#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF12	390999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	12837407	12837407	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr1:12837407A>T	ENST00000357726.4	+	3	1144	c.1117A>T	c.(1117-1119)Agc>Tgc	p.S373C		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	373					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCCTGCCCTGAGCCGCTGCTC	0.627																																					p.S373C		.											.	PRAMEF12-25	0			c.A1117T						.						99.0	101.0	100.0					1																	12837407		2203	4300	6503	SO:0001583	missense	390999	exon3			GCCCTGAGCCGCT		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.1117A>T	1.37:g.12837407A>T	ENSP00000350358:p.Ser373Cys	Somatic	505	0		WXS	Illumina HiSeq	Phase_I	737	215	NM_001080830	0	0	0	0	0		Missense_Mutation	SNP	ENST00000357726.4	37	CCDS41254.1	.	.	.	.	.	.	.	.	.	.	.	15.97	2.990792	0.54041	.	.	ENSG00000116726	ENST00000357726	T	0.12672	2.66	2.72	1.59	0.23543	.	0.618526	0.16899	N	0.194981	T	0.32102	0.0818	M	0.83384	2.64	0.27627	N	0.948171	D	0.89917	1.0	D	0.85130	0.997	T	0.10451	-1.0629	10	0.56958	D	0.05	.	3.0429	0.06143	0.6004:0.2557:0.1439:0.0	.	373	O95522	PRA12_HUMAN	C	373	ENSP00000350358:S373C	ENSP00000350358:S373C	S	+	1	0	PRAMEF12	12759994	0.357000	0.24938	0.906000	0.35671	0.303000	0.27691	-0.407000	0.07178	0.455000	0.26910	0.164000	0.16699	AGC	.		0.627	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760	
SPEN	23013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	16257911	16257911	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr1:16257911G>A	ENST00000375759.3	+	11	5380	c.5176G>A	c.(5176-5178)Gac>Aac	p.D1726N		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1726					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TTCATCAGGTGACCAGCCGCC	0.587																																					p.D1726N		.											.	SPEN-298	0			c.G5176A						.						136.0	148.0	144.0					1																	16257911		2203	4300	6503	SO:0001583	missense	23013	exon11			TCAGGTGACCAGC		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.5176G>A	1.37:g.16257911G>A	ENSP00000364912:p.Asp1726Asn	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	152	16	NM_015001	0	0	5	6	1	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032932	0.54790	.	.	ENSG00000065526	ENST00000375759	T	0.09163	3.01	5.16	4.25	0.50352	.	.	.	.	.	T	0.08891	0.0220	N	0.24115	0.695	0.09310	N	1	B	0.32245	0.361	B	0.30646	0.118	T	0.24548	-1.0157	9	0.40728	T	0.16	-3.0207	13.4332	0.61068	0.0759:0.0:0.9241:0.0	.	1726	Q96T58	MINT_HUMAN	N	1726	ENSP00000364912:D1726N	ENSP00000364912:D1726N	D	+	1	0	SPEN	16130498	0.999000	0.42202	0.001000	0.08648	0.749000	0.42624	6.058000	0.71126	1.152000	0.42452	0.467000	0.42956	GAC	.		0.587	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
TAL1	6886	broad.mit.edu	37	1	47685614	47685614	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr1:47685614C>G	ENST00000294339.3	-	4	1350	c.774G>C	c.(772-774)aaG>aaC	p.K258N	TAL1_ENST00000371884.2_Missense_Mutation_p.K258N|TAL1_ENST00000459729.1_5'UTR|TAL1_ENST00000371883.3_Missense_Mutation_p.K260N	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	258					angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						CCACAGGGTCCTTGCCAGTCT	0.642			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																p.K258N				Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	.	TAL1-1082	0			c.G774C						.						11.0	11.0	11.0					1																	47685614		2201	4287	6488	SO:0001583	missense	6886	exon4			AGGGTCCTTGCCA	M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.774G>C	1.37:g.47685614C>G	ENSP00000294339:p.Lys258Asn	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	58	16	NM_003189	0	0	0	0	0	D3DQ24	Missense_Mutation	SNP	ENST00000294339.3	37	CCDS547.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673282	0.67928	.	.	ENSG00000162367	ENST00000371884;ENST00000371883;ENST00000294339	D;D;D	0.97811	-4.54;-4.55;-4.54	5.01	4.1	0.47936	Helix-loop-helix DNA-binding (1);	0.120919	0.52532	D	0.000063	D	0.94991	0.8379	L	0.27053	0.805	0.41923	D	0.990522	D	0.60160	0.987	P	0.50708	0.648	D	0.93287	0.6665	10	0.51188	T	0.08	.	5.5117	0.16884	0.0:0.6676:0.0:0.3324	.	258	P17542	TAL1_HUMAN	N	258;260;258	ENSP00000360951:K258N;ENSP00000360950:K260N;ENSP00000294339:K258N	ENSP00000294339:K258N	K	-	3	2	TAL1	47458201	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	0.494000	0.22467	1.344000	0.45657	0.579000	0.79373	AAG	.		0.642	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021640.1	NM_003189	
ABCA4	24	broad.mit.edu	37	1	94486858	94486858	+	Silent	SNP	A	A	G	rs61750561		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr1:94486858A>G	ENST00000370225.3	-	35	5042	c.4956T>C	c.(4954-4956)taT>taC	p.Y1652Y	ABCA4_ENST00000536513.1_5'Flank	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1652			Y -> D (in STGD1). {ECO:0000269|PubMed:10206579}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CGGTGATTCCATACTCCTCGG	0.547																																					p.Y1652Y													.	ABCA4-162	0			c.T4956C	GRCh37	CM012882	ABCA4	M	rs61750561	.						184.0	177.0	180.0					1																	94486858		2203	4300	6503	SO:0001819	synonymous_variant	24	exon35			GATTCCATACTCC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.4956T>C	1.37:g.94486858A>G		Somatic	172	0		WXS	Illumina HiSeq	Phase_I	214	6	NM_000350	0	0	0	0	0	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																			.		0.547	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
NBPF15	284565	broad.mit.edu;bcgsc.ca	37	1	148594427	148594427	+	Missense_Mutation	SNP	G	G	C	rs587634015	byFrequency	TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr1:148594427G>C	ENST00000369187.3	+	19	2289	c.1800G>C	c.(1798-1800)gaG>gaC	p.E600D	NBPF15_ENST00000442702.2_Missense_Mutation_p.E600D	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	600	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					AAGTGGAAGAGCCTGAAGTCT	0.458																																					p.E600D													.	.	0			c.G1800C						.																																			SO:0001583	missense	728936	exon16			GGAAGAGCCTGAA	BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.1800G>C	1.37:g.148594427G>C	ENSP00000358188:p.Glu600Asp	Somatic	485	1		WXS	Illumina HiSeq	Phase_I	550	104	NM_001102663	0	0	27	33	6	Q3BBV9|Q8IX77	Missense_Mutation	SNP	ENST00000369187.3	37	CCDS932.1	.	.	.	.	.	.	.	.	.	.	.	10.47	1.358251	0.24598	.	.	ENSG00000243452	ENST00000442702;ENST00000369187	T;T	0.15372	2.43;2.43	0.502	0.502	0.16932	DUF1220 (2);	.	.	.	.	T	0.19005	0.0456	M	0.86420	2.815	0.09310	N	1	B	0.29188	0.236	P	0.44860	0.462	T	0.41106	-0.9527	8	0.66056	D	0.02	.	.	.	.	.	600	Q8N660	NBPFF_HUMAN	D	600	ENSP00000416864:E600D;ENSP00000358188:E600D	ENSP00000358188:E600D	E	+	3	2	NBPF15	146861051	0.937000	0.31787	0.003000	0.11579	0.003000	0.03518	0.894000	0.28350	0.557000	0.29117	0.377000	0.23210	GAG	G|1.000;A|0.000		0.458	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038609.3	NM_173638	
CADM3	57863	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	159170698	159170698	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr1:159170698G>T	ENST00000368125.4	+	9	1340	c.1183G>T	c.(1183-1185)Gaa>Taa	p.E395*	DARC_ENST00000537147.1_5'Flank|CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000497636.1_3'UTR|CTA-134P22.2_ENST00000609696.1_RNA|CADM3_ENST00000368124.4_Nonsense_Mutation_p.E429*	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	395					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CGACAAGAAGGAATATTTCAT	0.617																																					p.E429X		.											.	CADM3-92	0			c.G1285T						.						78.0	76.0	77.0					1																	159170698		2203	4300	6503	SO:0001587	stop_gained	57863	exon10			AAGAAGGAATATT	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.1183G>T	1.37:g.159170698G>T	ENSP00000357107:p.Glu395*	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	239	25	NM_021189	0	0	0	0	0	Q8IZQ9|Q9NVJ5|Q9UJP1	Nonsense_Mutation	SNP	ENST00000368125.4	37	CCDS44251.1	.	.	.	.	.	.	.	.	.	.	G	38	6.895315	0.97916	.	.	ENSG00000162706	ENST00000368124;ENST00000368125	.	.	.	3.81	3.81	0.43845	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.48571	D	0.999671	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.2211	0.59887	0.0:0.0:1.0:0.0	.	.	.	.	X	429;395	.	ENSP00000357106:E429X	E	+	1	0	CADM3	157437322	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.966000	0.93397	1.965000	0.57142	0.591000	0.81541	GAA	.		0.617	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189	
MROH9	80133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	170965712	170965712	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr1:170965712C>G	ENST00000367758.3	+	14	1501	c.1402C>G	c.(1402-1404)Cta>Gta	p.L468V	MROH9_ENST00000367759.4_Missense_Mutation_p.L468V	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	468																	GGATATTACTCTAATGAAGGA	0.443																																					p.L468V		.											.	.	0			c.C1402G						.						181.0	172.0	175.0					1																	170965712		1873	4113	5986	SO:0001583	missense	80133	exon14			ATTACTCTAATGA	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.1402C>G	1.37:g.170965712C>G	ENSP00000356732:p.Leu468Val	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	138	32	NM_025063	0	0	0	0	0	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	37	CCDS41436.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.85|17.85	3.489337|3.489337	0.64074|0.64074	.|.	.|.	ENSG00000117501|ENSG00000117501	ENST00000367759;ENST00000367758|ENST00000426136	T;T|.	0.67698|.	-0.28;1.49|.	5.75|5.75	5.75|5.75	0.90469|0.90469	Armadillo-like helical (1);|.	0.127327|.	0.36101|.	N|.	0.002798|.	T|T	0.49626|0.49626	0.1568|0.1568	M|M	0.69823|0.69823	2.125|2.125	0.29405|0.29405	N|N	0.86168|0.86168	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.997;0.997|.	T|T	0.49390|0.49390	-0.8945|-0.8945	10|5	0.72032|.	D|.	0.01|.	-13.2876|-13.2876	15.4599|15.4599	0.75346|0.75346	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	468;468|.	F5GWX6;Q5TGP6|.	.;CA129_HUMAN|.	V|C	468|74	ENSP00000356733:L468V;ENSP00000356732:L468V|.	ENSP00000356732:L468V|.	L|S	+|+	1|2	2|0	C1orf129|C1orf129	169232336|169232336	0.790000|0.790000	0.28787|0.28787	0.271000|0.271000	0.24616|0.24616	0.008000|0.008000	0.06430|0.06430	3.549000|3.549000	0.53681|0.53681	2.716000|2.716000	0.92895|0.92895	0.655000|0.655000	0.94253|0.94253	CTA|TCT	.		0.443	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063	
EPHX1	2052	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	226030105	226030105	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr1:226030105T>C	ENST00000366837.4	+	7	1166	c.970T>C	c.(970-972)Tat>Cat	p.Y324H	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.Y324H	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	324					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					TCTGGCTGCCTATATTCTAGA	0.582																																					p.Y324H													.	EPHX1-281	0			c.T970C						.						121.0	130.0	127.0					1																	226030105		2203	4300	6503	SO:0001583	missense	2052	exon7			GCTGCCTATATTC	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.970T>C	1.37:g.226030105T>C	ENSP00000355802:p.Tyr324His	Somatic	104	1		WXS	Illumina HiSeq	Phase_I	132	33	NM_001136018	0	0	52	73	21	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.776408	0.90195	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.08102	3.13;3.13	5.33	5.33	0.75918	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.41050	0.1142	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57248	-0.7844	10	0.87932	D	0	-30.0957	15.5961	0.76583	0.0:0.0:0.0:1.0	.	324	P07099	HYEP_HUMAN	H	324	ENSP00000272167:Y324H;ENSP00000355802:Y324H	ENSP00000272167:Y324H	Y	+	1	0	EPHX1	224096728	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	7.914000	0.87478	2.137000	0.66172	0.533000	0.62120	TAT	.		0.582	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
LYST	1130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	235872510	235872510	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr1:235872510G>A	ENST00000389794.3	-	44	10198	c.10024C>T	c.(10024-10026)Cgg>Tgg	p.R3342W	LYST_ENST00000389793.2_Missense_Mutation_p.R3342W|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3342	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AGAGCCTGCCGATGGATGAGG	0.483																																					p.R3342W		.											.	LYST-143	0			c.C10024T						.						97.0	95.0	96.0					1																	235872510		2203	4300	6503	SO:0001583	missense	1130	exon44			CCTGCCGATGGAT	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.10024C>T	1.37:g.235872510G>A	ENSP00000374444:p.Arg3342Trp	Somatic	275	0		WXS	Illumina HiSeq	Phase_I	291	82	NM_000081	0	0	1	1	0	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601748	0.87055	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.74209	-0.82;-0.82	5.39	4.47	0.54385	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.91345	0.7270	H	0.98005	4.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94675	0.7860	10	0.87932	D	0	.	15.9845	0.80142	0.0:0.0:0.8645:0.1355	.	3342	Q99698	LYST_HUMAN	W	3342	ENSP00000374444:R3342W;ENSP00000374443:R3342W	ENSP00000374443:R3342W	R	-	1	2	LYST	233939133	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.049000	0.71053	1.391000	0.46566	0.655000	0.94253	CGG	.		0.483	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
ACBD5	91452	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	27529275	27529275	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr10:27529275T>G	ENST00000375888.1	-	1	212	c.148A>C	c.(148-150)Aag>Cag	p.K50Q	ACBD5_ENST00000396271.3_Missense_Mutation_p.K52Q|ACBD5_ENST00000375897.3_5'UTR|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000375905.4_Missense_Mutation_p.K17Q|RP11-85G18.6_ENST00000574842.1_lincRNA|ACBD5_ENST00000375901.1_5'UTR			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	50	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.				peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						TGGATCACCTTCACGGCCGCC	0.617																																					p.K52Q		.											.	ACBD5-90	0			c.A154C						.						101.0	91.0	94.0					10																	27529275		2203	4300	6503	SO:0001583	missense	91452	exon2			TCACCTTCACGGC	AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.148A>C	10.37:g.27529275T>G	ENSP00000365049:p.Lys50Gln	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	136	39	NM_145698	0	0	2	4	2	B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	ENST00000375888.1	37		.	.	.	.	.	.	.	.	.	.	T	24.0	4.487454	0.84854	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375888;ENST00000426079;ENST00000412279	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	4.87	4.87	0.63330	.	0.087964	0.85682	D	0.000000	T	0.42921	0.1224	L	0.45352	1.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	T	0.25082	-1.0142	10	0.46703	T	0.11	-20.8054	14.7721	0.69688	0.0:0.0:0.0:1.0	.	52;50	Q5T8D3-3;B7Z2R7	.;.	Q	47;52;17;50;59;17	ENSP00000379568:K52Q;ENSP00000365070:K17Q;ENSP00000365049:K50Q;ENSP00000401591:K59Q;ENSP00000393398:K17Q	ENSP00000365049:K50Q	K	-	1	0	ACBD5	27569281	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.285000	0.58989	1.945000	0.56424	0.383000	0.25322	AAG	.		0.617	ACBD5-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000047314.1	NM_145698	
ATRNL1	26033	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	117075179	117075179	+	Silent	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr10:117075179G>A	ENST00000355044.3	+	18	3096	c.2970G>A	c.(2968-2970)gaG>gaA	p.E990E	ATRNL1_ENST00000423111.2_Silent_p.E87E|ATRNL1_ENST00000303745.7_De_novo_Start_OutOfFrame	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	990	PSI 5.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ACCACAGTGAGATGGTTCTTG	0.413																																					p.E990E													.	ATRNL1-96	0			c.G2970A						.						128.0	119.0	122.0					10																	117075179		2203	4300	6503	SO:0001819	synonymous_variant	26033	exon18			CAGTGAGATGGTT	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2970G>A	10.37:g.117075179G>A		Somatic	136	1		WXS	Illumina HiSeq	Phase_I	152	41	NM_207303	0	0	0	0	0	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	37	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	G	6.849	0.525834	0.13066	.	.	ENSG00000107518	ENST00000526373	.	.	.	5.34	1.35	0.21983	.	.	.	.	.	T	0.52125	0.1715	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42548	-0.9445	4	.	.	.	-8.6523	5.6587	0.17656	0.2884:0.1549:0.5567:0.0	.	.	.	.	N	120	.	.	D	+	1	0	ATRNL1	117065169	1.000000	0.71417	0.996000	0.52242	0.876000	0.50452	1.591000	0.36665	0.628000	0.30357	-0.391000	0.06502	GAT	.		0.413	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1264092	1264092	+	Silent	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:1264092C>T	ENST00000529681.1	+	31	6040	c.5982C>T	c.(5980-5982)cgC>cgT	p.R1994R	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.R1997R	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1994	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTGGACCCGCCTATCACAGA	0.637																																					p.R1994R		.											.	.	0			c.C5982T						.						118.0	172.0	154.0					11																	1264092		2117	4210	6327	SO:0001819	synonymous_variant	727897	exon31			GACCCGCCTATCA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5982C>T	11.37:g.1264092C>T		Somatic	785	0		WXS	Illumina HiSeq	Phase_I	1304	383	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.		0.637	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
NAV2	89797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	19890497	19890497	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:19890497T>A	ENST00000396087.3	+	4	564	c.465T>A	c.(463-465)aaT>aaA	p.N155K	NAV2_ENST00000540292.1_Missense_Mutation_p.N86K|NAV2_ENST00000360655.4_Missense_Mutation_p.N91K|NAV2_ENST00000527559.2_Missense_Mutation_p.N84K|NAV2_ENST00000534229.1_3'UTR|NAV2_ENST00000396085.1_Missense_Mutation_p.N155K|NAV2_ENST00000349880.4_Missense_Mutation_p.N155K	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	155	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CCTGCTTGAATTTCCTGGCAG	0.438																																					p.N155K		.											.	NAV2-96	0			c.T465A						.						70.0	71.0	70.0					11																	19890497		2199	4293	6492	SO:0001583	missense	89797	exon4			CTTGAATTTCCTG	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.465T>A	11.37:g.19890497T>A	ENSP00000379396:p.Asn155Lys	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	53	16	NM_145117	0	0	1	2	1	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	ENST00000396087.3	37	CCDS58126.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.133723	0.56828	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292	T;T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46;0.46	5.87	5.87	0.94306	.	0.090463	0.47852	D	0.000201	T	0.36166	0.0957	N	0.05177	-0.1	0.80722	D	1	B;B	0.20052	0.002;0.041	B;B	0.34722	0.034;0.188	T	0.29610	-1.0006	9	.	.	.	.	13.7906	0.63138	0.0:0.0:0.0:1.0	.	155;91	Q8IVL1-3;Q8IVL1-4	.;.	K	91;155;155;155;84;86	ENSP00000353871:N91K;ENSP00000379394:N155K;ENSP00000309577:N155K;ENSP00000379396:N155K;ENSP00000435395:N84K;ENSP00000443489:N86K	.	N	+	3	2	NAV2	19847073	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.897000	0.39799	2.242000	0.73789	0.533000	0.62120	AAT	.		0.438	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
GAS2	2620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	22759307	22759307	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:22759307G>A	ENST00000454584.2	+	5	771	c.466G>A	c.(466-468)Gca>Aca	p.A156T	GAS2_ENST00000433790.1_Missense_Mutation_p.A156T|GAS2_ENST00000278187.3_Missense_Mutation_p.A156T	NM_001143830.1	NP_001137302.1	O43903	GAS2_HUMAN	growth arrest-specific 2	156	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|regulation of cell shape (GO:0008360)	actin filament (GO:0005884)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(4)|stomach(1)	24						TGGCCGGATTGCAGCCAGGTA	0.458																																					p.A156T		.											.	GAS2-652	0			c.G466A						.						145.0	122.0	130.0					11																	22759307		2203	4300	6503	SO:0001583	missense	2620	exon5			CGGATTGCAGCCA	BC040470	CCDS7858.1	11p14.3	2005-10-11			ENSG00000148935	ENSG00000148935			4167	protein-coding gene	gene with protein product		602835				9521882	Standard	NM_005256		Approved		uc001mqo.3	O43903	OTTHUMG00000166071	ENST00000454584.2:c.466G>A	11.37:g.22759307G>A	ENSP00000401145:p.Ala156Thr	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	210	60	NM_177553	0	0	0	0	0	B2R9C8|D3DQZ0|Q6ICV8|Q7Z3X8	Missense_Mutation	SNP	ENST00000454584.2	37	CCDS7858.1	.	.	.	.	.	.	.	.	.	.	G	34	5.368653	0.95900	.	.	ENSG00000148935	ENST00000528582;ENST00000454584;ENST00000278187;ENST00000532398;ENST00000433790	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.64	5.64	0.86602	Calponin homology domain (3);	0.051266	0.85682	D	0.000000	T	0.70605	0.3243	M	0.82923	2.615	0.52501	D	0.999956	P	0.52316	0.952	P	0.62885	0.908	T	0.74256	-0.3724	10	0.72032	D	0.01	-13.9779	17.5008	0.87731	0.0:0.0:1.0:0.0	.	156	O43903	GAS2_HUMAN	T	156	ENSP00000432584:A156T;ENSP00000401145:A156T;ENSP00000278187:A156T;ENSP00000435946:A156T;ENSP00000396708:A156T	ENSP00000278187:A156T	A	+	1	0	GAS2	22715883	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.950000	0.75977	2.664000	0.90586	0.650000	0.86243	GCA	.		0.458	GAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387717.1	NM_177553	
PAMR1	25891	broad.mit.edu;bcgsc.ca	37	11	35492269	35492269	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:35492269C>A	ENST00000378880.2	-	5	1037	c.592G>T	c.(592-594)Gtc>Ttc	p.V198F	PAMR1_ENST00000278360.3_Missense_Mutation_p.V198F|PAMR1_ENST00000378878.3_Intron|PAMR1_ENST00000532848.1_Missense_Mutation_p.V158F|PAMR1_ENST00000534803.1_5'UTR	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	198	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TTGCCACAGACACGCTTGATG	0.517																																					p.V198F													.	PAMR1-70	0			c.G592T						.						138.0	109.0	119.0					11																	35492269		2202	4298	6500	SO:0001583	missense	25891	exon5			CACAGACACGCTT		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.592G>T	11.37:g.35492269C>A	ENSP00000368158:p.Val198Phe	Somatic	195	1		WXS	Illumina HiSeq	Phase_I	264	16	NM_001001991	0	0	0	0	0	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	ENST00000378880.2	37	CCDS31460.1	.	.	.	.	.	.	.	.	.	.	C	0.044	-1.272703	0.01421	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000532848;ENST00000527605	T;T;T;T	0.14893	2.47;2.47;2.47;2.47	5.39	-1.35	0.09114	CUB (5);	0.174175	0.53938	N	0.000059	T	0.03011	0.0089	N	0.00116	-2.08	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43556	-0.9384	10	0.87932	D	0	.	8.1749	0.31276	0.6507:0.2318:0.1175:0.0	.	198;198	Q6UXH9;Q6UXH9-2	PAMR1_HUMAN;.	F	198;198;158;158	ENSP00000278360:V198F;ENSP00000368158:V198F;ENSP00000433868:V158F;ENSP00000432591:V158F	ENSP00000278360:V198F	V	-	1	0	PAMR1	35448845	1.000000	0.71417	0.947000	0.38551	0.104000	0.19210	3.458000	0.53014	-0.534000	0.06315	-0.181000	0.13052	GTC	.		0.517	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430	
SLC43A3	29015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57182446	57182446	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:57182446G>C	ENST00000395123.2	-	10	1207	c.903C>G	c.(901-903)aaC>aaG	p.N301K	SLC43A3_ENST00000528098.1_5'Flank|SLC43A3_ENST00000395124.1_Missense_Mutation_p.N301K|SLC43A3_ENST00000533524.1_Missense_Mutation_p.N314K|SLC43A3_ENST00000529554.1_Missense_Mutation_p.N301K|SLC43A3_ENST00000352187.1_Missense_Mutation_p.N301K	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	301					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						TCAGCAAGGAGTTGAGAGTGC	0.582																																					p.N301K		.											.	SLC43A3-90	0			c.C903G						.						129.0	110.0	117.0					11																	57182446		2201	4296	6497	SO:0001583	missense	29015	exon10			CAAGGAGTTGAGA	AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.903C>G	11.37:g.57182446G>C	ENSP00000378555:p.Asn301Lys	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	69	21	NM_017611	0	0	4	4	0	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	ENST00000395123.2	37	CCDS7956.1	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434719	0.62955	.	.	ENSG00000134802	ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524;ENST00000530005	T;T;T;T;T;T	0.58652	0.37;0.37;0.37;0.37;0.37;0.32	5.05	4.13	0.48395	Major facilitator superfamily domain, general substrate transporter (1);	0.094270	0.64402	D	0.000001	T	0.58395	0.2119	M	0.71296	2.17	0.43924	D	0.99657	P;B;B	0.37548	0.599;0.186;0.343	B;B;B	0.44278	0.445;0.158;0.314	T	0.56019	-0.8048	10	0.06625	T	0.88	-17.6813	12.7477	0.57289	0.0:0.1658:0.8342:0.0	.	314;301;301	E7EQD2;Q8NBI5;A8K2X6	.;S43A3_HUMAN;.	K	301;301;301;301;314;301	ENSP00000378555:N301K;ENSP00000378556:N301K;ENSP00000337561:N301K;ENSP00000436254:N301K;ENSP00000434515:N314K;ENSP00000435893:N301K	ENSP00000337561:N301K	N	-	3	2	SLC43A3	56939022	1.000000	0.71417	0.996000	0.52242	0.418000	0.31294	6.596000	0.74113	1.117000	0.41842	0.563000	0.77884	AAC	.		0.582	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
PDE2A	5138	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	72292965	72292965	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:72292965C>T	ENST00000334456.5	-	22	2123	c.1878G>A	c.(1876-1878)atG>atA	p.M626I	PDE2A_ENST00000418754.2_Missense_Mutation_p.M511I|PDE2A_ENST00000444035.2_Missense_Mutation_p.M617I|RP11-169D4.2_ENST00000545254.1_RNA|PDE2A_ENST00000376450.3_Missense_Mutation_p.M370I|PDE2A_ENST00000540345.1_Missense_Mutation_p.M617I|PDE2A_ENST00000544570.1_Missense_Mutation_p.M619I	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	626					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	TGATGAAATTCATGTCCTGCA	0.577																																					p.M626I													.	PDE2A-156	0			c.G1878A						.						78.0	79.0	78.0					11																	72292965		2200	4293	6493	SO:0001583	missense	5138	exon22			GAAATTCATGTCC	U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.1878G>A	11.37:g.72292965C>T	ENSP00000334910:p.Met626Ile	Somatic	88	1		WXS	Illumina HiSeq	Phase_I	112	37	NM_002599	0	0	0	0	0	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	ENST00000334456.5	37	CCDS8216.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.890586	0.72524	.	.	ENSG00000186642	ENST00000334456;ENST00000376450;ENST00000444035;ENST00000429363;ENST00000544570;ENST00000418754;ENST00000540345;ENST00000420501;ENST00000441209;ENST00000542223	T;T;T;T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.51	5.51	0.81932	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.058122	0.64402	D	0.000002	T	0.69913	0.3164	L	0.46157	1.445	0.53688	D	0.999977	B;B;B;B;B;B	0.31968	0.162;0.087;0.149;0.349;0.087;0.237	B;B;B;B;B;B	0.33042	0.079;0.051;0.051;0.157;0.051;0.051	T	0.68708	-0.5337	10	0.40728	T	0.16	.	16.1456	0.81563	0.0:1.0:0.0:0.0	.	511;626;617;619;626;370	E9PEF1;O00408;E9PGI1;F6W5Z0;B2R646;Q6ZMR1	.;PDE2A_HUMAN;.;.;.;.	I	626;370;617;695;619;511;617;5;167;57	ENSP00000334910:M626I;ENSP00000365633:M370I;ENSP00000411657:M617I;ENSP00000442256:M619I;ENSP00000410310:M511I;ENSP00000446399:M617I;ENSP00000388997:M5I;ENSP00000392457:M167I;ENSP00000440834:M57I	ENSP00000334910:M626I	M	-	3	0	PDE2A	71970613	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.040000	0.76551	2.605000	0.88082	0.563000	0.77884	ATG	.		0.577	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219839.2	NM_002599	
MYO7A	4647	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	76891503	76891503	+	Silent	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:76891503G>A	ENST00000409709.3	+	22	2942	c.2670G>A	c.(2668-2670)aaG>aaA	p.K890K	MYO7A_ENST00000409893.1_Silent_p.K890K|MYO7A_ENST00000409619.2_Silent_p.K879K|MYO7A_ENST00000458637.2_Silent_p.K890K	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	890					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AGAAGGCCAAGGAGGAGGCCG	0.612																																					p.K890K													.	MYO7A-138	0			c.G2670A						.						38.0	46.0	43.0					11																	76891503		2114	4210	6324	SO:0001819	synonymous_variant	4647	exon22			GGCCAAGGAGGAG	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.2670G>A	11.37:g.76891503G>A		Somatic	56	1		WXS	Illumina HiSeq	Phase_I	112	34	NM_001127179	0	0	2	2	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																			.		0.612	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
KBTBD3	143879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	105925034	105925034	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:105925034A>T	ENST00000526793.1	-	3	541	c.382T>A	c.(382-384)Ttg>Atg	p.L128M	KBTBD3_ENST00000534815.1_Missense_Mutation_p.L49M|KBTBD3_ENST00000531837.1_Missense_Mutation_p.L128M	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	124										NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		AATGATGACAACTGGAAGAAC	0.308																																					p.L128M		.											.	KBTBD3-91	0			c.T382A						.						82.0	88.0	86.0					11																	105925034		2201	4298	6499	SO:0001583	missense	143879	exon3			ATGACAACTGGAA	AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.382T>A	11.37:g.105925034A>T	ENSP00000436262:p.Leu128Met	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	107	34	NM_152433	0	0	1	1	0	Q6N066|Q86X38|Q96NK5	Missense_Mutation	SNP	ENST00000526793.1	37	CCDS8334.1	.	.	.	.	.	.	.	.	.	.	A	7.067	0.567452	0.13560	.	.	ENSG00000182359	ENST00000534815;ENST00000526793;ENST00000531837	T;T;T	0.72835	-0.69;-0.69;-0.69	5.22	1.55	0.23275	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.271361	0.35936	N	0.002898	T	0.47451	0.1446	N	0.21545	0.675	0.32074	N	0.594092	B;B	0.23377	0.052;0.084	B;B	0.23018	0.043;0.029	T	0.33650	-0.9860	10	0.33940	T	0.23	.	1.1059	0.01693	0.4145:0.1523:0.286:0.1472	.	128;124	A8K1K0;Q8NAB2	.;KBTB3_HUMAN	M	49;128;128	ENSP00000431910:L49M;ENSP00000436262:L128M;ENSP00000432163:L128M	ENSP00000436262:L128M	L	-	1	2	KBTBD3	105430244	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	1.122000	0.31295	0.006000	0.14734	-0.421000	0.06004	TTG	.		0.308	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388705.2	NM_152433	
ESAM	90952	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	124623587	124623587	+	Silent	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:124623587C>T	ENST00000278927.5	-	7	1257	c.1128G>A	c.(1126-1128)gtG>gtA	p.V376V	VSIG2_ENST00000326621.5_5'Flank|VSIG2_ENST00000403470.1_5'Flank|ESAM_ENST00000442070.2_Intron	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	376					blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		CCATCACAGGCACAGCACCCA	0.577																																					p.V376V		.											.	ESAM-90	0			c.G1128A						.						56.0	58.0	57.0					11																	124623587		2201	4299	6500	SO:0001819	synonymous_variant	90952	exon7			CACAGGCACAGCA	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.1128G>A	11.37:g.124623587C>T		Somatic	55	0		WXS	Illumina HiSeq	Phase_I	84	7	NM_138961	0	0	19	19	0	B4DVN8|Q96T50	Silent	SNP	ENST00000278927.5	37	CCDS8453.1																																																																																			.		0.577	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	NM_138961	
NTM	50863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	132180102	132180102	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:132180102T>C	ENST00000374786.1	+	5	1237	c.758T>C	c.(757-759)tTc>tCc	p.F253S	NTM_ENST00000374791.3_Missense_Mutation_p.F253S|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000427481.2_Missense_Mutation_p.F244S|NTM_ENST00000539799.1_Missense_Mutation_p.F253S|NTM_ENST00000425719.2_Missense_Mutation_p.F253S|NTM_ENST00000374784.1_Missense_Mutation_p.F253S	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	253	Ig-like C2-type 3.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						TCAGCAGAATTCCAGTGGTAC	0.517																																					p.F253S		.											.	NTM-95	0			c.T758C						.						165.0	162.0	163.0					11																	132180102		2201	4297	6498	SO:0001583	missense	50863	exon5			CAGAATTCCAGTG	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.758T>C	11.37:g.132180102T>C	ENSP00000363918:p.Phe253Ser	Somatic	229	0		WXS	Illumina HiSeq	Phase_I	307	91	NM_001144059	0	0	0	0	0	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	CCDS8491.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.9|27.9	4.869133|4.869133	0.91587|0.91587	.|.	.|.	ENSG00000182667|ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784|ENST00000457381	T;T;T;T;T;T|.	0.67523|.	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27|.	6.07|6.07	6.07|6.07	0.98685|0.98685	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78886|0.78886	0.4354|0.4354	M|M	0.82323|0.82323	2.585|2.585	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.91635|.	0.998;0.999;0.996;0.999;0.997;0.997|.	T|T	0.80251|0.80251	-0.1460|-0.1460	10|5	0.13853|.	T|.	0.58|.	-27.0916|-27.0916	16.6288|16.6288	0.85011|0.85011	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	253;244;253;253;253;253|.	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2|.	.;.;.;NTRI_HUMAN;.;.|.	S|P	253;253;244;253;253;253|5	ENSP00000363923:F253S;ENSP00000437668:F253S;ENSP00000416320:F244S;ENSP00000363918:F253S;ENSP00000396722:F253S;ENSP00000363916:F253S|.	ENSP00000363916:F253S|.	F|S	+|+	2|1	0|0	NTM|NTM	131685312|131685312	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.864000|5.864000	0.69575|0.69575	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	TTC|TCC	.		0.517	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	
AQP2	359	broad.mit.edu	37	12	50344816	50344816	+	Missense_Mutation	SNP	A	A	C	rs104894331		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr12:50344816A>C	ENST00000199280.3	+	1	288	c.203A>C	c.(202-204)aAc>aCc	p.N68T	RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.6_ENST00000550530.1_RNA	NM_000486.5	NP_000477.1	P41181	AQP2_HUMAN	aquaporin 2 (collecting duct)	68			N -> S (in ANDI). {ECO:0000269|PubMed:9048343}.		actin filament depolymerization (GO:0030042)|aging (GO:0007568)|apoptotic process (GO:0006915)|cell volume homeostasis (GO:0006884)|cellular response to copper ion (GO:0071280)|cellular response to mercury ion (GO:0071288)|cellular response to water deprivation (GO:0042631)|excretion (GO:0007588)|female pregnancy (GO:0007565)|glycerol transport (GO:0015793)|hyperosmotic response (GO:0006972)|metanephric collecting duct development (GO:0072205)|positive regulation of calcium ion transport (GO:0051928)|renal water transport (GO:0003097)|response to calcium ion (GO:0051592)|response to glucagon (GO:0033762)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to salt stress (GO:0009651)|response to starvation (GO:0042594)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	glycerol transmembrane transporter activity (GO:0015168)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.N68T(2)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(4)|ovary(2)	10						GCCCACATCAACCCTGCCGTG	0.662																																					p.N68T													.	AQP2-92	2	Substitution - Missense(2)	cervix(1)|lung(1)	c.A203C	GRCh37	CM970098	AQP2	M	rs104894331	.						41.0	41.0	41.0					12																	50344816		2203	4300	6503	SO:0001583	missense	359	exon1			ACATCAACCCTGC		CCDS8792.1	12q12-q13	2014-09-17				ENSG00000167580		"""Ion channels / Aquaporins"""	634	protein-coding gene	gene with protein product		107777				7512890	Standard	NM_000486		Approved		uc001rvn.3	P41181		ENST00000199280.3:c.203A>C	12.37:g.50344816A>C	ENSP00000199280:p.Asn68Thr	Somatic	48	9		WXS	Illumina HiSeq	Phase_I	148	25	NM_000486	0	0	0	0	0	Q9UD68	Missense_Mutation	SNP	ENST00000199280.3	37	CCDS8792.1	.	.	.	.	.	.	.	.	.	.	A	17.54	3.414384	0.62511	.	.	ENSG00000167580	ENST00000199280;ENST00000550862	D;T	0.98792	-5.14;-0.93	4.62	4.62	0.57501	Major intrinsic protein, conserved site (1);Aquaporin-like (2);	0.000000	0.64402	D	0.000013	D	0.99569	0.9845	H	0.99911	4.935	0.58432	D	0.999993	D	0.89917	1.0	D	0.71870	0.975	D	0.97411	1.0002	10	0.87932	D	0	-19.7917	12.3053	0.54898	1.0:0.0:0.0:0.0	.	68	P41181	AQP2_HUMAN	T	68	ENSP00000199280:N68T;ENSP00000450022:N68T	ENSP00000199280:N68T	N	+	2	0	AQP2	48631083	1.000000	0.71417	0.995000	0.50966	0.381000	0.30169	7.516000	0.81772	1.859000	0.53934	0.533000	0.62120	AAC	A|0.998;C|0.002		0.662	AQP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405540.1	NM_000486	
LRP1	4035	broad.mit.edu	37	12	57566959	57566959	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr12:57566959C>A	ENST00000243077.3	+	21	3638	c.3172C>A	c.(3172-3174)Ccc>Acc	p.P1058T		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1058					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.P1058T(3)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGCCACGAGGCCCCCTGGTGG	0.672											OREG0021936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1058T													.	LRP1-596	3	Substitution - Missense(3)	prostate(2)|endometrium(1)	c.C3172A						.						45.0	42.0	43.0					12																	57566959		2203	4300	6503	SO:0001583	missense	4035	exon21			ACGAGGCCCCCTG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.3172C>A	12.37:g.57566959C>A	ENSP00000243077:p.Pro1058Thr	Somatic	51	1	1024	WXS	Illumina HiSeq	Phase_I	103	6	NM_002332	0	0	0	0	0	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589375	0.66105	.	.	ENSG00000123384	ENST00000243077	D	0.91237	-2.81	5.08	4.19	0.49359	.	0.000000	0.64402	D	0.000001	D	0.89255	0.6663	N	0.13140	0.3	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85355	0.1104	10	0.10902	T	0.67	.	14.634	0.68676	0.0:0.8532:0.1468:0.0	.	1058	Q07954	LRP1_HUMAN	T	1058	ENSP00000243077:P1058T	ENSP00000243077:P1058T	P	+	1	0	LRP1	55853226	1.000000	0.71417	0.993000	0.49108	0.962000	0.63368	7.488000	0.81441	1.355000	0.45865	0.561000	0.74099	CCC	.		0.672	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
TCHP	84260	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	110341898	110341898	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr12:110341898A>T	ENST00000312777.5	+	3	559	c.345A>T	c.(343-345)agA>agT	p.R115S	TCHP_ENST00000405876.4_Missense_Mutation_p.R115S	NM_032300.4	NP_115676.1			trichoplein, keratin filament binding											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(2)	22						AGGAAAGAAGAATCCGGGAGC	0.577																																					p.R115S													.	TCHP-91	0			c.A345T						.						59.0	52.0	55.0					12																	110341898		2200	4296	6496	SO:0001583	missense	84260	exon3			AAGAAGAATCCGG	AK092736	CCDS9137.1	12q24.11	2011-08-25	2006-01-27			ENSG00000139437			28135	protein-coding gene	gene with protein product	"""mitostatin"""	612654				15731013, 20930847	Standard	NM_032300		Approved	MGC10854, TpMs	uc001tpn.3	Q9BT92		ENST00000312777.5:c.345A>T	12.37:g.110341898A>T	ENSP00000324404:p.Arg115Ser	Somatic	79	1		WXS	Illumina HiSeq	Phase_I	146	28	NM_001143852	0	0	3	5	2		Missense_Mutation	SNP	ENST00000312777.5	37	CCDS9137.1	.	.	.	.	.	.	.	.	.	.	A	12.33	1.905459	0.33628	.	.	ENSG00000139437	ENST00000405876;ENST00000536868;ENST00000312777;ENST00000536408	T;T;T	0.42900	1.52;1.52;0.96	5.08	-4.39	0.03611	.	0.427244	0.26723	N	0.022822	T	0.19967	0.0480	L	0.38175	1.15	0.20926	N	0.99982	B	0.17852	0.024	B	0.10450	0.005	T	0.12066	-1.0562	10	0.18276	T	0.48	-3.2278	1.3904	0.02249	0.3888:0.1111:0.3091:0.1911	.	115	Q9BT92	TCHP_HUMAN	S	115	ENSP00000384520:R115S;ENSP00000324404:R115S;ENSP00000441835:R115S	ENSP00000324404:R115S	R	+	3	2	TCHP	108826281	0.872000	0.30054	0.473000	0.27253	0.658000	0.38924	1.003000	0.29809	-0.513000	0.06496	0.456000	0.33151	AGA	.		0.577	TCHP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403289.1	NM_032300	
EXOSC8	11340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	37583387	37583387	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr13:37583387A>G	ENST00000389704.3	+	11	1047	c.782A>G	c.(781-783)gAa>gGa	p.E261G		NM_181503.2	NP_852480.1	Q96B26	EXOS8_HUMAN	exosome component 8	261					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)			biliary_tract(1)|breast(1)|kidney(2)|pancreas(1)|prostate(1)|skin(1)	7		Lung NSC(96;6.57e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.67e-07)|Epithelial(112;1.31e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00699)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0411)		AGACACAAAGAAGTTAAAAAA	0.338																																					p.E261G		.											.	EXOSC8-91	0			c.A782G						.						57.0	56.0	56.0					13																	37583387		2203	4300	6503	SO:0001583	missense	11340	exon11			ACAAAGAAGTTAA	AF025438	CCDS31958.1	13q13.1	2010-05-07			ENSG00000120699	ENSG00000120699	3.1.13.-		17035	protein-coding gene	gene with protein product	"""CBP-interacting protein 3"", ""Opa interacting protein 2"""	606019				9466265, 11929972	Standard	NM_181503		Approved	OIP2, RRP43, bA421P11.3, Rrp43p, EAP2, p9, CIP3	uc001uwa.3	Q96B26	OTTHUMG00000016742	ENST00000389704.3:c.782A>G	13.37:g.37583387A>G	ENSP00000374354:p.Glu261Gly	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	138	29	NM_181503	0	0	5	11	6	O43480|Q5TBA5	Missense_Mutation	SNP	ENST00000389704.3	37	CCDS31958.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.862459	0.71949	.	.	ENSG00000120699	ENST00000389704;ENST00000379809;ENST00000481013	T	0.52754	0.65	5.92	5.92	0.95590	Exoribonuclease, phosphorolytic domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.69088	0.3072	M	0.77820	2.39	0.80722	D	1	P;D	0.76494	0.944;0.999	P;D	0.69654	0.56;0.965	T	0.71052	-0.4704	10	0.49607	T	0.09	-29.8227	16.3593	0.83251	1.0:0.0:0.0:0.0	.	233;261	Q5JXM0;Q96B26	.;EXOS8_HUMAN	G	261;233;54	ENSP00000374354:E261G	ENSP00000369137:E233G	E	+	2	0	EXOSC8	36481387	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.372000	0.90127	2.267000	0.75376	0.383000	0.25322	GAA	.		0.338	EXOSC8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044535.2	NM_181503	
VWA8	23078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	42293875	42293875	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr13:42293875A>G	ENST00000379310.3	-	26	3036	c.2968T>C	c.(2968-2970)Ttt>Ctt	p.F990L	VWA8_ENST00000281496.6_Missense_Mutation_p.F990L	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	990						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										TCAGTCGGAAATTTCTGTATT	0.294																																					p.F990L		.											.	.	0			c.T2968C						.						68.0	64.0	65.0					13																	42293875		2203	4300	6503	SO:0001583	missense	23078	exon26			TCGGAAATTTCTG	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.2968T>C	13.37:g.42293875A>G	ENSP00000368612:p.Phe990Leu	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	62	30	NM_015058	0	0	0	0	0	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	37	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	A	29.6	5.023069	0.93462	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496	T;T	0.26810	1.71;1.71	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.52240	0.1722	M	0.87456	2.885	0.80722	D	1	D	0.59357	0.985	P	0.57720	0.826	T	0.61133	-0.7124	10	0.62326	D	0.03	.	15.7306	0.77800	1.0:0.0:0.0:0.0	.	990	A3KMH1	K0564_HUMAN	L	894;990;990	ENSP00000368612:F990L;ENSP00000281496:F990L	ENSP00000251030:F894L	F	-	1	0	KIAA0564	41191875	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.248000	0.95456	2.175000	0.68902	0.477000	0.44152	TTT	.		0.294	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
TIMM9	26520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	58878635	58878635	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr14:58878635T>C	ENST00000395159.2	-	4	554	c.29A>G	c.(28-30)cAg>cGg	p.Q10R	TIMM9_ENST00000555593.1_Missense_Mutation_p.Q10R|TIMM9_ENST00000555061.1_Missense_Mutation_p.Q10R|RP11-517O13.1_ENST00000556734.1_RNA|TIMM9_ENST00000556007.2_Missense_Mutation_p.Q10R|TIMM9_ENST00000555404.1_Missense_Mutation_p.Q10R|TIMM9_ENST00000216463.4_Intron	NM_012460.2	NP_036592.1	Q9Y5J7	TIM9_HUMAN	translocase of inner mitochondrial membrane 9 homolog (yeast)	10					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein transport (GO:0072321)|protein import into mitochondrial inner membrane (GO:0045039)|protein targeting to mitochondrion (GO:0006626)|sensory perception of sound (GO:0007605)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial intermembrane space protein transporter complex (GO:0042719)|mitochondrion (GO:0005739)	chaperone binding (GO:0051087)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			kidney(2)|skin(1)	3						CTGTTTTATCTGATCAGATTC	0.353																																					p.Q10R		.											.	TIMM9-90	0			c.A29G						.						113.0	110.0	111.0					14																	58878635		2203	4300	6503	SO:0001583	missense	26520	exon4			TTTATCTGATCAG	AF150100	CCDS9735.1	14q22.3-q24	2008-07-04	2001-11-28		ENSG00000100575	ENSG00000100575			11819	protein-coding gene	gene with protein product		607384	"""translocase of inner mitochondrial membrane 9 (yeast) homolog"""			10552927, 14726512	Standard	NM_012460		Approved	TIM9A	uc001xds.3	Q9Y5J7	OTTHUMG00000140322	ENST00000395159.2:c.29A>G	14.37:g.58878635T>C	ENSP00000378588:p.Gln10Arg	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	75	35	NM_012460	0	0	0	0	0	B2R584	Missense_Mutation	SNP	ENST00000395159.2	37	CCDS9735.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.480758	0.84747	.	.	ENSG00000100575	ENST00000395159;ENST00000555593;ENST00000556007;ENST00000555061;ENST00000555404;ENST00000555097;ENST00000553450	T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.81302	0.4794	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.84141	0.0417	9	0.87932	D	0	-16.1458	14.6598	0.68861	0.0:0.0:0.0:1.0	.	10	Q9Y5J7	TIM9_HUMAN	R	10	ENSP00000378588:Q10R;ENSP00000451006:Q10R;ENSP00000452091:Q10R;ENSP00000450638:Q10R;ENSP00000451198:Q10R;ENSP00000450624:Q10R	ENSP00000216463:Q10R	Q	-	2	0	TIMM9	57948388	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.606000	0.82863	2.130000	0.65690	0.528000	0.53228	CAG	.		0.353	TIMM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276936.2		
PLEKHD1	400224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	69994009	69994009	+	Silent	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr14:69994009G>A	ENST00000322564.7	+	11	1373	c.1161G>A	c.(1159-1161)gaG>gaA	p.E387E		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	387										breast(1)|endometrium(1)|kidney(2)	4						GGAATAAGGAGAAGGAGGAGA	0.612																																					p.E387E		.											.	PLEKHD1-68	0			c.G1161A						.						37.0	41.0	40.0					14																	69994009		692	1591	2283	SO:0001819	synonymous_variant	400224	exon11			TAAGGAGAAGGAG	AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.1161G>A	14.37:g.69994009G>A		Somatic	158	0		WXS	Illumina HiSeq	Phase_I	174	52	NM_001161498	0	0	0	0	0	B9EJC2	Silent	SNP	ENST00000322564.7	37	CCDS53903.1																																																																																			.		0.612	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412451.2	NM_001161498	
WDR72	256764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	53815462	53815462	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr15:53815462A>G	ENST00000396328.1	-	19	3445	c.3206T>C	c.(3205-3207)gTg>gCg	p.V1069A	WDR72_ENST00000360509.5_Missense_Mutation_p.V1069A|WDR72_ENST00000557913.1_Missense_Mutation_p.V1066A|WDR72_ENST00000567224.1_5'UTR|WDR72_ENST00000559418.1_Missense_Mutation_p.V1079A	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	1069										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		CATGTCCTCCACGTCTTGGAA	0.443																																					p.V1069A		.											.	WDR72-92	0			c.T3206C						.						190.0	181.0	184.0					15																	53815462		2194	4293	6487	SO:0001583	missense	256764	exon19			TCCTCCACGTCTT	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.3206T>C	15.37:g.53815462A>G	ENSP00000379619:p.Val1069Ala	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	70	14	NM_182758	0	0	1	9	8	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	A	0.124	-1.121308	0.01785	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.33216	1.42;1.42	6.17	1.97	0.26223	.	1.192530	0.05923	N	0.633818	T	0.09949	0.0244	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31308	-0.9948	10	0.10636	T	0.68	.	1.0072	0.01489	0.2223:0.1286:0.3848:0.2643	.	1069	Q3MJ13	WDR72_HUMAN	A	1069	ENSP00000379619:V1069A;ENSP00000353699:V1069A	ENSP00000353699:V1069A	V	-	2	0	WDR72	51602754	0.018000	0.18449	0.000000	0.03702	0.436000	0.31835	0.638000	0.24674	0.137000	0.18759	-0.177000	0.13119	GTG	.		0.443	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758	
TLN2	83660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	63097959	63097959	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr15:63097959T>A	ENST00000561311.1	+	50	6868	c.6638T>A	c.(6637-6639)gTg>gAg	p.V2213E	TLN2_ENST00000306829.6_Missense_Mutation_p.V2213E			Q9Y4G6	TLN2_HUMAN	talin 2	2213					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CGGAAAGCCGTGTCAGATATG	0.512																																					p.V2213E		.											.	TLN2-573	0			c.T6638A						.						77.0	68.0	71.0					15																	63097959		2203	4300	6503	SO:0001583	missense	83660	exon48			AAGCCGTGTCAGA	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6638T>A	15.37:g.63097959T>A	ENSP00000453508:p.Val2213Glu	Somatic	154	0		WXS	Illumina HiSeq	Phase_I	196	56	NM_015059	0	0	1	5	4	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	T	32	5.119444	0.94385	.	.	ENSG00000171914	ENST00000306829	T	0.77098	-1.07	5.83	5.83	0.93111	.	0.055071	0.64402	D	0.000001	T	0.79724	0.4495	M	0.62723	1.935	0.80722	D	1	P	0.40398	0.716	B	0.43478	0.421	T	0.82133	-0.0608	10	0.87932	D	0	-21.9765	16.2009	0.82078	0.0:0.0:0.0:1.0	.	2213	Q9Y4G6	TLN2_HUMAN	E	2213	ENSP00000303476:V2213E	ENSP00000303476:V2213E	V	+	2	0	TLN2	60885012	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.997000	0.88414	2.235000	0.73313	0.533000	0.62120	GTG	.		0.512	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
MEGF11	84465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	66190397	66190397	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr15:66190397G>A	ENST00000409699.2	-	23	3182	c.3010C>T	c.(3010-3012)Cat>Tat	p.H1004Y	MEGF11_ENST00000395625.2_Missense_Mutation_p.H929Y|MEGF11_ENST00000478721.1_5'Flank|MEGF11_ENST00000360698.4_3'UTR|MEGF11_ENST00000288745.3_Missense_Mutation_p.H929Y|MEGF11_ENST00000422354.1_Missense_Mutation_p.H1004Y			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	1004					homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						CTGGAGTTATGACCGCAACCT	0.463																																					p.H1004Y		.											.	MEGF11-69	0			c.C3010T						.						124.0	107.0	113.0					15																	66190397		2201	4299	6500	SO:0001583	missense	84465	exon23			AGTTATGACCGCA	AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.3010C>T	15.37:g.66190397G>A	ENSP00000386908:p.His1004Tyr	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	139	34	NM_032445	0	0	0	0	0	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	ENST00000409699.2	37	CCDS10213.2	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.943794	0.00479	.	.	ENSG00000157890	ENST00000409699;ENST00000288745;ENST00000422354;ENST00000395625	D;D;D;D	0.86694	-2.16;-2.05;-2.16;-2.05	5.03	4.11	0.48088	.	0.766593	0.10702	U	0.643968	T	0.77191	0.4094	N	0.22421	0.69	0.18873	N	0.999982	B;B	0.22746	0.015;0.074	B;B	0.24269	0.008;0.052	T	0.56619	-0.7949	10	0.02654	T	1	.	12.3211	0.54985	0.0833:0.0:0.9167:0.0	.	1004;929	A6BM72;A6BM72-2	MEG11_HUMAN;.	Y	1004;929;1004;929	ENSP00000386908:H1004Y;ENSP00000288745:H929Y;ENSP00000414475:H1004Y;ENSP00000378987:H929Y	ENSP00000288745:H929Y	H	-	1	0	MEGF11	63977451	0.017000	0.18338	0.046000	0.18839	0.418000	0.31294	1.820000	0.39032	1.300000	0.44818	0.655000	0.94253	CAT	.		0.463	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329307.2	NM_032445	
DNAH3	55567	bcgsc.ca	37	16	20976403	20976403	+	Missense_Mutation	SNP	G	G	A	rs143399673		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr16:20976403G>A	ENST00000261383.3	-	53	8802	c.8803C>T	c.(8803-8805)Cgg>Tgg	p.R2935W	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2935	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCCTGGAGCCGATCTACCACC	0.532																																					p.R2935W													.	DNAH3-167	0			c.C8803T						.	G	TRP/ARG	1,4401	2.1+/-5.4	0,1,2200	190.0	180.0	183.0		8803	5.0	0.1	16	dbSNP_134	183	0,8600		0,0,4300	no	missense	DNAH3	NM_017539.1	101	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	2935/4117	20976403	1,13001	2201	4300	6501	SO:0001583	missense	55567	exon53			GGAGCCGATCTAC	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.8803C>T	16.37:g.20976403G>A	ENSP00000261383:p.Arg2935Trp	Somatic	110	3		WXS	Illumina HiSeq	Phase_1	159	74	NM_017539	0	0	0	0	0	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.444776	0.25987	2.27E-4	0.0	ENSG00000158486	ENST00000261383	T	0.74632	-0.86	5.93	4.96	0.65561	Dynein heavy chain, coiled coil stalk (1);	0.153499	0.43260	D	0.000600	D	0.88262	0.6389	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.90761	0.4665	10	0.87932	D	0	.	16.4106	0.83712	0.0:0.0:0.8675:0.1325	.	2935	Q8TD57	DYH3_HUMAN	W	2935	ENSP00000261383:R2935W	ENSP00000261383:R2935W	R	-	1	2	DNAH3	20883904	1.000000	0.71417	0.054000	0.19295	0.001000	0.01503	3.924000	0.56476	1.485000	0.48380	0.655000	0.94253	CGG	G|1.000;A|0.000		0.532	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
EEF2K	29904	ucsc.edu;bcgsc.ca	37	16	22291588	22291588	+	Silent	SNP	C	C	T	rs543402357		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr16:22291588C>T	ENST00000263026.5	+	17	2433	c.1959C>T	c.(1957-1959)ggC>ggT	p.G653G		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	653					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		GTGATGAGGGCGGTGAGTACG	0.612													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19850	0.0		0.0	False		,,,				2504	0.0				p.G653G	NSCLC(195;1411 2157 20319 27471 51856)												.	EEF2K-856	0			c.C1959T						.						108.0	84.0	92.0					16																	22291588		2197	4300	6497	SO:0001819	synonymous_variant	29904	exon17			TGAGGGCGGTGAG	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1959C>T	16.37:g.22291588C>T		Somatic	219	2		WXS	Illumina HiSeq		408	200	NM_013302	0	0	0	3	3	Q8N588	Silent	SNP	ENST00000263026.5	37	CCDS10604.1																																																																																			.		0.612	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302	
IL21R	50615	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	27459983	27459983	+	Silent	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr16:27459983G>T	ENST00000337929.3	+	9	1469	c.996G>T	c.(994-996)acG>acT	p.T332T	IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000564089.1_Silent_p.T332T|IL21R_ENST00000395754.4_Silent_p.T332T|IL21R_ENST00000564583.1_3'UTR|IL21R_ENST00000395755.1_Silent_p.T332T	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	332					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						TGCAGCTCACGGAGCTACAAG	0.662			T	BCL6	NHL																																p.T354T				Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R-660	0			c.G1062T						.						27.0	29.0	28.0					16																	27459983		2196	4297	6493	SO:0001819	synonymous_variant	50615	exon10			GCTCACGGAGCTA	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.996G>T	16.37:g.27459983G>T		Somatic	94	1		WXS	Illumina HiSeq	Phase_I	259	65	NM_181079	0	0	0	0	0	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Silent	SNP	ENST00000337929.3	37	CCDS10630.1																																																																																			.		0.662	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
POLR2C	5432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57503976	57503976	+	Silent	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr16:57503976G>A	ENST00000219252.5	+	7	881	c.543G>A	c.(541-543)ggG>ggA	p.G181G	POLR2C_ENST00000564651.1_3'UTR	NM_032940.2	NP_116558.1	P19387	RPB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa	181					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	10						CTACTGCAGGGGTGGCTTTTG	0.537																																					p.G181G		.											.	POLR2C-90	0			c.G543A						.						67.0	63.0	64.0					16																	57503976		2198	4300	6498	SO:0001819	synonymous_variant	5432	exon7			TGCAGGGGTGGCT		CCDS10782.1	16q13-q21	2013-01-21	2002-08-29		ENSG00000102978	ENSG00000102978		"""RNA polymerase subunits"""	9189	protein-coding gene	gene with protein product	"""RNA polymerase II subunit 3"""	180663	"""polymerase (RNA) II (DNA directed) polypeptide C (33kD)"""			8034326	Standard	NM_032940		Approved	RPB3	uc002elt.1	P19387	OTTHUMG00000133464	ENST00000219252.5:c.543G>A	16.37:g.57503976G>A		Somatic	185	0		WXS	Illumina HiSeq	Phase_I	337	182	NM_032940	0	0	13	47	34	O15161	Silent	SNP	ENST00000219252.5	37	CCDS10782.1																																																																																			.		0.537	POLR2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257340.3	NM_032940	
KLHDC4	54758	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	87760467	87760467	+	Silent	SNP	C	C	T	rs548850415		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr16:87760467C>T	ENST00000270583.5	-	7	721	c.663G>A	c.(661-663)ctG>ctA	p.L221L	KLHDC4_ENST00000566349.1_5'UTR|KLHDC4_ENST00000347925.5_Silent_p.L190L|KLHDC4_ENST00000353170.5_Silent_p.L164L	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	221										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		CTGACGGGGACAGCTTGCTCC	0.557																																					p.L221L		.											.	KLHDC4-182	0			c.G663A						.						91.0	90.0	90.0					16																	87760467		2198	4300	6498	SO:0001819	synonymous_variant	54758	exon7			CGGGGACAGCTTG	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.663G>A	16.37:g.87760467C>T		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	269	142	NM_017566	0	0	2	9	7	D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Silent	SNP	ENST00000270583.5	37	CCDS10963.1																																																																																			.		0.557	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	NM_017566	
ZNF469	84627	hgsc.bcm.edu	37	16	88496091	88496091	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr16:88496091G>T	ENST00000437464.1	+	1	2213	c.2213G>T	c.(2212-2214)cGc>cTc	p.R738L	ZNF469_ENST00000565624.1_Missense_Mutation_p.R738L	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	738					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CAGTGTGACCGCAACTACAGC	0.692																																					p.R738L		.											.	.	0			c.G2213T						.						6.0	6.0	6.0					16																	88496091		655	1536	2191	SO:0001583	missense	84627	exon1			GTGACCGCAACTA	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.2213G>T	16.37:g.88496091G>T	ENSP00000402343:p.Arg738Leu	Somatic	13	0		WXS	Illumina HiSeq	Phase_I	58	4	NM_001127464	0	0	0	0	0		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.557536	0.27827	.	.	ENSG00000225614	ENST00000437464	T	0.08546	3.08	4.85	2.52	0.30459	Zinc finger, C2H2-like (1);	.	.	.	.	T	0.05135	0.0137	N	0.19112	0.55	0.27584	N	0.949489	P	0.35714	0.517	B	0.31442	0.13	T	0.33085	-0.9882	9	0.87932	D	0	.	5.6701	0.17717	0.6723:0.0:0.3277:0.0	.	738	Q96JG9	ZN469_HUMAN	L	738	ENSP00000402343:R738L	ENSP00000402343:R738L	R	+	2	0	ZNF469	87023592	1.000000	0.71417	0.942000	0.38095	0.730000	0.41778	4.128000	0.57951	0.349000	0.23975	0.467000	0.42956	CGC	.		0.692	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
WDR81	124997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	1630178	1630178	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr17:1630178C>G	ENST00000409644.1	+	1	1925	c.1925C>G	c.(1924-1926)cCc>cGc	p.P642R	WDR81_ENST00000446363.1_Intron|WDR81_ENST00000437219.2_Intron|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000419248.1_Intron|WDR81_ENST00000309182.5_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	642					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GAGGCCACTCCCTGTGAGGCT	0.587																																					p.P642R		.											.	WDR81-91	0			c.C1925G						.						7.0	9.0	9.0					17																	1630178		690	1579	2269	SO:0001583	missense	124997	exon1			CCACTCCCTGTGA	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.1925C>G	17.37:g.1630178C>G	ENSP00000386609:p.Pro642Arg	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	99	42	NM_001163809	0	0	4	7	3	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	ENST00000409644.1	37	CCDS54062.1	.	.	.	.	.	.	.	.	.	.	C	4.713	0.132661	0.09032	.	.	ENSG00000167716	ENST00000409644	T	0.56275	0.47	5.59	4.62	0.57501	.	.	.	.	.	T	0.55433	0.1920	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52646	-0.8548	6	0.33940	T	0.23	.	9.7471	0.40453	0.0:0.8428:0.0:0.1572	.	.	.	.	R	642	ENSP00000386609:P642R	ENSP00000386609:P642R	P	+	2	0	WDR81	1576928	0.940000	0.31905	0.835000	0.33067	0.224000	0.24922	3.300000	0.51834	1.349000	0.45751	0.462000	0.41574	CCC	.		0.587	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
C17orf104	284071	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	42744034	42744034	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr17:42744034C>T	ENST00000409122.2	+	5	897	c.755C>T	c.(754-756)aCa>aTa	p.T252I	C17orf104_ENST00000409464.1_Missense_Mutation_p.T86I|C17orf104_ENST00000359945.3_Missense_Mutation_p.T252I	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	252										autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						AATATTCAGACAAATGATACA	0.353																																					p.T252I		.											.	C17orf104-22	0			c.C755T						.						72.0	63.0	66.0					17																	42744034		2203	4300	6503	SO:0001583	missense	284071	exon5			TTCAGACAAATGA		CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.755C>T	17.37:g.42744034C>T	ENSP00000386452:p.Thr252Ile	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	190	12	NM_001145080	0	0	0	0	0	B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Missense_Mutation	SNP	ENST00000409122.2	37	CCDS45703.2	.	.	.	.	.	.	.	.	.	.	C	10.68	1.418212	0.25552	.	.	ENSG00000180336	ENST00000359945;ENST00000409122;ENST00000432494;ENST00000456912;ENST00000409464	T;T;T;T;T	0.35048	1.33;1.33;1.63;1.63;1.34	5.54	4.58	0.56647	.	0.518815	0.20253	N	0.096034	T	0.24547	0.0595	N	0.14661	0.345	0.24157	N	0.995676	B;B;B	0.10296	0.003;0.003;0.003	B;B;B	0.14023	0.01;0.006;0.006	T	0.15350	-1.0440	10	0.39692	T	0.17	-10.3947	14.6777	0.68993	0.0:0.9298:0.0:0.0702	.	252;252;86	A2RUB1-5;A2RUB1;A2RUB1-1	.;CQ104_HUMAN;.	I	252;252;86;86;86	ENSP00000353028:T252I;ENSP00000386452:T252I;ENSP00000399809:T86I;ENSP00000397957:T86I;ENSP00000386586:T86I	ENSP00000353028:T252I	T	+	2	0	C17orf104	40099560	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.331000	0.52075	1.468000	0.48064	0.591000	0.81541	ACA	.		0.353	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329171.2	NM_001145080	
SLC35B1	10237	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	47781478	47781478	+	Silent	SNP	T	T	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr17:47781478T>A	ENST00000240333.6	-	6	760	c.639A>T	c.(637-639)acA>acT	p.T213T	SLC35B1_ENST00000415270.2_Silent_p.T250T			P78383	S35B1_HUMAN	solute carrier family 35, member B1	213					transport (GO:0006810)|UDP-galactose transmembrane transport (GO:0072334)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	UDP-galactose transmembrane transporter activity (GO:0005459)			endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(1)	7						CCAGCAGCAATGTCGACCAAA	0.527																																					p.T213T													.	SLC35B1-90	0			c.A639T						.						220.0	173.0	189.0					17																	47781478		2203	4300	6503	SO:0001819	synonymous_variant	10237	exon6			CAGCAATGTCGAC	D16978	CCDS11552.1, CCDS11552.2	17q21.32	2013-05-22			ENSG00000121073	ENSG00000121073		"""Solute carriers"""	20798	protein-coding gene	gene with protein product		610790				9010752	Standard	NM_005827		Approved	UGTREL1	uc002iph.1	P78383	OTTHUMG00000161638	ENST00000240333.6:c.639A>T	17.37:g.47781478T>A		Somatic	209	1		WXS	Illumina HiSeq	Phase_I	433	103	NM_005827	0	0	32	39	7	B4DEC4|J3KQV4|Q96EW7	Silent	SNP	ENST00000240333.6	37	CCDS11552.1																																																																																			.		0.527	SLC35B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365564.2	NM_005827	
PRKAR1A	5573	broad.mit.edu;bcgsc.ca	37	17	66526491	66526491	+	Silent	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr17:66526491G>A	ENST00000589228.1	+	11	1175	c.1047G>A	c.(1045-1047)aaG>aaA	p.K349K	PRKAR1A_ENST00000536854.2_Silent_p.K349K|PRKAR1A_ENST00000586397.1_Silent_p.K349K|PRKAR1A_ENST00000358598.2_Silent_p.K349K|PRKAR1A_ENST00000588188.2_Intron|PRKAR1A_ENST00000392711.1_Silent_p.K349K	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	349					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					AGTGCGTTAAGCTGGACCGAC	0.488			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												p.K349K	Ovarian(167;637 1670 33025 39608 46699 51856)		yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	.	PRKAR1A-1141	0			c.G1047A						.						262.0	211.0	228.0					17																	66526491		2203	4300	6503	SO:0001819	synonymous_variant	5573	exon11	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;	CGTTAAGCTGGAC		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.1047G>A	17.37:g.66526491G>A		Somatic	194	0		WXS	Illumina HiSeq	Phase_I	351	10	NM_212472	0	0	118	122	4	K7ER48|Q567S7	Silent	SNP	ENST00000589228.1	37	CCDS11678.1																																																																																			.		0.488	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1		
CD300A	11314	broad.mit.edu	37	17	72473598	72473598	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr17:72473598T>C	ENST00000360141.3	+	4	845	c.557T>C	c.(556-558)cTg>cCg	p.L186P	CD300A_ENST00000310828.5_Missense_Mutation_p.L73P|CD300A_ENST00000577511.1_Missense_Mutation_p.L56P|CD300A_ENST00000392625.3_Missense_Mutation_p.L73P|CD300A_ENST00000361933.3_Intron	NM_001256841.1|NM_007261.3	NP_001243770.1|NP_009192.2	Q9UGN4	CLM8_HUMAN	CD300a molecule	186					cell adhesion (GO:0007155)|immune system process (GO:0002376)|negative regulation of activation of JAK2 kinase activity (GO:1902569)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of eosinophil activation (GO:1902567)|negative regulation of eosinophil migration (GO:2000417)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell activation involved in immune response (GO:0033007)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of neutrophil activation (GO:1902564)|negative regulation of NK T cell activation (GO:0051134)|negative regulation of phagocytosis, engulfment (GO:0060101)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|regulation of T cell receptor signaling pathway (GO:0050856)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)|signaling receptor activity (GO:0038023)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(4)|urinary_tract(1)	16						CTCTCCCTGCTGGCATTGTTG	0.532																																					p.L186P													.	CD300A-92	0			c.T557C						.						75.0	63.0	67.0					17																	72473598		2203	4300	6503	SO:0001583	missense	11314	exon4			CCCTGCTGGCATT	BC032352	CCDS32720.1, CCDS58590.1	17q25.2	2013-01-11	2006-03-28		ENSG00000167851	ENSG00000167851		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19319	protein-coding gene	gene with protein product		606790	"""CD300a antigen"""			9701027, 10746781	Standard	NM_007261		Approved	Irp60, CMRF35H, CMRF-35-H9, IRC1, IRC2, IGSF12	uc002jkv.4	Q9UGN4	OTTHUMG00000067612	ENST00000360141.3:c.557T>C	17.37:g.72473598T>C	ENSP00000353259:p.Leu186Pro	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	169	4	NM_007261	0	0	2	2	0	A8MW96|O95100|Q9HD97|Q9P0F3|Q9UBK4|Q9UMS9|Q9UMT0	Missense_Mutation	SNP	ENST00000360141.3	37	CCDS32720.1	.	.	.	.	.	.	.	.	.	.	T	14.34	2.505708	0.44558	.	.	ENSG00000167851	ENST00000360141;ENST00000392625;ENST00000310828	T;T	0.52983	0.64;0.64	3.8	2.69	0.31865	.	0.741961	0.10047	N	0.722712	T	0.58779	0.2146	L	0.47190	1.495	0.09310	N	0.999997	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.98;0.98;0.997	T	0.42155	-0.9468	10	0.87932	D	0	.	6.5794	0.22585	0.0:0.1194:0.0:0.8806	.	73;73;186	Q9UGN4-4;Q9UGN4-2;Q9UGN4	.;.;CLM8_HUMAN	P	186;73;73	ENSP00000353259:L186P;ENSP00000308188:L73P	ENSP00000308188:L73P	L	+	2	0	CD300A	69985193	0.006000	0.16342	0.001000	0.08648	0.251000	0.25915	1.861000	0.39438	0.566000	0.29273	0.374000	0.22700	CTG	.		0.532	CD300A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145091.1	NM_007261	
ZACN	353174	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74076354	74076354	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr17:74076354G>T	ENST00000334586.5	+	5	476	c.393G>T	c.(391-393)agG>agT	p.R131S	ZACN_ENST00000392503.2_Intron|EXOC7_ENST00000591724.1_5'Flank	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel	131					ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						TGGACTGGAGGGACCAGAGCC	0.662																																					p.R131S													.	ZACN-90	0			c.G393T						.						50.0	48.0	48.0					17																	74076354		2203	4300	6503	SO:0001583	missense	353174	exon5			CTGGAGGGACCAG	AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.393G>T	17.37:g.74076354G>T	ENSP00000334854:p.Arg131Ser	Somatic	128	1		WXS	Illumina HiSeq	Phase_I	294	116	NM_180990	0	0	0	0	0	Q2TB29|Q6ZWK3|Q86YW4	Missense_Mutation	SNP	ENST00000334586.5	37	CCDS11740.2	.	.	.	.	.	.	.	.	.	.	G	6.430	0.447387	0.12223	.	.	ENSG00000186919	ENST00000334586	T	0.76839	-1.05	4.57	3.59	0.41128	Neurotransmitter-gated ion-channel ligand-binding (3);	0.656443	0.12755	N	0.441853	T	0.66519	0.2797	L	0.36672	1.1	0.80722	D	1	B	0.33000	0.393	B	0.28916	0.096	T	0.60667	-0.7218	10	0.33940	T	0.23	.	10.1865	0.43000	0.0964:0.0:0.9036:0.0	.	131	Q401N2	ZACN_HUMAN	S	131	ENSP00000334854:R131S	ENSP00000334854:R131S	R	+	3	2	ZACN	71587949	0.923000	0.31300	0.985000	0.45067	0.962000	0.63368	1.248000	0.32827	1.121000	0.41925	0.655000	0.94253	AGG	.		0.662	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347827.2	NM_180990	
QRICH2	84074	bcgsc.ca	37	17	74288508	74288508	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr17:74288508T>A	ENST00000262765.5	-	4	1981	c.1802A>T	c.(1801-1803)gAt>gTt	p.D601V		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	601	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						ACCATGCTGATCTGCACCAGG	0.537																																					p.D601V													.	QRICH2-94	0			c.A1802T						.						168.0	134.0	145.0					17																	74288508		2203	4300	6503	SO:0001583	missense	84074	exon4			TGCTGATCTGCAC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1802A>T	17.37:g.74288508T>A	ENSP00000262765:p.Asp601Val	Somatic	272	2		WXS	Illumina HiSeq	Phase_1	512	27	NM_032134	0	0	0	0	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	T	8.120	0.780708	0.16120	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.21734	1.99	4.82	-9.63	0.00544	.	.	.	.	.	T	0.06735	0.0172	N	0.16478	0.41	0.09310	N	1	P;B	0.37276	0.589;0.138	B;B	0.33454	0.164;0.033	T	0.14200	-1.0481	9	0.18710	T	0.47	0.7097	1.6345	0.02739	0.4588:0.2138:0.0952:0.2322	.	601;601	B5MD94;Q9H0J4	.;QRIC2_HUMAN	V	601	ENSP00000262765:D601V	ENSP00000262765:D601V	D	-	2	0	QRICH2	71800103	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.623000	0.00059	-2.309000	0.00651	-0.444000	0.05651	GAT	.		0.537	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
RNF152	220441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	59483369	59483369	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr18:59483369G>C	ENST00000312828.3	-	2	1427	c.328C>G	c.(328-330)Cgt>Ggt	p.R110G		NM_173557.2	NP_775828.1	Q8N8N0	RN152_HUMAN	ring finger protein 152	110					apoptotic process (GO:0006915)|protein K48-linked ubiquitination (GO:0070936)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)	17		Colorectal(73;0.186)				AGCAGCGCACGCTCCTTGGAG	0.627																																					p.R110G		.											.	RNF152-226	0			c.C328G						.						68.0	74.0	72.0					18																	59483369		2203	4300	6503	SO:0001583	missense	220441	exon2			GCGCACGCTCCTT	AK096495	CCDS11978.1	18q21.33	2013-01-09			ENSG00000176641	ENSG00000176641		"""RING-type (C3HC4) zinc fingers"""	26811	protein-coding gene	gene with protein product							Standard	XM_005266650		Approved	FLJ39176	uc002lih.1	Q8N8N0	OTTHUMG00000132774	ENST00000312828.3:c.328C>G	18.37:g.59483369G>C	ENSP00000316628:p.Arg110Gly	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	78	26	NM_173557	0	0	0	0	0	B3KV99|Q52LA4	Missense_Mutation	SNP	ENST00000312828.3	37	CCDS11978.1	.	.	.	.	.	.	.	.	.	.	G	5.884	0.347185	0.11126	.	.	ENSG00000176641	ENST00000312828	D	0.83335	-1.71	4.97	4.97	0.65823	.	0.139197	0.44902	D	0.000405	T	0.69424	0.3109	N	0.17082	0.46	0.45621	D	0.998557	B	0.06786	0.001	B	0.06405	0.002	T	0.63501	-0.6623	10	0.18710	T	0.47	-3.5749	13.096	0.59192	0.0:0.0:0.7221:0.2779	.	110	Q8N8N0	RN152_HUMAN	G	110	ENSP00000316628:R110G	ENSP00000316628:R110G	R	-	1	0	RNF152	57634349	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	3.456000	0.53000	2.600000	0.87896	0.655000	0.94253	CGT	.		0.627	RNF152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256180.1	NM_173557	
PSG11	5680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	43519496	43519496	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr19:43519496G>T	ENST00000401740.1	-	4	839	c.736C>A	c.(736-738)Cct>Act	p.P246T	PSG11_ENST00000595312.1_5'Flank|PSG11_ENST00000320078.7_Missense_Mutation_p.P246T|PSG11_ENST00000306322.7_Missense_Mutation_p.P124T|PSG11_ENST00000403486.1_Missense_Mutation_p.P124T			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	244	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				GTGACTGAAGGGAAAATTCTG	0.468																																					p.P246T		.											.	.	0			c.C736A						.						112.0	125.0	120.0					19																	43519496		2199	4298	6497	SO:0001583	missense	5680	exon4			CTGAAGGGAAAAT	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.736C>A	19.37:g.43519496G>T	ENSP00000384995:p.Pro246Thr	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	102	46	NM_002785	0	0	0	0	0	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	37	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	g	7.213	0.595792	0.13875	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88	0.961	-0.805	0.10879	Immunoglobulin-like (1);	.	.	.	.	T	0.80154	0.4571	M	0.84683	2.71	0.09310	N	1	B;B	0.28636	0.085;0.218	B;P	0.45037	0.078;0.467	T	0.75110	-0.3433	9	0.87932	D	0	.	4.7032	0.12837	0.2746:0.0:0.7254:0.0	.	124;246	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	T	246;124;124;246	ENSP00000319140:P246T;ENSP00000385427:P124T;ENSP00000304913:P124T;ENSP00000384995:P246T	ENSP00000304913:P124T	P	-	1	0	PSG11	48211336	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.167000	0.16602	-1.109000	0.02996	-1.109000	0.02080	CCT	.		0.468	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785	
ZNF415	55786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53612760	53612760	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr19:53612760T>A	ENST00000500065.4	-	4	871	c.538A>T	c.(538-540)Ata>Tta	p.I180L	ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000601493.1_5'UTR|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000243643.4_Missense_Mutation_p.I180L|ZNF415_ENST00000455735.2_Missense_Mutation_p.I228L|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.I167L|ZNF415_ENST00000421033.1_Missense_Mutation_p.I192L|ZNF415_ENST00000448501.1_Missense_Mutation_p.I228L	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		GAAGAAATTATTTGGGGTGGT	0.383																																					p.I180L		.											.	ZNF415-91	0			c.A538T						.						103.0	100.0	101.0					19																	53612760		2203	4300	6503	SO:0001583	missense	55786	exon4			AAATTATTTGGGG	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.538A>T	19.37:g.53612760T>A	ENSP00000439435:p.Ile180Leu	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	80	29	NM_018355	0	0	0	0	0	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	ENST00000500065.4	37	CCDS54313.1	.	.	.	.	.	.	.	.	.	.	T	11.10	1.538587	0.27475	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.07908	3.15;3.15;3.15;3.15;3.15;3.15	2.74	-0.82	0.10826	.	.	.	.	.	T	0.07007	0.0178	L	0.31578	0.945	0.09310	N	1	B;B;B;B;B;B	0.29085	0.033;0.041;0.038;0.11;0.033;0.232	B;B;B;B;B;B	0.34138	0.015;0.028;0.017;0.033;0.02;0.176	T	0.39440	-0.9614	9	0.59425	D	0.04	.	6.2583	0.20885	0.0:0.3858:0.0:0.6142	.	180;228;228;180;167;192	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	L	180;180;228;192;228;167	ENSP00000243643:I180L;ENSP00000439435:I180L;ENSP00000396492:I228L;ENSP00000395055:I192L;ENSP00000388787:I228L;ENSP00000414601:I167L	ENSP00000243643:I180L	I	-	1	0	ZNF415	58304572	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-0.921000	0.04008	-0.410000	0.07542	0.260000	0.18958	ATA	.		0.383	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
NCOA1	8648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	24929447	24929447	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr2:24929447G>A	ENST00000406961.1	+	13	1760	c.1108G>A	c.(1108-1110)Ggg>Agg	p.G370R	NCOA1_ENST00000348332.3_Missense_Mutation_p.G370R|NCOA1_ENST00000405141.1_Missense_Mutation_p.G370R|NCOA1_ENST00000407230.1_Missense_Mutation_p.G219R|NCOA1_ENST00000395856.3_Missense_Mutation_p.G370R|NCOA1_ENST00000538539.1_Missense_Mutation_p.G370R|NCOA1_ENST00000288599.5_Missense_Mutation_p.G370R			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	370	Interaction with STAT3.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGCACAGTGGGCTTTCTCC	0.383			T	PAX3	alveolar rhadomyosarcoma																																p.G370R		.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1-228	0			c.G1108A						.						65.0	66.0	66.0					2																	24929447		2203	4300	6503	SO:0001583	missense	8648	exon11			CACAGTGGGCTTT	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.1108G>A	2.37:g.24929447G>A	ENSP00000385216:p.Gly370Arg	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	70	24	NM_147223	0	0	0	0	0	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	G	7.212	0.595682	0.13875	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.02158	4.54;4.54;4.42;4.54;4.54;4.54;4.54	5.02	5.02	0.67125	.	0.298923	0.37483	N	0.002071	T	0.01940	0.0061	L	0.34521	1.04	0.29230	N	0.873364	B;B;B;B	0.31790	0.34;0.28;0.014;0.203	B;B;B;B	0.33392	0.101;0.163;0.049;0.127	T	0.38156	-0.9674	10	0.20046	T	0.44	.	4.5462	0.12081	0.083:0.1533:0.6049:0.1588	.	370;370;370;219	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	R	370;370;219;370;370;370;370	ENSP00000385216:G370R;ENSP00000385097:G370R;ENSP00000385195:G219R;ENSP00000444039:G370R;ENSP00000320940:G370R;ENSP00000288599:G370R;ENSP00000379197:G370R	ENSP00000288599:G370R	G	+	1	0	NCOA1	24782951	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.987000	0.49378	2.485000	0.83878	0.655000	0.94253	GGG	.		0.383	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
LRPPRC	10128	broad.mit.edu;bcgsc.ca	37	2	44203320	44203320	+	Silent	SNP	T	T	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr2:44203320T>A	ENST00000260665.7	-	6	756	c.699A>T	c.(697-699)gcA>gcT	p.A233A	LRPPRC_ENST00000409659.1_Silent_p.A233A|LRPPRC_ENST00000409946.1_Silent_p.A233A	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	233					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CACTGAATACTGCCTCTGTAA	0.403																																					p.A233A													.	LRPPRC-93	0			c.A699T						.						84.0	82.0	83.0					2																	44203320		2203	4300	6503	SO:0001819	synonymous_variant	10128	exon6			GAATACTGCCTCT	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.699A>T	2.37:g.44203320T>A		Somatic	98	1		WXS	Illumina HiSeq	Phase_I	60	18	NM_133259	0	0	3	7	4	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Silent	SNP	ENST00000260665.7	37	CCDS33189.1																																																																																			.		0.403	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
C2orf81	388963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74642884	74642884	+	Silent	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr2:74642884G>A	ENST00000517883.1	-	1	826	c.135C>T	c.(133-135)ccC>ccT	p.P45P	C2orf81_ENST00000290390.5_Silent_p.P143P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	136										endometrium(3)|kidney(1)	4						CGTGCAGCACGGGCACTGAAC	0.637																																					p.P143P		.											.	.	0			c.C429T						.						42.0	51.0	48.0					2																	74642884		692	1591	2283	SO:0001819	synonymous_variant	388963	exon3			CAGCACGGGCACT	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.135C>T	2.37:g.74642884G>A		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	169	55	NM_001145054	0	0	4	6	2		Silent	SNP	ENST00000517883.1	37																																																																																				.		0.637	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
EEF1B2	1933	broad.mit.edu	37	2	207025358	207025358	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr2:207025358A>G	ENST00000392222.2	+	2	502	c.127A>G	c.(127-129)Agc>Ggc	p.S43G	NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000457011.1_5'Flank|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|SNORD51_ENST00000384320.2_RNA|EEF1B2_ENST00000236957.5_Missense_Mutation_p.S43G|NDUFS1_ENST00000440274.1_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.S43G|NDUFS1_ENST00000423725.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	43	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.S43G(4)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						AGCCGTGTCCAGCCCACCGCC	0.468																																					p.S43G													.	EEF1B2-227	4	Substitution - Missense(4)	endometrium(2)|lung(1)|kidney(1)	c.A127G						.						109.0	99.0	102.0					2																	207025358		2203	4300	6503	SO:0001583	missense	1933	exon3			GTGTCCAGCCCAC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.127A>G	2.37:g.207025358A>G	ENSP00000376056:p.Ser43Gly	Somatic	156	1		WXS	Illumina HiSeq	Phase_I	255	6	NM_021121	0	0	192	192	0	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.585588	0.00872	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.47	0.911	0.19343	Glutathione S-transferase, C-terminal-like (2);	0.442134	0.26800	N	0.022437	T	0.19846	0.0477	N	0.16098	0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18745	-1.0327	10	0.17832	T	0.49	-2.1703	6.3337	0.21285	0.2348:0.0:0.6384:0.1268	.	43	P24534	EF1B_HUMAN	G	43	ENSP00000236957:S43G;ENSP00000376055:S43G;ENSP00000376056:S43G;ENSP00000407730:S43G	ENSP00000236957:S43G	S	+	1	0	EEF1B2	206733603	0.049000	0.20398	0.145000	0.22337	0.051000	0.14879	0.879000	0.28146	-0.027000	0.13873	-0.252000	0.11476	AGC	.		0.468	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
EEF1B2	1933	broad.mit.edu	37	2	207025366	207025366	+	Silent	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr2:207025366G>A	ENST00000392222.2	+	2	510	c.135G>A	c.(133-135)ccG>ccA	p.P45P	NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000432169.1_5'Flank|NDUFS1_ENST00000457011.1_5'Flank|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000455934.2_5'Flank|NDUFS1_ENST00000449699.1_5'Flank|SNORD51_ENST00000384320.2_RNA|EEF1B2_ENST00000236957.5_Silent_p.P45P|NDUFS1_ENST00000440274.1_5'Flank|EEF1B2_ENST00000392221.1_Silent_p.P45P|NDUFS1_ENST00000423725.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	45	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.P45P(5)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						CCAGCCCACCGCCTGCCGACT	0.448																																					p.P45P													.	EEF1B2-227	5	Substitution - coding silent(5)	kidney(2)|endometrium(2)|lung(1)	c.G135A						.						109.0	99.0	102.0					2																	207025366		2203	4300	6503	SO:0001819	synonymous_variant	1933	exon3			CCCACCGCCTGCC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.135G>A	2.37:g.207025366G>A		Somatic	166	1		WXS	Illumina HiSeq	Phase_I	255	6	NM_021121	0	0	158	158	0	A8K795|Q6IBH9	Silent	SNP	ENST00000392222.2	37	CCDS2367.1																																																																																			.		0.448	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336436.1	NM_001037663	
FN1	2335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	216274676	216274676	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr2:216274676G>T	ENST00000359671.1	-	14	2368	c.2103C>A	c.(2101-2103)agC>agA	p.S701R	FN1_ENST00000354785.4_Missense_Mutation_p.S701R|FN1_ENST00000357009.2_Missense_Mutation_p.S701R|FN1_ENST00000323926.6_Missense_Mutation_p.S701R|FN1_ENST00000421182.1_Missense_Mutation_p.S701R|FN1_ENST00000432072.2_Missense_Mutation_p.S701R|FN1_ENST00000336916.4_Missense_Mutation_p.S701R|FN1_ENST00000345488.5_Missense_Mutation_p.S701R|FN1_ENST00000346544.3_Missense_Mutation_p.S701R|FN1_ENST00000357867.4_Missense_Mutation_p.S701R|FN1_ENST00000446046.1_Missense_Mutation_p.S701R|FN1_ENST00000443816.1_Missense_Mutation_p.S701R|FN1_ENST00000356005.4_Missense_Mutation_p.S701R			P02751	FINC_HUMAN	fibronectin 1	701	Fibronectin type-III 1.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GTGTGCTGGTGCTGGTGGTGG	0.557																																					p.S701R		.											.	FN1-584	0			c.C2103A						.						370.0	375.0	373.0					2																	216274676		2203	4300	6503	SO:0001583	missense	2335	exon14			GCTGGTGCTGGTG		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.2103C>A	2.37:g.216274676G>T	ENSP00000352696:p.Ser701Arg	Somatic	398	0		WXS	Illumina HiSeq	Phase_I	506	121	NM_212476	0	0	4	4	0	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	G	11.17	1.559369	0.27827	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.47869	0.83;2.19;2.35;0.92;2.42;2.05;2.4;2.07;2.37;2.08;1.58;0.9;1.49	5.65	3.84	0.44239	.	0.360826	0.30464	N	0.009573	T	0.56077	0.1961	L	0.44542	1.39	0.42852	D	0.994085	D;B;B;B;B;P;D;B;B;D	0.89917	1.0;0.353;0.17;0.17;0.106;0.533;0.998;0.17;0.17;0.987	D;P;B;B;B;B;P;B;B;P	0.87578	0.998;0.522;0.079;0.127;0.036;0.326;0.865;0.127;0.127;0.904	T	0.54549	-0.8277	10	0.40728	T	0.16	.	8.8981	0.35476	0.2229:0.0:0.7771:0.0	.	701;701;701;701;701;701;701;701;701;701	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	R	701	ENSP00000394423:S701R;ENSP00000323534:S701R;ENSP00000338200:S701R;ENSP00000350534:S701R;ENSP00000346839:S701R;ENSP00000352696:S701R;ENSP00000265312:S701R;ENSP00000273049:S701R;ENSP00000349509:S701R;ENSP00000410422:S701R;ENSP00000415018:S701R;ENSP00000399538:S701R;ENSP00000348285:S701R	ENSP00000265313:S701R	S	-	3	2	FN1	215982921	1.000000	0.71417	0.896000	0.35187	0.102000	0.19082	1.257000	0.32932	1.531000	0.49152	-0.140000	0.14226	AGC	.		0.557	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
SEL1L2	80343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	13868446	13868446	+	Silent	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr20:13868446G>T	ENST00000284951.5	-	8	788	c.714C>A	c.(712-714)gcC>gcA	p.A238A	SEL1L2_ENST00000378072.5_Silent_p.A238A|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	238						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						AATAACTTAGGGCAACTTCAC	0.299																																					p.A238A		.											.	SEL1L2-70	0			c.C714A						.						129.0	123.0	125.0					20																	13868446		1817	4072	5889	SO:0001819	synonymous_variant	80343	exon8			ACTTAGGGCAACT	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.714C>A	20.37:g.13868446G>T		Somatic	98	0		WXS	Illumina HiSeq	Phase_I	83	21	NM_001271539	0	0	0	0	0	B4DXX5	Silent	SNP	ENST00000284951.5	37																																																																																				.		0.299	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	NM_025229	
ZNF337	26152	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	25656225	25656225	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr20:25656225A>T	ENST00000376436.1	-	4	2238	c.1699T>A	c.(1699-1701)Tcg>Acg	p.S567T	RP4-694B14.5_ENST00000421829.1_RNA|ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000455791.1_RNA|RP4-694B14.5_ENST00000439498.1_RNA|ZNF337_ENST00000538750.1_Missense_Mutation_p.S535T|RP4-694B14.5_ENST00000414393.1_RNA|ZNF337_ENST00000252979.5_Missense_Mutation_p.S567T|RP4-694B14.5_ENST00000428254.1_RNA			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	567					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CTTTCCCCCGAGTGTGTCCAC	0.473																																					p.S567T													.	ZNF337-90	0			c.T1699A						.						92.0	83.0	86.0					20																	25656225		2203	4300	6503	SO:0001583	missense	26152	exon5			CCCCCGAGTGTGT		CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.1699T>A	20.37:g.25656225A>T	ENSP00000365619:p.Ser567Thr	Somatic	194	1		WXS	Illumina HiSeq	Phase_I	238	86	NM_015655	0	0	1	6	5	B4DSM2|Q9Y3Y5	Missense_Mutation	SNP	ENST00000376436.1	37	CCDS13174.1	.	.	.	.	.	.	.	.	.	.	.	8.160	0.789335	0.16258	.	.	ENSG00000130684	ENST00000376436;ENST00000252979;ENST00000538750	T;T;T	0.12879	2.64;2.64;2.64	1.29	-2.14	0.07123	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03477	0.0100	N	0.02403	-0.565	0.22457	N	0.999081	B;B	0.13145	0.007;0.007	B;B	0.04013	0.001;0.001	T	0.41520	-0.9504	9	0.02654	T	1	.	5.6207	0.17455	0.3135:0.0:0.0:0.6864	.	535;567	B4DSM2;Q9Y3M9	.;ZN337_HUMAN	T	567;567;535	ENSP00000365619:S567T;ENSP00000252979:S567T;ENSP00000442181:S535T	ENSP00000252979:S567T	S	-	1	0	ZNF337	25604225	0.892000	0.30473	0.005000	0.12908	0.954000	0.61252	0.661000	0.25023	-0.602000	0.05775	0.248000	0.18094	TCG	.		0.473	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078454.1		
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V|FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.													.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	Somatic	828	17		WXS	Illumina HiSeq	Phase_1	914	37	.	0	0	31	31	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
TRPC4AP	26133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	33623074	33623074	+	Silent	SNP	A	A	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr20:33623074A>C	ENST00000252015.2	-	8	992	c.903T>G	c.(901-903)ctT>ctG	p.L301L	TRPC4AP_ENST00000432634.2_Silent_p.L262L|TRPC4AP_ENST00000451813.2_Silent_p.L301L|TRPC4AP_ENST00000539834.1_5'UTR			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	301	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			CCAGTTTGCAAAGCCGCTCAA	0.507																																					p.L301L		.											.	TRPC4AP-91	0			c.T903G						.						87.0	78.0	81.0					20																	33623074		2203	4300	6503	SO:0001819	synonymous_variant	26133	exon8			TTTGCAAAGCCGC	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.903T>G	20.37:g.33623074A>C		Somatic	115	0		WXS	Illumina HiSeq	Phase_I	90	26	NM_199368	0	0	7	15	8	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Silent	SNP	ENST00000252015.2	37	CCDS13246.1																																																																																			.		0.507	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
TRPC4AP	26133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	33623099	33623099	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr20:33623099C>A	ENST00000252015.2	-	8	967	c.878G>T	c.(877-879)aGc>aTc	p.S293I	TRPC4AP_ENST00000432634.2_Missense_Mutation_p.S254I|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.S293I|TRPC4AP_ENST00000539834.1_5'Flank			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	293	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GCCAGGAATGCTGAGAAGGGC	0.498																																					p.S293I		.											.	TRPC4AP-91	0			c.G878T						.						61.0	57.0	58.0					20																	33623099		2203	4300	6503	SO:0001583	missense	26133	exon8			GGAATGCTGAGAA	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.878G>T	20.37:g.33623099C>A	ENSP00000252015:p.Ser293Ile	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	75	20	NM_199368	0	0	0	0	0	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	37	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929049	0.52759	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000432634;ENST00000541994	T;T;T	0.27720	1.65;1.65;1.65	5.49	4.45	0.53987	.	0.085031	0.85682	D	0.000000	T	0.13329	0.0323	N	0.14661	0.345	0.80722	D	1	B;P;P	0.38335	0.396;0.475;0.627	B;B;B	0.31614	0.044;0.133;0.133	T	0.03524	-1.1028	10	0.54805	T	0.06	.	3.5606	0.07881	0.0:0.6443:0.0:0.3557	.	254;293;293	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	I	293;293;254;278	ENSP00000252015:S293I;ENSP00000400614:S293I;ENSP00000400497:S254I	ENSP00000252015:S293I	S	-	2	0	TRPC4AP	33086760	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.786000	0.55431	2.587000	0.87381	0.557000	0.71058	AGC	.		0.498	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
TP53TG5	27296	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	44005903	44005903	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr20:44005903C>A	ENST00000372726.3	-	3	359	c.203G>T	c.(202-204)aGg>aTg	p.R68M	TP53TG5_ENST00000494455.1_5'UTR|SYS1-DBNDD2_ENST00000475242.1_Intron|SYS1-DBNDD2_ENST00000452133.1_Intron|TP53TG5_ENST00000537995.1_Missense_Mutation_p.R52M	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	68					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						ATGCCAACACCTTTTGGCCAG	0.517																																					p.R68M													.	TP53TG5-90	0			c.G203T						.						198.0	185.0	189.0					20																	44005903		2203	4300	6503	SO:0001583	missense	27296	exon3			CAACACCTTTTGG	AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.203G>T	20.37:g.44005903C>A	ENSP00000361811:p.Arg68Met	Somatic	131	1		WXS	Illumina HiSeq	Phase_I	150	45	NM_014477	0	0	0	0	0		Missense_Mutation	SNP	ENST00000372726.3	37	CCDS13352.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757255	0.69648	.	.	ENSG00000124251	ENST00000372726;ENST00000537995	T;T	0.20598	2.06;2.06	5.52	2.25	0.28309	.	0.633338	0.15520	N	0.258106	T	0.34978	0.0916	L	0.46157	1.445	0.29922	N	0.82262	D	0.89917	1.0	D	0.73380	0.98	T	0.15235	-1.0444	10	0.87932	D	0	-16.0632	8.937	0.35706	0.0:0.6414:0.2788:0.0798	.	68	Q9Y2B4	T53G5_HUMAN	M	68;52	ENSP00000361811:R68M;ENSP00000438374:R52M	ENSP00000361811:R68M	R	-	2	0	TP53TG5	43439317	0.434000	0.25570	0.996000	0.52242	0.996000	0.88848	0.351000	0.20096	0.765000	0.33221	0.655000	0.94253	AGG	.		0.517	TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079460.1	NM_014477	
PCK1	5105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	56140806	56140806	+	Silent	SNP	C	C	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr20:56140806C>A	ENST00000319441.4	+	10	1979	c.1815C>A	c.(1813-1815)ccC>ccA	p.P605P	PCK1_ENST00000543666.1_Silent_p.P288P	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	605					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CCGACCTCCCCTGTGAAATCG	0.463																																					p.P605P		.											.	PCK1-227	0			c.C1815A						.						54.0	50.0	51.0					20																	56140806		2203	4300	6503	SO:0001819	synonymous_variant	5105	exon10			CCTCCCCTGTGAA		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.1815C>A	20.37:g.56140806C>A		Somatic	114	0		WXS	Illumina HiSeq	Phase_I	151	50	NM_002591	0	0	25	65	40	A8K437|B4DT64|Q8TCA3|Q9UJD2	Silent	SNP	ENST00000319441.4	37	CCDS13460.1																																																																																			.		0.463	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
ZGPAT	84619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62366740	62366740	+	Silent	SNP	T	T	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr20:62366740T>A	ENST00000328969.5	+	6	1408	c.1281T>A	c.(1279-1281)ccT>ccA	p.P427P	LIME1_ENST00000309546.3_5'Flank|ZGPAT_ENST00000369967.3_Silent_p.P407P|ZGPAT_ENST00000448100.2_Silent_p.P407P|ZGPAT_ENST00000355969.6_Silent_p.P407P|RP4-583P15.14_ENST00000467211.1_5'Flank|RP4-583P15.15_ENST00000490623.2_Missense_Mutation_p.L313Q|ZGPAT_ENST00000357119.4_Silent_p.P398P	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	427					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GTCAGGCTCCTGGGGCCCTAG	0.672																																					p.P427P		.											.	ZGPAT-90	0			c.T1281A						.						20.0	23.0	22.0					20																	62366740		2183	4294	6477	SO:0001819	synonymous_variant	84619	exon6			GGCTCCTGGGGCC	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.1281T>A	20.37:g.62366740T>A		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	61	20	NM_032527	0	0	20	37	17	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Silent	SNP	ENST00000328969.5	37	CCDS13534.1																																																																																			.		0.672	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484	
NEFH	4744	bcgsc.ca	37	22	29885458	29885458	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr22:29885458A>C	ENST00000310624.6	+	4	1862	c.1829A>C	c.(1828-1830)gAa>gCa	p.E610A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	610	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						ccagtgaaggaagaagcaaag	0.567																																					p.E610A													.	NEFH-90	0			c.A1829C						.						66.0	64.0	65.0					22																	29885458		2203	4300	6503	SO:0001583	missense	4744	exon4			TGAAGGAAGAAGC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1829A>C	22.37:g.29885458A>C	ENSP00000311997:p.Glu610Ala	Somatic	197	0		WXS	Illumina HiSeq	Phase_1	247	10	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	A	6.939	0.543004	0.13250	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	T	0.30448	1.53	4.98	1.5	0.22942	.	0.000000	0.37577	N	0.002038	T	0.29190	0.0726	M	0.69823	2.125	0.30754	N	0.74477	P	0.43392	0.805	P	0.45753	0.492	T	0.20075	-1.0286	10	0.14656	T	0.56	.	3.2852	0.06929	0.4892:0.0:0.239:0.2717	.	610	P12036	NFH_HUMAN	A	610	ENSP00000311997:E610A	ENSP00000311997:E610A	E	+	2	0	NEFH	28215458	0.987000	0.35691	0.168000	0.22838	0.172000	0.22775	3.046000	0.49846	0.238000	0.21222	0.377000	0.23210	GAA	.		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
LGALS2	3957	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	37966307	37966307	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr22:37966307C>T	ENST00000215886.4	-	4	536	c.362G>A	c.(361-363)gGc>gAc	p.G121D		NM_006498.2	NP_006489.1	P05162	LEG2_HUMAN	lectin, galactoside-binding, soluble, 2	121	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)|galactoside binding (GO:0016936)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)	11	Melanoma(58;0.0574)					GTTGAACCCGCCCCTTACGCT	0.498																																					p.G121D	GBM(193;1840 2185 13711 20676 24505)	.											.	LGALS2-154	0			c.G362A						.						90.0	94.0	93.0					22																	37966307		2203	4300	6503	SO:0001583	missense	3957	exon4			AACCCGCCCCTTA		CCDS13950.1	22q13.1	2011-08-04	2007-02-01		ENSG00000100079	ENSG00000100079		"""Lectins, galactoside-binding"""	6562	protein-coding gene	gene with protein product	"""galectin 2"""	150571				1988031, 15356130	Standard	NM_006498		Approved	HL14	uc003ata.3	P05162	OTTHUMG00000150590	ENST00000215886.4:c.362G>A	22.37:g.37966307C>T	ENSP00000215886:p.Gly121Asp	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	174	10	NM_006498	0	0	18	20	2	Q6FGY4	Missense_Mutation	SNP	ENST00000215886.4	37	CCDS13950.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824838	0.50739	.	.	ENSG00000100079	ENST00000215886	T	0.68181	-0.31	5.65	1.17	0.20885	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.292084	0.42821	D	0.000648	T	0.64983	0.2648	M	0.82056	2.57	0.09310	N	0.999994	B	0.30870	0.298	B	0.30943	0.122	T	0.59958	-0.7356	10	0.62326	D	0.03	0.0582	10.2071	0.43120	0.0:0.7317:0.0:0.2683	.	121	P05162	LEG2_HUMAN	D	121	ENSP00000215886:G121D	ENSP00000215886:G121D	G	-	2	0	LGALS2	36296253	0.010000	0.17322	0.000000	0.03702	0.000000	0.00434	1.026000	0.30103	0.056000	0.16144	-0.291000	0.09656	GGC	.		0.498	LGALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318991.1	NM_006498	
PNPLA3	80339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	44333050	44333050	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr22:44333050G>A	ENST00000216180.3	+	6	1050	c.877G>A	c.(877-879)Gct>Act	p.A293T	PNPLA3_ENST00000423180.2_Missense_Mutation_p.A289T	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	293					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				GGCTGCCTTGGCTGTGAGGCT	0.617																																					p.A293T		.											.	PNPLA3-90	0			c.G877A						.						105.0	84.0	91.0					22																	44333050		2203	4300	6503	SO:0001583	missense	80339	exon6			GCCTTGGCTGTGA		CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.877G>A	22.37:g.44333050G>A	ENSP00000216180:p.Ala293Thr	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	133	44	NM_025225	0	0	0	0	0	B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Missense_Mutation	SNP	ENST00000216180.3	37	CCDS14054.1	.	.	.	.	.	.	.	.	.	.	G	8.597	0.885868	0.17540	.	.	ENSG00000100344	ENST00000216180;ENST00000423180	T;T	0.28895	1.59;1.59	3.7	-1.2	0.09554	.	.	.	.	.	T	0.13670	0.0331	N	0.22421	0.69	0.09310	N	1	B	0.30326	0.276	B	0.25614	0.062	T	0.25363	-1.0134	9	0.18276	T	0.48	-0.1582	1.9895	0.03443	0.1065:0.1711:0.3719:0.3504	.	293	Q9NST1	PLPL3_HUMAN	T	293;289	ENSP00000216180:A293T;ENSP00000397987:A289T	ENSP00000216180:A293T	A	+	1	0	PNPLA3	42664383	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.317000	0.08060	-0.232000	0.09811	0.462000	0.41574	GCT	.		0.617	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318891.1	NM_025225	
PDCD6IP	10015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	33840351	33840351	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr3:33840351A>C	ENST00000307296.3	+	1	508	c.131A>C	c.(130-132)gAg>gCg	p.E44A	RP11-10C24.3_ENST00000604982.1_lincRNA|RP11-10C24.1_ENST00000605513.1_lincRNA|PDCD6IP_ENST00000457054.2_Missense_Mutation_p.E44A			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	44	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						CGCGCGGCGGAGGAGCTCAGC	0.692																																					p.E44A		.											.	PDCD6IP-228	0			c.A131C						.						10.0	11.0	11.0					3																	33840351		2139	4155	6294	SO:0001583	missense	10015	exon1			CGGCGGAGGAGCT	BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.131A>C	3.37:g.33840351A>C	ENSP00000307387:p.Glu44Ala	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	111	28	NM_013374	0	0	7	10	3	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Missense_Mutation	SNP	ENST00000307296.3	37	CCDS2660.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824727	0.50739	.	.	ENSG00000170248	ENST00000307296;ENST00000457054;ENST00000413073	T;T;T	0.16324	2.35;2.35;2.35	5.03	5.03	0.67393	BRO1 domain (3);	0.048074	0.85682	D	0.000000	T	0.09202	0.0227	N	0.13299	0.325	0.80722	D	1	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.11329	0.006;0.006;0.002	T	0.14364	-1.0475	10	0.08381	T	0.77	-21.2451	11.3154	0.49388	0.8641:0.0:0.0:0.1359	.	44;44;44	C5MQH7;E9PFU1;Q8WUM4	.;.;PDC6I_HUMAN	A	44	ENSP00000307387:E44A;ENSP00000411825:E44A;ENSP00000406693:E44A	ENSP00000307387:E44A	E	+	2	0	PDCD6IP	33815355	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.731000	0.74785	2.108000	0.64289	0.482000	0.46254	GAG	.		0.692	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
ARHGEF3	50650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	56766301	56766301	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr3:56766301C>A	ENST00000296315.3	-	9	1361	c.1193G>T	c.(1192-1194)gGc>gTc	p.G398V	ARHGEF3_ENST00000413728.2_Missense_Mutation_p.G404V|ARHGEF3_ENST00000495373.1_Missense_Mutation_p.G398V|ARHGEF3_ENST00000338458.4_Missense_Mutation_p.G430V|ARHGEF3_ENST00000497267.1_Missense_Mutation_p.G369V|ARHGEF3_ENST00000496106.1_Missense_Mutation_p.G404V	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	398	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		TCGCAGGGAGCCACCCAGCCT	0.552																																					p.G430V		.											.	ARHGEF3-228	0			c.G1289T						.						116.0	102.0	106.0					3																	56766301		2203	4300	6503	SO:0001583	missense	50650	exon12			AGGGAGCCACCCA	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.1193G>T	3.37:g.56766301C>A	ENSP00000296315:p.Gly398Val	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	202	46	NM_001128615	0	0	8	8	0	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Missense_Mutation	SNP	ENST00000296315.3	37	CCDS2878.1	.	.	.	.	.	.	.	.	.	.	C	32	5.120131	0.94385	.	.	ENSG00000163947	ENST00000296315;ENST00000338458;ENST00000413728;ENST00000496106;ENST00000497267;ENST00000495373	T;T;T;T;T;T	0.28666	1.88;1.79;1.8;1.8;1.82;1.6	5.83	5.83	0.93111	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.55016	0.1894	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;1.0;0.999;0.998;0.999	D;D;D;D;D;D;D	0.79108	0.982;0.97;0.982;0.982;0.982;0.97;0.992	T	0.46871	-0.9160	10	0.09590	T	0.72	-7.7666	20.1218	0.97964	0.0:1.0:0.0:0.0	.	404;369;196;398;430;398;404	E9PG37;E7EU49;Q9NR81-4;C9J586;Q9NR81-2;Q9NR81;Q9NR81-3	.;.;.;.;.;ARHG3_HUMAN;.	V	398;430;404;404;369;398	ENSP00000296315:G398V;ENSP00000341071:G430V;ENSP00000410922:G404V;ENSP00000420420:G404V;ENSP00000418826:G369V;ENSP00000417986:G398V	ENSP00000296315:G398V	G	-	2	0	ARHGEF3	56741341	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.763000	0.94921	0.561000	0.74099	GGC	.		0.552	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
MED12L	116931	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	150877786	150877786	+	Silent	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr3:150877786C>T	ENST00000474524.1	+	7	1043	c.1005C>T	c.(1003-1005)ggC>ggT	p.G335G	MED12L_ENST00000422248.2_Silent_p.G335G|MED12L_ENST00000309237.4_Silent_p.G335G|MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	335						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CCAGCCCTGGCCCCCCCGGCC	0.582																																					p.G335G													.	MED12L-576	0			c.C1005T						.						83.0	94.0	90.0					3																	150877786		2203	4300	6503	SO:0001819	synonymous_variant	116931	exon7			CCCTGGCCCCCCC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.1005C>T	3.37:g.150877786C>T		Somatic	50	1		WXS	Illumina HiSeq	Phase_I	109	53	NM_053002	0	0	0	0	0	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	37	CCDS33876.1																																																																																			.		0.582	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
SPON2	10417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1164263	1164263	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:1164263C>A	ENST00000290902.5	-	5	1070	c.738G>T	c.(736-738)caG>caT	p.Q246H	SPON2_ENST00000431380.1_Missense_Mutation_p.Q246H|RP11-20I20.4_ENST00000609548.1_RNA	NM_012445.3	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	246					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)		CCCTGGGGCTCTGTCGCAGCC	0.637																																					p.Q246H		.											.	SPON2-90	0			c.G738T						.						104.0	102.0	103.0					4																	1164263		2203	4300	6503	SO:0001583	missense	10417	exon5			GGGGCTCTGTCGC	AB027466	CCDS3347.1	4p16.3	2008-07-29			ENSG00000159674	ENSG00000159674			11253	protein-coding gene	gene with protein product	"""Mindin"", ""M-spondin"""	605918				10512675, 15094111	Standard	NM_012445		Approved	DIL1	uc003gco.4	Q9BUD6	OTTHUMG00000089002	ENST00000290902.5:c.738G>T	4.37:g.1164263C>A	ENSP00000290902:p.Gln246His	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	124	46	NM_012445	0	0	0	0	0	D3DVN9|Q4W5N4|Q9ULW1	Missense_Mutation	SNP	ENST00000290902.5	37	CCDS3347.1	.	.	.	.	.	.	.	.	.	.	C	4.701	0.130282	0.08981	.	.	ENSG00000159674	ENST00000290902;ENST00000431380	T;T	0.10005	2.92;2.92	4.73	0.866	0.19079	.	0.275166	0.40640	N	0.001054	T	0.10465	0.0256	M	0.62723	1.935	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.20773	-1.0265	10	0.48119	T	0.1	.	5.9277	0.19122	0.0:0.4937:0.254:0.2523	.	246;246	D3DVN9;Q9BUD6	.;SPON2_HUMAN	H	246	ENSP00000290902:Q246H;ENSP00000394832:Q246H	ENSP00000290902:Q246H	Q	-	3	2	SPON2	1154263	0.003000	0.15002	0.455000	0.27031	0.047000	0.14425	-0.195000	0.09546	0.077000	0.16863	0.603000	0.83216	CAG	.		0.637	SPON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202080.2		
NWD2	57495	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	37447380	37447380	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:37447380T>G	ENST00000309447.5	+	7	4618	c.3770T>G	c.(3769-3771)tTt>tGt	p.F1257C		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1257										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						TCAGCTGTGTTTTTTTGGAGG	0.443																																					p.F1257C		.											.	.	0			c.T3770G						.						46.0	37.0	39.0					4																	37447380		692	1591	2283	SO:0001583	missense	57495	exon7			CTGTGTTTTTTTG																												ENST00000309447.5:c.3770T>G	4.37:g.37447380T>G	ENSP00000309501:p.Phe1257Cys	Somatic	232	0		WXS	Illumina HiSeq	Phase_I	261	22	NM_001144990	0	0	0	0	0	A8MRU1	Missense_Mutation	SNP	ENST00000309447.5	37	CCDS47040.1	.	.	.	.	.	.	.	.	.	.	T	19.78	3.890298	0.72524	.	.	ENSG00000174145	ENST00000309447	T	0.30981	1.51	6.15	6.15	0.99193	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.43875	0.1267	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.27536	-1.0071	10	0.40728	T	0.16	.	16.7886	0.85580	0.0:0.0:0.0:1.0	.	1257	Q9ULI1	K1239_HUMAN	C	1257	ENSP00000309501:F1257C	ENSP00000309501:F1257C	F	+	2	0	KIAA1239	37123775	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	7.690000	0.84178	2.363000	0.80096	0.523000	0.50628	TTT	.		0.443	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347551.2		
KLB	152831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	39435931	39435931	+	Silent	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:39435931G>T	ENST00000257408.4	+	2	1024	c.927G>T	c.(925-927)cgG>cgT	p.R309R		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	309	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						AGCCAAACCGGTCGGAAAACA	0.473																																					p.R309R		.											.	KLB-69	0			c.G927T						.						118.0	101.0	107.0					4																	39435931		2203	4300	6503	SO:0001819	synonymous_variant	152831	exon2			AAACCGGTCGGAA	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.927G>T	4.37:g.39435931G>T		Somatic	307	0		WXS	Illumina HiSeq	Phase_I	373	119	NM_175737	0	0	0	0	0	Q2M3K8	Silent	SNP	ENST00000257408.4	37	CCDS3451.1																																																																																			.		0.473	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
GABRG1	2565	hgsc.bcm.edu;bcgsc.ca	37	4	46043272	46043272	+	Splice_Site	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:46043272C>T	ENST00000295452.4	-	9	1299		c.e9-1			NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1						gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAGGAGTCATCTGAGCACAAT	0.388																																					.		.											.	GABRG1-92	0			c.1132-1G>A						.						44.0	46.0	45.0					4																	46043272		2203	4297	6500	SO:0001630	splice_region_variant	2565	exon10			AGTCATCTGAGCA	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.1132-1G>A	4.37:g.46043272C>T		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	70	17	NM_173536	0	0	0	0	0	Q5H9T8	Splice_Site	SNP	ENST00000295452.4	37	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.483181	0.26598	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.36548	D	0.871662	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8364	0.40971	0.0:0.9066:0.0:0.0934	.	.	.	.	.	-1	.	.	.	-	.	.	GABRG1	45738029	0.279000	0.24239	0.267000	0.24556	0.006000	0.05464	1.471000	0.35365	2.436000	0.82500	0.585000	0.79938	.	.		0.388	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	Intron
G3BP2	9908	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	76570830	76570830	+	Silent	SNP	A	A	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:76570830A>T	ENST00000359707.4	-	12	2018	c.1233T>A	c.(1231-1233)gcT>gcA	p.A411A	G3BP2_ENST00000395719.3_Silent_p.A411A|G3BP2_ENST00000357854.3_Silent_p.A378A	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	411					cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GCTCTCTTGCAGCTCTTGTTT	0.453																																					p.A411A													.	G3BP2-153	0			c.T1233A						.						226.0	187.0	200.0					4																	76570830		2203	4300	6503	SO:0001819	synonymous_variant	9908	exon12			TCTTGCAGCTCTT	AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.1233T>A	4.37:g.76570830A>T		Somatic	204	1		WXS	Illumina HiSeq	Phase_I	226	59	NM_012297	0	0	10	14	4	A8K6X1|O60606|O75149|Q9UPA1	Silent	SNP	ENST00000359707.4	37	CCDS3571.1																																																																																			.		0.453	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252399.2	NM_012297	
ARHGAP24	83478	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	86916564	86916564	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:86916564G>A	ENST00000395184.1	+	9	2223	c.1757G>A	c.(1756-1758)gGg>gAg	p.G586E	ARHGAP24_ENST00000264343.4_Missense_Mutation_p.G493E|ARHGAP24_ENST00000395183.2_Missense_Mutation_p.G491E	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	586					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		TTTTTTGGGGGGAACTTTGAG	0.562																																					p.G586E													.	ARHGAP24-227	0			c.G1757A						.						71.0	74.0	73.0					4																	86916564		2203	4300	6503	SO:0001583	missense	83478	exon9			TTGGGGGGAACTT	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.1757G>A	4.37:g.86916564G>A	ENSP00000378611:p.Gly586Glu	Somatic	153	1		WXS	Illumina HiSeq	Phase_I	166	55	NM_001025616	0	0	5	16	11	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	37	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	G	13.10	2.135263	0.37728	.	.	ENSG00000138639	ENST00000395184;ENST00000395183;ENST00000514229;ENST00000264343	T;T;T;T	0.14144	2.88;2.54;2.53;2.53	5.73	4.85	0.62838	.	0.101205	0.64402	D	0.000002	T	0.17662	0.0424	L	0.60455	1.87	0.48830	D	0.999715	B;B;P	0.50066	0.086;0.04;0.931	B;B;B	0.44224	0.035;0.01;0.444	T	0.07252	-1.0782	10	0.10377	T	0.69	.	18.1969	0.89825	0.0:0.1889:0.8111:0.0	.	491;493;586	Q8N264-3;Q8N264-2;Q8N264	.;.;RHG24_HUMAN	E	586;491;501;493	ENSP00000378611:G586E;ENSP00000378610:G491E;ENSP00000425589:G501E;ENSP00000264343:G493E	ENSP00000264343:G493E	G	+	2	0	ARHGAP24	87135588	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	5.010000	0.64004	2.710000	0.92621	0.491000	0.48974	GGG	.		0.562	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	126239108	126239108	+	Silent	SNP	T	T	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:126239108T>C	ENST00000394329.3	+	1	1555	c.1542T>C	c.(1540-1542)atT>atC	p.I514I		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	514	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GTTACAGCATTGTCTCTGGCA	0.562											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I514I		.											.	FAT4-108	0			c.T1542C						.						63.0	65.0	65.0					4																	126239108		2203	4300	6503	SO:0001819	synonymous_variant	79633	exon1			CAGCATTGTCTCT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.1542T>C	4.37:g.126239108T>C		Somatic	150	0	1548	WXS	Illumina HiSeq	Phase_I	147	55	NM_024582	0	0	0	0	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																			.		0.562	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
HAND2	9464	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	174450317	174450317	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:174450317A>T	ENST00000359562.4	-	1	1063	c.124T>A	c.(124-126)Tac>Aac	p.Y42N	HAND2-AS1_ENST00000505621.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000503309.1_RNA|HAND2_ENST00000505300.1_5'UTR|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000507636.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000504429.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000505817.1_RNA|HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000508887.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2	42					adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CCATGGAAGTAGGGGTTCTCC	0.726																																					p.Y42N		.											.	HAND2-91	0			c.T124A						.						5.0	6.0	6.0					4																	174450317		1939	3897	5836	SO:0001583	missense	9464	exon1			GGAAGTAGGGGTT	AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.124T>A	4.37:g.174450317A>T	ENSP00000352565:p.Tyr42Asn	Somatic	17	0		WXS	Illumina HiSeq	Phase_I	29	7	NM_021973	0	0	0	0	0	B6ECG9|O95300|O95301|P97833|Q494T1	Missense_Mutation	SNP	ENST00000359562.4	37	CCDS3819.1	.	.	.	.	.	.	.	.	.	.	A	18.74	3.688940	0.68271	.	.	ENSG00000164107	ENST00000359562;ENST00000393686	D	0.97066	-4.23	3.57	3.57	0.40892	.	0.281047	0.34178	N	0.004194	D	0.96078	0.8722	L	0.38175	1.15	0.58432	D	0.999995	D;D;D	0.63046	0.992;0.992;0.986	P;P;P	0.57204	0.815;0.815;0.701	D	0.94998	0.8140	10	0.39692	T	0.17	-0.0407	12.291	0.54819	1.0:0.0:0.0:0.0	.	42;42;42	B6ECG9;P61296;E9PCP7	.;HAND2_HUMAN;.	N	42	ENSP00000352565:Y42N	ENSP00000352565:Y42N	Y	-	1	0	HAND2	174686892	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.391000	0.66266	1.491000	0.48482	0.379000	0.24179	TAC	.		0.726	HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362241.3		
WDR17	116966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	177056301	177056301	+	Missense_Mutation	SNP	G	G	A	rs140987021		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:177056301G>A	ENST00000280190.4	+	9	1369	c.1213G>A	c.(1213-1215)Gat>Aat	p.D405N	WDR17_ENST00000507824.2_Missense_Mutation_p.D388N|WDR17_ENST00000393643.2_Missense_Mutation_p.D381N|WDR17_ENST00000508596.1_Missense_Mutation_p.D381N			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	405										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CAAACCTGACGATCCTAATCT	0.353																																					p.D405N		.											.	WDR17-95	0			c.G1213A						.	G	ASN/ASP,ASN/ASP	0,4406		0,0,2203	121.0	122.0	122.0		1213,1141	2.4	1.0	4	dbSNP_134	122	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	WDR17	NM_170710.4,NM_181265.3	23,23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	405/1323,381/1284	177056301	1,13005	2203	4300	6503	SO:0001583	missense	116966	exon9			CCTGACGATCCTA	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1213G>A	4.37:g.177056301G>A	ENSP00000280190:p.Asp405Asn	Somatic	213	0		WXS	Illumina HiSeq	Phase_I	190	62	NM_170710	0	0	0	0	0	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326502	0.24080	0.0	1.16E-4	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.58652	0.35;3.58;0.32	5.5	2.42	0.29668	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);WD40-repeat-containing domain (1);	0.265065	0.38164	N	0.001790	T	0.30324	0.0761	N	0.13198	0.31	0.48571	D	0.999678	B;B	0.19445	0.036;0.036	B;B	0.18871	0.023;0.023	T	0.15150	-1.0447	10	0.05525	T	0.97	-17.5458	6.7154	0.23300	0.433:0.0:0.567:0.0	.	381;405	E7EQX0;Q8IZU2	.;WDR17_HUMAN	N	381;381;405;388	ENSP00000422763:D381N;ENSP00000377258:D381N;ENSP00000280190:D405N	ENSP00000280190:D405N	D	+	1	0	WDR17	177293295	1.000000	0.71417	0.998000	0.56505	0.740000	0.42216	3.339000	0.52135	0.703000	0.31848	0.650000	0.86243	GAT	G|1.000;A|0.000		0.353	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
ANKHD1	54882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	139876316	139876316	+	Silent	SNP	A	A	G			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr5:139876316A>G	ENST00000360839.2	+	15	2611	c.2457A>G	c.(2455-2457)gaA>gaG	p.E819E	ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.E819E|ANKHD1_ENST00000462121.1_3'UTR|ANKHD1_ENST00000297183.6_Silent_p.E819E	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	819						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGATAGAAGAACTTAAAAAGA	0.368																																					p.E819E		.											.	ANKHD1-185	0			c.A2457G						.						69.0	73.0	71.0					5																	139876316		2203	4300	6503	SO:0001819	synonymous_variant	54882	exon15			AGAAGAACTTAAA	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.2457A>G	5.37:g.139876316A>G		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	61	29	NM_017747	0	0	5	6	1	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	37	CCDS4225.1																																																																																			.		0.368	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
FAT2	2196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	150921871	150921871	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr5:150921871G>T	ENST00000261800.5	-	9	8829	c.8817C>A	c.(8815-8817)aaC>aaA	p.N2939K		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2939	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGACCTGCCTGTTCTGCTCAG	0.502																																					p.N2939K		.											.	FAT2-96	0			c.C8817A						.						127.0	121.0	123.0					5																	150921871		2203	4300	6503	SO:0001583	missense	2196	exon9			CTGCCTGTTCTGC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8817C>A	5.37:g.150921871G>T	ENSP00000261800:p.Asn2939Lys	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	104	30	NM_001447	0	0	0	0	0	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921781	0.73213	.	.	ENSG00000086570	ENST00000261800	T	0.59906	0.23	6.05	1.26	0.21427	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000002	T	0.76807	0.4039	M	0.89601	3.045	0.47511	D	0.999445	D	0.89917	1.0	D	0.97110	1.0	T	0.77199	-0.2675	10	0.56958	D	0.05	.	10.6765	0.45789	0.4552:0.0:0.5448:0.0	.	2939	Q9NYQ8	FAT2_HUMAN	K	2939	ENSP00000261800:N2939K	ENSP00000261800:N2939K	N	-	3	2	FAT2	150902064	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	1.206000	0.32321	0.147000	0.19030	0.650000	0.86243	AAC	.		0.502	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
KIF4B	285643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	154395501	154395501	+	Silent	SNP	G	G	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr5:154395501G>A	ENST00000435029.4	+	1	2242	c.2082G>A	c.(2080-2082)caG>caA	p.Q694Q		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	694	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAAACTTCCAGAAACAATCCA	0.438																																					p.Q694Q		.											.	KIF4B-1	0			c.G2082A						.						103.0	107.0	106.0					5																	154395501		2203	4300	6503	SO:0001819	synonymous_variant	285643	exon1			CTTCCAGAAACAA	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2082G>A	5.37:g.154395501G>A		Somatic	302	0		WXS	Illumina HiSeq	Phase_I	320	79	NM_001099293	0	0	0	0	0		Silent	SNP	ENST00000435029.4	37	CCDS47324.1																																																																																			.		0.438	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
CASP8AP2	9994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	90577520	90577520	+	RNA	SNP	G	G	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr6:90577520G>T	ENST00000551025.1	+	0	5948									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		AATTCAAGCAGTAAATCAAGT	0.423																																					p.S1504I	Colon(187;1656 2025 17045 31481 39901)	.											.	CASP8AP2-24	0			c.G4511T						.						84.0	80.0	82.0					6																	90577520		1902	4115	6017			9994	exon8			CAAGCAGTAAATC	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90577520G>T		Somatic	142	0		WXS	Illumina HiSeq	Phase_I	156	44	NM_001137667	0	0	0	1	1		Missense_Mutation	SNP	ENST00000551025.1	37																																																																																				.		0.423	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
FBXO30	84085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	146126628	146126628	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr6:146126628C>T	ENST00000237281.4	-	2	1080	c.914G>A	c.(913-915)gGt>gAt	p.G305D		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	305							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G305D(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		TTTTGAATCACCATGTAAATT	0.403																																					p.G305D		.											.	FBXO30-291	1	Substitution - Missense(1)	lung(1)	c.G914A						.						125.0	119.0	121.0					6																	146126628		2203	4300	6503	SO:0001583	missense	84085	exon2			GAATCACCATGTA	AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.914G>A	6.37:g.146126628C>T	ENSP00000237281:p.Gly305Asp	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	84	16	NM_032145	0	0	1	1	0	Q9BXZ7	Missense_Mutation	SNP	ENST00000237281.4	37	CCDS5208.1	.	.	.	.	.	.	.	.	.	.	C	0.042	-1.281092	0.01398	.	.	ENSG00000118496	ENST00000237281	T	0.17691	2.26	5.29	0.298	0.15766	.	1.121610	0.06334	N	0.706654	T	0.02767	0.0083	L	0.36672	1.1	0.22127	N	0.999344	B	0.02656	0.0	B	0.01281	0.0	T	0.40905	-0.9538	10	0.08381	T	0.77	-3.4918	2.8503	0.05555	0.1103:0.4508:0.2365:0.2024	.	305	Q8TB52	FBX30_HUMAN	D	305	ENSP00000237281:G305D	ENSP00000237281:G305D	G	-	2	0	FBXO30	146168321	0.000000	0.05858	0.946000	0.38457	0.946000	0.59487	0.028000	0.13644	0.046000	0.15833	0.655000	0.94253	GGT	.		0.403	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042570.2		
ABCB4	5244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	87037472	87037472	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr7:87037472C>T	ENST00000265723.4	-	25	3271	c.3160G>A	c.(3160-3162)Ggg>Agg	p.G1054R	ABCB4_ENST00000453593.1_Missense_Mutation_p.G1007R|ABCB4_ENST00000358400.3_Missense_Mutation_p.G1007R|ABCB4_ENST00000359206.3_Missense_Mutation_p.G1054R|ABCB4_ENST00000545634.1_Missense_Mutation_p.G1054R	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1054	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	AGGCTCAGCCCCTGAAGCACT	0.498																																					p.G1054R		.											.	ABCB4-96	0			c.G3160A						.						82.0	80.0	81.0					7																	87037472		2203	4300	6503	SO:0001583	missense	5244	exon25			TCAGCCCCTGAAG	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.3160G>A	7.37:g.87037472C>T	ENSP00000265723:p.Gly1054Arg	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	150	30	NM_018849	0	0	3	5	2	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	37	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.390489	0.82902	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.91011	-2.77;-2.77;-2.77;-2.77;-2.77	5.19	3.18	0.36537	ABC transporter-like (1);	0.158975	0.56097	N	0.000029	D	0.92632	0.7659	L	0.51914	1.62	0.80722	D	1	P;D;P	0.54047	0.947;0.964;0.939	P;D;D	0.68943	0.789;0.961;0.914	D	0.91904	0.5534	10	0.87932	D	0	-4.0274	11.256	0.49054	0.0:0.8415:0.0:0.1585	.	1007;1054;1054	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	R	1054;1007;1054;1007;1054	ENSP00000352135:G1054R;ENSP00000351172:G1007R;ENSP00000265723:G1054R;ENSP00000392983:G1007R;ENSP00000437465:G1054R	ENSP00000265723:G1054R	G	-	1	0	ABCB4	86875408	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.034000	0.57289	0.565000	0.29255	0.655000	0.94253	GGG	.		0.498	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
LRRD1	401387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	91794441	91794441	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr7:91794441A>T	ENST00000458448.1	-	2	276	c.76T>A	c.(76-78)Tca>Aca	p.S26T	LRRD1_ENST00000454089.2_5'UTR|CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000422722.1_Intron|LRRD1_ENST00000343318.5_Intron|LRRD1_ENST00000430130.2_Missense_Mutation_p.S26T			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	26					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						TCCTTCATTGACTGTGATCTA	0.353																																					p.S26T		.											.	.	0			c.T76A						.						42.0	35.0	37.0					7																	91794441		692	1590	2282	SO:0001583	missense	401387	exon1			TCATTGACTGTGA	BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.76T>A	7.37:g.91794441A>T	ENSP00000405987:p.Ser26Thr	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	72	37	NM_001161528	0	0	0	0	0	B7ZMM9|Q49AT9	Missense_Mutation	SNP	ENST00000458448.1	37	CCDS55124.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196434	0.58126	.	.	ENSG00000240720	ENST00000458448;ENST00000430130;ENST00000437357	T;T	0.39592	1.07;1.07	5.15	4.0	0.46444	.	.	.	.	.	T	0.33440	0.0863	L	0.29908	0.895	0.23765	N	0.996904	P	0.45044	0.849	B	0.42798	0.398	T	0.12218	-1.0556	9	0.72032	D	0.01	.	8.6791	0.34198	0.9112:0.0:0.0888:0.0	.	26	A4D1F6	LRRD1_HUMAN	T	26	ENSP00000405987:S26T;ENSP00000411568:S26T	ENSP00000411568:S26T	S	-	1	0	LRRD1	91632377	0.000000	0.05858	0.003000	0.11579	0.010000	0.07245	0.322000	0.19576	0.908000	0.36671	0.528000	0.53228	TCA	.		0.353	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342027.2	NM_001045475	
TECPR1	25851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	97847037	97847037	+	Silent	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr7:97847037C>T	ENST00000447648.2	-	25	3650	c.3351G>A	c.(3349-3351)gaG>gaA	p.E1117E	TECPR1_ENST00000379795.3_Silent_p.E1119E			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	1117					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GGCCCTTGGGCTCGTGAGGCT	0.667																																					p.E1117E		.											.	TECPR1-91	0			c.G3351A						.						12.0	16.0	15.0					7																	97847037		2009	3915	5924	SO:0001819	synonymous_variant	25851	exon25			CTTGGGCTCGTGA		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.3351G>A	7.37:g.97847037C>T		Somatic	15	0		WXS	Illumina HiSeq	Phase_I	68	20	NM_015395	0	0	6	8	2	A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Silent	SNP	ENST00000447648.2	37	CCDS47648.1																																																																																			.		0.667	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	NM_015395	
MEPCE	56257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100030705	100030705	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr7:100030705T>A	ENST00000310512.2	+	2	2223	c.1835T>A	c.(1834-1836)aTc>aAc	p.I612N	PPP1R35_ENST00000476185.1_5'Flank|RP11-758P17.2_ENST00000492523.1_RNA|MEPCE_ENST00000414441.1_Missense_Mutation_p.I143N	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	612	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCTGGGGGCATCCTGGTCCTA	0.577																																					p.I612N		.											.	MEPCE-91	0			c.T1835A						.						72.0	69.0	70.0					7																	100030705		2203	4300	6503	SO:0001583	missense	56257	exon2			GGGGCATCCTGGT	AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.1835T>A	7.37:g.100030705T>A	ENSP00000308546:p.Ile612Asn	Somatic	219	0		WXS	Illumina HiSeq	Phase_I	367	83	NM_019606	0	0	35	53	18	B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	ENST00000310512.2	37	CCDS5693.1	.	.	.	.	.	.	.	.	.	.	T	19.74	3.883852	0.72410	.	.	ENSG00000146834	ENST00000414441;ENST00000425355;ENST00000310512	T;T	0.46819	0.86;0.86	5.37	5.37	0.77165	Bin3-type S-adenosyl-L-methionine binding domain (1);Bicoid-interacting 3 (1);	0.077394	0.52532	D	0.000064	T	0.50837	0.1639	L	0.45352	1.415	0.45066	D	0.998087	D	0.59357	0.985	P	0.58013	0.831	T	0.46470	-0.9189	10	0.29301	T	0.29	-24.0822	8.2283	0.31582	0.0:0.0895:0.0:0.9105	.	612	Q7L2J0	MEPCE_HUMAN	N	143;143;612	ENSP00000400875:I143N;ENSP00000308546:I612N	ENSP00000308546:I612N	I	+	2	0	MEPCE	99868641	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	5.644000	0.67902	2.156000	0.67533	0.379000	0.24179	ATC	.		0.577	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339135.1		
ELP3	55140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	28047190	28047190	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr8:28047190G>C	ENST00000256398.8	+	15	1969	c.1592G>C	c.(1591-1593)aGa>aCa	p.R531T	ELP3_ENST00000537665.1_Missense_Mutation_p.R412T|ELP3_ENST00000542181.1_Missense_Mutation_p.R402T|ELP3_ENST00000524103.1_Missense_Mutation_p.R459T|ELP3_ENST00000521015.1_Missense_Mutation_p.R517T|ELP3_ENST00000380353.4_Missense_Mutation_p.R439T	NM_001284220.1|NM_001284226.1|NM_018091.5	NP_001271149.1|NP_001271155.1|NP_060561.3	Q9H9T3	ELP3_HUMAN	elongator acetyltransferase complex subunit 3	531	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	histone acetyltransferase activity (GO:0004402)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|phosphorylase kinase regulator activity (GO:0008607)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		AATTATTATAGAAAGATCGGC	0.468																																					p.R531T		.											.	ELP3-90	0			c.G1592C						.						127.0	132.0	130.0					8																	28047190		2203	4300	6503	SO:0001583	missense	55140	exon15			ATTATAGAAAGAT		CCDS6065.1, CCDS64860.1, CCDS64861.1, CCDS75717.1, CCDS75718.1	8p21.1	2012-08-14	2012-08-08		ENSG00000134014	ENSG00000134014		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Elongator acetyltransferase complex subunits"""	20696	protein-coding gene	gene with protein product		612722	"""elongation protein 3 homolog (S. cerevisiae)"""			11714725	Standard	NM_018091		Approved	FLJ10422, KAT9	uc003xgo.4	Q9H9T3	OTTHUMG00000102124	ENST00000256398.8:c.1592G>C	8.37:g.28047190G>C	ENSP00000256398:p.Arg531Thr	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	82	28	NM_018091	0	0	7	12	5	B4DE19|B4DIG1|E2QRI5|Q53G84|Q6AWB0|Q9BVF7|Q9NVZ1	Missense_Mutation	SNP	ENST00000256398.8	37	CCDS6065.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297498	0.60086	.	.	ENSG00000134014	ENST00000521015;ENST00000256398;ENST00000542181;ENST00000524103;ENST00000537665;ENST00000380353	T;T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94;1.94	5.13	5.13	0.70059	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.44371	0.1290	H	0.96604	3.85	0.58432	D	0.999995	B;B	0.24576	0.106;0.062	B;B	0.31337	0.128;0.128	T	0.56238	-0.8012	10	0.72032	D	0.01	-17.8026	13.9575	0.64160	0.0:0.0:1.0:0.0	.	412;531	B4DE19;Q9H9T3	.;ELP3_HUMAN	T	517;531;402;459;412;439	ENSP00000428449:R517T;ENSP00000256398:R531T;ENSP00000439242:R402T;ENSP00000429180:R459T;ENSP00000445558:R412T;ENSP00000369711:R439T	ENSP00000256398:R531T	R	+	2	0	ELP3	28103109	1.000000	0.71417	0.978000	0.43139	0.982000	0.71751	4.723000	0.61965	2.669000	0.90835	0.655000	0.94253	AGA	.		0.468	ELP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219963.2	NM_018091	
CSMD3	114788	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	113516202	113516202	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr8:113516202T>C	ENST00000297405.5	-	30	5144	c.4900A>G	c.(4900-4902)Agc>Ggc	p.S1634G	CSMD3_ENST00000343508.3_Missense_Mutation_p.S1594G|CSMD3_ENST00000455883.2_Missense_Mutation_p.S1530G|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1634G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1634	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGTTCTATGCTAAAACTgaaa	0.308										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S1634G		.											.	CSMD3-1132	0			c.A4900G						.						69.0	67.0	68.0					8																	113516202		2203	4300	6503	SO:0001583	missense	114788	exon30			CTATGCTAAAACT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4900A>G	8.37:g.113516202T>C	ENSP00000297405:p.Ser1634Gly	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	32	10	NM_198123	0	0	0	0	0	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	19.81	3.897390	0.72639	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23	4.96	4.96	0.65561	CUB (5);	0.056809	0.64402	D	0.000002	T	0.31104	0.0786	L	0.55990	1.75	0.33482	D	0.587596	B;B;P	0.49635	0.007;0.008;0.926	B;B;P	0.58454	0.026;0.044;0.839	T	0.33266	-0.9875	10	0.22706	T	0.39	.	14.7774	0.69740	0.0:0.0:0.0:1.0	.	1530;1634;1594	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	G	1594;1634;974;1530;1634	ENSP00000345799:S1594G;ENSP00000297405:S1634G;ENSP00000341558:S974G;ENSP00000412263:S1530G;ENSP00000343124:S1634G	ENSP00000297405:S1634G	S	-	1	0	CSMD3	113585378	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.657000	0.83745	2.069000	0.61940	0.455000	0.32223	AGC	.		0.308	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSMD3	114788	hgsc.bcm.edu;bcgsc.ca	37	8	113516207	113516207	+	Splice_Site	SNP	C	C	G	rs76670724		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr8:113516207C>G	ENST00000297405.5	-	30	5140		c.e30-1		CSMD3_ENST00000343508.3_Splice_Site|CSMD3_ENST00000455883.2_Splice_Site|CSMD3_ENST00000352409.3_Splice_Site	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TATGCTAAAACTgaaaaaaaa	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											.		.											.	CSMD3-1132	0			c.4584-1G>C						.						61.0	60.0	60.0					8																	113516207		2203	4299	6502	SO:0001630	splice_region_variant	114788	exon30			CTAAAACTGAAAA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4896-1G>C	8.37:g.113516207C>G		Somatic	42	0		WXS	Illumina HiSeq	Phase_I	25	9	NM_052900	0	0	0	0	0	Q96PZ3	Splice_Site	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.736213	0.69189	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.378	0.90441	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CSMD3	113585383	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	7.446000	0.80609	2.560000	0.86352	0.557000	0.71058	.	.		0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	Intron
ZNF79	7633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	130206739	130206739	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr9:130206739T>C	ENST00000342483.5	+	5	1166	c.760T>C	c.(760-762)Tgt>Cgt	p.C254R	ZNF79_ENST00000543471.1_Missense_Mutation_p.C230R	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						GTGCAGTGAATGTGGAAGAGC	0.532																																					p.C254R		.											.	ZNF79-90	0			c.T760C						.						101.0	92.0	95.0					9																	130206739		2203	4300	6503	SO:0001583	missense	7633	exon5			AGTGAATGTGGAA	X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.760T>C	9.37:g.130206739T>C	ENSP00000362446:p.Cys254Arg	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	129	35	NM_007135	0	0	0	0	0	Q5VVW1|Q96NV1	Missense_Mutation	SNP	ENST00000342483.5	37	CCDS6871.1	.	.	.	.	.	.	.	.	.	.	T	16.12	3.034463	0.54896	.	.	ENSG00000196152	ENST00000342483;ENST00000543471	D;D	0.85955	-2.05;-2.05	3.53	2.38	0.29361	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92404	0.7589	H	0.98682	4.3	0.80722	D	1	D	0.53745	0.962	P	0.53313	0.723	D	0.90977	0.4824	9	0.87932	D	0	.	6.7985	0.23738	0.0:0.1169:0.0:0.8831	.	254	Q15937	ZNF79_HUMAN	R	254;230	ENSP00000362446:C254R;ENSP00000438418:C230R	ENSP00000362446:C254R	C	+	1	0	ZNF79	129246560	1.000000	0.71417	0.659000	0.29680	0.986000	0.74619	5.308000	0.65768	0.555000	0.29079	0.533000	0.62120	TGT	.		0.532	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054188.1	NM_007135	
TLR7	51284	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	12906681	12906681	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chrX:12906681C>A	ENST00000380659.3	+	3	3193	c.3054C>A	c.(3052-3054)aaC>aaA	p.N1018K		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	1018	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	GGCCAACAAACCCGCAAGCTC	0.498																																					p.N1018K													.	TLR7-564	0			c.C3054A						.						132.0	132.0	132.0					X																	12906681		2203	4300	6503	SO:0001583	missense	51284	exon3			AACAAACCCGCAA	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.3054C>A	X.37:g.12906681C>A	ENSP00000370034:p.Asn1018Lys	Somatic	73	1		WXS	Illumina HiSeq	Phase_I	59	38	NM_016562	0	0	4	4	0	D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.709113	0.48517	.	.	ENSG00000196664	ENST00000380659	T	0.02552	4.25	5.72	3.77	0.43336	Toll/interleukin-1 receptor homology (TIR) domain (3);	0.126973	0.49916	D	0.000130	T	0.12305	0.0299	M	0.82630	2.6	0.53005	D	0.999963	D	0.57257	0.979	P	0.62298	0.9	T	0.00128	-1.2018	10	0.87932	D	0	.	7.9627	0.30081	0.0:0.5072:0.0:0.4928	.	1018	Q9NYK1	TLR7_HUMAN	K	1018	ENSP00000370034:N1018K	ENSP00000370034:N1018K	N	+	3	2	TLR7	12816602	0.966000	0.33281	0.997000	0.53966	0.987000	0.75469	0.178000	0.16820	0.448000	0.26722	0.600000	0.82982	AAC	.		0.498	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562	
FAM47A	158724	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	34148836	34148836	+	Silent	SNP	C	C	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chrX:34148836C>T	ENST00000346193.3	-	1	1611	c.1560G>A	c.(1558-1560)gaG>gaA	p.E520E		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	520										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TCTTGGGAGGCTCCGAGCGGA	0.657																																					p.E520E													.	FAM47A-134	0			c.G1560A						.						29.0	31.0	30.0					X																	34148836		2188	4287	6475	SO:0001819	synonymous_variant	158724	exon1			GGGAGGCTCCGAG	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1560G>A	X.37:g.34148836C>T		Somatic	23	1		WXS	Illumina HiSeq	Phase_I	79	52	NM_203408	0	0	0	0	0	A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	CCDS43926.1																																																																																			.		0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
TTTY14	83869	bcgsc.ca	37	Y	21154603	21154603	+	IGR	SNP	A	A	C	rs79788321		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chrY:21154603A>C								TTTY14 (114489 upstream) : RNU6-255P (26265 downstream)																							CATGTCCCCTACGTCGGTGCG	0.662																																					.													.	.	0			.						.																																			SO:0001628	intergenic_variant	100133941	.			TCCCCTACGTCGG																													Y.37:g.21154603A>C		Somatic	25	0		WXS	Illumina HiSeq	Phase_1	22	5	.	0	0	0	605	605		RNA	SNP		37																																																																																				.	0	0.662								
MKI67	4288	broad.mit.edu	37	10	129905112	129905113	+	Frame_Shift_Del	DEL	TG	TG	-	rs145960091		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr10:129905112_129905113delTG	ENST00000368654.3	-	13	5366_5367	c.4991_4992delCA	c.(4990-4992)acafs	p.T1664fs	MKI67_ENST00000368653.3_Frame_Shift_Del_p.T1304fs	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1664	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTGTTGGCTCTGTGTGTGTGTG	0.51																																					p.1664_1664del													.	MKI67-519	0			c.4991_4992del						.																																			SO:0001589	frameshift_variant	4288	exon13			TGGCTCTGTGTGT	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.4991_4992delCA	10.37:g.129905122_129905123delTG	ENSP00000357643:p.Thr1664fs	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	184	9	NM_002417	0	0	0	0	0	Q5VWH2	Frame_Shift_Del	DEL	ENST00000368654.3	37	CCDS7659.1																																																																																			.		0.510	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
TUT1	64852	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	62343357	62343370	+	Frame_Shift_Del	DEL	GTAAAGGGATCGGC	GTAAAGGGATCGGC	-	rs149885942|rs371469091		TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	GTAAAGGGATCGGC	GTAAAGGGATCGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr11:62343357_62343370delGTAAAGGGATCGGC	ENST00000476907.1	-	9	2512_2525	c.1821_1834delGCCGATCCCTTTAC	c.(1819-1836)acgccgatccctttacccfs	p.PIPLP608fs	EEF1G_ENST00000378019.3_5'Flank|EEF1G_ENST00000532986.1_5'Flank|TUT1_ENST00000308436.7_Frame_Shift_Del_p.PIPLP646fs|MIR3654_ENST00000496634.2_Intron|EEF1G_ENST00000329251.4_5'Flank			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	608					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGTGCAAGGGGTAAAGGGATCGGCGTAGCAGAGA	0.636																																					p.645_650del		.											.	TUT1-91	0			c.1935_1948del						.																																			SO:0001589	frameshift_variant	64852	exon9			.	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.1821_1834delGCCGATCCCTTTAC	11.37:g.62343357_62343370delGTAAAGGGATCGGC	ENSP00000419607:p.Pro608fs	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	130	27	NM_022830	0	0	0	0	0	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Frame_Shift_Del	DEL	ENST00000476907.1	37																																																																																				.		0.636	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000351319.2	NM_022830	
BTBD2	55643	broad.mit.edu	37	19	2015365	2015365	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr19:2015365delT	ENST00000255608.4	-	1	354	c.338delA	c.(337-339)aacfs	p.N113fs	BTBD2_ENST00000590646.1_Intron	NM_017797.3	NP_060267.2	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	113						cytoplasmic mRNA processing body (GO:0000932)				endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	12		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCACCTCGTTGTTGAAGAG	0.741																																					p.N113fs													.	BTBD2-92	0			c.338delA						.						19.0	12.0	14.0					19																	2015365		1832	3545	5377	SO:0001589	frameshift_variant	55643	exon1			ACCTCGTTGTTGA	AF355797	CCDS12078.1	19p13.3	2013-10-02			ENSG00000133243	ENSG00000133243		"""BTB/POZ domain containing"""	15504	protein-coding gene	gene with protein product		608531				11179693	Standard	XM_005259593		Approved		uc002lup.1	Q9BX70	OTTHUMG00000180017	ENST00000255608.4:c.338delA	19.37:g.2015365delT	ENSP00000255608:p.Asn113fs	Somatic	6	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_017797	0	0	0	0	0	O60418|O75248|Q4VBZ1|Q6IAC5|Q7Z5W0|Q96SX8|Q9NPS1|Q9NX81	Frame_Shift_Del	DEL	ENST00000255608.4	37	CCDS12078.1																																																																																			.		0.741	BTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449300.2		
TTL	150465	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	113260589	113260589	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr2:113260589delA	ENST00000233336.6	+	5	897	c.706delA	c.(706-708)aaafs	p.K236fs		NM_153712.4	NP_714923.1	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	236	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)|microtubule cytoskeleton organization (GO:0000226)|regulation of axon extension (GO:0030516)		ATP binding (GO:0005524)|tubulin-tyrosine ligase activity (GO:0004835)			breast(1)|large_intestine(2)|ovary(1)	4		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		TTTCCAAGACAAAACCTGCCA	0.388			T	ETV6	ALL																																p.K236fs		.		Dom	yes		2	2q13	150465	tubulin tyrosine ligase		L	.	TTL-658	0			c.706delA						.						126.0	124.0	125.0					2																	113260589		2203	4300	6503	SO:0001589	frameshift_variant	150465	exon5			.		CCDS2096.1	2q13	2010-04-21			ENSG00000114999	ENSG00000114999	6.3.2.25		21586	protein-coding gene	gene with protein product		608291				11431336	Standard	NM_153712		Approved	MGC46235	uc002thu.3	Q8NG68	OTTHUMG00000131316	ENST00000233336.6:c.706delA	2.37:g.113260589delA	ENSP00000233336:p.Lys236fs	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	126	31	NM_153712	0	0	0	0	0	Q585T3|Q7Z302|Q8N426	Frame_Shift_Del	DEL	ENST00000233336.6	37	CCDS2096.1																																																																																			.		0.388	TTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254085.2	NM_153712	
GRB14	2888	broad.mit.edu	37	2	165365288	165365288	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr2:165365288delT	ENST00000263915.3	-	7	1429	c.891delA	c.(889-891)aaafs	p.K297fs	GRB14_ENST00000543549.1_Frame_Shift_Del_p.K210fs	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	297	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.K297fs*23(2)		breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						GTGCTCCATGTTTTTTTTTGC	0.373																																					p.K297fs													.	GRB14-420	2	Deletion - Frameshift(2)	ovary(1)|breast(1)	c.891delA						.						111.0	115.0	114.0					2																	165365288		2203	4300	6503	SO:0001589	frameshift_variant	2888	exon7			TCCATGTTTTTTT		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.891delA	2.37:g.165365288delT	ENSP00000263915:p.Lys297fs	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	138	10	NM_004490	0	0	0	0	0	B7Z7F9|Q7Z6I1	Frame_Shift_Del	DEL	ENST00000263915.3	37	CCDS2222.1																																																																																			.		0.373	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2		
GAD1	2571	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	171705820	171705820	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr2:171705820delA	ENST00000358196.3	+	12	1694	c.1144delA	c.(1144-1146)atgfs	p.M382fs		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	382					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						TGGGCTGCTCATGTCCAGGAA	0.537																																					p.M382fs		.											.	GAD1-91	0			c.1144delA						.						76.0	67.0	70.0					2																	171705820		2203	4300	6503	SO:0001589	frameshift_variant	2571	exon12			.		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.1144delA	2.37:g.171705820delA	ENSP00000350928:p.Met382fs	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	138	50	NM_000817	0	0	0	0	0	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Frame_Shift_Del	DEL	ENST00000358196.3	37	CCDS2239.1																																																																																			.		0.537	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
CENPK	64105	broad.mit.edu;bcgsc.ca	37	5	64824334	64824341	+	Frame_Shift_Del	DEL	CCCAAGGT	CCCAAGGT	-			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	CCCAAGGT	CCCAAGGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr5:64824334_64824341delCCCAAGGT	ENST00000396679.1	-	9	749_756	c.535_542delACCTTGGG	c.(535-543)accttgggcfs	p.TLG179fs	CENPK_ENST00000510693.1_Frame_Shift_Del_p.TLG116fs|CENPK_ENST00000514814.1_Frame_Shift_Del_p.TLG179fs|CENPK_ENST00000508421.1_Frame_Shift_Del_p.TLG149fs|CENPK_ENST00000506282.2_5'UTR|CENPK_ENST00000242872.3_Frame_Shift_Del_p.TLG179fs	NM_022145.4	NP_071428.2	Q9BS16	CENPK_HUMAN	centromere protein K	179					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)	10		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00466)		TAGAAACTCGCCCAAGGTACTCAAGAGT	0.264																																					p.179_181del													.	CENPK-90	0			c.535_542del						.																																			SO:0001589	frameshift_variant	64105	exon9			AACTCGCCCAAGG	BC008504	CCDS3984.1	5q12.3	2013-11-05			ENSG00000123219	ENSG00000123219			29479	protein-coding gene	gene with protein product		611502				8950979	Standard	NM_022145		Approved	FKSG14, SOLT, CENP-K	uc003jtu.3	Q9BS16	OTTHUMG00000131227	ENST00000396679.1:c.535_542delACCTTGGG	5.37:g.64824334_64824341delCCCAAGGT	ENSP00000379911:p.Thr179fs	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	68	8	NM_001267038	0	0	0	0	0	Q9H4L0	Frame_Shift_Del	DEL	ENST00000396679.1	37	CCDS3984.1																																																																																			.		0.264	CENPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253971.2	NM_022145	
RGMB	285704	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	98115590	98115591	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr5:98115590_98115591delGG	ENST00000513185.1	+	2	879_880	c.443_444delGG	c.(442-444)aggfs	p.R148fs	RGMB_ENST00000308234.7_Frame_Shift_Del_p.R189fs|RGMB_ENST00000504776.1_3'UTR			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	148					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		GCTGGAGCCAGGGAACACAGGA	0.51																																					p.189_189del		.											.	.	0			c.566_567del						.																																			SO:0001589	frameshift_variant	285704	exon4			.	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.443_444delGG	5.37:g.98115590_98115591delGG	ENSP00000423256:p.Arg148fs	Somatic	174	0		WXS	Illumina HiSeq	Phase_I	204	65	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Frame_Shift_Del	DEL	ENST00000513185.1	37																																																																																				.		0.510	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
SLC25A40	55972	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	87466048	87466048	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr7:87466048delA	ENST00000341119.5	-	11	1247	c.901delT	c.(901-903)tcafs	p.S301fs		NM_018843.3	NP_061331.2	Q8TBP6	S2540_HUMAN	solute carrier family 25, member 40	301					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	17	Esophageal squamous(14;0.00202)					TTTTTACCTGAAAATAATCCG	0.264																																					p.S301fs		.											.	SLC25A40-91	0			c.901delT						.						25.0	27.0	26.0					7																	87466048		2182	4244	6426	SO:0001589	frameshift_variant	55972	exon11			.	AF125531	CCDS5610.1	7q21.12	2013-05-22			ENSG00000075303	ENSG00000075303		"""Solute carriers"""	29680	protein-coding gene	gene with protein product		610821				16949250	Standard	NM_018843		Approved	MCFP	uc003uje.3	Q8TBP6	OTTHUMG00000131033	ENST00000341119.5:c.901delT	7.37:g.87466048delA	ENSP00000344831:p.Ser301fs	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	112	21	NM_018843	0	0	0	0	0	A8K483|D6W5P6|Q53GB1|Q9UHR1	Frame_Shift_Del	DEL	ENST00000341119.5	37	CCDS5610.1																																																																																			.		0.264	SLC25A40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253677.5	NM_018843	
TRIM55	84675	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	67064722	67064722	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr8:67064722delT	ENST00000315962.4	+	8	1469	c.1096delT	c.(1096-1098)tttfs	p.F366fs	TRIM55_ENST00000276573.7_Frame_Shift_Del_p.F366fs|TRIM55_ENST00000353317.5_Frame_Shift_Del_p.F366fs|TRIM55_ENST00000350034.4_Intron	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	366					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TCAAACAGAGTTTCCAGGAGA	0.498																																					p.F366fs		.											.	TRIM55-230	0			c.1096delT						.						70.0	70.0	70.0					8																	67064722		2203	4300	6503	SO:0001589	frameshift_variant	84675	exon8			.	AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.1096delT	8.37:g.67064722delT	ENSP00000323913:p.Phe366fs	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	44	17	NM_184086	0	0	0	0	0	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Frame_Shift_Del	DEL	ENST00000315962.4	37	CCDS6184.1																																																																																			.		0.498	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378921.1	NM_184085	
IL9R	3581	broad.mit.edu	37	X	155239822	155239824	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	CAA	CAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chrX:155239822_155239824delCAA	ENST00000244174.5	+	9	1493_1495	c.1314_1316delCAA	c.(1312-1317)agcaac>agc	p.N442del	IL9R_ENST00000540897.1_3'UTR|IL9R_ENST00000424344.3_In_Frame_Del_p.N421del|IL9R_ENST00000369423.2_3'UTR	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	442	Poly-Asn.				cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)	p.N439S(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					gcagcagcagcaacaacaacaAC	0.635																																					p.438_439del													.	IL9R-40	1	Substitution - Missense(1)	kidney(1)	c.1314_1316del						.																																			SO:0001651	inframe_deletion	3581	exon9			CAGCAGCAACAAC	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.1314_1316delCAA	X.37:g.155239831_155239833delCAA	ENSP00000244174:p.Asn442del	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	239	8	NM_002186	0	0	0	0	0	B9ZVT0|Q14634|Q8WWU1|Q96TF0	In_Frame_Del	DEL	ENST00000244174.5	37	CCDS14771.4																																																																																			.		0.635	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	
NUP88	4927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	5312151	5312152	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr17:5312151_5312152insA	ENST00000573584.1	-	5	1267_1268	c.758_759insT	c.(757-759)ctafs	p.L253fs		NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	253					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						TTTGTCCAAATAGAGTCTTTGG	0.436																																					p.L253fs		.											.	NUP88-204	0			c.759_760insT						.																																			SO:0001589	frameshift_variant	4927	exon5			.	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.759dupT	17.37:g.5312152_5312152dupA	ENSP00000458954:p.Leu253fs	Somatic	162	0		WXS	Illumina HiSeq	Phase_I	254	61	NM_002532	0	0	0	0	0	D3DTM2|Q9BWE5	Frame_Shift_Ins	INS	ENST00000573584.1	37	CCDS11070.1																																																																																			.		0.436	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532	
ATP13A1	57130	broad.mit.edu;bcgsc.ca	37	19	19762514	19762515	+	Frame_Shift_Ins	INS	-	-	TGCAGGA			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr19:19762514_19762515insTGCAGGA	ENST00000357324.6	-	17	2344_2345	c.2318_2319insTCCTGCA	c.(2317-2319)cagfs	p.Q773fs	ATP13A1_ENST00000496082.1_5'Flank|ATP13A1_ENST00000291503.5_Frame_Shift_Ins_p.Q655fs	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	773						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CGGAGGGAGGCTGCAGGATCAG	0.609																																					p.Q773fs	Esophageal Squamous(142;920 1789 9047 14684 24777)												.	ATP13A1-138	0			c.2319_2320insTCCTGCA						.																																			SO:0001589	frameshift_variant	57130	exon17			GGGAGGCTGCAGG	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.2312_2318dupTCCTGCA	19.37:g.19762515_19762521dupTGCAGGA	ENSP00000349877:p.Gln773fs	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	227	36	NM_020410	0	0	0	0	0	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Frame_Shift_Ins	INS	ENST00000357324.6	37	CCDS32970.2																																																																																			.		0.609	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
SEL1L3	23231	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	25819805	25819806	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HE-A5NL-01A-11D-A26P-10	TCGA-HE-A5NL-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a441697c-4ca0-4eab-9b01-b9cb50223ce2	49cd5084-c2b5-47d4-b921-2f2316afe33a	g.chr4:25819805_25819806insT	ENST00000399878.3	-	9	1640_1641	c.1518_1519insA	c.(1516-1521)aaacacfs	p.H507fs	SEL1L3_ENST00000502949.1_Frame_Shift_Ins_p.H354fs|SEL1L3_ENST00000264868.5_Frame_Shift_Ins_p.H472fs	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	507						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						AAGCTGGGGTGTTTGTCTTTCA	0.55																																					p.H507fs		.											.	.	0			c.1519_1520insA						.																																			SO:0001589	frameshift_variant	23231	exon9			.	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.1519dupA	4.37:g.25819808_25819808dupT	ENSP00000382767:p.His507fs	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	198	49	NM_015187	0	0	0	0	0	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Frame_Shift_Ins	INS	ENST00000399878.3	37	CCDS47037.1																																																																																			.		0.550	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187	
