#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ASIC2	40	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	31618462	31618463	+	Intron	INS	-	-	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr17:31618462_31618463insT	ENST00000359872.6	-	2	1317				ASIC2_ENST00000225823.2_Frame_Shift_Ins_p.Y224fs|ASIC2_ENST00000448983.1_5'Flank	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GCTCGCCGCGGTACTTGCAGGA	0.688																																																	0																																										SO:0001627	intron_variant	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179377->A	17.37:g.31618463_31618463dupT		Somatic		WXS	Illumina HiSeq	Phase_I	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Frame_Shift_Del	INS	ENST00000359872.6	37	CCDS42296.1																																																																																				0.688	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1		NM_183377, NM_001094	
ACSS3	79611	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	81536908	81536908	+	Missense_Mutation	SNP	G	G	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr12:81536908G>A	ENST00000548058.1	+	5	1713	c.803G>A	c.(802-804)gGt>gAt	p.G268D	ACSS3_ENST00000261206.3_Missense_Mutation_p.G267D			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	268						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)	p.G268D(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						TTGGCTCCCGGTCGTGACCTT	0.403																																																	1	Substitution - Missense(1)	kidney(1)											105.0	97.0	100.0					12																	81536908		2203	4300	6503	SO:0001583	missense	79611				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.803G>A	12.37:g.81536908G>A	ENSP00000449535:p.Gly268Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	37	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	G	9.913	1.210101	0.22289	.	.	ENSG00000111058	ENST00000548058;ENST00000261206	T;T	0.39592	1.07;1.07	5.58	3.76	0.43208	AMP-dependent synthetase/ligase (1);	0.226250	0.53938	N	0.000060	T	0.35008	0.0917	L	0.50993	1.605	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.15235	-1.0444	10	0.51188	T	0.08	-9.9538	8.3603	0.32355	0.1347:0.0:0.739:0.1262	.	268	Q9H6R3	ACSS3_HUMAN	D	268;267	ENSP00000449535:G268D;ENSP00000261206:G267D	ENSP00000261206:G267D	G	+	2	0	ACSS3	80061039	0.998000	0.40836	0.777000	0.31699	0.310000	0.27922	2.565000	0.45939	0.841000	0.35020	-0.291000	0.09656	GGT		0.403	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1		NM_024560	
ACTG1	71	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	79477756	79477756	+	Missense_Mutation	SNP	T	T	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr17:79477756T>C	ENST00000575842.1	-	5	1514	c.1088A>G	c.(1087-1089)gAc>gGc	p.D363G	ACTG1_ENST00000331925.2_Missense_Mutation_p.D363G|ACTG1_ENST00000575087.1_Missense_Mutation_p.D363G|ACTG1_ENST00000573283.1_Missense_Mutation_p.D363G|AC139149.1_ENST00000584254.1_RNA			P63261	ACTG_HUMAN	actin, gamma 1	363					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)	p.D363G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			GCCCGACTCGTCGTACTCCTG	0.547																																																	1	Substitution - Missense(1)	kidney(1)											88.0	88.0	88.0					17																	79477756		2203	4300	6503	SO:0001583	missense	71				CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.1088A>G	17.37:g.79477756T>C	ENSP00000458162:p.Asp363Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	t	11.70	1.716671	0.30413	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.94966	-3.57	4.05	2.96	0.34315	Actin, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.97801	0.9278	H	0.96208	3.785	0.51233	D	0.999911	D	0.55605	0.972	D	0.80764	0.994	D	0.97368	0.9974	10	0.87932	D	0	.	10.372	0.44060	0.0:0.0:0.1653:0.8347	.	363	P63261	ACTG_HUMAN	G	363;321	ENSP00000331514:D363G	ENSP00000331514:D363G	D	-	2	0	ACTG1	77092351	1.000000	0.71417	0.842000	0.33263	0.784000	0.44337	7.467000	0.80930	0.613000	0.30089	0.525000	0.51046	GAC		0.547	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2		NM_001614	
ACVR2B	93	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	38519652	38519652	+	Missense_Mutation	SNP	A	A	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr3:38519652A>G	ENST00000352511.4	+	4	863	c.391A>G	c.(391-393)Aca>Gca	p.T131A		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	131					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.T131A(1)		lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		GCCACCCCCGACAGCCCCCAC	0.632																																																	1	Substitution - Missense(1)	kidney(1)											46.0	46.0	46.0					3																	38519652		2203	4300	6503	SO:0001583	missense	93			X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.391A>G	3.37:g.38519652A>G	ENSP00000340361:p.Thr131Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VAV0	Missense_Mutation	SNP	ENST00000352511.4	37	CCDS2679.1	.	.	.	.	.	.	.	.	.	.	A	8.004	0.755967	0.15846	.	.	ENSG00000114739	ENST00000352511	D	0.83755	-1.76	4.77	3.52	0.40303	.	0.484226	0.22620	N	0.057703	T	0.61615	0.2361	N	0.08118	0	0.29923	N	0.822536	B	0.02656	0.0	B	0.06405	0.002	T	0.51498	-0.8698	10	0.08179	T	0.78	.	9.1721	0.37089	0.6703:0.3297:0.0:0.0	.	131	Q13705	AVR2B_HUMAN	A	131	ENSP00000340361:T131A	ENSP00000340361:T131A	T	+	1	0	ACVR2B	38494656	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	2.852000	0.48310	1.788000	0.52465	0.379000	0.24179	ACA		0.632	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254059.3		NM_001106	
ADAMTS4	9507	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	161166010	161166010	+	Silent	SNP	A	A	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr1:161166010A>T	ENST00000367996.5	-	3	1469	c.1041T>A	c.(1039-1041)atT>atA	p.I347I	ADAMTS4_ENST00000367995.3_3'UTR|ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	347	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)	p.I347I(2)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	CATCCTCCACAATGGCACAGC	0.577																																																	2	Substitution - coding silent(2)	kidney(2)											104.0	98.0	100.0					1																	161166010		2203	4300	6503	SO:0001819	synonymous_variant	9507			AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.1041T>A	1.37:g.161166010A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Silent	SNP	ENST00000367996.5	37	CCDS1223.1																																																																																				0.577	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2		NM_005099	
BCLAF1	9774	broad.mit.edu;hgsc.bcm.edu	37	6	136597333	136597333	+	Missense_Mutation	SNP	G	G	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr6:136597333G>T	ENST00000531224.1	-	5	1582	c.1330C>A	c.(1330-1332)Ctg>Atg	p.L444M	BCLAF1_ENST00000527759.1_Missense_Mutation_p.L442M|BCLAF1_ENST00000527536.1_Missense_Mutation_p.L444M|BCLAF1_ENST00000530767.1_Intron|BCLAF1_ENST00000392348.2_Missense_Mutation_p.L442M|BCLAF1_ENST00000353331.4_Missense_Mutation_p.L442M	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	444					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.L444M(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TTGCCTTTCAGTGAAACTTTG	0.393																																					Colon(142;1534 1789 5427 7063 28491)												1	Substitution - Missense(1)	kidney(1)											160.0	160.0	160.0					6																	136597333		2203	4300	6503	SO:0001583	missense	9774			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1330C>A	6.37:g.136597333G>T	ENSP00000435210:p.Leu444Met	Somatic		WXS	Illumina HiSeq	Phase_I	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	G	9.244	1.038909	0.19669	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T	0.12569	2.84;2.84;2.87;2.85;2.84;2.67	5.21	1.24	0.21308	.	0.132422	0.33938	N	0.004411	T	0.02455	0.0075	N	0.22421	0.69	0.80722	D	1	B;B;B	0.17268	0.005;0.021;0.005	B;B;B	0.15870	0.014;0.006;0.014	T	0.39800	-0.9596	10	0.31617	T	0.26	-3.4136	4.7849	0.13220	0.318:0.0:0.4726:0.2094	.	442;442;444	Q9NYF8-2;Q9NYF8-3;Q9NYF8	.;.;BCLF1_HUMAN	M	444;442;444;442;442;444	ENSP00000435210:L444M;ENSP00000229446:L442M;ENSP00000435441:L444M;ENSP00000434826:L442M;ENSP00000376159:L442M;ENSP00000431734:L444M	ENSP00000229446:L442M	L	-	1	2	BCLAF1	136639026	0.999000	0.42202	0.998000	0.56505	0.997000	0.91878	0.418000	0.21230	0.009000	0.14813	0.644000	0.83932	CTG		0.393	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2		NM_014739	
BTBD8	284697	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	92554272	92554272	+	Missense_Mutation	SNP	T	T	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr1:92554272T>G	ENST00000342818.3	+	2	403	c.167T>G	c.(166-168)tTc>tGc	p.F56C	BTBD8_ENST00000370382.3_Missense_Mutation_p.F56C|BTBD8_ENST00000540648.1_Missense_Mutation_p.F56C	NM_183242.3	NP_899065.2	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	56						nucleus (GO:0005634)		p.F56C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)	16		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		AGGGAAGAATTCCATACAGAT	0.308																																																	1	Substitution - Missense(1)	kidney(1)											83.0	85.0	84.0					1																	92554272		2203	4300	6503	SO:0001583	missense	284697			AY346333	CCDS737.1	1p22.1	2013-01-08			ENSG00000189195	ENSG00000189195		"""BTB/POZ domain containing"""	21019	protein-coding gene	gene with protein product						14654994	Standard	NM_183242		Approved		uc001doo.3	Q5XKL5	OTTHUMG00000010289	ENST00000342818.3:c.167T>G	1.37:g.92554272T>G	ENSP00000343686:p.Phe56Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6V9S5	Missense_Mutation	SNP	ENST00000342818.3	37	CCDS737.1	.	.	.	.	.	.	.	.	.	.	T	14.23	2.473232	0.43942	.	.	ENSG00000189195	ENST00000370382;ENST00000342818;ENST00000540648	T;T;T	0.67698	-0.28;-0.28;-0.28	5.31	4.17	0.49024	BTB/POZ (1);BTB/POZ fold (2);	0.477968	0.19605	N	0.110281	T	0.37320	0.0999	L	0.37697	1.125	0.23174	N	0.99817	P	0.40731	0.728	B	0.38616	0.277	T	0.10382	-1.0632	10	0.36615	T	0.2	-10.4484	10.9475	0.47310	0.1406:0.0:0.0:0.8594	.	56	Q5XKL5	BTBD8_HUMAN	C	56	ENSP00000359408:F56C;ENSP00000343686:F56C;ENSP00000443397:F56C	ENSP00000343686:F56C	F	+	2	0	BTBD8	92326860	0.955000	0.32602	0.656000	0.29637	0.793000	0.44817	2.242000	0.43106	0.936000	0.37367	0.482000	0.46254	TTC		0.308	BTBD8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028372.1		NM_183242	
CCDC37	348807	broad.mit.edu;hgsc.bcm.edu	37	3	126142411	126142411	+	Missense_Mutation	SNP	C	C	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr3:126142411C>A	ENST00000352312.1	+	13	1309	c.1210C>A	c.(1210-1212)Ctg>Atg	p.L404M	CCDC37_ENST00000505024.1_Missense_Mutation_p.L405M|CCDC37_ENST00000393425.1_Missense_Mutation_p.L405M	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	404								p.L404M(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		GAACCTGTCGCTGATCCAGAA	0.597																																																	1	Substitution - Missense(1)	kidney(1)											91.0	77.0	82.0					3																	126142411		2203	4300	6503	SO:0001583	missense	348807			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.1210C>A	3.37:g.126142411C>A	ENSP00000344749:p.Leu404Met	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	ENST00000352312.1	37	CCDS3037.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513949	0.64522	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.55930	0.49;0.49;0.49	4.93	4.06	0.47325	.	0.155787	0.43110	D	0.000611	T	0.69717	0.3142	M	0.82132	2.575	0.47621	D	0.999471	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.71189	-0.4666	10	0.72032	D	0.01	-22.0493	7.6787	0.28500	0.0:0.8088:0.0:0.1912	.	405;404	Q494V2-2;Q494V2	.;CCD37_HUMAN	M	404;405;405	ENSP00000344749:L404M;ENSP00000377076:L405M;ENSP00000423046:L405M	ENSP00000344749:L404M	L	+	1	2	CCDC37	127625101	0.986000	0.35501	0.813000	0.32504	0.962000	0.63368	2.685000	0.46959	1.081000	0.41110	0.491000	0.48974	CTG		0.597	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000370099.4		NM_182628	
CCNB3	85417	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	50054338	50054338	+	Missense_Mutation	SNP	C	C	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chrX:50054338C>A	ENST00000376042.1	+	6	3467	c.3169C>A	c.(3169-3171)Cca>Aca	p.P1057T	CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.P1057T			Q8WWL7	CCNB3_HUMAN	cyclin B3	1057					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.P1057T(2)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					TGGAACCAGCCCATATGTGTT	0.522																																																	2	Substitution - Missense(2)	kidney(2)											115.0	92.0	100.0					X																	50054338		2203	4300	6503	SO:0001583	missense	85417			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.3169C>A	X.37:g.50054338C>A	ENSP00000365210:p.Pro1057Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	37	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	C	9.251	1.040803	0.19669	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.19938	2.11;2.11	2.74	-0.0331	0.13902	.	718.655000	0.00166	N	0.000018	T	0.17916	0.0430	N	0.24115	0.695	0.09310	N	1	D	0.56287	0.975	P	0.46362	0.514	T	0.10989	-1.0606	9	.	.	.	.	5.0148	0.14330	0.0:0.514:0.0:0.486	.	1057	Q8WWL7	CCNB3_HUMAN	T	1057	ENSP00000365210:P1057T;ENSP00000276014:P1057T	.	P	+	1	0	CCNB3	50071078	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	-1.636000	0.02016	-0.139000	0.11414	0.529000	0.55759	CCA		0.522	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1			
CCT4	10575	hgsc.bcm.edu;ucsc.edu	37	2	62104113	62104114	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr2:62104113_62104114insT	ENST00000394440.3	-	7	1014_1015	c.718_719insA	c.(718-720)agafs	p.R240fs	CCT4_ENST00000461540.2_5'UTR|CCT4_ENST00000538252.1_Frame_Shift_Ins_p.R184fs|AC107081.5_ENST00000425779.1_RNA|CCT4_ENST00000544185.1_Frame_Shift_Ins_p.R90fs|CCT4_ENST00000544079.1_Frame_Shift_Ins_p.R210fs	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	240					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			CTTTTCAACTCTGGTTATGCCA	0.406																																																	0																																										SO:0001589	frameshift_variant	10575				CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.719dupA	2.37:g.62104114_62104114dupT	ENSP00000377958:p.Arg240fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Frame_Shift_Ins	INS	ENST00000394440.3	37	CCDS33206.1																																																																																				0.406	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325548.2			
CPNE3	8895	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	87568470	87568470	+	Missense_Mutation	SNP	G	G	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr8:87568470G>C	ENST00000521271.1	+	16	1557	c.1395G>C	c.(1393-1395)gaG>gaC	p.E465D	CPNE3_ENST00000198765.4_Missense_Mutation_p.E465D	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	465	VWFA.				lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)	p.E465D(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						GCGCCATGGAGTTTCTGGATG	0.493																																																	1	Substitution - Missense(1)	kidney(1)											148.0	129.0	136.0					8																	87568470		2203	4300	6503	SO:0001583	missense	8895			AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.1395G>C	8.37:g.87568470G>C	ENSP00000430934:p.Glu465Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA47|Q8IYA1	Missense_Mutation	SNP	ENST00000521271.1	37	CCDS6243.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196570	0.79015	.	.	ENSG00000085719	ENST00000198765;ENST00000521271	T;T	0.24538	1.85;1.85	5.72	3.91	0.45181	von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	T	0.49029	0.1533	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.47433	-0.9118	10	0.59425	D	0.04	-23.9957	10.0457	0.42186	0.201:0.0:0.799:0.0	.	465	O75131	CPNE3_HUMAN	D	465	ENSP00000198765:E465D;ENSP00000430934:E465D	ENSP00000198765:E465D	E	+	3	2	CPNE3	87637586	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.261000	0.58841	0.756000	0.33013	0.650000	0.86243	GAG		0.493	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374994.1			
CSRP2BP	57325	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	18125954	18125954	+	Missense_Mutation	SNP	G	G	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr20:18125954G>T	ENST00000435364.3	+	2	678	c.337G>T	c.(337-339)Ggc>Tgc	p.G113C	CSRP2BP_ENST00000489634.2_5'UTR|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.G113C	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	113					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)	p.G113C(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						CTCAGCAGATGGCAAGGAGCA	0.458																																																	1	Substitution - Missense(1)	kidney(1)											182.0	186.0	185.0					20																	18125954		2203	4300	6503	SO:0001583	missense	57325			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.337G>T	20.37:g.18125954G>T	ENSP00000392318:p.Gly113Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611761	0.87258	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364	T;T;T	0.20738	2.05;2.05;2.05	5.28	5.28	0.74379	.	0.056142	0.64402	D	0.000001	T	0.44201	0.1282	M	0.64997	1.995	0.80722	D	1	D	0.71674	0.998	D	0.62955	0.909	T	0.34054	-0.9844	10	0.72032	D	0.01	-22.0886	19.2737	0.94021	0.0:0.0:1.0:0.0	.	113	Q9H8E8	CSR2B_HUMAN	C	113	ENSP00000278816:G113C;ENSP00000366909:G113C;ENSP00000392318:G113C	ENSP00000278816:G113C	G	+	1	0	CSRP2BP	18073954	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.895000	0.92512	2.633000	0.89246	0.467000	0.42956	GGC		0.458	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5		NM_020536	
CUTA	51596	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	33384503	33384503	+	Missense_Mutation	SNP	T	T	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr6:33384503T>C	ENST00000488034.1	-	6	585	c.464A>G	c.(463-465)cAg>cGg	p.Q155R	CUTA_ENST00000607266.1_Missense_Mutation_p.Q132R|CUTA_ENST00000374500.5_Missense_Mutation_p.Q174R|CUTA_ENST00000374496.3_Missense_Mutation_p.Q132R|CUTA_ENST00000492510.1_5'Flank|CUTA_ENST00000488478.1_Silent_p.T138T|CUTA_ENST00000494751.1_Intron|CUTA_ENST00000440279.3_Missense_Mutation_p.Q132R	NM_001014837.1|NM_001014838.1|NM_001014840.1|NM_015921.2	NP_001014837.1|NP_001014838.1|NP_001014840.1|NP_057005.1	O60888	CUTA_HUMAN	cutA divalent cation tolerance homolog (E. coli)	155					protein localization (GO:0008104)|response to metal ion (GO:0010038)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)	p.Q132R(1)	SLC22A1/CUTA(2)	kidney(1)|lung(3)|urinary_tract(1)	5						AAAGTTCCCCTGTTCCACAGG	0.517																																																	1	Substitution - Missense(1)	kidney(1)											118.0	99.0	105.0					6																	33384503		2203	4300	6503	SO:0001583	missense	51596			AF106943	CCDS4779.1, CCDS34432.1, CCDS34433.1	6p21.32	2008-02-04	2006-02-15	2006-02-15	ENSG00000112514	ENSG00000112514			21101	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 82"", ""acetylcholinesterase-associated protein"""	C6orf82, ACHAP			Standard	XM_006715108		Approved		uc003oen.1	O60888	OTTHUMG00000031254	ENST00000488034.1:c.464A>G	6.37:g.33384503T>C	ENSP00000417544:p.Gln155Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A2AB26|A2BEL4|Q3B784|Q5JXM9|Q5SU05|Q9NYQ9	Missense_Mutation	SNP	ENST00000488034.1	37	CCDS34433.1	.	.	.	.	.	.	.	.	.	.	T	19.62	3.861359	0.71949	.	.	ENSG00000112514	ENST00000374500;ENST00000440279;ENST00000488034;ENST00000374496	.	.	.	4.98	4.98	0.66077	Nitrogen regulatory PII-like, alpha/beta (1);	0.178753	0.50627	D	0.000113	T	0.34424	0.0897	N	0.25094	0.71	0.80722	D	1	P;P	0.50443	0.92;0.935	P;P	0.53988	0.699;0.739	T	0.12142	-1.0559	9	0.20519	T	0.43	-26.8813	10.9821	0.47501	0.0:0.0:0.0:1.0	.	174;155	O60888-2;O60888	.;CUTA_HUMAN	R	174;132;155;132	.	ENSP00000363620:Q132R	Q	-	2	0	CUTA	33492481	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	5.410000	0.66381	2.088000	0.63022	0.533000	0.62120	CAG		0.517	CUTA-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076541.3		NM_015921	
DAND5	199699	broad.mit.edu;ucsc.edu	37	19	13084386	13084386	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr19:13084386C>G	ENST00000317060.2	+	2	687	c.508C>G	c.(508-510)Cgt>Ggt	p.R170G	DAND5_ENST00000585548.1_3'UTR	NM_152654.2	NP_689867.1	Q8N907	DAND5_HUMAN	DAN domain family member 5, BMP antagonist	170	CTCK.				atrial septum development (GO:0003283)|determination of heart left/right asymmetry (GO:0061371)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of nodal signaling pathway (GO:1900108)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|sequestering of nodal from receptor via nodal binding (GO:0038101)|ventricular septum development (GO:0003281)	extracellular region (GO:0005576)	morphogen activity (GO:0016015)	p.R170G(1)		kidney(2)|lung(3)|ovary(1)	6			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)			CTCAGCCTCCCGTCGACGGGT	0.607																																																	1	Substitution - Missense(1)	kidney(1)											133.0	109.0	117.0					19																	13084386		2203	4300	6503	SO:0001583	missense	199699			AK095926	CCDS12291.1	19p13	2013-02-26	2013-02-26			ENSG00000179284			26780	protein-coding gene	gene with protein product		609068	"""DAN domain family, member 5"""			15254711	Standard	NM_152654		Approved	FLJ38607, CKTSF1B3, DANTE, GREM3, CER2, DTE	uc002mwc.1	Q8N907		ENST00000317060.2:c.508C>G	19.37:g.13084386C>G	ENSP00000323155:p.Arg170Gly	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000317060.2	37	CCDS12291.1	.	.	.	.	.	.	.	.	.	.	C	11.69	1.712743	0.30413	.	.	ENSG00000179284	ENST00000317060	T	0.33654	1.4	5.49	2.2	0.27929	DAN (1);	0.906086	0.09091	N	0.849807	T	0.36276	0.0961	L	0.46157	1.445	0.09310	N	1	P	0.38597	0.639	P	0.45071	0.468	T	0.28490	-1.0042	10	0.45353	T	0.12	-1.7171	4.9825	0.14172	0.1679:0.657:0.0:0.1752	.	170	Q8N907	DAND5_HUMAN	G	170	ENSP00000323155:R170G	ENSP00000323155:R170G	R	+	1	0	DAND5	12945386	0.003000	0.15002	0.002000	0.10522	0.065000	0.16274	0.242000	0.18087	0.280000	0.22209	0.655000	0.94253	CGT		0.607	DAND5-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452761.1		NM_152654	
DDX4	54514	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	55056036	55056036	+	Missense_Mutation	SNP	G	G	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr5:55056036G>A	ENST00000505374.1	+	4	228	c.136G>A	c.(136-138)Gat>Aat	p.D46N	SLC38A9_ENST00000504880.1_Intron|DDX4_ENST00000508580.1_3'UTR|DDX4_ENST00000353507.5_Missense_Mutation_p.D46N|DDX4_ENST00000354991.5_Missense_Mutation_p.D46N|DDX4_ENST00000514278.2_Missense_Mutation_p.D46N	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	46					male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)	p.D46N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				AGAAATGGATGATGGACCTTC	0.388																																																	1	Substitution - Missense(1)	kidney(1)											178.0	176.0	177.0					5																	55056036		2203	4300	6503	SO:0001583	missense	54514			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.136G>A	5.37:g.55056036G>A	ENSP00000424838:p.Asp46Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	37	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.312402	0.40895	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000506848;ENST00000514679;ENST00000354991;ENST00000511491	T;T;T;T;T;T;T	0.58060	1.94;1.94;1.98;3.46;0.45;1.94;0.36	4.86	4.0	0.46444	.	0.924655	0.09258	N	0.827037	T	0.37128	0.0992	N	0.19112	0.55	0.26454	N	0.975553	B;B;B	0.30361	0.277;0.005;0.181	B;B;B	0.33042	0.157;0.004;0.051	T	0.26467	-1.0102	10	0.14252	T	0.57	-33.1535	8.9224	0.35619	0.1005:0.0:0.8995:0.0	.	46;46;46	D6RDK4;Q9NQI0-2;Q9NQI0	.;.;DDX4_HUMAN	N	46	ENSP00000334167:D46N;ENSP00000425359:D46N;ENSP00000424838:D46N;ENSP00000427167:D46N;ENSP00000424112:D46N;ENSP00000347087:D46N;ENSP00000427522:D46N	ENSP00000334167:D46N	D	+	1	0	DDX4	55091793	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	3.949000	0.56668	1.271000	0.44313	-0.251000	0.11542	GAT		0.388	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2		NM_024415	
DPP9	91039	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	4704158	4704158	+	Silent	SNP	G	G	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr19:4704158G>A	ENST00000598800.1	-	7	1003	c.498C>T	c.(496-498)ggC>ggT	p.G166G	DPP9_ENST00000597849.1_Silent_p.G195G|DPP9_ENST00000262960.9_Silent_p.G195G|DPP9_ENST00000594671.1_Silent_p.G166G			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9	166						cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)	p.G274G(1)		cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		AGCCGTTCTTGCCGCCGTCGC	0.672																																																	1	Substitution - coding silent(1)	kidney(1)											36.0	44.0	42.0					19																	4704158		2033	4170	6203	SO:0001819	synonymous_variant	91039			AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.498C>T	19.37:g.4704158G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Silent	SNP	ENST00000598800.1	37																																																																																					0.672	DPP9-026	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000459343.2			
ESAM	90952	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	124623594	124623594	+	Missense_Mutation	SNP	C	C	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr11:124623594C>A	ENST00000278927.5	-	7	1250	c.1121G>T	c.(1120-1122)gGt>gTt	p.G374V	VSIG2_ENST00000326621.5_5'Flank|VSIG2_ENST00000403470.1_5'Flank|ESAM_ENST00000442070.2_Intron	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	374					blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.G374V(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		AGGCACAGCACCCATGCGGCT	0.587																																																	1	Substitution - Missense(1)	kidney(1)											58.0	60.0	59.0					11																	124623594		2201	4299	6500	SO:0001583	missense	90952			AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.1121G>T	11.37:g.124623594C>A	ENSP00000278927:p.Gly374Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DVN8|Q96T50	Missense_Mutation	SNP	ENST00000278927.5	37	CCDS8453.1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.742605	0.69418	.	.	ENSG00000149564	ENST00000278927	T	0.61392	0.11	5.17	4.25	0.50352	.	0.059006	0.64402	D	0.000002	T	0.73651	0.3614	M	0.79011	2.435	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.76721	-0.2855	10	0.72032	D	0.01	.	11.5321	0.50616	0.0:0.9139:0.0:0.0861	.	374	Q96AP7	ESAM_HUMAN	V	374	ENSP00000278927:G374V	ENSP00000278927:G374V	G	-	2	0	ESAM	124128804	0.997000	0.39634	1.000000	0.80357	0.978000	0.69477	3.895000	0.56258	1.295000	0.44724	0.655000	0.94253	GGT		0.587	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1		NM_138961	
FIGN	55137	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	164466509	164466509	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr2:164466509C>G	ENST00000333129.3	-	3	2147	c.1833G>C	c.(1831-1833)atG>atC	p.M611I	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	611					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.M611I(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						TGTCCAGTTGCATCAGAAATT	0.443																																																	1	Substitution - Missense(1)	kidney(1)											108.0	102.0	104.0					2																	164466509		1956	4153	6109	SO:0001583	missense	55137			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1833G>C	2.37:g.164466509C>G	ENSP00000333836:p.Met611Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	C	11.24	1.580047	0.28180	.	.	ENSG00000182263	ENST00000333129	D	0.94723	-3.5	5.47	5.47	0.80525	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.080649	0.85682	D	0.000000	D	0.88190	0.6370	N	0.03930	-0.32	0.80722	D	1	B	0.17667	0.023	B	0.29598	0.104	T	0.82506	-0.0423	10	0.25106	T	0.35	-14.8258	19.6959	0.96026	0.0:1.0:0.0:0.0	.	611	Q5HY92	FIGN_HUMAN	I	611	ENSP00000333836:M611I	ENSP00000333836:M611I	M	-	3	0	FIGN	164174755	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.212000	0.51145	2.729000	0.93468	0.467000	0.42956	ATG		0.443	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2		NM_018086	
FUS	2521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	31201624	31201624	+	Silent	SNP	T	T	C	rs76570520		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr16:31201624T>C	ENST00000254108.7	+	12	1302	c.1197T>C	c.(1195-1197)ggT>ggC	p.G399G	FUS_ENST00000568685.1_Silent_p.G400G|FUS_ENST00000380244.3_Silent_p.G398G|FUS_ENST00000474990.1_3'UTR	NM_001170634.1|NM_001170937.1|NM_004960.3	NP_001164105.1|NP_001164408.1|NP_004951.1	P35637	FUS_HUMAN	FUS RNA binding protein	399	Arg/Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.G399G(1)	FUS/ERG(167)|FUS/DDIT3(631)|FUS/FEV(2)|FUS/ATF1(4)|FUS/CREB3L1(6)|FUS/CREB3L2(158)	breast(3)|endometrium(5)|kidney(3)|large_intestine(1)|lung(5)|prostate(3)|skin(1)|urinary_tract(1)	22		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		gctatggaggtggtggcagtg	0.572			T	"""DDIT3, ERG, FEV, ATF1, CREB3L2, CREB3L1"""	"""liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma"""																																			Dom	yes		16	16p11.2	2521	"""fusion, derived from t(12;16) malignant liposarcoma"""		"""M, L"""	1	Substitution - coding silent(1)	kidney(1)											150.0	111.0	124.0					16																	31201624		2197	4300	6497	SO:0001819	synonymous_variant	2521			AF071213	CCDS10707.1, CCDS58454.1	16p11.2	2014-09-17	2014-05-09		ENSG00000089280	ENSG00000089280		"""RNA binding motif (RRM) containing"""	4010	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein P2"", ""translocated in liposarcoma"""	137070	"""fusion, derived from t(12;16) malignant liposarcoma"", ""amyotrophic lateral sclerosis 6"", ""fusion (involved in t(12;16) in malignant liposarcoma)"", ""fused in sarcoma"""	ALS6		2372777, 7503811, 19251628, 19251627	Standard	NM_004960		Approved	TLS, FUS1, hnRNP-P2, HNRNPP2	uc002ebe.2	P35637	OTTHUMG00000132395	ENST00000254108.7:c.1197T>C	16.37:g.31201624T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H4A8	Silent	SNP	ENST00000254108.7	37	CCDS10707.1																																																																																				0.572	FUS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255526.2		NM_004960	
GBP1	2633	broad.mit.edu;hgsc.bcm.edu	37	1	89525013	89525013	+	Missense_Mutation	SNP	T	T	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr1:89525013T>C	ENST00000370473.4	-	4	634	c.415A>G	c.(415-417)Atg>Gtg	p.M139V		NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	139	GB1/RHD3-type G.|GTPase domain (Globular).				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.M139V(1)		endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		AGTTGGTCCATAGCCTGCTGG	0.522																																																	1	Substitution - Missense(1)	kidney(1)											198.0	167.0	178.0					1																	89525013		2203	4300	6503	SO:0001583	missense	2633			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.415A>G	1.37:g.89525013T>C	ENSP00000359504:p.Met139Val	Somatic		WXS	Illumina HiSeq	Phase_I	D3DT26|Q5T8M1	Missense_Mutation	SNP	ENST00000370473.4	37	CCDS718.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.995692	0.35226	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	T	0.74106	-0.81	4.6	4.6	0.57074	Guanylate-binding protein, N-terminal (1);	0.137477	0.64402	D	0.000009	T	0.60038	0.2238	M	0.66297	2.02	0.28799	N	0.898867	B	0.30033	0.266	B	0.33042	0.157	T	0.60281	-0.7294	10	0.51188	T	0.08	.	11.9789	0.53109	0.0:0.0:0.0:1.0	.	139	P32455	GBP1_HUMAN	V	139;102	ENSP00000359504:M139V	ENSP00000359504:M139V	M	-	1	0	GBP1	89297601	0.983000	0.35010	1.000000	0.80357	0.706000	0.40770	-0.127000	0.10547	1.720000	0.51447	0.254000	0.18369	ATG		0.522	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029289.3		NM_002053	
PAXBP1	94104	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	34120909	34120909	+	Silent	SNP	T	T	C	rs371129196		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr21:34120909T>C	ENST00000331923.4	-	11	2013	c.1824A>G	c.(1822-1824)aaA>aaG	p.K608K	PAXBP1_ENST00000290178.4_Silent_p.K608K	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	608					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K608K(1)									ATGTGTAGTATTTTGAACGCC	0.383																																																	1	Substitution - coding silent(1)	kidney(1)						T	,	1,4405	2.1+/-5.4	0,1,2202	104.0	99.0	101.0		1824,1824	2.3	1.0	21		101	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	GCFC1	NM_013329.3,NM_016631.3	,	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	,	608/816,608/918	34120909	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.1824A>G	21.37:g.34120909T>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DSE7|Q96DU8|Q9NYQ0	Silent	SNP	ENST00000331923.4	37	CCDS13619.1																																																																																				0.383	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139563.1		NM_013329	
GNMT	27232	hgsc.bcm.edu;ucsc.edu	37	6	42929965	42929969	+	Frame_Shift_Del	DEL	GCTGG	GCTGG	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	GCTGG	GCTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr6:42929965_42929969delGCTGG	ENST00000372808.3	+	2	232_236	c.222_226delGCTGG	c.(220-228)atgctggtgfs	p.MLV74fs		NM_018960.4	NP_061833.1	Q14749	GNMT_HUMAN	glycine N-methyltransferase	74					cellular protein modification process (GO:0006464)|glycogen metabolic process (GO:0005977)|methionine metabolic process (GO:0006555)|one-carbon metabolic process (GO:0006730)|protein homotetramerization (GO:0051289)|regulation of gluconeogenesis (GO:0006111)|S-adenosylmethionine metabolic process (GO:0046500)	cytoplasm (GO:0005737)	folic acid binding (GO:0005542)|glycine binding (GO:0016594)|glycine N-methyltransferase activity (GO:0017174)			kidney(2)|large_intestine(1)|lung(1)	4	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	ACTCCATTATGCTGGTGGAAGAGGG	0.6																																																	0																																										SO:0001589	frameshift_variant	27232			AF101475	CCDS4876.1	6p12	2008-02-05			ENSG00000124713	ENSG00000124713			4415	protein-coding gene	gene with protein product		606628				10843803, 9495250	Standard	NM_018960		Approved		uc003otd.3	Q14749	OTTHUMG00000014712	ENST00000372808.3:c.222_226delGCTGG	6.37:g.42929965_42929969delGCTGG	ENSP00000361894:p.Met74fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T8W2|Q9NNZ1|Q9NS24	Frame_Shift_Del	DEL	ENST00000372808.3	37	CCDS4876.1																																																																																				0.600	GNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040568.1		NM_018960	
GPSM1	26086	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	139250844	139250844	+	Missense_Mutation	SNP	A	A	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr9:139250844A>T	ENST00000440944.1	+	13	1883	c.1663A>T	c.(1663-1665)Atc>Ttc	p.I555F	GPSM1_ENST00000392944.1_Missense_Mutation_p.I46F|GPSM1_ENST00000429455.1_Missense_Mutation_p.I46F	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	555	GoLoco 2. {ECO:0000255|PROSITE- ProRule:PRU00097}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)	p.I532F(1)		biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CTTCGACCTCATCGCCAGCTC	0.711																																																	1	Substitution - Missense(1)	kidney(1)											16.0	20.0	19.0					9																	139250844		2196	4291	6487	SO:0001583	missense	26086			AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1663A>T	9.37:g.139250844A>T	ENSP00000392828:p.Ile555Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Missense_Mutation	SNP	ENST00000440944.1	37	CCDS48055.1	.	.	.	.	.	.	.	.	.	.	A	29.0	4.967250	0.92855	.	.	ENSG00000160360	ENST00000440944;ENST00000354753;ENST00000429455;ENST00000392944;ENST00000291775	D;D	0.94280	-3.39;-3.37	5.3	4.16	0.48862	GoLoco motif (3);	0.107102	0.64402	D	0.000007	D	0.96178	0.8754	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95599	0.8661	10	0.62326	D	0.03	-10.8616	11.2445	0.48990	0.8358:0.1642:0.0:0.0	.	555	Q86YR5	GPSM1_HUMAN	F	555;532;46;46;46	ENSP00000392828:I555F;ENSP00000346797:I532F	ENSP00000291775:I46F	I	+	1	0	GPSM1	138370665	1.000000	0.71417	0.989000	0.46669	0.981000	0.71138	4.506000	0.60428	0.852000	0.35287	0.379000	0.24179	ATC		0.711	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_015597	
INPP5F	22876	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	121567515	121567515	+	Missense_Mutation	SNP	G	G	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr10:121567515G>C	ENST00000361976.2	+	13	1678	c.1512G>C	c.(1510-1512)atG>atC	p.M504I		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.M504I(1)		breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		ACCAGATAATGTGGGCCAATA	0.438																																																	1	Substitution - Missense(1)	kidney(1)											119.0	107.0	111.0					10																	121567515		2203	4300	6503	SO:0001583	missense	22876			AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1512G>C	10.37:g.121567515G>C	ENSP00000354519:p.Met504Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	37	CCDS7616.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016010	0.54468	.	.	ENSG00000198825	ENST00000361976	T	0.23348	1.91	5.55	5.55	0.83447	Synaptojanin, N-terminal (1);	0.042343	0.85682	D	0.000000	T	0.19366	0.0465	L	0.31207	0.915	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.03423	-1.1038	10	0.29301	T	0.29	-29.9176	12.7556	0.57333	0.1173:0.0:0.8827:0.0	.	504	Q9Y2H2	SAC2_HUMAN	I	504	ENSP00000354519:M504I	ENSP00000354519:M504I	M	+	3	0	INPP5F	121557505	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.352000	0.59404	2.773000	0.95371	0.585000	0.79938	ATG		0.438	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1		NM_014937	
INTS9	55756	broad.mit.edu;ucsc.edu	37	8	28625776	28625776	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr8:28625776C>G	ENST00000521022.1	-	17	1945	c.1864G>C	c.(1864-1866)Gct>Cct	p.A622P	INTS9_ENST00000521777.1_Missense_Mutation_p.A598P|INTS9_ENST00000397363.4_Missense_Mutation_p.A516P|INTS9_ENST00000416984.2_Missense_Mutation_p.A601P	NM_018250.3	NP_060720.2	Q9NV88	INT9_HUMAN	integrator complex subunit 9	622					snRNA processing (GO:0016180)	cytoplasm (GO:0005737)|integrator complex (GO:0032039)|nucleus (GO:0005634)		p.A622P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(2)	19		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)		AGCGTCTCAGCCTCCTGGAGC	0.522																																																	1	Substitution - Missense(1)	kidney(1)											268.0	257.0	261.0					8																	28625776		2203	4300	6503	SO:0001583	missense	55756			BC025267	CCDS34873.1, CCDS55215.1, CCDS55216.1	8p21.1	2008-02-05			ENSG00000104299	ENSG00000104299			25592	protein-coding gene	gene with protein product		611352				16239144	Standard	NM_001172562		Approved	FLJ10871, CPSF2L, RC-74	uc011lav.2	Q9NV88	OTTHUMG00000164030	ENST00000521022.1:c.1864G>C	8.37:g.28625776C>G	ENSP00000429065:p.Ala622Pro	Somatic		WXS	Illumina GAIIx	Phase_I	B7Z560|B7Z6M5|O00224|Q8TB16	Missense_Mutation	SNP	ENST00000521022.1	37	CCDS34873.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.63|19.63	3.864416|3.864416	0.71949|0.71949	.|.	.|.	ENSG00000104299|ENSG00000104299	ENST00000521022;ENST00000416984;ENST00000541706;ENST00000521777;ENST00000397363|ENST00000517383	T;T;T;T|.	0.45276|.	0.9;0.9;0.9;0.9|.	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	0.124706|.	0.56097|.	D|.	0.000035|.	T|T	0.67543|0.67543	0.2904|0.2904	L|L	0.44542|0.44542	1.39|1.39	0.58432|0.58432	D|D	0.999994|0.999994	B;B|.	0.29508|.	0.246;0.091|.	B;B|.	0.27608|.	0.081;0.081|.	T|T	0.64300|0.64300	-0.6440|-0.6440	10|5	0.34782|.	T|.	0.22|.	-15.741|-15.741	18.5577|18.5577	0.91090|0.91090	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	601;622|.	B7Z6M5;Q9NV88|.	.;INT9_HUMAN|.	P|S	622;601;466;598;516|113	ENSP00000429065:A622P;ENSP00000398208:A601P;ENSP00000430943:A598P;ENSP00000380520:A516P|.	ENSP00000380520:A516P|.	A|R	-|-	1|3	0|2	INTS9|INTS9	28681695|28681695	1.000000|1.000000	0.71417|0.71417	0.821000|0.821000	0.32701|0.32701	0.910000|0.910000	0.53928|0.53928	7.703000|7.703000	0.84585|0.84585	2.366000|2.366000	0.80165|0.80165	0.655000|0.655000	0.94253|0.94253	GCT|AGG		0.522	INTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376846.1		NM_018250	
KCNQ3	3786	hgsc.bcm.edu	37	8	133492523	133492523	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr8:133492523C>G	ENST00000388996.4	-	1	677	c.257G>C	c.(256-258)gGg>gCg	p.G86A	KCNQ3_ENST00000519445.1_Missense_Mutation_p.G86A	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	86					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.G86A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GGCCAGGAGCCCGATGCCCTG	0.692																																																	1	Substitution - Missense(1)	kidney(1)											32.0	36.0	35.0					8																	133492523		2203	4297	6500	SO:0001583	missense	3786			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.257G>C	8.37:g.133492523C>G	ENSP00000373648:p.Gly86Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300483	0.40694	.	.	ENSG00000184156	ENST00000388996;ENST00000519445;ENST00000542679	D;D	0.98914	-5.22;-5.23	4.43	4.43	0.53597	.	0.273259	0.25789	N	0.028286	D	0.96667	0.8912	L	0.38175	1.15	0.48341	D	0.999631	P;P	0.46784	0.884;0.884	B;B	0.41466	0.358;0.358	D	0.96914	0.9669	10	0.48119	T	0.1	-9.3909	16.2364	0.82377	0.0:1.0:0.0:0.0	.	86;86	E7ET42;O43525	.;KCNQ3_HUMAN	A	86;86;75	ENSP00000373648:G86A;ENSP00000428790:G86A	ENSP00000373648:G86A	G	-	2	0	KCNQ3	133561705	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	5.705000	0.68355	2.297000	0.77311	0.557000	0.71058	GGG		0.692	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2		NM_004519	
KRT71	112802	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	52940112	52940112	+	Missense_Mutation	SNP	T	T	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr12:52940112T>A	ENST00000267119.5	-	7	1352	c.1283A>T	c.(1282-1284)gAg>gTg	p.E428V		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	428	Coil 2.|Rod.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.E428V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		GGTGGCGATCTCCATGTCCAG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											80.0	70.0	73.0					12																	52940112		2203	4300	6503	SO:0001583	missense	112802			AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.1283A>T	12.37:g.52940112T>A	ENSP00000267119:p.Glu428Val	Somatic		WXS	Illumina HiSeq	Phase_I	B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	ENST00000267119.5	37	CCDS8831.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.848169	0.91277	.	.	ENSG00000139648	ENST00000267119	D	0.96830	-4.14	4.34	4.34	0.51931	Filament (1);	0.000000	0.40640	N	0.001047	D	0.98960	0.9646	H	0.99074	4.42	0.54753	D	0.99998	D	0.89917	1.0	D	0.97110	1.0	D	0.98925	1.0785	10	0.87932	D	0	.	14.2269	0.65866	0.0:0.0:0.0:1.0	.	428	Q3SY84	K2C71_HUMAN	V	428	ENSP00000267119:E428V	ENSP00000267119:E428V	E	-	2	0	KRT71	51226379	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	1.921000	0.55644	0.459000	0.35465	GAG		0.662	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396487.1		NM_033448	
LMOD3	56203	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	69168594	69168595	+	Frame_Shift_Ins	INS	-	-	T	rs373295911		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr3:69168594_69168595insT	ENST00000420581.2	-	2	1090_1091	c.911_912insA	c.(910-912)aacfs	p.N304fs	LMOD3_ENST00000475434.1_Frame_Shift_Ins_p.N304fs|LMOD3_ENST00000489031.1_Frame_Shift_Ins_p.N304fs	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	304						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		CACGCAACATGTTAGCCAAGGC	0.411																																																	0																																										SO:0001589	frameshift_variant	56203			AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.912dupA	3.37:g.69168596_69168596dupT	ENSP00000414670:p.Asn304fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Frame_Shift_Ins	INS	ENST00000420581.2	37	CCDS46862.1																																																																																				0.411	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352138.1		XM_067529	
LSM14B	149986	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	60701436	60701436	+	Missense_Mutation	SNP	A	A	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr20:60701436A>G	ENST00000279068.6	+	3	528	c.368A>G	c.(367-369)tAc>tGc	p.Y123C	LSM14B_ENST00000253001.4_Missense_Mutation_p.Y123C|LSM14B_ENST00000370915.1_Missense_Mutation_p.Y123C	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	123					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.Y123C(2)		endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			ATGGCGCCCTACGGCCCGCTG	0.632																																																	2	Substitution - Missense(2)	kidney(2)											45.0	47.0	47.0					20																	60701436		2048	4179	6227	SO:0001583	missense	149986			AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.368A>G	20.37:g.60701436A>G	ENSP00000279068:p.Tyr123Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PFW8|Q96LH8	Missense_Mutation	SNP	ENST00000279068.6	37	CCDS46626.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.057621	0.76074	.	.	ENSG00000149657	ENST00000370915;ENST00000279068;ENST00000253001;ENST00000444156;ENST00000400318;ENST00000279069;ENST00000370906;ENST00000361670	T;T;T;T	0.60672	0.8;0.83;0.78;0.17	5.42	5.42	0.78866	.	0.235442	0.45126	D	0.000387	T	0.76637	0.4015	M	0.78801	2.425	0.53005	D	0.999967	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.998	D;D;D;D;D	0.85130	0.981;0.991;0.996;0.997;0.982	T	0.80241	-0.1464	10	0.87932	D	0	.	15.4581	0.75330	1.0:0.0:0.0:0.0	.	4;4;123;149;123	E9PG81;C9J454;Q9BX40;Q5TBQ0;Q9BX40-2	.;.;LS14B_HUMAN;.;.	C	123;123;123;4;149;123;4;4	ENSP00000279068:Y123C;ENSP00000253001:Y123C;ENSP00000383172:Y149C;ENSP00000355209:Y4C	ENSP00000253001:Y123C	Y	+	2	0	LSM14B	60134831	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.172000	0.77604	2.046000	0.60703	0.418000	0.28097	TAC		0.632	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079996.4		NM_144703	
MCM3AP	8888	broad.mit.edu;ucsc.edu	37	21	47705106	47705106	+	Missense_Mutation	SNP	C	C	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr21:47705106C>A	ENST00000397708.1	-	2	349	c.95G>T	c.(94-96)cGa>cTa	p.R32L	YBEY_ENST00000329319.3_5'Flank|YBEY_ENST00000397692.1_5'Flank|YBEY_ENST00000339195.6_5'Flank|YBEY_ENST00000397691.1_5'Flank|MCM3AP_ENST00000291688.1_Missense_Mutation_p.R32L|YBEY_ENST00000397694.1_5'Flank|YBEY_ENST00000397701.4_5'Flank			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	32					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.R32L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					TTGACCAAATCGAAATGGCGG	0.458																																																	1	Substitution - Missense(1)	kidney(1)											73.0	76.0	75.0					21																	47705106		2203	4300	6503	SO:0001583	missense	8888			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.95G>T	21.37:g.47705106C>A	ENSP00000380820:p.Arg32Leu	Somatic		WXS	Illumina GAIIx	Phase_I	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.583022	0.46006	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000426537	T;T	0.03386	3.95;3.95	5.57	0.657	0.17850	.	0.708209	0.13075	N	0.415761	T	0.02230	0.0069	L	0.29908	0.895	0.27233	N	0.959352	P	0.40515	0.719	B	0.29524	0.103	T	0.46091	-0.9216	10	0.38643	T	0.18	-0.1106	5.0586	0.14546	0.0:0.4571:0.1428:0.4	.	32	O60318	MCM3A_HUMAN	L	32	ENSP00000380820:R32L;ENSP00000291688:R32L	ENSP00000291688:R32L	R	-	2	0	MCM3AP	46529534	1.000000	0.71417	0.040000	0.18447	0.850000	0.48378	0.579000	0.23788	-0.154000	0.11118	0.561000	0.74099	CGA		0.458	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1		NM_003906	
MPHOSPH10	10199	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	71361866	71361866	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr2:71361866delT	ENST00000244230.2	+	4	1389	c.1037delT	c.(1036-1038)gttfs	p.V346fs	MPHOSPH10_ENST00000498451.2_Frame_Shift_Del_p.V346fs	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	346					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						GATACAGGTGTTTTAAATGTA	0.294																																																	0													63.0	73.0	69.0					2																	71361866		2202	4294	6496	SO:0001589	frameshift_variant	10199			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1037delT	2.37:g.71361866delT	ENSP00000244230:p.Val346fs	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVJ8	Frame_Shift_Del	DEL	ENST00000244230.2	37	CCDS1916.1																																																																																				0.294	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2		NM_005791	
MPHOSPH10	10199	hgsc.bcm.edu	37	2	71361870	71361870	+	Missense_Mutation	SNP	A	A	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr2:71361870A>C	ENST00000244230.2	+	4	1393	c.1041A>C	c.(1039-1041)ttA>ttC	p.L347F	MPHOSPH10_ENST00000498451.2_Missense_Mutation_p.L347F	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	347					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						CAGGTGTTTTAAATGTAAAGA	0.289																																																	0													60.0	71.0	67.0					2																	71361870		2202	4295	6497	SO:0001583	missense	10199			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1041A>C	2.37:g.71361870A>C	ENSP00000244230:p.Leu347Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	A	10.85	1.468183	0.26335	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.11063	2.81;2.81	4.34	-0.0522	0.13823	.	0.865324	0.09828	N	0.750609	T	0.11965	0.0291	M	0.61703	1.905	0.22112	N	0.999352	B;B	0.21688	0.028;0.059	B;B	0.23275	0.018;0.045	T	0.32188	-0.9916	10	0.56958	D	0.05	.	6.1592	0.20354	0.3642:0.5343:0.1014:0.0	.	347;347	B3KPV5;O00566	.;MPP10_HUMAN	F	347;207	ENSP00000244230:L347F;ENSP00000393034:L207F	ENSP00000244230:L347F	L	+	3	2	MPHOSPH10	71215378	0.000000	0.05858	0.002000	0.10522	0.236000	0.25371	0.104000	0.15313	0.219000	0.20840	0.383000	0.25322	TTA		0.289	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2		NM_005791	
MYB	4602	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	135516962	135516962	+	Missense_Mutation	SNP	G	G	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr6:135516962G>A	ENST00000367814.4	+	9	1211	c.1025G>A	c.(1024-1026)aGt>aAt	p.S342N	MYB_ENST00000528774.1_Missense_Mutation_p.S339N|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000534044.1_Missense_Mutation_p.S342N|MYB_ENST00000533624.1_Missense_Mutation_p.S307N|MYB_ENST00000525369.1_Intron|MYB_ENST00000442647.2_Missense_Mutation_p.S339N|MYB_ENST00000341911.5_Missense_Mutation_p.S342N|MYB_ENST00000316528.8_Missense_Mutation_p.S342N|MYB_ENST00000527615.1_Missense_Mutation_p.S342N|MYB-AS1_ENST00000455534.1_RNA|MYB_ENST00000534121.1_Missense_Mutation_p.S342N	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	342	Negative regulatory domain. {ECO:0000250}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.S342N(2)		breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		CATGGAGACAGTGCACCTGTT	0.582			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	2	Substitution - Missense(2)	kidney(2)											161.0	126.0	138.0					6																	135516962		2203	4300	6503	SO:0001583	missense	4602				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.1025G>A	6.37:g.135516962G>A	ENSP00000356788:p.Ser342Asn	Somatic		WXS	Illumina HiSeq	Phase_I	E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	ENST00000367814.4	37	CCDS5174.1	.	.	.	.	.	.	.	.	.	.	G	11.87	1.768855	0.31320	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000533624	T;T;T;T;T;T;T;T;T	0.35973	2.54;2.05;2.04;2.06;1.28;2.53;2.68;1.71;2.11	5.82	2.02	0.26589	.	0.424457	0.30076	N	0.010465	T	0.07188	0.0182	N	0.08118	0	0.25432	N	0.98818	B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.0;0.001;0.001;0.0	B;B;B;B;B;B;B;B	0.08055	0.001;0.001;0.002;0.002;0.002;0.002;0.003;0.001	T	0.32295	-0.9912	10	0.44086	T	0.13	-1.9633	11.0855	0.48084	0.1276:0.1966:0.6759:0.0	.	307;342;339;339;342;342;342;342	E9PI07;E9PLZ5;P10242-2;E9PNL6;E9PNA4;P10242-4;P10242;Q708E1	.;.;.;.;.;.;MYB_HUMAN;.	N	342;339;342;342;342;342;339;342;342;307	ENSP00000339992:S342N;ENSP00000410825:S339N;ENSP00000326328:S342N;ENSP00000356788:S342N;ENSP00000433227:S342N;ENSP00000434723:S339N;ENSP00000432851:S342N;ENSP00000435055:S342N;ENSP00000436605:S307N	ENSP00000237302:S342N	S	+	2	0	MYB	135558655	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	1.586000	0.36611	0.377000	0.24735	-1.255000	0.01485	AGT		0.582	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042347.4			
MYO9B	4650	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	17212688	17212688	+	Missense_Mutation	SNP	G	G	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr19:17212688G>A	ENST00000594824.1	+	2	308	c.161G>A	c.(160-162)aGc>aAc	p.S54N	MYO9B_ENST00000397274.2_Missense_Mutation_p.S54N|MYO9B_ENST00000595618.1_Missense_Mutation_p.S54N|CTD-2528A14.5_ENST00000597045.1_RNA			Q13459	MYO9B_HUMAN	myosin IXB	54	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.S54N(2)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GCCATTGCCAGCCTGCGGCTG	0.637																																																	2	Substitution - Missense(2)	kidney(2)											40.0	48.0	45.0					19																	17212688		2137	4233	6370	SO:0001583	missense	4650				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.161G>A	19.37:g.17212688G>A	ENSP00000471367:p.Ser54Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	G	0.047	-1.264058	0.01433	.	.	ENSG00000099331	ENST00000397274	T	0.17213	2.29	4.93	1.2	0.21068	Ras-association (3);	0.988038	0.08234	N	0.977007	T	0.08980	0.0222	N	0.16478	0.41	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.10450	0.005;0.005;0.005	T	0.38542	-0.9656	10	0.32370	T	0.25	.	1.5822	0.02637	0.1248:0.1735:0.2414:0.4603	.	54;54;60	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	N	54	ENSP00000380444:S54N	ENSP00000380444:S54N	S	+	2	0	MYO9B	17073688	0.000000	0.05858	0.510000	0.27712	0.018000	0.09664	0.009000	0.13219	0.460000	0.27045	-0.169000	0.13324	AGC		0.637	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1			
PCDH1	5097	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	141248528	141248529	+	Missense_Mutation	DNP	GA	GA	TT	rs201001001		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr5:141248528_141248529GA>TT	ENST00000394536.3	-	2	647_648	c.508_509TC>AA	c.(508-510)TCa>AAa	p.S170K	PCDH1_ENST00000511044.1_5'Flank|PCDH1_ENST00000503492.1_Missense_Mutation_p.S170K|PCDH1_ENST00000456271.1_Missense_Mutation_p.S170K|PCDH1_ENST00000536585.1_Missense_Mutation_p.S148K|PCDH1_ENST00000287008.3_Missense_Mutation_p.S170K	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	170	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S170>?(1)|p.S170*(1)|p.S170T(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GATGACTGGTGAGGCGAAGTTG	0.559																																					Ovarian(132;1609 1739 4190 14731 45037)												3	Substitution - Nonsense(1)|Substitution - Missense(1)|Complex(1)	kidney(3)																																								SO:0001583	missense	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.508_509delinsTT	5.37:g.141248528_141248529delinsTT	ENSP00000378043:p.Ser170Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IUP2	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000394536.3	37	CCDS43375.1																																																																																				0.559	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1		NM_032420	
PDE3A	5139	broad.mit.edu;hgsc.bcm.edu	37	12	20832968	20832968	+	Missense_Mutation	SNP	G	G	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr12:20832968G>T	ENST00000359062.3	+	16	3229	c.3189G>T	c.(3187-3189)aaG>aaT	p.K1063N	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	1063	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.K1063N(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	ttttaGAAAAGAAGACTTTCA	0.348																																																	1	Substitution - Missense(1)	kidney(1)											27.0	27.0	27.0					12																	20832968		2203	4300	6503	SO:0001583	missense	5139				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.3189G>T	12.37:g.20832968G>T	ENSP00000351957:p.Lys1063Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	G	8.383	0.837893	0.16891	.	.	ENSG00000172572	ENST00000359062	T	0.76709	-1.04	5.72	4.83	0.62350	.	0.542560	0.19315	N	0.117288	T	0.70692	0.3253	L	0.55481	1.735	0.35300	D	0.782966	P	0.35656	0.514	B	0.24269	0.052	T	0.76798	-0.2826	10	0.41790	T	0.15	.	14.9366	0.70960	0.0687:0.0:0.9313:0.0	.	1063	Q14432	PDE3A_HUMAN	N	1063	ENSP00000351957:K1063N	ENSP00000351957:K1063N	K	+	3	2	PDE3A	20724235	1.000000	0.71417	1.000000	0.80357	0.465000	0.32709	2.403000	0.44530	1.423000	0.47198	-0.137000	0.14449	AAG		0.348	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2			
PDZD2	23037	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	32059357	32059357	+	Missense_Mutation	SNP	G	G	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr5:32059357G>T	ENST00000438447.1	+	13	2601	c.2213G>T	c.(2212-2214)gGa>gTa	p.G738V	PDZD2_ENST00000282493.3_Missense_Mutation_p.G738V			O15018	PDZD2_HUMAN	PDZ domain containing 2	738	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.G738V(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CCAAGAGTTGGATTAGGCATT	0.418																																																	1	Substitution - Missense(1)	kidney(1)											74.0	64.0	67.0					5																	32059357		2203	4300	6503	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2213G>T	5.37:g.32059357G>T	ENSP00000402033:p.Gly738Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226954	0.79576	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.27104	1.69;1.69	5.69	5.69	0.88448	PDZ/DHR/GLGF (3);	0.000000	0.44483	D	0.000459	T	0.65059	0.2655	H	0.95328	3.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75830	-0.3179	10	0.87932	D	0	.	17.3087	0.87202	0.0:0.0:1.0:0.0	.	564;738	B4E3P2;O15018	.;PDZD2_HUMAN	V	738;557;738	ENSP00000402033:G738V;ENSP00000282493:G738V	ENSP00000282493:G738V	G	+	2	0	PDZD2	32095114	1.000000	0.71417	0.962000	0.40283	0.769000	0.43574	9.283000	0.95860	2.679000	0.91253	0.591000	0.81541	GGA		0.418	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			
PHACTR4	65979	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	28785764	28785764	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr1:28785764C>A	ENST00000373839.3	+	3	446	c.185C>A	c.(184-186)tCa>tAa	p.S62*	PHACTR4_ENST00000373836.3_Nonsense_Mutation_p.S72*|PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	62					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)	p.S72*(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		AAAGAGACTTCAGAAGGTGAG	0.358																																																	1	Substitution - Nonsense(1)	kidney(1)											53.0	53.0	53.0					1																	28785764		1819	4084	5903	SO:0001587	stop_gained	65979			AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.185C>A	1.37:g.28785764C>A	ENSP00000362945:p.Ser62*	Somatic		WXS	Illumina HiSeq	Phase_I	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Nonsense_Mutation	SNP	ENST00000373839.3	37	CCDS41293.1	.	.	.	.	.	.	.	.	.	.	C	37	6.451314	0.97577	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	.	.	.	5.07	5.07	0.68467	.	0.220504	0.40640	N	0.001044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7715	17.8049	0.88599	0.0:1.0:0.0:0.0	.	.	.	.	X	62;72;61	.	ENSP00000362942:S72X	S	+	2	0	PHACTR4	28658351	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.416000	0.80143	2.523000	0.85059	0.650000	0.86243	TCA		0.358	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4		NM_023923	
PHLPP2	23035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	71683569	71683569	+	Missense_Mutation	SNP	T	T	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr16:71683569T>C	ENST00000568954.1	-	19	3574	c.3196A>G	c.(3196-3198)Aag>Gag	p.K1066E	PHLPP2_ENST00000356272.3_Missense_Mutation_p.K1066E|PHLPP2_ENST00000567016.1_Missense_Mutation_p.K1101E|PHLPP2_ENST00000393524.2_Missense_Mutation_p.K999E|PHLPP2_ENST00000360429.3_Intron|PHLPP2_ENST00000540628.1_Intron			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	1066					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.K1066E(1)		central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						GTGGCTGGCTTAGGGGCATCC	0.527																																																	1	Substitution - Missense(1)	kidney(1)											70.0	78.0	76.0					16																	71683569		2198	4299	6497	SO:0001583	missense	23035			BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.3196A>G	16.37:g.71683569T>C	ENSP00000457991:p.Lys1066Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	ENST00000568954.1	37	CCDS32479.1	.	.	.	.	.	.	.	.	.	.	T	1.789	-0.479902	0.04383	.	.	ENSG00000040199	ENST00000356272;ENST00000393524	T;T	0.40225	1.57;1.04	5.9	5.9	0.94986	.	0.104149	0.64402	D	0.000001	T	0.31827	0.0809	L	0.50919	1.6	0.28839	N	0.896739	B;B	0.22746	0.074;0.021	B;B	0.25140	0.058;0.019	T	0.37820	-0.9689	10	0.02654	T	1	-24.4828	8.7521	0.34622	0.0:0.083:0.0:0.917	.	999;1066	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	E	1066;999	ENSP00000348611:K1066E;ENSP00000377159:K999E	ENSP00000348611:K1066E	K	-	1	0	PHLPP2	70241070	1.000000	0.71417	0.943000	0.38184	0.260000	0.26232	3.400000	0.52594	2.251000	0.74343	0.528000	0.53228	AAG		0.527	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1		NM_015020	
PRKAR1A	5573	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	66525084	66525084	+	Missense_Mutation	SNP	G	G	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr17:66525084G>C	ENST00000589228.1	+	9	971	c.843G>C	c.(841-843)aaG>aaC	p.K281N	PRKAR1A_ENST00000586397.1_Missense_Mutation_p.K281N|PRKAR1A_ENST00000358598.2_Missense_Mutation_p.K281N|PRKAR1A_ENST00000536854.2_Missense_Mutation_p.K281N|PRKAR1A_ENST00000588188.2_Missense_Mutation_p.K281N|PRKAR1A_ENST00000392711.1_Missense_Mutation_p.K281N	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	281					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)	p.K281N(1)		adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					ATGGGCAGAAGATTGTGGTGC	0.403			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												Ovarian(167;637 1670 33025 39608 46699 51856)		yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	1	Substitution - Missense(1)	kidney(1)											161.0	152.0	155.0					17																	66525084		2203	4300	6503	SO:0001583	missense	5573	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.843G>C	17.37:g.66525084G>C	ENSP00000464977:p.Lys281Asn	Somatic		WXS	Illumina HiSeq	Phase_I	K7ER48|Q567S7	Missense_Mutation	SNP	ENST00000589228.1	37	CCDS11678.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.171490	0.57584	.	.	ENSG00000108946	ENST00000358598;ENST00000392711;ENST00000392710;ENST00000536854	D;D;D	0.92647	-3.08;-3.08;-3.08	5.89	4.9	0.64082	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	T	0.81716	0.4881	N	0.05230	-0.09	0.80722	D	1	B;B	0.20459	0.045;0.045	B;B	0.22753	0.041;0.041	T	0.75566	-0.3273	10	0.13853	T	0.58	-26.3948	12.9827	0.58572	0.0816:0.0:0.9184:0.0	.	281;281	B2R5T5;P10644	.;KAP0_HUMAN	N	281	ENSP00000351410:K281N;ENSP00000376475:K281N;ENSP00000445625:K281N	ENSP00000351410:K281N	K	+	3	2	PRKAR1A	64036679	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.695000	0.74593	1.403000	0.46800	0.650000	0.86243	AAG		0.403	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1			
PRUNE	58497	hgsc.bcm.edu;ucsc.edu	37	1	150981137	150981138	+	Frame_Shift_Ins	INS	-	-	TGCT	rs112740880	byFrequency	TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr1:150981137_150981138insTGCT	ENST00000271620.3	+	1	185_186	c.29_30insTGCT	c.(28-33)gctgctfs	p.-11fs	FAM63A_ENST00000312210.5_5'Flank|FAM63A_ENST00000361936.5_5'Flank|PRUNE_ENST00000368936.1_5'UTR|PRUNE_ENST00000368935.1_5'UTR|PRUNE_ENST00000368937.1_5'UTR|FAM63A_ENST00000470877.1_5'Flank|FAM63A_ENST00000493834.2_5'Flank|PRUNE_ENST00000467771.1_3'UTR|FAM63A_ENST00000361738.6_5'Flank|PRUNE_ENST00000271619.8_Frame_Shift_Ins_p.-11fs	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase							cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGTTGTCGAGCTGCTCTGCAGG	0.609																																																	0																																										SO:0001589	frameshift_variant	58497			U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.30_33dupTGCT	1.37:g.150981138_150981141dupTGCT	ENSP00000271620:p.Ala11fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Frame_Shift_Ins	INS	ENST00000271620.3	37	CCDS977.1																																																																																				0.609	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084885.1		NM_021222	
RAB32	10981	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	146865253	146865253	+	Silent	SNP	C	C	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr6:146865253C>T	ENST00000367495.3	+	1	425	c.246C>T	c.(244-246)atC>atT	p.I82I		NM_006834.3	NP_006825.1	Q13637	RAB32_HUMAN	RAB32, member RAS oncogene family	82					antigen processing and presentation (GO:0019882)|endosome to melanosome transport (GO:0035646)|GTP catabolic process (GO:0006184)|melanosome organization (GO:0032438)|phagosome maturation (GO:0090382)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|melanosome (GO:0042470)|membrane (GO:0016020)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)	AP-1 adaptor complex binding (GO:0035650)|AP-3 adaptor complex binding (GO:0035651)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)	p.I82I(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	8		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)		TGTGGGACATCGCGGGTAAGC	0.627																																																	1	Substitution - coding silent(1)	kidney(1)											25.0	25.0	25.0					6																	146865253		2203	4300	6503	SO:0001819	synonymous_variant	10981			U71127	CCDS5210.1	6q24.2	2010-08-20			ENSG00000118508	ENSG00000118508		"""RAB, member RAS oncogene"", ""A-kinase anchor proteins"""	9772	protein-coding gene	gene with protein product		612906					Standard	NM_006834		Approved		uc003qln.1	Q13637	OTTHUMG00000015755	ENST00000367495.3:c.246C>T	6.37:g.146865253C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000367495.3	37	CCDS5210.1																																																																																				0.627	RAB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042579.1		NM_006834	
RP1L1	94137	hgsc.bcm.edu	37	8	10467581	10467581	+	Missense_Mutation	SNP	C	C	T	rs143686100		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr8:10467581C>T	ENST00000382483.3	-	4	4250	c.4027G>A	c.(4027-4029)Gaa>Aaa	p.E1343K		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1359	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.		Missing (in allele RP1L1-1).|Missing (in allele RP1L1-2).		cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		ccttctgtttctttagtttcc	0.488																																																	0													89.0	80.0	83.0					8																	10467581		1937	4126	6063	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4027G>A	8.37:g.10467581C>T	ENSP00000371923:p.Glu1343Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	7.887	0.731481	0.15507	.	.	ENSG00000183638	ENST00000382483	T	0.04809	3.55	1.84	1.84	0.25277	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	B	0.24258	0.1	B	0.19391	0.025	T	0.43845	-0.9366	9	0.42905	T	0.14	.	10.4378	0.44445	0.0:1.0:0.0:0.0	.	1343	A6NKC6	.	K	1343	ENSP00000371923:E1343K	ENSP00000371923:E1343K	E	-	1	0	RP1L1	10504991	0.163000	0.22920	0.005000	0.12908	0.169000	0.22640	2.372000	0.44257	0.986000	0.38683	0.205000	0.17691	GAA		0.488	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			
RYR1	6261	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	38948875	38948875	+	Missense_Mutation	SNP	A	A	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr19:38948875A>G	ENST00000359596.3	+	18	2110	c.2110A>G	c.(2110-2112)Aac>Gac	p.N704D	RYR1_ENST00000360985.3_Missense_Mutation_p.N704D|RYR1_ENST00000355481.4_Missense_Mutation_p.N704D			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	704	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.N704D(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTGGGGCGGCAACGGGGTCGG	0.652																																																	1	Substitution - Missense(1)	kidney(1)											63.0	61.0	62.0					19																	38948875		2203	4299	6502	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2110A>G	19.37:g.38948875A>G	ENSP00000352608:p.Asn704Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	A	19.07	3.755513	0.69648	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.70045	-0.45;-0.45;-0.45	5.02	5.02	0.67125	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	U	0.000001	T	0.80465	0.4628	M	0.70903	2.155	0.45330	D	0.998327	D;D	0.89917	0.991;1.0	P;D	0.85130	0.86;0.997	T	0.82647	-0.0354	10	0.66056	D	0.02	.	14.6028	0.68453	1.0:0.0:0.0:0.0	.	704;704	P21817-2;P21817	.;RYR1_HUMAN	D	704	ENSP00000352608:N704D;ENSP00000347667:N704D;ENSP00000354254:N704D	ENSP00000347667:N704D	N	+	1	0	RYR1	43640715	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.139000	0.94554	2.119000	0.64992	0.449000	0.29647	AAC		0.652	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			
SGK1	6446	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	134494169	134494169	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr6:134494169C>G	ENST00000237305.7	-	6	629	c.541G>C	c.(541-543)Ggt>Cgt	p.G181R	SGK1_ENST00000367858.5_Missense_Mutation_p.G276R|SGK1_ENST00000528577.1_Missense_Mutation_p.G209R|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000367857.5_Missense_Mutation_p.G171R|SGK1_ENST00000475719.2_Intron|SGK1_ENST00000413996.3_Missense_Mutation_p.G195R	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	181	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)	p.G181R(1)|p.G209R(1)|p.G276R(1)|p.G171R(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		ACCTCTCCACCATTAATGTAG	0.428																																																	4	Substitution - Missense(4)	kidney(4)											92.0	94.0	94.0					6																	134494169		2203	4300	6503	SO:0001583	missense	6446			AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.541G>C	6.37:g.134494169C>G	ENSP00000237305:p.Gly181Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480934	0.84747	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577	T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75	5.9	5.9	0.94986	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.33089	0.0851	M	0.84156	2.68	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.09773	-1.0659	10	0.87932	D	0	.	20.2723	0.98479	0.0:1.0:0.0:0.0	.	209;195;171;276;181	O00141-5;O00141-3;O00141-4;O00141-2;O00141	.;.;.;.;SGK1_HUMAN	R	276;195;181;171;209	ENSP00000356832:G276R;ENSP00000396242:G195R;ENSP00000237305:G181R;ENSP00000356831:G171R;ENSP00000434450:G209R	ENSP00000237305:G181R	G	-	1	0	SGK1	134535862	1.000000	0.71417	0.966000	0.40874	0.540000	0.34992	7.818000	0.86416	2.793000	0.96121	0.563000	0.77884	GGT		0.428	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2			
SLCO4A1	28231	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	61300316	61300316	+	Silent	SNP	G	G	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr20:61300316G>T	ENST00000370507.1	+	10	2007	c.1911G>T	c.(1909-1911)gtG>gtT	p.V637V	RP11-93B14.5_ENST00000411824.1_RNA|RP11-93B14.5_ENST00000451648.1_RNA|SLCO4A1_ENST00000217159.1_Silent_p.V637V|SLCO4A1_ENST00000470412.1_3'UTR|RP11-93B14.5_ENST00000433126.1_RNA			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	637					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.V637V(1)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TCGGCTGGGTGATCGACAAGG	0.647											OREG0026115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(168;741 2006 10379 40139 45334)												1	Substitution - coding silent(1)	kidney(1)											37.0	38.0	37.0					20																	61300316		2203	4299	6502	SO:0001819	synonymous_variant	28231			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1911G>T	20.37:g.61300316G>T		Somatic	1052	WXS	Illumina HiSeq	Phase_I	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Silent	SNP	ENST00000370507.1	37	CCDS13501.1																																																																																				0.647	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2		NM_016354	
STAG1	10274	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	136170989	136170989	+	Splice_Site	SNP	C	C	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr3:136170989C>T	ENST00000383202.2	-	14	1570	c.1314G>A	c.(1312-1314)aaG>aaA	p.K438K	STAG1_ENST00000536929.1_Splice_Site_p.Q22Q|STAG1_ENST00000434713.2_Splice_Site_p.K212K|STAG1_ENST00000236698.5_Splice_Site_p.K438K	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	438					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.K438K(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						TGCTAAATAGCCTGGAAATGA	0.398																																																	1	Substitution - coding silent(1)	kidney(1)											103.0	92.0	96.0					3																	136170989		2203	4300	6503	SO:0001630	splice_region_variant	10274			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1314-1G>A	3.37:g.136170989C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O00539|Q6P275	Silent	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.404987	0.25378	.	.	ENSG00000118007	ENST00000492318	.	.	.	5.51	-0.435	0.12279	.	.	.	.	.	T	0.58793	0.2147	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54523	-0.8281	4	.	.	.	.	11.7569	0.51880	0.0:0.5001:0.0:0.4999	.	.	.	.	N	49	.	.	S	-	2	0	STAG1	137653679	0.401000	0.25303	0.872000	0.34217	0.979000	0.70002	-0.234000	0.09028	-0.161000	0.10983	0.591000	0.81541	AGC		0.398	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1		NM_005862	Silent
TBC1D13	54662	hgsc.bcm.edu;ucsc.edu	37	9	131550656	131550656	+	Frame_Shift_Del	DEL	T	T	-	rs550347992		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr9:131550656delT	ENST00000372648.5	+	2	217	c.67delT	c.(67-69)ttgfs	p.L23fs	TBC1D13_ENST00000223865.8_Frame_Shift_Del_p.L23fs|TBC1D13_ENST00000539497.1_De_novo_Start_InFrame|TBC1D13_ENST00000466056.1_3'UTR	NM_018201.3	NP_060671.3	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	23							Rab GTPase activator activity (GO:0005097)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6						CTCAATTGCATTGGAAAAGCT	0.512																																																	0													145.0	135.0	138.0					9																	131550656		2203	4300	6503	SO:0001589	frameshift_variant	54662			AK001605	CCDS6911.1, CCDS69677.1	9q34.13	2013-07-09			ENSG00000107021	ENSG00000107021			25571	protein-coding gene	gene with protein product						22762500	Standard	XM_005252060		Approved	FLJ10743	uc010myj.3	Q9NVG8	OTTHUMG00000020760	ENST00000372648.5:c.67delT	9.37:g.131550656delT	ENSP00000361731:p.Leu23fs	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2E7|B3KW04|B9EGJ8|Q5T270|Q5T271	Frame_Shift_Del	DEL	ENST00000372648.5	37	CCDS6911.1																																																																																				0.512	TBC1D13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054496.1		NM_018201	
TIAM1	7074	broad.mit.edu;hgsc.bcm.edu;ucsc.edu|hgsc.bcm.edu;ucsc.edu	37	21	32624302	32624303	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr21:32624302_32624303CC>AA	ENST00000286827.3	-	6	1637_1638	c.1166_1167GG>TT	c.(1165-1167)cGG>cTT	p.R389L	TIAM1_ENST00000469412.1_5'UTR|TIAM1_ENST00000541036.1_Missense_Mutation_p.R389L	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	389					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R389R(2)|p.R389>?(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TCTCCAGCTCCCGCCGGAAGTT	0.683																																																	4	Substitution - coding silent(2)|Complex(2)	kidney(4)																																								SO:0001583	missense	7074				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1166_1167delinsAA	21.37:g.32624302_32624303delinsAA	ENSP00000286827:p.Arg389Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLR6|F5GZ53|Q17RT7	Silent|Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1																																																																																				0.683	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1		NM_003253	
TINF2	26277	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	24709719	24709719	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr14:24709719C>G	ENST00000267415.7	-	6	1308	c.967G>C	c.(967-969)Gcc>Ccc	p.A323P	TINF2_ENST00000558510.1_5'Flank|TINF2_ENST00000538777.1_Missense_Mutation_p.A109P|TINF2_ENST00000558566.1_3'UTR|TINF2_ENST00000540705.1_Missense_Mutation_p.A288P|TINF2_ENST00000399423.4_Missense_Mutation_p.A323P|TINF2_ENST00000559019.1_3'UTR	NM_001099274.1	NP_001092744.1	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	323				ASTGKSKSPC -> PSNGKYKGPY (in Ref. 1; AAF18439). {ECO:0000305}.	negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of protein ADP-ribosylation (GO:0010836)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of telomere maintenance (GO:0032206)|protein localization to chromosome (GO:0034502)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinucleolar chromocenter (GO:0010370)	telomeric DNA binding (GO:0042162)	p.A323P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|prostate(1)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0185)		CCAGTGGAGGCTGCTCTTGTG	0.537									Congenital Dyskeratosis;Ataxia Pancytopenia syndrome																																								1	Substitution - Missense(1)	kidney(1)											49.0	50.0	50.0					14																	24709719		2020	4176	6196	SO:0001583	missense	26277	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita;Myelocerebellar disorder	AF195512	CCDS41936.1, CCDS41937.1	14q12	2008-07-29				ENSG00000092330			11824	protein-coding gene	gene with protein product		604319				10581025, 18252230	Standard	NM_012461		Approved	TIN2	uc001woa.4	Q9BSI4		ENST00000267415.7:c.967G>C	14.37:g.24709719C>G	ENSP00000267415:p.Ala323Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B3W5Q7|Q9H904|Q9UHC2	Missense_Mutation	SNP	ENST00000267415.7	37	CCDS41936.1	.	.	.	.	.	.	.	.	.	.	C	7.444	0.641385	0.14451	.	.	ENSG00000092330	ENST00000267415;ENST00000540705;ENST00000399423;ENST00000538777	D;D;D;D	0.89050	-2.05;-2.05;-2.05;-2.46	4.89	2.66	0.31614	.	0.659581	0.13760	N	0.364659	T	0.81019	0.4736	L	0.33485	1.01	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.14578	0.011;0.011	T	0.68265	-0.5454	10	0.36615	T	0.2	-0.0975	6.7618	0.23544	0.0:0.7023:0.1858:0.1118	.	288;323	B4DFJ1;Q9BSI4	.;TINF2_HUMAN	P	323;288;323;109	ENSP00000267415:A323P;ENSP00000442154:A288P;ENSP00000382350:A323P;ENSP00000437495:A109P	ENSP00000267415:A323P	A	-	1	0	TINF2	23779559	0.004000	0.15560	0.223000	0.23860	0.430000	0.31655	0.206000	0.17375	1.040000	0.40099	0.462000	0.41574	GCC		0.537	TINF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415406.2			
TMEM203	94107	broad.mit.edu;hgsc.bcm.edu	37	9	140099456	140099456	+	Nonstop_Mutation	SNP	C	C	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr9:140099456C>A	ENST00000343666.5	-	1	634	c.411G>T	c.(409-411)taG>taT	p.*137Y	NDOR1_ENST00000344894.5_5'Flank|TMEM203_ENST00000537254.1_Nonstop_Mutation_p.*137Y|NDOR1_ENST00000458322.2_5'Flank|TPRN_ENST00000541945.1_5'Flank|NDOR1_ENST00000371521.4_5'Flank|NDOR1_ENST00000427047.2_5'Flank	NM_053045.1	NP_444273.1	Q969S6	TM203_HUMAN	transmembrane protein 203	0						integral component of membrane (GO:0016021)		p.*137Y(1)		central_nervous_system(1)|kidney(1)	2	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CTCGGTGAGGCTAGTTGACCC	0.622																																																	1	Nonstop extension(1)	kidney(1)											30.0	30.0	30.0					9																	140099456		2202	4289	6491	SO:0001578	stop_lost	94107			BC009283	CCDS35185.1	9q34.3	2007-12-18			ENSG00000187713	ENSG00000187713			28217	protein-coding gene	gene with protein product	"""HBeAg-binding protein 1"""					12477932	Standard	NM_053045		Approved	MGC14327, HBEBP1	uc004clv.3	Q969S6	OTTHUMG00000020985	ENST00000343666.5:c.411G>T	9.37:g.140099456C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6NW08	Missense_Mutation	SNP	ENST00000343666.5	37	CCDS35185.1	.	.	.	.	.	.	.	.	.	.	C	1.292	-0.607218	0.03717	.	.	ENSG00000187713	ENST00000343666;ENST00000537254	.	.	.	4.31	0.307	0.15811	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.1298	0.14903	0.2877:0.5497:0.0:0.1627	.	.	.	.	Y	137	.	.	X	-	3	2	TMEM203	139219277	0.831000	0.29352	0.013000	0.15412	0.005000	0.04900	0.736000	0.26130	-0.120000	0.11809	-0.169000	0.13324	TAG		0.622	TMEM203-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055325.2		NM_053045	
UBR5	51366	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	103327008	103327008	+	Missense_Mutation	SNP	C	C	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr8:103327008C>T	ENST00000520539.1	-	15	2464	c.1858G>A	c.(1858-1860)Gca>Aca	p.A620T	UBR5_ENST00000220959.4_Missense_Mutation_p.A620T|UBR5_ENST00000521922.1_Missense_Mutation_p.A614T	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	620					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.A620S(1)|p.A620T(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			ATTGAGGATGCATCACTACAC	0.418																																					Ovarian(131;96 1741 5634 7352 27489)												2	Substitution - Missense(2)	lung(1)|kidney(1)											138.0	111.0	120.0					8																	103327008		2203	4300	6503	SO:0001583	missense	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.1858G>A	8.37:g.103327008C>T	ENSP00000429084:p.Ala620Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	C	8.395	0.840683	0.16891	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.38722	1.12;1.12;1.12	5.27	5.27	0.74061	.	0.056644	0.64402	D	0.000001	T	0.16342	0.0393	N	0.01048	-1.04	0.54753	D	0.999986	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30119	-0.9989	10	0.02654	T	1	.	18.883	0.92364	0.0:1.0:0.0:0.0	.	614;620	E7EMW7;O95071	.;UBR5_HUMAN	T	620;620;614	ENSP00000429084:A620T;ENSP00000220959:A620T;ENSP00000427819:A614T	ENSP00000220959:A620T	A	-	1	0	UBR5	103396184	1.000000	0.71417	0.552000	0.28243	0.856000	0.48823	5.556000	0.67307	2.482000	0.83794	0.585000	0.79938	GCA		0.418	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2		NM_015902	
VGLL1	51442	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	135638638	135638638	+	Missense_Mutation	SNP	A	A	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chrX:135638638A>T	ENST00000370634.3	+	5	887	c.717A>T	c.(715-717)aaA>aaT	p.K239N	VGLL1_ENST00000470358.1_3'UTR	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	239					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.K239N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					CACCTGGGAAATACTCACTTA	0.478																																																	1	Substitution - Missense(1)	kidney(1)											177.0	146.0	157.0					X																	135638638		2203	4300	6503	SO:0001583	missense	51442			AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.717A>T	X.37:g.135638638A>T	ENSP00000359668:p.Lys239Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q5H915	Missense_Mutation	SNP	ENST00000370634.3	37	CCDS14658.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	9.656|9.656	1.142817|1.142817	0.21205|0.21205	.|.	.|.	ENSG00000102243|ENSG00000102243	ENST00000440515|ENST00000370634;ENST00000430688;ENST00000456412	.|T;T	.|0.58797	.|0.66;0.31	3.86|3.86	-4.41|-4.41	0.03590|0.03590	.|.	.|2.199070	.|0.02330	.|N	.|0.073837	T|T	0.33352|0.33352	0.0860|0.0860	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|P	.|0.39480	.|0.675	.|B	.|0.34242	.|0.178	T|T	0.37361|0.37361	-0.9709|-0.9709	5|10	.|0.87932	.|D	.|0	.|.	6.8193|6.8193	0.23849|0.23849	0.3144:0.1626:0.523:0.0|0.3144:0.1626:0.523:0.0	.|.	.|239	.|Q99990	.|VGLL1_HUMAN	L|N	157|239;96;41	.|ENSP00000359668:K239N;ENSP00000388868:K41N	.|ENSP00000359668:K239N	I|K	+|+	1|3	0|2	VGLL1|VGLL1	135466304|135466304	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.030000|0.030000	0.12068|0.12068	-1.282000|-1.282000	0.02799|0.02799	-1.186000|-1.186000	0.02713|0.02713	0.478000|0.478000	0.44815|0.44815	ATA|AAA		0.478	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1		NM_016267	
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10188260	10188260	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr3:10188260delT	ENST00000256474.2	+	2	1243	c.403delT	c.(403-405)ttafs	p.L135fs	VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	135	Involved in binding to CCT complex.		L -> F (in hemangioblastoma). {ECO:0000269|PubMed:8069849}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.E134fs*24(1)|p.N131fs*7(1)|p.L135fs*9(1)|p.E134fs*7(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCAAACTGAATTATTTGTGCC	0.438		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	4	Deletion - Frameshift(3)|Insertion - Frameshift(1)	kidney(4)											213.0	197.0	203.0					3																	10188260		2203	4300	6503	SO:0001589	frameshift_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.403delT	3.37:g.10188260delT	ENSP00000256474:p.Leu135fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Frame_Shift_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.438	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WBSCR17	64409	broad.mit.edu;ucsc.edu	37	7	71175760	71175760	+	Silent	SNP	C	C	A	rs571368084		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr7:71175760C>A	ENST00000333538.5	+	10	2149	c.1515C>A	c.(1513-1515)acC>acA	p.T505T	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	505	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.T505T(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCCGCTACACCAAGGAAGGCT	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17882	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)											92.0	84.0	87.0					7																	71175760		2203	4300	6503	SO:0001819	synonymous_variant	64409			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1515C>A	7.37:g.71175760C>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q8NFV9|Q9NTA8	Silent	SNP	ENST00000333538.5	37	CCDS5540.1																																																																																				0.632	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1		NM_022479	
ZMYM1	79830	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	35579780	35579780	+	Missense_Mutation	SNP	A	A	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr1:35579780A>T	ENST00000373330.1	+	11	2523	c.2349A>T	c.(2347-2349)gaA>gaT	p.E783D	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Missense_Mutation_p.E783D			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	783						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.E783D(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TGTCTGGGGAAATGTTGGCAA	0.328																																																	1	Substitution - Missense(1)	kidney(1)											87.0	85.0	85.0					1																	35579780		1840	4091	5931	SO:0001583	missense	79830			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.2349A>T	1.37:g.35579780A>T	ENSP00000362427:p.Glu783Asp	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	A	9.833	1.188910	0.21954	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.23754	1.89;1.89;1.89	4.24	4.24	0.50183	Ribonuclease H-like (1);	0.272701	0.26467	N	0.024217	T	0.41650	0.1168	L	0.51422	1.61	0.26899	N	0.967155	D;D	0.64830	0.994;0.984	D;D	0.70716	0.97;0.956	T	0.12682	-1.0538	9	.	.	.	-18.8099	11.9416	0.52905	1.0:0.0:0.0:0.0	.	764;783	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	D	783;708;783	ENSP00000352920:E783D;ENSP00000362426:E708D;ENSP00000362427:E783D	.	E	+	3	2	ZMYM1	35352367	1.000000	0.71417	0.777000	0.31699	0.004000	0.04260	0.917000	0.28665	2.138000	0.66242	0.455000	0.32223	GAA		0.328	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1		NM_024772	
ZNF423	23090	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	49670001	49670001	+	Missense_Mutation	SNP	C	C	T			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr16:49670001C>T	ENST00000561648.1	-	4	3115	c.3062G>A	c.(3061-3063)cGc>cAc	p.R1021H	ZNF423_ENST00000562520.1_Missense_Mutation_p.R961H|ZNF423_ENST00000535559.1_Missense_Mutation_p.R904H|ZNF423_ENST00000262383.2_Missense_Mutation_p.R1021H|ZNF423_ENST00000567169.1_Missense_Mutation_p.R904H|ZNF423_ENST00000562871.1_Missense_Mutation_p.R961H|ZNF423_ENST00000563137.2_Missense_Mutation_p.R961H	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1021					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R1021H(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GACCACACAGCGGAAGCCCGT	0.602																																																	2	Substitution - Missense(2)	kidney(2)											81.0	75.0	77.0					16																	49670001		2199	4300	6499	SO:0001583	missense	23090			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.3062G>A	16.37:g.49670001C>T	ENSP00000455426:p.Arg1021His	Somatic		WXS	Illumina HiSeq	Phase_I	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.990520	0.74589	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.10288	2.89;2.94	5.0	5.0	0.66597	Zinc finger, C2H2-like (1);	0.050236	0.85682	D	0.000000	T	0.22044	0.0531	L	0.27053	0.805	0.46725	D	0.999174	D	0.89917	1.0	D	0.91635	0.999	T	0.03922	-1.0992	9	.	.	.	-38.9493	18.3264	0.90255	0.0:1.0:0.0:0.0	.	1021	Q2M1K9	ZN423_HUMAN	H	1021;904	ENSP00000262383:R1021H;ENSP00000442321:R904H	.	R	-	2	0	ZNF423	48227502	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.089000	0.71384	2.342000	0.79632	0.561000	0.74099	CGC		0.602	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1		NM_015069	
ZNF518A	9849	hgsc.bcm.edu;ucsc.edu	37	10	97917981	97917981	+	RNA	SNP	A	A	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr10:97917981A>C	ENST00000534948.1	+	0	2759							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q634H(2)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		CCTCCAACCAAGGATCATTAC	0.353																																																	2	Substitution - Missense(2)	kidney(2)											57.0	54.0	55.0					10																	97917981		1859	4104	5963			9849			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97917981A>C		Somatic		WXS	Illumina HiSeq	Phase_I	A0PJI5|O15044|Q32MP4	Missense_Mutation	SNP	ENST00000534948.1	37																																																																																					0.353	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript			NM_014803	
ZNF646	9726	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	31090216	31090216	+	Missense_Mutation	SNP	T	T	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr16:31090216T>A	ENST00000394979.2	+	1	2994	c.2571T>A	c.(2569-2571)ttT>ttA	p.F857L	ZNF646_ENST00000300850.5_Missense_Mutation_p.F857L			O15015	ZN646_HUMAN	zinc finger protein 646	857					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F857L(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CGAAGGAGTTTGACTCTCTGC	0.617																																																	1	Substitution - Missense(1)	kidney(1)											70.0	76.0	74.0					16																	31090216		2197	4300	6497	SO:0001583	missense	9726			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.2571T>A	16.37:g.31090216T>A	ENSP00000378429:p.Phe857Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37		.	.	.	.	.	.	.	.	.	.	T	21.1	4.099616	0.76983	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.71461	-0.57;-0.57	5.1	1.65	0.23941	.	.	.	.	.	T	0.79106	0.4390	M	0.82193	2.58	0.30224	N	0.796506	D	0.65815	0.995	P	0.56163	0.793	T	0.74680	-0.3584	9	0.87932	D	0	-8.987	8.2619	0.31790	0.0:0.2346:0.0:0.7654	.	857	O15015-2	.	L	857	ENSP00000300850:F857L;ENSP00000378429:F857L	ENSP00000300850:F857L	F	+	3	2	ZNF646	30997717	0.017000	0.18338	1.000000	0.80357	0.998000	0.95712	0.115000	0.15540	0.290000	0.22444	0.460000	0.39030	TTT		0.617	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2		NM_014699	
ZNF79	7633	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	130206351	130206351	+	Silent	SNP	T	T	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr9:130206351T>C	ENST00000342483.5	+	5	778	c.372T>C	c.(370-372)tcT>tcC	p.S124S	ZNF79_ENST00000543471.1_Silent_p.S100S	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S124S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						AAGCCCTTTCTGAAGCTTCAT	0.483																																																	1	Substitution - coding silent(1)	kidney(1)											91.0	90.0	90.0					9																	130206351		2203	4300	6503	SO:0001819	synonymous_variant	7633			X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.372T>C	9.37:g.130206351T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VVW1|Q96NV1	Silent	SNP	ENST00000342483.5	37	CCDS6871.1																																																																																				0.483	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054188.1		NM_007135	
DCHS1	8642	broad.mit.edu	37	11	6662745	6662746	+	In_Frame_Ins	INS	-	-	CAG	rs376287018|rs372916982|rs370785084|rs56194704		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr11:6662745_6662746insCAG	ENST00000299441.3	-	2	510_511	c.99_100insCTG	c.(97-102)ctgggg>ctgCTGggg	p.33_34insL		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	33					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L33_G34insL(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCCCAGCCCCcagcagcagca	0.639																																																	1	Insertion - In frame(1)	prostate(1)																																								SO:0001652	inframe_insertion	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.97_99dupCTG	11.37:g.6662752_6662754dupCAG	ENSP00000299441:p.Leu33_Leu33dup	Somatic		WXS	Illumina GAIIx	Phase_I	O15098	In_Frame_Ins	INS	ENST00000299441.3	37	CCDS7771.1																																																																																				0.639	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1		NM_003737	
HLA-DQB2	3120	broad.mit.edu	37	6	32726774	32726774	+	Missense_Mutation	SNP	C	C	T	rs200716952		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr6:32726774C>T	ENST00000437316.2	-	3	562	c.499G>A	c.(499-501)Gcc>Acc	p.A167T	HLA-DQB2_ENST00000435145.2_Missense_Mutation_p.A167T|HLA-DQB2_ENST00000411527.1_Missense_Mutation_p.A167T			P05538	DQB2_HUMAN	major histocompatibility complex, class II, DQ beta 2	171	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|B cell affinity maturation (GO:0002344)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of alpha-beta T cell activation (GO:0046635)|positive regulation of antigen processing and presentation (GO:0002579)|positive regulation of T-helper 1 type immune response (GO:0002827)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome (GO:0005769)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)|toxic substance binding (GO:0015643)	p.A167T(1)		endometrium(1)|kidney(1)|lung(1)|prostate(2)	5						ACAACACCGGCTGTCTCCTCC	0.542																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	3120			M83890	CCDS56419.1	6p21.3	2013-01-11			ENSG00000232629	ENSG00000232629		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4945	protein-coding gene	gene with protein product		615161		HLA-DXB		2564844	Standard	NM_001198858		Approved		uc003oby.4	P05538	OTTHUMG00000031125	ENST00000437316.2:c.499G>A	6.37:g.32726774C>T	ENSP00000396330:p.Ala167Thr	Somatic		WXS	Illumina GAIIx	Phase_I	A6NIA5|Q29826|Q29870|Q29871|Q29872|Q29873|Q5SR06	Missense_Mutation	SNP	ENST00000437316.2	37		.	.	.	.	.	.	.	.	.	.	C	10.03	1.238159	0.22711	.	.	ENSG00000232629	ENST00000437316;ENST00000435145;ENST00000411527	T;T;T	0.02812	4.15;4.15;4.15	3.43	2.56	0.30785	.	0.330401	0.23935	U	0.043113	T	0.00967	0.0032	L	0.33189	0.99	0.23425	N	0.997708	B;B	0.19073	0.001;0.033	B;B	0.26310	0.014;0.068	T	0.47394	-0.9121	10	0.33940	T	0.23	.	8.9215	0.35615	0.0:0.8839:0.0:0.1161	.	167;167	A2ADX3;Q5SR06	.;.	T	167	ENSP00000396330:A167T;ENSP00000410512:A167T;ENSP00000390431:A167T	ENSP00000390431:A167T	A	-	1	0	HLA-DQB2	32834752	0.000000	0.05858	0.869000	0.34112	0.359000	0.29487	0.045000	0.14013	0.784000	0.33661	-0.333000	0.08304	GCC		0.542	HLA-DQB2-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000076216.2			
KCNQ2	3785	broad.mit.edu	37	20	62050979	62050979	+	Missense_Mutation	SNP	G	G	A	rs368720575		TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr20:62050979G>A	ENST00000359125.2	-	12	1468	c.1294C>T	c.(1294-1296)Cgc>Tgc	p.R432C	KCNQ2_ENST00000344462.4_Intron|KCNQ2_ENST00000360480.3_Intron|KCNQ2_ENST00000359689.1_Missense_Mutation_p.R432C|KCNQ2_ENST00000354587.3_Intron|KCNQ2_ENST00000370224.1_Intron|KCNQ2_ENST00000357249.2_Intron	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	432					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.R432C(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TACCTAGAGCGTCCGGGGCAG	0.662																																																	1	Substitution - Missense(1)	kidney(1)						G	CYS/ARG,,,	1,4403	2.1+/-5.4	0,1,2201	41.0	38.0	39.0		1294,,,	3.8	1.0	20		39	0,8598		0,0,4299	no	missense,intron,intron,intron	KCNQ2	NM_172107.2,NM_004518.4,NM_172106.1,NM_172108.3	180,,,	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,,,	432/873,,,	62050979	1,13001	2202	4299	6501	SO:0001583	missense	3785			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1294C>T	20.37:g.62050979G>A	ENSP00000352035:p.Arg432Cys	Somatic		WXS	Illumina GAIIx	Phase_I	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938533	0.52972	2.27E-4	0.0	ENSG00000075043	ENST00000359125;ENST00000359689	D;D	0.99098	-5.42;-5.42	4.83	3.81	0.43845	.	.	.	.	.	D	0.94958	0.8369	N	0.14661	0.345	0.80722	D	1	P	0.39116	0.66	B	0.30646	0.118	D	0.94631	0.7822	9	0.56958	D	0.05	.	9.4771	0.38878	0.0:0.0:0.6191:0.3809	.	432	O43526	KCNQ2_HUMAN	C	432	ENSP00000352035:R432C;ENSP00000352718:R432C	ENSP00000352035:R432C	R	-	1	0	KCNQ2	61521423	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.218000	0.58554	2.227000	0.72691	0.655000	0.94253	CGC		0.662	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1		NM_172109	
MSI1	4440	broad.mit.edu	37	12	120805861	120805861	+	Missense_Mutation	SNP	C	C	G			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr12:120805861C>G	ENST00000257552.2	-	4	305	c.217G>C	c.(217-219)Ggg>Cgg	p.G73R	RPS27P25_ENST00000477404.1_RNA	NM_002442.3	NP_002433.1	O43347	MSI1H_HUMAN	musashi RNA-binding protein 1	73	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				epithelial cell differentiation (GO:0030855)|nervous system development (GO:0007399)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)	p.G73R(1)		breast(4)|central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTATCCACCCCCGCCTGGTCC	0.647																																																	1	Substitution - Missense(1)	kidney(1)											41.0	34.0	36.0					12																	120805861		2203	4300	6503	SO:0001583	missense	4440			AB012851	CCDS9196.1	12q24	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	7330	protein-coding gene	gene with protein product		603328	"""Musashi (Drosophila) homolog 1"", ""musashi homolog 1 (Drosophila)"""			9790759	Standard	NM_002442		Approved		uc001tye.2	O43347	OTTHUMG00000169344	ENST00000257552.2:c.217G>C	12.37:g.120805861C>G	ENSP00000257552:p.Gly73Arg	Somatic		WXS	Illumina GAIIx	Phase_I	Q96PU0|Q96PU1|Q96PU2|Q96PU3	Missense_Mutation	SNP	ENST00000257552.2	37	CCDS9196.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.708113	0.68615	.	.	ENSG00000135097	ENST00000257552	D	0.85484	-1.99	3.24	3.24	0.37175	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.50627	D	0.000112	D	0.84019	0.5380	N	0.25286	0.73	0.80722	D	1	P	0.48764	0.915	P	0.57468	0.821	D	0.84370	0.0543	10	0.40728	T	0.16	.	14.6092	0.68504	0.0:1.0:0.0:0.0	.	73	O43347	MSI1H_HUMAN	R	73	ENSP00000257552:G73R	ENSP00000257552:G73R	G	-	1	0	MSI1	119290244	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.248000	0.78268	1.808000	0.52836	0.305000	0.20034	GGG		0.647	MSI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403629.1		NM_002442	
PIPSL	266971	broad.mit.edu	37	10	95720191	95720191	+	RNA	SNP	A	A	C			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr10:95720191A>C	ENST00000480546.1	-	0	1106					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										CCATGGTGCCACCCCGTCGAG	0.517																																																	0																																												266971			BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95720191A>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q6NUK8	Silent	SNP	ENST00000480546.1	37																																																																																					0.517	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000351483.1		NR_002319	
SGK223	157285	broad.mit.edu	37	8	8175907	8175907	+	Missense_Mutation	SNP	C	C	A			TCGA-EU-5905-01A-11D-1669-08	TCGA-EU-5905-10A-01D-1669-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	091c18b6-bfc2-4353-9eba-ebc46c2c18c5	75193f95-bb70-4f8b-90df-9c2ff7df4f8d	g.chr8:8175907C>A	ENST00000520004.1	-	6	4242	c.3978G>T	c.(3976-3978)tgG>tgT	p.W1326C	SGK223_ENST00000330777.4_Missense_Mutation_p.W1326C			Q86YV5	SG223_HUMAN		1330	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.W1328C(1)|p.W1326C(1)									GCCGAGGCCCCCACAGCAGGC	0.682																																					GBM(34;731 755 10259 33573 33867)												2	Substitution - Missense(2)	kidney(2)											42.0	46.0	44.0					8																	8175907		2034	4177	6211	SO:0001583	missense	157285																														ENST00000520004.1:c.3978G>T	8.37:g.8175907C>A	ENSP00000428054:p.Trp1326Cys	Somatic		WXS	Illumina GAIIx	Phase_I	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.432331	0.83776	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.14391	2.51;2.51	5.39	5.39	0.77823	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.36413	0.0966	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.03175	-1.1064	10	0.87932	D	0	.	18.5141	0.90930	0.0:1.0:0.0:0.0	.	1326	Q86YV5	SG223_HUMAN	C	1326	ENSP00000330930:W1326C;ENSP00000428054:W1326C	ENSP00000330930:W1326C	W	-	3	0	AC068353.1	8213317	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.785000	0.85724	2.701000	0.92244	0.462000	0.41574	TGG		0.682	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1			
