#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PIK3CD	5293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	9782066	9782066	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:9782066G>T	ENST00000377346.4	+	17	2284	c.2089G>T	c.(2089-2091)Gac>Tac	p.D697Y	PIK3CD_ENST00000543390.1_3'UTR|PIK3CD_ENST00000361110.2_Missense_Mutation_p.D721Y|PIK3CD_ENST00000536656.1_Missense_Mutation_p.D721Y	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	697					adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	GGCCCTGAATGACTTCGTCAA	0.637											OREG0013082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D697Y		.											.	PIK3CD-1311	0			c.G2089T						.						74.0	84.0	81.0					1																	9782066		2203	4300	6503	SO:0001583	missense	5293	exon17			CTGAATGACTTCG		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.2089G>T	1.37:g.9782066G>T	ENSP00000366563:p.Asp697Tyr	Somatic	123	0	659	WXS	Illumina HiSeq	Phase_I	99	26	NM_005026	0	0	2	3	1	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.908660	0.33721	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	D;D;D	0.82081	-1.57;-1.57;-1.57	5.4	4.48	0.54585	Protein kinase-like domain (1);	0.151853	0.64402	D	0.000020	D	0.86339	0.5909	L	0.55990	1.75	0.80722	D	1	P;D;P	0.65815	0.939;0.995;0.939	P;P;P	0.57620	0.615;0.824;0.707	D	0.87479	0.2419	10	0.87932	D	0	-44.469	13.397	0.60858	0.0756:0.0:0.9244:0.0	.	696;721;697	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	Y	721;697;721;721	ENSP00000446444:D721Y;ENSP00000366563:D697Y;ENSP00000354410:D721Y	ENSP00000353766:D721Y	D	+	1	0	PIK3CD	9704653	1.000000	0.71417	0.063000	0.19743	0.112000	0.19704	7.859000	0.86982	1.275000	0.44379	0.561000	0.74099	GAC	.		0.637	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
TAS1R2	80834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19186021	19186021	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:19186021A>T	ENST00000375371.3	-	1	155	c.134T>A	c.(133-135)aTg>aAg	p.M45K	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	45					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	AATGCCCTTCATGTTGGCATG	0.592																																					p.M45K		.											.	TAS1R2-93	0			c.T134A						.						118.0	109.0	112.0					1																	19186021		2203	4300	6503	SO:0001583	missense	80834	exon1			CCCTTCATGTTGG		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.134T>A	1.37:g.19186021A>T	ENSP00000364520:p.Met45Lys	Somatic	162	0		WXS	Illumina HiSeq	Phase_I	107	16	NM_152232	0	0	0	0	0	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	.	.	.	.	.	.	.	.	.	.	A	8.739	0.918447	0.17982	.	.	ENSG00000179002	ENST00000375371	D	0.88046	-2.33	4.47	2.07	0.26955	.	0.544004	0.13698	U	0.369069	T	0.74627	0.3741	N	0.22421	0.69	0.09310	N	0.999998	B	0.27068	0.167	B	0.18871	0.023	T	0.63093	-0.6714	10	0.52906	T	0.07	.	4.5956	0.12327	0.699:0.196:0.1051:0.0	.	45	Q8TE23	TS1R2_HUMAN	K	45	ENSP00000364520:M45K	ENSP00000364520:M45K	M	-	2	0	TAS1R2	19058608	0.239000	0.23836	0.384000	0.26145	0.776000	0.43924	1.724000	0.38064	0.201000	0.20466	0.260000	0.18958	ATG	.		0.592	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
AHDC1	27245	ucsc.edu	37	1	27875553	27875553	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:27875553G>A	ENST00000247087.5	-	5	3670	c.3074C>T	c.(3073-3075)aCc>aTc	p.T1025I	AHDC1_ENST00000374011.2_Missense_Mutation_p.T1025I			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1025							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GGGGCCCCCGGTAGGCGGTGG	0.682																																					p.T1025I													.	AHDC1-90	0			c.C3074T						.						15.0	18.0	17.0					1																	27875553		2199	4295	6494	SO:0001583	missense	27245	exon6			CCCCCGGTAGGCG	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3074C>T	1.37:g.27875553G>A	ENSP00000247087:p.Thr1025Ile	Somatic	40	0		WXS	Illumina HiSeq		40	4	NM_001029882	0	0	37	37	0	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	37	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817319	0.50633	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.49720	0.77;0.77	5.79	5.79	0.91817	.	0.215591	0.30510	N	0.009468	T	0.41534	0.1163	N	0.14661	0.345	0.38962	D	0.958562	D	0.53745	0.962	P	0.46825	0.528	T	0.49986	-0.8880	10	0.87932	D	0	-10.3301	18.7978	0.92003	0.0:0.0:1.0:0.0	.	1025	Q5TGY3	AHDC1_HUMAN	I	1025	ENSP00000247087:T1025I;ENSP00000363123:T1025I	ENSP00000247087:T1025I	T	-	2	0	AHDC1	27748140	0.932000	0.31603	0.942000	0.38095	0.996000	0.88848	2.672000	0.46850	2.735000	0.93741	0.655000	0.94253	ACC	.		0.682	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
LRRC8C	84230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	90180336	90180336	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:90180336T>C	ENST00000370454.4	+	3	2462	c.2207T>C	c.(2206-2208)aTt>aCt	p.I736T	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	736					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		ACTCTGAAGATTGGAAAAAAC	0.353																																					p.I736T		.											.	LRRC8C-97	0			c.T2207C						.						62.0	64.0	64.0					1																	90180336		2203	4300	6503	SO:0001583	missense	84230	exon3			TGAAGATTGGAAA		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.2207T>C	1.37:g.90180336T>C	ENSP00000359483:p.Ile736Thr	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	88	7	NM_032270	0	0	12	15	3	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	37	CCDS725.1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.077889	0.36662	.	.	ENSG00000171488	ENST00000370454	T	0.27402	1.67	5.87	5.87	0.94306	.	0.047961	0.85682	D	0.000000	T	0.25791	0.0628	M	0.69358	2.11	0.53688	D	0.99997	B	0.21821	0.061	B	0.27715	0.082	T	0.08953	-1.0697	10	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	736	Q8TDW0	LRC8C_HUMAN	T	736	ENSP00000359483:I736T	ENSP00000359483:I736T	I	+	2	0	LRRC8C	89952924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	2.371000	0.80710	0.533000	0.62120	ATT	.		0.353	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
FCRL3	115352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	157667660	157667660	+	Silent	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:157667660G>A	ENST00000368184.3	-	5	639	c.348C>T	c.(346-348)gtC>gtT	p.V116V	FCRL3_ENST00000368186.5_Silent_p.V116V|RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	116	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					ATCTCAGAATGACATTGTCTC	0.423																																					p.V116V		.											.	FCRL3-156	0			c.C348T						.						104.0	96.0	99.0					1																	157667660		2203	4300	6503	SO:0001819	synonymous_variant	115352	exon5			CAGAATGACATTG	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.348C>T	1.37:g.157667660G>A		Somatic	72	1		WXS	Illumina HiSeq	Phase_I	70	27	NM_052939	0	0	0	0	0	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	CCDS1167.1																																																																																			.		0.423	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939	
IER5	51278	hgsc.bcm.edu	37	1	181058618	181058618	+	Missense_Mutation	SNP	C	C	G	rs1416829	byFrequency	TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:181058618C>G	ENST00000367577.4	+	1	981	c.580C>G	c.(580-582)Cgc>Ggc	p.R194G	RP11-309G3.3_ENST00000606938.1_lincRNA	NM_016545.4	NP_057629.2	Q5VY09	IER5_HUMAN	immediate early response 5	194			R -> G (in dbSNP:rs1416829). {ECO:0000269|PubMed:15498874}.							lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	4						CGCGACCCCCCGCGCTGCCTG	0.811													C|||	2222	0.44369	0.2489	0.4452	5008	,	,		5637	0.6012		0.3777	False		,,,				2504	0.6115				p.R194G		.											.	IER5-227	0			c.C580G						.						1.0	1.0	1.0					1																	181058618		352	834	1186	SO:0001583	missense	51278	exon1			ACCCCCCGCGCTG	BC000128	CCDS1343.1	1q25.3	2008-02-05			ENSG00000162783	ENSG00000162783			5393	protein-coding gene	gene with protein product		607177				10049588, 11102586	Standard	NM_016545		Approved		uc001got.4	Q5VY09	OTTHUMG00000035178	ENST00000367577.4:c.580C>G	1.37:g.181058618C>G	ENSP00000356549:p.Arg194Gly	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	3	3	NM_016545	0	0	0	0	0	B2RBV3|Q8WY68|Q9NY49|Q9NZP9	Missense_Mutation	SNP	ENST00000367577.4	37	CCDS1343.1	948	0.4340659340659341	135	0.27439024390243905	158	0.43646408839779005	360	0.6293706293706294	295	0.3891820580474934	C	4.540	0.100211	0.08731	.	.	ENSG00000162783	ENST00000367577	T	0.11821	2.74	3.33	-0.106	0.13596	.	1.560750	0.05354	N	0.532505	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.18610	0.029	B	0.15484	0.013	T	0.38972	-0.9636	9	0.34782	T	0.22	.	8.3021	0.32021	0.0:0.4746:0.4312:0.0942	rs1416829;rs3747953	194	Q5VY09	IER5_HUMAN	G	194	ENSP00000356549:R194G	ENSP00000356549:R194G	R	+	1	0	IER5	179325241	0.001000	0.12720	0.001000	0.08648	0.005000	0.04900	-0.019000	0.12546	0.004000	0.14682	-1.520000	0.00934	CGC	C|0.566;G|0.434		0.811	IER5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085142.1	NM_016545	
PRELP	5549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	203455866	203455866	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:203455866C>A	ENST00000343110.2	+	3	1133	c.1006C>A	c.(1006-1008)Cta>Ata	p.L336I		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	336					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			CCCCAACGACCTAGTGGCGTT	0.567																																					p.L336I		.											.	PRELP-516	0			c.C1006A						.						110.0	100.0	103.0					1																	203455866		2203	4300	6503	SO:0001583	missense	5549	exon3			AACGACCTAGTGG	BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.1006C>A	1.37:g.203455866C>A	ENSP00000343924:p.Leu336Ile	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	125	36	NM_201348	0	1	208	209	0	Q6FG38	Missense_Mutation	SNP	ENST00000343110.2	37	CCDS1438.1	.	.	.	.	.	.	.	.	.	.	C	1.678	-0.507353	0.04231	.	.	ENSG00000188783	ENST00000343110	T	0.49139	0.79	5.45	1.38	0.22167	.	0.097389	0.42964	N	0.000628	T	0.26557	0.0649	N	0.24115	0.695	0.19775	N	0.999957	B	0.06786	0.001	B	0.12156	0.007	T	0.15607	-1.0431	10	0.18710	T	0.47	-7.7426	5.6324	0.17518	0.2531:0.5559:0.1222:0.0687	.	336	P51888	PRELP_HUMAN	I	336	ENSP00000343924:L336I	ENSP00000343924:L336I	L	+	1	2	PRELP	201722489	0.003000	0.15002	0.003000	0.11579	0.246000	0.25737	-0.032000	0.12266	0.005000	0.14708	-0.300000	0.09419	CTA	.		0.567	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	NM_002725	
ITGA8	8516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	15688933	15688933	+	Silent	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:15688933G>A	ENST00000378076.3	-	12	1472	c.1119C>T	c.(1117-1119)gaC>gaT	p.D373D		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	373					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GGATCTGGGGGTCTCTGAAGA	0.483																																					p.D373D		.											.	ITGA8-230	0			c.C1119T						.						122.0	109.0	113.0					10																	15688933		2203	4300	6503	SO:0001819	synonymous_variant	8516	exon12			CTGGGGGTCTCTG	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1119C>T	10.37:g.15688933G>A		Somatic	130	0		WXS	Illumina HiSeq	Phase_I	106	21	NM_003638	0	0	6	6	0	B0YJ31|Q5VX94	Silent	SNP	ENST00000378076.3	37	CCDS31155.1																																																																																			.		0.483	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	16916468	16916468	+	Silent	SNP	G	G	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:16916468G>T	ENST00000377833.4	-	58	9206	c.9141C>A	c.(9139-9141)atC>atA	p.I3047I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3047	CUB 23. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GACTTGTGATGATTCCAGAAG	0.433																																					p.I3047I		.											.	CUBN-166	0			c.C9141A						.						168.0	135.0	146.0					10																	16916468		2203	4300	6503	SO:0001819	synonymous_variant	8029	exon58			TGTGATGATTCCA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9141C>A	10.37:g.16916468G>T		Somatic	101	0		WXS	Illumina HiSeq	Phase_I	89	24	NM_001081	0	0	1	1	0	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	CCDS7113.1																																																																																			.		0.433	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
UBTD1	80019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	99327795	99327795	+	Silent	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:99327795G>A	ENST00000370664.3	+	2	531	c.195G>A	c.(193-195)aaG>aaA	p.K65K		NM_024954.3	NP_079230.1	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1	65										central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		AGGGCCGCAAGGAGATCTGGG	0.632																																					p.K65K	Pancreas(100;169 2668 32720)	.											.	UBTD1-90	0			c.G195A						.						87.0	86.0	86.0					10																	99327795		2203	4300	6503	SO:0001819	synonymous_variant	80019	exon2			CCGCAAGGAGATC	BC007331	CCDS7465.1	10q24.2	2005-09-22			ENSG00000165886	ENSG00000165886			25683	protein-coding gene	gene with protein product						12477932	Standard	NM_024954		Approved	FLJ11807	uc001knv.1	Q9HAC8	OTTHUMG00000018856	ENST00000370664.3:c.195G>A	10.37:g.99327795G>A		Somatic	195	0		WXS	Illumina HiSeq	Phase_I	155	24	NM_024954	0	0	68	106	38	D3DR57|Q53HI3	Silent	SNP	ENST00000370664.3	37	CCDS7465.1																																																																																			.		0.632	UBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049701.1	NM_024954	
SFRP5	6425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	99527530	99527530	+	Missense_Mutation	SNP	G	G	T	rs199605298	byFrequency	TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:99527530G>T	ENST00000266066.3	-	3	813	c.695C>A	c.(694-696)cCg>cAg	p.P232Q		NM_003015.3	NP_003006.2	Q5T4F7	SFRP5_HUMAN	secreted frizzled-related protein 5	232	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cell differentiation (GO:0030154)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|establishment or maintenance of cell polarity (GO:0007163)|gonad development (GO:0008406)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of Wnt signaling pathway involved in digestive tract morphogenesis (GO:2000057)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|post-anal tail morphogenesis (GO:0036342)|signal transduction (GO:0007165)|vasculature development (GO:0001944)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			large_intestine(1)|lung(4)	5		Colorectal(252;0.234)		Epithelial(162;4.98e-10)|all cancers(201;3.58e-08)		CAGGGGGCCCGGCTTGAGCAG	0.587													G|||	8	0.00159744	0.0	0.0	5008	,	,		16353	0.0079		0.0	False		,,,				2504	0.0				p.P232Q		.											.	SFRP5-658	0			c.C695A						.						55.0	60.0	58.0					10																	99527530		2203	4300	6503	SO:0001583	missense	6425	exon3			GGGCCCGGCTTGA	AF017988	CCDS7472.1	10q24	2008-07-10			ENSG00000120057	ENSG00000120057		"""Secreted frizzled-related proteins"""	10779	protein-coding gene	gene with protein product	"""secreted apoptosis related protein 3"""	604158				9391078	Standard	NM_003015		Approved	SARP3	uc001kor.4	Q5T4F7	OTTHUMG00000018866	ENST00000266066.3:c.695C>A	10.37:g.99527530G>T	ENSP00000266066:p.Pro232Gln	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	97	43	NM_003015	0	0	0	0	0	O14780|Q86TH7	Missense_Mutation	SNP	ENST00000266066.3	37	CCDS7472.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	8.727	0.915701	0.17907	.	.	ENSG00000120057	ENST00000266066	T	0.19938	2.11	5.74	5.74	0.90152	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.747332	0.12885	N	0.431104	T	0.09774	0.0240	N	0.03608	-0.345	0.22292	N	0.999227	B	0.16396	0.017	B	0.18561	0.022	T	0.26985	-1.0087	10	0.13470	T	0.59	.	10.9329	0.47228	0.1134:0.0:0.8866:0.0	.	232	Q5T4F7	SFRP5_HUMAN	Q	232	ENSP00000266066:P232Q	ENSP00000266066:P232Q	P	-	2	0	SFRP5	99517520	0.958000	0.32768	0.999000	0.59377	0.995000	0.86356	2.473000	0.45145	2.712000	0.92718	0.561000	0.74099	CCG	G|0.999;T|0.001		0.587	SFRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049742.1	NM_003015	
CNIH2	254263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66049735	66049735	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr11:66049735A>G	ENST00000311445.6	+	2	345	c.87A>G	c.(85-87)atA>atG	p.I29M	CNIH2_ENST00000530519.1_3'UTR|CNIH2_ENST00000528852.1_Missense_Mutation_p.I29M|YIF1A_ENST00000526497.1_5'Flank	NM_182553.2	NP_872359.1	Q6PI25	CNIH2_HUMAN	cornichon family AMPA receptor auxiliary protein 2	29					intracellular signal transduction (GO:0035556)|localization within membrane (GO:0051668)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						CCCAGATCATAGCCTTTGATG	0.597																																					p.I29M		.											.	CNIH2-90	0			c.A87G						.						72.0	66.0	68.0					11																	66049735		2200	4295	6495	SO:0001583	missense	254263	exon2			GATCATAGCCTTT	BC047953	CCDS8131.1	11q13.2	2013-08-28	2013-08-28		ENSG00000174871	ENSG00000174871			28744	protein-coding gene	gene with protein product		611288	"""cornichon homolog 2 (Drosophila)"""			12477932	Standard	NM_182553		Approved	MGC50896, Cnil, CNIH-2	uc001ohi.2	Q6PI25	OTTHUMG00000166919	ENST00000311445.6:c.87A>G	11.37:g.66049735A>G	ENSP00000310003:p.Ile29Met	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	42	10	NM_182553	0	0	0	0	0		Missense_Mutation	SNP	ENST00000311445.6	37	CCDS8131.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634157	0.47049	.	.	ENSG00000174871	ENST00000528852;ENST00000311445	T;T	0.55760	0.5;0.5	5.33	1.49	0.22878	.	0.000000	0.85682	D	0.000000	T	0.68869	0.3048	M	0.89478	3.035	0.58432	D	0.999998	D;D	0.71674	0.961;0.998	P;D	0.68483	0.791;0.958	T	0.68221	-0.5466	10	0.59425	D	0.04	-24.0482	4.9261	0.13894	0.3807:0.2295:0.0:0.3897	.	29;29	Q6PI25;E9PS15	CNIH2_HUMAN;.	M	29	ENSP00000432177:I29M;ENSP00000310003:I29M	ENSP00000310003:I29M	I	+	3	3	CNIH2	65806311	0.998000	0.40836	1.000000	0.80357	0.547000	0.35210	1.267000	0.33050	0.919000	0.36945	0.460000	0.39030	ATA	.		0.597	CNIH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391892.1	NM_182553	
NPAS4	266743	broad.mit.edu	37	11	66191471	66191471	+	Silent	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr11:66191471C>A	ENST00000311034.2	+	7	1286	c.1110C>A	c.(1108-1110)ccC>ccA	p.P370P		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	370					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						TGGGGGCTCCCAGAAGCACCA	0.552																																					p.P370P													.	NPAS4-90	0			c.C1110A						.						134.0	140.0	138.0					11																	66191471		2200	4295	6495	SO:0001819	synonymous_variant	266743	exon7			GGCTCCCAGAAGC	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1110C>A	11.37:g.66191471C>A		Somatic	317	0		WXS	Illumina HiSeq	Phase_I	222	8	NM_178864	0	0	0	0	0	B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	ENST00000311034.2	37	CCDS8138.1																																																																																			.		0.552	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
EXPH5	23086	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	108380880	108380880	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr11:108380880C>T	ENST00000265843.4	-	6	5464	c.5354G>A	c.(5353-5355)tGg>tAg	p.W1785*	EXPH5_ENST00000443411.1_Nonsense_Mutation_p.W1597*|EXPH5_ENST00000525344.1_Nonsense_Mutation_p.W1778*|EXPH5_ENST00000428840.1_Nonsense_Mutation_p.W1709*	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1785					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CTCAGGTTCCCACTCCAGAGA	0.483																																					p.W1785X		.											.	EXPH5-95	0			c.G5354A						.						89.0	96.0	94.0					11																	108380880		2201	4298	6499	SO:0001587	stop_gained	23086	exon6			GGTTCCCACTCCA		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.5354G>A	11.37:g.108380880C>T	ENSP00000265843:p.Trp1785*	Somatic	188	0		WXS	Illumina HiSeq	Phase_I	107	46	NM_015065	0	0	0	1	1	Q2KHM1|Q9Y4D6	Nonsense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	C	41	8.551547	0.98859	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312	.	.	.	6.17	4.26	0.50523	.	0.766008	0.12354	N	0.476287	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	1.7662	10.3652	0.44019	0.0:0.497:0.431:0.0721	.	.	.	.	X	1785;1709;1597;1778;615;1709	.	ENSP00000265843:W1785X	W	-	2	0	EXPH5	107886090	0.060000	0.20803	0.159000	0.22649	0.035000	0.12851	0.897000	0.28390	0.883000	0.36040	0.655000	0.94253	TGG	.		0.483	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
KRT6A	3853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52882316	52882316	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr12:52882316G>A	ENST00000330722.6	-	7	1288	c.1220C>T	c.(1219-1221)gCc>gTc	p.A407V		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	407	Coil 2.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCAATGGCGGCCTGCAGGTT	0.557																																					p.A407V		.											.	KRT6A-27	0			c.C1220T						.						71.0	66.0	67.0					12																	52882316		2203	4300	6503	SO:0001583	missense	3853	exon7			ATGGCGGCCTGCA	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1220C>T	12.37:g.52882316G>A	ENSP00000369317:p.Ala407Val	Somatic	121	1		WXS	Illumina HiSeq	Phase_I	88	26	NM_005554	0	0	0	0	0	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	g	17.33	3.362592	0.61403	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	T	0.75821	-0.97	5.15	4.21	0.49690	Filament (1);	0.570128	0.16803	N	0.198918	T	0.74344	0.3704	M	0.75085	2.285	0.26350	N	0.977228	P	0.42757	0.789	B	0.43194	0.411	T	0.70769	-0.4782	10	0.62326	D	0.03	.	9.2357	0.37464	0.076:0.0:0.7787:0.1453	.	407	P02538	K2C6A_HUMAN	V	407;363	ENSP00000369317:A407V	ENSP00000369317:A407V	A	-	2	0	KRT6A	51168583	0.003000	0.15002	0.944000	0.38274	0.754000	0.42855	1.333000	0.33816	2.549000	0.85964	0.655000	0.94253	GCC	.		0.557	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
ERP29	10961	broad.mit.edu	37	12	112451270	112451270	+	Start_Codon_SNP	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr12:112451270A>G	ENST00000261735.3	+	1	151	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	ERP29_ENST00000455836.1_Start_Codon_SNP_p.M1V|TMEM116_ENST00000354825.3_5'Flank|TMEM116_ENST00000550831.3_5'Flank|TMEM116_ENST00000437003.2_5'Flank|TMEM116_ENST00000552839.2_5'Flank|TMEM116_ENST00000549537.2_5'Flank|TMEM116_ENST00000355445.3_5'Flank|TMEM116_ENST00000552374.2_5'Flank	NM_006817.3	NP_006808.1	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29	1					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)|protein secretion (GO:0009306)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						ACCCGGCGATATGGCTGCCGC	0.682																																					p.M1V													.	ERP29-90	0			c.A1G						.						52.0	58.0	56.0					12																	112451270		2203	4300	6503	SO:0001582	initiator_codon_variant	10961	exon1			GGCGATATGGCTG	X94910	CCDS9158.1, CCDS44977.1	12q24.13	2011-10-19	2005-10-05	2005-10-05		ENSG00000089248		"""Protein disulfide isomerases"""	13799	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 9"""	602287	"""chromosome 12 open reading frame 8"""	C12orf8		9738895, 9037184	Standard	NM_006817		Approved	ERp28, ERp31, ERp29, PDI-DB, PDIA9	uc001ttk.1	P30040	OTTHUMG00000169637	ENST00000261735.3:c.1A>G	12.37:g.112451270A>G	ENSP00000261735:p.Met1Val	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	91	4	NM_001034025	0	0	159	159	0	C9J183|Q3MJC3|Q6FHT4	Missense_Mutation	SNP	ENST00000261735.3	37	CCDS9158.1	.	.	.	.	.	.	.	.	.	.	A	11.82	1.753947	0.31046	.	.	ENSG00000089248	ENST00000261735;ENST00000455836	.	.	.	4.65	3.47	0.39725	.	1.596910	0.03938	N	0.286442	T	0.51058	0.1652	.	.	.	0.80722	D	1	B;B	0.28291	0.206;0.003	B;B	0.22601	0.04;0.004	T	0.36016	-0.9765	8	0.87932	D	0	-9.006	8.0992	0.30846	0.7948:0.2052:0.0:0.0	.	1;1	C9J183;P30040	.;ERP29_HUMAN	V	1	.	ENSP00000261735:M1V	M	+	1	0	ERP29	110935653	1.000000	0.71417	0.999000	0.59377	0.171000	0.22731	2.950000	0.49081	0.778000	0.33520	0.383000	0.25322	ATG	.		0.682	ERP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405200.1		Missense_Mutation
KDM2B	84678	broad.mit.edu;bcgsc.ca	37	12	122016841	122016841	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr12:122016841T>C	ENST00000377071.4	-	2	209	c.137A>G	c.(136-138)gAc>gGc	p.D46G	KDM2B_ENST00000377069.4_Missense_Mutation_p.D15G|KDM2B_ENST00000538046.2_Missense_Mutation_p.D46G|RP13-941N14.1_ENST00000541574.1_lincRNA|KDM2B_ENST00000536437.1_5'UTR	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	46					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						TCGCTGGCGGTCAATCGGGCG	0.627																																					p.D46G													.	KDM2B-638	0			c.A137G						.						64.0	71.0	68.0					12																	122016841		2046	4187	6233	SO:0001583	missense	84678	exon2			TGGCGGTCAATCG	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.137A>G	12.37:g.122016841T>C	ENSP00000366271:p.Asp46Gly	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	173	9	NM_032590	0	0	0	0	0	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	T	9.672	1.146946	0.21288	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000397478;ENST00000261824;ENST00000446152;ENST00000539371	T;T;T	0.42900	2.55;1.96;0.96	4.06	4.06	0.47325	.	1.411770	0.04385	N	0.361475	T	0.26521	0.0648	N	0.08118	0	0.80722	D	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.12156	0.007;0.001;0.0	T	0.28235	-1.0050	10	0.46703	T	0.11	-14.2477	6.3037	0.21127	0.0:0.1551:0.0:0.8449	.	46;46;15	E7EML5;Q8NHM5;A8MRS1	.;KDM2B_HUMAN;.	G	46;15;46;46;46;9;15	ENSP00000366269:D15G;ENSP00000366271:D46G;ENSP00000398279:D9G	ENSP00000261824:D46G	D	-	2	0	KDM2B	120501224	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.418000	0.52721	1.711000	0.51337	0.374000	0.22700	GAC	.		0.627	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
OR4N4	283694	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	22382930	22382930	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr15:22382930T>C	ENST00000328795.4	+	1	549	c.458T>C	c.(457-459)tTt>tCt	p.F153S	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTTGGGGGTTTTGTCCACTCC	0.527																																					p.F153S		.											.	OR4N4-73	0			c.T458C						.						100.0	87.0	91.0					15																	22382930		2187	4254	6441	SO:0001583	missense	283694	exon1			GGGGTTTTGTCCA	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.458T>C	15.37:g.22382930T>C	ENSP00000332500:p.Phe153Ser	Somatic	432	0		WXS	Illumina HiSeq	Phase_I	312	41	NM_001005241	0	0	0	0	0	Q6IEY3|Q6IF56	Missense_Mutation	SNP	ENST00000328795.4	37	CCDS32173.1	.	.	.	.	.	.	.	.	.	.	.	10.03	1.238759	0.22711	.	.	ENSG00000183706	ENST00000328795	T	0.00216	8.53	3.37	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000117	T	0.00412	0.0013	M	0.62723	1.935	0.09310	N	1	D	0.67145	0.996	D	0.74348	0.983	T	0.47873	-0.9083	10	0.87932	D	0	-8.9888	10.041	0.42158	0.0:0.0:0.0:1.0	.	153	Q8N0Y3	OR4N4_HUMAN	S	153	ENSP00000332500:F153S	ENSP00000332500:F153S	F	+	2	0	OR4N4	19884294	0.006000	0.16342	0.918000	0.36340	0.103000	0.19146	1.078000	0.30754	1.522000	0.49001	0.332000	0.21555	TTT	.		0.527	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1		
FURIN	5045	ucsc.edu	37	15	91419099	91419099	+	Silent	SNP	G	G	A	rs141410539		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr15:91419099G>A	ENST00000268171.3	+	2	408	c.129G>A	c.(127-129)gcG>gcA	p.A43A		NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	43			A -> V (in dbSNP:rs16944971).		cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GAGGCCCAGCGGTGGCCAACA	0.622																																					p.A43A													.	FURIN-1083	0			c.G129A						.	G		1,4387		0,1,2193	54.0	40.0	45.0		129	-9.5	0.0	15	dbSNP_134	45	1,8579		0,1,4289	no	coding-synonymous	FURIN	NM_002569.2		0,2,6482	AA,AG,GG		0.0117,0.0228,0.0154		43/795	91419099	2,12966	2194	4290	6484	SO:0001819	synonymous_variant	5045	exon2			CCCAGCGGTGGCC	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.129G>A	15.37:g.91419099G>A		Somatic	22	0		WXS	Illumina HiSeq		22	4	NM_002569	0	1	201	202	0	Q14336|Q6LBS3|Q9UCZ5	Silent	SNP	ENST00000268171.3	37	CCDS10364.1																																																																																			G|1.000;A|0.000		0.622	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569	
MRPS34	65993	hgsc.bcm.edu	37	16	1822947	1822947	+	Silent	SNP	C	C	G	rs1076695	byFrequency	TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr16:1822947C>G	ENST00000397375.2	-	1	209	c.174G>C	c.(172-174)gtG>gtC	p.V58V	MRPS34_ENST00000177742.3_Silent_p.V58V|EME2_ENST00000307394.7_5'Flank|NME3_ENST00000563498.1_5'Flank|NME3_ENST00000219302.3_5'Flank|EME2_ENST00000568449.1_5'Flank	NM_023936.1	NP_076425.1	P82930	RT34_HUMAN	mitochondrial ribosomal protein S34	58						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|skin(2)	3						TCTCGCGGCGCACGTCGGCCC	0.726													C|||	251	0.0501198	0.0061	0.0965	5008	,	,		10499	0.002		0.1421	False		,,,				2504	0.0317				p.V58V		.											.	MRPS34-92	0			c.G174C						.	C		25,2311		0,25,1143	1.0	2.0	2.0		174	1.7	1.0	16	dbSNP_86	2	405,4871		9,387,2242	no	coding-synonymous	MRPS34	NM_023936.1		9,412,3385	GG,GC,CC		7.6763,1.0702,5.649		58/219	1822947	430,7182	1168	2638	3806	SO:0001819	synonymous_variant	65993	exon1			GCGGCGCACGTCG	BC001182	CCDS10444.1, CCDS73805.1	16p13.3	2012-09-13			ENSG00000074071	ENSG00000074071		"""Mitochondrial ribosomal proteins / small subunits"""	16618	protein-coding gene	gene with protein product		611994					Standard	NM_023936		Approved	MRP-S12, MGC2616	uc002cmo.3	P82930	OTTHUMG00000128636	ENST00000397375.2:c.174G>C	16.37:g.1822947C>G		Somatic	2	1		WXS	Illumina HiSeq	Phase_I	4	4	NM_023936	0	0	0	1	1	Q9BVI7	Silent	SNP	ENST00000397375.2	37	CCDS10444.1																																																																																			C|0.923;G|0.077		0.726	MRPS34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250506.1	NM_023936	
E4F1	1877	broad.mit.edu;ucsc.edu	37	16	2284711	2284711	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr16:2284711C>T	ENST00000301727.4	+	11	1769	c.1721C>T	c.(1720-1722)cCg>cTg	p.P574L	DNASE1L2_ENST00000564065.1_5'Flank|E4F1_ENST00000565090.1_Missense_Mutation_p.P397L|E4F1_ENST00000564139.1_Missense_Mutation_p.P574L|RP11-304L19.12_ENST00000564055.1_lincRNA|DNASE1L2_ENST00000382437.4_5'Flank|DNASE1L2_ENST00000567494.1_5'Flank|DNASE1L2_ENST00000320700.5_5'Flank	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	574	Interaction with BMI1.|Mediates interaction with TP53.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			ovary(1)	1						GGCGAGAAGCCGTTCAAGTGC	0.667																																					p.P574L													.	E4F1-187	0			c.C1721T						.						17.0	14.0	15.0					16																	2284711		2176	4283	6459	SO:0001583	missense	1877	exon11			AGAAGCCGTTCAA	U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.1721C>T	16.37:g.2284711C>T	ENSP00000301727:p.Pro574Leu	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	18	7	NM_004424	0	0	19	36	17	A8K2R4|O00146	Missense_Mutation	SNP	ENST00000301727.4	37	CCDS32370.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.838062	0.50951	.	.	ENSG00000167967	ENST00000301727	T	0.27557	1.66	5.38	5.38	0.77491	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.049374	0.85682	D	0.000000	T	0.56863	0.2014	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.59579	-0.7428	10	0.72032	D	0.01	-22.8742	17.7029	0.88300	0.0:1.0:0.0:0.0	.	574	Q66K89	E4F1_HUMAN	L	574	ENSP00000301727:P574L	ENSP00000301727:P574L	P	+	2	0	E4F1	2224712	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	7.722000	0.84778	2.528000	0.85240	0.549000	0.68633	CCG	.		0.667	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435225.1	NM_004424	
SMG1	23049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	18856756	18856756	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr16:18856756T>C	ENST00000446231.2	-	39	6626	c.6214A>G	c.(6214-6216)Aaa>Gaa	p.K2072E	SMG1_ENST00000389467.3_Missense_Mutation_p.K2072E			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2072					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGTACCTCTTTAAATGGAATC	0.408																																					p.K2072E		.											.	SMG1-1160	0			c.A6214G						.						57.0	52.0	54.0					16																	18856756		1866	4105	5971	SO:0001583	missense	23049	exon39			CCTCTTTAAATGG	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.6214A>G	16.37:g.18856756T>C	ENSP00000402515:p.Lys2072Glu	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	62	33	NM_015092	0	0	0	0	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.237482	0.79800	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.80824	-1.42;-1.42	5.79	5.79	0.91817	Protein kinase-like domain (1);Armadillo-type fold (1);	0.080055	0.53938	D	0.000055	D	0.90249	0.6951	M	0.86178	2.8	0.80722	D	1	D;P	0.56035	0.974;0.743	D;B	0.67725	0.953;0.305	D	0.91308	0.5072	10	0.59425	D	0.04	.	16.1343	0.81471	0.0:0.0:0.0:1.0	.	1932;2072	Q96Q15-2;Q96Q15	.;SMG1_HUMAN	E	2072	ENSP00000402515:K2072E;ENSP00000374118:K2072E	ENSP00000374118:K2072E	K	-	1	0	SMG1	18764257	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.155000	0.71833	2.209000	0.71365	0.533000	0.62120	AAA	.		0.408	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
PDILT	204474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	20376785	20376785	+	Silent	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr16:20376785G>A	ENST00000302451.4	-	9	1442	c.1194C>T	c.(1192-1194)aaC>aaT	p.N398N		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	398	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						AGACGACTACGTTGAAGTTCT	0.448																																					p.N398N		.											.	PDILT-153	0			c.C1194T						.						175.0	164.0	168.0					16																	20376785		2203	4300	6503	SO:0001819	synonymous_variant	204474	exon9			GACTACGTTGAAG		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.1194C>T	16.37:g.20376785G>A		Somatic	176	0		WXS	Illumina HiSeq	Phase_I	163	39	NM_174924	0	0	0	0	0	Q8IVQ5	Silent	SNP	ENST00000302451.4	37	CCDS10584.1																																																																																			.		0.448	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
RNASEH2A	10535	ucsc.edu	37	19	12917561	12917561	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr19:12917561G>A	ENST00000221486.4	+	1	168	c.74G>A	c.(73-75)cGc>cAc	p.R25H		NM_006397.2	NP_006388.2	O75792	RNH2A_HUMAN	ribonuclease H2, subunit A	25					DNA replication (GO:0006260)|mismatch repair (GO:0006298)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)	metal ion binding (GO:0046872)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	14						GCGGTGTGCCGCAAGGAGCCT	0.706																																					p.R25H													.	RNASEH2A-524	0			c.G74A						.						17.0	14.0	15.0					19																	12917561		2190	4286	6476	SO:0001583	missense	10535	exon1			TGTGCCGCAAGGA	Z97029	CCDS12282.1	19p13.13	2014-09-17	2006-08-17			ENSG00000104889	3.1.26.-		18518	protein-coding gene	gene with protein product		606034	"""ribonuclease H2, large subunit"", ""Aicardi-Goutieres syndrome 4"""			9789007, 16845400	Standard	NM_006397		Approved	RNASEHI, RNHIA, RNHL, AGS4	uc002mvg.1	O75792		ENST00000221486.4:c.74G>A	19.37:g.12917561G>A	ENSP00000221486:p.Arg25His	Somatic	12	0		WXS	Illumina HiSeq		13	4	NM_006397	0	0	33	33	0	B2RCY1|Q96F11	Missense_Mutation	SNP	ENST00000221486.4	37	CCDS12282.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425088	0.83667	.	.	ENSG00000104889	ENST00000221486	D	0.83250	-1.7	4.97	1.52	0.23074	.	0.337880	0.30142	N	0.010304	T	0.76449	0.3989	L	0.53249	1.67	0.43381	D	0.995487	D	0.54397	0.966	B	0.42522	0.39	T	0.72316	-0.4330	10	0.59425	D	0.04	-3.1733	7.5491	0.27786	0.0807:0.0:0.6165:0.3028	.	25	O75792	RNH2A_HUMAN	H	25	ENSP00000221486:R25H	ENSP00000221486:R25H	R	+	2	0	RNASEH2A	12778561	0.118000	0.22208	0.974000	0.42286	0.665000	0.39181	0.302000	0.19192	0.105000	0.17753	0.462000	0.41574	CGC	.		0.706	RNASEH2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451507.1	NM_006397	
SYT5	6861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55685920	55685920	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr19:55685920C>T	ENST00000354308.3	-	8	1294	c.925G>A	c.(925-927)Gct>Act	p.A309T	SYT5_ENST00000590851.1_Missense_Mutation_p.A305T|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000592935.1_5'Flank|SYT5_ENST00000537500.1_Missense_Mutation_p.A309T	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	309	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		AAGCTGAAAGCTTCGTTGTAA	0.527																																					p.A309T		.											.	SYT5-90	0			c.G925A						.						190.0	182.0	185.0					19																	55685920		2203	4300	6503	SO:0001583	missense	6861	exon8			TGAAAGCTTCGTT	X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.925G>A	19.37:g.55685920C>T	ENSP00000346265:p.Ala309Thr	Somatic	282	0		WXS	Illumina HiSeq	Phase_I	248	62	NM_003180	0	0	2	5	3	B3KWJ8|B7Z300|Q86X72	Missense_Mutation	SNP	ENST00000354308.3	37	CCDS12919.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.144796	0.57044	.	.	ENSG00000129990	ENST00000537500;ENST00000354308;ENST00000543844	T;T	0.67345	-0.26;-0.26	3.42	1.23	0.21249	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.175642	0.49305	D	0.000147	T	0.38401	0.1039	N	0.03071	-0.42	0.38441	D	0.946694	B;B;B	0.27594	0.081;0.102;0.182	B;B;B	0.32465	0.146;0.026;0.092	T	0.23048	-1.0199	10	0.66056	D	0.02	.	5.0538	0.14522	0.4913:0.4025:0.0:0.1062	.	305;308;309	B7Z300;Q4FD32;O00445	.;.;SYT5_HUMAN	T	309;309;305	ENSP00000442896:A309T;ENSP00000346265:A309T	ENSP00000346265:A309T	A	-	1	0	SYT5	60377732	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.882000	0.28186	0.442000	0.26555	0.561000	0.74099	GCT	.		0.527	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180	
ZNF549	256051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58049607	58049607	+	Missense_Mutation	SNP	C	C	G	rs531934209		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr19:58049607C>G	ENST00000376233.3	+	4	1416	c.1235C>G	c.(1234-1236)aCg>aGg	p.T412R	ZNF549_ENST00000240719.3_Missense_Mutation_p.T399R|ZNF549_ENST00000594943.1_Intron|ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Intron	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGAATCCACACGGGAGAAAGG	0.433																																					p.T412R		.											.	ZNF549-91	0			c.C1235G						.						58.0	59.0	59.0					19																	58049607		2203	4300	6503	SO:0001583	missense	256051	exon4			TCCACACGGGAGA	AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.1235C>G	19.37:g.58049607C>G	ENSP00000365407:p.Thr412Arg	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	49	8	NM_001199295	0	0	0	0	0	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	ENST00000376233.3	37	CCDS56106.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.153855	0.57259	.	.	ENSG00000121406	ENST00000240719;ENST00000376233	T;T	0.25749	1.78;1.78	2.35	-0.274	0.12910	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37489	0.1005	L	0.46885	1.475	0.31073	N	0.712839	D;D	0.89917	1.0;1.0	D;D	0.87578	0.987;0.998	T	0.39683	-0.9602	9	0.72032	D	0.01	.	6.4994	0.22160	0.0:0.6894:0.1838:0.1268	.	412;399	Q6P9A3;Q6P9A3-2	ZN549_HUMAN;.	R	399;412	ENSP00000240719:T399R;ENSP00000365407:T412R	ENSP00000240719:T399R	T	+	2	0	ZNF549	62741419	0.892000	0.30473	0.923000	0.36655	0.989000	0.77384	2.036000	0.41165	0.319000	0.23209	0.585000	0.79938	ACG	.		0.433	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	NM_153263	
ZIK1	284307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58101980	58101980	+	Missense_Mutation	SNP	G	G	C	rs577749417		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr19:58101980G>C	ENST00000597850.1	+	4	1016	c.801G>C	c.(799-801)tgG>tgC	p.W267C	ZIK1_ENST00000536878.2_Missense_Mutation_p.W254C|ZIK1_ENST00000307468.4_3'UTR|ZIK1_ENST00000599456.1_Missense_Mutation_p.W212C	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	267					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AAAGGCCTTGGGAGTGCAATG	0.473																																					p.W267C		.											.	ZIK1-91	0			c.G801C						.						58.0	59.0	58.0					19																	58101980		2203	4300	6503	SO:0001583	missense	284307	exon4			GCCTTGGGAGTGC	AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.801G>C	19.37:g.58101980G>C	ENSP00000472867:p.Trp267Cys	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	63	11	NM_001010879	0	0	0	0	0	O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	37	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497409	0.44455	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.17691	2.26	3.37	-2.36	0.06663	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09992	0.0245	N	0.01438	-0.865	0.09310	N	0.999996	D;D	0.69078	0.997;0.993	P;P	0.60173	0.821;0.87	T	0.15178	-1.0446	9	0.87932	D	0	.	2.8351	0.05512	0.1183:0.0948:0.3259:0.4609	.	254;267	F5H435;Q3SY52	.;ZIK1_HUMAN	C	254;248;267	ENSP00000438487:W254C	ENSP00000303820:W267C	W	+	3	0	ZIK1	62793792	0.000000	0.05858	0.000000	0.03702	0.547000	0.35210	-1.932000	0.01554	-0.690000	0.05142	-0.182000	0.12963	TGG	.		0.473	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879	
CKAP2L	150468	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	113513875	113513875	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr2:113513875C>T	ENST00000302450.6	-	4	1151	c.1073G>A	c.(1072-1074)aGc>aAc	p.S358N	CKAP2L_ENST00000481732.1_5'Flank|CKAP2L_ENST00000541405.1_Missense_Mutation_p.S193N	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	358						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						ACAAACTTGGCTGGACTTCTG	0.428																																					p.S358N		.											.	CKAP2L-90	0			c.G1073A						.						149.0	144.0	145.0					2																	113513875		2203	4300	6503	SO:0001583	missense	150468	exon4			ACTTGGCTGGACT	AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.1073G>A	2.37:g.113513875C>T	ENSP00000305204:p.Ser358Asn	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	175	64	NM_152515	0	0	2	2	0	A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	ENST00000302450.6	37	CCDS2100.1	.	.	.	.	.	.	.	.	.	.	c	9.225	1.034367	0.19590	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.11821	2.74;3.39	4.69	-4.0	0.04057	.	0.732493	0.12806	N	0.437566	T	0.04227	0.0117	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34925	-0.9809	10	0.24483	T	0.36	-1.0892	0.994	0.01462	0.2342:0.3464:0.1852:0.2342	.	358	Q8IYA6	CKP2L_HUMAN	N	193;358	ENSP00000438763:S193N;ENSP00000305204:S358N	ENSP00000305204:S358N	S	-	2	0	CKAP2L	113230346	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.718000	0.04980	-0.903000	0.03881	-0.911000	0.02809	AGC	.		0.428	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254082.2	NM_152515	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179425266	179425266	+	Silent	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr2:179425266A>G	ENST00000591111.1	-	276	80894	c.80670T>C	c.(80668-80670)taT>taC	p.Y26890Y	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Silent_p.Y19658Y|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.Y19591Y|TTN_ENST00000460472.2_Silent_p.Y19466Y|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.Y28531Y|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Silent_p.Y25963Y|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26890	Fibronectin type-III 95. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACCAACACCATATTTATTAA	0.388																																					p.Y28531Y		.											.	TTN-636	0			c.T85593C						.						57.0	56.0	56.0					2																	179425266		1865	4100	5965	SO:0001819	synonymous_variant	7273	exon326			AACACCATATTTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80670T>C	2.37:g.179425266A>G		Somatic	72	0		WXS	Illumina HiSeq	Phase_I	60	20	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ITGA4	3676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	182399601	182399601	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr2:182399601T>C	ENST00000397033.2	+	27	3372	c.2942T>C	c.(2941-2943)aTt>aCt	p.I981T		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	981					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	ATAGTGATTATTTCAAGTAGC	0.313																																					p.I981T		.											.	ITGA4-230	0			c.T2942C						.						148.0	140.0	143.0					2																	182399601		1850	4088	5938	SO:0001583	missense	3676	exon27			TGATTATTTCAAG		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.2942T>C	2.37:g.182399601T>C	ENSP00000380227:p.Ile981Thr	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	103	29	NM_000885	0	0	10	11	1	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.035378	0.75617	.	.	ENSG00000115232	ENST00000397033	T	0.74737	-0.87	6.17	6.17	0.99709	.	0.088153	0.85682	D	0.000000	T	0.78735	0.4330	M	0.78049	2.395	0.58432	D	0.999995	P	0.52577	0.954	P	0.45310	0.476	T	0.82464	-0.0444	10	0.87932	D	0	.	15.3933	0.74767	0.0:0.0:0.0:1.0	.	981	P13612	ITA4_HUMAN	T	981	ENSP00000380227:I981T	ENSP00000380227:I981T	I	+	2	0	ITGA4	182107846	1.000000	0.71417	0.171000	0.22900	0.989000	0.77384	5.141000	0.64814	2.371000	0.80710	0.533000	0.62120	ATT	.		0.313	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
NBEAL1	65065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	204058575	204058575	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr2:204058575G>T	ENST00000449802.1	+	46	7225	c.6892G>T	c.(6892-6894)Gac>Tac	p.D2298Y		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2298										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AACCAAAATAGACACTTCAAC	0.343																																					p.D2298Y		.											.	NBEAL1-92	0			c.G6892T						.						157.0	157.0	157.0					2																	204058575		1870	4098	5968	SO:0001583	missense	65065	exon46			AAAATAGACACTT	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6892G>T	2.37:g.204058575G>T	ENSP00000399903:p.Asp2298Tyr	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	149	42	NM_001114132	0	0	1	2	1	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486179	0.63962	.	.	ENSG00000144426	ENST00000449802;ENST00000414576	T;T	0.56776	0.44;1.1	5.43	5.43	0.79202	.	0.063926	0.64402	U	0.000013	T	0.66684	0.2814	M	0.77103	2.36	0.58432	D	0.999999	P	0.49862	0.929	P	0.51487	0.671	T	0.67385	-0.5684	10	0.39692	T	0.17	.	18.8378	0.92169	0.0:0.0:1.0:0.0	.	2298	Q6ZS30	NBEL1_HUMAN	Y	2298;313	ENSP00000399903:D2298Y;ENSP00000388466:D313Y	ENSP00000388466:D313Y	D	+	1	0	NBEAL1	203766820	1.000000	0.71417	0.973000	0.42090	0.900000	0.52787	9.028000	0.93712	2.550000	0.86006	0.650000	0.86243	GAC	.		0.343	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
USP25	29761	broad.mit.edu	37	21	17138432	17138432	+	Nonsense_Mutation	SNP	C	C	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr21:17138432C>G	ENST00000285679.6	+	3	609	c.240C>G	c.(238-240)taC>taG	p.Y80*	USP25_ENST00000351097.5_Nonsense_Mutation_p.Y80*|USP25_ENST00000400183.2_Nonsense_Mutation_p.Y80*|USP25_ENST00000285681.2_Nonsense_Mutation_p.Y80*	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	80	SUMO interaction domain (SIM).				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		ATGATAGATACATCAGTGTGG	0.368																																					p.Y80X													.	USP25-663	0			c.C240G						.						108.0	98.0	101.0					21																	17138432		2203	4300	6503	SO:0001587	stop_gained	29761	exon3			TAGATACATCAGT	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.240C>G	21.37:g.17138432C>G	ENSP00000285679:p.Tyr80*	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	90	4	NM_013396	0	0	55	56	1	C0LSZ0|Q6DHZ9|Q9H9W1	Nonsense_Mutation	SNP	ENST00000285679.6	37	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	c	36	5.933887	0.97122	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000351097;ENST00000400183	.	.	.	5.42	0.564	0.17302	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7186	0.40289	0.0:0.6591:0.0:0.3409	.	.	.	.	X	80	.	ENSP00000285679:Y80X	Y	+	3	2	USP25	16060303	0.926000	0.31397	0.996000	0.52242	0.828000	0.46876	0.110000	0.15437	0.035000	0.15519	-0.993000	0.02533	TAC	.		0.368	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
SETD5	55209	hgsc.bcm.edu	37	3	9495547	9495547	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr3:9495547A>G	ENST00000406341.1	+	16	2661	c.2471A>G	c.(2470-2472)aAt>aGt	p.N824S	SETD5_ENST00000402198.1_Missense_Mutation_p.N824S|SETD5_ENST00000407969.1_Missense_Mutation_p.N843S|SETD5_ENST00000402466.1_Missense_Mutation_p.N726S|SETD5_ENST00000488236.1_3'UTR|SETD5_ENST00000302463.6_Missense_Mutation_p.N726S			Q9C0A6	SETD5_HUMAN	SET domain containing 5	824										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TGCAAAGACAATGCAGGTACG	0.353																																					p.N824S		.											.	SETD5-70	0			c.A2471G						.						86.0	80.0	82.0					3																	9495547		1861	4110	5971	SO:0001583	missense	55209	exon17			AAGACAATGCAGG	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.2471A>G	3.37:g.9495547A>G	ENSP00000383939:p.Asn824Ser	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	61	14	NM_001080517	0	0	0	0	0	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	37	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	A	0.331	-0.956084	0.02267	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463	D;D;D;D;D	0.90504	-2.37;-2.68;-2.37;-2.37;-2.68	5.4	-1.65	0.08291	.	0.396214	0.29015	N	0.013418	T	0.68879	0.3049	N	0.03608	-0.345	0.23581	N	0.997369	B;B;B;B	0.14438	0.01;0.008;0.0;0.002	B;B;B;B	0.15052	0.012;0.009;0.0;0.003	T	0.62416	-0.6859	10	0.02654	T	1	-4.8279	5.9999	0.19515	0.3801:0.2636:0.3563:0.0	.	493;726;824;843	B3KXG4;Q9C0A6-3;Q9C0A6;E7EWN3	.;.;SETD5_HUMAN;.	S	824;726;824;843;726	ENSP00000385852:N824S;ENSP00000384429:N726S;ENSP00000383939:N824S;ENSP00000384114:N843S;ENSP00000302028:N726S	ENSP00000302028:N726S	N	+	2	0	SETD5	9470547	0.998000	0.40836	0.970000	0.41538	0.385000	0.30292	0.664000	0.25068	-0.105000	0.12132	0.533000	0.62120	AAT	.		0.353	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
MTMR14	64419	ucsc.edu	37	3	9691415	9691415	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr3:9691415G>A	ENST00000296003.4	+	1	270	c.148G>A	c.(148-150)Ggc>Agc	p.G50S	MTMR14_ENST00000351233.5_Missense_Mutation_p.G50S|MTMR14_ENST00000353332.5_Missense_Mutation_p.G50S|MTMR14_ENST00000420925.1_Missense_Mutation_p.G50S	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	50					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					CAGCGGGACCGGCGGCTCTAA	0.617																																					p.G50S													.	MTMR14-91	0			c.G148A						.						13.0	16.0	15.0					3																	9691415		1951	4134	6085	SO:0001583	missense	64419	exon1			GGGACCGGCGGCT	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.148G>A	3.37:g.9691415G>A	ENSP00000296003:p.Gly50Ser	Somatic	27	0		WXS	Illumina HiSeq		29	4	NM_022485	0	0	0	0	0	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	ENST00000296003.4	37	CCDS43043.1	.	.	.	.	.	.	.	.	.	.	G	8.957	0.969656	0.18659	.	.	ENSG00000163719	ENST00000353332;ENST00000420925;ENST00000296003;ENST00000351233;ENST00000419048	T;D;T;T	0.89939	1.62;-2.59;1.62;1.62	5.3	1.8	0.24995	.	0.376195	0.26099	N	0.026353	T	0.77294	0.4109	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.12630	0.003;0.006;0.004;0.001	B;B;B;B	0.11329	0.002;0.003;0.006;0.001	T	0.57015	-0.7883	10	0.06625	T	0.88	-10.6331	7.7854	0.29089	0.295:0.0:0.705:0.0	.	50;50;50;50	C9JSR1;Q8NCE2-3;Q8NCE2-2;Q8NCE2	.;.;.;MTMRE_HUMAN	S	50	ENSP00000323462:G50S;ENSP00000401993:G50S;ENSP00000296003:G50S;ENSP00000334070:G50S	ENSP00000296003:G50S	G	+	1	0	MTMR14	9666415	0.756000	0.28383	0.024000	0.17045	0.002000	0.02628	1.655000	0.37345	0.029000	0.15352	-0.142000	0.14014	GGC	.		0.617	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
SLC9C1	285335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	111918287	111918287	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr3:111918287C>T	ENST00000305815.5	-	20	2656	c.2404G>A	c.(2404-2406)Gct>Act	p.A802T	SLC9C1_ENST00000487372.1_Missense_Mutation_p.A754T	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	802					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										ACAGTGACAGCAATTTCTGGG	0.279																																					p.A802T		.											.	.	0			c.G2404A						.						73.0	73.0	73.0					3																	111918287		2201	4297	6498	SO:0001583	missense	285335	exon20			TGACAGCAATTTC	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.2404G>A	3.37:g.111918287C>T	ENSP00000306627:p.Ala802Thr	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	89	45	NM_183061	0	0	0	0	0	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990748	0.54041	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.80480	-1.35;-1.38	5.55	2.81	0.32909	.	0.221517	0.31577	N	0.007408	T	0.81264	0.4786	M	0.65498	2.005	0.27008	N	0.96476	P;D	0.59767	0.855;0.986	P;P	0.52909	0.713;0.655	T	0.71745	-0.4500	10	0.33940	T	0.23	.	7.6697	0.28451	0.0:0.7356:0.0:0.2644	.	754;802	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	T	802;754	ENSP00000306627:A802T;ENSP00000420688:A754T	ENSP00000306627:A802T	A	-	1	0	SLC9A10	113400977	0.902000	0.30710	0.686000	0.30086	0.473000	0.32948	1.823000	0.39062	0.310000	0.22990	-0.140000	0.14226	GCT	.		0.279	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
TSC22D2	9819	ucsc.edu	37	3	150128649	150128649	+	Silent	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr3:150128649C>T	ENST00000361875.3	+	1	2528	c.1512C>T	c.(1510-1512)ccC>ccT	p.P504P	TSC22D2_ENST00000361136.2_Silent_p.P504P	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	504					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CCGTGGTGCCCGGAGTTCCAA	0.667																																					p.P504P													.	TSC22D2-91	0			c.C1512T						.						46.0	46.0	46.0					3																	150128649		2203	4300	6503	SO:0001819	synonymous_variant	9819	exon1			GGTGCCCGGAGTT	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1512C>T	3.37:g.150128649C>T		Somatic	53	0		WXS	Illumina HiSeq		42	4	NM_014779	0	0	27	27	0	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Silent	SNP	ENST00000361875.3	37	CCDS3149.1																																																																																			.		0.667	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779	
N4BP2	55728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	40103811	40103811	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr4:40103811A>G	ENST00000261435.6	+	4	762	c.346A>G	c.(346-348)Ata>Gta	p.I116V		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	116					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AGAAAGTAAAATAATGGAAAA	0.368																																					p.I116V		.											.	N4BP2-602	0			c.A346G						.						92.0	90.0	91.0					4																	40103811		2203	4300	6503	SO:0001583	missense	55728	exon4			AGTAAAATAATGG	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.346A>G	4.37:g.40103811A>G	ENSP00000261435:p.Ile116Val	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	90	28	NM_018177	0	0	1	1	0	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	37	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	A	0.424	-0.906575	0.02434	.	.	ENSG00000078177	ENST00000261435;ENST00000381804;ENST00000515550	T;T	0.79247	-1.25;-1.25	6.08	1.18	0.20946	.	0.531518	0.19034	N	0.124467	T	0.52451	0.1735	N	0.12746	0.255	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.14578	0.011;0.003	T	0.37291	-0.9712	10	0.02654	T	1	-6.4549	8.9819	0.35970	0.7223:0.0:0.2777:0.0	.	116;116	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	V	116;36;36	ENSP00000261435:I116V;ENSP00000422057:I36V	ENSP00000261435:I116V	I	+	1	0	N4BP2	39780206	0.971000	0.33674	0.507000	0.27676	0.442000	0.32017	0.597000	0.24059	0.543000	0.28864	0.482000	0.46254	ATA	.		0.368	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
CUTA	51596	hgsc.bcm.edu	37	6	33384696	33384696	+	Splice_Site	SNP	C	C	G	rs113648187		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr6:33384696C>G	ENST00000488034.1	-	5	535		c.e5+1		CUTA_ENST00000494751.1_Splice_Site|CUTA_ENST00000374496.3_Splice_Site|CUTA_ENST00000488478.1_Intron|CUTA_ENST00000492510.1_5'Flank|CUTA_ENST00000607266.1_Splice_Site|CUTA_ENST00000374500.5_Splice_Site|CUTA_ENST00000440279.3_Splice_Site	NM_001014837.1|NM_001014838.1|NM_001014840.1|NM_015921.2	NP_001014837.1|NP_001014838.1|NP_001014840.1|NP_057005.1	O60888	CUTA_HUMAN	cutA divalent cation tolerance homolog (E. coli)						protein localization (GO:0008104)|response to metal ion (GO:0010038)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)		SLC22A1/CUTA(2)	kidney(1)|lung(3)|urinary_tract(1)	5						AAAGTTCTCACCGAACAAAAT	0.468																																					.		.											.	CUTA-90	0			c.344+1G>C						.	C	,,,,	0,4406		0,0,2203	133.0	138.0	137.0		,,,,	4.1	1.0	6	dbSNP_132	137	1,8599	1.2+/-3.3	0,1,4299	no	splice-5,splice-5,splice-5,splice-5,splice-5	CUTA	NM_001014433.2,NM_001014837.1,NM_001014838.1,NM_001014840.1,NM_015921.2	,,,,	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	,,,,	,,,,	33384696	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	51596	exon6			TTCTCACCGAACA	AF106943	CCDS4779.1, CCDS34432.1, CCDS34433.1	6p21.32	2008-02-04	2006-02-15	2006-02-15	ENSG00000112514	ENSG00000112514			21101	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 82"", ""acetylcholinesterase-associated protein"""	C6orf82, ACHAP			Standard	XM_006715108		Approved		uc003oen.1	O60888	OTTHUMG00000031254	ENST00000488034.1:c.413+1G>C	6.37:g.33384696C>G		Somatic	74	0		WXS	Illumina HiSeq	Phase_I	51	3	NM_001014837	0	0	0	0	0	A2AB26|A2BEL4|Q3B784|Q5JXM9|Q5SU05|Q9NYQ9	Splice_Site	SNP	ENST00000488034.1	37	CCDS34433.1	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823920	0.71143	0.0	1.16E-4	ENSG00000112514	ENST00000374500;ENST00000440279;ENST00000488034;ENST00000494751;ENST00000374496	.	.	.	4.14	4.14	0.48551	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8038	0.52143	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CUTA	33492674	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.873000	0.63057	2.150000	0.67090	0.561000	0.74099	.	G|1.000		0.468	CUTA-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076541.3	NM_015921	Intron
MOXD1	26002	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	132649712	132649712	+	Missense_Mutation	SNP	C	C	G	rs146988576	byFrequency	TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr6:132649712C>G	ENST00000367963.3	-	5	803	c.685G>C	c.(685-687)Ggc>Cgc	p.G229R	MOXD1_ENST00000336749.3_Missense_Mutation_p.G161R	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	229						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		CTCTCATGGCCTCTCTGTATC	0.488																																					p.G229R													.	MOXD1-515	0			c.G685C						.						131.0	109.0	117.0					6																	132649712		2203	4300	6503	SO:0001583	missense	26002	exon5			CATGGCCTCTCTG	AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.685G>C	6.37:g.132649712C>G	ENSP00000356940:p.Gly229Arg	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	53	17	NM_015529	0	0	10	20	10	Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Missense_Mutation	SNP	ENST00000367963.3	37	CCDS5152.2	.	.	.	.	.	.	.	.	.	.	C	26.4	4.738753	0.89573	.	.	ENSG00000079931	ENST00000367963;ENST00000336749	T;T	0.29142	1.58;1.58	5.25	5.25	0.73442	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.057506	0.64402	D	0.000002	T	0.51041	0.1651	M	0.77103	2.36	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.71870	0.973;0.975	T	0.51631	-0.8681	10	0.49607	T	0.09	-9.5898	19.1947	0.93682	0.0:1.0:0.0:0.0	.	229;161	Q6UVY6;Q6UVY6-2	MOXD1_HUMAN;.	R	229;161	ENSP00000356940:G229R;ENSP00000336998:G161R	ENSP00000336998:G161R	G	-	1	0	MOXD1	132691405	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.470000	0.73558	2.592000	0.87571	0.655000	0.94253	GGC	C|0.999;T|0.001		0.488	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000125837.1	NM_015529	
RIPK2	8767	ucsc.edu	37	8	90770295	90770295	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr8:90770295G>A	ENST00000220751.4	+	1	321	c.7G>A	c.(7-9)Ggg>Agg	p.G3R	RIPK2_ENST00000540020.1_5'UTR|RP11-37B2.1_ENST00000504145.1_lincRNA	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	3					activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			GACCATGAACGGGGAGGCCAT	0.726																																					p.G3R													.	RIPK2-523	0			c.G7A						.						20.0	22.0	21.0					8																	90770295		2195	4290	6485	SO:0001583	missense	8767	exon1			ATGAACGGGGAGG	AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.7G>A	8.37:g.90770295G>A	ENSP00000220751:p.Gly3Arg	Somatic	21	0		WXS	Illumina HiSeq		30	4	NM_003821	0	0	15	15	0	B7Z748|Q6UWF0	Missense_Mutation	SNP	ENST00000220751.4	37	CCDS6247.1	.	.	.	.	.	.	.	.	.	.	G	6.747	0.506603	0.12883	.	.	ENSG00000104312	ENST00000220751	T	0.80123	-1.34	4.48	2.67	0.31697	.	0.739382	0.11020	N	0.608540	T	0.64249	0.2581	N	0.16478	0.41	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.48293	-0.9048	10	0.14656	T	0.56	1.359	9.0698	0.36486	0.0847:0.3987:0.5166:0.0	.	3	O43353	RIPK2_HUMAN	R	3	ENSP00000220751:G3R	ENSP00000220751:G3R	G	+	1	0	RIPK2	90839430	1.000000	0.71417	0.284000	0.24805	0.935000	0.57460	1.916000	0.39986	0.494000	0.27859	0.462000	0.41574	GGG	.		0.726	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375686.1		
SMU1	55234	hgsc.bcm.edu	37	9	33068839	33068839	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr9:33068839T>A	ENST00000397149.3	-	4	534	c.484A>T	c.(484-486)Atg>Ttg	p.M162L	SMU1_ENST00000536631.1_Start_Codon_SNP_p.M1L	NM_018225.2	NP_060695.2	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)	162						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|lung(4)|ovary(2)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		AGCAATGCCATGAGACGAGAT	0.522																																					p.M162L		.											.	SMU1-91	0			c.A484T						.						163.0	132.0	142.0					9																	33068839		2203	4300	6503	SO:0001583	missense	55234	exon4			ATGCCATGAGACG	AK001667	CCDS6534.1	9p12	2013-01-10			ENSG00000122692	ENSG00000122692		"""WD repeat domain containing"""	18247	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 57"""					11438655, 11410362	Standard	NM_018225		Approved	SMU-1, FLJ10805, BWD, fSAP57	uc003zsf.1	Q2TAY7	OTTHUMG00000019757	ENST00000397149.3:c.484A>T	9.37:g.33068839T>A	ENSP00000380336:p.Met162Leu	Somatic	84	2		WXS	Illumina HiSeq	Phase_I	59	4	NM_018225	0	0	45	45	0	B4E3L0|Q9BU59|Q9HA96|Q9NVD1	Missense_Mutation	SNP	ENST00000397149.3	37	CCDS6534.1	.	.	.	.	.	.	.	.	.	.	T	8.836	0.941179	0.18281	.	.	ENSG00000122692	ENST00000397149;ENST00000536631	T;T	0.40476	1.03;1.25	5.57	5.57	0.84162	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.14527	0.0351	N	0.00926	-1.1	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.24693	-1.0153	10	0.02654	T	1	-36.168	13.9704	0.64237	0.0:0.0:0.0:1.0	.	162;1;162	A0MNN4;B4E3L0;Q2TAY7	.;.;SMU1_HUMAN	L	162;1	ENSP00000380336:M162L;ENSP00000443639:M1L	ENSP00000380336:M162L	M	-	1	0	SMU1	33058839	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.910000	0.87451	2.248000	0.74166	0.533000	0.62120	ATG	.		0.522	SMU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052022.1	NM_018225	
RBBP7	5931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	16864059	16864059	+	Silent	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chrX:16864059A>G	ENST00000380087.2	-	11	1461	c.1101T>C	c.(1099-1101)ttT>ttC	p.F367F	RBBP7_ENST00000380084.4_Silent_p.F411F|RBBP7_ENST00000404022.1_Silent_p.F358F			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	367					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					CTCCATGAATAAACTGTTACA	0.363																																					p.F411F		.											.	RBBP7-227	0			c.T1233C						.						59.0	54.0	56.0					X																	16864059		2203	4300	6503	SO:0001819	synonymous_variant	5931	exon11			ATGAATAAACTGT	U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.1101T>C	X.37:g.16864059A>G		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	70	20	NM_001198719	0	0	0	0	0	Q5JP00	Silent	SNP	ENST00000380087.2	37	CCDS14179.1																																																																																			.		0.363	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055920.2	NM_002893	
ITIH6	347365	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	54777529	54777529	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chrX:54777529G>A	ENST00000218436.6	-	12	3666	c.3637C>T	c.(3637-3639)Cgc>Tgc	p.R1213C		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1213					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										TGCCTGTAGCGGTGTCGGAGG	0.632																																					p.R1213C													.	.	0			c.C3637T						.						40.0	32.0	35.0					X																	54777529		2202	4299	6501	SO:0001583	missense	347365	exon12			TGTAGCGGTGTCG	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3637C>T	X.37:g.54777529G>A	ENSP00000218436:p.Arg1213Cys	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	34	12	NM_198510	0	0	0	0	0	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	8.570	0.879748	0.17467	.	.	ENSG00000102313	ENST00000218436	T	0.13778	2.56	3.58	0.739	0.18324	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	1.511080	0.04820	U	0.436715	T	0.14874	0.0359	L	0.48642	1.525	0.28420	N	0.917793	B	0.15141	0.012	B	0.08055	0.003	T	0.35919	-0.9769	10	0.87932	D	0	.	7.9091	0.29780	0.2917:0.0:0.7083:0.0	.	1213	Q6UXX5	ITH5L_HUMAN	C	1213	ENSP00000218436:R1213C	ENSP00000218436:R1213C	R	-	1	0	ITIH5L	54794254	0.236000	0.23804	0.001000	0.08648	0.494000	0.33585	0.980000	0.29513	-0.321000	0.08627	0.287000	0.19450	CGC	.		0.632	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
ALAS2	212	broad.mit.edu	37	X	55051151	55051151	+	Splice_Site	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chrX:55051151C>A	ENST00000330807.5	-	3	441	c.304G>T	c.(304-306)Gat>Tat	p.D102Y	ALAS2_ENST00000396198.3_Splice_Site_p.G126*|ALAS2_ENST00000335854.4_Splice_Site_p.G102*	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	102					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	TGACTCCAACCTGTCTTGAAA	0.493																																					p.G126X													.	ALAS2-131	0			c.G376T						.						224.0	136.0	166.0					X																	55051151		2203	4300	6503	SO:0001630	splice_region_variant	212	exon4			TCCAACCTGTCTT		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.304+1G>T	X.37:g.55051151C>A		Somatic	145	0		WXS	Illumina HiSeq	Phase_I	154	7	NM_001037968	0	0	0	0	0	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Nonsense_Mutation	SNP	ENST00000330807.5	37	CCDS14366.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	33|33|33	5.289644|5.289644|5.289644	0.95546|0.95546|0.95546	.|.|.	.|.|.	ENSG00000158578|ENSG00000158578|ENSG00000158578	ENST00000330807|ENST00000396198;ENST00000335854|ENST00000455688	D|.|.	0.96856|.|.	-4.15|.|.	4.75|4.75|4.75	4.75|4.75|4.75	0.60458|0.60458|0.60458	.|.|.	0.743369|.|.	0.12618|.|.	N|.|.	0.453284|.|.	T|.|T	0.55114|.|0.55114	0.1900|.|0.1900	L|L|L	0.29908|0.29908|0.29908	0.895|0.895|0.895	0.80722|0.80722|0.80722	A|A|A	1|1|1	P|.|.	0.39311|.|.	0.667|.|.	B|.|.	0.35859|.|.	0.212|.|.	T|.|T	0.60732|.|0.60732	-0.7205|.|-0.7205	8|.|4	.|.|.	.|.|.	.|.|.	-4.8311|-4.8311|-4.8311	15.9952|15.9952|15.9952	0.80234|0.80234|0.80234	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	102|.|.	P22557|.|.	HEM0_HUMAN|.|.	Y|X|H	102|126;102|53	ENSP00000332369:D102Y|.|.	.|.|.	D|G|Q	-|-|-	1|1|3	0|0|2	ALAS2|ALAS2|ALAS2	55067876|55067876|55067876	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.662000|0.662000|0.662000	0.39071|0.39071|0.39071	5.652000|5.652000|5.652000	0.67959|0.67959|0.67959	2.110000|2.110000|2.110000	0.64415|0.64415|0.64415	0.600000|0.600000|0.600000	0.82982|0.82982|0.82982	GAT|GGA|CAG	.		0.493	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3	NM_000032	Missense_Mutation
MED12	9968	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	70349198	70349198	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chrX:70349198G>T	ENST00000374080.3	+	26	3642	c.3610G>T	c.(3610-3612)Gac>Tac	p.D1204Y	MED12_ENST00000374102.1_Missense_Mutation_p.D1204Y|MED12_ENST00000333646.6_Missense_Mutation_p.D1204Y			Q93074	MED12_HUMAN	mediator complex subunit 12	1204					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CTCCTCCTGCGACCGCCACCT	0.572			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome				OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D1204Y		.		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12-272	0			c.G3610T						.						51.0	54.0	53.0					X																	70349198		2101	4209	6310	SO:0001583	missense	9968	exon26			TCCTGCGACCGCC	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.3610G>T	X.37:g.70349198G>T	ENSP00000363193:p.Asp1204Tyr	Somatic	103	1	1121	WXS	Illumina HiSeq	Phase_I	57	13	NM_005120	0	0	4	21	17	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	21.5	4.165566	0.78339	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.61085	0.2319	M	0.72353	2.195	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.65335	-0.6193	10	0.87932	D	0	-21.5589	17.7452	0.88419	0.0:0.0:1.0:0.0	.	1204;1051;1204;1204	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	Y	1204;1204;1204;1204;1172	ENSP00000333125:D1204Y;ENSP00000363215:D1204Y;ENSP00000363193:D1204Y;ENSP00000414203:D1172Y	ENSP00000333125:D1204Y	D	+	1	0	MED12	70265923	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.894000	0.92506	2.465000	0.83290	0.529000	0.55759	GAC	.		0.572	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
ARHGEF6	9459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	135825892	135825892	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chrX:135825892A>T	ENST00000250617.6	-	5	1718	c.513T>A	c.(511-513)ttT>ttA	p.F171L	ARHGEF6_ENST00000370620.1_Missense_Mutation_p.F17L|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.F17L|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.F17L	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	171	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					TAGTCTGCTTAAAGTTGAATC	0.413																																					p.F171L		.											.	ARHGEF6-227	0			c.T513A						.						193.0	158.0	170.0					X																	135825892		2203	4300	6503	SO:0001583	missense	9459	exon5			CTGCTTAAAGTTG	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.513T>A	X.37:g.135825892A>T	ENSP00000250617:p.Phe171Leu	Somatic	189	0		WXS	Illumina HiSeq	Phase_I	171	50	NM_004840	0	0	7	7	0	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	37	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.525856	0.85600	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	6.08	2.47	0.30058	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.60869	0.2302	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	T	0.58763	-0.7579	10	0.72032	D	0.01	.	8.7263	0.34471	0.7085:0.0:0.2915:0.0	.	17;171	B7Z3C7;Q15052	.;ARHG6_HUMAN	L	171;17;17;17;17	ENSP00000250617:F171L;ENSP00000359654:F17L;ENSP00000359656:F17L;ENSP00000439483:F17L	ENSP00000250617:F171L	F	-	3	2	ARHGEF6	135653558	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.119000	0.50422	0.071000	0.16664	0.486000	0.48141	TTT	.		0.413	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840	
ATE1	11101	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	123658376	123658376	+	Intron	DEL	C	C	-	rs150970157		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:123658376delC	ENST00000224652.6	-	7	1028				ATE1_ENST00000535655.1_Intron|ATE1_ENST00000543447.1_Intron|ATE1_ENST00000540606.1_Frame_Shift_Del_p.D301fs|ATE1_ENST00000481784.1_Intron|ATE1_ENST00000369040.3_Frame_Shift_Del_p.D212fs|ATE1_ENST00000369043.3_Frame_Shift_Del_p.D308fs	NM_001001976.1	NP_001001976.1	O95260	ATE1_HUMAN	arginyltransferase 1						protein arginylation (GO:0016598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginyltransferase activity (GO:0004057)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				CCACATTCATCGGGTGGATCC	0.423																																					p.D308fs		.											.	ATE1-90	0			c.922delG						.						189.0	157.0	168.0					10																	123658376		2203	4300	6503	SO:0001627	intron_variant	11101	exon7			.	AF079098	CCDS31299.1, CCDS31300.1, CCDS73211.1, CCDS73212.1, CCDS73213.1	10q26	2013-05-08			ENSG00000107669	ENSG00000107669	2.3.2.8		782	protein-coding gene	gene with protein product		607103				16002466, 16943202	Standard	XM_005269458		Approved		uc001lfq.3	O95260	OTTHUMG00000019178	ENST00000224652.6:c.942+1004G>-	10.37:g.123658376delC		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	73	11	NM_007041	0	0	0	0	0	O95261|Q5SQQ3|Q8WW04	Frame_Shift_Del	DEL	ENST00000224652.6	37	CCDS31300.1																																																																																			.		0.423	ATE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001001976	
FRG1B	284802	broad.mit.edu;bcgsc.ca	37	20	29628229	29628230	+	Frame_Shift_Ins	INS	-	-	A	rs373737774		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr20:29628229_29628230insA	ENST00000278882.3	+	6	611_612	c.231_232insA	c.(232-234)aaafs	p.K78fs	FRG1B_ENST00000358464.4_Frame_Shift_Ins_p.K78fs|FRG1B_ENST00000439954.2_Frame_Shift_Ins_p.K83fs			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	78										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCACTTAGGGGAAAATGGCTTT	0.351																																					.													.	FRG1B-22	0			.						.																																			SO:0001589	frameshift_variant	284802	.			TTAGGGGAAAATG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.235dupA	20.37:g.29628233_29628233dupA	ENSP00000278882:p.Lys78fs	Somatic	144	1		WXS	Illumina HiSeq	Phase_I	142	13	.	0	0	0	0	0	C4AME5	RNA	INS	ENST00000278882.3	37																																																																																				-|0.500;A|0.500		0.351	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
SPIDR	23514	broad.mit.edu;bcgsc.ca	37	8	48508505	48508506	+	In_Frame_Ins	INS	-	-	AGC			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr8:48508505_48508506insAGC	ENST00000297423.4	+	9	1614_1615	c.1230_1231insAGC	c.(1231-1233)agc>AGCagc	p.411_411S>SS	SPIDR_ENST00000541342.1_In_Frame_Ins_p.341_341S>SS|SPIDR_ENST00000518074.1_In_Frame_Ins_p.351_351S>SS|SPIDR_ENST00000521214.1_3'UTR	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	411	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											TTCCAAGAAGAAGCATCTCTTT	0.371																																					p.R410delinsRS													.	KIAA0146-68	0			c.1230_1231insAGC						.																																			SO:0001652	inframe_insertion	23514	exon9			AAGAAGAAGCATC	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1231_1233dupAGC	8.37:g.48508506_48508508dupAGC	ENSP00000297423:p.Ser411dup	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	53	7	NM_001080394	0	0	0	0	0	B4DFV2|B4E0Y6|Q96BI5	In_Frame_Ins	INS	ENST00000297423.4	37	CCDS43737.1																																																																																			.		0.371	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
TMCC1	23023	hgsc.bcm.edu	37	3	129390056	129390057	+	Missense_Mutation	DNP	AG	AG	TT			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr3:129390056_129390057AG>TT	ENST00000393238.3	-	4	967_968	c.627_628CT>AA	c.(625-630)gcCTcc>gcAAcc	p.S210T	TMCC1_ENST00000329333.5_Missense_Mutation_p.S31T|TMCC1_ENST00000426664.2_Missense_Mutation_p.S96T|TMCC1_ENST00000432054.2_5'UTR	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	210						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TCGGTACTGGAGGCCACTGCAC	0.52																																					p.S210T		.											.	TMCC1	0			c.C627A						.																																			SO:0001583	missense	23023	exon4			ACTGGAGGCCACT	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.627_628delinsTT	3.37:g.129390056_129390057delinsTT	ENSP00000376930:p.Ser210Thr	Somatic	143.0	2.0		WXS	Illumina HiSeq	Phase_I	180.0	10.0		0	0	0	0	0	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	DNP	ENST00000393238.3	37	CCDS33855.1																																																																																			.		0.520	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
