#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PER3	8863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	7845603	7845603	+	Silent	SNP	A	A	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:7845603A>C	ENST00000361923.2	+	2	406	c.231A>C	c.(229-231)ctA>ctC	p.L77L	PER3_ENST00000377532.3_Silent_p.L77L|PER3_ENST00000377541.1_Silent_p.L77L	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	77					circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CAAGCACTCTAGATGCCCTCA	0.448																																					p.L77L		.											.	PER3-93	0			c.A231C						.						86.0	84.0	84.0					1																	7845603		2203	4300	6503	SO:0001819	synonymous_variant	8863	exon2			CACTCTAGATGCC	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.231A>C	1.37:g.7845603A>C		Somatic	84	1		WXS	Illumina HiSeq	Phase_I	81	19	NM_016831	0	0	8	9	1	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	ENST00000361923.2	37	CCDS89.1																																																																																			.		0.448	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
PRAMEF1	65121	broad.mit.edu	37	1	12855985	12855985	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:12855985T>C	ENST00000332296.7	+	4	1368	c.1265T>C	c.(1264-1266)tTg>tCg	p.L422S	PRAMEF1_ENST00000400814.3_Missense_Mutation_p.L177S	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	422					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTGAATTCCTTGGTTCGTGTC	0.552																																					p.L422S													.	PRAMEF1-22	0			c.T1265C						.						72.0	71.0	72.0					1																	12855985		2203	4296	6499	SO:0001583	missense	65121	exon4			ATTCCTTGGTTCG	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.1265T>C	1.37:g.12855985T>C	ENSP00000332134:p.Leu422Ser	Somatic	422	0		WXS	Illumina HiSeq	Phase_I	336	13	NM_023013	0	0	0	0	0	Q9UQP2	Missense_Mutation	SNP	ENST00000332296.7	37	CCDS148.1	.	.	.	.	.	.	.	.	.	.	.	0.161	-1.081469	0.01888	.	.	ENSG00000116721	ENST00000332296;ENST00000400814	T;T	0.01464	4.86;4.86	1.56	-3.12	0.05282	.	2.006700	0.02316	N	0.072532	T	0.01222	0.0040	N	0.12637	0.245	0.09310	N	1	P	0.35033	0.481	B	0.33454	0.164	T	0.40136	-0.9579	10	0.21540	T	0.41	.	4.7128	0.12880	0.201:0.0:0.5397:0.2593	.	422	O95521	PRAM1_HUMAN	S	422;177	ENSP00000332134:L422S;ENSP00000383616:L177S	ENSP00000332134:L422S	L	+	2	0	PRAMEF1	12778572	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.829000	0.00744	-2.159000	0.00787	-1.157000	0.01802	TTG	.		0.552	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
PTAFR	5724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	28477260	28477260	+	Silent	SNP	G	G	A	rs146920734		TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:28477260G>A	ENST00000373857.3	-	2	907	c.273C>T	c.(271-273)aaC>aaT	p.N91N	PTAFR_ENST00000539896.1_Silent_p.N91N|PTAFR_ENST00000305392.3_Silent_p.N91N	NM_000952.4|NM_001164722.2|NM_001164723.2	NP_000943.1|NP_001158194.1|NP_001158195.1	P25105	PTAFR_HUMAN	platelet-activating factor receptor	91					chemotaxis (GO:0006935)|cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|inositol trisphosphate biosynthetic process (GO:0032959)|interferon-gamma-mediated signaling pathway (GO:0060333)|phosphatidylinositol-mediated signaling (GO:0048015)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|phospholipid binding (GO:0005543)|platelet activating factor receptor activity (GO:0004992)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|stomach(1)	15		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		AGCCAGCCACGTTGCACAGGA	0.522																																					p.N91N		.											.	PTAFR-90	0			c.C273T						.	G	,,,	3,4403	8.1+/-20.4	0,3,2200	158.0	133.0	141.0		273,273,273,273	-1.6	0.1	1	dbSNP_134	141	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PTAFR	NM_000952.4,NM_001164721.1,NM_001164722.2,NM_001164723.2	,,,	0,4,6499	AA,AG,GG		0.0116,0.0681,0.0308	,,,	91/343,91/343,91/343,91/343	28477260	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	5724	exon3			AGCCACGTTGCAC	BC063000	CCDS318.1	1p35-p34.3	2012-08-20			ENSG00000169403	ENSG00000169403		"""GPCR / Class A : Platelet-activating factor receptors"""	9582	protein-coding gene	gene with protein product		173393				1322356	Standard	NM_001164721		Approved		uc001bpl.3	P25105	OTTHUMG00000003953	ENST00000373857.3:c.273C>T	1.37:g.28477260G>A		Somatic	123	0		WXS	Illumina HiSeq	Phase_I	82	29	NM_001164723	0	0	12	12	0	A3KMC8|A8K2H5	Silent	SNP	ENST00000373857.3	37	CCDS318.1																																																																																			G|1.000;A|0.000		0.522	PTAFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011258.1	NM_000952	
MECR	51102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	29520539	29520539	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:29520539T>A	ENST00000263702.6	-	10	1142	c.1117A>T	c.(1117-1119)Atg>Ttg	p.M373L	MECR_ENST00000373791.3_Missense_Mutation_p.M297L			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	373				M -> I (in Ref. 2; CAG32984). {ECO:0000305}.	fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		GATGATCACATGGTGAGAATC	0.597																																					p.M373L		.											.	MECR-91	0			c.A1117T						.						87.0	89.0	88.0					1																	29520539		2203	4300	6503	SO:0001583	missense	51102	exon10			ATCACATGGTGAG		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.1117A>T	1.37:g.29520539T>A	ENSP00000263702:p.Met373Leu	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	100	34	NM_016011	0	0	34	42	8	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	37	CCDS30659.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.969746	0.53614	.	.	ENSG00000116353	ENST00000373791;ENST00000263702	T;T	0.03094	4.05;4.12	5.61	5.61	0.85477	.	0.129329	0.64402	D	0.000001	T	0.06325	0.0163	M	0.66939	2.045	0.49798	D	0.999822	B	0.12630	0.006	B	0.14578	0.011	T	0.27226	-1.0080	10	0.19147	T	0.46	.	13.7585	0.62950	0.0:0.0:0.0:1.0	.	373	Q9BV79	MECR_HUMAN	L	297;373	ENSP00000362896:M297L;ENSP00000263702:M373L	ENSP00000263702:M373L	M	-	1	0	MECR	29393126	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.236000	0.32683	2.143000	0.66587	0.533000	0.62120	ATG	.		0.597	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1	NM_016011	
TXLNA	200081	hgsc.bcm.edu;broad.mit.edu	37	1	32646099	32646099	+	Silent	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:32646099T>C	ENST00000373609.1	+	1	434	c.153T>C	c.(151-153)gcT>gcC	p.A51A	TXLNA_ENST00000373610.3_Silent_p.A51A			P40222	TXLNA_HUMAN	taxilin alpha	51					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|exocytosis (GO:0006887)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	cytokine activity (GO:0005125)|high molecular weight B cell growth factor receptor binding (GO:0030372)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GCAGCCAGGCTCCTCGGAAGC	0.701																																					p.A51A		.											.	TXLNA-92	0			c.T153C						.						10.0	13.0	12.0					1																	32646099		2197	4291	6488	SO:0001819	synonymous_variant	200081	exon2			CCAGGCTCCTCGG	AF516206	CCDS353.1	1p35	2012-02-21			ENSG00000084652	ENSG00000084652			30685	protein-coding gene	gene with protein product		608676				15184072, 14623251	Standard	NM_175852		Approved	DKFZp451J0118	uc001bui.3	P40222	OTTHUMG00000004423	ENST00000373609.1:c.153T>C	1.37:g.32646099T>C		Somatic	28	0		WXS	Illumina HiSeq	Phase_I	14	4	NM_175852	0	0	3	5	2	D3DPP6|Q5TFJ6|Q66K62|Q86T54|Q86T85|Q86T86|Q86Y86|Q86YW3|Q8N2Y3	Silent	SNP	ENST00000373609.1	37	CCDS353.1																																																																																			.		0.701	TXLNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012844.1	NM_175852	
CDCA8	55143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	38174030	38174030	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:38174030C>T	ENST00000373055.1	+	10	1108	c.835C>T	c.(835-837)Cac>Tac	p.H279Y	CDCA8_ENST00000327331.2_Missense_Mutation_p.H279Y	NM_001256875.1|NM_018101.3	NP_001243804.1|NP_060571.1	Q53HL2	BOREA_HUMAN	cell division cycle associated 8	279					chromosome organization (GO:0051276)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(1)|stomach(1)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CATACGGACCCACAAATGAGA	0.483																																					p.H279Y		.											.	CDCA8-90	0			c.C835T						.						131.0	125.0	127.0					1																	38174030		2203	4300	6503	SO:0001583	missense	55143	exon10			CGGACCCACAAAT	BG354581	CCDS424.1	1p34.3	2013-01-17			ENSG00000134690	ENSG00000134690			14629	protein-coding gene	gene with protein product	"""borealin"""	609977				12188893, 15260989	Standard	NM_001256875		Approved	FLJ12042, MESRGP, BOR, DasraB	uc001cbs.4	Q53HL2	OTTHUMG00000004320	ENST00000373055.1:c.835C>T	1.37:g.38174030C>T	ENSP00000362146:p.His279Tyr	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	67	16	NM_001256875	0	0	2	2	0	D3DPT4|Q53HN1|Q96AM3|Q9NVW5	Missense_Mutation	SNP	ENST00000373055.1	37	CCDS424.1	.	.	.	.	.	.	.	.	.	.	C	6.465	0.453973	0.12283	.	.	ENSG00000134690	ENST00000373055;ENST00000327331	T;T	0.46063	0.88;0.88	5.48	2.55	0.30701	.	1.036760	0.07555	N	0.916095	T	0.26159	0.0638	N	0.22421	0.69	0.25891	N	0.983472	B	0.02656	0.0	B	0.01281	0.0	T	0.27640	-1.0068	10	0.22706	T	0.39	-2.4563	3.8562	0.08976	0.1641:0.5775:0.1703:0.0881	.	279	Q53HL2	BOREA_HUMAN	Y	279	ENSP00000362146:H279Y;ENSP00000316121:H279Y	ENSP00000316121:H279Y	H	+	1	0	CDCA8	37946617	0.989000	0.36119	0.332000	0.25469	0.213000	0.24496	0.321000	0.19558	0.402000	0.25451	0.650000	0.86243	CAC	.		0.483	CDCA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012473.1	NM_018101	
LRRC40	55631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	70671136	70671136	+	Missense_Mutation	SNP	C	C	G	rs368762009		TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:70671136C>G	ENST00000370952.3	-	1	167	c.88G>C	c.(88-90)Ggg>Cgg	p.G30R	SRSF11_ENST00000370950.3_5'Flank|SRSF11_ENST00000405432.1_5'Flank|SRSF11_ENST00000454435.2_5'Flank|SRSF11_ENST00000370951.1_5'Flank	NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	30						membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						TTCAACAGCCCTTGGGGTACC	0.562																																					p.G30R		.											.	LRRC40-91	0			c.G88C						.						91.0	82.0	85.0					1																	70671136		2203	4300	6503	SO:0001583	missense	55631	exon1			ACAGCCCTTGGGG		CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.88G>C	1.37:g.70671136C>G	ENSP00000359990:p.Gly30Arg	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	82	8	NM_017768	0	0	2	3	1	Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	SNP	ENST00000370952.3	37	CCDS646.1	.	.	.	.	.	.	.	.	.	.	C	19.60	3.858799	0.71834	.	.	ENSG00000066557	ENST00000370952	T	0.25085	1.82	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.26702	0.0653	L	0.35854	1.095	0.58432	D	0.999997	D	0.89917	1.0	D	0.76575	0.988	T	0.01679	-1.1297	10	0.17832	T	0.49	.	14.1132	0.65137	0.0:1.0:0.0:0.0	.	30	Q9H9A6	LRC40_HUMAN	R	30	ENSP00000359990:G30R	ENSP00000359990:G30R	G	-	1	0	LRRC40	70443724	1.000000	0.71417	0.998000	0.56505	0.271000	0.26615	4.265000	0.58865	2.703000	0.92315	0.563000	0.77884	GGG	.		0.562	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025914.1	NM_017768	
ODF2L	57489	hgsc.bcm.edu	37	1	86842001	86842001	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:86842001A>G	ENST00000359242.3	-	8	1006	c.725T>C	c.(724-726)tTa>tCa	p.L242S	ODF2L_ENST00000370566.3_Missense_Mutation_p.L242S|ODF2L_ENST00000524695.1_5'Flank|ODF2L_ENST00000370567.1_Missense_Mutation_p.L242S|ODF2L_ENST00000317336.7_Missense_Mutation_p.L242S|ODF2L_ENST00000394731.1_Missense_Mutation_p.L111S|ODF2L_ENST00000294678.2_Missense_Mutation_p.L242S	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	242						centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		TGCCTTTTTTAAAGCTACAGT	0.353																																					p.L242S		.											.	ODF2L-69	0			c.T725C						.						132.0	121.0	125.0					1																	86842001		2201	4300	6501	SO:0001583	missense	57489	exon8			TTTTTTAAAGCTA		CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.725T>C	1.37:g.86842001A>G	ENSP00000359600:p.Leu242Ser	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	32	2	NM_001007022	0	0	11	11	0	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Missense_Mutation	SNP	ENST00000359242.3	37	CCDS41354.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.60|15.60	2.882540|2.882540	0.51908|0.51908	.|.	.|.	ENSG00000122417|ENSG00000122417	ENST00000441121;ENST00000370566;ENST00000359242;ENST00000460698;ENST00000317336;ENST00000370567;ENST00000394731;ENST00000457680;ENST00000294678;ENST00000479890|ENST00000459999	T;T;T;T;T;T;T;D|.	0.85088|.	0.96;0.91;1.08;0.97;0.98;1.09;0.95;-1.94|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.66386|.	0.2784|.	M|M	0.72894|0.72894	2.215|2.215	0.46458|0.46458	D|D	0.999054|0.999054	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.91635|.	0.999;0.999;0.999;0.999;0.999;0.999|.	T|.	0.67654|.	-0.5615|.	10|.	0.72032|.	D|.	0.01|.	-5.523|-5.523	14.3411|14.3411	0.66627|0.66627	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	242;242;242;242;242;242|.	B4E037;B4DZ83;Q9ULJ1-2;Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1|.	.;.;.;.;.;ODF2L_HUMAN|.	S|Q	242;242;242;118;242;242;111;72;242;72|91	ENSP00000359597:L242S;ENSP00000359600:L242S;ENSP00000433092:L118S;ENSP00000320165:L242S;ENSP00000359598:L242S;ENSP00000378219:L111S;ENSP00000294678:L242S;ENSP00000432834:L72S|.	ENSP00000294678:L242S|.	L|X	-|-	2|1	0|0	ODF2L|ODF2L	86614589|86614589	0.996000|0.996000	0.38824|0.38824	0.991000|0.991000	0.47740|0.47740	0.164000|0.164000	0.22412|0.22412	5.973000|5.973000	0.70456|0.70456	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	TTA|TAA	.		0.353	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2		
NTNG1	22854	hgsc.bcm.edu	37	1	107973392	107973392	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:107973392T>C	ENST00000370068.1	+	6	1954	c.1108T>C	c.(1108-1110)Tcc>Ccc	p.S370P	NTNG1_ENST00000370071.2_Intron|NTNG1_ENST00000370072.3_Missense_Mutation_p.S370P|NTNG1_ENST00000370074.4_Intron|NTNG1_ENST00000370070.2_Intron|NTNG1_ENST00000370073.2_Missense_Mutation_p.S370P|NTNG1_ENST00000370065.1_Missense_Mutation_p.S370P|NTNG1_ENST00000370061.3_Intron|NTNG1_ENST00000542803.1_Missense_Mutation_p.S370P|NTNG1_ENST00000370067.1_Intron|NTNG1_ENST00000370066.1_Intron			Q9Y2I2	NTNG1_HUMAN	netrin G1	370	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CTTCGGCCACTCCAATCGATG	0.428																																					p.S370P		.											.	NTNG1-140	0			c.T1108C						.						96.0	81.0	86.0					1																	107973392		1568	3582	5150	SO:0001583	missense	22854	exon6			GGCCACTCCAATC	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1108T>C	1.37:g.107973392T>C	ENSP00000359085:p.Ser370Pro	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_001113226	0	0	0	0	0	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	T	16.72	3.202136	0.58234	.	.	ENSG00000162631	ENST00000370073;ENST00000542803;ENST00000370072;ENST00000370064;ENST00000370068;ENST00000370065	T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04	5.47	5.47	0.80525	EGF-like, laminin (3);	0.000000	0.64402	D	0.000017	T	0.81800	0.4899	H	0.95187	3.635	0.80722	D	1	D	0.76494	0.999	D	0.68483	0.958	D	0.86997	0.2114	10	0.56958	D	0.05	.	15.5448	0.76090	0.0:0.0:0.0:1.0	.	370	Q9Y2I2	NTNG1_HUMAN	P	370;370;370;173;370;370	ENSP00000359090:S370P;ENSP00000440561:S370P;ENSP00000359089:S370P;ENSP00000359085:S370P;ENSP00000359082:S370P	ENSP00000359081:S173P	S	+	1	0	NTNG1	107774915	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.030000	0.88816	2.069000	0.61940	0.533000	0.62120	TCC	.		0.428	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917	
OR6K2	81448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158669896	158669896	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:158669896C>T	ENST00000359610.2	-	1	590	c.547G>A	c.(547-549)Gtg>Atg	p.V183M		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					AGACGCAGCACTGGGAGGAAG	0.478																																					p.V183M		.											.	OR6K2-69	0			c.G547A						.						133.0	112.0	119.0					1																	158669896		2203	4300	6503	SO:0001583	missense	81448	exon1			GCAGCACTGGGAG	BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.547G>A	1.37:g.158669896C>T	ENSP00000352626:p.Val183Met	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	105	35	NM_001005279	0	0	0	0	0	B9EH33|Q6IFR6	Missense_Mutation	SNP	ENST00000359610.2	37	CCDS30902.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489601	0.44249	.	.	ENSG00000196171	ENST00000359610	T	0.00231	8.49	5.09	3.14	0.36123	GPCR, rhodopsin-like superfamily (1);	0.438834	0.16622	N	0.206443	T	0.00109	0.0003	M	0.66939	2.045	0.09310	N	1	B	0.31893	0.345	B	0.43360	0.417	T	0.34254	-0.9836	10	0.72032	D	0.01	-4.3506	3.0153	0.06058	0.2617:0.4934:0.1539:0.091	.	183	Q8NGY2	OR6K2_HUMAN	M	183	ENSP00000352626:V183M	ENSP00000352626:V183M	V	-	1	0	OR6K2	156936520	0.000000	0.05858	0.982000	0.44146	0.993000	0.82548	-1.509000	0.02264	1.348000	0.45733	0.655000	0.94253	GTG	.		0.478	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279	
PAPPA2	60676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	176740277	176740277	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:176740277G>T	ENST00000367662.3	+	17	5840	c.4676G>T	c.(4675-4677)gGg>gTg	p.G1559V		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1559	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGCAAACCAGGGTACTATGTG	0.478																																					p.G1559V		.											.	PAPPA2-548	0			c.G4676T						.						96.0	90.0	92.0					1																	176740277		2009	4181	6190	SO:0001583	missense	60676	exon17			AACCAGGGTACTA	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4676G>T	1.37:g.176740277G>T	ENSP00000356634:p.Gly1559Val	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	75	18	NM_020318	0	0	6	6	0	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.439678	0.83885	.	.	ENSG00000116183	ENST00000367662	T	0.77358	-1.09	5.53	5.53	0.82687	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.88544	0.6465	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89575	0.3816	10	0.87932	D	0	-23.6151	18.0257	0.89268	0.0:0.0:1.0:0.0	.	1559	Q9BXP8	PAPP2_HUMAN	V	1559	ENSP00000356634:G1559V	ENSP00000356634:G1559V	G	+	2	0	PAPPA2	175006900	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	9.050000	0.93843	2.592000	0.87571	0.655000	0.94253	GGG	.		0.478	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
OLAH	55301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	15107661	15107661	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr10:15107661G>A	ENST00000378228.3	+	6	735	c.481G>A	c.(481-483)Ggc>Agc	p.G161S	OLAH_ENST00000485251.1_3'UTR|OLAH_ENST00000378217.3_Missense_Mutation_p.G214S	NM_001039702.2	NP_001034791.1	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase	161					fatty acid biosynthetic process (GO:0006633)		myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)			endometrium(2)|large_intestine(1)|lung(14)|stomach(1)	18						GGAATTTGGAGGCACCCCCAA	0.408																																					p.G214S		.											.	OLAH-68	0			c.G640A						.						83.0	77.0	79.0					10																	15107661		2203	4300	6503	SO:0001583	missense	55301	exon7			TTTGGAGGCACCC	AK001844	CCDS7106.1, CCDS31152.1	10p13	2010-11-23	2006-07-07	2006-07-07	ENSG00000152463	ENSG00000152463	3.1.2.14		25625	protein-coding gene	gene with protein product			"""thioesterase domain containing 1"""	THEDC1			Standard	NM_018324		Approved	FLJ11106, SAST	uc001inu.2	Q9NV23	OTTHUMG00000017724	ENST00000378228.3:c.481G>A	10.37:g.15107661G>A	ENSP00000367473:p.Gly161Ser	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	62	17	NM_018324	0	0	0	0	0	Q5VUB6|Q9NUW1	Missense_Mutation	SNP	ENST00000378228.3	37	CCDS31152.1	.	.	.	.	.	.	.	.	.	.	g	16.13	3.036095	0.54896	.	.	ENSG00000152463	ENST00000429028;ENST00000378228;ENST00000378217	.	.	.	5.03	4.12	0.48240	Thioesterase (1);	0.096919	0.64402	D	0.000001	D	0.84552	0.5497	M	0.92122	3.275	0.52099	D	0.999948	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.99	D	0.87441	0.2395	9	0.72032	D	0.01	-5.4247	12.2837	0.54779	0.0:0.0:0.8303:0.1697	.	161;214	Q9NV23;Q9NV23-2	SAST_HUMAN;.	S	161;161;214	.	ENSP00000367462:G214S	G	+	1	0	OLAH	15147667	1.000000	0.71417	0.972000	0.41901	0.162000	0.22319	1.630000	0.37081	1.222000	0.43521	0.557000	0.71058	GGC	.		0.408	OLAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046964.1	NM_018324	
SLC5A12	159963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	26725363	26725363	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr11:26725363A>C	ENST00000396005.3	-	5	966	c.657T>G	c.(655-657)aaT>aaG	p.N219K	SLC5A12_ENST00000280467.6_Missense_Mutation_p.N219K	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	219					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						GTCGAGATCCATTTGTTGATT	0.368																																					p.N219K		.											.	SLC5A12-92	0			c.T657G						.						230.0	218.0	222.0					11																	26725363		2203	4299	6502	SO:0001583	missense	159963	exon5			AGATCCATTTGTT	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.657T>G	11.37:g.26725363A>C	ENSP00000379326:p.Asn219Lys	Somatic	244	0		WXS	Illumina HiSeq	Phase_I	172	56	NM_178498	0	0	0	0	0	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	A	7.436	0.639686	0.14386	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.87256	-2.23;-2.23;-2.23	5.07	3.9	0.45041	.	0.177263	0.47852	D	0.000209	T	0.81283	0.4790	L	0.48174	1.505	0.34755	D	0.732193	B;B	0.32467	0.055;0.372	B;B	0.36030	0.037;0.216	T	0.78191	-0.2300	10	0.22109	T	0.4	.	7.1583	0.25649	0.7866:0.0:0.0757:0.1378	.	219;219	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	K	219;219;31	ENSP00000379326:N219K;ENSP00000280467:N219K;ENSP00000435053:N31K	ENSP00000280467:N219K	N	-	3	2	SLC5A12	26681939	1.000000	0.71417	0.997000	0.53966	0.669000	0.39330	1.028000	0.30128	0.834000	0.34852	0.397000	0.26171	AAT	.		0.368	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
LRFN4	78999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66625625	66625625	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr11:66625625C>T	ENST00000309602.4	+	1	653	c.410C>T	c.(409-411)cCg>cTg	p.P137L	LRFN4_ENST00000393952.3_Missense_Mutation_p.P137L|PC_ENST00000393958.2_Intron|PC_ENST00000393960.1_Intron|PC_ENST00000393955.2_Intron	NM_024036.4	NP_076941.2	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III domain containing 4	137						integral component of membrane (GO:0016021)				breast(1)|lung(1)|prostate(1)	3						CGCATCGCGCCGGGAGCCTTC	0.692																																					p.P137L		.											.	LRFN4-90	0			c.C410T						.						49.0	54.0	52.0					11																	66625625		2200	4294	6494	SO:0001583	missense	78999	exon1			TCGCGCCGGGAGC	BC007718	CCDS8153.1	11q13.1	2013-02-11				ENSG00000173621		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28456	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 6"""	612810				16495444, 16828986	Standard	NM_024036		Approved	MGC3103, SALM3., FIGLER6	uc001ojr.3	Q6PJG9		ENST00000309602.4:c.410C>T	11.37:g.66625625C>T	ENSP00000312535:p.Pro137Leu	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	66	18	NM_024036	0	0	1	1	0	Q4VBZ3|Q59GV4|Q8N644|Q9BWJ0	Missense_Mutation	SNP	ENST00000309602.4	37	CCDS8153.1	.	.	.	.	.	.	.	.	.	.	C	6.081	0.383217	0.11524	.	.	ENSG00000173621	ENST00000393952;ENST00000309602;ENST00000525479	T;T	0.60424	0.19;0.19	4.18	3.26	0.37387	.	0.304296	0.23951	N	0.042954	T	0.51227	0.1662	M	0.69358	2.11	0.24168	N	0.99564	P;B	0.34662	0.462;0.1	B;B	0.29862	0.105;0.108	T	0.50980	-0.8763	10	0.56958	D	0.05	.	9.9013	0.41348	0.0:0.8973:0.0:0.1027	.	137;137	E9PLQ1;Q6PJG9	.;LRFN4_HUMAN	L	137	ENSP00000377524:P137L;ENSP00000312535:P137L	ENSP00000312535:P137L	P	+	2	0	LRFN4	66382201	0.000000	0.05858	0.111000	0.21465	0.012000	0.07955	0.687000	0.25407	1.107000	0.41642	0.313000	0.20887	CCG	.		0.692	LRFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393127.1	NM_024036	
LRP5	4041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	68205929	68205929	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr11:68205929C>T	ENST00000294304.7	+	20	4233	c.4127C>T	c.(4126-4128)cCc>cTc	p.P1376L		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1376					adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACCAAGCCGCCCTCAGACGAC	0.592																																					p.P1376L		.											.	LRP5-661	0			c.C4127T						.						95.0	98.0	97.0					11																	68205929		2200	4294	6494	SO:0001583	missense	4041	exon20			AGCCGCCCTCAGA	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4127C>T	11.37:g.68205929C>T	ENSP00000294304:p.Pro1376Leu	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	90	22	NM_002335	0	0	40	67	27	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.065810	0.36470	.	.	ENSG00000162337	ENST00000294304	D	0.94000	-3.33	4.53	4.53	0.55603	.	0.139825	0.31495	U	0.007555	D	0.90889	0.7137	L	0.45137	1.4	0.43787	D	0.996329	B;B	0.24092	0.097;0.097	B;B	0.26094	0.066;0.066	D	0.88780	0.3270	10	0.49607	T	0.09	.	17.5404	0.87845	0.0:1.0:0.0:0.0	.	1376;1376	Q9UES7;O75197	.;LRP5_HUMAN	L	1376	ENSP00000294304:P1376L	ENSP00000294304:P1376L	P	+	2	0	LRP5	67962505	0.649000	0.27322	0.025000	0.17156	0.056000	0.15407	5.269000	0.65542	2.379000	0.81126	0.585000	0.79938	CCC	.		0.592	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49433380	49433380	+	Silent	SNP	C	C	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr12:49433380C>G	ENST00000301067.7	-	32	8066	c.8067G>C	c.(8065-8067)ctG>ctC	p.L2689L	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2689					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GCCGAATCAGCAGCTCTCGTA	0.577																																					p.L2689L		.											.	MLL2-612	0			c.G8067C						.						19.0	21.0	20.0					12																	49433380		1995	4182	6177	SO:0001819	synonymous_variant	8085	exon32			AATCAGCAGCTCT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8067G>C	12.37:g.49433380C>G		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	28	10	NM_003482	0	0	3	4	1	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.577	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
POLR3B	55703	broad.mit.edu	37	12	106889911	106889911	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr12:106889911C>A	ENST00000228347.4	+	24	3014	c.2792C>A	c.(2791-2793)cCa>cAa	p.P931Q	POLR3B_ENST00000539066.1_Missense_Mutation_p.P873Q|RP11-144F15.1_ENST00000551505.1_3'UTR	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	931					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						ATCATGAACCCACACGGCTTC	0.488																																					p.P931Q													.	POLR3B-91	0			c.C2792A						.						183.0	156.0	165.0					12																	106889911		2203	4300	6503	SO:0001583	missense	55703	exon24			TGAACCCACACGG	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.2792C>A	12.37:g.106889911C>A	ENSP00000228347:p.Pro931Gln	Somatic	156	0		WXS	Illumina HiSeq	Phase_I	144	5	NM_018082	0	0	6	6	0	A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	C	33	5.263308	0.95399	.	.	ENSG00000013503	ENST00000228347;ENST00000539066	D;D	0.92595	-3.07;-3.07	5.4	5.4	0.78164	DNA-directed RNA polymerase, subunit 2, domain 6 (2);	0.000000	0.85682	D	0.000000	D	0.98267	0.9426	H	0.99650	4.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99572	1.0971	10	0.87932	D	0	-13.2872	19.5252	0.95201	0.0:1.0:0.0:0.0	.	931	Q9NW08	RPC2_HUMAN	Q	931;873	ENSP00000228347:P931Q;ENSP00000445721:P873Q	ENSP00000228347:P931Q	P	+	2	0	POLR3B	105414041	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.720000	0.84759	2.678000	0.91216	0.655000	0.94253	CCA	.		0.488	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082	
RPH3A	22895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	113306301	113306301	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr12:113306301C>A	ENST00000389385.4	+	8	1008	c.511C>A	c.(511-513)Cct>Act	p.P171T	RPH3A_ENST00000420983.2_Missense_Mutation_p.P171T|RPH3A_ENST00000551052.1_Missense_Mutation_p.P167T|RPH3A_ENST00000548866.1_Missense_Mutation_p.P122T|RPH3A_ENST00000447659.2_Missense_Mutation_p.P122T|RPH3A_ENST00000415485.3_Missense_Mutation_p.P171T|RPH3A_ENST00000543106.2_Missense_Mutation_p.P171T|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	171	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		ACAGCCTATGCCTATAAAGAA	0.602																																					p.P171T		.											.	RPH3A-519	0			c.C511A						.						60.0	58.0	59.0					12																	113306301		2203	4300	6503	SO:0001583	missense	22895	exon8			CCTATGCCTATAA	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.511C>A	12.37:g.113306301C>A	ENSP00000374036:p.Pro171Thr	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	63	13	NM_001143854	0	0	0	0	0	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653855	0.88056	.	.	ENSG00000089169	ENST00000543106;ENST00000551593;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T	0.64438	-0.0;-0.0;-0.1;-0.0;-0.0;-0.1;-0.0	4.77	4.77	0.60923	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.64402	D	0.000009	T	0.73521	0.3597	L	0.49126	1.545	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.996;0.996;0.998	T	0.70676	-0.4806	10	0.28530	T	0.3	.	16.5919	0.84767	0.0:1.0:0.0:0.0	.	122;171;171;167	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	T	171;171;171;122;167;171;122;171	ENSP00000440384:P171T;ENSP00000374036:P171T;ENSP00000413254:P122T;ENSP00000448297:P167T;ENSP00000405357:P171T;ENSP00000450347:P122T;ENSP00000408889:P171T	ENSP00000374036:P171T	P	+	1	0	RPH3A	111790684	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.916000	0.75776	2.213000	0.71641	0.655000	0.94253	CCT	.		0.602	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
FBXW8	26259	hgsc.bcm.edu	37	12	117348921	117348921	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr12:117348921C>G	ENST00000309909.5	+	1	161	c.79C>G	c.(79-81)Cga>Gga	p.R27G	FBXW8_ENST00000455858.2_Missense_Mutation_p.R27G			Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8	27					cell proliferation (GO:0008283)|Golgi organization (GO:0007030)|labyrinthine layer blood vessel development (GO:0060716)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|spongiotrophoblast layer development (GO:0060712)	Cul7-RING ubiquitin ligase complex (GO:0031467)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)				endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	22	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		GAAGAAGCGGCGACGGCCCGA	0.751																																					p.R27G		.											.	FBXW8-229	0			c.C79G						.						3.0	4.0	4.0					12																	117348921		1164	2768	3932	SO:0001583	missense	26259	exon1			AAGCGGCGACGGC	AF176707	CCDS9182.1, CCDS44988.1	12q24.23	2013-01-09	2007-02-08	2003-06-13				"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13597	protein-coding gene	gene with protein product		609073	"""F-box only protein 29"", ""F-box and WD-40 domain protein 8"""	FBXO29		10531035, 10531037	Standard	NM_012174		Approved	FBX29, FBW6, FBW8	uc001twg.1	Q8N3Y1	OTTHUMG00000169329	ENST00000309909.5:c.79C>G	12.37:g.117348921C>G	ENSP00000310686:p.Arg27Gly	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	3	3	NM_012174	0	0	0	0	0	Q9UK95	Missense_Mutation	SNP	ENST00000309909.5	37	CCDS9182.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482464	0.44147	.	.	ENSG00000174989	ENST00000309909;ENST00000455858;ENST00000505227	T;T	0.10477	2.91;2.87	4.11	4.11	0.48088	.	0.440966	0.21290	N	0.076982	T	0.19525	0.0469	L	0.27053	0.805	0.33657	D	0.609235	D;D	0.67145	0.993;0.996	D;D	0.76575	0.972;0.988	T	0.13072	-1.0523	10	0.72032	D	0.01	-20.9936	12.0561	0.53536	0.0:1.0:0.0:0.0	.	27;27	Q8N3Y1;Q8N3Y1-2	FBXW8_HUMAN;.	G	27	ENSP00000310686:R27G;ENSP00000389144:R27G	ENSP00000310686:R27G	R	+	1	2	FBXW8	115833304	1.000000	0.71417	0.998000	0.56505	0.087000	0.18053	1.536000	0.36072	2.273000	0.75805	0.555000	0.69702	CGA	.		0.751	FBXW8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403561.1	NM_012174	
CCDC62	84660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	123286278	123286278	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr12:123286278A>T	ENST00000253079.6	+	9	1929	c.1585A>T	c.(1585-1587)Atg>Ttg	p.M529L	CCDC62_ENST00000392440.2_Missense_Mutation_p.M290L|CCDC62_ENST00000392441.4_Missense_Mutation_p.M529L|CCDC62_ENST00000537566.1_Missense_Mutation_p.M290L	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	529					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		CCCAGGCCACATGTCTGACGT	0.502																																					p.M529L		.											.	CCDC62-157	0			c.A1585T						.						138.0	145.0	143.0					12																	123286278		2203	4300	6503	SO:0001583	missense	84660	exon9			GGCCACATGTCTG		CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.1585A>T	12.37:g.123286278A>T	ENSP00000253079:p.Met529Leu	Somatic	270	0		WXS	Illumina HiSeq	Phase_I	250	59	NM_201435	0	0	0	0	0	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	ENST00000253079.6	37	CCDS9238.1	.	.	.	.	.	.	.	.	.	.	A	13.84	2.358511	0.41801	.	.	ENSG00000130783	ENST00000253079;ENST00000392441;ENST00000537566;ENST00000392440	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.73	-0.599	0.11645	.	0.206543	0.35805	N	0.002975	T	0.49609	0.1567	L	0.56769	1.78	0.18873	N	0.999988	B;B;B	0.21225	0.053;0.004;0.001	B;B;B	0.15484	0.013;0.006;0.001	T	0.44298	-0.9337	10	0.56958	D	0.05	-8.7087	4.9707	0.14113	0.4874:0.1609:0.3517:0.0	.	529;290;529	Q6P9F0-2;Q6P9F0-3;Q6P9F0	.;.;CCD62_HUMAN	L	529;529;290;290	ENSP00000253079:M529L;ENSP00000376236:M529L;ENSP00000445045:M290L;ENSP00000376235:M290L	ENSP00000253079:M529L	M	+	1	0	CCDC62	121852231	0.575000	0.26692	0.748000	0.31131	0.676000	0.39594	0.351000	0.20096	0.101000	0.17610	0.482000	0.46254	ATG	.		0.502	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1	NM_032573	
SLC15A4	121260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	129283926	129283926	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr12:129283926A>G	ENST00000266771.5	-	7	1490	c.1451T>C	c.(1450-1452)aTg>aCg	p.M484T	SLC15A4_ENST00000545031.1_Start_Codon_SNP_p.M1T|SLC15A4_ENST00000544112.1_Missense_Mutation_p.M147T	NM_145648.3	NP_663623.1	Q8N697	S15A4_HUMAN	solute carrier family 15 (oligopeptide transporter), member 4	484					ion transport (GO:0006811)|oligopeptide transport (GO:0006857)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	L-histidine transmembrane transporter activity (GO:0005290)|symporter activity (GO:0015293)			endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|skin(1)	22	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		GGCACTCTGCATGGACTTGGG	0.512																																					p.M484T		.											.	SLC15A4-90	0			c.T1451C						.						84.0	81.0	82.0					12																	129283926		2203	4300	6503	SO:0001583	missense	121260	exon7			CTCTGCATGGACT	AY038999	CCDS9264.1	12q24.32	2013-07-18	2013-07-18		ENSG00000139370	ENSG00000139370		"""Solute carriers"""	23090	protein-coding gene	gene with protein product		615806	"""solute carrier family 15, member 4"""			11741232	Standard	NM_145648		Approved	PHT1, PTR4	uc001uhu.2	Q8N697	OTTHUMG00000168415	ENST00000266771.5:c.1451T>C	12.37:g.129283926A>G	ENSP00000266771:p.Met484Thr	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	95	36	NM_145648	0	0	15	37	22	A6H8Y9|B3KTK1|Q71M34|Q7Z5F8|Q8TAH0	Missense_Mutation	SNP	ENST00000266771.5	37	CCDS9264.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.361060	0.82353	.	.	ENSG00000139370	ENST00000266771;ENST00000545031;ENST00000544112	T;T	0.05382	3.45;3.45	5.15	5.15	0.70609	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.28830	0.0715	M	0.85542	2.76	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.08249	-1.0731	10	0.87932	D	0	.	14.985	0.71342	1.0:0.0:0.0:0.0	.	484	Q8N697	S15A4_HUMAN	T	484;1;147	ENSP00000266771:M484T;ENSP00000439946:M147T	ENSP00000266771:M484T	M	-	2	0	SLC15A4	127849879	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.574000	0.90763	1.929000	0.55896	0.533000	0.62120	ATG	.		0.512	SLC15A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399663.1	NM_145648	
SLITRK1	114798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	84453895	84453895	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr13:84453895G>A	ENST00000377084.2	-	1	2633	c.1748C>T	c.(1747-1749)gCt>gTt	p.A583V		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	583					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CGAGATCCTAGCGTACAGCTG	0.542																																					p.A583V		.											.	SLITRK1-94	0			c.C1748T						.						94.0	80.0	85.0					13																	84453895		2203	4300	6503	SO:0001583	missense	114798	exon1			ATCCTAGCGTACA	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1748C>T	13.37:g.84453895G>A	ENSP00000366288:p.Ala583Val	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	35	9	NM_052910	0	0	0	2	2	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	G	7.865	0.726968	0.15439	.	.	ENSG00000178235	ENST00000377084	T	0.58797	0.31	5.22	4.36	0.52297	.	0.190710	0.45126	D	0.000397	T	0.58409	0.2120	M	0.76574	2.34	0.45261	D	0.998262	B	0.22541	0.071	B	0.25987	0.065	T	0.56595	-0.7953	10	0.30854	T	0.27	-10.4812	13.8324	0.63389	0.0:0.1548:0.8452:0.0	.	583	Q96PX8	SLIK1_HUMAN	V	583	ENSP00000366288:A583V	ENSP00000366288:A583V	A	-	2	0	SLITRK1	83351896	1.000000	0.71417	0.958000	0.39756	0.986000	0.74619	3.881000	0.56152	1.320000	0.45209	-0.175000	0.13238	GCT	.		0.542	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
UBAC2	337867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	99890774	99890774	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr13:99890774T>C	ENST00000403766.3	+	2	260	c.125T>C	c.(124-126)gTg>gCg	p.V42A	UBAC2_ENST00000376440.2_Missense_Mutation_p.C84R	NM_001144072.1	NP_001137544.1	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2	42					protein localization to endoplasmic reticulum (GO:0070972)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)	10	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AAGCTCTTTGTGTATGACCTT	0.547																																					p.C84R		.											.	UBAC2-91	0			c.T250C						.						222.0	221.0	222.0					13																	99890774		2203	4300	6503	SO:0001583	missense	337867	exon2			TCTTTGTGTATGA	AK055110	CCDS9490.1, CCDS45064.1	13q32.3	2012-02-01	2007-04-20	2007-04-20	ENSG00000134882	ENSG00000134882			20486	protein-coding gene	gene with protein product			"""phosphoglycerate dehydrogenase like 1"""	PHGDHL1			Standard	NM_177967		Approved	FLJ30548, RP11-178C10.1	uc001voa.4	Q8NBM4	OTTHUMG00000017267	ENST00000403766.3:c.125T>C	13.37:g.99890774T>C	ENSP00000383911:p.Val42Ala	Somatic	442	0		WXS	Illumina HiSeq	Phase_I	334	83	NM_177967	0	0	16	39	23	B3KNV7|Q0VAB5|Q5W0W6|Q5W0W9|Q6GQR2|Q6P4B0|Q8N2E8|Q96NW2	Missense_Mutation	SNP	ENST00000403766.3	37	CCDS45064.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.11|13.11	2.139733|2.139733	0.37728|0.37728	.|.	.|.	ENSG00000134882|ENSG00000134882	ENST00000376440|ENST00000403766;ENST00000355700;ENST00000457666	.|T;T;T	.|0.45276	.|0.9;0.9;0.9	5.72|5.72	4.52|4.52	0.55395|0.55395	.|.	.|0.610304	.|0.17766	.|N	.|0.162736	T|T	0.25865|0.25865	0.0630|0.0630	.|.	.|.	.|.	0.37528|0.37528	D|D	0.917816|0.917816	B|B	0.18968|0.13594	0.032|0.008	B|B	0.13407|0.06405	0.009|0.002	T|T	0.12268|0.12268	-1.0554|-1.0554	6|8	.|.	.|.	.|.	-4.5461|-4.5461	5.6483|5.6483	0.17602|0.17602	0.1608:0.0847:0.0:0.7545|0.1608:0.0847:0.0:0.7545	.|.	84|42	Q8NBM4-2|Q8NBM4	.|UBAC2_HUMAN	R|A	84|42;42;48	.|ENSP00000383911:V42A;ENSP00000347928:V42A;ENSP00000402249:V48A	.|.	C|V	+|+	1|2	0|0	UBAC2|UBAC2	98688775|98688775	0.007000|0.007000	0.16637|0.16637	0.998000|0.998000	0.56505|0.56505	0.983000|0.983000	0.72400|0.72400	1.311000|1.311000	0.33562|0.33562	0.960000|0.960000	0.38005|0.38005	0.482000|0.482000	0.46254|0.46254	TGT|GTG	.		0.547	UBAC2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045588.1	NM_177967	
LAMP1	3916	broad.mit.edu	37	13	113960803	113960803	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr13:113960803T>C	ENST00000332556.4	+	2	259	c.65T>C	c.(64-66)cTc>cCc	p.L22P	LAMP1_ENST00000397181.3_Missense_Mutation_p.L22P	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	22				LLLLLGLMHCA -> PVAAARPHALS (in Ref. 1; AAA60382). {ECO:0000305}.	autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			TTGACAGGCCTCATGCATTGT	0.473																																					p.L22P													.	LAMP1-514	0			c.T65C						.						168.0	162.0	164.0					13																	113960803		1967	4166	6133	SO:0001583	missense	3916	exon2			CAGGCCTCATGCA	J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.65T>C	13.37:g.113960803T>C	ENSP00000333298:p.Leu22Pro	Somatic	233	0		WXS	Illumina HiSeq	Phase_I	178	4	NM_005561	0	0	1	1	0	B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Missense_Mutation	SNP	ENST00000332556.4	37	CCDS41909.1	.	.	.	.	.	.	.	.	.	.	T	12.75	2.032500	0.35893	.	.	ENSG00000185896	ENST00000332556;ENST00000397181	T;T	0.34859	1.34;1.45	5.04	5.04	0.67666	.	1.537360	0.04718	N	0.418782	T	0.62877	0.2464	M	0.80028	2.48	0.53005	D	0.99996	D;D	0.71674	0.998;0.983	D;P	0.62955	0.909;0.799	T	0.41980	-0.9478	10	0.44086	T	0.13	-17.283	11.4481	0.50136	0.0:0.0:0.0:1.0	.	22;22	B4DWL3;P11279	.;LAMP1_HUMAN	P	22	ENSP00000333298:L22P;ENSP00000415354:L22P	ENSP00000333298:L22P	L	+	2	0	LAMP1	113008804	0.249000	0.23941	0.861000	0.33841	0.020000	0.10135	3.432000	0.52824	2.026000	0.59711	0.421000	0.28195	CTC	.		0.473	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045876.2		
FOXG1	2290	hgsc.bcm.edu	37	14	29237806	29237806	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr14:29237806T>C	ENST00000313071.4	+	1	1520	c.1321T>C	c.(1321-1323)Tcc>Ccc	p.S441P	FOXG1_ENST00000382535.3_Missense_Mutation_p.S441P	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	441					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		GGCCGCGTCCTCCTCCACGTC	0.617																																					p.S441P		.											.	FOXG1-660	0			c.T1321C						.						66.0	62.0	63.0					14																	29237806		2203	4300	6503	SO:0001583	missense	2290	exon1			GCGTCCTCCTCCA		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1321T>C	14.37:g.29237806T>C	ENSP00000339004:p.Ser441Pro	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	55	3	NM_005249	0	0	0	0	0	A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	ENST00000313071.4	37	CCDS9636.1	.	.	.	.	.	.	.	.	.	.	T	9.301	1.053132	0.19907	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.93712	-3.27;-3.27	4.14	4.14	0.48551	.	0.394510	0.21935	U	0.066968	D	0.87156	0.6107	N	0.19112	0.55	0.44117	D	0.996893	P	0.44578	0.838	B	0.41813	0.367	D	0.86285	0.1670	10	0.42905	T	0.14	.	10.3384	0.43862	0.0:0.0:0.1649:0.835	.	441	P55316	FOXG1_HUMAN	P	441	ENSP00000371975:S441P;ENSP00000339004:S441P	ENSP00000339004:S441P	S	+	1	0	FOXG1	28307557	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.354000	0.52254	1.633000	0.50488	0.402000	0.26972	TCC	.		0.617	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
NEO1	4756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	73428245	73428245	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr15:73428245G>T	ENST00000339362.5	+	6	1339	c.892G>T	c.(892-894)Gta>Tta	p.V298L	NEO1_ENST00000558964.1_Missense_Mutation_p.V298L|NEO1_ENST00000560262.1_Missense_Mutation_p.V298L|NEO1_ENST00000261908.6_Missense_Mutation_p.V298L			Q92859	NEO1_HUMAN	neogenin 1	298	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						TGAAAGATTGGTATTGCTGGC	0.338																																					p.V298L		.											.	NEO1-116	0			c.G892T						.						88.0	84.0	85.0					15																	73428245		2197	4297	6494	SO:0001583	missense	4756	exon5			AGATTGGTATTGC	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.892G>T	15.37:g.73428245G>T	ENSP00000341198:p.Val298Leu	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	16	5	NM_001172623	0	0	3	6	3	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	37	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	G	3.964	-0.009769	0.07727	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.66638	-0.22;-0.22	6.04	0.438	0.16560	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.602380	0.17828	N	0.160637	T	0.42877	0.1222	N	0.17872	0.535	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.002	T	0.14896	-1.0456	10	0.27785	T	0.31	-0.8513	4.3015	0.10927	0.3044:0.0:0.443:0.2526	.	298;298;298	B7ZKM9;B7ZKN0;Q92859	.;.;NEO1_HUMAN	L	298;16;298	ENSP00000341198:V298L;ENSP00000261908:V298L	ENSP00000261908:V298L	V	+	1	0	NEO1	71215298	0.026000	0.19158	0.105000	0.21289	0.246000	0.25737	0.203000	0.17315	0.170000	0.19704	-0.219000	0.12488	GTA	.		0.338	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
SCAMP2	10066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75142970	75142970	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr15:75142970A>T	ENST00000268099.9	-	6	626	c.517T>A	c.(517-519)Tgg>Agg	p.W173R		NM_005697.3	NP_005688.2	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	173					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)|trans-Golgi network membrane (GO:0032588)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	9						CCCGAGAACCAGGCCAGGCAG	0.562																																					p.W173R		.											.	SCAMP2-91	0			c.T517A						.						123.0	112.0	115.0					15																	75142970		2197	4295	6492	SO:0001583	missense	10066	exon6			AGAACCAGGCCAG	AF005038	CCDS10271.1	15q23-q25	2013-02-21			ENSG00000140497	ENSG00000140497		"""Secretory carrier membrane proteins"""	10564	protein-coding gene	gene with protein product		606912				9378760	Standard	NM_005697		Approved		uc002azb.1	O15127	OTTHUMG00000142817	ENST00000268099.9:c.517T>A	15.37:g.75142970A>T	ENSP00000268099:p.Trp173Arg	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	93	21	NM_005697	0	0	48	87	39	B2RDF0|Q9BQE8	Missense_Mutation	SNP	ENST00000268099.9	37	CCDS10271.1	.	.	.	.	.	.	.	.	.	.	A	7.869	0.727707	0.15439	.	.	ENSG00000140497	ENST00000268099;ENST00000543345	T	0.16597	2.33	4.48	4.48	0.54585	.	0.307839	0.34802	N	0.003680	T	0.22513	0.0543	M	0.71036	2.16	0.30893	N	0.730139	B;B	0.21520	0.049;0.057	B;B	0.29267	0.035;0.1	T	0.10543	-1.0625	10	0.25751	T	0.34	.	13.2599	0.60098	1.0:0.0:0.0:0.0	.	173;142	O15127;B3KU14	SCAM2_HUMAN;.	R	173;142	ENSP00000268099:W173R	ENSP00000268099:W173R	W	-	1	0	SCAMP2	72930023	1.000000	0.71417	1.000000	0.80357	0.454000	0.32378	4.332000	0.59279	1.795000	0.52594	0.402000	0.26972	TGG	.		0.562	SCAMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286403.3	NM_005697	
ZSCAN2	54993	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	85159554	85159554	+	Intron	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr15:85159554G>A	ENST00000448803.2	+	3	698				ZSCAN2_ENST00000327179.6_Intron|ZSCAN2_ENST00000538076.1_Intron|ZSCAN2_ENST00000546148.1_Intron|ZSCAN2_ENST00000358472.3_Intron|ZSCAN2_ENST00000541040.1_Intron|ZSCAN2_ENST00000379358.3_Missense_Mutation_p.V141I|ZSCAN2_ENST00000485222.2_Intron|RP11-182J1.5_ENST00000542197.1_RNA	NM_181877.3	NP_870992.2	Q7Z7L9	ZSCA2_HUMAN	zinc finger and SCAN domain containing 2						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|liver(2)|lung(4)|ovary(1)|pancreas(1)	19				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		agcttcctgcgtacatggctg	0.463																																					p.V141I		.											.	ZSCAN2-91	0			c.G421A						.						170.0	139.0	149.0					15																	85159554		2203	4299	6502	SO:0001627	intron_variant	54993	exon3			TCCTGCGTACATG	BC041620	CCDS10329.2, CCDS32315.1, CCDS32316.1	15q25.2	2013-01-08	2004-11-01	2004-11-02	ENSG00000176371	ENSG00000176371		"""-"", ""Zinc fingers, C2H2-type"""	20994	protein-coding gene	gene with protein product			"""zinc finger protein 29"""	ZFP29		1937051	Standard	NM_017894		Approved	FLJ20595, ZNF854	uc002bkr.3	Q7Z7L9	OTTHUMG00000074027	ENST00000448803.2:c.407-4279G>A	15.37:g.85159554G>A		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	65	22	NM_001007072	0	0	1	1	0	A6NG83|B2RMQ9|Q6ZQY9|Q9NWU4	Missense_Mutation	SNP	ENST00000448803.2	37	CCDS10329.2	.	.	.	.	.	.	.	.	.	.	G	2.654	-0.281322	0.05642	.	.	ENSG00000176371	ENST00000379358	T	0.05855	3.38	1.85	-3.69	0.04450	.	.	.	.	.	T	0.03434	0.0099	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41787	-0.9489	8	0.38643	T	0.18	.	1.9006	0.03267	0.2148:0.1858:0.4349:0.1645	.	141	Q7Z7L9-4	.	I	141	ENSP00000368663:V141I	ENSP00000368663:V141I	V	+	1	0	ZSCAN2	82960558	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-2.727000	0.00807	-1.295000	0.02357	-0.414000	0.06135	GTA	.		0.463	ZSCAN2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396956.1	NM_017894	
CHTF18	63922	hgsc.bcm.edu	37	16	845697	845697	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr16:845697A>G	ENST00000262315.9	+	17	2251	c.2188A>G	c.(2188-2190)Atg>Gtg	p.M730V	CHTF18_ENST00000317063.6_Missense_Mutation_p.M939V|CHTF18_ENST00000455171.2_Missense_Mutation_p.M758V	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	730					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CCAGAACCGGATGAGCCAGAT	0.726																																					p.M730V		.											.	CHTF18-227	0			c.A2188G						.						14.0	18.0	17.0					16																	845697		2054	4170	6224	SO:0001583	missense	63922	exon17			AACCGGATGAGCC	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2188A>G	16.37:g.845697A>G	ENSP00000262315:p.Met730Val	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	35	3	NM_022092	0	0	0	0	0	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	ENST00000262315.9	37	CCDS45371.1	.	.	.	.	.	.	.	.	.	.	a	4.345	0.063383	0.08388	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	T;T;T	0.09723	2.95;2.99;2.99	4.41	3.29	0.37713	.	1.148390	0.06406	N	0.719777	T	0.08358	0.0208	L	0.40543	1.245	0.09310	N	1	B;B	0.24675	0.041;0.109	B;B	0.17098	0.017;0.013	T	0.44574	-0.9319	10	0.16896	T	0.51	-0.0122	1.7224	0.02915	0.5608:0.1754:0.0948:0.1689	.	758;730	Q8WVB6-2;Q8WVB6	.;CTF18_HUMAN	V	939;758;730	ENSP00000313029:M939V;ENSP00000406252:M758V;ENSP00000262315:M730V	ENSP00000262315:M730V	M	+	1	0	CHTF18	785698	0.012000	0.17670	0.132000	0.22025	0.973000	0.67179	0.965000	0.29319	0.538000	0.28769	0.370000	0.22315	ATG	.		0.726	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	3	3	NM_178167	0	0	0	1	1	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
C16orf59	80178	hgsc.bcm.edu	37	16	2511166	2511166	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr16:2511166G>C	ENST00000361837.4	+	4	611	c.546G>C	c.(544-546)caG>caC	p.Q182H	C16orf59_ENST00000569496.1_Missense_Mutation_p.Q182H|C16orf59_ENST00000563531.1_Missense_Mutation_p.Q182H|RP11-715J22.4_ENST00000566085.1_lincRNA|C16orf59_ENST00000483320.1_Missense_Mutation_p.Q15H	NM_025108.2	NP_079384.2	Q7L2K0	CP059_HUMAN	chromosome 16 open reading frame 59	182										lung(1)|skin(1)|urinary_tract(1)	3		Ovarian(90;0.17)				TCAGGGACCAGCAAATGGCCC	0.667																																					p.Q182H		.											.	C16orf59-90	0			c.G546C						.						10.0	13.0	12.0					16																	2511166		1889	4101	5990	SO:0001583	missense	80178	exon4			GGACCAGCAAATG	AK023971	CCDS10468.2	16p13.3	2008-10-30			ENSG00000162062	ENSG00000162062			25849	protein-coding gene	gene with protein product						12477932	Standard	XM_006720955		Approved	FLJ13909	uc002cqh.3	Q7L2K0	OTTHUMG00000128859	ENST00000361837.4:c.546G>C	16.37:g.2511166G>C	ENSP00000355022:p.Gln182His	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	21	2	NM_025108	0	0	0	0	0	B4DXD7|Q96H61|Q9H872	Missense_Mutation	SNP	ENST00000361837.4	37	CCDS10468.2	.	.	.	.	.	.	.	.	.	.	G	14.25	2.479988	0.44044	.	.	ENSG00000162062	ENST00000361837	T	0.49432	0.78	3.42	-0.616	0.11583	.	0.610181	0.13837	N	0.359307	T	0.54175	0.1842	M	0.62723	1.935	0.09310	N	1	D;P;P;D	0.60160	0.987;0.95;0.95;0.983	P;P;P;P	0.58391	0.838;0.712;0.712;0.785	T	0.46005	-0.9222	10	0.66056	D	0.02	-1.5097	6.6308	0.22855	0.459:0.0:0.541:0.0	.	15;182;15;15	Q7L2K0-3;Q7L2K0;D3DU95;Q7L2K0-2	.;CP059_HUMAN;.;.	H	182	ENSP00000355022:Q182H	ENSP00000355022:Q182H	Q	+	3	2	C16orf59	2451167	0.001000	0.12720	0.003000	0.11579	0.019000	0.09904	0.419000	0.21247	-0.125000	0.11703	-0.345000	0.07892	CAG	.		0.667	C16orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250802.3	NM_025108	
ACSM2A	123876	hgsc.bcm.edu;broad.mit.edu	37	16	20482481	20482481	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr16:20482481C>G	ENST00000573854.1	+	5	797	c.683C>G	c.(682-684)cCc>cGc	p.P228R	ACSM2A_ENST00000417235.2_Missense_Mutation_p.P149R|ACSM2A_ENST00000219054.6_Missense_Mutation_p.P228R|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000575690.1_Missense_Mutation_p.P228R|ACSM2A_ENST00000536134.1_Intron|ACSM2A_ENST00000396104.2_Missense_Mutation_p.P228R	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	228					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						AGTGGTCTTCCCAAGATGGCA	0.507																																					p.P228R		.											.	ACSM2A-91	0			c.C683G						.						88.0	81.0	84.0					16																	20482481		2202	4280	6482	SO:0001583	missense	123876	exon6			GTCTTCCCAAGAT	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.683C>G	16.37:g.20482481C>G	ENSP00000459451:p.Pro228Arg	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	136	28	NM_001010845	0	0	592	805	213	B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	37	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977023	0.53720	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000396104	D;D;D	0.85013	-1.93;-1.93;-1.93	4.04	4.04	0.47022	AMP-dependent synthetase/ligase (1);AMP-binding, conserved site (1);	0.000000	0.46758	D	0.000276	D	0.93044	0.7786	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94275	0.7514	10	0.87932	D	0	-15.3933	13.1463	0.59463	0.0:1.0:0.0:0.0	.	149;228	B7Z8R0;Q08AH3	.;ACS2A_HUMAN	R	149;228;228	ENSP00000392169:P149R;ENSP00000219054:P228R;ENSP00000379411:P228R	ENSP00000219054:P228R	P	+	2	0	ACSM2A	20389982	0.994000	0.37717	0.968000	0.41197	0.633000	0.38033	5.357000	0.66058	1.796000	0.52611	0.298000	0.19748	CCC	.		0.507	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	
KIAA0556	23247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	27761006	27761006	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr16:27761006T>A	ENST00000261588.4	+	16	2744	c.2725T>A	c.(2725-2727)Tcc>Acc	p.S909T		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	909						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CTTCGACCGCTCCCACCGGGG	0.637																																					p.S909T		.											.	KIAA0556-141	0			c.T2725A						.						63.0	60.0	61.0					16																	27761006		2197	4300	6497	SO:0001583	missense	23247	exon16			GACCGCTCCCACC	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.2725T>A	16.37:g.27761006T>A	ENSP00000261588:p.Ser909Thr	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	93	22	NM_015202	0	0	2	3	1	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	T	18.42	3.620080	0.66787	.	.	ENSG00000047578	ENST00000261588	T	0.10382	2.88	4.7	3.58	0.41010	.	0.196895	0.45606	D	0.000352	T	0.10465	0.0256	L	0.53249	1.67	0.25290	N	0.989366	P	0.47545	0.897	P	0.45639	0.488	T	0.06373	-1.0830	10	0.06365	T	0.9	-22.2078	6.7315	0.23385	0.0:0.0832:0.161:0.7558	.	909	O60303	K0556_HUMAN	T	909	ENSP00000261588:S909T	ENSP00000261588:S909T	S	+	1	0	KIAA0556	27668507	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.876000	0.48498	0.738000	0.32606	0.533000	0.62120	TCC	.		0.637	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
SEZ6L2	26470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	29884867	29884867	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr16:29884867T>A	ENST00000308713.5	-	13	2815	c.2288A>T	c.(2287-2289)aAa>aTa	p.K763I	SEZ6L2_ENST00000537485.1_Missense_Mutation_p.K719I|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.K649I|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.K693I	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	763	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ACAGGCGCATTTGGGGACCCT	0.667																																					p.K763I		.											.	SEZ6L2-92	0			c.A2288T						.						60.0	55.0	57.0					16																	29884867		2197	4300	6497	SO:0001583	missense	26470	exon13			GCGCATTTGGGGA	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.2288A>T	16.37:g.29884867T>A	ENSP00000312550:p.Lys763Ile	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	61	12	NM_001243332	0	0	0	0	0	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.145084	0.77888	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	4.67	4.67	0.58626	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.49916	D	0.000135	T	0.66742	0.2820	L	0.28556	0.865	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.999;1.0	D;D;D;D;D;D	0.91635	0.997;0.999;0.996;0.998;0.998;0.999	T	0.63088	-0.6715	10	0.23891	T	0.37	.	13.1007	0.59218	0.0:0.0:0.0:1.0	.	719;763;649;693;763;693	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	I	693;763;649;719	ENSP00000310206:K693I;ENSP00000312550:K763I;ENSP00000319215:K649I;ENSP00000439412:K719I	ENSP00000312550:K763I	K	-	2	0	SEZ6L2	29792368	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.939000	0.70179	1.737000	0.51674	0.533000	0.62120	AAA	.		0.667	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
HEATR3	55027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	50104088	50104088	+	Splice_Site	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr16:50104088G>A	ENST00000299192.7	+	4	590		c.e4-1		HEATR3_ENST00000285767.4_Splice_Site	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3											cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						TTTGGTTACAGTGTAGTGCTG	0.383																																					.		.											.	HEATR3-92	0			c.400-1G>A						.						86.0	83.0	84.0					16																	50104088		2198	4300	6498	SO:0001630	splice_region_variant	55027	exon4			GTTACAGTGTAGT	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.400-1G>A	16.37:g.50104088G>A		Somatic	68	0		WXS	Illumina HiSeq	Phase_I	60	31	NM_182922	0	0	0	0	0	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Splice_Site	SNP	ENST00000299192.7	37	CCDS10739.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012741	0.75161	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.545	0.95291	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HEATR3	48661589	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.402000	0.73260	2.861000	0.98227	0.655000	0.94253	.	.		0.383	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	Intron
AMFR	267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	56401438	56401438	+	Splice_Site	SNP	C	C	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr16:56401438C>A	ENST00000290649.5	-	12	1727	c.1517G>T	c.(1516-1518)cGg>cTg	p.R506L		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	506					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						GCTATCTGACCGCTGGAAGAG	0.498																																					p.R506L	Pancreas(2;144 323 39528)	.											.	AMFR-1009	0			c.G1517T						.						248.0	233.0	238.0					16																	56401438		2198	4300	6498	SO:0001630	splice_region_variant	267	exon12			TCTGACCGCTGGA	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.1516-1G>T	16.37:g.56401438C>A		Somatic	360	0		WXS	Illumina HiSeq	Phase_I	398	100	NM_001144	0	0	0	0	0	P26442|Q8IZ70	Missense_Mutation	SNP	ENST00000290649.5	37	CCDS10758.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.611801	0.46631	.	.	ENSG00000159461	ENST00000290649	T	0.14391	2.51	5.8	5.8	0.92144	.	0.234971	0.44483	D	0.000455	T	0.15998	0.0385	M	0.63428	1.95	0.80722	D	1	B;P	0.37985	0.415;0.613	B;B	0.28709	0.089;0.093	T	0.02208	-1.1195	10	0.34782	T	0.22	-24.0104	18.2436	0.89977	0.0:1.0:0.0:0.0	.	506;155	Q9UKV5;Q1RN03	AMFR2_HUMAN;.	L	506	ENSP00000290649:R506L	ENSP00000290649:R506L	R	-	2	0	AMFR	54958939	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	3.487000	0.53222	2.735000	0.93741	0.655000	0.94253	CGG	.		0.498	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256978.2		Missense_Mutation
HYDIN	54768	hgsc.bcm.edu;broad.mit.edu	37	16	70866949	70866949	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr16:70866949T>A	ENST00000393567.2	-	80	13851	c.13701A>T	c.(13699-13701)aaA>aaT	p.K4567N		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4567					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GAGGCTCAAATTTTTTGATGT	0.413																																					p.K4567N		.											.	HYDIN-92	0			c.A13701T						.						14.0	14.0	14.0					16																	70866949		1811	4061	5872	SO:0001583	missense	54768	exon80			CTCAAATTTTTTG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.13701A>T	16.37:g.70866949T>A	ENSP00000377197:p.Lys4567Asn	Somatic	57	1		WXS	Illumina HiSeq	Phase_I	52	12	NM_001270974	0	0	10	17	7	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	T	15.28	2.787649	0.49997	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01099	5.34	4.62	-0.806	0.10875	.	0.437992	0.16234	U	0.223455	T	0.02888	0.0086	M	0.74258	2.255	0.09310	N	1	D	0.56968	0.978	P	0.61070	0.883	T	0.40515	-0.9559	10	0.23891	T	0.37	.	1.6269	0.02724	0.1205:0.2403:0.3257:0.3135	.	4566	F8WD23	.	N	4567;4566	ENSP00000377197:K4567N	ENSP00000313052:K4566N	K	-	3	2	HYDIN	69424450	0.181000	0.23161	0.011000	0.14972	0.919000	0.55068	-0.435000	0.06931	-0.520000	0.06435	-0.473000	0.04963	AAA	.		0.413	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
GRB7	2886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37898588	37898588	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr17:37898588A>G	ENST00000309156.4	+	2	291	c.34A>G	c.(34-36)Agc>Ggc	p.S12G	GRB7_ENST00000394209.2_Missense_Mutation_p.S12G|GRB7_ENST00000445327.2_Missense_Mutation_p.S35G|GRB7_ENST00000309185.3_Missense_Mutation_p.S12G|GRB7_ENST00000578702.1_3'UTR|GRB7_ENST00000394211.3_Missense_Mutation_p.S12G|GRB7_ENST00000394204.1_Missense_Mutation_p.S12G	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	12					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TCATCTTAGCAGCTCTCCGGA	0.617																																					p.S35G		.											.	GRB7-848	0			c.A103G						.						154.0	151.0	152.0					17																	37898588		2203	4300	6503	SO:0001583	missense	2886	exon2			CTTAGCAGCTCTC	D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.34A>G	17.37:g.37898588A>G	ENSP00000310771:p.Ser12Gly	Somatic	295	0		WXS	Illumina HiSeq	Phase_I	250	100	NM_001242442	0	0	14	61	47	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	ENST00000309156.4	37	CCDS11345.1	.	.	.	.	.	.	.	.	.	.	A	7.773	0.707831	0.15239	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86	4.61	4.61	0.57282	.	0.366448	0.26349	N	0.024892	T	0.38585	0.1046	L	0.47716	1.5	0.27860	N	0.940439	B;B	0.28971	0.229;0.043	B;B	0.29176	0.099;0.037	T	0.24404	-1.0161	10	0.21540	T	0.41	-25.7351	10.4148	0.44316	1.0:0.0:0.0:0.0	.	12;12	Q14451-2;Q14451	.;GRB7_HUMAN	G	12;12;12;12;35;12	ENSP00000311752:S12G;ENSP00000310771:S12G;ENSP00000377761:S12G;ENSP00000377759:S12G;ENSP00000403459:S35G;ENSP00000377754:S12G	ENSP00000310771:S12G	S	+	1	0	GRB7	35152114	1.000000	0.71417	0.981000	0.43875	0.110000	0.19582	4.739000	0.62080	1.718000	0.51419	0.459000	0.35465	AGC	.		0.617	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257024.2	NM_005310	
KRT13	3860	broad.mit.edu	37	17	39658827	39658827	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr17:39658827G>A	ENST00000246635.3	-	6	1089	c.1043C>T	c.(1042-1044)aCg>aTg	p.T348M	AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Missense_Mutation_p.T348M|KRT13_ENST00000587118.1_5'Flank|KRT13_ENST00000336861.3_Missense_Mutation_p.T348M	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	348	Coil 2.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				CTCTGCCACCGTGTTCTCCAG	0.632																																					p.T348M													.	KRT13-95	0			c.C1043T						.						85.0	76.0	79.0					17																	39658827		2203	4300	6503	SO:0001583	missense	3860	exon6			GCCACCGTGTTCT		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.1043C>T	17.37:g.39658827G>A	ENSP00000246635:p.Thr348Met	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	149	5	NM_002274	0	0	0	0	0	Q53G54|Q6AZK5|Q8N240	Missense_Mutation	SNP	ENST00000246635.3	37	CCDS11396.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.94|11.94	1.789143|1.789143	0.31685|0.31685	.|.	.|.	ENSG00000171401|ENSG00000171401	ENST00000157775|ENST00000246635;ENST00000336861	.|D;D	.|0.89415	.|-2.51;-2.51	4.45|4.45	4.45|4.45	0.53987|0.53987	.|Filament (1);	.|0.451868	.|0.18101	.|N	.|0.151665	.|D	.|0.93559	.|0.7944	M|M	0.77616|0.77616	2.38|2.38	0.09310|0.09310	N|N	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.999;0.999;0.999	.|D;D;D;D	.|0.67900	.|0.954;0.953;0.921;0.953	.|D	.|0.87051	.|0.2147	.|10	.|0.87932	.|D	.|0	.|.	13.5215|13.5215	0.61569|0.61569	0.0:0.0:0.7766:0.2234|0.0:0.0:0.7766:0.2234	.|.	.|336;348;348;348	.|P13646-2;A1A4E9;P13646-3;P13646	.|.;.;.;K1C13_HUMAN	.|M	-1|348	.|ENSP00000246635:T348M;ENSP00000336604:T348M	.|ENSP00000246635:T348M	.|T	-|-	.|2	.|0	KRT13|KRT13	36912353|36912353	0.254000|0.254000	0.23992|0.23992	0.463000|0.463000	0.27130|0.27130	0.221000|0.221000	0.24807|0.24807	3.044000|3.044000	0.49830|0.49830	2.460000|2.460000	0.83146|0.83146	0.478000|0.478000	0.44815|0.44815	.|ACG	.		0.632	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
CDC27	996	hgsc.bcm.edu	37	17	45234484	45234484	+	Missense_Mutation	SNP	T	T	C	rs202100614		TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr17:45234484T>C	ENST00000066544.3	-	7	730	c.637A>G	c.(637-639)Aac>Gac	p.N213D	CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000531206.1_Missense_Mutation_p.N213D|CDC27_ENST00000446365.2_Missense_Mutation_p.N152D|CDC27_ENST00000527547.1_Missense_Mutation_p.N213D	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	213					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTCAATCTGTTTAATTCCTGA	0.294																																					p.N213D		.											.	CDC27-291	0			c.A637G						.																																			SO:0001583	missense	996	exon7			ATCTGTTTAATTC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.637A>G	17.37:g.45234484T>C	ENSP00000066544:p.Asn213Asp	Somatic	42	1		WXS	Illumina HiSeq	Phase_I	26	2	NM_001114091	0	0	0	0	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.424821	0.62733	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67698	-0.24;-0.28;-0.04;-0.24;0.82	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.49423	0.1556	N	0.24115	0.695	0.58432	D	0.999999	B;B;B;B	0.33379	0.41;0.011;0.006;0.167	B;B;B;B	0.23275	0.045;0.004;0.006;0.045	T	0.50021	-0.8876	10	0.30078	T	0.28	-15.7847	14.1506	0.65381	0.0:0.0:0.0:1.0	.	152;213;213;213	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	D	213;213;152;213;213	ENSP00000066544:N213D;ENSP00000434614:N213D;ENSP00000392802:N152D;ENSP00000437339:N213D;ENSP00000432105:N213D	ENSP00000066544:N213D	N	-	1	0	CDC27	42589483	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.522000	0.81844	2.227000	0.72691	0.455000	0.32223	AAC	.		0.294	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
CDK5RAP3	80279	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	46058013	46058013	+	Silent	SNP	C	C	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr17:46058013C>T	ENST00000338399.4	+	12	1238	c.1132C>T	c.(1132-1134)Ctg>Ttg	p.L378L	RP11-6N17.10_ENST00000578239.1_RNA|CDK5RAP3_ENST00000578663.1_3'UTR|CDK5RAP3_ENST00000536708.2_Silent_p.L403L	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	378					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						GGCAGATGTCCTGTCTGTGAG	0.527																																					p.L378L		.											.	CDK5RAP3-226	0			c.C1132T						.						182.0	184.0	183.0					17																	46058013		2092	4207	6299	SO:0001819	synonymous_variant	80279	exon12			GATGTCCTGTCTG	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.1132C>T	17.37:g.46058013C>T		Somatic	231	0		WXS	Illumina HiSeq	Phase_I	213	12	NM_176096	0	0	181	197	16	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	ENST00000338399.4	37	CCDS42356.1																																																																																			.		0.527	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442913.1	NM_176096	
POTEC	388468	broad.mit.edu	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	C	T	rs201788045		TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr18:14513764C>T	ENST00000358970.5	-	10	1429	c.1430G>A	c.(1429-1431)cGg>cAg	p.R477Q		NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	477								p.R477Q(12)		NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						AAGTTGTTTCCGGGTATCATT	0.358																																					p.R477Q													.	POTEC-3	12	Substitution - Missense(12)	endometrium(4)|kidney(3)|urinary_tract(2)|prostate(2)|soft_tissue(1)	c.G1430A						.						13.0	9.0	10.0					18																	14513764		683	1543	2226	SO:0001583	missense	388468	exon10			TGTTTCCGGGTAT	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.1430G>A	18.37:g.14513764C>T	ENSP00000351856:p.Arg477Gln	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	119	6	NM_001137671	0	0	0	0	0		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	492	0.22527472527472528	61	0.12398373983739837	82	0.2265193370165746	187	0.3269230769230769	162	0.21372031662269128	c	0.001	-3.539655	0.00009	.	.	ENSG00000183206	ENST00000358970	T	0.20881	2.04	1.34	0.0657	0.14358	.	.	.	.	.	T	0.00012	0.0000	N	0.00116	-2.08	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42430	-0.9452	9	0.06757	T	0.87	.	3.4153	0.07373	0.0:0.2473:0.0:0.7527	.	477	B2RU33	POTEC_HUMAN	Q	477	ENSP00000351856:R477Q	ENSP00000351856:R477Q	R	-	2	0	POTEC	14503764	0.885000	0.30320	0.063000	0.19743	0.005000	0.04900	1.581000	0.36558	0.005000	0.14708	-1.615000	0.00797	CGG	.		0.358	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
RANBP3	8498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5941706	5941706	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr19:5941706T>C	ENST00000340578.6	-	5	389	c.332A>G	c.(331-333)gAa>gGa	p.E111G	RANBP3_ENST00000541471.1_Intron|RANBP3_ENST00000591124.1_5'UTR|RANBP3_ENST00000591092.1_Missense_Mutation_p.E43G|RANBP3_ENST00000439268.2_Missense_Mutation_p.E111G|RANBP3_ENST00000034275.8_Missense_Mutation_p.E43G	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	111					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						ATTTCCATCTTCTCTGTCAGA	0.423																																					p.E111G		.											.	RANBP3-272	0			c.A332G						.						161.0	152.0	155.0					19																	5941706		1912	4133	6045	SO:0001583	missense	8498	exon5			CCATCTTCTCTGT	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.332A>G	19.37:g.5941706T>C	ENSP00000341483:p.Glu111Gly	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	99	30	NM_007322	0	0	0	0	0	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	37	CCDS42478.1	.	.	.	.	.	.	.	.	.	.	T	18.44	3.625162	0.66901	.	.	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000324807	T;T;T	0.38887	1.11;1.15;1.83	5.26	5.26	0.73747	.	0.096682	0.64402	D	0.000001	T	0.46171	0.1379	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.58268	0.97;0.982;0.982;0.97	P;P;P;P	0.60345	0.683;0.832;0.873;0.749	T	0.47114	-0.9142	10	0.54805	T	0.06	-17.7103	13.15	0.59484	0.0:0.0:0.0:1.0	.	43;43;111;111	B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;RANB3_HUMAN	G	111;111;43;42	ENSP00000341483:E111G;ENSP00000404837:E111G;ENSP00000034275:E43G	ENSP00000034275:E43G	E	-	2	0	RANBP3	5892706	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.699000	0.74613	1.996000	0.58369	0.533000	0.62120	GAA	.		0.423	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322	
CLEC4M	10332	hgsc.bcm.edu	37	19	7830937	7830937	+	Missense_Mutation	SNP	G	G	C	rs59002457	byFrequency	TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr19:7830937G>C	ENST00000327325.5	+	4	746	c.628G>C	c.(628-630)Gag>Cag	p.E210Q	CLEC4M_ENST00000595496.1_Intron|CLEC4M_ENST00000359059.5_Missense_Mutation_p.E166Q|CLEC4M_ENST00000248228.4_Missense_Mutation_p.E188Q|CLEC4M_ENST00000394122.2_Missense_Mutation_p.E198Q|CLEC4M_ENST00000357361.2_Missense_Mutation_p.E210Q|CLEC4M_ENST00000334806.5_Missense_Mutation_p.E159Q|CLEC4M_ENST00000596363.1_Missense_Mutation_p.E182Q|CLEC4M_ENST00000597522.1_Intron|CLEC4M_ENST00000596707.1_Missense_Mutation_p.E189Q	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	210	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)	p.T209>?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						GGAGCTGACGGAGCTGAAGGC	0.577													C|||	107	0.0213658	0.0015	0.0605	5008	,	,		16155	0.0109		0.0368	False		,,,				2504	0.0153				p.E210Q		.											.	CLEC4M-91	1	Complex(1)	large_intestine(1)	c.G628C						.						118.0	96.0	104.0					19																	7830937		2192	4023	6215	SO:0001583	missense	10332	exon4			CTGACGGAGCTGA	AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.628G>C	19.37:g.7830937G>C	ENSP00000316228:p.Glu210Gln	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	4	2	NM_014257	0	0	0	0	0	A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Missense_Mutation	SNP	ENST00000327325.5	37	CCDS12187.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.492474	0.00159	.	.	ENSG00000104938	ENST00000327325;ENST00000394122;ENST00000248228;ENST00000334806;ENST00000359059;ENST00000357361;ENST00000358690	T;T;T;T;T;T	0.21734	4.13;1.99;1.99;4.14;2.31;4.01	0.592	0.592	0.17471	.	.	.	.	.	T	0.03263	0.0095	N	0.00142	-2.005	0.09310	N	1	B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.001;0.0;0.0;0.001	B;B;B;B;B;B;B	0.19666	0.001;0.004;0.001;0.001;0.0;0.002;0.026	T	0.40757	-0.9546	8	0.02654	T	1	.	.	.	.	rs59002457	159;182;210;198;187;182;154	B4E2Z5;B4DNV9;Q9H2X3;E7ENS9;Q9H2X3-8;Q9H2X3-9;Q9H2X3-10	.;.;CLC4M_HUMAN;.;.;.;.	Q	210;198;188;159;166;210;154	ENSP00000316228:E210Q;ENSP00000377680:E198Q;ENSP00000248228:E188Q;ENSP00000335228:E159Q;ENSP00000351954:E166Q;ENSP00000349924:E210Q	ENSP00000248228:E188Q	E	+	1	0	CLEC4M	7736937	0.000000	0.05858	0.011000	0.14972	0.006000	0.05464	-1.133000	0.03232	-0.203000	0.10251	-0.463000	0.05309	GAG	.		0.577	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461161.1	NM_014257	
HNRNPM	4670	ucsc.edu	37	19	8527467	8527467	+	Splice_Site	SNP	T	T	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr19:8527467T>G	ENST00000325495.4	+	3	377		c.e3+2		HNRNPM_ENST00000348943.3_Splice_Site	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						AAGTCAAGGGTAAGTGTCTGA	0.428																																					.													.	HNRNPM-68	0			c.336+2T>G						.						241.0	220.0	227.0					19																	8527467		2203	4300	6503	SO:0001630	splice_region_variant	4670	exon3			CAAGGGTAAGTGT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.336+2T>G	19.37:g.8527467T>G		Somatic	210	1		WXS	Illumina HiSeq		164	1	NM_031203	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Splice_Site	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.580056	0.65992	.	.	ENSG00000099783	ENST00000325495;ENST00000348943	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0018	0.71479	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNRNPM	8433467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.225000	0.72522	0.459000	0.35465	.	.		0.428	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		Intron
TMED1	11018	hgsc.bcm.edu;bcgsc.ca	37	19	10945675	10945675	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr19:10945675C>G	ENST00000214869.2	-	3	498	c.400G>C	c.(400-402)Gtc>Ctc	p.V134L	C19orf38_ENST00000592854.1_5'Flank|TMED1_ENST00000588289.1_5'UTR|TMED1_ENST00000591695.1_Intron	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	134					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						CATCCTTCGACCTCCTCGTCA	0.557																																					p.V134L		.											.	TMED1-155	0			c.G400C						.						160.0	148.0	152.0					19																	10945675		2203	4300	6503	SO:0001583	missense	11018	exon3			CTTCGACCTCCTC	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.400G>C	19.37:g.10945675C>G	ENSP00000214869:p.Val134Leu	Somatic	204	0		WXS	Illumina HiSeq	Phase_I	144	8	NM_006858	0	0	43	43	0		Missense_Mutation	SNP	ENST00000214869.2	37	CCDS12249.1	.	.	.	.	.	.	.	.	.	.	C	7.304	0.613556	0.14066	.	.	ENSG00000099203	ENST00000214869	T	0.40225	1.04	5.02	2.88	0.33553	GOLD (2);	0.765986	0.12157	N	0.494351	T	0.15869	0.0382	N	0.04203	-0.255	0.24941	N	0.991855	B	0.02656	0.0	B	0.11329	0.006	T	0.29822	-0.9999	10	0.09338	T	0.73	-22.7796	2.1997	0.03920	0.156:0.5179:0.1518:0.1743	.	134	Q13445	TMED1_HUMAN	L	134	ENSP00000214869:V134L	ENSP00000214869:V134L	V	-	1	0	TMED1	10806675	0.028000	0.19301	0.524000	0.27887	0.904000	0.53231	1.864000	0.39469	0.520000	0.28426	0.462000	0.41574	GTC	.		0.557	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
ZNF101	94039	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19789581	19789581	+	Silent	SNP	G	G	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr19:19789581G>C	ENST00000592502.1	+	3	287	c.177G>C	c.(175-177)ctG>ctC	p.L59L	ZNF101_ENST00000415784.2_5'UTR|ZNF101_ENST00000444249.2_Missense_Mutation_p.W58S			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	59	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						ACCAAAACCTGGGGATTAAGC	0.333																																					p.L59L		.											.	ZNF101-92	0			c.G177C						.						45.0	45.0	45.0					19																	19789581		2203	4300	6503	SO:0001819	synonymous_variant	94039	exon3			AAACCTGGGGATT	AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.177G>C	19.37:g.19789581G>C		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	42	8	NM_033204	0	0	0	0	0	C9JU83|Q0VDG9	Silent	SNP	ENST00000592502.1	37	CCDS32971.1																																																																																			.		0.333	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460559.1	NM_033204	
ZFP14	57677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36831515	36831515	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr19:36831515A>C	ENST00000270001.7	-	5	1328	c.1213T>G	c.(1213-1215)Ttt>Gtt	p.F405V		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					TAACTACTAAAGGTCTTCCAA	0.408																																					p.F405V		.											.	ZFP14-91	0			c.T1213G						.						115.0	106.0	109.0					19																	36831515		2203	4300	6503	SO:0001583	missense	57677	exon5			TACTAAAGGTCTT	AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.1213T>G	19.37:g.36831515A>C	ENSP00000270001:p.Phe405Val	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	118	34	NM_020917	0	0	3	3	0	A7MD23	Missense_Mutation	SNP	ENST00000270001.7	37	CCDS33002.1	.	.	.	.	.	.	.	.	.	.	a	18.65	3.668655	0.67814	.	.	ENSG00000142065	ENST00000270001;ENST00000392172	T	0.46063	0.88	3.99	3.99	0.46301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46442	D	0.000284	T	0.67822	0.2934	M	0.88181	2.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.74919	-0.3500	10	0.87932	D	0	.	12.2842	0.54783	1.0:0.0:0.0:0.0	.	405;405	A8KAN8;Q9HCL3	.;ZFP14_HUMAN	V	405	ENSP00000270001:F405V	ENSP00000270001:F405V	F	-	1	0	ZFP14	41523355	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	5.755000	0.68750	1.794000	0.52575	0.523000	0.50628	TTT	.		0.408	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452528.1	NM_020917	
OTX1	5013	hgsc.bcm.edu	37	2	63282948	63282948	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr2:63282948C>G	ENST00000282549.2	+	5	838	c.562C>G	c.(562-564)Ccc>Gcc	p.P188A	OTX1_ENST00000366671.3_Missense_Mutation_p.P188A	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	188					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					AGGCTCAGCGCCCGCGTCCGT	0.687																																					p.P188A		.											.	OTX1-70	0			c.C562G						.						13.0	14.0	14.0					2																	63282948		2186	4283	6469	SO:0001583	missense	5013	exon5			TCAGCGCCCGCGT		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.562C>G	2.37:g.63282948C>G	ENSP00000282549:p.Pro188Ala	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_014562	0	0	0	0	0	A6NHA2|B3KTJ4|Q53TG6	Missense_Mutation	SNP	ENST00000282549.2	37	CCDS1873.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127474	0.56721	.	.	ENSG00000115507	ENST00000366671;ENST00000282549	D;D	0.90900	-2.75;-2.75	3.41	3.41	0.39046	Transcription factor Otx, C-terminal (1);	0.269321	0.29321	N	0.012488	D	0.91730	0.7385	L	0.53249	1.67	0.80722	D	1	D	0.62365	0.991	D	0.66602	0.945	D	0.88527	0.3100	10	0.10377	T	0.69	.	12.6775	0.56903	0.0:1.0:0.0:0.0	.	188	P32242	OTX1_HUMAN	A	188	ENSP00000355631:P188A;ENSP00000282549:P188A	ENSP00000282549:P188A	P	+	1	0	OTX1	63136452	0.997000	0.39634	0.968000	0.41197	0.935000	0.57460	4.214000	0.58527	1.901000	0.55032	0.462000	0.41574	CCC	.		0.687	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1		
CIR1	9541	hgsc.bcm.edu;broad.mit.edu	37	2	175215408	175215408	+	Silent	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr2:175215408T>C	ENST00000342016.3	-	9	749	c.657A>G	c.(655-657)aaA>aaG	p.K219K	CIR1_ENST00000362053.5_3'UTR	NM_004882.3	NP_004873.3	Q86X95	CIR1_HUMAN	corepressor interacting with RBPJ, 1	219	Interaction with RP9. {ECO:0000250}.|Lys/Ser-rich.				mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(5)|skin(1)	15						TCTGTTTTTGTTTGGTTGTTA	0.303																																					p.K219K		.											.	CIR1-153	0			c.A657G						.						80.0	76.0	78.0					2																	175215408		2203	4299	6502	SO:0001819	synonymous_variant	9541	exon9			TTTTTGTTTGGTT	AF098297	CCDS2256.1	2q31.1	2009-07-14			ENSG00000138433	ENSG00000138433			24217	protein-coding gene	gene with protein product	"""recepin"", ""CBF1 interacting corepressor"""	605228				15652350, 11222720, 9874765	Standard	NM_004882		Approved	CIR	uc002uim.3	Q86X95	OTTHUMG00000132338	ENST00000342016.3:c.657A>G	2.37:g.175215408T>C		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	67	5	NM_004882	0	0	153	156	3	A6NFI6|A8K8M4|O95367|Q12804|Q4G1B9|Q6PJI4|Q8IWI2	Silent	SNP	ENST00000342016.3	37	CCDS2256.1																																																																																			.		0.303	CIR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255460.1	NM_004882	
STK36	27148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219556970	219556970	+	Silent	SNP	C	C	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr2:219556970C>G	ENST00000295709.3	+	15	2148	c.1869C>G	c.(1867-1869)ctC>ctG	p.L623L	STK36_ENST00000392105.3_Silent_p.L623L|STK36_ENST00000440309.1_Silent_p.L623L|STK36_ENST00000392106.2_Silent_p.L623L	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		TGGATGGGCTCCTTCATGGCT	0.537																																					p.L623L		.											.	STK36-1004	0			c.C1869G						.						90.0	95.0	93.0					2																	219556970		2203	4300	6503	SO:0001819	synonymous_variant	27148	exon15			TGGGCTCCTTCAT	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.1869C>G	2.37:g.219556970C>G		Somatic	110	0		WXS	Illumina HiSeq	Phase_I	133	70	NM_015690	0	0	10	24	14		Silent	SNP	ENST00000295709.3	37	CCDS2421.1																																																																																			.		0.537	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2		
ECEL1	9427	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	233350797	233350797	+	Silent	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr2:233350797G>A	ENST00000304546.1	-	2	777	c.567C>T	c.(565-567)gaC>gaT	p.D189D	ECEL1_ENST00000409941.1_Silent_p.D189D	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	189					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		TCTCGCGCATGTCGAGGCACG	0.746																																					p.D189D		.											.	ECEL1-90	0			c.C567T						.																																			SO:0001819	synonymous_variant	9427	exon2			GCGCATGTCGAGG	Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.567C>T	2.37:g.233350797G>A		Somatic	15	0		WXS	Illumina HiSeq	Phase_I	29	7	NM_004826	0	0	0	0	0	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Silent	SNP	ENST00000304546.1	37	CCDS2493.1																																																																																			.		0.746	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826	
CHGB	1114	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	5903930	5903930	+	Silent	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr20:5903930T>C	ENST00000378961.4	+	4	1344	c.1140T>C	c.(1138-1140)agT>agC	p.S380S		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	380						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						GTGAGGAGAGTTGGGATGAGG	0.547																																					p.S380S		.											.	CHGB-96	0			c.T1140C						.						114.0	113.0	113.0					20																	5903930		2203	4300	6503	SO:0001819	synonymous_variant	1114	exon4			GGAGAGTTGGGAT		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1140T>C	20.37:g.5903930T>C		Somatic	202	2		WXS	Illumina HiSeq	Phase_I	201	48	NM_001819	0	0	7	9	2	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Silent	SNP	ENST00000378961.4	37	CCDS13092.1																																																																																			.		0.547	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2	NM_001819	
BPIFA1	51297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31825663	31825663	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr20:31825663G>A	ENST00000354297.4	+	2	217	c.146G>A	c.(145-147)gGa>gAa	p.G49E	BPIFA1_ENST00000375413.4_Missense_Mutation_p.G49E|BPIFA1_ENST00000375422.2_Missense_Mutation_p.G49E	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	49					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										GGTCTTGCAGGAAGCTTGACA	0.557																																					p.G49E		.											.	.	0			c.G146A						.						84.0	78.0	80.0					20																	31825663		2203	4300	6503	SO:0001583	missense	51297	exon2			TTGCAGGAAGCTT	AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.146G>A	20.37:g.31825663G>A	ENSP00000346251:p.Gly49Glu	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	104	39	NM_016583	0	0	0	0	0	A8K9R3|E1P5M9|Q9NZT0	Missense_Mutation	SNP	ENST00000354297.4	37	CCDS13217.1	.	.	.	.	.	.	.	.	.	.	G	9.833	1.189055	0.21954	.	.	ENSG00000198183	ENST00000375422;ENST00000354297;ENST00000375413;ENST00000544328	T;T;T	0.11385	2.78;2.78;2.78	5.11	-0.843	0.10744	.	0.563694	0.17374	N	0.176573	T	0.06826	0.0174	L	0.39245	1.2	0.09310	N	1	B	0.24882	0.113	B	0.23419	0.046	T	0.43702	-0.9375	10	0.02654	T	1	0.4054	9.72	0.40297	0.0869:0.5908:0.3223:0.0	.	49	Q9NP55	BPIA1_HUMAN	E	49;49;49;35	ENSP00000364571:G49E;ENSP00000346251:G49E;ENSP00000364562:G49E	ENSP00000346251:G49E	G	+	2	0	BPIFA1	31289324	0.316000	0.24580	0.019000	0.16419	0.005000	0.04900	0.387000	0.20718	0.087000	0.17167	0.655000	0.94253	GGA	.		0.557	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078667.2	NM_130852	
MYH7B	57644	ucsc.edu;bcgsc.ca	37	20	33578248	33578248	+	Intron	SNP	A	A	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr20:33578248A>T	ENST00000262873.7	+	20	2195				MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta							membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TCTCCACGTGAACATCACAGC	0.637																																					.													.	.	0			.						.						48.0	48.0	48.0					20																	33578248		1568	3582	5150	SO:0001627	intron_variant	574501	.			CACGTGAACATCA	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.2103+135A>T	20.37:g.33578248A>T		Somatic	55	0		WXS	Illumina HiSeq		54	27	.	0	0	0	1	1	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	RNA	SNP	ENST00000262873.7	37	CCDS42869.1																																																																																			.		0.637	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
TUBB1	81027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	57599037	57599037	+	Silent	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr20:57599037G>A	ENST00000217133.1	+	4	824	c.555G>A	c.(553-555)gcG>gcA	p.A185A		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	185					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.A185A(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	CCTACAACGCGGTTCTGTCTA	0.517																																					p.A185A		.											.	TUBB1-227	1	Substitution - coding silent(1)	lung(1)	c.G555A						.						127.0	121.0	123.0					20																	57599037		2203	4300	6503	SO:0001819	synonymous_variant	81027	exon4			CAACGCGGTTCTG	AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.555G>A	20.37:g.57599037G>A		Somatic	195	1		WXS	Illumina HiSeq	Phase_I	196	25	NM_030773	0	0	1	1	0		Silent	SNP	ENST00000217133.1	37	CCDS13475.1																																																																																			.		0.517	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079903.1	NM_030773	
COL6A1	1291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47423886	47423886	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr21:47423886G>A	ENST00000361866.3	+	35	3160	c.3046G>A	c.(3046-3048)Gtc>Atc	p.V1016I	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	1016	C-terminal globular domain.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		GCTCCGCGGTGTCTTCCACCA	0.662																																					p.V1016I		.											.	COL6A1-91	0			c.G3046A						.						56.0	58.0	58.0					21																	47423886		2203	4300	6503	SO:0001583	missense	1291	exon35			CGCGGTGTCTTCC	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.3046G>A	21.37:g.47423886G>A	ENSP00000355180:p.Val1016Ile	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	150	63	NM_001848	0	1	160	309	148	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	37	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.958303	0.73902	.	.	ENSG00000142156	ENST00000361866	D	0.91464	-2.85	4.83	4.83	0.62350	von Willebrand factor, type A (1);	0.000000	0.64402	D	0.000001	D	0.90376	0.6988	L	0.57536	1.79	0.58432	D	0.99999	D	0.52996	0.957	P	0.49752	0.621	D	0.88044	0.2783	10	0.08381	T	0.77	-40.0397	17.9387	0.89020	0.0:0.0:1.0:0.0	.	1016	P12109	CO6A1_HUMAN	I	1016	ENSP00000355180:V1016I	ENSP00000355180:V1016I	V	+	1	0	COL6A1	46248314	1.000000	0.71417	0.957000	0.39632	0.304000	0.27724	5.907000	0.69908	2.232000	0.73038	0.596000	0.82720	GTC	.		0.662	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848	
ARVCF	421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	19966432	19966432	+	Missense_Mutation	SNP	G	G	A	rs542020914	byFrequency	TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr22:19966432G>A	ENST00000263207.3	-	7	1859	c.1568C>T	c.(1567-1569)tCg>tTg	p.S523L	ARVCF_ENST00000406522.1_Missense_Mutation_p.S460L|ARVCF_ENST00000406259.1_Missense_Mutation_p.S523L|ARVCF_ENST00000401994.1_Missense_Mutation_p.S460L|ARVCF_ENST00000344269.3_Missense_Mutation_p.S460L|ARVCF_ENST00000487793.1_5'Flank	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	523					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					CAGGCAGCCCGACGTGTTCTT	0.622													G|||	2	0.000399361	0.0	0.0	5008	,	,		20460	0.0		0.0	False		,,,				2504	0.002				p.S523L		.											.	ARVCF-91	0			c.C1568T						.						136.0	91.0	106.0					22																	19966432		2203	4300	6503	SO:0001583	missense	421	exon7			CAGCCCGACGTGT		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.1568C>T	22.37:g.19966432G>A	ENSP00000263207:p.Ser523Leu	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	42	8	NM_001670	0	0	0	0	0	B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	37	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.930425	0.92389	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11	4.43	4.43	0.53597	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64811	0.2632	M	0.75777	2.31	0.80722	D	1	P;D	0.89917	0.906;1.0	P;D	0.79108	0.475;0.992	T	0.66913	-0.5803	9	.	.	.	-14.4434	17.6161	0.88068	0.0:0.0:1.0:0.0	.	523;45	O00192;E7EV58	ARVC_HUMAN;.	L	523;460;460;460;523	ENSP00000263207:S523L;ENSP00000342042:S460L;ENSP00000384341:S460L;ENSP00000384732:S460L;ENSP00000385444:S523L	.	S	-	2	0	ARVCF	18346432	1.000000	0.71417	0.164000	0.22755	0.982000	0.71751	7.455000	0.80726	2.472000	0.83506	0.563000	0.77884	TCG	.		0.622	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670	
GUCD1	83606	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24938994	24938994	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr22:24938994A>T	ENST00000407471.3	-	6	893	c.703T>A	c.(703-705)Ttt>Att	p.F235I	GUCD1_ENST00000490922.1_Intron|GUCD1_ENST00000404664.3_Missense_Mutation_p.F290I|GUCD1_ENST00000435822.1_Missense_Mutation_p.F234I|GUCD1_ENST00000447813.2_3'UTR|GUCD1_ENST00000402766.1_3'UTR	NM_001284251.1	NP_001271180.1	Q96NT3	GUCD1_HUMAN	guanylyl cyclase domain containing 1	235																	AAGTAGACAAAGAGGATGTCC	0.637																																					p.F235I		.											.	.	0			c.T703A						.						216.0	165.0	182.0					22																	24938994		2203	4300	6503	SO:0001583	missense	83606	exon6			AGACAAAGAGGAT	AK054681	CCDS33621.1, CCDS63426.1, CCDS63427.1, CCDS74831.1, CCDS74832.1, CCDS74833.1	22q11.2	2012-11-13	2012-11-13	2012-11-13	ENSG00000138867	ENSG00000138867			14237	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 13"""	C22orf13		12477932	Standard	XM_005261761		Approved	MGC1842, LLN4	uc003aah.2	Q96NT3	OTTHUMG00000150728	ENST00000407471.3:c.703T>A	22.37:g.24938994A>T	ENSP00000386076:p.Phe235Ile	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	106	32	NM_031444	0	0	36	67	31	B5MCB8|B5MCL7|Q96Q79|Q9BU32	Missense_Mutation	SNP	ENST00000407471.3	37	CCDS33621.1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.981630	0.93044	.	.	ENSG00000138867	ENST00000407471;ENST00000435822;ENST00000404664	.	.	.	5.37	5.37	0.77165	.	0.104223	0.64402	D	0.000003	T	0.70806	0.3266	M	0.69823	2.125	0.80722	D	1	P;P;P;P	0.47409	0.811;0.885;0.895;0.477	P;P;P;B	0.51324	0.489;0.666;0.629;0.327	T	0.72693	-0.4216	9	0.45353	T	0.12	-8.7496	14.5939	0.68392	1.0:0.0:0.0:0.0	.	290;298;191;235	B5MCL7;B4DH83;B4DL90;Q96NT3	.;.;.;CV013_HUMAN	I	235;234;290	.	ENSP00000381297:F234I	F	-	1	0	C22orf13	23268994	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.244000	0.78228	2.037000	0.60232	0.456000	0.33151	TTT	.		0.637	GUCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319819.1	NM_031444	
OSM	5008	hgsc.bcm.edu	37	22	30660245	30660245	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr22:30660245T>C	ENST00000215781.2	-	3	426	c.386A>G	c.(385-387)aAc>aGc	p.N129S	OSM_ENST00000403389.1_Missense_Mutation_p.N108S|OSM_ENST00000403463.1_3'UTR	NM_020530.4	NP_065391.1	P13725	ONCM_HUMAN	oncostatin M	129					behavioral response to pain (GO:0048266)|cell proliferation (GO:0008283)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|peripheral nervous system development (GO:0007422)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|response to heat (GO:0009408)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	extracellular space (GO:0005615)|oncostatin-M receptor complex (GO:0005900)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|oncostatin-M receptor binding (GO:0005147)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|skin(3)	11			Epithelial(10;0.206)			GTCCTCGATGTTCAGCCCAGA	0.602																																					p.N129S		.											.	OSM-493	0			c.A386G						.						49.0	40.0	43.0					22																	30660245		2203	4300	6503	SO:0001583	missense	5008	exon3			TCGATGTTCAGCC	AF129855	CCDS13873.1	22q12.2	2011-07-21			ENSG00000099985	ENSG00000099985			8506	protein-coding gene	gene with protein product		165095				1717982	Standard	NM_020530		Approved	MGC20461	uc003ahb.3	P13725	OTTHUMG00000150913	ENST00000215781.2:c.386A>G	22.37:g.30660245T>C	ENSP00000215781:p.Asn129Ser	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_020530	0	0	20	20	0	Q6FHP8|Q9UCP6	Missense_Mutation	SNP	ENST00000215781.2	37	CCDS13873.1	.	.	.	.	.	.	.	.	.	.	T	5.822	0.336000	0.11013	.	.	ENSG00000099985	ENST00000215781;ENST00000403389	T	0.50001	0.76	0.559	-0.762	0.11034	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.	.	.	.	T	0.25044	0.0608	L	0.29908	0.895	0.09310	N	1	P	0.36909	0.573	B	0.31442	0.13	T	0.17471	-1.0368	8	0.13108	T	0.6	.	.	.	.	.	129	P13725	ONCM_HUMAN	S	129;108	ENSP00000215781:N129S	ENSP00000215781:N129S	N	-	2	0	OSM	28990245	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.028000	0.13644	-0.427000	0.07350	-0.441000	0.05720	AAC	.		0.602	OSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320512.1	NM_020530	
JAGN1	84522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9934676	9934676	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:9934676G>A	ENST00000307768.4	+	2	336	c.167G>A	c.(166-168)aGc>aAc	p.S56N		NM_032492.3	NP_115881.3			jagunal homolog 1 (Drosophila)											breast(1)|central_nervous_system(1)|endometrium(4)|lung(3)|ovary(1)	10	Medulloblastoma(99;0.227)					GCTAAGATGAGCGTGGGACAC	0.512																																					p.S56N		.											.	JAGN1-91	0			c.G167A						.						158.0	132.0	141.0					3																	9934676		2203	4300	6503	SO:0001583	missense	84522	exon2			AGATGAGCGTGGG	AK074760	CCDS2588.1	3p25.2	2010-03-23			ENSG00000171135	ENSG00000171135			26926	protein-coding gene	gene with protein product						12477932	Standard	NM_032492		Approved	GL009, FLJ14602	uc003btt.4	Q8N5M9	OTTHUMG00000128523	ENST00000307768.4:c.167G>A	3.37:g.9934676G>A	ENSP00000306106:p.Ser56Asn	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	79	20	NM_032492	0	0	64	92	28		Missense_Mutation	SNP	ENST00000307768.4	37	CCDS2588.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.434837	0.25813	.	.	ENSG00000171135	ENST00000307768;ENST00000543379	.	.	.	5.24	3.34	0.38264	.	0.446433	0.27754	N	0.017994	T	0.36220	0.0959	L	0.36672	1.1	0.20638	N	0.999878	B	0.17667	0.023	B	0.24541	0.054	T	0.21655	-1.0239	9	0.26408	T	0.33	-15.5227	10.1674	0.42888	0.0:0.1322:0.5948:0.2731	.	56	Q8N5M9	JAGN1_HUMAN	N	56	.	ENSP00000306106:S56N	S	+	2	0	JAGN1	9909676	0.775000	0.28604	0.992000	0.48379	0.966000	0.64601	1.530000	0.36007	0.514000	0.28300	0.313000	0.20887	AGC	.		0.512	JAGN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250335.1	NM_032492	
APEH	327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49720689	49720689	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:49720689A>G	ENST00000296456.5	+	22	2513	c.2113A>G	c.(2113-2115)Agc>Ggc	p.S705G	AC099668.5_ENST00000563780.1_RNA|APEH_ENST00000438011.1_Missense_Mutation_p.S710G	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	705					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CTATCCCAAAAGCACCCACGC	0.557																																					p.S705G		.											.	APEH-91	0			c.A2113G						.						188.0	196.0	193.0					3																	49720689		2203	4300	6503	SO:0001583	missense	327	exon22			CCCAAAAGCACCC	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.2113A>G	3.37:g.49720689A>G	ENSP00000296456:p.Ser705Gly	Somatic	332	0		WXS	Illumina HiSeq	Phase_I	353	63	NM_001640	0	0	313	445	132	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	A	13.25	2.180168	0.38511	.	.	ENSG00000164062	ENST00000296456;ENST00000438011	T;T	0.32753	1.44;1.44	5.75	5.75	0.90469	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.129744	0.64402	D	0.000001	T	0.20129	0.0484	N	0.17278	0.47	0.37781	D	0.927029	B;B	0.10296	0.003;0.002	B;B	0.15052	0.012;0.006	T	0.08269	-1.0730	10	0.48119	T	0.1	-38.9892	10.7009	0.45926	0.9202:0.0:0.0798:0.0	.	710;705	C9JIF9;P13798	.;ACPH_HUMAN	G	705;710	ENSP00000296456:S705G;ENSP00000415862:S710G	ENSP00000296456:S705G	S	+	1	0	APEH	49695693	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.552000	0.53705	2.192000	0.70111	0.459000	0.35465	AGC	.		0.557	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
ACY1	95	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52022538	52022538	+	Splice_Site	SNP	A	A	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:52022538A>C	ENST00000404366.2	+	13	1067		c.e13-1		ACY1_ENST00000476854.1_Splice_Site|ACY1_ENST00000476351.1_Splice_Site|ACY1_ENST00000458031.2_Splice_Site|ACY1_ENST00000494103.1_Splice_Site|ABHD14A-ACY1_ENST00000463937.1_Splice_Site	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1						cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	CCTGTCCCTCAGAAGTGGATG	0.562																																					.		.											.	ACY1-154	0			c.817-2A>C						.						103.0	86.0	92.0					3																	52022538		2203	4300	6503	SO:0001630	splice_region_variant	95	exon12			TCCCTCAGAAGTG	L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.922-1A>C	3.37:g.52022538A>C		Somatic	72	0		WXS	Illumina HiSeq	Phase_I	74	17	NM_001198898	0	0	6	8	2	C9J6I6|C9J9D8|C9JWD4	Splice_Site	SNP	ENST00000404366.2	37	CCDS2844.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.321906	0.41096	.	.	ENSG00000114786;ENSG00000114786;ENSG00000114786;ENSG00000243989;ENSG00000243989;ENSG00000243989;ENSG00000243989	ENST00000458031;ENST00000463937;ENST00000232907;ENST00000476854;ENST00000476351;ENST00000494103;ENST00000404366	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0907	0.72192	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACY1;RP11-155D18.11	51997578	1.000000	0.71417	0.993000	0.49108	0.278000	0.26855	8.943000	0.92975	2.048000	0.60808	0.459000	0.35465	.	.		0.562	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349657.1	NM_000666	Intron
STAB1	23166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52554291	52554291	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:52554291C>A	ENST00000321725.6	+	52	5560	c.5484C>A	c.(5482-5484)tgC>tgA	p.C1828*		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1828	FAS1 6. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CTTTCTCCTGCAGCCGAACGC	0.632																																					p.C1828X		.											.	STAB1-139	0			c.C5484A						.						82.0	83.0	83.0					3																	52554291		2203	4300	6503	SO:0001587	stop_gained	23166	exon52			CTCCTGCAGCCGA	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5484C>A	3.37:g.52554291C>A	ENSP00000312946:p.Cys1828*	Somatic	165	0		WXS	Illumina HiSeq	Phase_I	160	17	NM_015136	0	0	0	0	0	A7E297|Q8IUH0|Q8IUH1|Q93072	Nonsense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	C	40	8.313466	0.98754	.	.	ENSG00000010327	ENST00000321725	.	.	.	6.07	0.741	0.18336	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.5698	0.22533	0.1187:0.5434:0.0:0.3378	.	.	.	.	X	1828	.	ENSP00000312946:C1828X	C	+	3	2	STAB1	52529331	0.999000	0.42202	0.997000	0.53966	0.055000	0.15305	0.493000	0.22451	0.463000	0.27118	-0.126000	0.14955	TGC	.		0.632	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	108110610	108110610	+	Silent	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:108110610G>A	ENST00000273353.3	-	38	5543	c.5487C>T	c.(5485-5487)tcC>tcT	p.S1829S		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1829						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CTCCTACCCTGGATTCTAGTT	0.473																																					p.S1829S		.											.	MYH15-73	0			c.C5487T						.						183.0	184.0	183.0					3																	108110610		1923	4132	6055	SO:0001819	synonymous_variant	22989	exon38			TACCCTGGATTCT	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5487C>T	3.37:g.108110610G>A		Somatic	207	0		WXS	Illumina HiSeq	Phase_I	213	38	NM_014981	0	0	0	0	0		Silent	SNP	ENST00000273353.3	37	CCDS43127.1																																																																																			.		0.473	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
FAM162A	26355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	122128621	122128621	+	Silent	SNP	C	C	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:122128621C>T	ENST00000477892.1	+	5	492	c.408C>T	c.(406-408)aaC>aaT	p.N136N	FAM162A_ENST00000232125.5_Silent_p.N126N	NM_014367.3	NP_055182.3	Q96A26	F162A_HUMAN	family with sequence similarity 162, member A	136					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to hypoxia (GO:0071456)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|transformed cell apoptotic process (GO:0006927)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6						CAAGCTTGAACTTAGAAAAGA	0.438																																					p.N136N		.											.	FAM162A-159	0			c.C408T						.						108.0	98.0	101.0					3																	122128621		1886	4118	6004	SO:0001819	synonymous_variant	26355	exon5			CTTGAACTTAGAA	AF191020	CCDS43139.1	3q21.1	2008-06-05	2008-06-05	2008-06-05	ENSG00000114023	ENSG00000114023			17865	protein-coding gene	gene with protein product		608017	"""chromosome 3 open reading frame 28"""	C3orf28		11085516	Standard	NM_014367		Approved	E2IG5	uc003eez.3	Q96A26	OTTHUMG00000159494	ENST00000477892.1:c.408C>T	3.37:g.122128621C>T		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	126	55	NM_014367	0	0	82	151	69	Q9NRN6|Q9UJX8	Silent	SNP	ENST00000477892.1	37	CCDS43139.1	.	.	.	.	.	.	.	.	.	.	C	6.587	0.476718	0.12521	.	.	ENSG00000114023	ENST00000440333	.	.	.	5.44	3.65	0.41850	.	.	.	.	.	T	0.64080	0.2566	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64732	-0.6338	5	0.72032	D	0.01	.	8.2172	0.31519	0.0:0.8217:0.0:0.1783	.	.	.	.	F	135	.	ENSP00000405770:L135F	L	+	1	0	FAM162A	123611311	0.995000	0.38212	1.000000	0.80357	0.745000	0.42441	1.364000	0.34171	0.857000	0.35407	0.655000	0.94253	CTT	.		0.438	FAM162A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355766.1	NM_014367	
PLXNA1	5361	broad.mit.edu	37	3	126730880	126730880	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:126730880A>C	ENST00000393409.2	+	9	2192	c.2192A>C	c.(2191-2193)aAc>aCc	p.N731T	PLXNA1_ENST00000251772.4_Missense_Mutation_p.N708T	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	731					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		GCCGCACGGAACCTGCCACAG	0.627																																					p.N731T													.	PLXNA1-93	0			c.A2192C						.						75.0	70.0	72.0					3																	126730880		2203	4300	6503	SO:0001583	missense	5361	exon9			CACGGAACCTGCC	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2192A>C	3.37:g.126730880A>C	ENSP00000377061:p.Asn731Thr	Somatic	109	13		WXS	Illumina HiSeq	Phase_I	93	14	NM_032242	0	0	9	10	1		Missense_Mutation	SNP	ENST00000393409.2	37	CCDS33847.2	.	.	.	.	.	.	.	.	.	.	A	16.79	3.221294	0.58560	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.16457	2.34;2.35	3.87	3.87	0.44632	.	0.000000	0.64402	D	0.000004	T	0.45377	0.1339	M	0.87547	2.89	0.58432	D	0.999999	D	0.89917	1.0	D	0.77557	0.99	T	0.54248	-0.8322	10	0.66056	D	0.02	.	12.8542	0.57876	1.0:0.0:0.0:0.0	.	731	Q9UIW2	PLXA1_HUMAN	T	731;708	ENSP00000377061:N731T;ENSP00000251772:N708T	ENSP00000251772:N708T	N	+	2	0	PLXNA1	128213570	1.000000	0.71417	0.996000	0.52242	0.313000	0.28021	7.309000	0.78937	1.633000	0.50488	0.402000	0.26972	AAC	.		0.627	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	142238533	142238533	+	Silent	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:142238533G>A	ENST00000350721.4	-	24	4481	c.4360C>T	c.(4360-4362)Cta>Tta	p.L1454L	ATR_ENST00000383101.3_Silent_p.L1390L	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1454					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TGAGGTTCTAGTATTTCCCGA	0.363								Other conserved DNA damage response genes																													p.L1454L		.											.	ATR-1139	0			c.C4360T						.						118.0	118.0	118.0					3																	142238533		2203	4300	6503	SO:0001819	synonymous_variant	545	exon24			GTTCTAGTATTTC	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.4360C>T	3.37:g.142238533G>A		Somatic	170	0		WXS	Illumina HiSeq	Phase_I	152	32	NM_001184	0	0	5	5	0	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	37	CCDS3124.1																																																																																			.		0.363	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
FXR1	8087	hgsc.bcm.edu	37	3	180693192	180693192	+	Splice_Site	SNP	G	G	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:180693192G>C	ENST00000357559.4	+	16	2079	c.1695G>C	c.(1693-1695)atG>atC	p.M565I	FXR1_ENST00000480918.1_Splice_Site_p.M552I|FXR1_ENST00000491062.1_Intron|FXR1_ENST00000445140.2_Intron|FXR1_ENST00000468861.1_Intron|FXR1_ENST00000305586.7_Splice_Site_p.M480I	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	565					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			AGAAAGAAATGGTAAGGAGAA	0.328																																					p.M565I		.											.	FXR1-153	0			c.G1695C						.						25.0	26.0	26.0					3																	180693192		2182	4290	6472	SO:0001630	splice_region_variant	8087	exon16			AGAAATGGTAAGG	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1695+1G>C	3.37:g.180693192G>C		Somatic	32	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_005087	0	0	2	2	0	A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	ENST00000357559.4	37	CCDS3238.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.11|12.11	1.840212|1.840212	0.32513|0.32513	.|.	.|.	ENSG00000114416|ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000480918|ENST00000482125	T;T;T|.	0.26373|.	1.93;1.74;1.74|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.453907|.	0.26987|.	N|.	0.021492|.	T|T	0.47303|0.47303	0.1438|0.1438	N|N	0.08118|0.08118	0|0	0.58432|0.58432	D|D	0.99999|0.99999	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.001;0.001|.	T|T	0.43523|0.43523	-0.9386|-0.9386	10|5	0.14252|.	T|.	0.57|.	-25.5339|-25.5339	19.2374|19.2374	0.93866|0.93866	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	552;509;565|.	B4DXZ6;E7ERF5;P51114|.	.;.;FXR1_HUMAN|.	I|S	565;480;552|193	ENSP00000350170:M565I;ENSP00000307633:M480I;ENSP00000418097:M552I|.	ENSP00000307633:M480I|.	M|W	+|+	3|2	0|0	FXR1|FXR1	182175886|182175886	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.220000|9.220000	0.95180|0.95180	2.550000|2.550000	0.86006|0.86006	0.609000|0.609000	0.83330|0.83330	ATG|TGG	.		0.328	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		Missense_Mutation
LNX1	84708	broad.mit.edu;bcgsc.ca	37	4	54362298	54362298	+	Silent	SNP	G	G	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr4:54362298G>A	ENST00000263925.7	-	6	1556	c.1242C>T	c.(1240-1242)ggC>ggT	p.G414G	LNX1-AS1_ENST00000502373.1_RNA|FIP1L1_ENST00000507166.1_Intron|LNX1_ENST00000306888.2_Silent_p.G318G	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	414	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			ATGCCACACCGCCATCCAGCA	0.502																																					p.G414G													.	LNX1-229	0			c.C1242T						.						159.0	135.0	143.0					4																	54362298		2203	4300	6503	SO:0001819	synonymous_variant	84708	exon6			CACACCGCCATCC	AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1242C>T	4.37:g.54362298G>A		Somatic	181	1		WXS	Illumina HiSeq	Phase_I	176	7	NM_001126328	0	0	2	2	0	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Silent	SNP	ENST00000263925.7	37	CCDS47057.1																																																																																			.		0.502	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
MARCH1	55016	broad.mit.edu	37	4	165118517	165118517	+	Intron	SNP	A	A	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr4:165118517A>G	ENST00000503008.1	-	2	864				MARCH1_ENST00000508725.1_Intron|MARCH1_ENST00000514618.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GCAATTGAAAAGGTCTAAGCT	0.433																																					p.L116P													.	ANP32C-90	0			c.T347C						.						160.0	159.0	159.0					4																	165118517		2203	4300	6503	SO:0001627	intron_variant	23520	exon1			TTGAAAAGGTCTA	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-85703T>C	4.37:g.165118517A>G		Somatic	165	0		WXS	Illumina HiSeq	Phase_I	209	3	NM_012403	0	0	162	162	0	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	CCDS54814.1																																																																																			.		0.433	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923	
SLC9A3	6550	hgsc.bcm.edu	37	5	475016	475016	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr5:475016A>G	ENST00000264938.3	-	16	2492	c.2483T>C	c.(2482-2484)cTc>cCc	p.L828P	CTD-2228K2.5_ENST00000342584.3_5'Flank|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.5_ENST00000510604.1_5'Flank|SLC9A3_ENST00000514375.1_Missense_Mutation_p.L819P|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.5_ENST00000510714.1_5'Flank	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	828					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GGACTCGGGGAGGGCGGCGGG	0.721																																					p.L828P		.											.	SLC9A3-90	0			c.T2483C						.						7.0	9.0	8.0					5																	475016		2156	4230	6386	SO:0001583	missense	6550	exon16			TCGGGGAGGGCGG		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2483T>C	5.37:g.475016A>G	ENSP00000264938:p.Leu828Pro	Somatic	16	1		WXS	Illumina HiSeq	Phase_I	12	2	NM_004174	0	0	14	14	0	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	A	3.598	-0.082275	0.07141	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.73897	-0.79;-0.79	4.4	-5.74	0.02391	.	10.822200	0.00447	N	0.000092	T	0.54935	0.1889	N	0.14661	0.345	0.09310	N	0.999998	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.43909	-0.9362	10	0.28530	T	0.3	.	7.8835	0.29635	0.3532:0.0:0.5187:0.1281	.	819;828	E9PF67;P48764	.;SL9A3_HUMAN	P	828;819	ENSP00000264938:L828P;ENSP00000422983:L819P	ENSP00000264938:L828P	L	-	2	0	SLC9A3	528016	0.003000	0.15002	0.000000	0.03702	0.014000	0.08584	-0.110000	0.10824	-1.517000	0.01780	-1.542000	0.00909	CTC	.		0.721	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
NIPAL4	348938	hgsc.bcm.edu	37	5	156899851	156899851	+	Silent	SNP	C	C	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr5:156899851C>T	ENST00000311946.7	+	6	1400	c.1284C>T	c.(1282-1284)ccC>ccT	p.P428P	ADAM19_ENST00000430702.2_Intron|NIPAL4_ENST00000435489.2_Silent_p.P409P	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4	428						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						CCCCTTCTCCCGCCCCGGAAC	0.512																																					p.P428P		.											.	NIPAL4-68	0			c.C1284T						.						40.0	39.0	40.0					5																	156899851		1923	4135	6058	SO:0001819	synonymous_variant	348938	exon6			TTCTCCCGCCCCG	AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.1284C>T	5.37:g.156899851C>T		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	59	4	NM_001099287	0	0	0	0	0	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	Silent	SNP	ENST00000311946.7	37	CCDS47328.1																																																																																			.		0.512	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373789.1	NM_001099287	
EHMT2	10919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31864742	31864742	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr6:31864742C>A	ENST00000375537.4	-	2	73	c.67G>T	c.(67-69)Gcg>Tcg	p.A23S	EHMT2_ENST00000395728.3_Missense_Mutation_p.A80S|EHMT2_ENST00000480912.1_5'Flank|EHMT2_ENST00000375528.4_Missense_Mutation_p.A80S|EHMT2_ENST00000375530.4_Missense_Mutation_p.A23S|C2_ENST00000469372.1_5'Flank	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	23					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						AGCAGCAGCGCCCCCATCTCA	0.637																																					p.A23S		.											.	EHMT2-91	0			c.G67T						.						129.0	130.0	130.0					6																	31864742		1511	2709	4220	SO:0001583	missense	10919	exon2			GCAGCGCCCCCAT	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.67G>T	6.37:g.31864742C>A	ENSP00000364687:p.Ala23Ser	Somatic	202	0		WXS	Illumina HiSeq	Phase_I	137	37	NM_025256	0	0	7	10	3	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673198	0.29693	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537	T;T;T;T	0.76968	-0.73;-1.06;-0.98;-0.68	3.79	1.93	0.25924	.	0.364320	0.20081	N	0.099658	T	0.38957	0.1060	N	0.08118	0	0.22531	N	0.999013	B;P;B;B	0.50819	0.03;0.939;0.05;0.03	B;B;B;B	0.43867	0.017;0.434;0.025;0.002	T	0.32798	-0.9893	10	0.51188	T	0.08	.	5.6198	0.17451	0.0:0.7389:0.0:0.261	.	80;23;23;23	A2ABF8;Q96KQ7-3;Q96KQ7-2;Q96KQ7	.;.;.;EHMT2_HUMAN	S	80;80;23;23	ENSP00000379078:A80S;ENSP00000364678:A80S;ENSP00000364680:A23S;ENSP00000364687:A23S	ENSP00000364678:A80S	A	-	1	0	EHMT2	31972721	1.000000	0.71417	1.000000	0.80357	0.248000	0.25809	1.196000	0.32198	0.735000	0.32537	-0.361000	0.07541	GCG	.		0.637	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
BRD2	6046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32945266	32945266	+	Silent	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr6:32945266T>C	ENST00000374825.4	+	8	2949	c.1248T>C	c.(1246-1248)gcT>gcC	p.A416A	BRD2_ENST00000443797.2_Silent_p.A296A|BRD2_ENST00000449085.2_Silent_p.A369A|BRD2_ENST00000395287.1_Silent_p.A416A|BRD2_ENST00000395289.2_Silent_p.A416A|BRD2_ENST00000374831.4_Silent_p.A416A	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	416	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						AGTTTGCTGCTGATGTACGGC	0.517																																					p.A416A		.											.	BRD2-398	0			c.T1248C						.						279.0	225.0	244.0					6																	32945266		1511	2708	4219	SO:0001819	synonymous_variant	6046	exon8			TGCTGCTGATGTA	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1248T>C	6.37:g.32945266T>C		Somatic	228	0		WXS	Illumina HiSeq	Phase_I	158	41	NM_005104	0	0	49	69	20	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Silent	SNP	ENST00000374825.4	37	CCDS4762.1	.	.	.	.	.	.	.	.	.	.	T	9.651	1.141473	0.21205	.	.	ENSG00000204256	ENST00000449025	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	T	0.55337	0.1914	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56360	-0.7992	4	.	.	.	-14.7189	13.1555	0.59514	0.0:0.0:0.0:1.0	.	.	.	.	P	422	.	.	L	+	2	0	BRD2	33053244	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.370000	0.20433	2.205000	0.71048	0.523000	0.50628	CTG	.		0.517	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	38913344	38913344	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr6:38913344T>C	ENST00000359357.3	+	78	11712	c.11458T>C	c.(11458-11460)Ttt>Ctt	p.F3820L	RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000449981.2_Missense_Mutation_p.F4037L|DNAH8_ENST00000441566.1_Missense_Mutation_p.F3784L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3820					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ACTTCCACAATTTGCAGAAAT	0.488																																					p.F4037L		.											.	DNAH8-615	0			c.T12109C						.						96.0	95.0	96.0					6																	38913344		2203	4300	6503	SO:0001583	missense	1769	exon80			CCACAATTTGCAG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.11458T>C	6.37:g.38913344T>C	ENSP00000352312:p.Phe3820Leu	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	114	35	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	T	26.7	4.762200	0.89932	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.10382	2.88;2.88;2.88	5.59	5.59	0.84812	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.30634	0.0771	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.20706	-1.0267	10	0.62326	D	0.03	.	15.7453	0.77936	0.0:0.0:0.0:1.0	.	3784;3820	Q96JB1-2;Q96JB1	.;DYH8_HUMAN	L	4025;4025;3820;3784	ENSP00000333363:F4025L;ENSP00000352312:F3820L;ENSP00000402294:F3784L	ENSP00000333363:F4025L	F	+	1	0	DNAH8	39021322	1.000000	0.71417	0.981000	0.43875	0.962000	0.63368	7.948000	0.87774	2.129000	0.65627	0.459000	0.35465	TTT	.		0.488	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
SLC35B2	347734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	44224125	44224125	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr6:44224125G>C	ENST00000393812.3	-	3	457	c.314C>G	c.(313-315)cCg>cGg	p.P105R	SLC35B2_ENST00000393810.1_Intron|SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000537814.1_Intron|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000538577.1_Intron	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	105					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTGCCACATCGGGGTGGTCTC	0.627																																					p.P105R		.											.	SLC35B2-91	0			c.C314G						.						58.0	67.0	64.0					6																	44224125		2203	4300	6503	SO:0001583	missense	347734	exon3			CACATCGGGGTGG	AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.314C>G	6.37:g.44224125G>C	ENSP00000377401:p.Pro105Arg	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	98	30	NM_178148	0	0	47	100	53	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	ENST00000393812.3	37	CCDS34462.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752871	0.31046	.	.	ENSG00000157593	ENST00000393812;ENST00000341553	T	0.30714	1.52	4.26	3.35	0.38373	.	0.419213	0.26176	N	0.025884	T	0.08935	0.0221	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.06826	-1.0805	10	0.22109	T	0.4	-29.8524	15.4721	0.75446	0.0:0.1512:0.8488:0.0	.	105	Q8TB61	S35B2_HUMAN	R	105	ENSP00000377401:P105R	ENSP00000342455:P105R	P	-	2	0	SLC35B2	44332103	1.000000	0.71417	0.889000	0.34880	0.859000	0.49053	7.270000	0.78493	2.191000	0.70037	0.561000	0.74099	CCG	.		0.627	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2		
MOXD1	26002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	132694134	132694134	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr6:132694134A>C	ENST00000367963.3	-	3	532	c.414T>G	c.(412-414)gaT>gaG	p.D138E	MOXD1_ENST00000336749.3_Missense_Mutation_p.D70E	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	138	DOMON. {ECO:0000255|PROSITE- ProRule:PRU00246}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		TCACAGTGCTATCCTGGGGAT	0.458																																					p.D138E		.											.	MOXD1-515	0			c.T414G						.						100.0	89.0	92.0					6																	132694134		2203	4300	6503	SO:0001583	missense	26002	exon3			AGTGCTATCCTGG	AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.414T>G	6.37:g.132694134A>C	ENSP00000356940:p.Asp138Glu	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	103	31	NM_015529	0	0	0	0	0	Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Missense_Mutation	SNP	ENST00000367963.3	37	CCDS5152.2	.	.	.	.	.	.	.	.	.	.	A	4.845	0.157121	0.09236	.	.	ENSG00000079931	ENST00000367963;ENST00000336749	T;T	0.77750	-1.12;-1.12	5.3	0.0261	0.14148	DOMON domain (3);	0.440036	0.24074	N	0.041793	T	0.17195	0.0413	N	0.02129	-0.67	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.37842	-0.9688	10	0.02654	T	1	-26.2778	1.3667	0.02202	0.1886:0.3795:0.1103:0.3217	.	138;70	Q6UVY6;Q6UVY6-2	MOXD1_HUMAN;.	E	138;70	ENSP00000356940:D138E;ENSP00000336998:D70E	ENSP00000336998:D70E	D	-	3	2	MOXD1	132735827	0.665000	0.27466	0.999000	0.59377	0.974000	0.67602	-0.336000	0.07863	0.084000	0.17077	0.528000	0.53228	GAT	.		0.458	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000125837.1	NM_015529	
TXLNB	167838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	139563747	139563747	+	Silent	SNP	T	T	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr6:139563747T>C	ENST00000358430.3	-	10	2203	c.1971A>G	c.(1969-1971)gcA>gcG	p.A657A	RP1-225E12.3_ENST00000585874.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	657						cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		CCTCTGCTGCTGCTCGTGGGG	0.642																																					p.A657A		.											.	TXLNB-91	0			c.A1971G						.						47.0	53.0	51.0					6																	139563747		2203	4300	6503	SO:0001819	synonymous_variant	167838	exon10			TGCTGCTGCTCGT		CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1971A>G	6.37:g.139563747T>C		Somatic	142	0		WXS	Illumina HiSeq	Phase_I	131	42	NM_153235	0	0	0	0	0	Q5VTF3|Q76L25|Q86T52|Q8N3S2	Silent	SNP	ENST00000358430.3	37	CCDS34545.1																																																																																			.		0.642	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235	
PHF10	55274	ucsc.edu	37	6	170117955	170117955	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr6:170117955C>A	ENST00000339209.4	-	4	496	c.373G>T	c.(373-375)Gag>Tag	p.E125*	PHF10_ENST00000366780.4_Nonsense_Mutation_p.E123*|PHF10_ENST00000464779.1_5'UTR	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	125	Essential to induce neural progenitor proliferation. {ECO:0000250}.|SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		ACATTTAGCTCTCTCAGGTAG	0.333																																					p.E125X													.	PHF10-226	0			c.G373T						.						48.0	44.0	45.0					6																	170117955		2202	4299	6501	SO:0001587	stop_gained	55274	exon4			TTAGCTCTCTCAG	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.373G>T	6.37:g.170117955C>A	ENSP00000341805:p.Glu125*	Somatic	52	0		WXS	Illumina HiSeq		42	4	NM_018288	0	0	36	36	0	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Nonsense_Mutation	SNP	ENST00000339209.4	37	CCDS5308.2	.	.	.	.	.	.	.	.	.	.	C	32	5.117991	0.94385	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-31.5125	19.3504	0.94381	0.0:1.0:0.0:0.0	.	.	.	.	X	123;125	.	ENSP00000341805:E125X	E	-	1	0	PHF10	169859880	1.000000	0.71417	0.967000	0.41034	0.871000	0.50021	7.211000	0.77933	2.885000	0.99019	0.655000	0.94253	GAG	.		0.333	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
TWISTNB	221830	ucsc.edu	37	7	19738032	19738032	+	Silent	SNP	C	C	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr7:19738032C>T	ENST00000222567.5	-	4	994	c.924G>A	c.(922-924)aaG>aaA	p.K308K		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	308	Lys-rich.				transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						TCTTTTTTTTCTTTTTATGGT	0.378																																					p.K308K													.	TWISTNB-91	0			c.G924A						.						113.0	126.0	122.0					7																	19738032		2200	4298	6498	SO:0001819	synonymous_variant	221830	exon4			TTTTTTCTTTTTA	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.924G>A	7.37:g.19738032C>T		Somatic	241	3		WXS	Illumina HiSeq		304	1	NM_001002926	0	0	29	33	4	A0PJ45|B7Z724	Silent	SNP	ENST00000222567.5	37	CCDS34606.1																																																																																			.		0.378	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1		
HOXA10	3206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	27211695	27211695	+	Silent	SNP	C	C	T			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr7:27211695C>T	ENST00000283921.4	-	2	1055	c.1056G>A	c.(1054-1056)gaG>gaA	p.E352E	RP1-170O19.20_ENST00000465941.1_Intron|RP1-170O19.20_ENST00000470747.4_Intron|HOXA-AS4_ENST00000519935.1_RNA|HOXA10_ENST00000521421.1_5'UTR|HOXA-AS4_ENST00000523790.1_RNA|HOXA-AS4_ENST00000519694.1_RNA|HOXA10_ENST00000396344.4_Silent_p.E36E|HOXA9_ENST00000497089.1_5'Flank|MIR196B_ENST00000384852.1_RNA	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10	352					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						GAAACTCCTTCTCCAGCTCCA	0.532																																					p.E352E		.											.	HOXA10-68	0			c.G1056A						.						111.0	105.0	107.0					7																	27211695		2203	4300	6503	SO:0001819	synonymous_variant	3206	exon2			CTCCTTCTCCAGC		CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.1056G>A	7.37:g.27211695C>T		Somatic	130	0		WXS	Illumina HiSeq	Phase_I	182	80	NM_018951	0	0	17	52	35	O43370|O43605|Q15949|Q504T1	Silent	SNP	ENST00000283921.4	37	CCDS5410.2																																																																																			.		0.532	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358724.2		
NRG1	3084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	32463201	32463201	+	Splice_Site	SNP	G	G	A	rs78513616		TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr8:32463201G>A	ENST00000405005.3	+	3	400	c.400G>A	c.(400-402)Gag>Aag	p.E134K	NRG1_ENST00000356819.4_Splice_Site_p.E134K|NRG1_ENST00000519301.1_Splice_Site_p.A113T|NRG1_ENST00000287845.5_Splice_Site_p.A134T|NRG1_ENST00000521670.1_Splice_Site_p.E134K|NRG1_ENST00000338921.4_Splice_Site_p.E134K|NRG1_ENST00000523079.1_Splice_Site_p.E134K|NRG1_ENST00000287842.3_Splice_Site_p.E134K|NRG1_ENST00000520407.1_Splice_Site_p.A349T|NRG1_ENST00000341377.5_Splice_Site_p.E134K			Q02297	NRG1_HUMAN	neuregulin 1	134					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GGAATCAAACGGTAAGAGATA	0.398																																					p.A349T		.											.	NRG1-525	0			c.G1045A						.	G	LYS/GLU,LYS/GLU,THR/ALA,LYS/GLU,LYS/GLU,THR/ALA,THR/ALA,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU,THR/ALA,LYS/GLU	0,4406		0,0,2203	143.0	129.0	134.0		337,337,337,400,400,400,400,400,400,400,400,400,400,1045,400	5.0	1.0	8	dbSNP_131	134	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice	NRG1	NM_001159995.1,NM_001159999.1,NM_001160001.1,NM_001160002.1,NM_001160004.1,NM_001160005.1,NM_001160007.1,NM_001160008.1,NM_004495.3,NM_013956.3,NM_013957.3,NM_013958.3,NM_013960.3,NM_013962.2,NM_013964.3	56,56,58,56,56,58,58,56,56,56,56,56,56,58,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	113/608,113/625,113/591,134/195,134/460,134/208,134/178,134/421,134/212,134/646,134/638,134/242,134/463,349/423,134/641	32463201	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	3084	exon3			TCAAACGGTAAGA	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.400+1G>A	8.37:g.32463201G>A		Somatic	161	0		WXS	Illumina HiSeq	Phase_I	123	21	NM_013962	0	0	0	0	0	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.01|13.01	2.108806|2.108806	0.37242|0.37242	0.0|0.0	1.16E-4|1.16E-4	ENSG00000157168|ENSG00000157168	ENST00000519301;ENST00000520407;ENST00000287845|ENST00000518104;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000341377;ENST00000287842;ENST00000405005;ENST00000521670	T;T;T|T;T;T;T;T;T;T;T;T;T	0.75260|0.39997	-0.92;-0.83;-0.49|1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05	5.03|5.03	5.03|5.03	0.67393|0.67393	.|Immunoglobulin-like fold (1);	.|0.695834	.|0.14318	.|N	.|0.327222	T|T	0.54013|0.54013	0.1832|0.1832	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	B;B;B|P;P;P;P;D;P;P;P;P;D	0.32071|0.59767	0.355;0.11;0.22|0.76;0.776;0.614;0.76;0.986;0.733;0.589;0.857;0.863;0.964	B;B;B|B;B;B;B;D;B;B;B;B;P	0.23852|0.68192	0.049;0.01;0.016|0.038;0.079;0.053;0.038;0.956;0.077;0.054;0.165;0.115;0.454	T|T	0.38478|0.38478	-0.9659|-0.9659	9|10	0.02654|0.24483	T|T	1|0.36	-3.1604|-3.1604	16.914|16.914	0.86147|0.86147	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	134;133;349|134;134;133;134;134;134;134;134;134;134	F8W9E3;B0FWZ3;Q02297-9|E9PHH4;Q7RTW4;B0FYA9;B7Z4Z3;Q02297-4;Q02297-7;Q02297;Q02297-6;Q02297-3;Q02297-8	.;.;.|.;.;.;.;.;.;NRG1_HUMAN;.;.;.	T|K	113;349;134|113;202;134;134;134;134;134;134;134;134	ENSP00000429582:A113T;ENSP00000434640:A349T;ENSP00000287845:A134T|ENSP00000430053:E113K;ENSP00000429067:E202K;ENSP00000430120:E134K;ENSP00000343395:E134K;ENSP00000349275:E134K;ENSP00000287840:E134K;ENSP00000340497:E134K;ENSP00000287842:E134K;ENSP00000384620:E134K;ENSP00000428828:E134K	ENSP00000287845:A134T|ENSP00000287840:E134K	A|E	+|+	1|1	0|0	NRG1|NRG1	32582743|32582743	1.000000|1.000000	0.71417|0.71417	0.953000|0.953000	0.39169|0.39169	0.154000|0.154000	0.21943|0.21943	6.210000|6.210000	0.72176|0.72176	2.485000|2.485000	0.83878|0.83878	0.650000|0.650000	0.86243|0.86243	GCT|GAG	G|1.000;A|0.000		0.398	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		Missense_Mutation
GPR124	25960	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	37692907	37692907	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr8:37692907C>G	ENST00000412232.2	+	12	1837	c.1824C>G	c.(1822-1824)ttC>ttG	p.F608L	GPR124_ENST00000315215.7_Intron	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	608					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGTCGTCCTTCCACATCAAGG	0.682																																					p.F608L		.											.	GPR124-157	0			c.C1824G						.						19.0	23.0	22.0					8																	37692907		2201	4298	6499	SO:0001583	missense	25960	exon12			GTCCTTCCACATC	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1824C>G	8.37:g.37692907C>G	ENSP00000406367:p.Phe608Leu	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	29	11	NM_032777	0	0	0	0	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	C	7.845	0.722846	0.15439	.	.	ENSG00000020181	ENST00000416514;ENST00000412232	T	0.53857	0.6	5.29	1.44	0.22558	.	0.251562	0.38778	N	0.001564	T	0.36963	0.0986	N	0.17474	0.49	0.47698	D	0.999493	D	0.62365	0.991	P	0.51266	0.664	T	0.25745	-1.0123	10	0.06625	T	0.88	-18.4995	9.5253	0.39160	0.0:0.7051:0.0:0.2949	.	608	Q96PE1	GP124_HUMAN	L	601;608	ENSP00000406367:F608L	ENSP00000406367:F608L	F	+	3	2	GPR124	37812065	1.000000	0.71417	0.905000	0.35620	0.440000	0.31957	1.327000	0.33746	0.231000	0.21079	-0.140000	0.14226	TTC	.		0.682	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
GAPVD1	26130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	128121733	128121733	+	Missense_Mutation	SNP	G	G	A	rs374403416		TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr9:128121733G>A	ENST00000495955.1	+	26	4350	c.4060G>A	c.(4060-4062)Gta>Ata	p.V1354I	GAPVD1_ENST00000394105.2_Missense_Mutation_p.V1363I|GAPVD1_ENST00000394104.2_Missense_Mutation_p.V1354I|GAPVD1_ENST00000265956.4_Missense_Mutation_p.V1328I|GAPVD1_ENST00000470056.1_Missense_Mutation_p.V1309I|GAPVD1_ENST00000312123.9_Missense_Mutation_p.V1315I|GAPVD1_ENST00000297933.6_Missense_Mutation_p.V1336I|GAPVD1_ENST00000394083.2_Missense_Mutation_p.V1288I			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1354	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						ATTGTCTAAAGTAGTGACTGC	0.358																																					p.V1363I		.											.	GAPVD1-93	0			c.G4087A						.	G	ILE/VAL	0,4406		0,0,2203	140.0	141.0	141.0		4087	6.2	1.0	9		141	1,8599	1.2+/-3.3	0,1,4299	no	missense	GAPVD1	NM_015635.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1363/1488	128121733	1,13005	2203	4300	6503	SO:0001583	missense	26130	exon25			TCTAAAGTAGTGA		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.4060G>A	9.37:g.128121733G>A	ENSP00000419063:p.Val1354Ile	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	158	35	NM_015635	0	0	17	26	9	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	37		.	.	.	.	.	.	.	.	.	.	G	26.2	4.716877	0.89205	0.0	1.16E-4	ENSG00000165219	ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000297933;ENST00000312123;ENST00000438537	T;T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56	6.17	6.17	0.99709	Vacuolar sorting protein 9 (1);	0.000000	0.85682	D	0.000000	T	0.33352	0.0860	N	0.22421	0.69	0.80722	D	1	B;B;B;B;B;B	0.30870	0.118;0.23;0.298;0.298;0.298;0.188	B;B;B;B;B;B	0.42692	0.113;0.082;0.225;0.395;0.225;0.277	T	0.05194	-1.0900	10	0.25106	T	0.35	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	1354;369;1309;1315;1336;1363	Q14C86;B3KTX2;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	GAPD1_HUMAN;.;.;.;.;.	I	1309;1363;1354;1328;1288;1354;1336;1315;47	ENSP00000419767:V1309I;ENSP00000377665:V1363I;ENSP00000377664:V1354I;ENSP00000265956:V1328I;ENSP00000377645:V1288I;ENSP00000419063:V1354I;ENSP00000297933:V1336I;ENSP00000309582:V1315I	ENSP00000265956:V1328I	V	+	1	0	GAPVD1	127161554	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GTA	.		0.358	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
KDM5D	8284	hgsc.bcm.edu	37	Y	21901510	21901510	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chrY:21901510A>C	ENST00000317961.4	-	6	832	c.561T>G	c.(559-561)gaT>gaG	p.D187E	KDM5D_ENST00000541639.1_Missense_Mutation_p.D187E|KDM5D_ENST00000382806.2_Missense_Mutation_p.D130E	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	187					histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	TGTATTCCTTATCTTTTACCT	0.413																																					p.D187E		.											.	KDM5D-560	0			c.T561G						.						97.0	112.0	108.0					Y																	21901510		597	1932	2529	SO:0001583	missense	8284	exon6			TTCCTTATCTTTT	U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.561T>G	Y.37:g.21901510A>C	ENSP00000322408:p.Asp187Glu	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	15	5	NM_001146705	0	0	0	4	4	A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Missense_Mutation	SNP	ENST00000317961.4	37	CCDS14794.1																																																																																			.		0.413	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1	NM_004653	
AHNAK	79026	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	62293750	62293750	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr11:62293750delG	ENST00000378024.4	-	5	8413	c.8139delC	c.(8137-8139)gacfs	p.D2713fs	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2713					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCAGGTTTAAGTCAATATCAG	0.463																																					p.D2713fs		.											.	AHNAK-109	0			c.8139delC						.						195.0	192.0	193.0					11																	62293750		2202	4299	6501	SO:0001589	frameshift_variant	79026	exon5			.	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.8139delC	11.37:g.62293750delG	ENSP00000367263:p.Asp2713fs	Somatic	343	0		WXS	Illumina HiSeq	Phase_I	260	83	NM_001620	0	0	0	0	0	A1A586	Frame_Shift_Del	DEL	ENST00000378024.4	37	CCDS31584.1																																																																																			.		0.463	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
CASC5	57082	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	40914067	40914068	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr15:40914067_40914068delTT	ENST00000346991.5	+	11	2073_2074	c.1683_1684delTT	c.(1681-1686)aattgtfs	p.NC561fs	CASC5_ENST00000527044.1_3'UTR|CASC5_ENST00000399668.2_Frame_Shift_Del_p.NC535fs			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	561	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TGAATGTAAATTGTAACTCAGT	0.371																																					p.561_562del		.											.	CASC5-660	0			c.1683_1684del						.																																			SO:0001589	frameshift_variant	57082	exon11			.	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1683_1684delTT	15.37:g.40914067_40914068delTT	ENSP00000335463:p.Asn561fs	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	65	21	NM_170589	0	0	0	0	0	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Frame_Shift_Del	DEL	ENST00000346991.5	37	CCDS42023.1																																																																																			.		0.371	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
SPTBN5	51332	broad.mit.edu	37	15	42178141	42178141	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr15:42178141delG	ENST00000320955.6	-	7	1539	c.1312delC	c.(1312-1314)cggfs	p.R438fs		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	438					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		AAACTCTCCCGGAGGGCTGCC	0.667																																					p.R403fs													.	SPTBN5-91	0			c.1207delC						.						13.0	14.0	14.0					15																	42178141		1868	4084	5952	SO:0001589	frameshift_variant	51332	exon7			TCTCCCGGAGGGC	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.1312delC	15.37:g.42178141delG	ENSP00000317790:p.Arg438fs	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_016642	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000320955.6	37																																																																																				.		0.667	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
DNMT1	1786	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	10250732	10250732	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr19:10250732delA	ENST00000340748.4	-	32	3983	c.3748delT	c.(3748-3750)tccfs	p.S1250fs	DNMT1_ENST00000359526.4_Frame_Shift_Del_p.S1266fs|DNMT1_ENST00000540357.1_Frame_Shift_Del_p.S1250fs|DNMT1_ENST00000589538.1_Intron			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	1250	Catalytic.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.|SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CTGAGGAAGGAAACCACCAGA	0.612																																					p.S1266fs		.											.	DNMT1-660	0			c.3796delT						.						39.0	40.0	40.0					19																	10250732		2203	4300	6503	SO:0001589	frameshift_variant	1786	exon33			.	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.3748delT	19.37:g.10250732delA	ENSP00000345739:p.Ser1250fs	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	51	10	NM_001130823	0	0	0	0	0	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Frame_Shift_Del	DEL	ENST00000340748.4	37	CCDS12228.1																																																																																			.		0.612	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
TMED1	11018	hgsc.bcm.edu	37	19	10945675	10945687	+	Frame_Shift_Del	DEL	CCTCCTCGTCATC	CCTCCTCGTCATC	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	CCTCCTCGTCATC	CCTCCTCGTCATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr19:10945675_10945687delCCTCCTCGTCATC	ENST00000214869.2	-	3	486_498	c.388_400delGATGACGAGGAGG	c.(388-402)gatgacgaggaggtcfs	p.DDEEV130fs	C19orf38_ENST00000592854.1_5'Flank|TMED1_ENST00000588289.1_5'UTR|TMED1_ENST00000591695.1_Intron	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	130					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						CATCCTTCGACCTCCTCGTCATCCTGGAGGCTG	0.568																																					p.130_134del		.											.	TMED1-155	0			c.388_400del						.																																			SO:0001589	frameshift_variant	11018	exon3			.	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.388_400delGATGACGAGGAGG	19.37:g.10945675_10945687delCCTCCTCGTCATC	ENSP00000214869:p.Asp130fs	Somatic	190	0		WXS	Illumina HiSeq	Phase_I	134	21	NM_006858	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000214869.2	37	CCDS12249.1																																																																																			.		0.568	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
ZNF776	284309	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	58265245	58265245	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr19:58265245delT	ENST00000317178.5	+	3	1010	c.747delT	c.(745-747)aatfs	p.N249fs		NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	249					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		GCAAAAGTAATAGTTTTAATA	0.413																																					p.N249fs		.											.	ZNF776-91	0			c.747delT						.						63.0	64.0	64.0					19																	58265245		2203	4300	6503	SO:0001589	frameshift_variant	284309	exon3			.	AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.747delT	19.37:g.58265245delT	ENSP00000321812:p.Asn249fs	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	65	17	NM_173632	0	0	0	0	0	Q6ZS36|Q8N968	Frame_Shift_Del	DEL	ENST00000317178.5	37	CCDS12962.2																																																																																			.		0.413	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346722.2	NM_173632	
MAP3K7CL	56911	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	30547133	30547133	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr21:30547133delT	ENST00000399947.2	+	9	926	c.649delT	c.(649-651)ttgfs	p.L217fs	MAP3K7CL_ENST00000399926.1_Frame_Shift_Del_p.L117fs|MAP3K7CL_ENST00000545939.1_Frame_Shift_Del_p.L111fs|MAP3K7CL_ENST00000286791.5_3'UTR|MAP3K7CL_ENST00000341618.4_Frame_Shift_Del_p.L217fs|MAP3K7CL_ENST00000399935.2_Frame_Shift_Del_p.L117fs|MAP3K7CL_ENST00000339024.4_Frame_Shift_Del_p.L117fs|MAP3K7CL_ENST00000399934.1_Frame_Shift_Del_p.L117fs|MAP3K7CL_ENST00000399928.1_Frame_Shift_Del_p.L117fs|MAP3K7CL_ENST00000399925.1_Frame_Shift_Del_p.L117fs	NM_020152.2	NP_064537.1	P57077	M3KCL_HUMAN	MAP3K7 C-terminal like	217						cytosol (GO:0005829)|nucleus (GO:0005634)											GAATCGGACGTTGAGGTTGGC	0.488																																					p.L217X		.											.	.	0			c.649delT						.						115.0	106.0	109.0					21																	30547133		2203	4300	6503	SO:0001589	frameshift_variant	56911	exon9			.	AF269161	CCDS13584.1, CCDS68182.1, CCDS74775.1	21q22.3	2013-02-22	2013-02-22	2013-02-22	ENSG00000156265	ENSG00000156265			16457	protein-coding gene	gene with protein product		611110	"""chromosome 21 open reading frame 7"""	C21orf7			Standard	NM_020152		Approved	TAKL, TAK1L, TAKL-1, TAKL-2, TAKL-4	uc002ynf.3	P57077	OTTHUMG00000078806	ENST00000399947.2:c.649delT	21.37:g.30547133delT	ENSP00000382828:p.Leu217fs	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	65	19	NM_020152	0	0	0	0	0	D3DSE0|Q8TCL9	Nonsense_Mutation	DEL	ENST00000399947.2	37	CCDS13584.1																																																																																			.		0.488	MAP3K7CL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000171865.2	NM_020152	
DAG1	1605	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	49568641	49568641	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr3:49568641delA	ENST00000539901.1	+	3	1255	c.697delA	c.(697-699)aacfs	p.N233fs	DAG1_ENST00000538711.1_Frame_Shift_Del_p.N233fs|DAG1_ENST00000545947.1_Frame_Shift_Del_p.N233fs|DAG1_ENST00000308775.2_Frame_Shift_Del_p.N233fs|DAG1_ENST00000515359.2_Frame_Shift_Del_p.N233fs|DAG1_ENST00000541308.1_Frame_Shift_Del_p.N233fs	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	233	Required for laminin recognition.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GGTGGTGAATAACAGACTATT	0.522																																					p.N233fs		.											.	DAG1-92	0			c.697delA						.						72.0	77.0	75.0					3																	49568641		2203	4300	6503	SO:0001589	frameshift_variant	1605	exon4			.	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.697delA	3.37:g.49568641delA	ENSP00000439334:p.Asn233fs	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	49	10	NM_001177642	0	0	0	0	0	A8K6M7|Q969J9	Frame_Shift_Del	DEL	ENST00000539901.1	37	CCDS2799.1																																																																																			.		0.522	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1		
N4BP2	55728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	40122970	40122970	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr4:40122970delA	ENST00000261435.6	+	9	3655	c.3239delA	c.(3238-3240)gaafs	p.E1080fs		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1080					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						TTTGTTGAAGAAAGTGAGCTT	0.338																																					p.E1080fs		.											.	N4BP2-602	0			c.3239delA						.						75.0	81.0	79.0					4																	40122970		2201	4300	6501	SO:0001589	frameshift_variant	55728	exon9			.	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.3239delA	4.37:g.40122970delA	ENSP00000261435:p.Glu1080fs	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	96	25	NM_018177	0	0	0	0	0	A0AVR3|Q9NVK2|Q9P2D4	Frame_Shift_Del	DEL	ENST00000261435.6	37	CCDS3457.1																																																																																			.		0.338	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
MRPL2	51069	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	43023807	43023820	+	Splice_Site	DEL	GCCATCTCTCACCT	GCCATCTCTCACCT	-			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	GCCATCTCTCACCT	GCCATCTCTCACCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr6:43023807_43023820delGCCATCTCTCACCT	ENST00000388752.3	-	4	943_945	c.519_521delAGGTGAGAGATGGC	c.(517-522)gcaggt>gct	p.G174fs	MRPL2_ENST00000489623.1_Intron|CUL7_ENST00000265348.3_5'Flank|CUL7_ENST00000535468.1_5'Flank|MRPL2_ENST00000230413.5_Splice_Site_p.G174fs	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2	174					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		ACATCTGGTAGCCATCTCTCACCTGCCATTCGGC	0.533																																					p.173_174del		.											.	MRPL2-90	0			c.519_520del						.																																			SO:0001630	splice_region_variant	51069	exon4			.	AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.520+1AGGTGAGAGATGGC>-	6.37:g.43023807_43023820delGCCATCTCTCACCT		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	45	11	NM_015950	0	0	0	0	0	B2RC56|Q8WUL1|Q96Q56|Q9Y311	Frame_Shift_Del	DEL	ENST00000388752.3	37	CCDS34454.1																																																																																			.		0.533	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040577.2		Frame_Shift_Del
PON2	5445	broad.mit.edu	37	7	95035516	95035516	+	Frame_Shift_Del	DEL	G	G	-	rs77619496		TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr7:95035516delG	ENST00000222572.3	-	8	1067	c.821delC	c.(820-822)cctfs	p.P274fs	PON2_ENST00000433091.2_Frame_Shift_Del_p.P262fs|PON2_ENST00000483292.1_5'UTR|PON2_ENST00000536183.1_Frame_Shift_Del_p.P295fs			Q15165	PON2_HUMAN	paraoxonase 2	274					aromatic compound catabolic process (GO:0019439)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arylesterase activity (GO:0004064)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_cancers(62;9.35e-11)|all_epithelial(64;3.37e-09)		STAD - Stomach adenocarcinoma(171;0.0151)			CCCCGAGGAAGGATCAATAGA	0.398																																					p.P274fs	GBM(42;803 823 13649 23368 31463)												.	PON2-90	0			c.821delC						.						128.0	128.0	128.0					7																	95035516		2203	4300	6503	SO:0001589	frameshift_variant	5445	exon8			GAGGAAGGATCAA	M63012, AF001601	CCDS5640.1, CCDS47644.1	7q21.3	2014-03-14			ENSG00000105854	ENSG00000105854	3.1.1.2	"""Paraoxonases"""	9205	protein-coding gene	gene with protein product	"""paraoxonase nirs"", ""arylesterase 2"""	602447				8661009, 9714608	Standard	XM_005250453		Approved		uc003unv.3	Q15165	OTTHUMG00000153948	ENST00000222572.3:c.821delC	7.37:g.95035516delG	ENSP00000222572:p.Pro274fs	Somatic	182	0		WXS	Illumina HiSeq	Phase_I	246	13	NM_000305	0	0	0	0	0	A4D1H7|B2RCP9|B4DJD5|O15114|O15115|O75856|Q5FBX7|Q86YL0	Frame_Shift_Del	DEL	ENST00000222572.3	37	CCDS5640.1																																																																																			.		0.398	PON2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333142.1	NM_000305	
KDM3A	55818	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	86716748	86716749	+	In_Frame_Ins	INS	-	-	GGG			TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr2:86716748_86716749insGGG	ENST00000409556.1	+	24	3904_3905	c.3539_3540insGGG	c.(3538-3543)aaggac>aaGGGggac	p.1180_1181KD>KGD	KDM3A_ENST00000312912.5_In_Frame_Ins_p.1180_1181KD>KGD|KDM3A_ENST00000542128.1_In_Frame_Ins_p.1128_1129KD>KGD|KDM3A_ENST00000409064.1_In_Frame_Ins_p.1180_1181KD>KGD			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	1180	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						TATGCTGCAAAGGACACGGAGA	0.406																																					p.K1180delinsKG	NSCLC(96;1150 1523 6936 46253 49736)	.											.	KDM3A-291	0			c.3539_3540insGGG						.																																			SO:0001652	inframe_insertion	55818	exon23			.	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	Exception_encountered	2.37:g.86716748_86716749insGGG	ENSP00000386660:p.Lys1180_Asp1181insGly	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	131	51	NM_018433	0	0	0	0	0	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	In_Frame_Ins	INS	ENST00000409556.1	37	CCDS1990.1																																																																																			.		0.406	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
CFHR3	10878	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	196762616	196762617	+	Missense_Mutation	DNP	GA	GA	TT	rs149081467	byFrequency	TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr1:196762616_196762617GA>TT	ENST00000367425.4	+	6	1058_1059	c.966_967GA>TT	c.(964-969)ggGAta>ggTTta	p.I323L	CFHR3_ENST00000391985.3_Missense_Mutation_p.I262L	NM_021023.5	NP_066303.2	Q02985	FHR3_HUMAN	complement factor H-related 3	323	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18						GTCGGGAAGGGATAGTGGAATA	0.381																																					p.I323L		.											.	CFHR3	0			c.A967T						.																																			SO:0001583	missense	10878	exon6			GAAGGGATAGTGG	X68679	CCDS30958.1, CCDS53453.1	1q32	2014-09-17		2006-02-28	ENSG00000116785	ENSG00000116785		"""Complement system"""	16980	protein-coding gene	gene with protein product	"""complement factor H related 3"""	605336		CFHL3		8428964, 10380701	Standard	NM_021023		Approved	FHR-3, HLF4, FHR3, DOWN16	uc001gtl.3	Q02985	OTTHUMG00000035929	Exception_encountered	1.37:g.196762616_196762617delinsTT	ENSP00000356395:p.Ile323Leu	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	9.0		0	0	0	0	0	B4DPR0|Q9UJ16	Missense_Mutation	DNP	ENST00000367425.4	37	CCDS30958.1																																																																																			.		0.381	CFHR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087505.2	NM_021023	
CSF2RB	1439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37334445	37334446	+	Missense_Mutation	DNP	GC	GC	TT	rs554053520		TCGA-G7-7502-01A-11D-2201-08	TCGA-G7-7502-10A-01D-2201-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea718e65-433a-4e16-82fc-4f8e5be936af	2c767e98-3e53-4915-a687-2e67bc2cedc5	g.chr22:37334445_37334446GC>TT	ENST00000403662.3	+	14	2817_2818	c.2595_2596GC>TT	c.(2593-2598)gtGCcc>gtTTcc	p.P866S	CSF2RB_ENST00000262825.5_Missense_Mutation_p.P872S|CSF2RB_ENST00000536485.1_Missense_Mutation_p.P813S|CSF2RB_ENST00000406230.1_Missense_Mutation_p.P872S			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	866					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	GCCAGGCTGTGCCCCAGGTGCC	0.589																																					p.P872S		.											.	CSF2RB	0			c.C2596T						.																																			SO:0001583	missense	1439	exon14			GCTGTGCCCCAGG	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	Exception_encountered	22.37:g.37334445_37334446delinsTT	ENSP00000384053:p.Pro866Ser	Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	38.0		0	0	0	0	0	Q5JZI1|Q6ICE0	Missense_Mutation	DNP	ENST00000403662.3	37	CCDS13936.1																																																																																			.		0.589	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395	
