.000000	T	0.67325	0.2881	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73017	-0.4115	10	0.87932	D	0	-17.0676	20.5568	0.99304	0.0:1.0:0.0:0.0	.	452	Q969Y0	FA55C_HUMAN	R	452	ENSP00000273347:P452R;ENSP00000417485:P452R;ENSP00000418369:P452R;ENSP00000396421:P452R	ENSP00000273347:P452R	P	+	2	0	FAM55C	103023163	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.747000	0.85070	2.861000	0.98227	0.655000	0.94253	CCT	.		0.552	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	
POLQ	10721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121260288	121260288	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:121260288G>A	ENST00000264233.5	-	3	510	c.382C>T	c.(382-384)Ctt>Ttt	p.L128F		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	128	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TTCAAAATAAGTAATTCTGCC	0.348								DNA polymerases (catalytic subunits)																													p.L128F	Pancreas(152;907 1925 26081 31236 36904)	.											.	POLQ-664	0			c.C382T						.						145.0	164.0	157.0					3																	121260288		2203	4300	6503	SO:0001583	missense	10721	exon3			AAATAAGTAATTC	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.382C>T	3.37:g.121260288G>A	ENSP00000264233:p.Leu128Phe	Somatic	380	0		WXS	Illumina HiSeq	Phase_I	448	78	NM_199420	0	0	0	0	0	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569858	0.86542	.	.	ENSG00000051341	ENST00000264233;ENST00000393672	T	0.60672	0.17	5.74	5.74	0.90152	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.275715	0.37261	N	0.002169	T	0.79787	0.4506	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81741	-0.0794	10	0.87932	D	0	.	19.9346	0.97133	0.0:0.0:1.0:0.0	.	128	O75417	DPOLQ_HUMAN	F	128;263	ENSP00000264233:L128F	ENSP00000264233:L128F	L	-	1	0	POLQ	122742978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.652000	0.54439	2.712000	0.92718	0.563000	0.77884	CTT	.		0.348	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
DNAJC13	23317	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	132207161	132207161	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:132207161C>A	ENST00000260818.6	+	30	3535	c.3287C>A	c.(3286-3288)cCt>cAt	p.P1096H		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1096					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						ACCTTTGACCCTATCCTTGTT	0.348																																					p.P1096H													.	DNAJC13-272	0			c.C3287A						.						89.0	82.0	84.0					3																	132207161		2203	4300	6503	SO:0001583	missense	23317	exon30			TTGACCCTATCCT	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.3287C>A	3.37:g.132207161C>A	ENSP00000260818:p.Pro1096His	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	69	14	NM_015268	0	0	14	23	9	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910247	0.92107	.	.	ENSG00000138246	ENST00000260818	T	0.53206	0.63	5.75	5.75	0.90469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76528	0.4000	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80723	-0.1255	10	0.87932	D	0	.	19.9542	0.97213	0.0:1.0:0.0:0.0	.	1096	O75165	DJC13_HUMAN	H	1096	ENSP00000260818:P1096H	ENSP00000260818:P1096H	P	+	2	0	DNAJC13	133689851	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.435000	0.80391	2.728000	0.93425	0.650000	0.86243	CCT	.		0.348	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	142284995	142284995	+	Missense_Mutation	SNP	C	C	T	rs200407265		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:142284995C>T	ENST00000350721.4	-	3	381	c.260G>A	c.(259-261)aGt>aAt	p.S87N	ATR_ENST00000383101.3_Missense_Mutation_p.S87N	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	87					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ATGGCTTCCACTCACATTTAC	0.413								Other conserved DNA damage response genes																													p.S87N		.											.	ATR-1139	0			c.G260A						.						107.0	101.0	103.0					3																	142284995		2203	4300	6503	SO:0001583	missense	545	exon3			CTTCCACTCACAT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.260G>A	3.37:g.142284995C>T	ENSP00000343741:p.Ser87Asn	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	111	23	NM_001184	0	0	4	10	6	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	2.407	-0.336336	0.05278	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.30448	1.53;1.53	5.53	0.0727	0.14388	.	1.113090	0.06757	N	0.781079	T	0.07548	0.0190	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36553	-0.9743	10	0.02654	T	1	-9.1875	2.5644	0.04779	0.1129:0.2236:0.1159:0.5476	.	87	Q13535	ATR_HUMAN	N	87	ENSP00000343741:S87N;ENSP00000372581:S87N	ENSP00000343741:S87N	S	-	2	0	ATR	143767685	0.931000	0.31567	1.000000	0.80357	0.976000	0.68499	0.080000	0.14802	0.369000	0.24510	-0.414000	0.06135	AGT	C|0.999;A|0.000		0.413	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
WDR1	9948	ucsc.edu	37	4	10090323	10090323	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:10090323C>A	ENST00000499869.2	-	6	794	c.601G>T	c.(601-603)Ggg>Tgg	p.G201W	WDR1_ENST00000382451.2_Missense_Mutation_p.G61W|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000502702.1_Missense_Mutation_p.G61W|WDR1_ENST00000382452.2_Missense_Mutation_p.G201W			O75083	WDR1_HUMAN	WD repeat domain 1	201					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		AATCTGTTCCCATCAGGAGAG	0.562																																					p.G201W													.	WDR1-48	0			c.G601T						.						41.0	45.0	44.0					4																	10090323		2016	4178	6194	SO:0001583	missense	9948	exon6			TGTTCCCATCAGG	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.601G>T	4.37:g.10090323C>A	ENSP00000427687:p.Gly201Trp	Somatic	21	0		WXS	Illumina HiSeq		23	2	NM_017491	0	0	207	273	66	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Missense_Mutation	SNP	ENST00000499869.2	37	CCDS54740.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.600557	0.87055	.	.	ENSG00000071127	ENST00000499869;ENST00000382452;ENST00000382451;ENST00000443592;ENST00000502702;ENST00000439733;ENST00000508079	T;T;T;T;T	0.63913	1.05;1.05;0.33;0.33;-0.07	5.44	5.44	0.79542	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87505	0.6194	H	0.98199	4.17	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.92074	0.5667	10	0.87932	D	0	-27.7323	18.2591	0.90028	0.0:1.0:0.0:0.0	.	36;61;201	B4DY05;O75083-3;O75083	.;.;WDR1_HUMAN	W	201;201;61;60;61;36;205	ENSP00000427687:G201W;ENSP00000371890:G201W;ENSP00000371889:G61W;ENSP00000426725:G61W;ENSP00000425481:G205W	ENSP00000371889:G61W	G	-	1	0	WDR1	9699421	1.000000	0.71417	0.964000	0.40570	0.717000	0.41224	7.186000	0.77722	2.554000	0.86153	0.467000	0.42956	GGG	.		0.562	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1		
BOD1L1	259282	broad.mit.edu	37	4	13603393	13603393	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:13603393G>T	ENST00000040738.5	-	10	5266	c.5131C>A	c.(5131-5133)Cag>Aag	p.Q1711K		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1711						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q1711K(1)									ATATTTCCCTGGGAGCCATCC	0.428																																					p.Q1711K													.	.	1	Substitution - Missense(1)	lung(1)	c.C5131A						.						172.0	177.0	175.0					4																	13603393		2203	4300	6503	SO:0001583	missense	259282	exon10			TTCCCTGGGAGCC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.5131C>A	4.37:g.13603393G>T	ENSP00000040738:p.Gln1711Lys	Somatic	277	0		WXS	Illumina HiSeq	Phase_I	309	10	NM_148894	0	0	14	14	0	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	G	11.11	1.541422	0.27563	.	.	ENSG00000038219	ENST00000040738	T	0.09073	3.02	4.59	4.59	0.56863	.	0.124466	0.36555	N	0.002526	T	0.07728	0.0194	L	0.34521	1.04	0.09310	N	1	B	0.19583	0.037	B	0.19391	0.025	T	0.21861	-1.0233	10	0.36615	T	0.2	-3.04	12.0992	0.53774	0.0:0.0:0.8166:0.1834	.	1711	Q8NFC6	BOD1L_HUMAN	K	1711	ENSP00000040738:Q1711K	ENSP00000040738:Q1711K	Q	-	1	0	BOD1L	13212491	1.000000	0.71417	0.144000	0.22314	0.658000	0.38924	4.107000	0.57811	2.247000	0.74100	0.555000	0.69702	CAG	.		0.428	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
N4BP2	55728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	40122682	40122682	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:40122682C>G	ENST00000261435.6	+	9	3367	c.2951C>G	c.(2950-2952)cCa>cGa	p.P984R		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	984					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AATAGTGCACCAACTGTTTCT	0.443																																					p.P984R		.											.	N4BP2-602	0			c.C2951G						.						84.0	80.0	82.0					4																	40122682		2203	4300	6503	SO:0001583	missense	55728	exon9			GTGCACCAACTGT	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2951C>G	4.37:g.40122682C>G	ENSP00000261435:p.Pro984Arg	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	58	9	NM_018177	0	0	0	0	0	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	C	3.483	-0.105433	0.06967	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.21543	2.0	5.1	4.25	0.50352	.	0.600314	0.17354	N	0.177287	T	0.22898	0.0553	L	0.54323	1.7	0.09310	N	1	D;P	0.53151	0.958;0.93	P;B	0.45506	0.483;0.289	T	0.11421	-1.0588	10	0.48119	T	0.1	0.0045	8.0754	0.30714	0.0:0.8201:0.0:0.1799	.	984;984	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	R	984;904	ENSP00000261435:P984R	ENSP00000261435:P984R	P	+	2	0	N4BP2	39799077	0.020000	0.18652	0.005000	0.12908	0.002000	0.02628	2.644000	0.46613	1.513000	0.48852	0.655000	0.94253	CCA	.		0.443	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
SCD5	79966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	83557889	83557889	+	Silent	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:83557889G>C	ENST00000319540.4	-	4	976	c.657C>G	c.(655-657)tcC>tcG	p.S219S		NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	219					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				CCAAGAAGTAGGAATTCCACA	0.537																																					p.S219S		.											.	SCD5-91	0			c.C657G						.						108.0	95.0	100.0					4																	83557889		2203	4300	6503	SO:0001819	synonymous_variant	79966	exon4			GAAGTAGGAATTC	AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.657C>G	4.37:g.83557889G>C		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	45	9	NM_001037582	0	0	7	13	6	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Silent	SNP	ENST00000319540.4	37	CCDS34024.1																																																																																			.		0.537	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252635.1	NM_024906	
DMP1	1758	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	88584223	88584223	+	Silent	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:88584223G>A	ENST00000339673.6	+	6	1392	c.1293G>A	c.(1291-1293)gaG>gaA	p.E431E	RP11-742B18.1_ENST00000507894.1_RNA|RP11-742B18.1_ENST00000506480.1_RNA|DMP1_ENST00000282479.7_Silent_p.E415E|RP11-742B18.1_ENST00000506814.1_RNA	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	431					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		CCAGCCAGGAGGGCCTCCAGT	0.552																																					p.E431E													.	DMP1-132	0			c.G1293A						.						54.0	55.0	55.0					4																	88584223		2203	4300	6503	SO:0001819	synonymous_variant	1758	exon6			CCAGGAGGGCCTC	U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.1293G>A	4.37:g.88584223G>A		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	50	11	NM_004407	0	0	0	0	0	A1L4L3|O43265	Silent	SNP	ENST00000339673.6	37	CCDS3623.1																																																																																			.		0.552	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1		
ABCG2	9429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	89034494	89034494	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:89034494G>C	ENST00000237612.3	-	9	1700	c.1155C>G	c.(1153-1155)ttC>ttG	p.F385L	ABCG2_ENST00000515655.1_Missense_Mutation_p.F385L	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	385					cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	GCAAGTTTTTGAATGAACGCT	0.448																																					p.F385L		.											.	ABCG2-90	0			c.C1155G						.						128.0	129.0	128.0					4																	89034494		2203	4300	6503	SO:0001583	missense	9429	exon9			GTTTTTGAATGAA	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.1155C>G	4.37:g.89034494G>C	ENSP00000237612:p.Phe385Leu	Somatic	211	1		WXS	Illumina HiSeq	Phase_I	187	33	NM_004827	0	0	3	3	0	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	ENST00000237612.3	37	CCDS3628.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854425	0.32791	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	T;T	0.71817	-0.6;-0.6	5.67	3.91	0.45181	ABC-2 type transporter (1);	0.044132	0.85682	D	0.000000	T	0.63604	0.2525	L	0.47716	1.5	0.41151	D	0.986026	B;B;B	0.24721	0.02;0.11;0.055	B;B;B	0.34873	0.03;0.191;0.05	T	0.59177	-0.7503	10	0.31617	T	0.26	-34.9217	7.6017	0.28079	0.3144:0.0:0.6856:0.0	.	385;385;385	Q9UNQ0-2;Q9UNQ0;Q4W5I3	.;ABCG2_HUMAN;.	L	385	ENSP00000426917:F385L;ENSP00000237612:F385L	ENSP00000237612:F385L	F	-	3	2	ABCG2	89253518	0.998000	0.40836	1.000000	0.80357	0.730000	0.41778	0.469000	0.22067	1.361000	0.45981	0.557000	0.71058	TTC	.		0.448	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827	
KIAA0922	23240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	154557454	154557454	+	Splice_Site	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:154557454C>T	ENST00000409663.3	+	35	4608	c.4556C>T	c.(4555-4557)cCc>cTc	p.P1519L	KIAA0922_ENST00000409959.3_Splice_Site_p.P1520L|KIAA0922_ENST00000440693.1_Splice_Site_p.P1436L	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1519						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				ATACTTCAGCCCTACCTCACA	0.413																																					p.P1520L		.											.	KIAA0922-92	0			c.C4559T						.						76.0	85.0	82.0					4																	154557454		2203	4300	6503	SO:0001630	splice_region_variant	23240	exon35			TTCAGCCCTACCT	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.4555-1C>T	4.37:g.154557454C>T		Somatic	230	0		WXS	Illumina HiSeq	Phase_I	208	24	NM_001131007	0	0	0	0	0	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	37	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298160	0.81025	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.31510	1.76;1.49;1.75;1.51	5.93	5.07	0.68467	.	0.056199	0.64402	D	0.000001	T	0.50034	0.1592	L	0.52573	1.65	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.995	D;D;P	0.68621	0.959;0.934;0.86	T	0.53129	-0.8482	10	0.87932	D	0	-12.4672	16.3753	0.83383	0.133:0.867:0.0:0.0	.	1436;1520;1519	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	L	1519;1436;1520;1297	ENSP00000386574:P1519L;ENSP00000409663:P1436L;ENSP00000386787:P1520L;ENSP00000240487:P1297L	ENSP00000240487:P1297L	P	+	2	0	KIAA0922	154776904	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.205000	0.77881	1.466000	0.48025	0.655000	0.94253	CCC	.		0.413	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	Missense_Mutation
FNIP2	57600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	159756556	159756556	+	Splice_Site	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:159756556G>A	ENST00000264433.6	+	7	730		c.e7-1		FNIP2_ENST00000379346.3_Splice_Site	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2						intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CTTTATCTTAGCACACAGCAC	0.383																																					.		.											.	FNIP2-68	0			c.656-1G>A						.						258.0	258.0	258.0					4																	159756556		1966	4155	6121	SO:0001630	splice_region_variant	57600	exon7			ATCTTAGCACACA	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.656-1G>A	4.37:g.159756556G>A		Somatic	305	0		WXS	Illumina HiSeq	Phase_I	298	56	NM_020840	0	0	0	0	0	Q05DC3|Q96I31|Q9H994	Splice_Site	SNP	ENST00000264433.6	37	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225241	0.79576	.	.	ENSG00000052795	ENST00000264433;ENST00000512986;ENST00000379346;ENST00000504715	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2857	0.98533	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FNIP2	159976006	1.000000	0.71417	0.995000	0.50966	0.794000	0.44872	9.224000	0.95209	2.803000	0.96430	0.650000	0.86243	.	.		0.383	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	Intron
LIFR	3977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	38489203	38489203	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr5:38489203G>A	ENST00000263409.4	-	16	2474	c.2312C>T	c.(2311-2313)tCt>tTt	p.S771F	LIFR_ENST00000503088.1_5'Flank|LIFR_ENST00000453190.2_Missense_Mutation_p.S771F	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	771	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					CCTCATCTTAGATGTGTCTCT	0.343			T	PLAG1	salivary adenoma																																p.S771F	Melanoma(13;4 730 6426 9861 34751)	.		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	LIFR-1173	0			c.C2312T						.						80.0	84.0	83.0					5																	38489203		2203	4300	6503	SO:0001583	missense	3977	exon16			ATCTTAGATGTGT	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2312C>T	5.37:g.38489203G>A	ENSP00000263409:p.Ser771Phe	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	109	26	NM_002310	0	0	1	4	3	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.037720	0.35989	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.53423	0.62;0.62	5.78	4.92	0.64577	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.715180	0.14869	N	0.293661	T	0.46367	0.1389	M	0.76838	2.35	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.46624	-0.9178	10	0.09084	T	0.74	-6.9518	11.4001	0.49864	0.1549:0.0:0.8451:0.0	.	771	P42702	LIFR_HUMAN	F	771	ENSP00000263409:S771F;ENSP00000398368:S771F	ENSP00000263409:S771F	S	-	2	0	LIFR	38524960	0.985000	0.35326	0.823000	0.32752	0.952000	0.60782	2.593000	0.46180	1.456000	0.47831	0.650000	0.86243	TCT	.		0.343	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
BDP1	55814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	70837317	70837317	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr5:70837317A>T	ENST00000358731.4	+	29	6322	c.6059A>T	c.(6058-6060)gAt>gTt	p.D2020V	BDP1_ENST00000380675.2_Missense_Mutation_p.D156V	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2020					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		CATTCAAAGGATAAAAGCCAT	0.303																																					p.D2020V		.											.	BDP1-92	0			c.A6059T						.						112.0	103.0	106.0					5																	70837317		1822	4082	5904	SO:0001583	missense	55814	exon29			CAAAGGATAAAAG	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.6059A>T	5.37:g.70837317A>T	ENSP00000351575:p.Asp2020Val	Somatic	179	1		WXS	Illumina HiSeq	Phase_I	184	33	NM_018429	0	0	4	7	3	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	A	14.87	2.664806	0.47572	.	.	ENSG00000145734	ENST00000358731;ENST00000451951;ENST00000380675;ENST00000545546	T;T	0.18960	2.18;2.18	5.3	1.47	0.22746	.	0.842883	0.10728	N	0.640927	T	0.38585	0.1046	M	0.62723	1.935	0.18873	N	0.999982	D;D	0.71674	0.964;0.998	P;D	0.69142	0.7;0.962	T	0.12889	-1.0530	10	0.87932	D	0	.	7.508	0.27555	0.7287:0.0:0.2713:0.0	.	2020;2020	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	V	2020;1568;156;156	ENSP00000351575:D2020V;ENSP00000370050:D156V	ENSP00000351575:D2020V	D	+	2	0	BDP1	70873073	0.736000	0.28164	0.333000	0.25482	0.856000	0.48823	2.703000	0.47110	0.394000	0.25230	0.377000	0.23210	GAT	.		0.303	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
PCDHB6	56130	ucsc.edu	37	5	140531445	140531445	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr5:140531445C>T	ENST00000231136.1	+	1	1607	c.1607C>T	c.(1606-1608)tCc>tTc	p.S536F	PCDHB6_ENST00000543635.1_Missense_Mutation_p.S400F	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	536	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACCGCGGCTCCCCGGCGTTG	0.672																																					p.S536F													.	PCDHB6-91	0			c.C1607T						.						54.0	61.0	59.0					5																	140531445		2203	4300	6503	SO:0001583	missense	56130	exon1			GCGGCTCCCCGGC	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1607C>T	5.37:g.140531445C>T	ENSP00000231136:p.Ser536Phe	Somatic	167	6		WXS	Illumina HiSeq		113	3	NM_018939	0	0	14	23	9	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.419887	0.25552	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	T;T	0.01838	4.61;4.61	4.07	3.18	0.36537	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.04679	0.0127	L	0.59912	1.85	0.09310	N	1	B	0.30664	0.289	B	0.40477	0.33	T	0.25641	-1.0126	9	0.59425	D	0.04	.	7.5727	0.27918	0.1652:0.7455:0.0:0.0893	.	536	Q9Y5E3	PCDB6_HUMAN	F	400;536;321	ENSP00000438466:S400F;ENSP00000231136:S536F	ENSP00000231136:S536F	S	+	2	0	PCDHB6	140511629	0.000000	0.05858	0.082000	0.20525	0.800000	0.45204	0.373000	0.20484	1.986000	0.57962	0.556000	0.70494	TCC	.		0.672	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHGC4	56098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140864817	140864817	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr5:140864817A>G	ENST00000306593.1	+	1	77	c.77A>G	c.(76-78)tAc>tGc	p.Y26C	PCDHGB6_ENST00000520790.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	26					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCTGGGTTACGTTTGTGGG	0.542																																					p.Y26C		.											.	PCDHGC4-72	0			c.A77G						.						61.0	64.0	63.0					5																	140864817		2203	4300	6503	SO:0001583	missense	56098	exon1			TGGGTTACGTTTG	AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.77A>G	5.37:g.140864817A>G	ENSP00000306918:p.Tyr26Cys	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	86	15	NM_018928	0	0	0	0	0	Q495T2|Q9Y5C3	Missense_Mutation	SNP	ENST00000306593.1	37	CCDS4262.1	.	.	.	.	.	.	.	.	.	.	A	8.646	0.897050	0.17686	.	.	ENSG00000242419	ENST00000306593	T	0.46819	0.86	4.81	4.81	0.61882	.	.	.	.	.	T	0.26557	0.0649	N	0.08118	0	0.09310	N	1	B;B	0.16396	0.017;0.001	B;B	0.16722	0.016;0.004	T	0.07888	-1.0749	9	0.38643	T	0.18	.	6.6967	0.23203	0.6868:0.231:0.0822:0.0	.	26;26	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	C	26	ENSP00000306918:Y26C	ENSP00000306918:Y26C	Y	+	2	0	PCDHGC4	140845001	0.831000	0.29352	0.975000	0.42487	0.979000	0.70002	2.204000	0.42761	2.012000	0.59069	0.459000	0.35465	TAC	.		0.542	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928	
OR2J3	442186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	29079815	29079815	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr6:29079815A>G	ENST00000377169.1	+	1	148	c.148A>G	c.(148-150)Atc>Gtc	p.I50V		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						GTTCATCATCATCCTGTCATA	0.423																																					p.I50V		.											.	OR2J3-90	0			c.A148G						.						291.0	305.0	300.0					6																	29079815		1349	2628	3977	SO:0001583	missense	442186	exon1			ATCATCATCCTGT		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.148A>G	6.37:g.29079815A>G	ENSP00000366374:p.Ile50Val	Somatic	337	0		WXS	Illumina HiSeq	Phase_I	269	53	NM_001005216	0	0	0	0	0	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	37	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	A	2.071	-0.413113	0.04799	.	.	ENSG00000204701	ENST00000377169	T	0.03889	3.77	2.78	1.58	0.23477	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00784	0.0026	N	0.05414	-0.055	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.48080	-0.9066	9	0.48119	T	0.1	.	4.2981	0.10911	0.682:0.2023:0.1157:0.0	.	50	O76001	OR2J3_HUMAN	V	50	ENSP00000366374:I50V	ENSP00000366374:I50V	I	+	1	0	OR2J3	29187794	0.000000	0.05858	0.992000	0.48379	0.314000	0.28054	-0.814000	0.04486	0.295000	0.22570	0.358000	0.22013	ATC	.		0.423	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2		
ZBTB22	9278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	33284668	33284668	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr6:33284668C>T	ENST00000431845.2	-	2	177	c.26G>A	c.(25-27)aGt>aAt	p.S9N	TAPBP_ENST00000434618.2_5'Flank|TAPBP_ENST00000489157.1_5'Flank|DAXX_ENST00000477162.1_5'Flank|ZBTB22_ENST00000418724.1_Missense_Mutation_p.S9N|TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000475304.1_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						TGCTGCCCCACTGGGAGACAG	0.657																																					p.S9N		.											.	ZBTB22-69	0			c.G26A						.						18.0	22.0	21.0					6																	33284668		2202	4295	6497	SO:0001583	missense	9278	exon2			GCCCCACTGGGAG	Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.26G>A	6.37:g.33284668C>T	ENSP00000407545:p.Ser9Asn	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	47	10	NM_001145338	0	0	9	15	6	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Missense_Mutation	SNP	ENST00000431845.2	37	CCDS4775.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.996665	0.35226	.	.	ENSG00000236104	ENST00000418724;ENST00000431845;ENST00000441117	T;T;T	0.64803	3.38;3.38;-0.12	4.68	2.67	0.31697	.	.	.	.	.	T	0.17831	0.0428	N	0.08118	0	0.26387	N	0.976649	B	0.16166	0.016	B	0.14578	0.011	T	0.11567	-1.0582	9	0.38643	T	0.18	.	4.8891	0.13717	0.0:0.6566:0.2229:0.1205	.	9	O15209	ZBT22_HUMAN	N	9	ENSP00000404403:S9N;ENSP00000407545:S9N;ENSP00000413172:S9N	ENSP00000404403:S9N	S	-	2	0	ZBTB22	33392646	0.013000	0.17824	1.000000	0.80357	0.995000	0.86356	1.367000	0.34204	1.172000	0.42781	0.638000	0.83543	AGT	.		0.657	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076183.2		
UBR2	23304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	42559909	42559909	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr6:42559909C>G	ENST00000372899.1	+	3	617	c.359C>G	c.(358-360)aCt>aGt	p.T120S	UBR2_ENST00000372901.1_Missense_Mutation_p.T120S|UBR2_ENST00000372903.2_Missense_Mutation_p.T120S	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	120					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			GTTGATCCAACTTGTGTTTTG	0.323																																					p.T120S		.											.	UBR2-94	0			c.C359G						.						112.0	101.0	105.0					6																	42559909		2203	4300	6503	SO:0001583	missense	23304	exon3			ATCCAACTTGTGT	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.359C>G	6.37:g.42559909C>G	ENSP00000361990:p.Thr120Ser	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	78	11	NM_001184801	0	0	12	18	6	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730359	0.89390	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	D;D;D	0.82255	-1.59;-1.59;-1.59	5.24	5.24	0.73138	Zinc finger, N-recognin, metazoa (1);Zinc finger, N-recognin (2);	0.000000	0.85682	D	0.000000	D	0.88887	0.6559	M	0.73319	2.225	0.80722	D	1	D;D	0.76494	0.999;0.992	D;P	0.81914	0.995;0.894	D	0.87768	0.2603	10	0.41790	T	0.15	-11.9828	18.4238	0.90602	0.0:1.0:0.0:0.0	.	120;120	Q8IWV8;Q8IWV8-2	UBR2_HUMAN;.	S	120	ENSP00000361994:T120S;ENSP00000361990:T120S;ENSP00000361992:T120S	ENSP00000361990:T120S	T	+	2	0	UBR2	42667887	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.756000	0.74919	2.459000	0.83118	0.655000	0.94253	ACT	.		0.323	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
SLC35B2	347734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	44222677	44222677	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr6:44222677G>C	ENST00000393812.3	-	4	1208	c.1065C>G	c.(1063-1065)atC>atG	p.I355M	MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000538577.1_Missense_Mutation_p.I262M|SLC35B2_ENST00000393810.1_3'UTR|SLC35B2_ENST00000537814.1_Missense_Mutation_p.I222M	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	355					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGGTGTAAAAGATGAAGAGCT	0.577																																					p.I355M		.											.	SLC35B2-91	0			c.C1065G						.						59.0	52.0	54.0					6																	44222677		2203	4300	6503	SO:0001583	missense	347734	exon4			GTAAAAGATGAAG	AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.1065C>G	6.37:g.44222677G>C	ENSP00000377401:p.Ile355Met	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	29	6	NM_178148	0	0	48	78	30	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	ENST00000393812.3	37	CCDS34462.1	.	.	.	.	.	.	.	.	.	.	g	16.92	3.256373	0.59321	.	.	ENSG00000157593	ENST00000393812;ENST00000537814;ENST00000538577;ENST00000341553	T;T;T	0.40476	1.03;1.03;1.03	5.0	2.85	0.33270	.	0.000000	0.85682	D	0.000000	T	0.67031	0.2850	H	0.96460	3.825	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.77838	-0.2439	10	0.87932	D	0	-30.6983	12.2066	0.54355	0.1659:0.0:0.8341:0.0	.	262;355	F5H7Y9;Q8TB61	.;S35B2_HUMAN	M	355;222;262;315	ENSP00000377401:I355M;ENSP00000440340:I222M;ENSP00000443845:I262M	ENSP00000342455:I315M	I	-	3	3	SLC35B2	44330655	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.845000	0.48254	1.121000	0.41925	0.540000	0.68198	ATC	.		0.577	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2		
UBE3D	90025	ucsc.edu;bcgsc.ca	37	6	83728805	83728805	+	Silent	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr6:83728805G>T	ENST00000369747.3	-	8	1019	c.897C>A	c.(895-897)tcC>tcA	p.S299S		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	299					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)										TGATATATTTGGAATTTCTCA	0.373																																					p.S299S													.	.	0			c.C897A						.						64.0	68.0	67.0					6																	83728805		2203	4300	6503	SO:0001819	synonymous_variant	90025	exon8			ATATTTGGAATTT	AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.897C>A	6.37:g.83728805G>T		Somatic	53	0		WXS	Illumina HiSeq		69	10	NM_198920	0	0	1	1	0	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Silent	SNP	ENST00000369747.3	37	CCDS34491.1																																																																																			.		0.373	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041347.7	NM_198920	
TTYH3	80727	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	2691878	2691878	+	Splice_Site	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:2691878T>C	ENST00000258796.7	+	8	1132		c.e8+2		TTYH3_ENST00000407643.1_Splice_Site|TTYH3_ENST00000403167.1_Splice_Site	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		TTCCAGCAGGTGAGAGCCTGG	0.657																																					.													.	TTYH3-90	0			c.927+2T>C						.						32.0	28.0	29.0					7																	2691878		2203	4300	6503	SO:0001630	splice_region_variant	80727	exon8			AGCAGGTGAGAGC		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.927+2T>C	7.37:g.2691878T>C		Somatic	55	0		WXS	Illumina HiSeq	Phase_I	40	6	NM_025250	0	0	1	1	0	A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Splice_Site	SNP	ENST00000258796.7	37	CCDS34588.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.450033	0.26074	.	.	ENSG00000136295	ENST00000258796;ENST00000407643;ENST00000403167	.	.	.	4.1	4.1	0.47936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4007	0.60881	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TTYH3	2658404	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	7.226000	0.78060	1.635000	0.50512	0.455000	0.32223	.	.		0.657	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325082.2	XM_166523	Intron
GPNMB	10457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	23313792	23313792	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:23313792C>G	ENST00000381990.2	+	11	1829	c.1668C>G	c.(1666-1668)aaC>aaG	p.N556K	GPNMB_ENST00000539136.1_Missense_Mutation_p.N445K|GPNMB_ENST00000453162.2_Missense_Mutation_p.N498K|GPNMB_ENST00000258733.4_Missense_Mutation_p.N544K|GPNMB_ENST00000478451.1_3'UTR	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	556					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			TCCCGGGAAACCAGGAAAAGG	0.428																																					p.N556K		.											.	GPNMB-580	0			c.C1668G						.						86.0	89.0	88.0					7																	23313792		2203	4300	6503	SO:0001583	missense	10457	exon11			GGGAAACCAGGAA	X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.1668C>G	7.37:g.23313792C>G	ENSP00000371420:p.Asn556Lys	Somatic	104	1		WXS	Illumina HiSeq	Phase_I	109	17	NM_001005340	0	3	2994	3046	49	A4D155|Q6UVX1|Q8N1A1	Missense_Mutation	SNP	ENST00000381990.2	37	CCDS34610.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936771	0.52972	.	.	ENSG00000136235	ENST00000258733;ENST00000435486;ENST00000381990;ENST00000425903;ENST00000539136;ENST00000453162	T;T;T;T	0.14640	2.49;2.5;2.49;2.51	5.93	5.93	0.95920	.	0.509964	0.20778	N	0.085853	T	0.15132	0.0365	L	0.53249	1.67	0.42155	D	0.991579	P;B;P;P	0.41848	0.617;0.001;0.544;0.763	B;B;B;B	0.33960	0.173;0.004;0.122;0.173	T	0.10359	-1.0633	10	0.19147	T	0.46	-3.5709	19.9388	0.97151	0.0:1.0:0.0:0.0	.	445;498;556;544	F6SKP1;F5GY20;Q14956;Q14956-2	.;.;GPNMB_HUMAN;.	K	544;591;556;439;445;498	ENSP00000258733:N544K;ENSP00000371420:N556K;ENSP00000445266:N445K;ENSP00000405586:N498K	ENSP00000258733:N544K	N	+	3	2	GPNMB	23280317	0.716000	0.27956	0.982000	0.44146	0.521000	0.34408	2.571000	0.45990	2.815000	0.96918	0.561000	0.74099	AAC	.		0.428	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340	
TPST1	8460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	65705725	65705725	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:65705725C>A	ENST00000304842.5	+	2	738	c.313C>A	c.(313-315)Ccc>Acc	p.P105T	TPST1_ENST00000480281.1_Intron	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	105					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						CAGGGTCATTCCCCGAATCCT	0.527																																					p.P105T		.											.	TPST1-90	0			c.C313A						.						96.0	93.0	94.0					7																	65705725		2203	4300	6503	SO:0001583	missense	8460	exon2			GTCATTCCCCGAA	AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.313C>A	7.37:g.65705725C>A	ENSP00000302413:p.Pro105Thr	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	96	39	NM_003596	0	0	11	31	20	A4D2M0|Q6FGM7	Missense_Mutation	SNP	ENST00000304842.5	37	CCDS5533.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574392	0.86542	.	.	ENSG00000169902	ENST00000304842;ENST00000544114;ENST00000451388	T;T	0.41065	1.01;1.01	5.78	5.78	0.91487	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	M	0.89658	3.05	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.80764	0.986;0.994	T	0.76498	-0.2937	10	0.56958	D	0.05	-14.1045	19.0054	0.92848	0.0:1.0:0.0:0.0	.	105;105	F5H7U7;O60507	.;TPST1_HUMAN	T	105	ENSP00000302413:P105T;ENSP00000391338:P105T	ENSP00000302413:P105T	P	+	1	0	TPST1	65343160	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.950000	0.75977	2.723000	0.93209	0.585000	0.79938	CCC	.		0.527	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251705.2	NM_003596	
ELN	2006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73474279	73474279	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:73474279C>T	ENST00000252034.7	+	23	1877	c.1478C>T	c.(1477-1479)cCt>cTt	p.P493L	ELN_ENST00000357036.5_Missense_Mutation_p.P498L|ELN_ENST00000380553.4_Missense_Mutation_p.P357L|ELN_ENST00000380584.4_Missense_Mutation_p.P460L|ELN_ENST00000380575.4_Missense_Mutation_p.P464L|ELN_ENST00000380576.5_Missense_Mutation_p.P474L|ELN_ENST00000429192.1_Missense_Mutation_p.P479L|ELN_ENST00000320399.6_Missense_Mutation_p.P493L|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000414324.1_Missense_Mutation_p.P469L|ELN_ENST00000445912.1_Missense_Mutation_p.P493L|ELN_ENST00000358929.4_Missense_Mutation_p.P528L|ELN_ENST00000380562.4_Missense_Mutation_p.P499L|ELN_ENST00000320492.7_Missense_Mutation_p.P412L|ELN_ENST00000458204.1_Missense_Mutation_p.P483L	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GGTGTGGCTCCTGGAGTTGGC	0.612			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.P498L		.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN-95	0			c.C1493T						.						205.0	192.0	196.0					7																	73474279		2203	4300	6503	SO:0001583	missense	2006	exon23			TGGCTCCTGGAGT		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1478C>T	7.37:g.73474279C>T	ENSP00000252034:p.Pro493Leu	Somatic	408	1		WXS	Illumina HiSeq	Phase_I	376	128	NM_001081754	0	0	12	16	4	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	C	14.98	2.695839	0.48202	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44482	1.42;1.35;1.26;1.39;0.95;1.27;0.92;1.18;1.41;1.4;0.95;1.07;1.0;1.38	2.86	2.86	0.33363	.	.	.	.	.	T	0.41119	0.1145	.	.	.	0.80722	D	1	P;P;P;P;P;P;P;P;P;P;P;P;P	0.51351	0.573;0.573;0.573;0.573;0.573;0.573;0.573;0.573;0.573;0.944;0.573;0.573;0.573	B;B;B;B;B;B;B;B;B;P;B;B;B	0.44811	0.199;0.199;0.199;0.199;0.199;0.199;0.199;0.199;0.199;0.461;0.199;0.199;0.199	T	0.47302	-0.9128	8	0.62326	D	0.03	.	11.5518	0.50725	0.0:1.0:0.0:0.0	.	493;412;469;483;499;464;479;498;474;357;404;460;493	E7ENM0;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.	L	493;493;528;412;469;499;464;460;483;498;479;357;474;493	ENSP00000389857:P493L;ENSP00000252034:P493L;ENSP00000351807:P528L;ENSP00000315607:P412L;ENSP00000392575:P469L;ENSP00000369936:P499L;ENSP00000369949:P464L;ENSP00000369958:P460L;ENSP00000403162:P483L;ENSP00000349540:P498L;ENSP00000391129:P479L;ENSP00000369926:P357L;ENSP00000369950:P474L;ENSP00000313565:P493L	ENSP00000252034:P493L	P	+	2	0	ELN	73112215	0.159000	0.22864	0.014000	0.15608	0.005000	0.04900	3.649000	0.54417	1.625000	0.50366	0.555000	0.69702	CCT	.		0.612	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
MCM7	4176	ucsc.edu;bcgsc.ca	37	7	99690937	99690937	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:99690937C>A	ENST00000303887.5	-	14	2581	c.1936G>T	c.(1936-1938)Gga>Tga	p.G646*	MIR106B_ENST00000385301.1_RNA|MIR93_ENST00000385024.1_RNA|MCM7_ENST00000343023.6_Intron|MIR25_ENST00000384816.1_RNA|MCM7_ENST00000354230.3_Nonsense_Mutation_p.G470*	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	646	Interaction with ATRIP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCCTTGTCTCCTAGAAGAGAG	0.483																																					p.G646X													.	MCM7-651	0			c.G1936T						.																																			SO:0001587	stop_gained	4176	exon14			TGTCTCCTAGAAG		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1936G>T	7.37:g.99690937C>A	ENSP00000307288:p.Gly646*	Somatic	265	3		WXS	Illumina HiSeq		301	31	NM_005916	0	0	75	96	21	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Nonsense_Mutation	SNP	ENST00000303887.5	37	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	C	42	9.787820	0.99264	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	.	.	.	5.35	2.48	0.30137	.	0.126219	0.53938	D	0.000052	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-26.219	6.5489	0.22423	0.1452:0.6947:0.0:0.1601	.	.	.	.	X	646;583;539;470	.	ENSP00000307288:G646X	G	-	1	0	MCM7	99528873	0.912000	0.30974	0.205000	0.23548	0.402000	0.30811	2.813000	0.48002	0.842000	0.35045	-0.229000	0.12294	GGA	.		0.483	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3		
TRIM56	81844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100732355	100732355	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:100732355T>C	ENST00000306085.6	+	3	2059	c.1762T>C	c.(1762-1764)Tcc>Ccc	p.S588P		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	588					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTGAGCCTCTCCCAGGCCAG	0.697																																					p.S588P	Ovarian(89;1092 1379 22756 38989 39611)	.											.	TRIM56-226	0			c.T1762C						.						44.0	51.0	48.0					7																	100732355		2048	4159	6207	SO:0001583	missense	81844	exon3			AGCCTCTCCCAGG	BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.1762T>C	7.37:g.100732355T>C	ENSP00000305161:p.Ser588Pro	Somatic	217	2		WXS	Illumina HiSeq	Phase_I	166	43	NM_030961	0	0	10	20	10	Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Missense_Mutation	SNP	ENST00000306085.6	37	CCDS43625.1	.	.	.	.	.	.	.	.	.	.	T	7.472	0.646792	0.14516	.	.	ENSG00000169871	ENST00000306085	T	0.27557	1.66	3.87	-0.121	0.13535	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	T	0.14485	0.0350	N	0.14661	0.345	0.09310	N	1	B	0.26975	0.165	B	0.20384	0.029	T	0.19582	-1.0301	9	0.45353	T	0.12	.	4.0445	0.09766	0.2464:0.0:0.3462:0.4074	.	588	Q9BRZ2	TRI56_HUMAN	P	588	ENSP00000305161:S588P	ENSP00000305161:S588P	S	+	1	0	TRIM56	100519075	0.037000	0.19845	0.007000	0.13788	0.735000	0.41995	0.307000	0.19296	-0.011000	0.14247	0.477000	0.44152	TCC	.		0.697	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347185.1	NM_030961	
DLD	1738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	107542828	107542828	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:107542828T>C	ENST00000205402.5	+	4	538	c.257T>C	c.(256-258)aTt>aCt	p.I86T	DLD_ENST00000494441.1_3'UTR|DLD_ENST00000537148.1_Intron|DLD_ENST00000440410.1_Intron|DLD_ENST00000437604.2_Missense_Mutation_p.I86T	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	86					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	GTTGGTTGTATTCCTTCTAAG	0.368																																					p.I86T		.											.	DLD-226	0			c.T257C						.						295.0	259.0	271.0					7																	107542828		2203	4300	6503	SO:0001583	missense	1738	exon4			GTTGTATTCCTTC	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.257T>C	7.37:g.107542828T>C	ENSP00000205402:p.Ile86Thr	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	97	31	NM_000108	0	0	0	0	0	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	ENST00000205402.5	37	CCDS5749.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.430417	0.83776	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000437604;ENST00000539590	T;T;T	0.56103	0.48;0.48;0.48	6.17	6.17	0.99709	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.82365	0.5021	H	0.96691	3.865	0.80722	D	1	P;D	0.54397	0.945;0.966	D;D	0.83275	0.955;0.996	D	0.87980	0.2742	10	0.87932	D	0	-11.8281	16.0034	0.80327	0.0:0.0:0.0:1.0	.	86;86	B4DT69;P09622	.;DLDH_HUMAN	T	86;86;86;36	ENSP00000205402:I86T;ENSP00000390667:I86T;ENSP00000387542:I86T	ENSP00000205402:I86T	I	+	2	0	DLD	107330064	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.900000	0.75687	2.371000	0.80710	0.533000	0.62120	ATT	.		0.368	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108	
MET	4233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116417457	116417457	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:116417457G>A	ENST00000318493.6	+	16	3515	c.3328G>A	c.(3328-3330)Gta>Ata	p.V1110I	MET_ENST00000397752.3_Missense_Mutation_p.V1092I|MET_ENST00000539704.1_5'UTR			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTTGGTTGTGTATATCATGG	0.338			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.V1110I		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	0			c.G3328A	GRCh37	CM990852	MET	M		.						191.0	176.0	180.0					7																	116417457		1827	4084	5911	SO:0001583	missense	4233	exon16	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GGTTGTGTATATC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3328G>A	7.37:g.116417457G>A	ENSP00000317272:p.Val1110Ile	Somatic	158	0		WXS	Illumina HiSeq	Phase_I	223	26	NM_001127500	0	0	212	305	93	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834124	0.91036	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	T;T	0.64991	-0.13;-0.13	5.16	5.16	0.70880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81178	0.4768	M	0.80422	2.495	0.80722	D	1	D;D	0.76494	0.999;0.99	D;D	0.85130	0.997;0.99	D	0.83726	0.0195	10	0.87932	D	0	.	19.0107	0.92871	0.0:0.0:1.0:0.0	.	1110;1092	P08581-2;P08581	.;MET_HUMAN	I	1092;1110	ENSP00000380860:V1092I;ENSP00000317272:V1110I	ENSP00000317272:V1110I	V	+	1	0	MET	116204693	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.813000	0.99286	2.560000	0.86352	0.563000	0.77884	GTA	.		0.338	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
DLGAP2	9228	broad.mit.edu	37	8	1497740	1497740	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:1497740T>A	ENST00000421627.2	+	2	1015	c.881T>A	c.(880-882)cTg>cAg	p.L294Q		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	373					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TGGTCTACGCTGACGGTCAGC	0.652																																					p.L294Q													.	DLGAP2-22	0			c.T881A						.						16.0	18.0	17.0					8																	1497740		2174	4272	6446	SO:0001583	missense	9228	exon2			CTACGCTGACGGT	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.881T>A	8.37:g.1497740T>A	ENSP00000400258:p.Leu294Gln	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	20	5	NM_004745	0	0	0	0	0	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.4|23.4	4.417592|4.417592	0.83449|0.83449	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.37235|.	1.21|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.80481|.	0.4631|.	M|M	0.88704|0.88704	2.975|2.975	0.49915|0.49915	D|D	0.999833|0.999833	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.991|.	D|.	0.84080|.	0.0384|.	10|.	0.87932|.	D|.	0|.	-13.9858|-13.9858	15.2356|15.2356	0.73427|0.73427	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	373;373|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	Q|R	339;294|311	ENSP00000400258:L294Q|.	ENSP00000348366:L339Q|.	L|X	+|+	2|1	0|0	DLGAP2|DLGAP2	1485147|1485147	1.000000|1.000000	0.71417|0.71417	0.959000|0.959000	0.39883|0.39883	0.823000|0.823000	0.46562|0.46562	7.257000|7.257000	0.78362|0.78362	1.992000|1.992000	0.58205|0.58205	0.533000|0.533000	0.62120|0.62120	CTG|TGA	.		0.652	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
MCPH1	79648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	6302563	6302563	+	Silent	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:6302563T>C	ENST00000344683.5	+	8	1396	c.1320T>C	c.(1318-1320)gcT>gcC	p.A440A	MCPH1_ENST00000522905.1_Silent_p.A392A|MCPH1_ENST00000519480.1_Silent_p.A440A	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	440					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		CAAGCCCTGCTCAGTTGAGCT	0.403																																					p.A440A	Colon(95;1448 1467 8277 34473 35819)	.											.	MCPH1-229	0			c.T1320C						.						90.0	88.0	89.0					8																	6302563		1903	4122	6025	SO:0001819	synonymous_variant	79648	exon8			CCCTGCTCAGTTG	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1320T>C	8.37:g.6302563T>C		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	120	18	NM_001172574	0	0	7	8	1	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Silent	SNP	ENST00000344683.5	37	CCDS43689.1																																																																																			.		0.403	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
TM2D2	83877	ucsc.edu	37	8	38853742	38853742	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:38853742A>T	ENST00000456397.2	-	1	310	c.217T>A	c.(217-219)Tgc>Agc	p.C73S	ADAM9_ENST00000466936.1_5'Flank|ADAM9_ENST00000487273.2_5'Flank|TM2D2_ENST00000456845.2_Intron|TM2D2_ENST00000522434.1_Intron|TM2D2_ENST00000397070.2_5'UTR|TM2D2_ENST00000412303.1_Intron|ADAM9_ENST00000481513.1_5'Flank	NM_078473.2	NP_510882.1	Q9BX73	TM2D2_HUMAN	TM2 domain containing 2	73						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		all_lung(54;0.00338)|Lung NSC(58;0.0133)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			AGGTAAGAGCAGAGGATGACC	0.657																																					p.C73S													.	TM2D2-90	0			c.T217A						.						29.0	32.0	31.0					8																	38853742		2203	4300	6503	SO:0001583	missense	83877	exon1			AAGAGCAGAGGAT	AF353991	CCDS6111.1, CCDS43733.1	8p11.23	2005-08-09				ENSG00000169490			24127	protein-coding gene	gene with protein product		610081				11278849	Standard	XM_005273657		Approved	BLP1	uc003xmk.3	Q9BX73		ENST00000456397.2:c.217T>A	8.37:g.38853742A>T	ENSP00000416050:p.Cys73Ser	Somatic	45	0		WXS	Illumina HiSeq		47	3	NM_078473	0	0	0	0	0	B2RBK4|D3DSX8|Q8N0X9	Missense_Mutation	SNP	ENST00000456397.2	37	CCDS6111.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.029304	0.93518	.	.	ENSG00000169490	ENST00000456397	T	0.39787	1.06	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.77406	2.37	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.70680	-0.4805	10	0.87932	D	0	-19.8572	15.7636	0.78106	1.0:0.0:0.0:0.0	.	73	Q9BX73	TM2D2_HUMAN	S	73	ENSP00000416050:C73S	ENSP00000416050:C73S	C	-	1	0	TM2D2	38972899	1.000000	0.71417	0.979000	0.43373	0.721000	0.41392	7.461000	0.80834	2.210000	0.71456	0.533000	0.62120	TGC	.		0.657	TM2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377280.1	NM_031940	
HGSNAT	138050	hgsc.bcm.edu;broad.mit.edu	37	8	43002092	43002092	+	Splice_Site	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:43002092C>G	ENST00000458501.2	+	2	204	c.204C>G	c.(202-204)gaC>gaG	p.D68E	HGSNAT_ENST00000379644.4_Splice_Site_p.D40E			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	68					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)			cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TTCTACCAGACTTAGACAAAA	0.388																																					p.D40E		.											.	HGSNAT-68	0			c.C120G						.						79.0	71.0	73.0					8																	43002092		1832	4081	5913	SO:0001630	splice_region_variant	138050	exon2			ACCAGACTTAGAC		CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.203-1C>G	8.37:g.43002092C>G		Somatic	27	0		WXS	Illumina HiSeq	Phase_I	28	5	NM_152419	0	0	0	0	0	B4E2V0	Missense_Mutation	SNP	ENST00000458501.2	37		.	.	.	.	.	.	.	.	.	.	C	13.07	2.126375	0.37533	.	.	ENSG00000165102	ENST00000458501;ENST00000332689;ENST00000379644	D;D	0.92495	-3.05;-3.05	5.42	-5.43	0.02632	.	0.299191	0.23658	N	0.045843	D	0.84229	0.5426	L	0.48642	1.525	0.18873	N	0.999986	B	0.33694	0.421	B	0.22386	0.039	T	0.70472	-0.4862	10	0.39692	T	0.17	.	13.0426	0.58908	0.0:0.1384:0.0:0.8616	.	68	Q68CP4	HGNAT_HUMAN	E	68;40;40	ENSP00000389524:D68E;ENSP00000368965:D40E	ENSP00000327833:D40E	D	+	3	2	HGSNAT	43121249	0.309000	0.24518	0.090000	0.20809	0.088000	0.18126	-1.048000	0.03517	-1.182000	0.02727	-0.390000	0.06520	GAC	.		0.388	HGSNAT-202	KNOWN	basic	protein_coding	protein_coding		XM_372038	Missense_Mutation
COL14A1	7373	broad.mit.edu	37	8	121170484	121170484	+	Splice_Site	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:121170484A>G	ENST00000297848.3	+	3	474	c.204A>G	c.(202-204)tcA>tcG	p.S68S	COL14A1_ENST00000247781.3_Splice_Site_p.S68S|COL14A1_ENST00000309791.4_Splice_Site_p.S68S|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000537875.1_Splice_Site_p.S68S	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CTCCAACTTCAGGTAAAAACA	0.353																																					p.S68S													.	COL14A1-543	0			c.A204G						.						59.0	60.0	59.0					8																	121170484		2203	4300	6503	SO:0001630	splice_region_variant	7373	exon3			AACTTCAGGTAAA		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.205+1A>G	8.37:g.121170484A>G		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	79	3	NM_021110	0	0	0	0	0		Silent	SNP	ENST00000297848.3	37	CCDS34938.1																																																																																			.		0.353	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	Silent
ADCY8	114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	131921969	131921969	+	Missense_Mutation	SNP	G	G	C	rs368729916		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:131921969G>C	ENST00000286355.5	-	6	3717	c.1625C>G	c.(1624-1626)tCt>tGt	p.S542C	ADCY8_ENST00000377928.3_Missense_Mutation_p.S542C	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	542					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GATTCCTCCAGATTCGAGTTT	0.463										HNSCC(32;0.087)																											p.S542C		.											.	ADCY8-157	0			c.C1625G						.	G	CYS/SER	1,4405	2.1+/-5.4	0,1,2202	242.0	216.0	225.0		1625	5.9	1.0	8		225	0,8600		0,0,4300	no	missense	ADCY8	NM_001115.2	112	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	probably-damaging	542/1252	131921969	1,13005	2203	4300	6503	SO:0001583	missense	114	exon6			CCTCCAGATTCGA	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1625C>G	8.37:g.131921969G>C	ENSP00000286355:p.Ser542Cys	Somatic	372	0		WXS	Illumina HiSeq	Phase_I	337	67	NM_001115	0	0	0	0	0		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	G	31	5.072076	0.93950	2.27E-4	0.0	ENSG00000155897	ENST00000286355;ENST00000377928;ENST00000522949	D;D;D	0.87029	-2.2;-2.2;-2.2	5.93	5.93	0.95920	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.052374	0.85682	D	0.000000	D	0.96423	0.8833	H	0.98276	4.19	0.49483	D	0.999792	D;D	0.69078	0.995;0.997	D;D	0.68353	0.957;0.953	D	0.97510	1.0066	10	0.87932	D	0	.	19.3421	0.94347	0.0:0.0:1.0:0.0	.	542;542	E7EVL1;P40145	.;ADCY8_HUMAN	C	542;542;157	ENSP00000286355:S542C;ENSP00000367161:S542C;ENSP00000428010:S157C	ENSP00000286355:S542C	S	-	2	0	ADCY8	131991151	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.826000	0.97356	0.655000	0.94253	TCT	.		0.463	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
EEF1D	1936	broad.mit.edu	37	8	144659504	144659504	+	IGR	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:144659504A>G	ENST00000529272.1	-	0	1311				RP11-661A12.9_ENST00000531730.1_RNA|RP11-661A12.7_ENST00000529247.1_RNA|NAPRT1_ENST00000460623.1_5'Flank|NAPRT1_ENST00000276844.7_Missense_Mutation_p.M168T|NAPRT1_ENST00000426292.3_Missense_Mutation_p.M168T|NAPRT1_ENST00000449291.2_Missense_Mutation_p.M168T|NAPRT1_ENST00000435154.3_Missense_Mutation_p.M168T			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CCTCAGGCCCATCTCTAGCAG	0.697																																					p.M168T													.	NAPRT1-91	0			c.T503C						.						9.0	11.0	11.0					8																	144659504		2175	4277	6452	SO:0001628	intergenic_variant	93100	exon4			AGGCCCATCTCTA	AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191		8.37:g.144659504A>G		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	20	3	NM_145201	0	0	23	37	14	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	ENST00000529272.1	37	CCDS6405.1	.	.	.	.	.	.	.	.	.	.	A	18.50	3.637134	0.67130	.	.	ENSG00000147813	ENST00000435154;ENST00000449291;ENST00000340490;ENST00000426292;ENST00000276844	T;T;T;T;T	0.46451	0.89;0.89;0.87;0.9;0.88	4.84	4.84	0.62591	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.225191	0.51477	D	0.000096	T	0.49525	0.1562	M	0.83603	2.65	0.44976	D	0.997993	B;P;B;P	0.35944	0.351;0.529;0.435;0.491	B;B;B;B	0.37015	0.239;0.236;0.154;0.239	T	0.59311	-0.7478	10	0.87932	D	0	-9.6205	13.7315	0.62789	1.0:0.0:0.0:0.0	.	168;168;168;168	C9J8U2;G5E977;Q6XQN6-3;Q6XQN6	.;.;.;PNCB_HUMAN	T	168	ENSP00000405670:M168T;ENSP00000401508:M168T;ENSP00000341136:M168T;ENSP00000390949:M168T;ENSP00000276844:M168T	ENSP00000276844:M168T	M	-	2	0	NAPRT1	144730647	1.000000	0.71417	0.991000	0.47740	0.942000	0.58702	5.649000	0.67936	2.022000	0.59522	0.533000	0.62120	ATG	.		0.697	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382592.2	NM_032378	
DENND4C	55667	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	19369966	19369966	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:19369966C>T	ENST00000380432.2	+	26	4834	c.4801C>T	c.(4801-4803)Cca>Tca	p.P1601S	RP11-513M16.7_ENST00000609609.1_RNA|DENND4C_ENST00000602925.1_Missense_Mutation_p.P1837S|DENND4C_ENST00000434457.2_Missense_Mutation_p.P1886S			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1601					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						GCAAATGAAGCCAGGCATGAA	0.338																																					p.P1837S													.	DENND4C-92	0			c.C5509T						.						86.0	79.0	81.0					9																	19369966		2203	4300	6503	SO:0001583	missense	55667	exon30			ATGAAGCCAGGCA	AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.4801C>T	9.37:g.19369966C>T	ENSP00000369797:p.Pro1601Ser	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	63	11	NM_017925	0	0	29	45	16	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	ENST00000380432.2	37		.	.	.	.	.	.	.	.	.	.	C	13.01	2.108364	0.37242	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000453857;ENST00000540671;ENST00000380432;ENST00000380427;ENST00000361024	T;T	0.24908	1.83;1.83	5.07	3.23	0.37069	.	0.284189	0.32430	N	0.006116	T	0.25717	0.0626	L	0.52905	1.665	0.37625	D	0.921457	B;B;B	0.27853	0.009;0.191;0.0	B;B;B	0.34452	0.008;0.183;0.001	T	0.10019	-1.0648	9	.	.	.	-0.5743	10.1821	0.42975	0.0:0.7786:0.1463:0.0752	.	931;783;1601	B7Z660;Q5VZ89-3;Q5VZ89	.;.;DEN4C_HUMAN	S	1601;1074;783;931;1074;783;598	ENSP00000305795:P1074S;ENSP00000443804:P931S	.	P	+	1	0	DENND4C	19359966	1.000000	0.71417	0.836000	0.33094	0.707000	0.40811	2.238000	0.43070	0.735000	0.32537	0.650000	0.86243	CCA	.		0.338	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925	
TEK	7010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	27197591	27197591	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:27197591A>G	ENST00000380036.4	+	12	2345	c.1903A>G	c.(1903-1905)Agt>Ggt	p.S635G	TEK_ENST00000406359.4_Missense_Mutation_p.S592G|RNA5SP280_ENST00000411230.1_RNA|TEK_ENST00000519097.1_Missense_Mutation_p.S488G	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	635	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	TTGGACCCTTAGTGACAGTAA	0.493																																					p.S635G		.											.	TEK-1584	0			c.A1903G						.						39.0	40.0	40.0					9																	27197591		2203	4300	6503	SO:0001583	missense	7010	exon12			ACCCTTAGTGACA	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.1903A>G	9.37:g.27197591A>G	ENSP00000369375:p.Ser635Gly	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	38	8	NM_000459	0	0	0	0	0	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	A	9.271	1.045584	0.19748	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359;ENST00000519080	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.54	5.54	0.83059	Fibronectin, type III (1);	0.000000	0.64402	D	0.000010	T	0.62816	0.2459	L	0.56769	1.78	0.51233	D	0.999913	B;P;D;B	0.63880	0.281;0.462;0.993;0.361	B;B;D;B	0.68192	0.056;0.141;0.956;0.081	T	0.58457	-0.7633	10	0.23302	T	0.38	.	15.6853	0.77405	1.0:0.0:0.0:0.0	.	488;668;592;635	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	G	488;635;592;445	ENSP00000430686:S488G;ENSP00000369375:S635G;ENSP00000383977:S592G;ENSP00000428337:S445G	ENSP00000369375:S635G	S	+	1	0	TEK	27187591	0.999000	0.42202	0.744000	0.31058	0.104000	0.19210	4.662000	0.61525	2.117000	0.64856	0.533000	0.62120	AGT	.		0.493	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
ZCCHC6	79670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	88943326	88943326	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:88943326C>G	ENST00000375963.3	-	11	1709	c.1537G>C	c.(1537-1539)Gac>Cac	p.D513H	ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.D390H|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.D513H	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	513					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						GCAGCACTGTCAGTATGTTCC	0.408																																					p.D513H		.											.	ZCCHC6-92	0			c.G1537C						.						246.0	214.0	225.0					9																	88943326		2203	4300	6503	SO:0001583	missense	79670	exon11			CACTGTCAGTATG	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.1537G>C	9.37:g.88943326C>G	ENSP00000365130:p.Asp513His	Somatic	253	0		WXS	Illumina HiSeq	Phase_I	232	48	NM_024617	0	0	9	10	1	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662242	0.47572	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963	T;T;T	0.46819	0.86;1.06;1.06	4.35	4.35	0.52113	.	0.478121	0.23602	N	0.046437	T	0.55162	0.1903	L	0.36672	1.1	0.19945	N	0.999947	D;D	0.69078	0.997;0.991	P;P	0.61132	0.884;0.769	T	0.49551	-0.8928	10	0.66056	D	0.02	-18.5595	15.1952	0.73081	0.0:1.0:0.0:0.0	.	390;513	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	H	390;513;513	ENSP00000365127:D390H;ENSP00000365128:D513H;ENSP00000365130:D513H	ENSP00000365127:D390H	D	-	1	0	ZCCHC6	88133146	0.448000	0.25681	0.092000	0.20876	0.015000	0.08874	1.298000	0.33412	2.699000	0.92147	0.462000	0.41574	GAC	.		0.408	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
CRAT	1384	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131864688	131864688	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:131864688G>T	ENST00000318080.2	-	5	915	c.621C>A	c.(619-621)caC>caA	p.H207Q	CRAT_ENST00000464290.1_5'UTR|RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	207					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	CCTGGTAGTTGTGTACCACGG	0.642																																					p.H207Q		.											.	CRAT-90	0			c.C621A						.						147.0	128.0	135.0					9																	131864688		2203	4300	6503	SO:0001583	missense	1384	exon5			GTAGTTGTGTACC	X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.621C>A	9.37:g.131864688G>T	ENSP00000315013:p.His207Gln	Somatic	232	0		WXS	Illumina HiSeq	Phase_I	162	42	NM_000755	0	0	0	0	0	Q5T952|Q9BW16	Missense_Mutation	SNP	ENST00000318080.2	37	CCDS6919.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.223146	0.79464	.	.	ENSG00000095321	ENST00000351352;ENST00000318080	D	0.89343	-2.5	5.37	4.23	0.50019	.	0.000000	0.85682	D	0.000000	D	0.92528	0.7627	M	0.76170	2.325	0.80722	D	1	D	0.62365	0.991	D	0.68039	0.955	D	0.90458	0.4444	10	0.31617	T	0.26	-47.0361	10.6033	0.45379	0.12:0.0:0.88:0.0	.	207	P43155	CACP_HUMAN	Q	207	ENSP00000315013:H207Q	ENSP00000315013:H207Q	H	-	3	2	CRAT	130904509	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.076000	0.57591	0.913000	0.36797	0.561000	0.74099	CAC	.		0.642	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253700.1		
HDHD1	8226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	7023838	7023838	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chrX:7023838T>G	ENST00000381077.5	-	2	179	c.103A>C	c.(103-105)Aat>Cat	p.N35H	HDHD1_ENST00000424830.2_Missense_Mutation_p.N58H|HDHD1_ENST00000540122.1_Missense_Mutation_p.N35H|HDHD1_ENST00000412827.2_Missense_Mutation_p.N35H|HDHD1_ENST00000498474.2_5'UTR	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1	35					nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)			breast(2)|large_intestine(1)|lung(3)	6						TCATAGCGATTACATATTTCT	0.393																																					p.N58H		.											.	HDHD1-130	0			c.A172C						.						55.0	46.0	49.0					X																	7023838		1847	4082	5929	SO:0001583	missense	8226	exon3			AGCGATTACATAT	M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.103A>C	X.37:g.7023838T>G	ENSP00000370467:p.Asn35His	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	33	12	NM_001135565	0	0	1	6	5	B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Missense_Mutation	SNP	ENST00000381077.5	37	CCDS48075.1	.	.	.	.	.	.	.	.	.	.	c	7.623	0.677318	0.14841	.	.	ENSG00000130021	ENST00000381077;ENST00000544385;ENST00000412827;ENST00000424830;ENST00000540122;ENST00000486446	T;T;T;T;T	0.30714	3.42;1.52;3.42;3.42;3.42	4.01	4.01	0.46588	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.660693	0.15594	N	0.254263	T	0.23766	0.0575	N	0.21282	0.65	0.09310	N	1	D;B;P;B;B	0.53745	0.962;0.346;0.711;0.045;0.136	B;B;P;B;B	0.46419	0.4;0.382;0.516;0.057;0.201	T	0.05500	-1.0881	10	0.45353	T	0.12	-18.7046	7.1959	0.25853	0.0:0.7837:0.0:0.2163	.	35;35;58;35;35	Q08623-3;Q08623-2;E9PAV8;E7EVH9;Q08623	.;.;.;.;HDHD1_HUMAN	H	35;51;35;58;35;35	ENSP00000370467:N35H;ENSP00000406260:N35H;ENSP00000396452:N58H;ENSP00000441208:N35H;ENSP00000430995:N35H	ENSP00000370467:N35H	N	-	1	0	HDHD1	7033838	0.177000	0.23109	0.002000	0.10522	0.370000	0.29829	0.823000	0.27366	0.559000	0.29153	-0.177000	0.13119	AAT	.		0.393	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055683.2	NM_012080	
GPRASP1	9737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	101910063	101910063	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chrX:101910063T>A	ENST00000361600.5	+	5	2023	c.1222T>A	c.(1222-1224)Tgg>Agg	p.W408R	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Missense_Mutation_p.W408R|GPRASP1_ENST00000415986.1_Missense_Mutation_p.W408R|GPRASP1_ENST00000444152.1_Missense_Mutation_p.W408R	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	408					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CATTGGGACCTGGTTCTGGGC	0.562																																					p.W408R		.											.	GPRASP1-131	0			c.T1222A						.						58.0	61.0	60.0					X																	101910063		2203	4300	6503	SO:0001583	missense	9737	exon3			GGGACCTGGTTCT	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.1222T>A	X.37:g.101910063T>A	ENSP00000355146:p.Trp408Arg	Somatic	72	1		WXS	Illumina HiSeq	Phase_I	49	22	NM_001099411	0	0	0	1	1	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.398444	0.42512	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	2.32	2.32	0.28847	.	.	.	.	.	T	0.50786	0.1636	M	0.71036	2.16	0.25851	N	0.983946	D	0.64830	0.994	D	0.79784	0.993	T	0.40961	-0.9535	9	0.12430	T	0.62	-2.7103	7.7932	0.29133	0.0:0.0:0.0:1.0	.	408	Q5JY77	GASP1_HUMAN	R	408	ENSP00000393691:W408R;ENSP00000409420:W408R;ENSP00000355146:W408R;ENSP00000445683:W408R	ENSP00000355146:W408R	W	+	1	0	GPRASP1	101796719	0.613000	0.27009	0.876000	0.34364	0.595000	0.36748	0.390000	0.20768	1.168000	0.42723	0.372000	0.22366	TGG	.		0.562	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
ARHGAP21	57584	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	24908604	24908604	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr10:24908604delT	ENST00000396432.2	-	9	2706	c.2220delA	c.(2218-2220)aaafs	p.K740fs	ARHGAP21_ENST00000320481.6_Frame_Shift_Del_p.K527fs	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	739					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CAGATGGAGGTTTTTCCCTTA	0.453																																					p.K740fs		.											.	ARHGAP21-235	0			c.2220delA						.						102.0	96.0	98.0					10																	24908604		2203	4300	6503	SO:0001589	frameshift_variant	57584	exon9			.	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.2220delA	10.37:g.24908604delT	ENSP00000379709:p.Lys740fs	Somatic	177	0		WXS	Illumina HiSeq	Phase_I	156	25	NM_020824	0	0	0	0	0	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Frame_Shift_Del	DEL	ENST00000396432.2	37	CCDS7144.2																																																																																			.		0.453	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
STOX1	219736	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	70645179	70645179	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr10:70645179delT	ENST00000298596.6	+	3	1710	c.1627delT	c.(1627-1629)tttfs	p.F543fs	STOX1_ENST00000399162.2_Intron|STOX1_ENST00000421961.2_Frame_Shift_Del_p.F433fs|STOX1_ENST00000399165.4_Intron|STOX1_ENST00000399169.4_Frame_Shift_Del_p.F543fs	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	543						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						CTCAAGAATCTTTGATGGTAA	0.418																																					p.F543fs		.											.	STOX1-92	0			c.1627delT						.						66.0	60.0	62.0					10																	70645179		1853	4096	5949	SO:0001589	frameshift_variant	219736	exon3			.	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.1627delT	10.37:g.70645179delT	ENSP00000298596:p.Phe543fs	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	53	12	NM_152709	0	0	0	0	0	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Frame_Shift_Del	DEL	ENST00000298596.6	37	CCDS41535.1																																																																																			.		0.418	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
GRIP1	23426	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	66765625	66765625	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:66765625delA	ENST00000398016.3	-	22	2773	c.2705delT	c.(2704-2706)ttcfs	p.F902fs	GRIP1_ENST00000359742.4_Frame_Shift_Del_p.F954fs|GRIP1_ENST00000286445.7_Frame_Shift_Del_p.F939fs	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GCGCTCCTGGAAGCTGGCCTG	0.552																																					p.F902fs		.											.	GRIP1-494	0			c.2705delT						.						86.0	94.0	91.0					12																	66765625		2074	4214	6288	SO:0001589	frameshift_variant	23426	exon22			.	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2705delT	12.37:g.66765625delA	ENSP00000381098:p.Phe902fs	Somatic	219	0		WXS	Illumina HiSeq	Phase_I	202	34	NM_021150	0	0	0	0	0	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Frame_Shift_Del	DEL	ENST00000398016.3	37	CCDS41807.1																																																																																			.		0.552	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2		
RCBTB1	55213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	50115836	50115836	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr13:50115836delC	ENST00000378302.2	-	11	1560	c.1300delG	c.(1300-1302)gacfs	p.D434fs	RCBTB1_ENST00000471984.1_5'Flank|RCBTB1_ENST00000258646.3_Frame_Shift_Del_p.D434fs	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	434	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		GGCGGCAGGTCGACTGTGTCT	0.458																																					p.D434fs		.											.	RCBTB1-91	0			c.1300delG						.						156.0	116.0	130.0					13																	50115836		2203	4300	6503	SO:0001589	frameshift_variant	55213	exon11			.	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.1300delG	13.37:g.50115836delC	ENSP00000367552:p.Asp434fs	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	86	15	NM_018191	0	0	0	0	0	Q8IY29|Q969U9	Frame_Shift_Del	DEL	ENST00000378302.2	37	CCDS9418.1																																																																																			.		0.458	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044912.2	NM_018191	
RCBTB1	55213	hgsc.bcm.edu	37	13	50115836	50115837	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr13:50115836_50115837delCG	ENST00000378302.2	-	11	1559_1560	c.1299_1300delCG	c.(1297-1302)gtcgacfs	p.D434fs	RCBTB1_ENST00000471984.1_5'Flank|RCBTB1_ENST00000258646.3_Frame_Shift_Del_p.D434fs	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	434	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		GGCGGCAGGTCGACTGTGTCTG	0.455																																					p.433_434del		.											.	RCBTB1-91	0			c.1299_1300del						.																																			SO:0001589	frameshift_variant	55213	exon11			.	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.1299_1300delCG	13.37:g.50115836_50115837delCG	ENSP00000367552:p.Asp434fs	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	91	15	NM_018191	0	0	0	0	0	Q8IY29|Q969U9	Frame_Shift_Del	DEL	ENST00000378302.2	37	CCDS9418.1																																																																																			.		0.455	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044912.2	NM_018191	
ADAP2	55803	hgsc.bcm.edu;broad.mit.edu	37	17	29261211	29261211	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:29261211delG	ENST00000330889.3	+	5	741	c.406delG	c.(406-408)gaafs	p.E136fs	ADAP2_ENST00000580525.1_Frame_Shift_Del_p.E142fs	NM_018404.2	NP_060874.1	Q9NPF8	ADAP2_HUMAN	ArfGAP with dual PH domains 2	136	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				heart development (GO:0007507)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|mitochondrial envelope (GO:0005740)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						AGGTAACCGAGAAGGATTCCT	0.478																																					p.E136fs		.											.	ADAP2-91	1	Unknown(1)	central_nervous_system(1)	c.406delG						.						96.0	80.0	85.0					17																	29261211		2203	4300	6503	SO:0001589	frameshift_variant	55803	exon5			.	AJ238994	CCDS11261.1	17q11.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000184060	ENSG00000184060		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16487	protein-coding gene	gene with protein product		608635	"""centaurin, alpha 2"""	CENTA2			Standard	XM_005258008		Approved		uc002hfx.3	Q9NPF8	OTTHUMG00000132868	ENST00000330889.3:c.406delG	17.37:g.29261211delG	ENSP00000329468:p.Glu136fs	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	59	10	NM_018404	0	0	0	0	0	Q8N4Q6|Q96SD5	Frame_Shift_Del	DEL	ENST00000330889.3	37	CCDS11261.1																																																																																			.		0.478	ADAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256346.1	NM_018404	
BAIAP2	10458	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	79082274	79082274	+	Splice_Site	DEL	G	G	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:79082274delG	ENST00000321300.6	+	13	1593		c.e13-1		BAIAP2_ENST00000321280.7_Splice_Site|BAIAP2_ENST00000575712.1_Splice_Site|BAIAP2_ENST00000575245.1_Splice_Site|BAIAP2_ENST00000435091.3_Splice_Site|BAIAP2_ENST00000428708.2_Splice_Site|BAIAP2_ENST00000416299.2_Splice_Site|BAIAP2_ENST00000392411.3_Splice_Site	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2						actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCTGCCCCCAGGGCCTGGATG	0.637																																					.		.											.	BAIAP2-90	0			c.1501-1G>-						.						72.0	70.0	71.0					17																	79082274		2203	4300	6503	SO:0001630	splice_region_variant	10458	exon13			.	AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1501-1G>-	17.37:g.79082274delG		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	55	12	NM_001144888	0	0	0	0	0	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Splice_Site	DEL	ENST00000321300.6	37	CCDS11775.1																																																																																			.		0.637	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438553.1		Intron
SOCS6	9306	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	67992496	67992496	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr18:67992496delA	ENST00000397942.3	+	2	908	c.592delA	c.(592-594)aatfs	p.N198fs	SOCS6_ENST00000582322.1_Frame_Shift_Del_p.N198fs	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	198					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GGCTTCTCATAATGGAGACCT	0.512																																					p.N198fs	Melanoma(84;1024 1361 24382 36583 42651)	.											.	SOCS6-721	0			c.592delA						.						108.0	94.0	99.0					18																	67992496		2203	4300	6503	SO:0001589	frameshift_variant	9306	exon2			.	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.592delA	18.37:g.67992496delA	ENSP00000381034:p.Asn198fs	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	129	28	NM_004232	0	0	0	0	0	Q8WUM3	Frame_Shift_Del	DEL	ENST00000397942.3	37	CCDS11998.1																																																																																			.		0.512	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
PLCD1	5333	broad.mit.edu;bcgsc.ca	37	3	38051199	38051201	+	In_Frame_Del	DEL	TCG	TCG	-	rs375010877		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	TCG	TCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:38051199_38051201delTCG	ENST00000334661.4	-	9	1611_1613	c.1389_1391delCGA	c.(1387-1392)gacgag>gag	p.D463del	PLCD1_ENST00000463876.1_In_Frame_Del_p.D484del|PLCD1_ENST00000479619.1_5'Flank	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	463					angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)	p.D484D(1)|p.D463D(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CTCAGCAGCCTCGTCTTCGTCTG	0.65																																					p.484_485del													.	PLCD1-226	2	Substitution - coding silent(2)	endometrium(2)	c.1452_1454del						.																																			SO:0001651	inframe_deletion	5333	exon9			GCAGCCTCGTCTT		CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.1389_1391delCGA	3.37:g.38051199_38051201delTCG	ENSP00000335600:p.Asp463del	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	42	9	NM_001130964	0	0	0	0	0	B3KR14|Q86VN8	In_Frame_Del	DEL	ENST00000334661.4	37	CCDS2671.1																																																																																			.		0.650	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	108107907	108107918	+	In_Frame_Del	DEL	TTCCAGTTCACG	TTCCAGTTCACG	-	rs143417195	byFrequency	TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	TTCCAGTTCACG	TTCCAGTTCACG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:108107907_108107918delTTCCAGTTCACG	ENST00000273353.3	-	39	5550_5561	c.5494_5505delCGTGAACTGGAA	c.(5494-5505)cgtgaactggaadel	p.RELE1832del		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1832						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R1832S(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CCAGTTCACCTTCCAGTTCACGAACCTGCAAC	0.524																																					p.1832_1835del		.											.	MYH15-73	1	Substitution - Missense(1)	lung(1)	c.5494_5505del						.																																			SO:0001651	inframe_deletion	22989	exon39			.	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5494_5505delCGTGAACTGGAA	3.37:g.108107907_108107918delTTCCAGTTCACG	ENSP00000273353:p.Arg1832_Glu1835del	Somatic	242	0		WXS	Illumina HiSeq	Phase_I	136	21	NM_014981	0	0	0	0	0		In_Frame_Del	DEL	ENST00000273353.3	37	CCDS43127.1																																																																																			.		0.524	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
SEC22A	26984	broad.mit.edu	37	3	122978380	122978380	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:122978380delG	ENST00000309934.4	+	5	1563	c.667delG	c.(667-669)gatfs	p.D224fs	SEC22A_ENST00000492595.1_Frame_Shift_Del_p.D224fs|SEC22A_ENST00000481965.2_Frame_Shift_Del_p.V64fs	NM_012430.4	NP_036562.2	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A (S. cerevisiae)	224					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	10				GBM - Glioblastoma multiforme(114;0.0548)		GAGTGATGGTGATGATTTTAA	0.343																																					p.D223fs													.	SEC22A-91	0			c.667delG						.						102.0	98.0	99.0					3																	122978380		2203	4298	6501	SO:0001589	frameshift_variant	26984	exon6			GATGGTGATGATT	AF100749	CCDS3021.1	3q21.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000121542	ENSG00000121542			20260	protein-coding gene	gene with protein product		612442	"""SEC22 vesicle trafficking protein-like 2 (S. cerevisiae)"""	SEC22L2		9094723, 9501016	Standard	NM_012430		Approved		uc003ege.3	Q96IW7	OTTHUMG00000159495	ENST00000309934.4:c.667delG	3.37:g.122978380delG	ENSP00000310521:p.Asp224fs	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	50	8	NM_012430	0	0	0	0	0	B2RE26|Q9Y682	Frame_Shift_Del	DEL	ENST00000309934.4	37	CCDS3021.1																																																																																			.		0.343	SEC22A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355770.2	NM_012430	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	114195785	114195785	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:114195785delG	ENST00000357077.4	+	15	1716	c.1663delG	c.(1663-1665)gccfs	p.A555fs	ANK2_ENST00000264366.6_Frame_Shift_Del_p.A555fs|ANK2_ENST00000506722.1_Frame_Shift_Del_p.A534fs|ANK2_ENST00000394537.3_Frame_Shift_Del_p.A555fs	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	555					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGCAGGAGCAGCCCACTCCTT	0.517																																					p.A555fs		.											.	ANK2-583	0			c.1663delG						.						80.0	78.0	79.0					4																	114195785		2203	4300	6503	SO:0001589	frameshift_variant	287	exon15			.	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1663delG	4.37:g.114195785delG	ENSP00000349588:p.Ala555fs	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	69	12	NM_001148	0	0	0	0	0	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Frame_Shift_Del	DEL	ENST00000357077.4	37	CCDS3702.1																																																																																			.		0.517	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
SYNPO	11346	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	150027927	150027927	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr5:150027927delA	ENST00000394243.1	+	3	1196	c.822delA	c.(820-822)ctafs	p.L274fs	SYNPO_ENST00000519664.1_Frame_Shift_Del_p.L30fs|SYNPO_ENST00000518872.1_Intron|SYNPO_ENST00000522122.1_Frame_Shift_Del_p.L274fs|SYNPO_ENST00000307662.4_Frame_Shift_Del_p.L30fs	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	274					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGTTTATCTAAAGGAGAATG	0.602																																					p.L274fs		.											.	SYNPO-153	0			c.822delA						.						82.0	91.0	88.0					5																	150027927		2203	4300	6503	SO:0001589	frameshift_variant	11346	exon3			.	AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.822delA	5.37:g.150027927delA	ENSP00000377789:p.Leu274fs	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	92	24	NM_001166209	0	0	0	0	0	A5PKZ8|D3DQG8|O15271|Q9UPX1	Frame_Shift_Del	DEL	ENST00000394243.1	37	CCDS54937.1																																																																																			.		0.602	SYNPO-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252371.1	NM_007286	
ZFP37	7539	broad.mit.edu;bcgsc.ca	37	9	115806495	115806495	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:115806495delG	ENST00000374227.3	-	4	430	c.403delC	c.(403-405)ctcfs	p.L136fs	ZFP37_ENST00000553380.1_Frame_Shift_Del_p.L151fs|ZFP37_ENST00000555206.1_Frame_Shift_Del_p.L137fs	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	136					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TCCCTGAGGAGTTTGTTTTGA	0.353																																					p.L135fs													.	ZFP37-92	0			c.403delC						.						85.0	91.0	89.0					9																	115806495		2171	4194	6365	SO:0001589	frameshift_variant	7539	exon4			TGAGGAGTTTGTT	AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.403delC	9.37:g.115806495delG	ENSP00000363344:p.Leu136fs	Somatic	158	0		WXS	Illumina HiSeq	Phase_I	190	27	NM_003408	0	0	0	0	0	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Frame_Shift_Del	DEL	ENST00000374227.3	37	CCDS6787.1																																																																																			.		0.353	ZFP37-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055439.1	NM_003408	
OR1N1	138883	bcgsc.ca	37	9	125288660	125288670	+	Frame_Shift_Del	DEL	GACTGAAGAGC	GACTGAAGAGC	-	rs202175357		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	GACTGAAGAGC	GACTGAAGAGC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:125288660_125288670delGACTGAAGAGC	ENST00000304880.2	-	1	902_912	c.903_913delGCTCTTCAGTC	c.(901-915)aggctcttcagtcacfs	p.LFSH302fs		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						ATACTCCTGTGACTGAAGAGCCTCTTTAGGG	0.46																																					p.301_305del													.	OR1N1-133	0			c.903_913del						.																																			SO:0001589	frameshift_variant	138883	exon1			TCCTGTGACTGAA	U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.903_913delGCTCTTCAGTC	9.37:g.125288660_125288670delGACTGAAGAGC	ENSP00000306974:p.Leu302fs	Somatic	82	0		WXS	Illumina HiSeq	Phase_1	78	4	NM_012363	0	0	0	0	0	A3KFM1|O43870|Q6IF16|Q96R93	Frame_Shift_Del	DEL	ENST00000304880.2	37	CCDS6844.1																																																																																			.		0.460	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053938.1		
LRRC27	80313	broad.mit.edu;bcgsc.ca	37	10	134144951	134144952	+	5'Flank	INS	-	-	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr10:134144951_134144952insC	ENST00000368614.3	+	0	0				LRRC27_ENST00000392638.2_5'Flank|LRRC27_ENST00000356571.4_5'Flank|STK32C_ENST00000368625.4_Frame_Shift_Ins_p.A97fs|LRRC27_ENST00000368613.4_5'Flank|LRRC27_ENST00000368615.3_5'Flank|LRRC27_ENST00000344079.5_5'Flank	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27											breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		GCGTTTCCTCGCCCCCCTCACT	0.579																																					.													.	LRRC27-91	0			.						.																																			SO:0001631	upstream_gene_variant	80313	.			TTCCTCGCCCCCC	AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284		10.37:g.134144957_134144957dupC	Exception_encountered	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	32	7	.	0	0	0	0	0	A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Frame_Shift_Ins	INS	ENST00000368614.3	37	CCDS31316.1																																																																																			.		0.579	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051058.2	XM_290462	
GIF	2694	broad.mit.edu;bcgsc.ca	37	11	59610051	59610052	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:59610051_59610052insG	ENST00000257248.2	-	4	422_423	c.375_376insC	c.(373-378)cccaacfs	p.N126fs	GIF_ENST00000541311.1_Frame_Shift_Ins_p.N101fs	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	126					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	GCTTCAGCGTTGGGGCCTCCGA	0.525																																					p.N126fs	NSCLC(53;1139 1245 16872 38474 42853)												.	GIF-92	0			c.376_377insC						.																																			SO:0001589	frameshift_variant	2694	exon4			CAGCGTTGGGGCC	X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.376dupC	11.37:g.59610055_59610055dupG	ENSP00000257248:p.Asn126fs	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	55	9	NM_005142	0	0	0	0	0	B2RAN8|B4DVZ1	Frame_Shift_Ins	INS	ENST00000257248.2	37	CCDS7977.1																																																																																			.		0.525	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394497.1	NM_005142	
INTS2	57508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	59945081	59945082	+	In_Frame_Ins	INS	-	-	GAA			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:59945081_59945082insGAA	ENST00000444766.3	-	25	3526_3527	c.3451_3452insTTC	c.(3451-3453)caa>cTTCaa	p.1150_1151insL	INTS2_ENST00000251334.6_In_Frame_Ins_p.1142_1143insL	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	1150					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						CTTTATTTGTTGAAGACCTACA	0.351																																					p.Q1151delinsLQ		.											.	INTS2-206	0			c.3452_3453insTTC						.																																			SO:0001652	inframe_insertion	57508	exon25			.	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.3449_3451dupTTC	17.37:g.59945082_59945084dupGAA	ENSP00000414237:p.Leu1150_Leu1150dup	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	132	27	NM_020748	0	0	0	0	0	Q9ULD3	In_Frame_Ins	INS	ENST00000444766.3	37	CCDS45750.1																																																																																			.		0.351	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
BCR	613	broad.mit.edu;bcgsc.ca	37	22	23523615	23523616	+	Frame_Shift_Ins	INS	-	-	A	rs369883604		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr22:23523615_23523616insA	ENST00000305877.8	+	1	1219_1220	c.468_469insA	c.(469-471)aacfs	p.N157fs	BCR_ENST00000398512.5_Frame_Shift_Ins_p.N157fs|BCR_ENST00000359540.3_Frame_Shift_Ins_p.N157fs	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	157	Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CGCTCAGGTCCAACTTCGAGCG	0.738			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.S156fs				Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	BCR-1349	0			c.468_469insA						.																																			SO:0001589	frameshift_variant	613	exon1			CAGGTCCAACTTC		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.470dupA	22.37:g.23523617_23523617dupA	ENSP00000303507:p.Asn157fs	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	83	18	NM_021574	0	0	0	0	0	P78501|Q12842|Q4LE80|Q6NZI3	Frame_Shift_Ins	INS	ENST00000305877.8	37	CCDS13806.1																																																																																			.		0.738	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
RPL24	6152	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	101401697	101401698	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:101401697_101401698insA	ENST00000394077.3	-	4	351_352	c.246_247insT	c.(244-249)attactfs	p.T83fs	RPL24_ENST00000495401.1_Frame_Shift_Ins_p.T83fs|RPL24_ENST00000469605.1_Frame_Shift_Ins_p.T83fs	NM_000986.3	NP_000977.1	P83731	RL24_HUMAN	ribosomal protein L24	83					cellular protein metabolic process (GO:0044267)|exit from mitosis (GO:0010458)|gene expression (GO:0010467)|mitotic cell cycle checkpoint (GO:0007093)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|optic nerve development (GO:0021554)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|ribosomal large subunit assembly (GO:0000027)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(2)|urinary_tract(1)	4						GATGCACCAGTAATGGCCCTCT	0.436																																					p.T83fs		.											.	RPL24-90	0			c.247_248insT						.																																			SO:0001589	frameshift_variant	6152	exon4			.	AB007177	CCDS33809.1	3q12	2011-04-06			ENSG00000114391	ENSG00000114391		"""L ribosomal proteins"""	10325	protein-coding gene	gene with protein product		604180				9582194	Standard	NM_000986		Approved	L24	uc003dvh.1	P83731	OTTHUMG00000159146	ENST00000394077.3:c.247dupT	3.37:g.101401699_101401699dupA	ENSP00000377640:p.Thr83fs	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	98	23	NM_000986	0	0	0	0	0	B2R4Y3|P38663|Q6IBS3	Frame_Shift_Ins	INS	ENST00000394077.3	37	CCDS33809.1																																																																																			.		0.436	RPL24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353487.1	NM_000986	
SLC7A14	57709	broad.mit.edu;bcgsc.ca	37	3	170201153	170201154	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:170201153_170201154insA	ENST00000231706.5	-	6	1379_1380	c.1064_1065insT	c.(1063-1065)ttcfs	p.F355fs	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	355					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TCGGCATCGGGAAGAGGGACCC	0.54											OREG0015917	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F355fs													.	SLC7A14-94	0			c.1065_1066insT						.																																			SO:0001589	frameshift_variant	57709	exon6			CATCGGGAAGAGG	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1065dupT	3.37:g.170201155_170201155dupA	ENSP00000231706:p.Phe355fs	Somatic	152	0	1883	WXS	Illumina HiSeq	Phase_I	105	12	NM_020949	0	0	0	0	0	B3KV33|Q9HCF9	Frame_Shift_Ins	INS	ENST00000231706.5	37	CCDS33892.1																																																																																			.		0.540	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	41496201	41496202	+	Missense_Mutation	DNP	AA	AA	TG			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr21:41496201_41496202AA>TG	ENST00000400454.1	-	20	4093_4094	c.3616_3617TT>CA	c.(3616-3618)TTt>CAt	p.F1206H		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1206	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCAGGACACAAAGACCATGGAG	0.564																																					p.F1206H	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	0			c.T3616C						.																																			SO:0001583	missense	1826	exon20			ACACAAAGACCAT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3616_3617delinsTG	21.37:g.41496201_41496202delinsTG	ENSP00000383303:p.Phe1206His	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	26.0		0	0	0	0	0	O60468	Missense_Mutation	DNP	ENST00000400454.1	37	CCDS42929.1																																																																																			.		0.564	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
