#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF2	65122	hgsc.bcm.edu	37	1	12919095	12919095	+	Silent	SNP	A	A	C	rs116865587	byFrequency	TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:12919095A>C	ENST00000240189.2	+	2	318	c.231A>C	c.(229-231)ccA>ccC	p.P77P		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	77					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATCTGGAGCCATTGAAAGCAT	0.557																																					p.P77P		.											.	PRAMEF2-68	0			c.A231C						.						165.0	177.0	173.0					1																	12919095		2201	4296	6497	SO:0001819	synonymous_variant	65122	exon2			GGAGCCATTGAAA		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.231A>C	1.37:g.12919095A>C		Somatic	153	1		WXS	Illumina HiSeq	Phase_I	39	2	NM_023014	0	0	0	0	0		Silent	SNP	ENST00000240189.2	37	CCDS149.1																																																																																			A|0.974;G|0.026		0.557	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
HFM1	164045	hgsc.bcm.edu	37	1	91844675	91844675	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:91844675G>C	ENST00000370425.3	-	9	1201	c.1103C>G	c.(1102-1104)aCa>aGa	p.T368R	HFM1_ENST00000370424.3_Missense_Mutation_p.T47R|HFM1_ENST00000294696.5_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	368	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		ATCCATTACTGTATCTCCAGT	0.333																																					p.T368R		.											.	HFM1-112	0			c.C1103G						.						85.0	82.0	83.0					1																	91844675		2203	4299	6502	SO:0001583	missense	164045	exon9			ATTACTGTATCTC	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.1103C>G	1.37:g.91844675G>C	ENSP00000359454:p.Thr368Arg	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_001017975	0	0	0	0	0	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	37	CCDS30769.2	.	.	.	.	.	.	.	.	.	.	G	26.5	4.747630	0.89663	.	.	ENSG00000162669	ENST00000370425;ENST00000370424;ENST00000370421;ENST00000541820	T;T	0.37235	2.43;1.21	5.42	5.42	0.78866	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.40385	U	0.001107	T	0.48352	0.1495	L	0.58669	1.825	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.999	P;D;D	0.79784	0.899;0.993;0.981	T	0.21621	-1.0240	10	0.26408	T	0.33	.	19.2139	0.93768	0.0:0.0:1.0:0.0	.	47;368;368	A6NGI5;B7ZM16;A2PYH4	.;.;HFM1_HUMAN	R	368;47;52;401	ENSP00000359454:T368R;ENSP00000359453:T47R	ENSP00000359450:T52R	T	-	2	0	HFM1	91617263	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.476000	0.97823	2.534000	0.85438	0.563000	0.77884	ACA	.		0.333	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
EVI5	7813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	93160869	93160869	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:93160869C>G	ENST00000370331.1	-	7	1048	c.1039G>C	c.(1039-1041)Gag>Cag	p.E347Q	EVI5_ENST00000543509.1_Missense_Mutation_p.E347Q|EVI5_ENST00000540033.1_Missense_Mutation_p.E347Q	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	347	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TAGCTTACCTCAGACATAAAG	0.423																																					p.E347Q		.											.	EVI5-136	0			c.G1039C						.						107.0	109.0	108.0					1																	93160869		2203	4300	6503	SO:0001583	missense	7813	exon7			TTACCTCAGACAT	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1039G>C	1.37:g.93160869C>G	ENSP00000359356:p.Glu347Gln	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	66	7	NM_005665	0	0	0	0	0	A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	37	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	C	31	5.084339	0.94100	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509	T;T;T	0.14766	2.48;2.48;2.48	5.94	5.94	0.96194	Rab-GAP/TBC domain (4);	0.045268	0.85682	D	0.000000	T	0.34424	0.0897	M	0.83223	2.63	0.80722	D	1	D;D	0.60575	0.986;0.988	P;P	0.62560	0.844;0.904	T	0.13282	-1.0515	10	0.87932	D	0	-17.0097	20.3552	0.98837	0.0:1.0:0.0:0.0	.	347;347	F5H4R0;O60447	.;EVI5_HUMAN	Q	347	ENSP00000359356:E347Q;ENSP00000440826:E347Q;ENSP00000445019:E347Q	ENSP00000359356:E347Q	E	-	1	0	EVI5	92933457	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.760000	0.85248	2.812000	0.96745	0.557000	0.71058	GAG	.		0.423	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	
ASH1L	55870	broad.mit.edu	37	1	155451419	155451419	+	Silent	SNP	T	T	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:155451419T>C	ENST00000368346.3	-	3	1881	c.1242A>G	c.(1240-1242)gcA>gcG	p.A414A	ASH1L_ENST00000392403.3_Silent_p.A414A|ASH1L_ENST00000548830.1_3'UTR			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	414					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TGATCAGACCTGCCAAAGGAC	0.438																																					p.A414A													.	ASH1L-234	0			c.A1242G						.						98.0	95.0	96.0					1																	155451419		2203	4299	6502	SO:0001819	synonymous_variant	55870	exon3			CAGACCTGCCAAA	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.1242A>G	1.37:g.155451419T>C		Somatic	154	0		WXS	Illumina HiSeq	Phase_I	145	3	NM_018489	0	0	8	8	0	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	ENST00000368346.3	37																																																																																				.		0.438	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
OR6Y1	391112	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	158517503	158517503	+	Silent	SNP	A	A	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:158517503A>T	ENST00000302617.3	-	1	392	c.393T>A	c.(391-393)atT>atA	p.I131I		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					GTGGATTACAAATGGCTACAT	0.473																																					p.I131I		.											.	OR6Y1-69	0			c.T393A						.						100.0	85.0	90.0					1																	158517503		2202	4300	6502	SO:0001819	synonymous_variant	391112	exon1			ATTACAAATGGCT	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.393T>A	1.37:g.158517503A>T		Somatic	100	0		WXS	Illumina HiSeq	Phase_I	104	8	NM_001005189	0	0	0	0	0	Q6IFS0	Silent	SNP	ENST00000302617.3	37	CCDS30899.1																																																																																			.		0.473	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	NM_001005189	
NUAK2	81788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	205274389	205274389	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:205274389T>C	ENST00000367157.3	-	6	887	c.761A>G	c.(760-762)gAc>gGc	p.D254G		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GATCTTATGGTCATGCCCATC	0.572																																					p.D254G		.											.	NUAK2-391	0			c.A761G						.						98.0	83.0	88.0					1																	205274389		2203	4300	6503	SO:0001583	missense	81788	exon6			TTATGGTCATGCC	AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.761A>G	1.37:g.205274389T>C	ENSP00000356125:p.Asp254Gly	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	69	17	NM_030952	0	0	32	61	29		Missense_Mutation	SNP	ENST00000367157.3	37	CCDS1453.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.895395	0.91962	.	.	ENSG00000163545	ENST00000367157	T	0.26373	1.74	5.73	5.73	0.89815	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47093	D	0.000245	T	0.38983	0.1061	L	0.41124	1.26	0.80722	D	1	D	0.63046	0.992	P	0.59056	0.851	T	0.13710	-1.0499	10	0.62326	D	0.03	.	15.683	0.77388	0.0:0.0:0.0:1.0	.	254	Q9H093	NUAK2_HUMAN	G	254	ENSP00000356125:D254G	ENSP00000356125:D254G	D	-	2	0	NUAK2	203541012	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	8.040000	0.89188	2.188000	0.69820	0.459000	0.35465	GAC	.		0.572	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	216138718	216138718	+	Missense_Mutation	SNP	C	C	T	rs201386640		TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:216138718C>T	ENST00000307340.3	-	37	7447	c.7061G>A	c.(7060-7062)cGc>cAc	p.R2354H	USH2A_ENST00000366943.2_Missense_Mutation_p.R2354H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2354	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> H (in USH2A). {ECO:0000269|PubMed:17085681}.		hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R2354H(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCATTAGGGCGAAAAGGTGC	0.403										HNSCC(13;0.011)			C|||	1	0.000199681	0.0	0.0	5008	,	,		16044	0.0		0.001	False		,,,				2504	0.0				p.R2354H		.											.	USH2A-115	1	Substitution - Missense(1)	large_intestine(1)	c.G7061A	GRCh37	CM065510	USH2A	M		.						151.0	149.0	150.0					1																	216138718		2203	4300	6503	SO:0001583	missense	7399	exon37			TTAGGGCGAAAAG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7061G>A	1.37:g.216138718C>T	ENSP00000305941:p.Arg2354His	Somatic	200	0		WXS	Illumina HiSeq	Phase_I	166	54	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	9.917	1.211142	0.22289	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53640	0.61;0.61	5.56	-5.71	0.02413	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.141870	0.06669	N	0.765866	T	0.13072	0.0317	N	0.00621	-1.32	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21655	-1.0239	10	0.18276	T	0.48	.	5.5397	0.17031	0.0751:0.2583:0.1031:0.5634	.	2354	O75445	USH2A_HUMAN	H	2354	ENSP00000305941:R2354H;ENSP00000355910:R2354H	ENSP00000305941:R2354H	R	-	2	0	USH2A	214205341	0.095000	0.21747	0.000000	0.03702	0.490000	0.33462	0.145000	0.16157	-0.801000	0.04427	-0.136000	0.14681	CGC	C|0.999;T|0.000		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
SDE2	163859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	226180666	226180666	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:226180666A>C	ENST00000272091.7	-	3	294	c.276T>G	c.(274-276)atT>atG	p.I92M		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	92																	TTGTCTTCTCAATCTGAGCAC	0.428																																					p.I92M		.											.	.	0			c.T276G						.						85.0	76.0	79.0					1																	226180666		1868	4101	5969	SO:0001583	missense	163859	exon3			CTTCTCAATCTGA	BC071563	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751			26643	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 55"""	C1orf55		21333630	Standard	NM_152608		Approved	FLJ35382	uc001hpu.4	Q6IQ49	OTTHUMG00000037504	ENST00000272091.7:c.276T>G	1.37:g.226180666A>C	ENSP00000272091:p.Ile92Met	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	69	25	NM_152608	0	0	9	15	6	A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	ENST00000272091.7	37	CCDS41473.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.5|20.5	3.994098|3.994098	0.74703|0.74703	.|.	.|.	ENSG00000143751|ENSG00000143751	ENST00000272091;ENST00000366818|ENST00000366817	T|T	0.42131|0.49139	0.98|0.79	5.86|5.86	2.21|2.21	0.28008|0.28008	.|.	0.046995|.	0.85682|.	D|.	0.000000|.	T|T	0.41488|0.41488	0.1161|0.1161	L|L	0.41356|0.41356	1.27|1.27	0.29942|0.29942	N|N	0.82101|0.82101	D;D|.	0.89917|.	1.0;0.998|.	D;D|.	0.91635|.	0.999;0.978|.	T|T	0.45071|0.45071	-0.9286|-0.9286	10|7	0.15066|0.87932	T|D	0.55|0	-11.6814|-11.6814	4.9973|4.9973	0.14245|0.14245	0.6408:0.0:0.1288:0.2305|0.6408:0.0:0.1288:0.2305	.|.	80;92|.	Q6IQ49-2;Q6IQ49|.	.;CA055_HUMAN|.	M|W	92;80|41	ENSP00000272091:I92M|ENSP00000355782:L41W	ENSP00000272091:I92M|ENSP00000355782:L41W	I|L	-|-	3|2	3|0	C1orf55|C1orf55	224247289|224247289	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.520000|1.520000	0.35899|0.35899	0.119000|0.119000	0.18210|0.18210	0.529000|0.529000	0.55759|0.55759	ATT|TTG	.		0.428	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091310.1	NM_152608	
FH	2271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	241663812	241663812	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:241663812G>A	ENST00000366560.3	-	9	1353	c.1315C>T	c.(1315-1317)Cag>Tag	p.Q439*		NM_000143.3	NP_000134.2	P07954	FUMH_HUMAN	fumarate hydratase	439					cellular metabolic process (GO:0044237)|fumarate metabolic process (GO:0006106)|homeostasis of number of cells within a tissue (GO:0048873)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|tricarboxylic acid cycle enzyme complex (GO:0045239)	fumarate hydratase activity (GO:0004333)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(2)	26	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		GTATTGGCCTGGATTCCCACC	0.413			"""Mis, N, F"""			"""lieomyomatosis, renal"""			Hereditary Leiomyomatosis and Renal Cell Cancer																												p.Q439X	Melanoma(148;1573 2486 7381 46575)	.	yes	Rec		hereditary leiomyomatosis and renal cell cancer	1	1q42.1	2271	fumarate hydratase		"""E, M"""	.	FH-416	0			c.C1315T						.						149.0	143.0	145.0					1																	241663812		2203	4298	6501	SO:0001587	stop_gained	2271	exon9	Familial Cancer Database	HLRCC, Reed syndrome, Hereditary Multiple Leiomyomata of Skin and Uterus	TGGCCTGGATTCC	BC003108	CCDS1617.1	1q42.1	2014-09-17			ENSG00000091483	ENSG00000091483	4.2.1.2		3700	protein-coding gene	gene with protein product		136850					Standard	NM_000143		Approved	fumarase	uc001hyx.3	P07954	OTTHUMG00000039597	ENST00000366560.3:c.1315C>T	1.37:g.241663812G>A	ENSP00000355518:p.Gln439*	Somatic	195	0		WXS	Illumina HiSeq	Phase_I	218	91	NM_000143	0	0	42	49	7	B1ANK7	Nonsense_Mutation	SNP	ENST00000366560.3	37	CCDS1617.1	.	.	.	.	.	.	.	.	.	.	G	36	5.942978	0.97128	.	.	ENSG00000091483	ENST00000366560	.	.	.	5.71	5.71	0.89125	.	0.221640	0.47093	D	0.000245	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-13.6944	17.3485	0.87316	0.0:0.0:1.0:0.0	.	.	.	.	X	439	.	ENSP00000355518:Q439X	Q	-	1	0	FH	239730435	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.437000	0.52863	2.697000	0.92050	0.655000	0.94253	CAG	.		0.413	FH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095490.1	NM_000143	
C11orf80	79703	hgsc.bcm.edu;broad.mit.edu	37	11	66555634	66555634	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr11:66555634T>C	ENST00000360962.4	+	5	534	c.527T>C	c.(526-528)aTa>aCa	p.I176T	C11orf80_ENST00000346672.4_Missense_Mutation_p.I21T|C11orf80_ENST00000527368.1_3'UTR|C11orf80_ENST00000527634.1_Intron|C11orf80_ENST00000532565.2_5'UTR|C11orf80_ENST00000540737.1_Missense_Mutation_p.I10T|C11orf80_ENST00000525449.2_Missense_Mutation_p.I21T	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	176										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						CACACAGAAATACAGTCCATA	0.433																																					p.I176T		.											.	.	0			c.T527C						.						78.0	72.0	74.0					11																	66555634		1872	4107	5979	SO:0001583	missense	79703	exon5			CAGAAATACAGTC			11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.527T>C	11.37:g.66555634T>C	ENSP00000354227:p.Ile176Thr	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	47	3	NM_024650	0	0	0	0	0	Q9H677	Missense_Mutation	SNP	ENST00000360962.4	37	CCDS53664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.06|12.06	1.823474|1.823474	0.32237|0.32237	.|.	.|.	ENSG00000173715|ENSG00000173715	ENST00000525908;ENST00000360962;ENST00000346672;ENST00000528340;ENST00000540737;ENST00000525449|ENST00000532089	T;T|.	0.38560|.	1.13;1.14|.	5.38|5.38	4.26|4.26	0.50523|0.50523	.|.	0.346678|.	0.24542|.	N|.	0.037636|.	T|T	0.31513|0.31513	0.0799|0.0799	L|L	0.27053|0.27053	0.805|0.805	0.25537|0.25537	N|N	0.987218|0.987218	P|.	0.46512|.	0.879|.	P|.	0.48677|.	0.586|.	T|T	0.19614|0.19614	-1.0300|-1.0300	10|5	0.72032|.	D|.	0.01|.	.|.	7.6859|7.6859	0.28540|0.28540	0.0:0.0949:0.0:0.9051|0.0:0.0949:0.0:0.9051	.|.	10|.	E9PKZ8|.	.|.	T|H	127;176;21;10;10;21|2	ENSP00000432039:I127T;ENSP00000354227:I176T|.	ENSP00000317408:I21T|.	I|Y	+|+	2|1	0|0	C11orf80|C11orf80	66312210|66312210	0.770000|0.770000	0.28543|0.28543	0.546000|0.546000	0.28166|0.28166	0.821000|0.821000	0.46438|0.46438	2.127000|2.127000	0.42035|0.42035	0.910000|0.910000	0.36722|0.36722	0.533000|0.533000	0.62120|0.62120	ATA|TAC	.		0.433	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024650	
GLB1L2	89944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	134241359	134241359	+	Silent	SNP	A	A	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr11:134241359A>G	ENST00000535456.2	+	14	1589	c.1401A>G	c.(1399-1401)acA>acG	p.T467T	GLB1L2_ENST00000389881.3_Silent_p.T467T|GLB1L2_ENST00000529077.1_3'UTR|GLB1L2_ENST00000339772.7_Silent_p.T467T	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	467					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		ACTACAAGACAACGAAGATTG	0.542																																					p.T467T		.											.	GLB1L2-25	0			c.A1401G						.						161.0	159.0	160.0					11																	134241359		2201	4297	6498	SO:0001819	synonymous_variant	89944	exon14			CAAGACAACGAAG		CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.1401A>G	11.37:g.134241359A>G		Somatic	216	0		WXS	Illumina HiSeq	Phase_I	210	79	NM_138342	0	0	31	59	28	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Silent	SNP	ENST00000535456.2	37	CCDS31724.1	.	.	.	.	.	.	.	.	.	.	A	4.458	0.084834	0.08583	.	.	ENSG00000149328	ENST00000525089	.	.	.	4.72	-9.38	0.00623	.	.	.	.	.	T	0.13457	0.0326	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.17961	-1.0352	4	.	.	.	-3.4454	0.6104	0.00760	0.3795:0.1978:0.2259:0.1968	.	.	.	.	D	406	.	.	N	+	1	0	GLB1L2	133746569	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-3.622000	0.00412	-1.622000	0.01560	-1.291000	0.01355	AAC	.		0.542	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393629.2	NM_138342	
IPO8	10526	hgsc.bcm.edu;broad.mit.edu	37	12	30787080	30787080	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr12:30787080T>C	ENST00000256079.4	-	23	3174	c.2836A>G	c.(2836-2838)Agt>Ggt	p.S946G	IPO8_ENST00000544829.1_Missense_Mutation_p.S741G	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	946					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AGTGGAGTACTGAACCCCTCA	0.403																																					p.S946G		.											.	IPO8-227	0			c.A2836G						.						222.0	173.0	190.0					12																	30787080		2203	4300	6503	SO:0001583	missense	10526	exon23			GAGTACTGAACCC	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2836A>G	12.37:g.30787080T>C	ENSP00000256079:p.Ser946Gly	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	66	5	NM_006390	0	0	53	58	5	B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	37	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.098449	0.56183	.	.	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.65732	-0.17;-0.17	5.22	5.22	0.72569	Armadillo-type fold (1);	0.037226	0.85682	D	0.000000	T	0.62073	0.2398	M	0.64997	1.995	0.58432	D	0.999998	P;P;P	0.46395	0.791;0.877;0.749	B;B;B	0.43194	0.219;0.411;0.194	T	0.62714	-0.6796	10	0.30854	T	0.27	-16.0242	15.3733	0.74584	0.0:0.0:0.0:1.0	.	741;422;946	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	G	946;422;741	ENSP00000256079:S946G;ENSP00000444520:S741G	ENSP00000256079:S946G	S	-	1	0	IPO8	30678347	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	4.133000	0.57983	2.081000	0.62600	0.533000	0.62120	AGT	.		0.403	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
ULK1	8408	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	132395297	132395297	+	Silent	SNP	C	C	T	rs571147302		TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr12:132395297C>T	ENST00000321867.4	+	12	1251	c.900C>T	c.(898-900)tcC>tcT	p.S300S		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	300	Interaction with GABARAP and GABARAPL2.|Poly-Ser.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GCTCGGGGTCCGGCAGCAGCT	0.662													T|||	1	0.000199681	0.0008	0.0	5008	,	,		14232	0.0		0.0	False		,,,				2504	0.0				p.S300S		.											.	ULK1-758	0			c.C900T						.						76.0	67.0	70.0					12																	132395297		2203	4299	6502	SO:0001819	synonymous_variant	8408	exon12			GGGGTCCGGCAGC	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.900C>T	12.37:g.132395297C>T		Somatic	95	0		WXS	Illumina HiSeq	Phase_I	81	31	NM_003565	0	0	12	22	10	Q9UQ28	Silent	SNP	ENST00000321867.4	37	CCDS9274.1																																																																																			.		0.662	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		
DOCK9	23348	hgsc.bcm.edu	37	13	99536093	99536093	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr13:99536093G>C	ENST00000376460.1	-	22	2523	c.2443C>G	c.(2443-2445)Cat>Gat	p.H815D	DOCK9_ENST00000448493.2_Missense_Mutation_p.H827D|DOCK9_ENST00000339416.2_Missense_Mutation_p.H816D|DOCK9_ENST00000442173.1_Missense_Mutation_p.H815D	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	816	DHR-1.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GAAACCAGATGAGTGGAAATT	0.383																																					p.H816D		.											.	DOCK9-90	0			c.C2446G						.						72.0	71.0	71.0					13																	99536093		1852	4090	5942	SO:0001583	missense	23348	exon22			CCAGATGAGTGGA	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.2443C>G	13.37:g.99536093G>C	ENSP00000365643:p.His815Asp	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	7	2	NM_001130049	0	0	18	18	0	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429336	0.83776	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.32315	0.0825	L	0.43152	1.355	0.80722	D	1	P;D;P;B;D	0.89917	0.888;1.0;0.888;0.104;0.996	P;D;P;B;D	0.81914	0.824;0.995;0.579;0.054;0.969	T	0.01508	-1.1337	10	0.62326	D	0.03	.	19.2291	0.93831	0.0:0.0:1.0:0.0	.	816;815;815;815;816	A6H8Z6;E9PFM9;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;DOCK9_HUMAN	D	815;816;816;816;815;816;827;815	ENSP00000365643:H815D;ENSP00000341086:H816D;ENSP00000401958:H827D;ENSP00000406883:H815D	ENSP00000341086:H816D	H	-	1	0	DOCK9	98334094	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.420000	0.97426	2.614000	0.88457	0.655000	0.94253	CAT	.		0.383	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
JKAMP	51528	hgsc.bcm.edu	37	14	59965598	59965598	+	Silent	SNP	G	G	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr14:59965598G>C	ENST00000261247.9	+	5	759	c.612G>C	c.(610-612)gtG>gtC	p.V204V	JKAMP_ENST00000425728.2_Silent_p.V198V|JKAMP_ENST00000554271.1_Silent_p.V218V|JKAMP_ENST00000356057.5_Silent_p.V212V|RP11-701B16.2_ENST00000554253.1_RNA	NM_001098625.1|NM_001284203.1|NM_016475.3	NP_001092095.1|NP_001271132.1|NP_057559.2	Q9P055	JKAMP_HUMAN	JNK1/MAPK8-associated membrane protein	219					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|kidney(1)|lung(3)	6						TTTTAACCGTGCTTCAGGCAG	0.348																																					p.V204V		.											.	JKAMP-67	0			c.G612C						.						102.0	91.0	95.0					14																	59965598		1830	4092	5922	SO:0001819	synonymous_variant	51528	exon5			AACCGTGCTTCAG	AF212245	CCDS45116.1, CCDS45117.1, CCDS61462.1, CCDS61463.1	14q22.3	2014-02-14	2009-08-13	2009-08-13	ENSG00000050130	ENSG00000050130			20184	protein-coding gene	gene with protein product	"""Jun N-terminal kinase 1-associated membrane protein"""	611176	"""chromosome 14 open reading frame 100"""	C14orf100		16166642, 19269966	Standard	NM_001284202		Approved	HSPC213, JAMP, HSPC327, CDA06	uc001xef.4	Q9P055	OTTHUMG00000171054	ENST00000261247.9:c.612G>C	14.37:g.59965598G>C		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_016475	0	0	51	51	0	B4DP67|Q6FIB6|Q6IAJ2|Q7Z5D4|Q86SY6|Q9H0Q6|Q9H2W0|Q9HAH5|Q9P0R3	Silent	SNP	ENST00000261247.9	37	CCDS45116.1																																																																																			.		0.348	JKAMP-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411430.1	NM_001098625	
SNURF	8926	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	25207297	25207297	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr15:25207297C>T	ENST00000577949.1	+	2	114	c.51C>T	c.(49-51)caC>caT	p.H17H	SNRPN_ENST00000346403.6_5'UTR|SNRPN_ENST00000554227.2_5'UTR|SNURF_ENST00000338094.6_Silent_p.H17H|SNRPN_ENST00000577565.1_5'UTR|SNRPN_ENST00000400100.1_5'UTR|SNURF_ENST00000551312.2_Silent_p.H17H|SNRPN_ENST00000400098.1_5'UTR|SNRPN_ENST00000390687.4_5'UTR|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR|SNURF_ENST00000338327.4_Silent_p.H17H			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame	17						nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		CAGAACAGCACGTACCAGAGG	0.448																																					p.H17H		.											.	SNURF-90	0			c.C51T						.						154.0	124.0	134.0					15																	25207297		2203	4300	6503	SO:0001819	synonymous_variant	8926	exon2			ACAGCACGTACCA		CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000577949.1:c.51C>T	15.37:g.25207297C>T		Somatic	129	0		WXS	Illumina HiSeq	Phase_I	74	5	NM_005678	0	0	35	35	0	A6NCW2	Silent	SNP	ENST00000577949.1	37	CCDS10016.1																																																																																			.		0.448	SNURF-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446300.1	NM_005678	
UACA	55075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	70987423	70987423	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr15:70987423C>T	ENST00000322954.6	-	3	419	c.234G>A	c.(232-234)aaG>aaA	p.K78K	UACA_ENST00000560441.1_Silent_p.K65K|UACA_ENST00000539319.1_Silent_p.K78K|UACA_ENST00000379983.2_Silent_p.K65K	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	78					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						CAAGATTCCCCTTTGAGGTCA	0.353																																					p.K78K		.											.	UACA-94	0			c.G234A						.						91.0	83.0	86.0					15																	70987423		2199	4297	6496	SO:0001819	synonymous_variant	55075	exon3			ATTCCCCTTTGAG	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.234G>A	15.37:g.70987423C>T		Somatic	44	0		WXS	Illumina HiSeq	Phase_I	27	18	NM_018003	0	0	13	26	13	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Silent	SNP	ENST00000322954.6	37	CCDS10235.1																																																																																			.		0.353	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
HCN4	10021	hgsc.bcm.edu	37	15	73660576	73660576	+	Silent	SNP	G	G	C	rs201193660	byFrequency	TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr15:73660576G>C	ENST00000261917.3	-	1	1029	c.36C>G	c.(34-36)ctC>ctG	p.L12L		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	12					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GGAGGCTGTAGAGCCGCTTGC	0.761													G|||	18	0.00359425	0.0	0.0101	5008	,	,		8058	0.0		0.0109	False		,,,				2504	0.0				p.L12L		.											.	HCN4-96	0			c.C36G						.	G		5,3709		0,5,1852	3.0	4.0	3.0		36	1.2	1.0	15		3	36,7592		0,36,3778	no	coding-synonymous	HCN4	NM_005477.2		0,41,5630	CC,CG,GG		0.4719,0.1346,0.3615		12/1204	73660576	41,11301	1857	3814	5671	SO:0001819	synonymous_variant	10021	exon1			GCTGTAGAGCCGC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.36C>G	15.37:g.73660576G>C		Somatic	4	1		WXS	Illumina HiSeq	Phase_I	3	2	NM_005477	0	0	0	0	0	Q9UMQ7	Silent	SNP	ENST00000261917.3	37	CCDS10248.1																																																																																			G|0.989;C|0.011		0.761	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
KIAA0753	9851	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	6531560	6531560	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr17:6531560G>A	ENST00000361413.3	-	3	953	c.595C>T	c.(595-597)Cag>Tag	p.Q199*	KIAA0753_ENST00000542606.1_5'UTR|KIAA0753_ENST00000572370.1_5'UTR	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	199						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		GGATGAGGCTGAAGTCCCGGA	0.483																																					p.Q199X		.											.	KIAA0753-90	0			c.C595T						.						129.0	131.0	131.0					17																	6531560		2023	4175	6198	SO:0001587	stop_gained	9851	exon3			GAGGCTGAAGTCC		CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.595C>T	17.37:g.6531560G>A	ENSP00000355250:p.Gln199*	Somatic	179	0		WXS	Illumina HiSeq	Phase_I	157	9	NM_014804	0	0	18	20	2	A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Nonsense_Mutation	SNP	ENST00000361413.3	37	CCDS42247.1	.	.	.	.	.	.	.	.	.	.	G	32	5.129961	0.94473	.	.	ENSG00000198920	ENST00000361413	.	.	.	5.34	-0.77	0.11005	.	0.864801	0.09963	N	0.733125	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-2.5116	10.7147	0.46005	0.0:0.5544:0.3039:0.1417	.	.	.	.	X	199	.	ENSP00000355250:Q199X	Q	-	1	0	KIAA0753	6472284	0.004000	0.15560	0.007000	0.13788	0.294000	0.27393	0.211000	0.17474	0.282000	0.22254	0.655000	0.94253	CAG	.		0.483	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439769.3	NM_014804	
TRPV2	51393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	16340169	16340169	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr17:16340169A>G	ENST00000338560.7	+	15	2660	c.2261A>G	c.(2260-2262)aAc>aGc	p.N754S	C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA|TRPV2_ENST00000577397.1_Missense_Mutation_p.N324S|C17orf76-AS1_ENST00000481898.1_RNA	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	754					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TCTGAGGAAAACTATGTGCCC	0.562																																					p.N754S		.											.	TRPV2-91	0			c.A2261G						.						154.0	134.0	141.0					17																	16340169		2203	4300	6503	SO:0001583	missense	51393	exon15			AGGAAAACTATGT	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.2261A>G	17.37:g.16340169A>G	ENSP00000342222:p.Asn754Ser	Somatic	156	0		WXS	Illumina HiSeq	Phase_I	145	58	NM_016113	0	0	4	4	0	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	ENST00000338560.7	37	CCDS32576.1	.	.	.	.	.	.	.	.	.	.	A	5.819	0.335390	0.11013	.	.	ENSG00000187688	ENST00000338560	D	0.87334	-2.24	3.83	3.83	0.44106	.	0.576086	0.16403	N	0.215935	T	0.72740	0.3498	N	0.08118	0	0.19775	N	0.999956	B	0.09022	0.002	B	0.09377	0.004	T	0.61093	-0.7132	10	0.34782	T	0.22	-56.024	9.2873	0.37764	1.0:0.0:0.0:0.0	.	754	Q9Y5S1	TRPV2_HUMAN	S	754	ENSP00000342222:N754S	ENSP00000342222:N754S	N	+	2	0	TRPV2	16280894	0.920000	0.31207	0.964000	0.40570	0.094000	0.18550	2.141000	0.42168	1.972000	0.57404	0.459000	0.35465	AAC	.		0.562	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113	
TTC25	83538	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40101470	40101470	+	RNA	SNP	T	T	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr17:40101470T>C	ENST00000591658.1	+	0	1207							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)				endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				CAGCAAGCCATTGACACGTGA	0.458																																					.													.	TTC25-23	0			.						.						44.0	39.0	41.0					17																	40101470		1882	4110	5992			83538	.			AAGCCATTGACAC	AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40101470T>C		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	23	13	.	0	0	0	0	0	Q6NX40|Q6PJ04|Q9H0K5	Missense_Mutation	SNP	ENST00000591658.1	37																																																																																				.		0.458	TTC25-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000449237.1	NM_031421	
EPN3	55040	ucsc.edu	37	17	48608775	48608775	+	5'Flank	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr17:48608775C>T	ENST00000268933.3	+	0	0				MYCBPAP_ENST00000436259.2_3'UTR|EPN3_ENST00000537145.1_5'Flank|MYCBPAP_ENST00000323776.5_Missense_Mutation_p.R981C|EPN3_ENST00000541226.1_5'Flank	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3							clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GGAGGCTTTGCGCCTCTGCAG	0.522																																					p.R981C													.	MYCBPAP-230	0			c.C2941T						.						70.0	59.0	63.0					17																	48608775		2203	4300	6503	SO:0001631	upstream_gene_variant	84073	exon19			GCTTTGCGCCTCT	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201			17.37:g.48608775C>T	Exception_encountered	Somatic	24	0		WXS	Illumina HiSeq		31	4	NM_032133	0	0	0	0	0	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	ENST00000268933.3	37	CCDS11570.1	.	.	.	.	.	.	.	.	.	.	C	9.729	1.161778	0.21538	.	.	ENSG00000136449	ENST00000323776	T	0.26810	1.71	5.1	1.66	0.24008	.	0.990904	0.08203	N	0.981944	T	0.24353	0.0590	L	0.57536	1.79	0.09310	N	1	B	0.17465	0.022	B	0.08055	0.003	T	0.31779	-0.9931	10	0.72032	D	0.01	0.4844	4.9734	0.14127	0.0:0.6024:0.1803:0.2173	.	944	Q8TBZ2	MYBPP_HUMAN	C	981	ENSP00000323184:R981C	ENSP00000323184:R981C	R	+	1	0	MYCBPAP	45963774	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.063000	0.11655	1.040000	0.40099	0.549000	0.68633	CGC	.		0.522	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
ENPP7	339221	broad.mit.edu	37	17	77710872	77710872	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr17:77710872C>T	ENST00000328313.5	+	4	1280	c.1059C>T	c.(1057-1059)caC>caT	p.H353H		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			ATGGGGAGCACGGCTTTGACA	0.607																																					p.H353H													.	ENPP7-92	0			c.C1059T						.						98.0	81.0	87.0					17																	77710872		2203	4300	6503	SO:0001819	synonymous_variant	339221	exon4			GGAGCACGGCTTT	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.1059C>T	17.37:g.77710872C>T		Somatic	119	0		WXS	Illumina HiSeq	Phase_I	94	5	NM_178543	0	0	0	0	0		Silent	SNP	ENST00000328313.5	37	CCDS11763.1																																																																																			.		0.607	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543	
SYT4	6860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	40853736	40853736	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr18:40853736C>G	ENST00000255224.3	-	2	1026	c.658G>C	c.(658-660)Gat>Cat	p.D220H	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.D202H	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	220	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						AAGGTCTCATCAAAAGCTGGA	0.403																																					p.D220H	NSCLC(85;81 1419 2855 22820 35912)	.											.	SYT4-132	0			c.G658C						.						111.0	108.0	109.0					18																	40853736		2203	4300	6503	SO:0001583	missense	6860	exon2			TCTCATCAAAAGC	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.658G>C	18.37:g.40853736C>G	ENSP00000255224:p.Asp220His	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	68	30	NM_020783	0	0	1	1	0	B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	37	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319387	0.81469	.	.	ENSG00000132872	ENST00000255224;ENST00000442661	T	0.09163	3.01	5.87	5.87	0.94306	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.043597	0.85682	D	0.000000	T	0.33265	0.0857	M	0.64260	1.97	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.69142	0.962;0.962	T	0.00357	-1.1792	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	202;220	B4DEU3;Q9H2B2	.;SYT4_HUMAN	H	220;25	ENSP00000255224:D220H	ENSP00000255224:D220H	D	-	1	0	SYT4	39107734	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.729000	0.84864	2.941000	0.99782	0.655000	0.94253	GAT	.		0.403	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
SERPINB10	5273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	61585305	61585305	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr18:61585305T>A	ENST00000238508.3	+	4	400	c.341T>A	c.(340-342)aTa>aAa	p.I114K		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	114					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				GCCAATGCGATATATGGAGAG	0.363																																					p.I114K		.											.	SERPINB10-227	0			c.T341A						.						103.0	94.0	97.0					18																	61585305		2203	4300	6503	SO:0001583	missense	5273	exon3			ATGCGATATATGG	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.341T>A	18.37:g.61585305T>A	ENSP00000238508:p.Ile114Lys	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	44	6	NM_005024	0	0	0	0	0	Q4VAX4|Q4VAX7	Missense_Mutation	SNP	ENST00000238508.3	37	CCDS11990.1	.	.	.	.	.	.	.	.	.	.	T	9.136	1.012671	0.19277	.	.	ENSG00000242550	ENST00000238508	D	0.84370	-1.84	5.83	3.43	0.39272	Serpin domain (3);	0.694589	0.14087	N	0.342276	D	0.88555	0.6468	H	0.94771	3.58	0.09310	N	1	B	0.27316	0.175	B	0.28465	0.09	T	0.83166	-0.0096	10	0.87932	D	0	.	9.1438	0.36919	0.0:0.1534:0.0:0.8466	.	114	P48595	SPB10_HUMAN	K	114	ENSP00000238508:I114K	ENSP00000238508:I114K	I	+	2	0	SERPINB10	59736285	0.002000	0.14202	0.004000	0.12327	0.109000	0.19521	1.191000	0.32138	1.037000	0.40024	-0.274000	0.10170	ATA	.		0.363	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024	
ZSWIM4	65249	broad.mit.edu	37	19	13941242	13941242	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr19:13941242C>T	ENST00000254323.2	+	13	2537	c.2348C>T	c.(2347-2349)tCg>tTg	p.S783L	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.S617L	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	783							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			AAGAACCACTCGGCCTTCGAG	0.697																																					p.S783L													.	ZSWIM4-90	0			c.C2348T						.						78.0	80.0	80.0					19																	13941242		2203	4300	6503	SO:0001583	missense	65249	exon13			ACCACTCGGCCTT	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.2348C>T	19.37:g.13941242C>T	ENSP00000254323:p.Ser783Leu	Somatic	200	0		WXS	Illumina HiSeq	Phase_I	168	7	NM_023072	0	0	12	12	0		Missense_Mutation	SNP	ENST00000254323.2	37	CCDS32924.1	.	.	.	.	.	.	.	.	.	.	C	2.142	-0.396521	0.04899	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.41065	1.01;1.01	4.14	4.14	0.48551	.	0.205124	0.32640	N	0.005825	T	0.21761	0.0524	N	0.08118	0	0.23791	N	0.996832	B;B	0.15719	0.014;0.002	B;B	0.09377	0.003;0.004	T	0.08994	-1.0695	10	0.11485	T	0.65	-2.7245	13.8964	0.63775	0.0:1.0:0.0:0.0	.	617;783	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	L	783;617	ENSP00000254323:S783L;ENSP00000405278:S617L	ENSP00000254323:S783L	S	+	2	0	ZSWIM4	13802242	0.980000	0.34600	0.110000	0.21437	0.293000	0.27360	2.803000	0.47924	1.849000	0.53698	0.484000	0.47621	TCG	.		0.697	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342	
KXD1	79036	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	18679377	18679377	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr19:18679377A>T	ENST00000602094.1	+	5	1927	c.467A>T	c.(466-468)cAg>cTg	p.Q156L	KXD1_ENST00000595073.1_Missense_Mutation_p.Q156L|KXD1_ENST00000599319.1_Missense_Mutation_p.Q156L|KXD1_ENST00000601630.1_Missense_Mutation_p.Q175L|KXD1_ENST00000539106.1_Missense_Mutation_p.Q156L|AC005253.4_ENST00000593791.1_RNA|KXD1_ENST00000222307.4_Missense_Mutation_p.Q156L|KXD1_ENST00000540691.1_Missense_Mutation_p.Q156L			Q9BQD3	KXDL1_HUMAN	KxDL motif containing 1	156					vesicle-mediated transport (GO:0016192)	BLOC-1 complex (GO:0031083)											TCCCATGTCCAGCCTGGCTCC	0.657																																					p.Q156L		.											.	.	0			c.A467T						.						96.0	89.0	92.0					19																	18679377		2203	4300	6503	SO:0001583	missense	79036	exon6			ATGTCCAGCCTGG	AK098346	CCDS12381.1	19p13.11	2011-11-24	2011-11-24	2011-11-24	ENSG00000105700	ENSG00000105700			28420	protein-coding gene	gene with protein product		615178	"""chromosome 19 open reading frame 50"""	C19orf50		21159114	Standard	NM_001171948		Approved	FLJ25480, MGC2749, KXDL	uc002njo.3	Q9BQD3		ENST00000602094.1:c.467A>T	19.37:g.18679377A>T	ENSP00000472836:p.Gln156Leu	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	141	9	NM_001171948	0	0	69	69	0	O76098	Missense_Mutation	SNP	ENST00000602094.1	37	CCDS12381.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.064988	0.36470	.	.	ENSG00000105700	ENST00000540691;ENST00000539106;ENST00000222307	T;T;T	0.45276	0.9;0.9;0.9	4.59	-4.19	0.03835	.	0.517276	0.21501	N	0.073525	T	0.21590	0.0520	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.05699	-1.0869	10	0.59425	D	0.04	-5.0797	6.0241	0.19646	0.4521:0.2352:0.3127:0.0	.	156	Q9BQD3	CS050_HUMAN	L	156	ENSP00000443549:Q156L;ENSP00000438903:Q156L;ENSP00000222307:Q156L	ENSP00000222307:Q156L	Q	+	2	0	C19orf50	18540377	0.002000	0.14202	0.000000	0.03702	0.040000	0.13550	0.014000	0.13333	-0.954000	0.03640	-0.345000	0.07892	CAG	.		0.657	KXD1-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465107.1	NM_024069	
NKPD1	284353	broad.mit.edu	37	19	45656458	45656458	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr19:45656458G>A	ENST00000438936.2	-	3	782	c.571C>T	c.(571-573)Cgg>Tgg	p.R191W	NKPD1_ENST00000589776.1_Missense_Mutation_p.R191W|AC005757.7_ENST00000589594.1_lincRNA|NKPD1_ENST00000317951.4_Missense_Mutation_p.R413W|NKPD1_ENST00000429338.1_Missense_Mutation_p.R191W			Q17RQ9	NKPD1_HUMAN	NTPase, KAP family P-loop domain containing 1	191	KAP NTPase.					integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|prostate(2)|urinary_tract(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GACACCAGCCGCTCGATCTTC	0.617																																					p.R413W													.	NKPD1-68	0			c.C1237T						.						11.0	14.0	13.0					19																	45656458		2064	4212	6276	SO:0001583	missense	284353	exon4			CCAGCCGCTCGAT	AK090919		19q13.32	2012-07-02		2012-07-02	ENSG00000179846	ENSG00000179846			24739	protein-coding gene	gene with protein product						14702039	Standard	NM_198478		Approved	FLJ33600	uc010xxi.2	Q17RQ9	OTTHUMG00000160521	ENST00000438936.2:c.571C>T	19.37:g.45656458G>A	ENSP00000401739:p.Arg191Trp	Somatic	13	0		WXS	Illumina HiSeq	Phase_I	5	4	NM_198478	0	0	0	0	0	B7ZLG6|D6RH15|Q8N2A2	Missense_Mutation	SNP	ENST00000438936.2	37		.	.	.	.	.	.	.	.	.	.	G	16.16	3.043458	0.55003	.	.	ENSG00000179846	ENST00000317951;ENST00000438936;ENST00000429338	T;T;T	0.51574	0.7;0.7;0.72	4.66	3.57	0.40892	KAP P-loop (1);	0.070935	0.53938	D	0.000059	T	0.62925	0.2468	M	0.61703	1.905	0.34967	D	0.752799	D	0.89917	1.0	D	0.75484	0.986	T	0.74019	-0.3799	10	0.72032	D	0.01	-35.867	11.9149	0.52759	0.0:0.0:0.8259:0.1741	.	191	Q17RQ9	NKPD1_HUMAN	W	413;191;191	ENSP00000321976:R413W;ENSP00000401739:R191W;ENSP00000404706:R191W	ENSP00000321976:R413W	R	-	1	2	NKPD1	50348298	0.999000	0.42202	1.000000	0.80357	0.948000	0.59901	1.046000	0.30354	2.121000	0.65114	0.313000	0.20887	CGG	.		0.617	NKPD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000360950.2	NM_198478	
MYBPC2	4606	broad.mit.edu	37	19	50939282	50939282	+	Silent	SNP	G	G	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr19:50939282G>T	ENST00000357701.5	+	4	261	c.210G>T	c.(208-210)gtG>gtT	p.V70V		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	70	Ig-like C2-type 1.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		AGGACGCAGTGGTCGTGGCCA	0.607																																					p.V70V													.	MYBPC2-67	0			c.G210T						.						33.0	38.0	36.0					19																	50939282		2082	4200	6282	SO:0001819	synonymous_variant	4606	exon4			CGCAGTGGTCGTG		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.210G>T	19.37:g.50939282G>T		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	12	6	NM_004533	0	0	0	0	0	A1L4G9	Silent	SNP	ENST00000357701.5	37	CCDS46152.1																																																																																			.		0.607	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
BIRC6	57448	hgsc.bcm.edu	37	2	32639897	32639897	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:32639897T>C	ENST00000421745.2	+	10	1672	c.1538T>C	c.(1537-1539)cTc>cCc	p.L513P		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	513					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CTCAGCATTCTCCAACAGCCA	0.383																																					p.L513P	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6-233	0			c.T1538C						.						57.0	55.0	56.0					2																	32639897		2203	4300	6503	SO:0001583	missense	57448	exon10			GCATTCTCCAACA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1538T>C	2.37:g.32639897T>C	ENSP00000393596:p.Leu513Pro	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	56	3	NM_016252	0	0	13	13	0	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	T	16.00	2.998429	0.54147	.	.	ENSG00000115760	ENST00000421745	T	0.81078	-1.45	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.85699	0.5757	L	0.44542	1.39	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.86691	0.1923	10	0.56958	D	0.05	.	15.1339	0.72549	0.0:0.0:0.0:1.0	.	513	Q9NR09	BIRC6_HUMAN	P	513	ENSP00000393596:L513P	ENSP00000393596:L513P	L	+	2	0	BIRC6	32493401	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	7.948000	0.87774	2.045000	0.60652	0.528000	0.53228	CTC	.		0.383	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
EIF2AK3	9451	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	88890366	88890366	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:88890366C>T	ENST00000303236.3	-	5	1273	c.972G>A	c.(970-972)aaG>aaA	p.K324K	EIF2AK3_ENST00000419748.1_Silent_p.K173K	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	324					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						GTCCTCCCTTCTTACTGAATG	0.423																																					p.K324K	GBM(138;671 1851 16235 39058 45249)	.											.	EIF2AK3-361	0			c.G972A						.						168.0	156.0	160.0					2																	88890366		2203	4300	6503	SO:0001819	synonymous_variant	9451	exon5			TCCCTTCTTACTG	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.972G>A	2.37:g.88890366C>T		Somatic	191	1		WXS	Illumina HiSeq	Phase_I	170	11	NM_004836	0	0	21	23	2	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Silent	SNP	ENST00000303236.3	37	CCDS33241.1																																																																																			.		0.423	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836	
SCN2A	6326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	166201262	166201262	+	Silent	SNP	C	C	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:166201262C>G	ENST00000375437.2	+	16	3050	c.2760C>G	c.(2758-2760)ctC>ctG	p.L920L	SCN2A_ENST00000283256.6_Silent_p.L920L|SCN2A_ENST00000375427.2_Silent_p.L920L|SCN2A_ENST00000357398.3_Silent_p.L920L	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	920					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATTGTGAACTCCCACGCTGGC	0.488																																					p.L920L		.											.	SCN2A-142	0			c.C2760G						.						231.0	208.0	216.0					2																	166201262		2203	4300	6503	SO:0001819	synonymous_variant	6326	exon15			TGAACTCCCACGC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2760C>G	2.37:g.166201262C>G		Somatic	199	0		WXS	Illumina HiSeq	Phase_I	182	26	NM_001040143	0	0	3	5	2	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	37	CCDS33314.1																																																																																			.		0.488	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	168105759	168105759	+	Silent	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:168105759G>A	ENST00000409195.1	+	9	7946	c.7857G>A	c.(7855-7857)cgG>cgA	p.R2619R	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Silent_p.R2619R|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Silent_p.R2397R	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2444					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTAATGCTCGGATACTAGGAG	0.458																																					p.R2619R		.											.	XIRP2-104	0			c.G7857A						.						88.0	85.0	86.0					2																	168105759		1909	4120	6029	SO:0001819	synonymous_variant	129446	exon9			TGCTCGGATACTA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7857G>A	2.37:g.168105759G>A		Somatic	134	0		WXS	Illumina HiSeq	Phase_I	147	41	NM_152381	0	0	0	0	0	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	CCDS42769.1																																																																																			.		0.458	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	179598482	179598482	+	Nonsense_Mutation	SNP	C	C	A	rs377754692		TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:179598482C>A	ENST00000591111.1	-	51	14907	c.14683G>T	c.(14683-14685)Gga>Tga	p.G4895*	TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.G3968*|TTN_ENST00000589042.1_Nonsense_Mutation_p.G5212*|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12287	Ig-like 29.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGATTTTTCCGTCTTCTCTG	0.453																																					p.G5212X		.											.	TTN-636	0			c.G15634T						.						199.0	188.0	191.0					2																	179598482		1906	4138	6044	SO:0001587	stop_gained	7273	exon53			TTTTTCCGTCTTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.14683G>T	2.37:g.179598482C>A	ENSP00000465570:p.Gly4895*	Somatic	251	1		WXS	Illumina HiSeq	Phase_I	197	14	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	54	22.899424	0.99951	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.0214	0.47720	0.0:0.8884:0.0:0.1116	.	.	.	.	X	3968	.	ENSP00000343764:G3968X	G	-	1	0	TTN	179306727	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.981000	0.56902	2.734000	0.93682	0.655000	0.94253	GGA	.		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SESTD1	91404	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179986590	179986590	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:179986590G>A	ENST00000428443.3	-	13	1665	c.1349C>T	c.(1348-1350)tCc>tTc	p.S450F		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	450							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			ATAGGCCCAGGATGCCTGATT	0.393																																					p.S450F		.											.	SESTD1-228	0			c.C1349T						.						109.0	106.0	107.0					2																	179986590		2203	4300	6503	SO:0001583	missense	91404	exon13			GCCCAGGATGCCT	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.1349C>T	2.37:g.179986590G>A	ENSP00000415332:p.Ser450Phe	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	84	26	NM_178123	0	0	17	33	16	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547863	0.86022	.	.	ENSG00000187231	ENST00000428443	T	0.06371	3.31	5.18	5.18	0.71444	.	0.102206	0.64402	D	0.000001	T	0.06280	0.0162	N	0.24115	0.695	0.80722	D	1	P	0.50943	0.94	B	0.41571	0.36	T	0.50268	-0.8848	9	.	.	.	-0.0059	18.0499	0.89344	0.0:0.0:1.0:0.0	.	450	Q86VW0	SESD1_HUMAN	F	450	ENSP00000415332:S450F	.	S	-	2	0	SESTD1	179694835	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.023000	0.93683	2.584000	0.87258	0.467000	0.42956	TCC	.		0.393	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
ICA1L	130026	broad.mit.edu	37	2	203693626	203693626	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:203693626T>G	ENST00000392237.2	-	3	264	c.107A>C	c.(106-108)aAa>aCa	p.K36T	ICA1L_ENST00000418208.1_Missense_Mutation_p.K36T|ICA1L_ENST00000358299.2_Missense_Mutation_p.K36T|ICA1L_ENST00000425178.1_Missense_Mutation_p.K36T	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like	36										breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATCCTCTTTTTTTCCTGTTGC	0.388																																					p.K36T													.	ICA1L-90	0			c.A107C						.						189.0	175.0	180.0					2																	203693626		2203	4300	6503	SO:0001583	missense	130026	exon4			TCTTTTTTTCCTG	AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.107A>C	2.37:g.203693626T>G	ENSP00000376070:p.Lys36Thr	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	161	4	NM_178231	0	0	4	4	0	B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	Missense_Mutation	SNP	ENST00000392237.2	37	CCDS2354.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.302954	0.60195	.	.	ENSG00000163596	ENST00000392237;ENST00000358299;ENST00000420558;ENST00000425178;ENST00000418208;ENST00000450143;ENST00000435143;ENST00000419460;ENST00000441547;ENST00000412210;ENST00000457524;ENST00000432273;ENST00000416760;ENST00000454326;ENST00000411681;ENST00000421334	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21	6.02	4.84	0.62591	Arfaptin-like (1);	0.046952	0.85682	D	0.000000	D	0.84893	0.5573	M	0.66378	2.025	0.53688	D	0.999973	D;D	0.71674	0.979;0.998	D;D	0.75484	0.925;0.986	D	0.83552	0.0102	10	0.40728	T	0.16	.	10.553	0.45101	0.0:0.0766:0.0:0.9234	.	36;36	Q96Q33;Q8NDH6	.;ICA1L_HUMAN	T	36	ENSP00000376070:K36T;ENSP00000351047:K36T;ENSP00000400249:K36T;ENSP00000404189:K36T;ENSP00000412158:K36T;ENSP00000410747:K36T;ENSP00000405592:K36T;ENSP00000410135:K36T;ENSP00000404618:K36T;ENSP00000387382:K36T;ENSP00000404707:K36T;ENSP00000397827:K36T;ENSP00000392609:K36T;ENSP00000416726:K36T;ENSP00000409741:K36T	ENSP00000351047:K36T	K	-	2	0	ICA1L	203401871	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.187000	0.72039	1.064000	0.40671	0.528000	0.53228	AAA	.		0.388	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256330.1	NM_138468	
ABCB6	10058	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	220074990	220074990	+	Silent	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:220074990G>A	ENST00000265316.3	-	18	2698	c.2382C>T	c.(2380-2382)atC>atT	p.I794I	ABCB6_ENST00000439002.2_Silent_p.I748I	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	794	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGATGACGAGGATCTGGTCAG	0.562																																					p.I794I		.											.	ABCB6-153	0			c.C2382T						.						102.0	97.0	99.0					2																	220074990		2203	4300	6503	SO:0001819	synonymous_variant	10058	exon18			GACGAGGATCTGG	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.2382C>T	2.37:g.220074990G>A		Somatic	129	0		WXS	Illumina HiSeq	Phase_I	126	8	NM_005689	0	0	62	63	1	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Silent	SNP	ENST00000265316.3	37	CCDS2436.1	.	.	.	.	.	.	.	.	.	.	G	9.909	1.208939	0.22205	.	.	ENSG00000115657	ENST00000295750	.	.	.	4.83	0.378	0.16204	.	.	.	.	.	T	0.56062	0.1960	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49579	-0.8925	4	.	.	.	-23.7644	9.3287	0.38008	0.3743:0.0:0.6257:0.0	.	.	.	.	F	642	.	.	S	-	2	0	ABCB6	219783234	1.000000	0.71417	0.992000	0.48379	0.984000	0.73092	0.893000	0.28336	0.171000	0.19730	-0.145000	0.13849	TCC	.		0.562	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
LSS	4047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47615617	47615617	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr21:47615617G>A	ENST00000397728.3	-	19	1868	c.1790C>T	c.(1789-1791)gCc>gTc	p.A597V	AP001468.1_ENST00000594486.1_5'Flank|LSS_ENST00000522411.1_Missense_Mutation_p.A586V|LSS_ENST00000457828.2_Missense_Mutation_p.A517V|LSS_ENST00000356396.4_Missense_Mutation_p.A597V	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	597					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)	p.A597V(1)		cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					CCCCATACAGGCGAAGGCCTC	0.582																																					p.A597V	Pancreas(114;955 2313 34923 50507)	.											.	LSS-90	1	Substitution - Missense(1)	skin(1)	c.C1790T						.						127.0	109.0	115.0					21																	47615617		2203	4300	6503	SO:0001583	missense	4047	exon19			ATACAGGCGAAGG	U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.1790C>T	21.37:g.47615617G>A	ENSP00000380837:p.Ala597Val	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	67	51	NM_001001438	0	0	1	14	13	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	ENST00000397728.3	37	CCDS13733.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738473	0.69304	.	.	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	5.61	5.61	0.85477	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.098347	0.64402	D	0.000001	T	0.31670	0.0804	L	0.39692	1.235	0.80722	D	1	D;D	0.62365	0.979;0.991	B;P	0.49922	0.393;0.626	T	0.01205	-1.1419	10	0.19590	T	0.45	.	19.224	0.93810	0.0:0.0:1.0:0.0	.	586;597	E9PEI9;P48449	.;ERG7_HUMAN	V	597;517;597;586	ENSP00000348762:A597V;ENSP00000409191:A517V;ENSP00000380837:A597V;ENSP00000429133:A586V	ENSP00000348762:A597V	A	-	2	0	LSS	46440045	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	9.232000	0.95325	2.633000	0.89246	0.655000	0.94253	GCC	.		0.582	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2		
PRMT2	3275	bcgsc.ca	37	21	48083430	48083430	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr21:48083430G>A	ENST00000397637.1	+	10	2187	c.1233G>A	c.(1231-1233)tgG>tgA	p.W411*	PRMT2_ENST00000451211.2_Intron|PRMT2_ENST00000355680.3_Nonsense_Mutation_p.W411*|PRMT2_ENST00000291705.6_Intron|PRMT2_ENST00000440086.1_Nonsense_Mutation_p.W309*|PRMT2_ENST00000458387.2_Missense_Mutation_p.G264S|PRMT2_ENST00000397638.2_Nonsense_Mutation_p.W411*			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	411	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		CTCTGAGCTGGGCTGTCACTT	0.542																																					p.W411X													.	PRMT2-91	0			c.G1233A						.						136.0	120.0	125.0					21																	48083430		2203	4300	6503	SO:0001587	stop_gained	3275	exon11			GAGCTGGGCTGTC	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.1233G>A	21.37:g.48083430G>A	ENSP00000380759:p.Trp411*	Somatic	89	0		WXS	Illumina HiSeq	Phase_1	49	4	NM_206962	0	0	88	88	0	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Nonsense_Mutation	SNP	ENST00000397637.1	37	CCDS13737.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	46|46	12.763896|12.763896	0.99694|0.99694	.|.	.|.	ENSG00000160310|ENSG00000160310	ENST00000458387|ENST00000355680;ENST00000397638;ENST00000397637;ENST00000440086	T|.	0.75938|.	-0.98|.	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	.|0.195548	.|0.48767	.|D	.|0.000171	T|.	0.72104|.	0.3419|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	P|.	0.35433|.	0.501|.	B|.	0.22386|.	0.039|.	T|.	0.70722|.	-0.4794|.	7|.	.|.	.|.	.|.	-16.0416|-16.0416	16.504|16.504	0.84264|0.84264	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	264|.	B7U631|.	.|.	S|X	264|411;411;411;309	ENSP00000407463:G264S|.	.|.	G|W	+|+	1|3	0|0	PRMT2|PRMT2	46907858|46907858	1.000000|1.000000	0.71417|0.71417	0.962000|0.962000	0.40283|0.40283	0.939000|0.939000	0.58152|0.58152	6.436000|6.436000	0.73417|0.73417	2.583000|2.583000	0.87209|0.87209	0.561000|0.561000	0.74099|0.74099	GGC|TGG	.		0.542	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207401.1	NM_001535	
APOL3	80833	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	36556768	36556768	+	Missense_Mutation	SNP	G	G	T	rs11089781	byFrequency	TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr22:36556768G>T	ENST00000349314.2	-	1	209	c.172C>A	c.(172-174)Cag>Aag	p.Q58K	APOL3_ENST00000361710.2_5'UTR|APOL3_ENST00000397293.2_5'UTR|APOL3_ENST00000424878.2_5'UTR|APOL3_ENST00000397287.2_5'UTR	NM_145640.2	NP_663615.1	O95236	APOL3_HUMAN	apolipoprotein L, 3	58					inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(1)|lung(1)|stomach(1)	5						GTTCTGAGCTGTGTGGATCCC	0.512																																					p.Q58K		.											.	APOL3-90	0			c.C172A						.						149.0	122.0	131.0					22																	36556768		2203	4300	6503	SO:0001583	missense	80833	exon1			TGAGCTGTGTGGA	AF305227	CCDS13922.1, CCDS13924.1	22q13.1	2013-01-24			ENSG00000128284	ENSG00000128284		"""Apolipoproteins"""	14868	protein-coding gene	gene with protein product		607253				11374903	Standard	NM_145640		Approved	CG12-1, APOLIII	uc003aot.3	O95236	OTTHUMG00000150632	ENST00000349314.2:c.172C>A	22.37:g.36556768G>T	ENSP00000344577:p.Gln58Lys	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	75	11	NM_145640	0	0	87	87	0	B1AHI4|B1AHI5|Q5U5N4|Q9BQ82|Q9BQA3	Missense_Mutation	SNP	ENST00000349314.2	37	CCDS13922.1	.	.	.	.	.	.	.	.	.	.	G	5.735	0.320098	0.10845	.	.	ENSG00000128284	ENST00000349314;ENST00000531095	T;T	0.60672	3.74;0.17	2.76	1.71	0.24356	.	680.984000	0.00751	U	0.001072	T	0.34890	0.0913	N	0.08118	0	0.23879	N	0.99658	P	0.43477	0.808	B	0.33799	0.17	T	0.40040	-0.9584	10	0.51188	T	0.08	.	6.0512	0.19787	0.1475:0.0:0.8525:0.0	.	58	O95236	APOL3_HUMAN	K	58;22	ENSP00000344577:Q58K;ENSP00000432271:Q22K	ENSP00000344577:Q58K	Q	-	1	0	APOL3	34886714	0.000000	0.05858	0.006000	0.13384	0.005000	0.04900	-0.640000	0.05440	0.726000	0.32339	0.603000	0.83216	CAG	G|0.932;A|0.068		0.512	APOL3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319268.1	NM_145641	
CNOT10	25904	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	32766999	32766999	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr3:32766999G>A	ENST00000328834.5	+	9	1236	c.920G>A	c.(919-921)aGc>aAc	p.S307N	CNOT10_ENST00000331889.6_Missense_Mutation_p.S307N|CNOT10_ENST00000463697.1_3'UTR|CNOT10_ENST00000538368.1_Missense_Mutation_p.S79N|CNOT10_ENST00000454516.2_Missense_Mutation_p.S367N	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	307					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						TTTGCCATGAGCAAGCACAAT	0.393																																					p.S367N		.											.	CNOT10-91	0			c.G1100A						.						148.0	145.0	146.0					3																	32766999		2203	4300	6503	SO:0001583	missense	25904	exon9			CCATGAGCAAGCA	BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.920G>A	3.37:g.32766999G>A	ENSP00000330060:p.Ser307Asn	Somatic	177	0		WXS	Illumina HiSeq	Phase_I	133	8	NM_001256742	0	0	19	24	5	B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Missense_Mutation	SNP	ENST00000328834.5	37	CCDS2655.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689299	0.68271	.	.	ENSG00000182973	ENST00000331889;ENST00000328834;ENST00000540405;ENST00000538368;ENST00000454516	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.52	5.52	0.82312	Tetratricopeptide-like helical (1);	0.043732	0.85682	D	0.000000	T	0.39279	0.1072	N	0.03608	-0.345	0.47037	D	0.999297	B;B;B;B	0.17465	0.022;0.011;0.019;0.014	B;B;B;B	0.19946	0.027;0.012;0.019;0.02	T	0.23013	-1.0200	10	0.39692	T	0.17	-16.0206	19.4425	0.94827	0.0:0.0:1.0:0.0	.	367;307;306;307	F8WAF2;Q9H9A5-3;Q9H9A5-2;Q9H9A5	.;.;.;CNOTA_HUMAN	N	307;307;207;79;367	ENSP00000329376:S307N;ENSP00000330060:S307N;ENSP00000442552:S79N;ENSP00000399862:S367N	ENSP00000330060:S307N	S	+	2	0	CNOT10	32742003	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.348000	0.97062	2.594000	0.87642	0.655000	0.94253	AGC	.		0.393	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253248.2	NM_015442	
RAD54L2	23132	hgsc.bcm.edu;bcgsc.ca	37	3	51664392	51664392	+	Missense_Mutation	SNP	A	A	G	rs562443962	byFrequency	TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr3:51664392A>G	ENST00000409535.2	+	5	711	c.586A>G	c.(586-588)Agc>Ggc	p.S196G	RAD54L2_ENST00000296477.3_Intron	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	196						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GGATGAAAAAAGCAGTCGAGA	0.502																																					p.S196G		.											.	RAD54L2-93	0			c.A586G						.						126.0	114.0	118.0					3																	51664392		2203	4300	6503	SO:0001583	missense	23132	exon5			GAAAAAAGCAGTC	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.586A>G	3.37:g.51664392A>G	ENSP00000386520:p.Ser196Gly	Somatic	105	1		WXS	Illumina HiSeq	Phase_I	79	4	NM_015106	0	0	0	0	0	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	A	13.31	2.197689	0.38806	.	.	ENSG00000164080	ENST00000409535	T	0.22539	1.95	5.92	4.77	0.60923	.	0.400829	0.31347	N	0.007812	T	0.07458	0.0188	N	0.01352	-0.895	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21586	-1.0241	10	0.22109	T	0.4	-10.2268	11.1025	0.48184	0.9282:0.0:0.0718:0.0	.	196	Q9Y4B4	ARIP4_HUMAN	G	196	ENSP00000386520:S196G	ENSP00000386520:S196G	S	+	1	0	RAD54L2	51639432	1.000000	0.71417	0.997000	0.53966	0.921000	0.55340	3.547000	0.53663	1.069000	0.40788	0.533000	0.62120	AGC	.		0.502	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
CHIC2	26511	hgsc.bcm.edu	37	4	54876297	54876297	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr4:54876297A>C	ENST00000263921.3	-	6	852	c.463T>G	c.(463-465)Ttt>Gtt	p.F155V	FIP1L1_ENST00000507166.1_Intron|CHIC2_ENST00000512964.1_Missense_Mutation_p.F136V	NM_012110.3	NP_036242.1	Q9UKJ5	CHIC2_HUMAN	cysteine-rich hydrophobic domain 2	155						Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	all_cancers(7;0.0193)|all_neural(26;0.0209)|Lung NSC(11;0.0281)|Glioma(25;0.08)		LUSC - Lung squamous cell carcinoma(32;0.00216)			TTTGGTAAAAATTCTATGAGG	0.299			T	ETV6	AML																																p.F155V		.		Dom	yes		4	4q11-q12	26511	cysteine-rich hydrophobic domain 2		L	.	CHIC2-1082	0			c.T463G						.						49.0	51.0	51.0					4																	54876297		2203	4299	6502	SO:0001583	missense	26511	exon6			GTAAAAATTCTAT	AF159423	CCDS3493.1	4q12	2013-09-04			ENSG00000109220	ENSG00000109220			1935	protein-coding gene	gene with protein product		604332				10477709	Standard	NM_012110		Approved	BTL	uc003haj.2	Q9UKJ5	OTTHUMG00000102101	ENST00000263921.3:c.463T>G	4.37:g.54876297A>C	ENSP00000263921:p.Phe155Val	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_012110	0	0	9	9	0	B2R639	Missense_Mutation	SNP	ENST00000263921.3	37	CCDS3493.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.06|15.06	2.720392|2.720392	0.48728|0.48728	.|.	.|.	ENSG00000109220|ENSG00000109220	ENST00000263921;ENST00000512964|ENST00000510894	.|.	.|.	.|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72985|0.72985	0.3529|0.3529	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	B|.	0.14012|.	0.009|.	B|.	0.19391|.	0.025|.	T|T	0.72283|0.72283	-0.4339|-0.4339	9|5	0.45353|.	T|.	0.12|.	.|.	16.0516|16.0516	0.80765|0.80765	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	155|.	Q9UKJ5|.	CHIC2_HUMAN|.	V|S	155;136|126	.|.	ENSP00000263921:F155V|.	F|I	-|-	1|2	0|0	CHIC2|CHIC2	54571054|54571054	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.509000|8.509000	0.90529|0.90529	2.181000|2.181000	0.69327|0.69327	0.455000|0.455000	0.32223|0.32223	TTT|ATT	.		0.299	CHIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219937.2		
FHDC1	85462	bcgsc.ca	37	4	153886112	153886112	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr4:153886112T>C	ENST00000511601.1	+	9	1273	c.1085T>C	c.(1084-1086)gTt>gCt	p.V362A	FHDC1_ENST00000260008.3_Missense_Mutation_p.V362A			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	362	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.								ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					TTGCATCATGTTCAGAAGACT	0.313																																					p.V362A													.	FHDC1-136	0			c.T1085C						.						72.0	78.0	76.0					4																	153886112		2203	4298	6501	SO:0001583	missense	85462	exon8			ATCATGTTCAGAA	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.1085T>C	4.37:g.153886112T>C	ENSP00000427567:p.Val362Ala	Somatic	155	0		WXS	Illumina HiSeq	Phase_1	101	4	NM_033393	0	0	5	5	0		Missense_Mutation	SNP	ENST00000511601.1	37	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.305972	0.60305	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.63744	-0.06;-0.06	5.49	5.49	0.81192	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.349721	0.28431	N	0.015377	D	0.82282	0.5003	M	0.88570	2.965	0.58432	D	0.999997	D	0.89917	1.0	D	0.79784	0.993	D	0.85958	0.1468	10	0.87932	D	0	.	15.8895	0.79286	0.0:0.0:0.0:1.0	.	362	Q9C0D6	FHDC1_HUMAN	A	362	ENSP00000427567:V362A;ENSP00000260008:V362A	ENSP00000260008:V362A	V	+	2	0	FHDC1	154105562	1.000000	0.71417	0.969000	0.41365	0.621000	0.37620	7.317000	0.79018	2.207000	0.71202	0.533000	0.62120	GTT	.		0.313	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
TAS2R1	50834	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	9629374	9629374	+	Silent	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr5:9629374G>A	ENST00000382492.2	-	1	1089	c.771C>T	c.(769-771)ttC>ttT	p.F257F	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	257					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						ACAGAAAGATGAACCTTCTGA	0.378																																					p.F257F		.											.	TAS2R1-93	0			c.C771T						.						97.0	101.0	100.0					5																	9629374		2203	4300	6503	SO:0001819	synonymous_variant	50834	exon1			AAAGATGAACCTT	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.771C>T	5.37:g.9629374G>A		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	85	7	NM_019599	0	0	0	0	0	Q646G8	Silent	SNP	ENST00000382492.2	37	CCDS3876.1																																																																																			.		0.378	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2		
HCN1	348980	ucsc.edu	37	5	45461992	45461992	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr5:45461992G>A	ENST00000303230.4	-	3	1024	c.967C>T	c.(967-969)Cag>Tag	p.Q323*		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	323					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						GGGAAGTCCTGCAGTAGTGGT	0.428																																					p.Q323X													.	HCN1-91	0			c.C967T						.						75.0	74.0	74.0					5																	45461992		2203	4300	6503	SO:0001587	stop_gained	348980	exon3			AGTCCTGCAGTAG	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.967C>T	5.37:g.45461992G>A	ENSP00000307342:p.Gln323*	Somatic	60	0		WXS	Illumina HiSeq		41	4	NM_021072	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000303230.4	37	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	G	38	6.874056	0.97901	.	.	ENSG00000164588	ENST00000303230	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.8983	0.96975	0.0:0.0:1.0:0.0	.	.	.	.	X	323	.	ENSP00000307342:Q323X	Q	-	1	0	HCN1	45497749	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.857000	0.99534	2.718000	0.92993	0.650000	0.86243	CAG	.		0.428	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
SHROOM1	134549	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	132161119	132161119	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr5:132161119C>T	ENST00000378679.3	-	4	1518	c.714G>A	c.(712-714)ccG>ccA	p.P238P	SHROOM1_ENST00000378676.1_Silent_p.P238P|SHROOM1_ENST00000319854.3_Silent_p.P238P|SHROOM1_ENST00000488072.1_5'Flank	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	238					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATTCCCGCGCCGGCCCACCGC	0.682																																					p.P238P		.											.	SHROOM1-91	0			c.G714A						.																																			SO:0001819	synonymous_variant	134549	exon1			CCGCGCCGGCCCA	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.714G>A	5.37:g.132161119C>T		Somatic	25	0		WXS	Illumina HiSeq	Phase_I	11	8	NM_133456	0	0	1	1	0	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Silent	SNP	ENST00000378679.3	37	CCDS54902.1																																																																																			.		0.682	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
PCDHGA2	56113	broad.mit.edu	37	5	140720783	140720783	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr5:140720783T>G	ENST00000394576.2	+	1	2245	c.2245T>G	c.(2245-2247)Ttc>Gtc	p.F749V	PCDHGA3_ENST00000253812.6_5'Flank|PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	749					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTTCGGGCTTTCCTGCAGAC	0.627																																					p.F749V													.	PCDHGA2-71	0			c.T2245G						.						72.0	76.0	75.0					5																	140720783		2203	4300	6503	SO:0001583	missense	56113	exon1			CGGGCTTTCCTGC	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2245T>G	5.37:g.140720783T>G	ENSP00000378077:p.Phe749Val	Somatic	211	0		WXS	Illumina HiSeq	Phase_I	149	3	NM_018915	0	0	2	2	0	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	14.19	2.460361	0.43736	.	.	ENSG00000081853	ENST00000394576	T	0.44482	0.92	5.39	5.39	0.77823	.	0.000000	0.43579	U	0.000547	T	0.70011	0.3175	H	0.94542	3.55	0.25255	N	0.989647	D;D	0.62365	0.989;0.991	D;P	0.66847	0.947;0.852	T	0.69457	-0.5140	10	0.66056	D	0.02	.	9.5959	0.39573	0.0:0.0792:0.0:0.9208	.	749;749	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	V	749	ENSP00000378077:F749V	ENSP00000378077:F749V	F	+	1	0	PCDHGA2	140700967	0.001000	0.12720	0.914000	0.36105	0.053000	0.15095	0.253000	0.18296	2.051000	0.60960	0.402000	0.26972	TTC	.		0.627	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
RUNX2	860	hgsc.bcm.edu	37	6	45390482	45390482	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr6:45390482C>G	ENST00000371438.1	+	2	569	c.211C>G	c.(211-213)Cag>Gag	p.Q71E	RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000576263.1_Missense_Mutation_p.Q71E|RUNX2_ENST00000465038.2_Missense_Mutation_p.Q71E|RUNX2_ENST00000371436.6_Missense_Mutation_p.Q71E|RUNX2_ENST00000541979.1_Missense_Mutation_p.Q139E|RUNX2_ENST00000371432.3_Missense_Mutation_p.Q57E|RUNX2_ENST00000352853.5_Missense_Mutation_p.Q139E|RUNX2_ENST00000359524.5_Missense_Mutation_p.Q57E	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	71	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						gcagcagcagcaggaggcggc	0.716																																					p.Q71E		.											.	RUNX2-417	0			c.C211G						.						6.0	10.0	9.0					6																	45390482		1279	2789	4068	SO:0001583	missense	860	exon3			CAGCAGCAGGAGG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.211C>G	6.37:g.45390482C>G	ENSP00000360493:p.Gln71Glu	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	28	3	NM_001024630	0	0	0	0	0	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985548	0.35036	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08	3.45	3.45	0.39498	.	1.972660	0.03402	N	0.203449	T	0.19248	0.0462	N	0.14661	0.345	0.27094	N	0.962779	B;B;B	0.23806	0.033;0.055;0.091	B;B;B	0.20384	0.029;0.013;0.029	T	0.13818	-1.0495	10	0.02654	T	1	.	14.8379	0.70197	0.0:1.0:0.0:0.0	.	139;71;57	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	E	71;139;139;71;71;57;57	ENSP00000420707:Q71E;ENSP00000319087:Q139E;ENSP00000446290:Q139E;ENSP00000360493:Q71E;ENSP00000360491:Q71E;ENSP00000352514:Q57E;ENSP00000360486:Q57E	ENSP00000319087:Q139E	Q	+	1	0	RUNX2	45498460	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.268000	0.33062	1.622000	0.50330	0.407000	0.27541	CAG	.		0.716	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
MTHFD1L	25902	hgsc.bcm.edu	37	6	151358132	151358132	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr6:151358132A>G	ENST00000367321.3	+	26	3000	c.2726A>G	c.(2725-2727)aAg>aGg	p.K909R	AL133260.1_ENST00000408542.1_RNA	NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	909	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TGCATGGCAAAGACCCACCTT	0.463																																					p.K910R		.											.	MTHFD1L-292	0			c.A2729G						.						85.0	79.0	81.0					6																	151358132		2203	4300	6503	SO:0001583	missense	25902	exon26			TGGCAAAGACCCA	BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.2726A>G	6.37:g.151358132A>G	ENSP00000356290:p.Lys909Arg	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	87	6	NM_001242767	0	0	71	71	0	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	ENST00000367321.3	37	CCDS5228.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.951688	0.92660	.	.	ENSG00000120254	ENST00000367321;ENST00000453602;ENST00000450635	T;T;T	0.39787	1.06;1.06;1.06	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.73297	0.3569	H	0.97918	4.105	0.80722	D	1	D;D;D	0.89917	1.0;0.994;1.0	D;D;D	0.91635	0.999;0.914;0.999	D	0.84465	0.0596	10	0.72032	D	0.01	.	15.1893	0.73032	1.0:0.0:0.0:0.0	.	910;664;909	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	R	909;34;8	ENSP00000356290:K909R;ENSP00000391022:K34R;ENSP00000399804:K8R	ENSP00000356290:K909R	K	+	2	0	MTHFD1L	151399825	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	1.974000	0.57490	0.533000	0.62120	AAG	.		0.463	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042699.1	NM_015440	
EPHB6	2051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	142561393	142561393	+	Silent	SNP	A	A	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr7:142561393A>T	ENST00000392957.2	+	6	892	c.105A>T	c.(103-105)gtA>gtT	p.V35V	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Silent_p.V35V	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	35	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					GGGCAGAGGTATTGCTGGACA	0.582																																					p.V35V		.											.	EPHB6-1489	0			c.A105T						.						79.0	75.0	76.0					7																	142561393		2203	4300	6503	SO:0001819	synonymous_variant	2051	exon6			AGAGGTATTGCTG	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.105A>T	7.37:g.142561393A>T		Somatic	100	1		WXS	Illumina HiSeq	Phase_I	86	37	NM_004445	0	0	0	0	0	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	37	CCDS5873.2																																																																																			.		0.582	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
COL22A1	169044	broad.mit.edu	37	8	139767734	139767734	+	Silent	SNP	T	T	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr8:139767734T>C	ENST00000303045.6	-	20	2414	c.1968A>G	c.(1966-1968)aaA>aaG	p.K656K	COL22A1_ENST00000435777.1_Silent_p.K656K	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	656	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCTGTTCCCCTTTCAAGCCCT	0.507										HNSCC(7;0.00092)																											p.K656K													.	COL22A1-103	0			c.A1968G						.						327.0	284.0	299.0					8																	139767734		2203	4300	6503	SO:0001819	synonymous_variant	169044	exon20			TTCCCCTTTCAAG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1968A>G	8.37:g.139767734T>C		Somatic	299	0		WXS	Illumina HiSeq	Phase_I	268	4	NM_152888	0	0	0	0	0	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																			.		0.507	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
KANK1	23189	broad.mit.edu;bcgsc.ca	37	9	732477	732477	+	Silent	SNP	G	G	A	rs569686873|rs370051574		TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr9:732477G>A	ENST00000382303.1	+	10	3757	c.3105G>A	c.(3103-3105)gaG>gaA	p.E1035E	KANK1_ENST00000382297.2_Silent_p.E1035E|KANK1_ENST00000382293.3_Silent_p.E877E|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1035					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TTGAAGAAGAGGAGGAGGAGG	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		19819	0.0		0.0	False		,,,				2504	0.001				p.E1035E													.	KANK1-517	0			c.G3105A						.						153.0	134.0	140.0					9																	732477		2203	4300	6503	SO:0001819	synonymous_variant	23189	exon10			AGAAGAGGAGGAG	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3105G>A	9.37:g.732477G>A		Somatic	176	1		WXS	Illumina HiSeq	Phase_I	130	5	NM_001256876	0	0	51	51	0	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	ENST00000382303.1	37	CCDS34976.1																																																																																			.		0.468	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
CCDC183	84960	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	139694856	139694856	+	Missense_Mutation	SNP	G	G	A	rs544497218	byFrequency	TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr9:139694856G>A	ENST00000338005.6	+	5	489	c.454G>A	c.(454-456)Gag>Aag	p.E152K	KIAA1984_ENST00000371682.3_3'UTR|RP11-216L13.19_ENST00000415992.1_RNA|RP11-216L13.18_ENST00000471502.1_RNA|RP11-216L13.17_ENST00000456614.2_Missense_Mutation_p.E182K	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		152										biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		CCGCCAGCTGGAGAACAACAT	0.602													G|||	3	0.000599042	0.0	0.0	5008	,	,		10479	0.0		0.0	False		,,,				2504	0.0031				p.E152K		.											.	KIAA1984-91	0			c.G454A						.																																			SO:0001583	missense	84960	exon5			CAGCTGGAGAACA																												ENST00000338005.6:c.454G>A	9.37:g.139694856G>A	ENSP00000338013:p.Glu152Lys	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	17	6	NM_001039374	0	0	3	3	0	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	ENST00000338005.6	37	CCDS43906.1	.	.	.	.	.	.	.	.	.	.	G	31	5.059818	0.93846	.	.	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.31510	1.49	4.19	4.19	0.49359	.	0.000000	0.41823	U	0.000810	T	0.50086	0.1595	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.49360	-0.8948	10	0.48119	T	0.1	-24.9723	12.0196	0.53336	0.0:0.0:1.0:0.0	.	152	Q5T5S1	K1984_HUMAN	K	152	ENSP00000338013:E152K	ENSP00000338013:E152K	E	+	1	0	KIAA1984	138814677	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	3.494000	0.53273	1.873000	0.54277	0.305000	0.20034	GAG	.		0.602	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354899.1		
ATP2B3	492	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	152823737	152823737	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chrX:152823737C>T	ENST00000349466.2	+	16	2927	c.2601C>T	c.(2599-2601)gcC>gcT	p.A867A	ATP2B3_ENST00000359149.3_Silent_p.A867A|ATP2B3_ENST00000263519.4_Silent_p.A867A|ATP2B3_ENST00000370186.1_Silent_p.A853A|ATP2B3_ENST00000370181.2_Silent_p.A853A|ATP2B3_ENST00000460549.1_3'UTR|ATP2B3_ENST00000393842.1_Silent_p.A853A			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	867					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGATCGTGGCCTTCACAGGTG	0.582																																					p.A867A		.											.	ATP2B3-109	0			c.C2601T						.						181.0	128.0	146.0					X																	152823737		2203	4300	6503	SO:0001819	synonymous_variant	492	exon15			CGTGGCCTTCACA	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.2601C>T	X.37:g.152823737C>T		Somatic	208	0		WXS	Illumina HiSeq	Phase_I	133	8	NM_001001344	0	0	0	0	0	B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	37	CCDS35440.1																																																																																			.		0.582	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
KLHL35	283212	broad.mit.edu	37	11	75140917	75140917	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr11:75140917delA	ENST00000539798.1	-	1	757	c.758delT	c.(757-759)ctgfs	p.L253fs	KLHL35_ENST00000376292.4_Frame_Shift_Del_p.L33fs	NM_001039548.2	NP_001034637.2	Q6PF15	KLH35_HUMAN	kelch-like family member 35	253										lung(2)|stomach(1)	3						CACCTTCTCCAGGAAGTAAGC	0.751																																					p.L253fs	Colon(77;683 1691 18820 23811)												.	.	0			c.758delT						.						3.0	4.0	4.0					11																	75140917		1441	3421	4862	SO:0001589	frameshift_variant	283212	exon1			TTCTCCAGGAAGT		CCDS44685.1, CCDS44685.2	11q13.4	2013-02-22	2013-02-22		ENSG00000149243	ENSG00000149243		"""Kelch-like"", ""BTB/POZ domain containing"""	26597	protein-coding gene	gene with protein product			"""kelch-like 35 (Drosophila)"""				Standard	NM_001039548		Approved	FLJ33790	uc001owm.2	Q6PF15	OTTHUMG00000133573	ENST00000539798.1:c.758delT	11.37:g.75140917delA	ENSP00000438526:p.Leu253fs	Somatic	3	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_001039548	0	0	0	0	0	A2RU06|F5H412|Q86XM7|Q8NBB1	Frame_Shift_Del	DEL	ENST00000539798.1	37	CCDS44685.2																																																																																			.		0.751	KLHL35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173583	
PUS3	83480	broad.mit.edu	37	11	125766029	125766029	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr11:125766029delT	ENST00000530811.1	-	1	196	c.151delA	c.(151-153)actfs	p.T51fs	PUS3_ENST00000227474.3_Frame_Shift_Del_p.T51fs|HYLS1_ENST00000526028.1_Intron|HYLS1_ENST00000425380.2_Intron|HYLS1_ENST00000356438.3_Intron			Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	51					tRNA pseudouridine synthesis (GO:0031119)	nucleus (GO:0005634)	pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		GCACGCTTAGTTTTTCCAGCT	0.448																																					p.T51fs													.	PUS3-91	0			c.151delA						.						230.0	226.0	227.0					11																	125766029		2201	4299	6500	SO:0001589	frameshift_variant	83480	exon2			GCTTAGTTTTTCC	BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05							25461	protein-coding gene	gene with protein product						12477932	Standard	NM_031307		Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.151delA	11.37:g.125766029delT	ENSP00000432386:p.Thr51fs	Somatic	249	0		WXS	Illumina HiSeq	Phase_I	238	18	NM_031307	0	0	0	0	0	B2RAM0|Q96D17|Q96J23|Q96NB4	Frame_Shift_Del	DEL	ENST00000530811.1	37	CCDS8466.1																																																																																			.		0.448	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386783.1	NM_031307	
KANSL2	54934	broad.mit.edu	37	12	49062988	49062988	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr12:49062988delT	ENST00000420613.2	-	6	824	c.777delA	c.(775-777)aaafs	p.K259fs	KANSL2_ENST00000550347.1_Frame_Shift_Del_p.K442fs|KANSL2_ENST00000553086.1_Frame_Shift_Del_p.K259fs|KANSL2_ENST00000357861.3_Frame_Shift_Del_p.K64fs|SNORA2B_ENST00000384583.1_RNA	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	259					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											GTCGCAGACATTTTAATCGCT	0.502																																					p.K259fs													.	.	0			c.777delA						.						75.0	68.0	70.0					12																	49062988		1932	4130	6062	SO:0001589	frameshift_variant	54934	exon6			CAGACATTTTAAT	AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.777delA	12.37:g.49062988delT	ENSP00000415436:p.Lys259fs	Somatic	6	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_017822	0	0	0	0	0	Q8N3B5|Q96CV0|Q9NX51	Frame_Shift_Del	DEL	ENST00000420613.2	37	CCDS44869.1																																																																																			.		0.502	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822	
B2M	567	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	45003781	45003782	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr15:45003781_45003782delCT	ENST00000558401.1	+	1	107_108	c.37_38delCT	c.(37-39)ctcfs	p.L13fs	PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Frame_Shift_Del_p.L13fs|B2M_ENST00000544417.1_Frame_Shift_Del_p.L13fs	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	13					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L15fs*41(4)|p.A11fs*42(1)|p.L13F(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GCTCGCGCTACTCTCTCTTTCT	0.614																																					p.13_13del		.											.	B2M-93	6	Deletion - Frameshift(5)|Substitution - Missense(1)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|skin(1)	c.37_38del						.																																			SO:0001589	frameshift_variant	567	exon1			.	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.37_38delCT	15.37:g.45003787_45003788delCT	ENSP00000452780:p.Leu13fs	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	58	10	NM_004048	0	0	0	0	0	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Frame_Shift_Del	DEL	ENST00000558401.1	37	CCDS10113.1																																																																																			.		0.614	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
STARD3	10948	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	37809843	37809854	+	In_Frame_Del	DEL	CCTCCCTGGGCT	CCTCCCTGGGCT	-	rs371019835		TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	CCTCCCTGGGCT	CCTCCCTGGGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr17:37809843_37809854delCCTCCCTGGGCT	ENST00000336308.5	+	2	277_288	c.59_70delCCTCCCTGGGCT	c.(58-72)gcctccctgggctcc>gcc	p.SLGS21del	STARD3_ENST00000578232.1_Intron|STARD3_ENST00000394250.4_In_Frame_Del_p.SLGS21del|STARD3_ENST00000580611.1_In_Frame_Del_p.SLGS21del|STARD3_ENST00000544210.2_In_Frame_Del_p.SLGS21del	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	21					cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCTGCCGTGGCCTCCCTGGGCTCCTCACTGTC	0.684											OREG0024381	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.20_24del		.											.	STARD3-90	0			c.59_70del						.																																			SO:0001651	inframe_deletion	10948	exon2			.		CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.59_70delCCTCCCTGGGCT	17.37:g.37809843_37809854delCCTCCCTGGGCT	ENSP00000337446:p.Ser21_Ser24del	Somatic	76	0	873	WXS	Illumina HiSeq	Phase_I	60	20	NM_006804	0	0	0	0	0	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	In_Frame_Del	DEL	ENST00000336308.5	37	CCDS11341.1																																																																																			.		0.684	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256933.1		
TAF1B	9014	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	10059757	10059763	+	Frame_Shift_Del	DEL	GCACACT	GCACACT	-	rs59159809		TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	GCACACT	GCACACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:10059757_10059763delGCACACT	ENST00000263663.5	+	14	1561_1567	c.1373_1379delGCACACT	c.(1372-1380)agcacactgfs	p.STL458fs	TAF1B_ENST00000396242.3_Frame_Shift_Del_p.STL203fs	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	458					gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AAACAATTTAGCACACTGGTCGAGTCA	0.391																																					p.458_460del		.											.	TAF1B-92	0			c.1373_1379del						.																																			SO:0001589	frameshift_variant	9014	exon14			.	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1373_1379delGCACACT	2.37:g.10059757_10059763delGCACACT	ENSP00000263663:p.Ser458fs	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	101	17	NM_005680	0	0	0	0	0	B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	ENST00000263663.5	37	CCDS33143.1																																																																																			.		0.391	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2	NM_005680	
TCFL5	10732	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	61490803	61490806	+	Frame_Shift_Del	DEL	AGAA	AGAA	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	AGAA	AGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr20:61490803_61490806delAGAA	ENST00000335351.3	-	3	996_999	c.904_907delTTCT	c.(904-909)ttctgtfs	p.FC302fs	TCFL5_ENST00000217162.5_Frame_Shift_Del_p.FC254fs	NM_006602.2	NP_006593.2	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 (basic helix-loop-helix)	302					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|urinary_tract(1)	9	Breast(26;5.68e-08)					TGCTGATAACAGAAAGAAAATGCT	0.387																																					p.302_303del		.											.	TCFL5-581	0			c.904_907del						.																																			SO:0001589	frameshift_variant	10732	exon3			.	AB012124	CCDS13506.1	20q13.33	2013-09-19			ENSG00000101190	ENSG00000101190		"""Basic helix-loop-helix proteins"""	11646	protein-coding gene	gene with protein product	"""HPV-16 E2 binding protein 1"""	604745				9763657	Standard	XM_005260185		Approved	Figlb, E2BP-1, CHA, bHLHe82	uc002ydp.3	Q9UL49	OTTHUMG00000032939	ENST00000335351.3:c.904_907delTTCT	20.37:g.61490807_61490810delAGAA	ENSP00000334294:p.Phe302fs	Somatic	228	0		WXS	Illumina HiSeq	Phase_I	210	74	NM_006602	0	0	0	0	0	O94771|Q9BYW0	Frame_Shift_Del	DEL	ENST00000335351.3	37	CCDS13506.1																																																																																			.		0.387	TCFL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080079.2	NM_006602	
NF2	4771	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	30061052	30061052	+	Splice_Site	DEL	T	T	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr22:30061052delT	ENST00000338641.4	+	9	1325	c.884delT	c.(883-885)ctg>cg	p.L295fs	NF2_ENST00000361166.4_Splice_Site_p.L295fs|NF2_ENST00000403999.3_Splice_Site_p.L295fs|NF2_ENST00000413209.2_Intron|NF2_ENST00000334961.7_Splice_Site_p.L212fs|NF2_ENST00000361452.4_Splice_Site_p.L254fs|NF2_ENST00000403435.1_Splice_Site_p.L295fs|NF2_ENST00000397789.3_Splice_Site_p.L295fs|NF2_ENST00000347330.5_Splice_Site_p.L136fs|NF2_ENST00000353887.4_Splice_Site_p.L212fs|NF2_ENST00000361676.4_Splice_Site_p.L253fs	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	295	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)|p.F271_L295del(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						GTTAATAAGCTGGTAAGTTGA	0.333			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.L295fs		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	4	Unknown(3)|Deletion - In frame(1)	central_nervous_system(2)|large_intestine(1)|stomach(1)	c.884delT	GRCh37	CD070492	NF2	D		.						111.0	103.0	106.0					22																	30061052		2202	4300	6502	SO:0001630	splice_region_variant	4771	exon9	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	.	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.885+1T>-	22.37:g.30061052delT		Somatic	28	0		WXS	Illumina HiSeq	Phase_I	24	18	NM_000268	0	0	0	0	0	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Frame_Shift_Del	DEL	ENST00000338641.4	37	CCDS13861.1																																																																																			.		0.333	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	Frame_Shift_Del
CACNG2	10369	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	37098492	37098492	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr22:37098492delT	ENST00000300105.6	-	1	1111	c.130delA	c.(130-132)agtfs	p.S44fs	RP1-293L6.1_ENST00000430281.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	44					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						TCACTGACACTTTTGGTCTTG	0.488																																					p.S44fs		.											.	CACNG2-90	0			c.130delA						.						266.0	225.0	239.0					22																	37098492		2203	4300	6503	SO:0001589	frameshift_variant	10369	exon1			.	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.130delA	22.37:g.37098492delT	ENSP00000300105:p.Ser44fs	Somatic	266	0		WXS	Illumina HiSeq	Phase_I	174	120	NM_006078	0	0	0	0	0	Q2M1M1|Q5TGT3|Q9UGZ7	Frame_Shift_Del	DEL	ENST00000300105.6	37	CCDS13931.1																																																																																			.		0.488	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
B2M	567	broad.mit.edu	37	15	45007645	45007646	+	Frame_Shift_Ins	INS	-	-	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr15:45007645_45007646insA	ENST00000558401.1	+	2	162_163	c.92_93insA	c.(91-96)tcacgtfs	p.R32fs	B2M_ENST00000559916.1_Frame_Shift_Ins_p.R32fs|B2M_ENST00000544417.1_Frame_Shift_Ins_p.R32fs|B2M_ENST00000559220.1_Intron	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	32	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		CAGGTTTACTCACGTCATCCAG	0.411																																					p.S31fs													.	B2M-93	0			c.92_93insA						.																																			SO:0001589	frameshift_variant	567	exon2			TTTACTCACGTCA	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.93dupA	15.37:g.45007646_45007646dupA	ENSP00000452780:p.Arg32fs	Somatic	197	0		WXS	Illumina HiSeq	Phase_I	116	8	NM_004048	0	0	0	0	0	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Frame_Shift_Ins	INS	ENST00000558401.1	37	CCDS10113.1																																																																																			.		0.411	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
