#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R2	80834	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19181215	19181215	+	Missense_Mutation	SNP	G	G	A	rs79635934	byFrequency	TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:19181215G>A	ENST00000375371.3	-	3	770	c.749C>T	c.(748-750)aCg>aTg	p.T250M	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	250					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CTCCTCTGACGTCATGTTCTG	0.657													G|||	2	0.000399361	0.0008	0.0	5008	,	,		20261	0.0		0.0	False		,,,				2504	0.001				p.T250M													.	TAS1R2-93	0			c.C749T						.						57.0	51.0	53.0					1																	19181215		2203	4300	6503	SO:0001583	missense	80834	exon3			TCTGACGTCATGT		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.749C>T	1.37:g.19181215G>A	ENSP00000364520:p.Thr250Met	Somatic	61	1		WXS	Illumina HiSeq	Phase_I	50	9	NM_152232	0	0	0	0	0	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	4.948	0.176107	0.09443	.	.	ENSG00000179002	ENST00000375371	D	0.83335	-1.71	4.99	0.249	0.15531	Extracellular ligand-binding receptor (1);	0.889934	0.09444	N	0.801346	T	0.70894	0.3276	L	0.40543	1.245	0.09310	N	1	B	0.27679	0.185	B	0.29176	0.099	T	0.56950	-0.7894	10	0.32370	T	0.25	.	0.6727	0.00861	0.2718:0.2522:0.3128:0.1632	.	250	Q8TE23	TS1R2_HUMAN	M	250	ENSP00000364520:T250M	ENSP00000364520:T250M	T	-	2	0	TAS1R2	19053802	0.005000	0.15991	0.001000	0.08648	0.002000	0.02628	0.849000	0.27723	0.185000	0.20105	-0.254000	0.11334	ACG	G|0.999;A|0.000		0.657	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
VCAM1	7412	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	101198018	101198018	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:101198018C>G	ENST00000294728.2	+	7	1671	c.1570C>G	c.(1570-1572)Ctg>Gtg	p.L524V	VCAM1_ENST00000347652.2_Missense_Mutation_p.L432V|VCAM1_ENST00000370119.4_Missense_Mutation_p.L462V|VCAM1_ENST00000370115.1_Missense_Mutation_p.L325V	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	524	Ig-like C2-type 6.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	TTCCTCCATCCTGGAGGAAGG	0.537																																					p.L524V		.											.	VCAM1-90	0			c.C1570G						.						66.0	70.0	69.0					1																	101198018		2203	4300	6503	SO:0001583	missense	7412	exon7			TCCATCCTGGAGG	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.1570C>G	1.37:g.101198018C>G	ENSP00000294728:p.Leu524Val	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	27	9	NM_001078	0	0	210	441	231	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	CCDS773.1	.	.	.	.	.	.	.	.	.	.	C	2.960	-0.214840	0.06101	.	.	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728;ENST00000370115	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	5.57	-3.82	0.04281	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.317042	0.32884	N	0.005531	T	0.00524	0.0017	N	0.01048	-1.04	0.09310	N	1	B;B;B	0.19706	0.001;0.038;0.0	B;B;B	0.23150	0.007;0.044;0.008	T	0.33675	-0.9859	10	0.02654	T	1	-0.0111	4.6967	0.12808	0.1001:0.1771:0.5014:0.2214	.	462;432;524	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	V	462;432;524;325	ENSP00000359137:L462V;ENSP00000304611:L432V;ENSP00000294728:L524V;ENSP00000359133:L325V	ENSP00000294728:L524V	L	+	1	2	VCAM1	100970606	0.000000	0.05858	0.002000	0.10522	0.771000	0.43674	-1.681000	0.01937	-0.367000	0.08052	-0.140000	0.14226	CTG	.		0.537	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078	
GON4L	54856	ucsc.edu	37	1	155726782	155726782	+	Silent	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:155726782C>T	ENST00000368331.1	-	27	5532	c.5484G>A	c.(5482-5484)agG>agA	p.R1828R	GON4L_ENST00000437809.1_Silent_p.R1828R|GON4L_ENST00000271883.5_Silent_p.R1828R	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1828					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCTCTTTTTTCCTCTTGTTCT	0.438																																					p.R1828R													.	GON4L-93	0			c.G5484A						.						120.0	114.0	116.0					1																	155726782		1859	4096	5955	SO:0001819	synonymous_variant	54856	exon27			TTTTTTCCTCTTG	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.5484G>A	1.37:g.155726782C>T		Somatic	107	0		WXS	Illumina HiSeq		206	3	NM_001037533	0	0	9	10	1	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				.		0.438	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
TTC24	164118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156552861	156552861	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:156552861G>C	ENST00000368237.3	+	3	938	c.938G>C	c.(937-939)gGc>gCc	p.G313A	TTC24_ENST00000368236.3_Missense_Mutation_p.G313A|TTC24_ENST00000478081.1_Intron			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	313										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGGGAGCAGGGCCGGAGCTTT	0.657																																					p.G313A		.											.	TTC24-46	0			c.G938C						.						33.0	39.0	37.0					1																	156552861		2031	4169	6200	SO:0001583	missense	164118	exon4			AGCAGGGCCGGAG		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.938G>C	1.37:g.156552861G>C	ENSP00000357220:p.Gly313Ala	Somatic	190	0		WXS	Illumina HiSeq	Phase_I	183	38	NM_001105669	0	0	0	0	0	Q5T3H7	Missense_Mutation	SNP	ENST00000368237.3	37	CCDS53379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.276|7.276	0.608179|0.608179	0.14002|0.14002	.|.	.|.	ENSG00000187862|ENSG00000187862	ENST00000340086;ENST00000413282|ENST00000368236;ENST00000368237	.|T;T	.|0.70869	.|-0.52;-0.52	4.72|4.72	4.72|4.72	0.59763|0.59763	.|Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.|0.000000	.|0.48767	.|D	.|0.000175	T|T	0.56761|0.56761	0.2007|0.2007	L|L	0.33245|0.33245	0.995|0.995	0.37041|0.37041	D|D	0.897135|0.897135	.|D	.|0.62365	.|0.991	.|P	.|0.60541	.|0.876	T|T	0.59402|0.59402	-0.7461|-0.7461	5|10	.|0.02654	.|T	.|1	-14.4059|-14.4059	13.0458|13.0458	0.58925|0.58925	0.0:0.163:0.8369:0.0|0.0:0.163:0.8369:0.0	.|.	.|313	.|A2A3L6	.|TTC24_HUMAN	P|A	86;78|313	.|ENSP00000357219:G313A;ENSP00000357220:G313A	.|ENSP00000357219:G313A	A|G	+|+	1|2	0|0	TTC24|TTC24	154819485|154819485	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.445000|4.445000	0.60007|0.60007	2.474000|2.474000	0.83562|0.83562	0.455000|0.455000	0.32223|0.32223	GCC|GGC	.		0.657	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158547.1	XM_089384	
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158596772	158596772	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:158596772T>C	ENST00000368147.4	-	41	5870	c.5690A>G	c.(5689-5691)aAa>aGa	p.K1897R		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1897					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGAAATCTCTTTGTTCTGACT	0.413																																					p.K1897R		.											.	SPTA1-142	0			c.A5690G						.						127.0	125.0	126.0					1																	158596772		1849	4090	5939	SO:0001583	missense	6708	exon41			ATCTCTTTGTTCT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5690A>G	1.37:g.158596772T>C	ENSP00000357129:p.Lys1897Arg	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	127	19	NM_003126	0	0	0	0	0	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	12.07	1.827369	0.32329	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.53640	0.61;0.61	4.87	3.73	0.42828	.	.	.	.	.	T	0.15435	0.0372	N	0.21448	0.665	0.29575	N	0.849575	B	0.02656	0.0	B	0.12837	0.008	T	0.14643	-1.0465	9	0.46703	T	0.11	.	8.4299	0.32750	0.3124:0.0:0.0:0.6876	.	1897	P02549	SPTA1_HUMAN	R	1897;1894	ENSP00000357130:K1897R;ENSP00000357129:K1894R	ENSP00000357129:K1894R	K	-	2	0	SPTA1	156863396	0.976000	0.34144	0.910000	0.35882	0.968000	0.65278	0.874000	0.28065	0.864000	0.35578	0.460000	0.39030	AAA	.		0.413	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
OLFML2B	25903	broad.mit.edu;bcgsc.ca	37	1	161989778	161989778	+	Silent	SNP	C	C	G	rs138821383		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:161989778C>G	ENST00000294794.3	-	2	792	c.369G>C	c.(367-369)tcG>tcC	p.S123S	OLFML2B_ENST00000367940.2_Silent_p.S123S	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	123					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			GATTGAGGGCCGATGGGGGTG	0.592																																					p.S123S													.	OLFML2B-69	0			c.G369C						.						69.0	68.0	68.0					1																	161989778		2203	4300	6503	SO:0001819	synonymous_variant	25903	exon2			GAGGGCCGATGGG	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.369G>C	1.37:g.161989778C>G		Somatic	148	0		WXS	Illumina HiSeq	Phase_I	190	8	NM_015441	0	0	4	4	0	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Silent	SNP	ENST00000294794.3	37	CCDS1236.1																																																																																			C|0.999;T|0.000		0.592	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
HHIPL2	79802	broad.mit.edu;bcgsc.ca	37	1	222715413	222715413	+	Silent	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:222715413G>A	ENST00000343410.6	-	3	1117	c.1059C>T	c.(1057-1059)ttC>ttT	p.F353F		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	353					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)	p.F353F(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CGTCCCCAGTGAATATGTACA	0.507																																					p.F353F													.	HHIPL2-69	1	Substitution - coding silent(1)	stomach(1)	c.C1059T						.						69.0	66.0	67.0					1																	222715413		2203	4300	6503	SO:0001819	synonymous_variant	79802	exon3			CCCAGTGAATATG	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1059C>T	1.37:g.222715413G>A		Somatic	165	0		WXS	Illumina HiSeq	Phase_I	207	10	NM_024746	0	0	2	2	0	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Silent	SNP	ENST00000343410.6	37	CCDS1530.2																																																																																			.		0.507	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	237993878	237993878	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:237993878C>T	ENST00000366574.2	+	103	15021	c.14704C>T	c.(14704-14706)Cca>Tca	p.P4902S	RYR2_ENST00000360064.6_Missense_Mutation_p.P4908S|RYR2_ENST00000542537.1_Missense_Mutation_p.P4886S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4902			P -> L (in CPVT1). {ECO:0000269|PubMed:14571276}.		BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CGACACAGTGCCACATGGCTT	0.433																																					p.P4902S		.											.	RYR2-158	0			c.C14704T						.						213.0	200.0	204.0					1																	237993878		1968	4170	6138	SO:0001583	missense	6262	exon103			ACAGTGCCACATG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14704C>T	1.37:g.237993878C>T	ENSP00000355533:p.Pro4902Ser	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	212	74	NM_001035	0	0	0	0	0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	34	5.362728	0.95877	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96774	-4.12;-4.08;-4.11	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000007	D	0.97539	0.9194	L	0.56280	1.765	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.98376	1.0556	10	0.87932	D	0	-8.5845	19.143	0.93452	0.0:1.0:0.0:0.0	.	4902	Q92736	RYR2_HUMAN	S	4902;4908;4886	ENSP00000355533:P4902S;ENSP00000353174:P4908S;ENSP00000443798:P4886S	ENSP00000353174:P4908S	P	+	1	0	RYR2	236060501	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.773000	0.85462	2.509000	0.84616	0.561000	0.74099	CCA	.		0.433	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
CHRM3	1131	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	240072456	240072456	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:240072456C>T	ENST00000255380.4	+	5	2484	c.1705C>T	c.(1705-1707)Cgc>Tgc	p.R569C		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	569					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AAAAAAGAGGCGCAAGCAGCA	0.498																																					p.R569C		.											.	CHRM3-95	0			c.C1705T						.						49.0	49.0	49.0					1																	240072456		2203	4300	6503	SO:0001583	missense	1131	exon5			AAGAGGCGCAAGC	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1705C>T	1.37:g.240072456C>T	ENSP00000255380:p.Arg569Cys	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	210	18	NM_000740	0	0	0	0	0	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	37	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593426	0.66219	.	.	ENSG00000133019	ENST00000255380	T	0.38887	1.11	5.58	5.58	0.84498	.	0.120714	0.51477	D	0.000092	T	0.58637	0.2136	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	P	0.57324	0.818	T	0.60459	-0.7259	10	0.72032	D	0.01	-16.0194	19.5758	0.95444	0.0:1.0:0.0:0.0	.	569	P20309	ACM3_HUMAN	C	569	ENSP00000255380:R569C	ENSP00000255380:R569C	R	+	1	0	CHRM3	238139079	0.996000	0.38824	0.992000	0.48379	0.986000	0.74619	3.339000	0.52135	2.632000	0.89209	0.655000	0.94253	CGC	.		0.498	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
OR2L3	391192	broad.mit.edu	37	1	248224862	248224862	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:248224862C>A	ENST00000359959.3	+	1	879	c.879C>A	c.(877-879)aaC>aaA	p.N293K	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GCCTGAGGAACAAGGAGGTGA	0.498																																					p.N293K													.	OR2L3-68	0			c.C879A						.						57.0	58.0	58.0					1																	248224862		2203	4300	6503	SO:0001583	missense	391192	exon1			GAGGAACAAGGAG	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.879C>A	1.37:g.248224862C>A	ENSP00000353044:p.Asn293Lys	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	178	5	NM_001004687	0	0	0	0	0	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.724007	0.30593	.	.	ENSG00000198128	ENST00000359959	T	0.50001	0.76	2.01	2.01	0.26516	.	.	.	.	.	T	0.71230	0.3315	H	0.96889	3.9	0.26668	N	0.971781	D	0.54601	0.967	P	0.53224	0.721	T	0.67534	-0.5646	9	0.87932	D	0	.	11.9452	0.52924	0.0:1.0:0.0:0.0	.	293	Q8NG85	OR2L3_HUMAN	K	293	ENSP00000353044:N293K	ENSP00000353044:N293K	N	+	3	2	OR2L3	246291485	0.000000	0.05858	0.983000	0.44433	0.575000	0.36095	-1.063000	0.03465	1.119000	0.41883	0.456000	0.33151	AAC	.		0.498	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	16955917	16955917	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr10:16955917G>A	ENST00000377833.4	-	48	7491	c.7426C>T	c.(7426-7428)Cgg>Tgg	p.R2476W		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2476	CUB 18. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCGCAGATCCGGCCATGAGGA	0.532																																					p.R2476W		.											.	CUBN-166	0			c.C7426T						.						113.0	107.0	109.0					10																	16955917		2203	4300	6503	SO:0001583	missense	8029	exon48			AGATCCGGCCATG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.7426C>T	10.37:g.16955917G>A	ENSP00000367064:p.Arg2476Trp	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	42	14	NM_001081	0	0	0	1	1	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165155	0.38217	.	.	ENSG00000107611	ENST00000377833	T	0.28895	1.59	5.42	2.44	0.29823	CUB (5);	0.173875	0.27686	N	0.018262	T	0.32585	0.0834	M	0.76838	2.35	0.80722	D	1	B	0.20988	0.05	B	0.18561	0.022	T	0.11060	-1.0603	10	0.59425	D	0.04	.	8.2013	0.31426	0.0727:0.0:0.5311:0.3961	.	2476	O60494	CUBN_HUMAN	W	2476	ENSP00000367064:R2476W	ENSP00000367064:R2476W	R	-	1	2	CUBN	16995923	1.000000	0.71417	0.175000	0.22980	0.703000	0.40648	1.663000	0.37429	0.219000	0.20840	0.591000	0.81541	CGG	.		0.532	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
BMI1	648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	22618246	22618246	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr10:22618246C>G	ENST00000376663.3	+	10	1261	c.756C>G	c.(754-756)gaC>gaG	p.D252E	COMMD3-BMI1_ENST00000602390.1_Missense_Mutation_p.D395E	NM_005180.8	NP_005171.4	P35226	BMI1_HUMAN	BMI1 proto-oncogene, polycomb ring finger	252	Pro/Ser-rich.				chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|regulation of gene expression (GO:0010468)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|ubiquitin ligase complex (GO:0000151)	RING-like zinc finger domain binding (GO:0071535)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|urinary_tract(1)	12						TGGAAAGTGACTCTGGGAGTG	0.493																																					p.D395E		.											.	.	0			c.C1185G						.						92.0	86.0	88.0					10																	22618246		2203	4300	6503	SO:0001583	missense	0	exon14			AAGTGACTCTGGG	BC011652	CCDS7138.1	10p13	2014-06-26	2014-06-26	2006-04-26	ENSG00000168283	ENSG00000168283		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	1066	protein-coding gene	gene with protein product		164831	"""polycomb group ring finger 4"", ""B lymphoma Mo-MLV insertion region 1 homolog (mouse)"""	PCGF4		8268912	Standard	NM_005180		Approved	RNF51		P35226	OTTHUMG00000017807	ENST00000376663.3:c.756C>G	10.37:g.22618246C>G	ENSP00000365851:p.Asp252Glu	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	65	22	NM_001204062	0	0	38	51	13	Q16030|Q5T8Z3|Q96F37	Missense_Mutation	SNP	ENST00000376663.3	37	CCDS7138.1	.	.	.	.	.	.	.	.	.	.	C	2.210	-0.380859	0.05000	.	.	ENSG00000168283	ENST00000376691;ENST00000376663;ENST00000443519	T;T	0.46063	1.61;0.88	5.58	5.58	0.84498	.	0.045306	0.85682	D	0.000000	T	0.28532	0.0706	N	0.20328	0.56	0.49483	D	0.99979	B;B	0.26547	0.152;0.091	B;B	0.23275	0.03;0.045	T	0.11542	-1.0583	10	0.06891	T	0.86	-6.5673	19.1861	0.93644	0.0:1.0:0.0:0.0	.	252;252	Q5U0M5;P35226	.;BMI1_HUMAN	E	164;252;157	ENSP00000365851:D252E;ENSP00000390768:D157E	ENSP00000365851:D252E	D	+	3	2	BMI1	22658252	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.602000	0.61098	2.638000	0.89438	0.650000	0.86243	GAC	.		0.493	BMI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047176.1	NM_005180	
PIPSL	266971	ucsc.edu	37	10	95718760	95718760	+	RNA	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr10:95718760G>A	ENST00000480546.1	-	0	2537					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										ATGTGTCCATGGCTGAGCTGG	0.527																																					.													.	.	0			.						.																																					266971	.			GTCCATGGCTGAG	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95718760G>A		Somatic	342	0		WXS	Illumina HiSeq		303	1	.	0	0	0	2	2	Q6NUK8	RNA	SNP	ENST00000480546.1	37																																																																																				.		0.527	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000351483.1	NR_002319	
PIPSL	266971	ucsc.edu	37	10	95719427	95719427	+	RNA	SNP	T	T	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr10:95719427T>C	ENST00000480546.1	-	0	1870					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										ATGGGCCACGTGGATGCCCAT	0.537																																					.													.	.	0			.						.																																					266971	.			GCCACGTGGATGC	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95719427T>C		Somatic	269	0		WXS	Illumina HiSeq		224	1	.	0	0	0	0	0	Q6NUK8	RNA	SNP	ENST00000480546.1	37																																																																																				.		0.537	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000351483.1	NR_002319	
ABCC2	1244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	101578919	101578919	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr10:101578919C>A	ENST00000370449.4	+	19	2626	c.2513C>A	c.(2512-2514)aCa>aAa	p.T838K		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	838	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	GGGAATGGAACAATTGTAGAG	0.403																																					p.T838K		.											.	ABCC2-91	0			c.C2513A						.						111.0	111.0	111.0					10																	101578919		2203	4300	6503	SO:0001583	missense	1244	exon19			ATGGAACAATTGT	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.2513C>A	10.37:g.101578919C>A	ENSP00000359478:p.Thr838Lys	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	105	21	NM_000392	0	0	0	0	0	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.655317	0.00779	.	.	ENSG00000023839	ENST00000370449	T	0.75050	-0.9	5.6	2.69	0.31865	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.560580	0.20863	N	0.084313	T	0.43033	0.1229	N	0.04355	-0.22	0.09310	N	0.999999	B	0.11235	0.004	B	0.10450	0.005	T	0.25847	-1.0120	10	0.07813	T	0.8	-14.5155	3.6997	0.08378	0.1227:0.5036:0.2384:0.1353	.	838	Q92887	MRP2_HUMAN	K	838	ENSP00000359478:T838K	ENSP00000359478:T838K	T	+	2	0	ABCC2	101568909	0.000000	0.05858	0.950000	0.38849	0.198000	0.23893	-0.155000	0.10115	0.699000	0.31761	0.561000	0.74099	ACA	.		0.403	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
TRIM8	81603	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104404529	104404529	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr10:104404529G>C	ENST00000302424.7	+	1	277	c.155G>C	c.(154-156)tGc>tCc	p.C52S	RP11-47A8.5_ENST00000607967.1_lincRNA	NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	52					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CTCGTACGCTGCCCAGAGTGC	0.612																																					p.C52S													.	TRIM8-227	0			c.G155C						.						33.0	37.0	35.0					10																	104404529		2202	4300	6502	SO:0001583	missense	81603	exon1			TACGCTGCCCAGA	AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.155G>C	10.37:g.104404529G>C	ENSP00000302120:p.Cys52Ser	Somatic	162	2		WXS	Illumina HiSeq	Phase_I	122	15	NM_030912	0	0	58	61	3	A6NI31|Q9C028	Missense_Mutation	SNP	ENST00000302424.7	37	CCDS31274.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154435	0.78114	.	.	ENSG00000171206	ENST00000302424;ENST00000369896	T	0.54479	0.57	3.53	3.53	0.40419	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.84714	0.5533	H	0.99619	4.66	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92169	0.5742	10	0.87932	D	0	.	16.3843	0.83500	0.0:0.0:1.0:0.0	.	52	Q9BZR9	TRIM8_HUMAN	S	52	ENSP00000302120:C52S	ENSP00000302120:C52S	C	+	2	0	TRIM8	104394519	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.361000	0.97122	2.277000	0.76020	0.561000	0.74099	TGC	.		0.612	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050084.3	NM_030912	
OR6A2	8590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6816105	6816105	+	Missense_Mutation	SNP	C	C	A	rs369095527		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr11:6816105C>A	ENST00000332601.3	-	1	1023	c.835G>T	c.(835-837)Gtc>Ttc	p.V279F		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	279					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AGTACAGAGACCAACTTGTTG	0.468																																					p.V279F		.											.	OR6A2-94	0			c.G835T						.	C	PHE/VAL	0,4402		0,0,2201	139.0	130.0	133.0		835	4.1	0.9	11		133	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR6A2	NM_003696.2	50	0,1,6496	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging	279/328	6816105	1,12993	2201	4296	6497	SO:0001583	missense	8590	exon1			CAGAGACCAACTT	AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.835G>T	11.37:g.6816105C>A	ENSP00000330384:p.Val279Phe	Somatic	192	0		WXS	Illumina HiSeq	Phase_I	152	18	NM_003696	0	0	0	0	0	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	ENST00000332601.3	37	CCDS7772.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845132	0.32606	0.0	1.16E-4	ENSG00000184933	ENST00000332601	T	0.38722	1.12	5.04	4.13	0.48395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000122	T	0.51719	0.1691	L	0.42632	1.34	0.33539	D	0.594625	D	0.89917	1.0	D	0.97110	1.0	T	0.63959	-0.6519	10	0.87932	D	0	.	7.3142	0.26491	0.0:0.7407:0.1697:0.0896	.	279	O95222	OR6A2_HUMAN	F	279	ENSP00000330384:V279F	ENSP00000330384:V279F	V	-	1	0	OR6A2	6772681	0.000000	0.05858	0.883000	0.34634	0.059000	0.15707	-0.095000	0.11077	1.508000	0.48769	0.655000	0.94253	GTC	.		0.468	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385981.1	NM_003696	
IGSF22	283284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	18738381	18738381	+	Silent	SNP	A	A	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr11:18738381A>G	ENST00000513874.1	-	10	1279	c.1140T>C	c.(1138-1140)gaT>gaC	p.D380D	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	380										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						GCGTCAGACCATCTTCGGACA	0.522																																					p.D380D		.											.	IGSF22-140	0			c.T1140C						.						242.0	237.0	238.0					11																	18738381		2077	4197	6274	SO:0001819	synonymous_variant	283284	exon10			CAGACCATCTTCG	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1140T>C	11.37:g.18738381A>G		Somatic	443	0		WXS	Illumina HiSeq	Phase_I	370	109	NM_173588	0	0	0	0	0	A6NNA0|D6RGV7	Silent	SNP	ENST00000513874.1	37	CCDS41625.2																																																																																			.		0.522	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
OR4S1	256148	broad.mit.edu;bcgsc.ca	37	11	48328626	48328626	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr11:48328626C>G	ENST00000319988.1	+	1	852	c.852C>G	c.(850-852)atC>atG	p.I284M		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						ACCCTTTGATCTATACACTAA	0.458																																					p.I284M													.	OR4S1-69	0			c.C852G						.						116.0	103.0	108.0					11																	48328626		2201	4298	6499	SO:0001583	missense	256148	exon1			TTTGATCTATACA	AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.852C>G	11.37:g.48328626C>G	ENSP00000321447:p.Ile284Met	Somatic	254	0		WXS	Illumina HiSeq	Phase_I	170	8	NM_001004725	0	0	0	0	0	Q6IFB4	Missense_Mutation	SNP	ENST00000319988.1	37	CCDS31488.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.826742	0.32329	.	.	ENSG00000176555	ENST00000319988	T	0.57273	0.41	5.02	-0.74	0.11115	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.72415	0.3457	M	0.91612	3.225	0.29229	N	0.87339	D	0.89917	1.0	D	0.91635	0.999	T	0.63633	-0.6593	9	0.87932	D	0	.	5.8325	0.18588	0.1251:0.5577:0.0:0.3173	.	284	Q8NGB4	OR4S1_HUMAN	M	284	ENSP00000321447:I284M	ENSP00000321447:I284M	I	+	3	3	OR4S1	48285202	0.001000	0.12720	0.255000	0.24374	0.385000	0.30292	-1.467000	0.02352	-0.015000	0.14150	0.655000	0.94253	ATC	.		0.458	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390556.1	NM_001004725	
OR4D9	390199	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	59282746	59282746	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr11:59282746G>C	ENST00000329328.3	+	1	361	c.361G>C	c.(361-363)Gac>Cac	p.D121H		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						GATGGCGTTTGACCGCTATAT	0.522																																					p.D121H		.											.	OR4D9-68	0			c.G361C						.						83.0	80.0	81.0					11																	59282746		2201	4295	6496	SO:0001583	missense	390199	exon1			GCGTTTGACCGCT	AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.361G>C	11.37:g.59282746G>C	ENSP00000328563:p.Asp121His	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	72	6	NM_001004711	0	0	0	0	0	Q6IFF3	Missense_Mutation	SNP	ENST00000329328.3	37	CCDS31564.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617776	0.46736	.	.	ENSG00000172742	ENST00000329328	T	0.55234	0.53	4.16	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42821	U	0.000643	T	0.80053	0.4553	H	0.95437	3.67	0.40769	D	0.983072	D	0.89917	1.0	D	0.81914	0.995	D	0.87427	0.2386	10	0.87932	D	0	-6.8922	15.3691	0.74548	0.0:0.0:1.0:0.0	.	121	Q8NGE8	OR4D9_HUMAN	H	121	ENSP00000328563:D121H	ENSP00000328563:D121H	D	+	1	0	OR4D9	59039322	1.000000	0.71417	0.849000	0.33467	0.015000	0.08874	9.723000	0.98772	2.002000	0.58637	0.563000	0.77884	GAC	.		0.522	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394237.1	NM_001004711	
SLCO2B1	11309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	74875111	74875111	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr11:74875111G>T	ENST00000289575.5	+	3	646	c.251G>T	c.(250-252)aGc>aTc	p.S84I	SLCO2B1_ENST00000454962.2_Intron|SLCO2B1_ENST00000428359.2_Missense_Mutation_p.S62I|SLCO2B1_ENST00000532236.1_Intron|SLCO2B1_ENST00000531756.1_Intron|SLCO2B1_ENST00000341411.4_5'UTR|SLCO2B1_ENST00000525650.1_Intron|SLCO2B1_ENST00000526660.1_Intron	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	84					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	GGCCTCTCCAGCCAGACGTCG	0.637																																					p.S84I		.											.	SLCO2B1-154	0			c.G251T						.						26.0	22.0	23.0					11																	74875111		2200	4293	6493	SO:0001583	missense	11309	exon3			TCTCCAGCCAGAC	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.251G>T	11.37:g.74875111G>T	ENSP00000289575:p.Ser84Ile	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	99	9	NM_007256	0	0	1	2	1	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Missense_Mutation	SNP	ENST00000289575.5	37	CCDS8235.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547002	0.86022	.	.	ENSG00000137491	ENST00000531713;ENST00000289575;ENST00000527180;ENST00000534186;ENST00000428359	T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36	4.82	4.82	0.62117	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.80303	0.4598	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.86661	0.1904	10	0.87932	D	0	.	15.3904	0.74739	0.0:0.0:1.0:0.0	.	84	O94956	SO2B1_HUMAN	I	62;84;62;62;62	ENSP00000432889:S62I;ENSP00000289575:S84I;ENSP00000436513:S62I;ENSP00000433872:S62I;ENSP00000388912:S62I	ENSP00000289575:S84I	S	+	2	0	SLCO2B1	74552759	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.180000	0.94867	2.240000	0.73641	0.591000	0.81541	AGC	.		0.637	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	
TENM4	26011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	78413254	78413254	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr11:78413254C>A	ENST00000278550.7	-	28	4866	c.4404G>T	c.(4402-4404)gaG>gaT	p.E1468D		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1468					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CGGTGGCTGACTCCAGGGTTG	0.567																																					p.E1468D		.											.	.	0			c.G4404T						.						59.0	60.0	60.0					11																	78413254		2071	4210	6281	SO:0001583	missense	26011	exon28			GGCTGACTCCAGG	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.4404G>T	11.37:g.78413254C>A	ENSP00000278550:p.Glu1468Asp	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	58	30	NM_001098816	0	0	0	0	0	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428265	0.62844	.	.	ENSG00000149256	ENST00000278550	D	0.90004	-2.6	5.53	5.53	0.82687	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.89636	0.6772	L	0.35593	1.075	0.50467	D	0.999876	D	0.64830	0.994	D	0.70716	0.97	D	0.87315	0.2314	9	.	.	.	.	10.0702	0.42328	0.0:0.8536:0.0:0.1464	.	1468	Q6N022	TEN4_HUMAN	D	1468	ENSP00000278550:E1468D	.	E	-	3	2	ODZ4	78090902	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	0.803000	0.27083	2.882000	0.98803	0.655000	0.94253	GAG	.		0.567	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
A2M	2	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	9251341	9251341	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr12:9251341G>C	ENST00000318602.7	-	15	2020	c.1713C>G	c.(1711-1713)agC>agG	p.S571R		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	571					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	ATGGGCTGAAGCTCAAATCCA	0.527																																					p.S571R		.											.	A2M-515	0			c.C1713G						.						45.0	46.0	46.0					12																	9251341		2203	4300	6503	SO:0001583	missense	2	exon15			GCTGAAGCTCAAA	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.1713C>G	12.37:g.9251341G>C	ENSP00000323929:p.Ser571Arg	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	88	15	NM_000014	0	0	0	0	0	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720504	0.30503	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.62232	0.04	5.55	3.61	0.41365	Alpha-2-macroglobulin, N-terminal 2 (1);	0.741044	0.13685	N	0.369887	T	0.55924	0.1951	L	0.60455	1.87	0.33904	D	0.638822	B	0.24092	0.097	B	0.30316	0.114	T	0.61574	-0.7035	10	0.36615	T	0.2	.	5.8923	0.18919	0.0783:0.135:0.6479:0.1387	.	571	P01023	A2MG_HUMAN	R	571;586	ENSP00000323929:S571R	ENSP00000323929:S571R	S	-	3	2	A2M	9142608	0.512000	0.26186	0.998000	0.56505	0.376000	0.30014	0.897000	0.28390	1.484000	0.48361	0.655000	0.94253	AGC	.		0.527	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
ABCD2	225	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	39973352	39973352	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr12:39973352C>T	ENST00000308666.3	-	8	1997	c.1862G>A	c.(1861-1863)cGt>cAt	p.R621H		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	621	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)	p.R621L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						ATAAAACATACGAGCCATGCC	0.358																																					p.R621H		.											.	ABCD2-95	1	Substitution - Missense(1)	lung(1)	c.G1862A						.						141.0	136.0	138.0					12																	39973352		2203	4300	6503	SO:0001583	missense	225	exon8			AACATACGAGCCA	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.1862G>A	12.37:g.39973352C>T	ENSP00000310688:p.Arg621His	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	72	13	NM_005164	0	0	0	0	0	B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	CCDS8734.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589233	0.86851	.	.	ENSG00000173208	ENST00000308666	D	0.99893	-7.57	5.08	5.08	0.68730	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.069130	0.56097	D	0.000022	D	0.99932	0.9969	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.95891	0.8907	9	.	.	.	-16.2697	18.5246	0.90967	0.0:1.0:0.0:0.0	.	621	Q9UBJ2	ABCD2_HUMAN	H	621	ENSP00000310688:R621H	.	R	-	2	0	ABCD2	38259619	1.000000	0.71417	0.983000	0.44433	0.666000	0.39218	7.520000	0.81821	2.381000	0.81170	0.579000	0.79373	CGT	.		0.358	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49431988	49431988	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr12:49431988C>G	ENST00000301067.7	-	34	9150	c.9151G>C	c.(9151-9153)Gca>Cca	p.A3051P	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3051					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TCAGTATATGCCAGCAGGTCA	0.517																																					p.A3051P		.											.	MLL2-612	0			c.G9151C						.						97.0	95.0	95.0					12																	49431988		2015	4202	6217	SO:0001583	missense	8085	exon34			TATATGCCAGCAG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9151G>C	12.37:g.49431988C>G	ENSP00000301067:p.Ala3051Pro	Somatic	235	0		WXS	Illumina HiSeq	Phase_I	256	59	NM_003482	0	0	1	2	1	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.202944	0.38905	.	.	ENSG00000167548	ENST00000301067	D	0.94457	-3.43	5.11	5.11	0.69529	.	0.000000	0.38272	N	0.001746	D	0.96284	0.8788	L	0.49126	1.545	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.96801	0.9589	10	0.87932	D	0	.	17.698	0.88286	0.0:1.0:0.0:0.0	.	3051	O14686	MLL2_HUMAN	P	3051	ENSP00000301067:A3051P	ENSP00000301067:A3051P	A	-	1	0	MLL2	47718255	1.000000	0.71417	0.972000	0.41901	0.971000	0.66376	7.707000	0.84623	2.549000	0.85964	0.655000	0.94253	GCA	.		0.517	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
SHMT2	6472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57625677	57625677	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr12:57625677G>C	ENST00000328923.3	+	4	945	c.493G>C	c.(493-495)Gac>Cac	p.D165H	SHMT2_ENST00000449049.3_Missense_Mutation_p.D144H|SHMT2_ENST00000554600.1_3'UTR|SHMT2_ENST00000553474.1_Missense_Mutation_p.D144H|SHMT2_ENST00000557487.1_Missense_Mutation_p.D165H|SHMT2_ENST00000393827.4_Missense_Mutation_p.W59C|SHMT2_ENST00000414700.3_Missense_Mutation_p.D144H	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	165					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	CATGGGGCTGGACCTGCCCGA	0.587																																					p.D165H	Esophageal Squamous(150;1369 2416 49071 49364)	.											.	SHMT2-91	0			c.G493C						.						30.0	27.0	28.0					12																	57625677		2203	4300	6503	SO:0001583	missense	6472	exon4			GGGCTGGACCTGC	AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.493G>C	12.37:g.57625677G>C	ENSP00000333667:p.Asp165His	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	75	15	NM_005412	0	0	85	118	33	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	37	CCDS8934.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.546641|4.546641	0.86022|0.86022	.|.	.|.	ENSG00000182199|ENSG00000182199	ENST00000328923;ENST00000557487;ENST00000555634;ENST00000556689;ENST00000414700;ENST00000553529;ENST00000554310;ENST00000557427;ENST00000553474;ENST00000555773;ENST00000554975;ENST00000449049;ENST00000556737|ENST00000393827	T;T;T;T;T;T;T;T;T;T;T;T;T|T	0.50001|0.31510	1.39;0.76;0.76;0.76;1.39;1.39;1.39;1.39;1.39;1.39;1.39;1.39;1.39|1.49	4.53|4.53	4.53|4.53	0.55603|0.55603	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.57110|0.57110	0.2031|0.2031	M|M	0.89163|0.89163	3.01|3.01	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|D	0.71674|0.67145	0.998;0.993;0.997|0.996	D;D;P|P	0.66497|0.57371	0.944;0.925;0.815|0.819	T|T	0.68228|0.68228	-0.5464|-0.5464	10|9	0.87932|0.87932	D|D	0|0	-5.8122|-5.8122	16.58|16.58	0.84712|0.84712	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	174;165;165|59	B4DWA7;Q8N1A5;P34897|B4DLV4	.;.;GLYM_HUMAN|.	H|C	165;165;4;165;144;144;144;144;144;144;144;144;144|59	ENSP00000333667:D165H;ENSP00000452315:D165H;ENSP00000450930:D4H;ENSP00000452035:D165H;ENSP00000406881:D144H;ENSP00000452161:D144H;ENSP00000450893:D144H;ENSP00000452045:D144H;ENSP00000452419:D144H;ENSP00000451968:D144H;ENSP00000452404:D144H;ENSP00000413770:D144H;ENSP00000451495:D144H|ENSP00000377413:W59C	ENSP00000333667:D165H|ENSP00000377413:W59C	D|W	+|+	1|3	0|0	SHMT2|SHMT2	55911944|55911944	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.657000|9.657000	0.98554|0.98554	2.517000|2.517000	0.84864|0.84864	0.561000|0.561000	0.74099|0.74099	GAC|TGG	.		0.587	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
CYP27B1	1594	bcgsc.ca	37	12	58160674	58160674	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr12:58160674C>G	ENST00000228606.4	-	1	360	c.151G>C	c.(151-153)Gaa>Caa	p.E51Q	CYP27B1_ENST00000546496.1_5'Flank	NM_000785.3	NP_000776.1	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B, polypeptide 1	51					bone mineralization (GO:0030282)|calcitriol biosynthetic process from calciol (GO:0036378)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|decidualization (GO:0046697)|G1 to G0 transition (GO:0070314)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of bone mineralization (GO:0030500)|response to estrogen (GO:0043627)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	calcidiol 1-monooxygenase activity (GO:0004498)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|urinary_tract(1)	15	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Alfacalcidol(DB01436)|Calcidiol(DB00146)|Corticotropin(DB01285)|Ergocalciferol(DB00153)	CAGAAAAGTTCGGCCAGAAAG	0.632																																					p.E51Q													.	CYP27B1-514	0			c.G151C						.						65.0	73.0	70.0					12																	58160674		2203	4300	6503	SO:0001583	missense	1594	exon1			AAAGTTCGGCCAG	AB006987	CCDS8954.1	12q14.1	2013-11-13	2003-01-14		ENSG00000111012	ENSG00000111012		"""Cytochrome P450s"""	2606	protein-coding gene	gene with protein product	"""VDDR I"", ""1alpha(OH)ase"", ""25-Hydroxyvitamin D3 1alpha-hydroxylase"""	609506	"""cytochrome P450, subfamily XXVIIB (25-hydroxyvitamin D-1-alpha-hydroxylase), polypeptide 1"""	VDD1, PDDR		9295274, 9344864	Standard	NM_000785		Approved	CYP1, P450c1	uc001spz.1	O15528	OTTHUMG00000170457	ENST00000228606.4:c.151G>C	12.37:g.58160674C>G	ENSP00000228606:p.Glu51Gln	Somatic	164	0		WXS	Illumina HiSeq	Phase_1	203	9	NM_000785	0	0	0	0	0	B2RC61|Q548T3	Missense_Mutation	SNP	ENST00000228606.4	37	CCDS8954.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516287	0.85495	.	.	ENSG00000111012	ENST00000228606	T	0.68479	-0.33	5.26	5.26	0.73747	.	0.059156	0.64402	D	0.000003	T	0.54127	0.1839	N	0.12920	0.275	0.49299	D	0.999778	B	0.30634	0.288	B	0.39094	0.29	T	0.48603	-0.9021	10	0.08837	T	0.75	.	17.7796	0.88519	0.0:1.0:0.0:0.0	.	51	O15528	CP27B_HUMAN	Q	51	ENSP00000228606:E51Q	ENSP00000228606:E51Q	E	-	1	0	CYP27B1	56446941	1.000000	0.71417	0.963000	0.40424	0.870000	0.49936	6.357000	0.73051	2.729000	0.93468	0.655000	0.94253	GAA	.		0.632	CYP27B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409248.1	NM_000785	
TCP11L2	255394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	106717360	106717360	+	Missense_Mutation	SNP	C	C	G	rs138241328		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr12:106717360C>G	ENST00000299045.3	+	6	882	c.708C>G	c.(706-708)caC>caG	p.H236Q	TCP11L2_ENST00000546625.1_Missense_Mutation_p.H236Q|TCP11L2_ENST00000547153.1_Missense_Mutation_p.H236Q|TCP11L2_ENST00000552690.1_3'UTR	NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	236										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						TCAGACCGCACCTTCAACGCC	0.343																																					p.H236Q		.											.	TCP11L2-93	0			c.C708G						.						55.0	60.0	58.0					12																	106717360		2203	4300	6503	SO:0001583	missense	255394	exon6			ACCGCACCTTCAA	BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.708C>G	12.37:g.106717360C>G	ENSP00000299045:p.His236Gln	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	153	22	NM_152772	0	0	2	2	0	B2RA65|G3V1Y9	Missense_Mutation	SNP	ENST00000299045.3	37	CCDS9104.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024466	0.54683	.	.	ENSG00000166046	ENST00000547153;ENST00000299045;ENST00000546625	T;T;T	0.10960	2.82;2.82;2.82	5.76	2.51	0.30379	.	0.573213	0.19030	N	0.124583	T	0.07908	0.0198	N	0.25380	0.74	0.27925	N	0.938083	P;B;B	0.34815	0.47;0.13;0.138	B;B;B	0.39465	0.3;0.039;0.022	T	0.27020	-1.0086	10	0.25751	T	0.34	-14.6909	5.8057	0.18438	0.0:0.5201:0.1733:0.3066	.	236;236;236	Q8N4U5;G3V1Y9;G3V1Z2	T11L2_HUMAN;.;.	Q	236	ENSP00000448952:H236Q;ENSP00000299045:H236Q;ENSP00000449123:H236Q	ENSP00000299045:H236Q	H	+	3	2	TCP11L2	105241490	0.044000	0.20184	0.935000	0.37517	0.949000	0.60115	-0.293000	0.08320	0.588000	0.29660	0.655000	0.94253	CAC	C|1.000;T|0.000		0.343	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407206.1	NM_152772	
FAM222A	84915	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	110207030	110207030	+	Silent	SNP	G	G	A	rs138993259		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr12:110207030G>A	ENST00000538780.1	+	3	2012	c.1296G>A	c.(1294-1296)acG>acA	p.T432T	FAM222A_ENST00000358906.3_Silent_p.T432T|FAM222A-AS1_ENST00000541723.1_RNA|FAM222A-AS1_ENST00000541460.1_RNA	NM_032829.2	NP_116218.2	Q5U5X8	F222A_HUMAN	family with sequence similarity 222, member A	432																	GCTATGAGACGGTGGCCGTGC	0.627																																					p.T432T		.											.	.	0			c.G1296A						.	G		0,4396		0,0,2198	22.0	18.0	19.0		1296	-6.8	0.9	12	dbSNP_134	19	1,8569		0,1,4284	no	coding-synonymous	C12orf34	NM_032829.2		0,1,6482	AA,AG,GG		0.0117,0.0,0.0077		432/453	110207030	1,12965	2198	4285	6483	SO:0001819	synonymous_variant	84915	exon3			TGAGACGGTGGCC	AK027627	CCDS9133.1	12q24.11	2012-04-27	2012-04-27	2012-04-27	ENSG00000139438	ENSG00000139438			25915	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 34"""	C12orf34		12477932	Standard	NM_032829		Approved	FLJ14721	uc001tpd.2	Q5U5X8	OTTHUMG00000169260	ENST00000538780.1:c.1296G>A	12.37:g.110207030G>A		Somatic	154	0		WXS	Illumina HiSeq	Phase_I	209	18	NM_032829	0	0	0	0	0	Q8NCD5|Q96SP6	Silent	SNP	ENST00000538780.1	37	CCDS9133.1																																																																																			G|1.000;A|0.000		0.627	FAM222A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403175.1	NM_032829	
TRPV4	59341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	110234478	110234478	+	Missense_Mutation	SNP	G	G	A	rs374197231		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr12:110234478G>A	ENST00000418703.2	-	6	1278	c.1184C>T	c.(1183-1185)aCg>aTg	p.T395M	TRPV4_ENST00000544971.1_Intron|TRPV4_ENST00000261740.2_Missense_Mutation_p.T395M|TRPV4_ENST00000541794.1_Missense_Mutation_p.T348M|TRPV4_ENST00000537083.1_Intron|TRPV4_ENST00000392719.2_Missense_Mutation_p.T348M|TRPV4_ENST00000536838.1_Missense_Mutation_p.T361M|TRPV4_ENST00000346520.2_Intron	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	395					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						GTCCTCATCCGTCACCTCCCG	0.627																																					p.T395M		.											.	TRPV4-94	0			c.C1184T						.	G	MET/THR,MET/THR,,MET/THR,	0,4406		0,0,2203	102.0	85.0	91.0		1043,1082,,1184,	3.2	0.9	12		91	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron,missense,intron	TRPV4	NM_001177428.1,NM_001177431.1,NM_001177433.1,NM_021625.4,NM_147204.2	81,81,,81,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,,probably-damaging,	348/825,361/838,,395/872,	110234478	1,13005	2203	4300	6503	SO:0001583	missense	59341	exon7			TCATCCGTCACCT	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.1184C>T	12.37:g.110234478G>A	ENSP00000406191:p.Thr395Met	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	113	18	NM_021625	0	0	5	5	0	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	CCDS9134.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.037326	0.35989	0.0	1.16E-4	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000541794;ENST00000536838	D;D;D;D;D	0.89552	-2.53;-2.53;-2.31;-2.31;-2.53	5.16	3.22	0.36961	.	0.149468	0.64402	D	0.000018	T	0.81631	0.4863	L	0.31476	0.935	0.80722	D	1	D;B;B	0.54772	0.968;0.184;0.32	P;B;B	0.45276	0.475;0.103;0.103	T	0.78386	-0.2224	10	0.38643	T	0.18	-9.8296	6.9524	0.24552	0.0814:0.0:0.6258:0.2927	.	395;348;361	Q9HBA0;Q9HBA0-4;Q9HBA0-5	TRPV4_HUMAN;.;.	M	395;395;348;348;361	ENSP00000406191:T395M;ENSP00000261740:T395M;ENSP00000376480:T348M;ENSP00000442167:T348M;ENSP00000444336:T361M	ENSP00000261740:T395M	T	-	2	0	TRPV4	108718861	0.916000	0.31088	0.919000	0.36401	0.863000	0.49368	1.418000	0.34782	1.181000	0.42912	-0.251000	0.11542	ACG	.		0.627	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625	
EP400	57634	broad.mit.edu	37	12	132522575	132522575	+	Silent	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr12:132522575G>A	ENST00000333577.4	+	33	6358	c.6249G>A	c.(6247-6249)gtG>gtA	p.V2083V	EP400_ENST00000332482.4_Silent_p.V2010V|EP400_ENST00000330386.6_Silent_p.V1966V|EP400_ENST00000389562.2_Silent_p.V2046V|EP400_ENST00000389561.2_Silent_p.V2047V			Q96L91	EP400_HUMAN	E1A binding protein p400	2083					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		AGGAGTTTGTGGTGCTTTCTC	0.458																																					p.V2047V													.	EP400-520	0			c.G6141A						.						201.0	183.0	189.0					12																	132522575		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon32			GTTTGTGGTGCTT	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.6249G>A	12.37:g.132522575G>A		Somatic	317	1		WXS	Illumina HiSeq	Phase_I	382	8	NM_015409	0	0	13	14	1	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				.		0.458	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
RCBTB1	55213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	50134123	50134123	+	Silent	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr13:50134123G>C	ENST00000378302.2	-	5	635	c.375C>G	c.(373-375)ctC>ctG	p.L125L	RCBTB1_ENST00000258646.3_Silent_p.L125L|RCBTB1_ENST00000546015.1_Silent_p.L125L	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	125					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		GCTTGATCAAGAGATTGGTAC	0.483																																					p.L125L		.											.	RCBTB1-91	0			c.C375G						.						210.0	203.0	206.0					13																	50134123		2203	4300	6503	SO:0001819	synonymous_variant	55213	exon5			GATCAAGAGATTG	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.375C>G	13.37:g.50134123G>C		Somatic	224	0		WXS	Illumina HiSeq	Phase_I	217	47	NM_018191	0	0	2	3	1	Q8IY29|Q969U9	Silent	SNP	ENST00000378302.2	37	CCDS9418.1																																																																																			.		0.483	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044912.2	NM_018191	
NALCN	259232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	101881861	101881861	+	Silent	SNP	T	T	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr13:101881861T>C	ENST00000251127.6	-	13	1590	c.1509A>G	c.(1507-1509)ggA>ggG	p.G503G	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Silent_p.G503G	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	503					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CAAGCTTTTTTCCAGGACCAA	0.398																																					p.G503G		.											.	NALCN-167	0			c.A1509G						.						104.0	112.0	110.0					13																	101881861		2203	4300	6503	SO:0001819	synonymous_variant	259232	exon13			CTTTTTTCCAGGA	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1509A>G	13.37:g.101881861T>C		Somatic	51	0		WXS	Illumina HiSeq	Phase_I	18	7	NM_052867	0	0	0	0	0	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	ENST00000251127.6	37	CCDS9498.1																																																																																			.		0.398	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
HECTD1	25831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	31582629	31582629	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr14:31582629C>T	ENST00000399332.1	-	33	6406	c.5918G>A	c.(5917-5919)aGt>aAt	p.S1973N	HECTD1_ENST00000553700.1_Missense_Mutation_p.S1973N	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1973					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		AATATCACTACTTTGAAGAGT	0.388																																					p.S1973N		.											.	HECTD1-570	0			c.G5918A						.						167.0	164.0	165.0					14																	31582629		1831	4088	5919	SO:0001583	missense	25831	exon33			TCACTACTTTGAA	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.5918G>A	14.37:g.31582629C>T	ENSP00000382269:p.Ser1973Asn	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	52	10	NM_015382	0	0	4	12	8	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.089|1.089	-0.664515|-0.664515	0.03428|0.03428	.|.	.|.	ENSG00000092148|ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957|ENST00000554882	T;T;T|.	0.43294|.	0.95;0.95;1.2|.	5.94|5.94	2.88|2.88	0.33553|0.33553	.|.	0.115316|.	0.56097|.	U|.	0.000027|.	T|T	0.46112|0.46112	0.1376|0.1376	L|L	0.40543|0.40543	1.245|1.245	0.38847|0.38847	D|D	0.956199|0.956199	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.30679|0.30679	-0.9970|-0.9970	10|5	0.18276|.	T|.	0.48|.	-2.8194|-2.8194	6.637|6.637	0.22889|0.22889	0.0:0.4212:0.0:0.5788|0.0:0.4212:0.0:0.5788	.|.	1973;1973|.	D3DS86;Q9ULT8|.	.;HECD1_HUMAN|.	N|I	1973;1975;1973;1400|339	ENSP00000450697:S1973N;ENSP00000382269:S1973N;ENSP00000451860:S1400N|.	ENSP00000261312:S1975N|.	S|V	-|-	2|1	0|0	HECTD1|HECTD1	30652380|30652380	1.000000|1.000000	0.71417|0.71417	0.970000|0.970000	0.41538|0.41538	0.020000|0.020000	0.10135|0.10135	2.462000|2.462000	0.45049|0.45049	0.363000|0.363000	0.24346|0.24346	-0.145000|-0.145000	0.13849|0.13849	AGT|GTA	.		0.388	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
HEATR5A	25938	broad.mit.edu;bcgsc.ca	37	14	31763220	31763220	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr14:31763220A>G	ENST00000389961.3	-	34	5691	c.5692T>C	c.(5692-5694)Tgt>Cgt	p.C1898R	HEATR5A_ENST00000439727.1_Missense_Mutation_p.C1611R|HEATR5A_ENST00000543095.2_Missense_Mutation_p.C1904R|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000439348.1_Missense_Mutation_p.C1823R			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1898										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TCCATGATACAGGATGCTAAA	0.398																																					p.C1904R													.	HEATR5A-23	0			c.T5710C						.						119.0	103.0	108.0					14																	31763220		1848	4109	5957	SO:0001583	missense	25938	exon35			TGATACAGGATGC	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5692T>C	14.37:g.31763220A>G	ENSP00000374611:p.Cys1898Arg	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	101	5	NM_015473	0	0	1	2	1	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	ENST00000389961.3	37		.	.	.	.	.	.	.	.	.	.	A	0.006	-2.045063	0.00398	.	.	ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095	T;T;T;T	0.67865	-0.07;-0.29;-0.07;-0.07	5.22	1.47	0.22746	.	0.352635	0.30227	N	0.010105	T	0.20129	0.0484	N	0.00237	-1.79	0.19575	N	0.999969	B	0.02656	0.0	B	0.01281	0.0	T	0.40683	-0.9550	10	0.02654	T	1	.	4.434	0.11542	0.6479:0.0:0.2188:0.1333	.	1823	Q86XA9-2	.	R	1898;1823;1611;1904	ENSP00000374611:C1898R;ENSP00000405407:C1823R;ENSP00000408681:C1611R;ENSP00000437968:C1904R	ENSP00000374611:C1898R	C	-	1	0	HEATR5A	30832971	0.000000	0.05858	0.277000	0.24703	0.168000	0.22595	0.567000	0.23608	0.317000	0.23160	-0.509000	0.04479	TGT	.		0.398	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473	
SYNE2	23224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	64519117	64519117	+	Nonsense_Mutation	SNP	T	T	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr14:64519117T>G	ENST00000344113.4	+	48	8698	c.8486T>G	c.(8485-8487)tTa>tGa	p.L2829*	SYNE2_ENST00000554584.1_Nonsense_Mutation_p.L2862*|SYNE2_ENST00000358025.3_Nonsense_Mutation_p.L2829*|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2829					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCACAGCAATTAGAATTTAAG	0.343																																					p.L2829X		.											.	SYNE2-164	0			c.T8486G						.						43.0	41.0	42.0					14																	64519117		1811	4086	5897	SO:0001587	stop_gained	23224	exon48			AGCAATTAGAATT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.8486T>G	14.37:g.64519117T>G	ENSP00000341781:p.Leu2829*	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	45	6	NM_182914	0	0	0	0	0	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Nonsense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	50	16.272729	0.99859	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	.	.	.	5.27	5.27	0.74061	.	0.000000	0.38720	N	0.001585	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7819	0.63087	0.0:0.0:0.0:1.0	.	.	.	.	X	2829;2829;2862;2862	.	ENSP00000261678:L2862X	L	+	2	0	SYNE2	63588870	0.992000	0.36948	0.998000	0.56505	0.933000	0.57130	5.172000	0.65003	2.004000	0.58718	0.260000	0.18958	TTA	.		0.343	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
CKB	1152	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	103988811	103988811	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr14:103988811T>G	ENST00000348956.2	-	2	377	c.20A>C	c.(19-21)cAc>cCc	p.H7P	RP11-600F24.7_ENST00000568177.1_RNA	NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	7					cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	CAGTGCGTTGTGGCTGTTGGA	0.706																																					p.H7P	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.A20C						.						49.0	43.0	45.0					14																	103988811		2201	4300	6501	SO:0001583	missense	1152	exon2			GCGTTGTGGCTGT		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.20A>C	14.37:g.103988811T>G	ENSP00000299198:p.His7Pro	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	22	9	NM_001823	0	0	0	29	29	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Missense_Mutation	SNP	ENST00000348956.2	37	CCDS9981.1	.	.	.	.	.	.	.	.	.	.	T	14.98	2.696367	0.48202	.	.	ENSG00000166165	ENST00000348956;ENST00000428256;ENST00000553878	T;T	0.38240	1.82;1.15	4.17	4.17	0.49024	ATP:guanido phosphotransferase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.56202	0.1969	M	0.82193	2.58	0.80722	D	1	P	0.48503	0.911	P	0.55112	0.769	T	0.64896	-0.6299	10	0.87932	D	0	.	13.5095	0.61504	0.0:0.0:0.0:1.0	.	7	P12277	KCRB_HUMAN	P	7	ENSP00000299198:H7P;ENSP00000451904:H7P	ENSP00000299198:H7P	H	-	2	0	CKB	103058564	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	6.860000	0.75473	1.783000	0.52377	0.246000	0.17985	CAC	.		0.706	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
CAPN15	6650	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	598994	598994	+	Splice_Site	SNP	A	A	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr16:598994A>G	ENST00000219611.2	+	5	1814	c.1451A>G	c.(1450-1452)aAc>aGc	p.N484S	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	484					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCTCTGCAGAACAATGTGAGC	0.662																																					p.N484S		.											.	SOLH-523	0			c.A1451G						.						112.0	92.0	99.0					16																	598994		2198	4297	6495	SO:0001630	splice_region_variant	6650	exon5			TGCAGAACAATGT	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.1450-1A>G	16.37:g.598994A>G		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	65	4	NM_005632	0	0	2	2	0	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	37	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	a	10.23	1.292148	0.23564	.	.	ENSG00000103326	ENST00000219611	T	0.40756	1.02	5.04	5.04	0.67666	Peptidase C2, calpain, catalytic domain (1);	0.090831	0.64402	D	0.000001	T	0.49372	0.1553	L	0.27053	0.805	0.58432	D	0.999994	D	0.71674	0.998	D	0.77004	0.989	T	0.43147	-0.9409	10	0.30854	T	0.27	.	13.6292	0.62186	1.0:0.0:0.0:0.0	.	484	O75808	CAN15_HUMAN	S	484	ENSP00000219611:N484S	ENSP00000219611:N484S	N	+	2	0	SOLH	538995	1.000000	0.71417	0.967000	0.41034	0.345000	0.29048	6.977000	0.76141	1.903000	0.55091	0.454000	0.30748	AAC	.		0.662	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	Missense_Mutation
RRN3	54700	broad.mit.edu	37	16	15168670	15168670	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr16:15168670G>T	ENST00000198767.6	-	11	990	c.907C>A	c.(907-909)Ctc>Atc	p.L303I	RRN3_ENST00000563559.1_Missense_Mutation_p.L303I|RRN3_ENST00000540462.1_Missense_Mutation_p.L121I|RRN3_ENST00000429751.2_Missense_Mutation_p.L273I|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000327307.7_Missense_Mutation_p.L270I	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	303					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						ATCTGGTCGAGCCGTTCAGGA	0.413																																					p.L303I													.	RRN3-91	0			c.C907A						.						113.0	84.0	94.0					16																	15168670		2197	4300	6497	SO:0001583	missense	54700	exon11			GGTCGAGCCGTTC	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.907C>A	16.37:g.15168670G>T	ENSP00000198767:p.Leu303Ile	Somatic	78	2		WXS	Illumina HiSeq	Phase_I	103	6	NM_018427	0	0	30	33	3	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	7.146	0.582795	0.13749	.	.	ENSG00000085721	ENST00000198767;ENST00000429751;ENST00000327307;ENST00000540462	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.52	4.51	0.55191	.	0.660421	0.13888	N	0.355828	T	0.28433	0.0703	N	0.19112	0.55	0.09310	N	1	B;B;B	0.14012	0.004;0.005;0.009	B;B;B	0.12156	0.003;0.007;0.007	T	0.06935	-1.0799	10	0.36615	T	0.2	.	10.7149	0.46006	0.0:0.0:0.628:0.372	.	273;204;303	F5H148;B4DZL9;Q9NYV6	.;.;RRN3_HUMAN	I	303;273;270;121	ENSP00000198767:L303I;ENSP00000402027:L273I;ENSP00000318484:L270I;ENSP00000437963:L121I	ENSP00000198767:L303I	L	-	1	0	RRN3	15076171	0.000000	0.05858	0.041000	0.18516	0.004000	0.04260	0.777000	0.26718	2.586000	0.87340	0.561000	0.74099	CTC	.		0.413	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
TMEM219	124446	broad.mit.edu	37	16	29982731	29982731	+	Silent	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr16:29982731G>A	ENST00000566848.1	+	4	1055	c.588G>A	c.(586-588)gaG>gaA	p.E196E	TMEM219_ENST00000279396.6_Silent_p.E196E|TAOK2_ENST00000308893.4_5'Flank|TAOK2_ENST00000543033.1_5'Flank|TMEM219_ENST00000561899.2_Silent_p.E196E|TAOK2_ENST00000279394.3_5'Flank|TMEM219_ENST00000414689.2_Silent_p.E196E			Q86XT9	TM219_HUMAN	transmembrane protein 219	196					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(1)|lung(1)|prostate(2)	4						CTCCCTAGGAGGAGCTGGCTC	0.582																																					p.E196E													.	TMEM219-90	0			c.G588A						.						114.0	118.0	117.0					16																	29982731		2037	4174	6211	SO:0001819	synonymous_variant	124446	exon5			CTAGGAGGAGCTG		CCDS42145.1	16p11.2	2008-08-08			ENSG00000149932	ENSG00000149932			25201	protein-coding gene	gene with protein product							Standard	NM_194280		Approved		uc010bzk.1	Q86XT9		ENST00000566848.1:c.588G>A	16.37:g.29982731G>A		Somatic	155	0		WXS	Illumina HiSeq	Phase_I	160	4	NM_001083613	0	0	1	1	0	D5FK14|Q8WVV8	Silent	SNP	ENST00000566848.1	37	CCDS42145.1																																																																																			.		0.582	TMEM219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435307.1	NM_001083613	
DNAH2	146754	broad.mit.edu;bcgsc.ca	37	17	7689597	7689597	+	Silent	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr17:7689597C>T	ENST00000572933.1	+	40	7745	c.6285C>T	c.(6283-6285)cgC>cgT	p.R2095R	DNAH2_ENST00000389173.2_Silent_p.R2095R			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2095	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTCATGGCGCATTCTACAGG	0.582																																					p.R2095R													.	DNAH2-102	0			c.C6285T						.						63.0	59.0	61.0					17																	7689597		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon39			ATGGCGCATTCTA	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6285C>T	17.37:g.7689597C>T		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	87	6	NM_020877	0	0	0	0	0	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																			.		0.582	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
MYH8	4626	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	10300168	10300168	+	Silent	SNP	A	A	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr17:10300168A>T	ENST00000403437.2	-	31	4408	c.4314T>A	c.(4312-4314)tcT>tcA	p.S1438S	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1438					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						AGGCTGCATTAGACCTTTCCA	0.463									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.S1438S		.											.	MYH8-101	0			c.T4314A						.						110.0	100.0	103.0					17																	10300168		2203	4300	6503	SO:0001819	synonymous_variant	4626	exon31	Familial Cancer Database	Carney Complex Variant	TGCATTAGACCTT		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4314T>A	17.37:g.10300168A>T		Somatic	177	0		WXS	Illumina HiSeq	Phase_I	230	19	NM_002472	0	0	0	0	0	Q14910	Silent	SNP	ENST00000403437.2	37	CCDS11153.1																																																																																			.		0.463	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
TMEM132E	124842	broad.mit.edu;bcgsc.ca	37	17	32956104	32956104	+	Missense_Mutation	SNP	C	C	G	rs371393529		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr17:32956104C>G	ENST00000321639.5	+	5	1277	c.949C>G	c.(949-951)Cgg>Ggg	p.R317G		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	317						integral component of membrane (GO:0016021)		p.R317W(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTCAGTCAAGCGGAGGATCAT	0.612																																					p.R317G													.	TMEM132E-68	1	Substitution - Missense(1)	cervix(1)	c.C949G						.						100.0	93.0	95.0					17																	32956104		2203	4300	6503	SO:0001583	missense	124842	exon5			GTCAAGCGGAGGA	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.949C>G	17.37:g.32956104C>G	ENSP00000316532:p.Arg317Gly	Somatic	298	0		WXS	Illumina HiSeq	Phase_I	304	10	NM_207313	0	0	2	2	0	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	37	CCDS11283.1	.	.	.	.	.	.	.	.	.	.	c	9.345	1.063991	0.20067	.	.	ENSG00000181291	ENST00000321639	T	0.18960	2.18	4.51	3.53	0.40419	.	0.000000	0.85682	D	0.000000	T	0.31857	0.0810	L	0.39397	1.21	0.49130	D	0.999751	D	0.89917	1.0	D	0.85130	0.997	T	0.03514	-1.1029	10	0.15499	T	0.54	-29.8251	11.4588	0.50197	0.3265:0.6735:0.0:0.0	.	317	Q6IEE7	T132E_HUMAN	G	317	ENSP00000316532:R317G	ENSP00000316532:R317G	R	+	1	2	TMEM132E	29980217	0.995000	0.38212	0.984000	0.44739	0.044000	0.14063	1.296000	0.33389	1.236000	0.43740	0.447000	0.29281	CGG	.		0.612	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
CLTC	1213	broad.mit.edu;bcgsc.ca	37	17	57728648	57728648	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr17:57728648G>T	ENST00000269122.3	+	5	1040	c.766G>T	c.(766-768)Gca>Tca	p.A256S	CLTC_ENST00000393043.1_Missense_Mutation_p.A256S|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	256	Globular terminal domain.|WD40-like repeat 5.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TCCTCCAGAAGCACAAAATGA	0.353			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.A256S				Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC-835	0			c.G766T						.						146.0	149.0	148.0					17																	57728648		2203	4300	6503	SO:0001583	missense	1213	exon5			CCAGAAGCACAAA	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.766G>T	17.37:g.57728648G>T	ENSP00000269122:p.Ala256Ser	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	195	8	NM_004859	0	0	24	25	1	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	G	35	5.556566	0.96514	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.24350	1.86;1.86	5.62	5.62	0.85841	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.85682	D	0.000000	T	0.63640	0.2528	M	0.93283	3.4	0.80722	D	1	D;P	0.58268	0.982;0.857	D;P	0.72338	0.977;0.876	T	0.68992	-0.5263	10	0.44086	T	0.13	.	20.0333	0.97547	0.0:0.0:1.0:0.0	.	256;256	Q00610;Q00610-2	CLH1_HUMAN;.	S	256	ENSP00000269122:A256S;ENSP00000376763:A256S	ENSP00000269122:A256S	A	+	1	0	CLTC	55083430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.810000	0.96702	0.585000	0.79938	GCA	.		0.353	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
BPTF	2186	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	65960510	65960510	+	Missense_Mutation	SNP	G	G	T	rs368469411		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr17:65960510G>T	ENST00000321892.4	+	27	8883	c.8822G>T	c.(8821-8823)cGt>cTt	p.R2941L	BPTF_ENST00000424123.3_Missense_Mutation_p.R2659L|BPTF_ENST00000306378.6_Missense_Mutation_p.R2815L|BPTF_ENST00000335221.5_Missense_Mutation_p.R2798L			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2941					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGGGTGCTCCGTTCCTTACAG	0.458																																					p.R2815L		.											.	BPTF-94	0			c.G8444T						.						83.0	74.0	77.0					17																	65960510		2203	4300	6503	SO:0001583	missense	2186	exon25			TGCTCCGTTCCTT	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.8822G>T	17.37:g.65960510G>T	ENSP00000315454:p.Arg2941Leu	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	153	14	NM_182641	0	0	1	1	0	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	G	16.21	3.057919	0.55325	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892;ENST00000342579	T;T;T	0.30448	1.53;1.53;1.53	5.65	5.65	0.86999	.	.	.	.	.	T	0.52435	0.1734	L	0.49455	1.56	0.80722	D	1	P;P;D;D	0.76494	0.587;0.872;0.999;0.999	B;P;D;D	0.80764	0.187;0.773;0.994;0.994	T	0.45190	-0.9278	9	0.49607	T	0.09	-6.4917	19.7202	0.96139	0.0:0.0:1.0:0.0	.	146;619;2815;2798	E9PE19;B4DJV8;Q12830-2;Q12830-4	.;.;.;.	L	2815;2798;2941;146	ENSP00000307208:R2815L;ENSP00000334351:R2798L;ENSP00000315454:R2941L	ENSP00000307208:R2815L	R	+	2	0	BPTF	63390972	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.807000	0.99171	2.660000	0.90430	0.555000	0.69702	CGT	.		0.458	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
CBX4	8535	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	77807886	77807886	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr17:77807886G>C	ENST00000269397.4	-	5	1732	c.1555C>G	c.(1555-1557)Cca>Gca	p.P519A		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	519	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GCCTCGGCTGGAGGCTTCTCC	0.672																																					p.P519A		.											.	CBX4-228	0			c.C1555G						.						36.0	45.0	42.0					17																	77807886		2201	4296	6497	SO:0001583	missense	8535	exon5			CGGCTGGAGGCTT	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1555C>G	17.37:g.77807886G>C	ENSP00000269397:p.Pro519Ala	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	77	7	NM_003655	0	0	8	10	2	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	ENST00000269397.4	37	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	g	8.387	0.838920	0.16891	.	.	ENSG00000141582	ENST00000269397;ENST00000343048	.	.	.	3.16	3.16	0.36331	.	3.167460	0.02836	N	0.127360	T	0.20251	0.0487	N	0.11560	0.145	0.19575	N	0.999969	B	0.20261	0.043	B	0.17433	0.018	T	0.25152	-1.0140	9	0.12103	T	0.63	-14.3825	5.4008	0.16295	0.1115:0.0:0.6877:0.2008	.	519	O00257	CBX4_HUMAN	A	519;249	.	ENSP00000269397:P519A	P	-	1	0	CBX4	75422481	0.931000	0.31567	0.470000	0.27216	0.496000	0.33645	2.539000	0.45718	1.796000	0.52611	0.299000	0.19835	CCA	.		0.672	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
CEP131	22994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79165083	79165083	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr17:79165083C>A	ENST00000269392.4	-	22	2931	c.2684G>T	c.(2683-2685)gGc>gTc	p.G895V	AZI1_ENST00000575907.1_Missense_Mutation_p.G859V|AZI1_ENST00000374782.3_Missense_Mutation_p.G856V|AZI1_ENST00000450824.2_Missense_Mutation_p.G892V	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		895					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTTGTCCCGGCCTTTCCGGAT	0.667																																					p.G892V		.											.	AZI1-136	0			c.G2675T						.						84.0	79.0	81.0					17																	79165083		2203	4300	6503	SO:0001583	missense	22994	exon22			TCCCGGCCTTTCC																												ENST00000269392.4:c.2684G>T	17.37:g.79165083C>A	ENSP00000269392:p.Gly895Val	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	169	32	NM_014984	0	0	33	35	2	A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	ENST00000269392.4	37		.	.	.	.	.	.	.	.	.	.	C	13.17	2.157738	0.38119	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.14266	2.52;2.55;2.52	4.37	0.923	0.19413	.	0.413716	0.23832	N	0.044131	T	0.06690	0.0171	L	0.29908	0.895	0.54753	D	0.999988	B;B;P;P	0.37122	0.218;0.135;0.583;0.583	B;B;B;B	0.32090	0.081;0.055;0.14;0.14	T	0.35992	-0.9766	10	0.41790	T	0.15	-20.1739	1.6764	0.02823	0.1712:0.4525:0.148:0.2282	.	892;895;856;892	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	V	892;856;895	ENSP00000393583:G892V;ENSP00000363914:G856V;ENSP00000269392:G895V	ENSP00000269392:G895V	G	-	2	0	AZI1	76779678	0.999000	0.42202	0.994000	0.49952	0.993000	0.82548	0.828000	0.27435	0.474000	0.27392	0.491000	0.48974	GGC	.		0.667	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1		
SERPINB3	6317	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	61322975	61322975	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr18:61322975G>C	ENST00000283752.5	-	8	1232	c.1089C>G	c.(1087-1089)ttC>ttG	p.F363L	SERPINB11_ENST00000489748.1_RNA|SERPINB3_ENST00000332821.8_Missense_Mutation_p.F311L	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	363					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						GATTACAATGGAACTCTTCAT	0.458																																					p.F363L													.	SERPINB3-228	0			c.C1089G						.						171.0	168.0	169.0					18																	61322975		2203	4300	6503	SO:0001583	missense	6317	exon8			ACAATGGAACTCT	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.1089C>G	18.37:g.61322975G>C	ENSP00000283752:p.Phe363Leu	Somatic	281	2		WXS	Illumina HiSeq	Phase_I	186	72	NM_006919	0	0	0	0	0	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	37	CCDS11987.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657623	0.47467	.	.	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.87571	-2.27;-2.27	2.96	-2.58	0.06228	Serpin domain (3);Protease inhibitor I4, serpin, conserved site (1);	0.163773	0.28940	N	0.013642	D	0.82962	0.5151	M	0.74546	2.27	0.20403	N	0.999908	B;B	0.24651	0.02;0.108	B;B	0.28638	0.044;0.092	T	0.73372	-0.4003	10	0.62326	D	0.03	.	6.4823	0.22069	0.5376:0.1327:0.3296:0.0	.	311;363	P29508-2;P29508	.;SPB3_HUMAN	L	363;311	ENSP00000283752:F363L;ENSP00000329498:F311L	ENSP00000283752:F363L	F	-	3	2	SERPINB3	59473955	0.000000	0.05858	0.001000	0.08648	0.956000	0.61745	0.135000	0.15952	-0.655000	0.05387	0.449000	0.29647	TTC	.		0.458	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919	
PGLYRP2	114770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15587343	15587343	+	Silent	SNP	G	G	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr19:15587343G>T	ENST00000340880.4	-	2	618	c.138C>A	c.(136-138)acC>acA	p.T46T	PGLYRP2_ENST00000292609.4_Silent_p.T46T	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	46			T -> A (in dbSNP:rs3813135). {ECO:0000269|PubMed:12975309}.		defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						CTGTGTGTCTGGTCTTGGCAG	0.587																																					p.T46T		.											.	PGLYRP2-93	0			c.C138A						.						50.0	47.0	48.0					19																	15587343		2203	4300	6503	SO:0001819	synonymous_variant	114770	exon2			GTGTCTGGTCTTG	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.138C>A	19.37:g.15587343G>T		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	123	19	NM_052890	0	0	0	0	0	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Silent	SNP	ENST00000340880.4	37	CCDS12330.2																																																																																			.		0.587	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	NM_052890	
GRAMD1A	57655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	35512474	35512474	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr19:35512474C>T	ENST00000317991.5	+	14	1736	c.1544C>T	c.(1543-1545)tCg>tTg	p.S515L	GRAMD1A_ENST00000504615.2_Missense_Mutation_p.S281L|GRAMD1A_ENST00000599564.1_Missense_Mutation_p.S602L|GRAMD1A_ENST00000411896.2_Missense_Mutation_p.S508L|CTD-2527I21.14_ENST00000605640.1_RNA	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	515						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GAGAAGAACTCGTGGAGCGGC	0.582																																					p.S515L		.											.	GRAMD1A-90	0			c.C1544T						.						70.0	73.0	72.0					19																	35512474		1948	4122	6070	SO:0001583	missense	57655	exon14			AGAACTCGTGGAG	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.1544C>T	19.37:g.35512474C>T	ENSP00000441032:p.Ser515Leu	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	95	24	NM_020895	0	1	74	102	27	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	37	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.182600	0.57800	.	.	ENSG00000089351	ENST00000453966;ENST00000504615;ENST00000317991;ENST00000411896	T;T;T	0.22336	1.96;1.96;1.96	4.33	4.33	0.51752	.	0.086126	0.48767	D	0.000164	T	0.29458	0.0734	L	0.60455	1.87	0.42985	D	0.994471	D;P;D;D	0.62365	0.971;0.83;0.991;0.968	B;B;P;P	0.48873	0.439;0.086;0.539;0.593	T	0.07635	-1.0762	10	0.51188	T	0.08	.	14.3583	0.66752	0.0:1.0:0.0:0.0	.	515;515;281;508	Q96CP6-3;Q96CP6;B3KQF7;Q96CP6-2	.;GRM1A_HUMAN;.;.	L	601;281;515;508	ENSP00000423728:S281L;ENSP00000441032:S515L;ENSP00000439267:S508L	ENSP00000441032:S515L	S	+	2	0	GRAMD1A	40204314	0.806000	0.28996	0.955000	0.39395	0.977000	0.68977	2.268000	0.43338	2.255000	0.74692	0.491000	0.48974	TCG	.		0.582	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
ZNF585B	92285	broad.mit.edu;bcgsc.ca	37	19	37680577	37680577	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr19:37680577C>T	ENST00000532828.2	-	4	529	c.278G>A	c.(277-279)cGt>cAt	p.R93H	CTC-454I21.3_ENST00000585860.2_Missense_Mutation_p.R93H|ZNF585B_ENST00000586320.1_Missense_Mutation_p.R78H|ZNF585B_ENST00000531805.1_Missense_Mutation_p.R38H|ZNF585B_ENST00000527838.1_Missense_Mutation_p.R93H|ZNF585B_ENST00000312908.5_5'Flank	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	93	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GCAGCTGTGACGTGGCCTCTC	0.498																																					p.R93H	Melanoma(93;882 1454 18863 28917 48427)												.	ZNF585B-91	0			c.G278A						.						159.0	125.0	136.0					19																	37680577		2203	4300	6503	SO:0001583	missense	92285	exon4			CTGTGACGTGGCC	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.278G>A	19.37:g.37680577C>T	ENSP00000433773:p.Arg93His	Somatic	270	0		WXS	Illumina HiSeq	Phase_I	186	8	NM_152279	0	0	0	0	0	Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	37	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	C	9.289	1.050057	0.19827	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000527838	T;T;T	0.09163	3.03;3.01;6.62	2.55	-1.74	0.08056	Krueppel-associated box (1);	1.911660	0.03152	N	0.168174	T	0.10937	0.0267	L	0.48218	1.51	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35076	-0.9803	10	0.33940	T	0.23	.	6.7578	0.23524	0.0:0.6143:0.0:0.3857	.	93	Q52M93	Z585B_HUMAN	H	38;93;93	ENSP00000436774:R38H;ENSP00000433773:R93H;ENSP00000435268:R93H	ENSP00000435268:R93H	R	-	2	0	ZNF585B	42372417	0.000000	0.05858	0.000000	0.03702	0.268000	0.26511	-0.529000	0.06186	-0.421000	0.07416	0.305000	0.20034	CGT	.		0.498	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
RAD51AP2	729475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	17699184	17699184	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:17699184T>G	ENST00000399080.2	-	1	522	c.499A>C	c.(499-501)Ata>Cta	p.I167L		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	167										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ATTCCATGTATATCGTGTATA	0.423																																					p.I167L		.											.	RAD51AP2-23	0			c.A499C						.						64.0	62.0	63.0					2																	17699184		1913	4131	6044	SO:0001583	missense	729475	exon1			CATGTATATCGTG	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.499A>C	2.37:g.17699184T>G	ENSP00000382030:p.Ile167Leu	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	125	27	NM_001099218	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399080.2	37	CCDS42656.1	.	.	.	.	.	.	.	.	.	.	T	10.22	1.291283	0.23564	.	.	ENSG00000214842	ENST00000399080	T	0.30182	1.54	3.6	-4.94	0.03057	.	.	.	.	.	T	0.18509	0.0444	N	0.19112	0.55	0.09310	N	1	B	0.16396	0.017	B	0.16289	0.015	T	0.21690	-1.0238	9	0.48119	T	0.1	.	12.4465	0.55653	0.0:0.7287:0.0:0.2713	.	167	Q09MP3	R51A2_HUMAN	L	167	ENSP00000382030:I167L	ENSP00000382030:I167L	I	-	1	0	RAD51AP2	17562665	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.991000	0.00657	-1.048000	0.03238	-0.290000	0.09829	ATA	.		0.423	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218	
DNMT3A	1788	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	25458669	25458669	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:25458669G>A	ENST00000264709.3	-	22	2841	c.2504C>T	c.(2503-2505)aCg>aTg	p.T835M	DNMT3A_ENST00000380746.4_Missense_Mutation_p.T646M|DNMT3A_ENST00000321117.5_Missense_Mutation_p.T835M|DNMT3A_ENST00000402667.1_Missense_Mutation_p.T612M|DNMT3A_ENST00000474887.1_5'UTR	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	835	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTGACCTCGTAGTAATGGT	0.438			"""Mis, F, N, S"""		AML																																p.T835M				Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A-1924	0			c.C2504T						.						171.0	155.0	160.0					2																	25458669		2203	4300	6503	SO:0001583	missense	1788	exon22			GACCTCGTAGTAA		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2504C>T	2.37:g.25458669G>A	ENSP00000264709:p.Thr835Met	Somatic	146	1		WXS	Illumina HiSeq	Phase_I	271	88	NM_175629	0	0	27	46	19	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	37	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.953779	0.92660	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.97089	-4.24;-4.24;-4.24;-4.24	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.98617	0.9537	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.991;0.997	D	0.99453	1.0941	10	0.72032	D	0.01	-6.841	18.1492	0.89669	0.0:0.0:1.0:0.0	.	835;646	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	M	646;835;835;612	ENSP00000370122:T646M;ENSP00000324375:T835M;ENSP00000264709:T835M;ENSP00000384237:T612M	ENSP00000264709:T835M	T	-	2	0	DNMT3A	25312173	1.000000	0.71417	0.993000	0.49108	0.988000	0.76386	9.697000	0.98697	2.717000	0.92951	0.650000	0.86243	ACG	.		0.438	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
C2orf70	339778	broad.mit.edu	37	2	26785532	26785532	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:26785532G>T	ENST00000329615.3	+	1	83	c.52G>T	c.(52-54)Gtg>Ttg	p.V18L	C2orf70_ENST00000409392.1_5'UTR	NM_001105519.1	NP_001098989.1	A6NJV1	CB070_HUMAN	chromosome 2 open reading frame 70	18						nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	13						TGCCGCCTACGTGCCCCCTGG	0.701																																					p.V18L													.	C2orf70-69	0			c.G52T						.						17.0	25.0	23.0					2																	26785532		2041	4159	6200	SO:0001583	missense	339778	exon1			GCCTACGTGCCCC		CCDS42661.1	2p23.3	2011-05-09			ENSG00000173557	ENSG00000173557			27938	protein-coding gene	gene with protein product	"""hypothetical protein LOC339778"""						Standard	NM_001105519		Approved	LOC339778	uc010eyn.3	A6NJV1	OTTHUMG00000151994	ENST00000329615.3:c.52G>T	2.37:g.26785532G>T	ENSP00000332875:p.Val18Leu	Somatic	144	1		WXS	Illumina HiSeq	Phase_I	165	6	NM_001105519	0	0	13	13	0		Missense_Mutation	SNP	ENST00000329615.3	37	CCDS42661.1	.	.	.	.	.	.	.	.	.	.	g	23.4	4.409415	0.83340	.	.	ENSG00000173557	ENST00000329615	T	0.32515	1.45	5.27	5.27	0.74061	.	0.000000	0.47455	D	0.000235	T	0.40979	0.1139	M	0.68317	2.08	0.80722	D	1	D	0.53312	0.959	P	0.51895	0.683	T	0.21415	-1.0246	10	0.41790	T	0.15	-16.9952	9.9347	0.41543	0.0921:0.0:0.9079:0.0	.	18	A6NJV1	CB070_HUMAN	L	18	ENSP00000332875:V18L	ENSP00000332875:V18L	V	+	1	0	C2orf70	26639036	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.156000	0.50708	2.462000	0.83206	0.558000	0.71614	GTG	.		0.701	C2orf70-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353258.1	NM_001105519	
CEBPZ	10153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	37430124	37430124	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:37430124T>A	ENST00000234170.5	-	14	3057	c.2912A>T	c.(2911-2913)aAt>aTt	p.N971I	AC007390.5_ENST00000402297.1_3'UTR|AC007390.5_ENST00000397064.2_Intron|AC007390.5_ENST00000406711.1_Intron|AC007390.5_ENST00000392061.2_Intron	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	971					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				GCTGGAATCATTTAAGTTTCT	0.264																																					p.N971I		.											.	CEBPZ-91	0			c.A2912T						.						54.0	58.0	57.0					2																	37430124		2200	4294	6494	SO:0001583	missense	10153	exon14			GAATCATTTAAGT	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.2912A>T	2.37:g.37430124T>A	ENSP00000234170:p.Asn971Ile	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	216	75	NM_005760	0	0	64	122	58	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	37	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	T	6.448	0.450836	0.12223	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	T	0.14144	2.53	5.53	-1.96	0.07525	.	0.448282	0.25529	N	0.030057	T	0.11367	0.0277	L	0.44542	1.39	0.09310	N	1	B	0.26744	0.158	B	0.26517	0.07	T	0.16897	-1.0387	10	0.72032	D	0.01	.	11.4206	0.49978	0.0:0.2571:0.0:0.7429	.	971	Q03701	CEBPZ_HUMAN	I	971	ENSP00000234170:N971I	ENSP00000234170:N971I	N	-	2	0	CEBPZ	37283628	0.000000	0.05858	0.014000	0.15608	0.199000	0.23934	-0.102000	0.10956	-0.622000	0.05626	-0.400000	0.06385	AAT	.		0.264	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
PREPL	9581	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	44566372	44566372	+	Nonsense_Mutation	SNP	G	G	A	rs145356495		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:44566372G>A	ENST00000409936.1	-	7	1320	c.883C>T	c.(883-885)Cga>Tga	p.R295*	PREPL_ENST00000378520.3_Nonsense_Mutation_p.R295*|PREPL_ENST00000378511.3_Nonsense_Mutation_p.R295*|PREPL_ENST00000409411.1_Nonsense_Mutation_p.R206*|PREPL_ENST00000260648.6_Nonsense_Mutation_p.R295*|PREPL_ENST00000409957.1_Nonsense_Mutation_p.R206*|PREPL_ENST00000541738.1_Nonsense_Mutation_p.R206*|PREPL_ENST00000409272.1_Nonsense_Mutation_p.R295*|PREPL_ENST00000410081.1_Nonsense_Mutation_p.R295*	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	295						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCATGTATTCGCTTCTGGATA	0.413																																					p.R295X		.											.	PREPL-91	0			c.C883T						.	G	stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	113.0	109.0	110.0		883,883,883,883,616,616,883	3.4	1.0	2	dbSNP_134	110	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained	PREPL	NM_001042385.2,NM_001042386.2,NM_001171603.1,NM_001171606.1,NM_001171613.1,NM_001171617.1,NM_006036.4	,,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,	295/666,295/662,295/728,295/728,206/639,206/639,295/728	44566372	1,13005	2203	4300	6503	SO:0001587	stop_gained	9581	exon7			GTATTCGCTTCTG	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.883C>T	2.37:g.44566372G>A	ENSP00000386543:p.Arg295*	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	182	14	NM_001171603	0	0	21	21	0	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Nonsense_Mutation	SNP	ENST00000409936.1	37	CCDS33190.1	.	.	.	.	.	.	.	.	.	.	G	36	5.741979	0.96873	0.0	1.16E-4	ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511	.	.	.	5.46	3.39	0.38822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5424	14.6218	0.68592	0.0:0.0:0.6226:0.3774	.	.	.	.	X	206;206;206;295;295;295;295;295;295	.	ENSP00000260648:R295X	R	-	1	2	PREPL	44419876	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.377000	0.34317	1.221000	0.43506	0.650000	0.86243	CGA	G|1.000;A|0.000		0.413	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036	
PREPL	9581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44566451	44566451	+	Silent	SNP	A	A	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:44566451A>G	ENST00000409936.1	-	7	1241	c.804T>C	c.(802-804)aaT>aaC	p.N268N	PREPL_ENST00000378520.3_Silent_p.N268N|PREPL_ENST00000378511.3_Silent_p.N268N|PREPL_ENST00000409411.1_Silent_p.N179N|PREPL_ENST00000260648.6_Silent_p.N268N|PREPL_ENST00000409957.1_Silent_p.N179N|PREPL_ENST00000541738.1_Silent_p.N179N|PREPL_ENST00000409272.1_Silent_p.N268N|PREPL_ENST00000410081.1_Silent_p.N268N	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	268						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGTTCATAATATTTATGGTGA	0.413																																					p.N268N		.											.	PREPL-91	0			c.T804C						.						84.0	79.0	81.0					2																	44566451		2203	4300	6503	SO:0001819	synonymous_variant	9581	exon7			CATAATATTTATG	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.804T>C	2.37:g.44566451A>G		Somatic	143	0		WXS	Illumina HiSeq	Phase_I	142	16	NM_001171603	0	0	13	13	0	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Silent	SNP	ENST00000409936.1	37	CCDS33190.1																																																																																			.		0.413	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036	
CCDC88A	55704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55561724	55561724	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:55561724T>G	ENST00000436346.1	-	15	3074	c.2233A>C	c.(2233-2235)Aaa>Caa	p.K745Q	AC012358.8_ENST00000599475.1_RNA|AC012358.8_ENST00000608103.1_RNA|AC012358.8_ENST00000599352.1_RNA|CCDC88A_ENST00000336838.6_Missense_Mutation_p.K745Q|AC012358.8_ENST00000600219.1_RNA|CCDC88A_ENST00000413716.2_Missense_Mutation_p.K745Q|CCDC88A_ENST00000263630.8_Missense_Mutation_p.K745Q|AC012358.8_ENST00000594078.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	745					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						AAAGATGCTTTCAGGAGCTCC	0.363																																					p.K745Q		.											.	CCDC88A-94	0			c.A2233C						.						91.0	93.0	92.0					2																	55561724		2202	4299	6501	SO:0001583	missense	55704	exon15			ATGCTTTCAGGAG	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.2233A>C	2.37:g.55561724T>G	ENSP00000410608:p.Lys745Gln	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	74	14	NM_018084	0	0	2	2	0	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37		.	.	.	.	.	.	.	.	.	.	T	14.75	2.628283	0.46944	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.17213	2.29;2.51;2.48;2.3	4.86	4.86	0.63082	.	0.126339	0.34725	U	0.003726	T	0.17238	0.0414	L	0.46885	1.475	0.80722	D	1	B;P;B;B;B	0.44478	0.061;0.836;0.018;0.009;0.031	B;B;B;B;B	0.40101	0.145;0.319;0.092;0.028;0.028	T	0.03130	-1.1069	10	0.29301	T	0.29	-11.7377	14.7941	0.69865	0.0:0.0:0.0:1.0	.	745;745;745;745;745	B7ZM78;Q3V6T2-2;Q3V6T2;Q3V6T2-3;Q3V6T2-4	.;.;GRDN_HUMAN;.;.	Q	745	ENSP00000338728:K745Q;ENSP00000263630:K745Q;ENSP00000410608:K745Q;ENSP00000404431:K745Q	ENSP00000263630:K745Q	K	-	1	0	CCDC88A	55415228	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.647000	0.67923	1.956000	0.56807	0.374000	0.22700	AAA	.		0.363	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
MBD5	55777	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	149247732	149247732	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:149247732G>A	ENST00000407073.1	+	12	4829	c.3832G>A	c.(3832-3834)Gag>Aag	p.E1278K	MBD5_ENST00000404807.1_Missense_Mutation_p.E1511K	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1278					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GAGTTTTAAGGAGAGACTAGA	0.413																																					p.E1278K		.											.	MBD5-95	0			c.G3832A						.						61.0	62.0	61.0					2																	149247732		2203	4300	6503	SO:0001583	missense	55777	exon12			TTTAAGGAGAGAC	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3832G>A	2.37:g.149247732G>A	ENSP00000386049:p.Glu1278Lys	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	64	6	NM_018328	0	0	6	7	1	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	37	CCDS33302.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493136	0.84962	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.63913	0.15;-0.07	5.89	5.89	0.94794	.	0.093845	0.46442	D	0.000287	T	0.68366	0.2993	N	0.24115	0.695	0.58432	D	0.999999	B;D	0.64830	0.302;0.994	B;P	0.61397	0.182;0.888	T	0.71421	-0.4598	10	0.87932	D	0	-2.9361	20.2363	0.98357	0.0:0.0:1.0:0.0	.	1511;1278	E9PHH0;Q9P267	.;MBD5_HUMAN	K	1278;1511	ENSP00000386049:E1278K;ENSP00000384672:E1511K	ENSP00000384672:E1511K	E	+	1	0	MBD5	148964202	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.039000	0.93777	2.789000	0.95967	0.655000	0.94253	GAG	.		0.413	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
CCDC173	129881	hgsc.bcm.edu;bcgsc.ca	37	2	170506849	170506849	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:170506849C>T	ENST00000447353.1	-	7	1247	c.1142G>A	c.(1141-1143)cGa>cAa	p.R381Q		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	381																	CACAATGGCTCGATATTCTGC	0.338																																					p.R381Q		.											.	.	0			c.G1142A						.						86.0	76.0	79.0					2																	170506849		1811	4068	5879	SO:0001583	missense	129881	exon7			ATGGCTCGATATT	BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.1142G>A	2.37:g.170506849C>T	ENSP00000391504:p.Arg381Gln	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	64	4	NM_001085447	0	0	0	0	0	Q6PJF6	Missense_Mutation	SNP	ENST00000447353.1	37	CCDS46445.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543115	0.86022	.	.	ENSG00000154479	ENST00000447353	T	0.15256	2.44	5.42	5.42	0.78866	.	.	.	.	.	T	0.41096	0.1144	M	0.71581	2.175	0.45946	D	0.998779	D	0.89917	1.0	D	0.87578	0.998	T	0.06267	-1.0836	9	0.30854	T	0.27	.	16.2096	0.82148	0.0:1.0:0.0:0.0	.	381	Q0VFZ6	CB077_HUMAN	Q	381	ENSP00000391504:R381Q	ENSP00000391504:R381Q	R	-	2	0	C2orf77	170215095	1.000000	0.71417	0.986000	0.45419	0.965000	0.64279	4.503000	0.60407	2.565000	0.86533	0.558000	0.71614	CGA	.		0.338	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333954.2	NM_001085447	
TTN	7273	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179469564	179469564	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:179469564C>G	ENST00000591111.1	-	231	49553	c.49329G>C	c.(49327-49329)ttG>ttC	p.L16443F	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L9144F|TTN_ENST00000460472.2_Missense_Mutation_p.L9019F|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L15516F|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L18084F|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L9211F|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16443	Fibronectin type-III 19. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCCCATGTCAAGTAGCAAG	0.433																																					p.L18084F													.	TTN-636	0			c.G54252C						.						131.0	119.0	123.0					2																	179469564		1901	4143	6044	SO:0001583	missense	7273	exon281			CCATGTCAAGTAG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.49329G>C	2.37:g.179469564C>G	ENSP00000465570:p.Leu16443Phe	Somatic	236	1		WXS	Illumina HiSeq	Phase_I	237	42	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	8.786	0.929337	0.18131	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.74	2.93	0.34026	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.81484	0.4832	M	0.93808	3.46	0.42388	D	0.992518	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.81760	-0.0785	9	0.87932	D	0	.	8.5796	0.33621	0.0:0.6169:0.0:0.3831	.	9019;9144;9211;16443	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	15516;9019;9211;9144;9019	ENSP00000343764:L15516F;ENSP00000434586:L9019F;ENSP00000340554:L9211F;ENSP00000352154:L9144F	ENSP00000340554:L9211F	L	-	3	2	TTN	179177809	0.812000	0.29077	0.999000	0.59377	0.928000	0.56348	-0.105000	0.10907	0.421000	0.25980	0.563000	0.77884	TTG	.		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SF3B1	23451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	198265617	198265617	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:198265617G>A	ENST00000335508.6	-	18	2631	c.2540C>T	c.(2539-2541)gCa>gTa	p.A847V	SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	847					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TATAATTTCTGCTGCACCTAC	0.358			Mis		myelodysplastic syndrome																																p.A847V		.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	0			c.C2540T						.						99.0	97.0	98.0					2																	198265617		2203	4300	6503	SO:0001583	missense	23451	exon18			ATTTCTGCTGCAC	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2540C>T	2.37:g.198265617G>A	ENSP00000335321:p.Ala847Val	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	78	11	NM_012433	0	0	109	140	31	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833082	0.71258	.	.	ENSG00000115524	ENST00000335508	T	0.65549	-0.16	5.77	5.77	0.91146	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59622	0.2207	L	0.41961	1.31	0.80722	D	1	B	0.14438	0.01	B	0.18561	0.022	T	0.52917	-0.8511	10	0.48119	T	0.1	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	847	O75533	SF3B1_HUMAN	V	847	ENSP00000335321:A847V	ENSP00000335321:A847V	A	-	2	0	SF3B1	197973862	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.737000	0.98831	2.885000	0.99019	0.655000	0.94253	GCA	.		0.358	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
PLEKHM3	389072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	208725904	208725904	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:208725904C>G	ENST00000427836.2	-	7	2522	c.2033G>C	c.(2032-2034)aGc>aCc	p.S678T	PLEKHM3_ENST00000389247.4_Missense_Mutation_p.S678T	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	678					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCCCTTCTGGCTACAAAGACT	0.418																																					p.S678T		.											.	PLEKHM3-23	0			c.G2033C						.						148.0	142.0	144.0					2																	208725904		1924	4136	6060	SO:0001583	missense	389072	exon7			TTCTGGCTACAAA	AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.2033G>C	2.37:g.208725904C>G	ENSP00000417003:p.Ser678Thr	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	133	7	NM_001080475	0	0	0	0	0	B9EKV2|Q8WW68	Missense_Mutation	SNP	ENST00000427836.2	37	CCDS42808.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.28|15.28	2.787482|2.787482	0.49997|0.49997	.|.	.|.	ENSG00000178385|ENSG00000178385	ENST00000427836;ENST00000389247|ENST00000447645	D;D|.	0.83163|.	-1.68;-1.69|.	5.06|5.06	5.06|5.06	0.68205|0.68205	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);|.	0.045109|.	0.85682|.	D|.	0.000000|.	T|.	0.55321|.	0.1913|.	N|N	0.21194|0.21194	0.64|0.64	0.52501|0.52501	D|D	0.999957|0.999957	P|.	0.39060|.	0.657|.	P|.	0.46585|.	0.521|.	T|.	0.48875|.	-0.8996|.	10|.	0.09084|.	T|.	0.74|.	.|.	18.9822|18.9822	0.92758|0.92758	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	678|.	Q6ZWE6|.	PKHM3_HUMAN|.	T|Y	678|429	ENSP00000417003:S678T;ENSP00000373899:S678T|.	ENSP00000373899:S678T|.	S|X	-|-	2|3	0|2	PLEKHM3|PLEKHM3	208434149|208434149	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.870000|5.870000	0.69620|0.69620	2.763000|2.763000	0.94921|0.94921	0.655000|0.655000	0.94253|0.94253	AGC|TAG	.		0.418	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337036.1	NM_001080475	
DGKD	8527	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	234368474	234368474	+	Silent	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr2:234368474C>T	ENST00000264057.2	+	23	2778	c.2766C>T	c.(2764-2766)gtC>gtT	p.V922V	DGKD_ENST00000409813.3_Silent_p.V878V	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	922					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	AGGCCTGGGTCCAGCCGCCAG	0.602																																					p.V922V		.											.	DGKD-676	0			c.C2766T						.						76.0	66.0	69.0					2																	234368474		2203	4300	6503	SO:0001819	synonymous_variant	8527	exon23			CTGGGTCCAGCCG	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2766C>T	2.37:g.234368474C>T		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	134	8	NM_152879	0	0	0	1	1	Q14158|Q6PK55|Q8NG53	Silent	SNP	ENST00000264057.2	37	CCDS2504.1																																																																																			.		0.602	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
AHCY	191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	32873337	32873337	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr20:32873337C>T	ENST00000217426.2	-	9	1153	c.1076G>A	c.(1075-1077)aGt>aAt	p.S359N	AHCY_ENST00000538132.1_Missense_Mutation_p.S331N|CTD-3216D2.5_ENST00000609218.1_RNA	NM_000687.2	NP_000678.1	P23526	SAHH_HUMAN	adenosylhomocysteinase	359					cellular nitrogen compound metabolic process (GO:0034641)|chronic inflammatory response to antigenic stimulus (GO:0002439)|circadian sleep/wake cycle (GO:0042745)|homocysteine biosynthetic process (GO:0071268)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|S-adenosylhomocysteine catabolic process (GO:0019510)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	adenosylhomocysteinase activity (GO:0004013)|adenyl nucleotide binding (GO:0030554)|NAD binding (GO:0051287)			endometrium(6)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GAAGGAGTTACTCATCACGAA	0.587																																					p.S359N		.											.	AHCY-91	0			c.G1076A						.						91.0	78.0	82.0					20																	32873337		2203	4300	6503	SO:0001583	missense	191	exon9			GAGTTACTCATCA	M61832	CCDS13233.1, CCDS54457.1	20q11.22	2009-06-12	2009-06-12		ENSG00000101444	ENSG00000101444	3.3.1.1		343	protein-coding gene	gene with protein product		180960	"""S-adenosylhomocysteine hydrolase"""			7079734, 6580258	Standard	NM_001161766		Approved	SAHH	uc002xai.3	P23526	OTTHUMG00000140098	ENST00000217426.2:c.1076G>A	20.37:g.32873337C>T	ENSP00000217426:p.Ser359Asn	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	140	27	NM_000687	0	0	163	182	19	A8K307|B3KUN3|E1P5P2|F5H737|Q96A36	Missense_Mutation	SNP	ENST00000217426.2	37	CCDS13233.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040615	0.93630	.	.	ENSG00000101444	ENST00000217426;ENST00000538132	T;T	0.79033	-1.23;-1.23	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.88952	0.6577	H	0.96777	3.88	0.80722	D	1	P	0.48589	0.912	P	0.48524	0.58	D	0.92976	0.6402	10	0.87932	D	0	.	18.522	0.90956	0.0:1.0:0.0:0.0	.	359	P23526	SAHH_HUMAN	N	359;331	ENSP00000217426:S359N;ENSP00000442820:S331N	ENSP00000217426:S359N	S	-	2	0	AHCY	32336998	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.701000	0.84566	2.457000	0.83068	0.650000	0.86243	AGT	.		0.587	AHCY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078773.2	NM_000687	
SRSF6	6431	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	42089596	42089596	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr20:42089596T>G	ENST00000244020.3	+	6	1034	c.928T>G	c.(928-930)Tca>Gca	p.S310A		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	310	Arg/Ser-rich (RS domain).				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						TGTTCCACCCTCAAAGGCCCG	0.502																																					p.S310A													.	SRSF6-289	0			c.T928G						.						83.0	82.0	83.0					20																	42089596		2203	4300	6503	SO:0001583	missense	6431	exon6			CCACCCTCAAAGG	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.928T>G	20.37:g.42089596T>G	ENSP00000244020:p.Ser310Ala	Somatic	90	1		WXS	Illumina HiSeq	Phase_I	97	14	NM_006275	0	0	442	541	98	B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	ENST00000244020.3	37	CCDS13318.1	.	.	.	.	.	.	.	.	.	.	T	11.56	1.674496	0.29693	.	.	ENSG00000124193	ENST00000244020	T	0.38722	1.12	5.64	4.47	0.54385	.	0.467630	0.22589	N	0.058110	T	0.22589	0.0545	N	0.08118	0	0.39375	D	0.966157	B	0.15141	0.012	B	0.06405	0.002	T	0.08764	-1.0706	10	0.25751	T	0.34	.	11.8146	0.52202	0.0:0.0:0.1463:0.8537	.	310	Q13247	SRSF6_HUMAN	A	310	ENSP00000244020:S310A	ENSP00000244020:S310A	S	+	1	0	SRSF6	41523010	.	.	1.000000	0.80357	0.919000	0.55068	.	.	2.265000	0.75225	0.482000	0.46254	TCA	.		0.502	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275	
ZBP1	81030	broad.mit.edu;bcgsc.ca	37	20	56195329	56195329	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr20:56195329G>A	ENST00000371173.3	-	1	200	c.23C>T	c.(22-24)cCg>cTg	p.P8L	ZBP1_ENST00000541799.1_Missense_Mutation_p.P8L|ZBP1_ENST00000340462.4_Missense_Mutation_p.P8L|ZBP1_ENST00000343535.4_Missense_Mutation_p.P8L|ZBP1_ENST00000538947.1_5'UTR|ZBP1_ENST00000395822.3_Missense_Mutation_p.P8L	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	8					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			TTCTCTGCCCGGGTCAGCAGG	0.587																																					p.P8L													.	ZBP1-228	0			c.C23T						.						35.0	31.0	32.0					20																	56195329		2200	4298	6498	SO:0001583	missense	81030	exon1			CTGCCCGGGTCAG	AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.23C>T	20.37:g.56195329G>A	ENSP00000360215:p.Pro8Leu	Somatic	182	0		WXS	Illumina HiSeq	Phase_I	240	8	NM_001160419	0	0	0	0	0	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	ENST00000371173.3	37	CCDS13461.1	.	.	.	.	.	.	.	.	.	.	G	1.396	-0.579487	0.03854	.	.	ENSG00000124256	ENST00000371173;ENST00000395822;ENST00000340462;ENST00000357677;ENST00000343535;ENST00000541799	T;T;T;T;T	0.17370	3.34;2.28;3.35;3.27;2.96	3.23	-2.64	0.06114	Winged helix-turn-helix transcription repressor DNA-binding (1);	1.393840	0.04956	N	0.461273	T	0.08044	0.0201	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.24426	0.103;0.006;0.02;0.006	B;B;B;B	0.21360	0.034;0.002;0.003;0.002	T	0.33420	-0.9869	10	0.02654	T	1	-0.6611	8.1512	0.31141	0.7008:0.0:0.2992:0.0	.	8;8;8;8	F5GYT1;A2RRL9;A2A2F7;Q9H171	.;.;.;ZBP1_HUMAN	L	8	ENSP00000360215:P8L;ENSP00000379167:P8L;ENSP00000344954:P8L;ENSP00000340584:P8L;ENSP00000440552:P8L	ENSP00000344954:P8L	P	-	2	0	ZBP1	55628735	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.330000	0.07925	-0.567000	0.06046	-1.141000	0.01876	CCG	.		0.587	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776	
SMTN	6525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	31484747	31484747	+	Silent	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr22:31484747G>C	ENST00000347557.2	+	5	575	c.357G>C	c.(355-357)cgG>cgC	p.R119R	SMTN_ENST00000358743.1_Silent_p.R119R|SMTN_ENST00000333137.7_Silent_p.R119R	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	119					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						GCCGTGTACGGGCTCAGGAGA	0.632											OREG0026472	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R175R		.											.	SMTN-154	0			c.G525C						.						75.0	63.0	67.0					22																	31484747		2202	4300	6502	SO:0001819	synonymous_variant	6525	exon4			TGTACGGGCTCAG	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.357G>C	22.37:g.31484747G>C		Somatic	141	0	825	WXS	Illumina HiSeq	Phase_I	94	26	NM_001207018	0	0	4	7	3	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Silent	SNP	ENST00000347557.2	37	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	G	5.557	0.287703	0.10513	.	.	ENSG00000183963	ENST00000438223	.	.	.	4.79	1.3	0.21679	.	.	.	.	.	T	0.43055	0.1230	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26744	-1.0094	4	.	.	.	-19.7875	1.9964	0.03457	0.2418:0.1338:0.4874:0.137	.	.	.	.	R	174	.	.	G	+	1	0	SMTN	29814747	1.000000	0.71417	0.975000	0.42487	0.527000	0.34593	0.687000	0.25407	0.543000	0.28864	0.655000	0.94253	GGC	.		0.632	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270	
RAC2	5880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37627391	37627391	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr22:37627391T>A	ENST00000249071.6	-	5	449	c.328A>T	c.(328-330)Atc>Ttc	p.I110F	RAC2_ENST00000405484.1_Missense_Mutation_p.I103F|RAC2_ENST00000406508.1_Missense_Mutation_p.I66F	NM_002872.3	NP_002863.1	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)	110					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell projection assembly (GO:0030031)|G-protein coupled receptor signaling pathway (GO:0007186)|lymphocyte aggregation (GO:0071593)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|regulation of cell-substrate adhesion (GO:0010810)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of neutrophil migration (GO:1902622)|regulation of respiratory burst (GO:0060263)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	12					Dextromethorphan(DB00514)	ACCAGGATGATGGGTGTGCTG	0.632																																					p.I110F		.											.	RAC2-723	0			c.A328T						.						91.0	78.0	83.0					22																	37627391		2203	4300	6503	SO:0001583	missense	5880	exon5			GGATGATGGGTGT	M64595	CCDS13945.1	22q13.1	2014-09-17			ENSG00000128340	ENSG00000128340		"""Endogenous ligands"""	9802	protein-coding gene	gene with protein product		602049				2674130	Standard	NM_002872		Approved	EN-7	uc003arc.3	P15153	OTTHUMG00000150540	ENST00000249071.6:c.328A>T	22.37:g.37627391T>A	ENSP00000249071:p.Ile110Phe	Somatic	273	0		WXS	Illumina HiSeq	Phase_I	225	83	NM_002872	0	0	13	34	21	Q9UDJ4	Missense_Mutation	SNP	ENST00000249071.6	37	CCDS13945.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.992414	0.74703	.	.	ENSG00000128340	ENST00000249071;ENST00000406508;ENST00000405484;ENST00000441619	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	4.98	4.98	0.66077	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	L	0.47190	1.495	0.80722	D	1	B	0.22746	0.074	B	0.36030	0.216	T	0.63554	-0.6611	10	0.22109	T	0.4	.	14.9666	0.71198	0.0:0.0:0.0:1.0	.	110	P15153	RAC2_HUMAN	F	110;66;103;110	ENSP00000249071:I110F;ENSP00000385270:I66F;ENSP00000385590:I103F;ENSP00000403778:I110F	ENSP00000249071:I110F	I	-	1	0	RAC2	35957337	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.003000	0.58678	0.459000	0.35465	ATC	.		0.632	RAC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318812.1		
FANCD2	2177	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	10089633	10089633	+	Silent	SNP	G	G	A	rs564577177		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr3:10089633G>A	ENST00000419585.1	+	16	1472	c.1311G>A	c.(1309-1311)tcG>tcA	p.S437S	FANCD2_ENST00000383806.1_Silent_p.S437S|FANCD2_ENST00000287647.3_Silent_p.S437S|FANCD2_ENST00000383807.1_Silent_p.S437S			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	437					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCATTCTGTCGCTGGCTCAGA	0.408			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.S437S		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2-229	0			c.G1311A						.						171.0	174.0	173.0					3																	10089633		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon16	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TCTGTCGCTGGCT	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.1311G>A	3.37:g.10089633G>A		Somatic	137	0		WXS	Illumina HiSeq	Phase_I	107	8	NM_001018115	0	0	1	1	0	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																			.		0.408	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
SCN11A	11280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38962716	38962716	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr3:38962716C>T	ENST00000302328.3	-	6	941	c.743G>A	c.(742-744)cGc>cAc	p.R248H	SCN11A_ENST00000450244.1_Missense_Mutation_p.R248H|SCN11A_ENST00000444237.2_Missense_Mutation_p.R248H|SCN11A_ENST00000456224.3_Missense_Mutation_p.R248H	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	248					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTCACAGAGCGTAGCAAGGC	0.542																																					p.R248H		.											.	SCN11A-99	0			c.G743A						.						115.0	111.0	112.0					3																	38962716		2203	4300	6503	SO:0001583	missense	11280	exon6			ACAGAGCGTAGCA	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.743G>A	3.37:g.38962716C>T	ENSP00000307599:p.Arg248His	Somatic	149	1		WXS	Illumina HiSeq	Phase_I	138	106	NM_014139	0	0	0	0	0	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	12.93	2.085095	0.36758	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08	4.67	3.79	0.43588	Ion transport (1);	0.217778	0.42964	D	0.000631	D	0.94729	0.8299	N	0.25332	0.735	0.32489	N	0.540524	B	0.26081	0.141	B	0.22880	0.042	D	0.92393	0.5923	10	0.16896	T	0.51	.	7.3286	0.26569	0.0:0.7983:0.0:0.2017	.	248	Q9UI33	SCNBA_HUMAN	H	248	ENSP00000307599:R248H;ENSP00000400945:R248H;ENSP00000416757:R248H;ENSP00000408028:R248H	ENSP00000307599:R248H	R	-	2	0	SCN11A	38937720	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.635000	0.61332	0.966000	0.38159	0.585000	0.79938	CGC	.		0.542	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
ZBTB38	253461	broad.mit.edu	37	3	141162716	141162716	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr3:141162716G>A	ENST00000514251.1	+	4	1765	c.1486G>A	c.(1486-1488)Gta>Ata	p.V496I	ZBTB38_ENST00000321464.5_Missense_Mutation_p.V497I|ZBTB38_ENST00000441582.2_Missense_Mutation_p.V496I					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						CTGCAACAAAGTATTTGCATT	0.418																																					p.V496I													.	ZBTB38-25	0			c.G1486A						.						99.0	92.0	94.0					3																	141162716		1929	4124	6053	SO:0001583	missense	253461	exon8			AACAAAGTATTTG	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.1486G>A	3.37:g.141162716G>A	ENSP00000426387:p.Val496Ile	Somatic	115	1		WXS	Illumina HiSeq	Phase_I	94	3	NM_001080412	0	0	4	4	0		Missense_Mutation	SNP	ENST00000514251.1	37	CCDS43157.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791622	0.90367	.	.	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.39	5.39	0.77823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.64907	0.2641	N	0.21240	0.645	0.49213	D	0.999765	D;D	0.71674	0.998;0.998	D;D	0.81914	0.994;0.995	T	0.62714	-0.6796	9	.	.	.	-22.0045	19.1701	0.93574	0.0:0.0:1.0:0.0	.	497;496	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	I	496;496;496;497	ENSP00000424254:V496I;ENSP00000426387:V496I;ENSP00000406955:V496I;ENSP00000372635:V497I	.	V	+	1	0	ZBTB38	142645406	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.476000	0.97823	2.543000	0.85770	0.650000	0.86243	GTA	.		0.418	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2		
AADACL2	344752	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	151475280	151475280	+	Silent	SNP	T	T	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr3:151475280T>C	ENST00000356517.3	+	5	1213	c.1104T>C	c.(1102-1104)gaT>gaC	p.D368D	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_207365.3	NP_997248.2	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2	368						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			NS(1)|breast(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(13)|skin(2)	24			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ATATTGAGGATGGAATTCATG	0.338																																					p.D368D		.											.	AADACL2-90	0			c.T1104C						.						97.0	95.0	96.0					3																	151475280		2203	4299	6502	SO:0001819	synonymous_variant	344752	exon5			TGAGGATGGAATT	BC065724	CCDS3161.2	3q25.1	2010-12-14			ENSG00000197953	ENSG00000197953			24427	protein-coding gene	gene with protein product							Standard	NM_207365		Approved	MGC72001	uc003ezc.3	Q6P093	OTTHUMG00000155914	ENST00000356517.3:c.1104T>C	3.37:g.151475280T>C		Somatic	137	0		WXS	Illumina HiSeq	Phase_I	191	15	NM_207365	0	0	0	0	0	Q5HYJ4	Silent	SNP	ENST00000356517.3	37	CCDS3161.2																																																																																			.		0.338	AADACL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342288.3	NM_207365	
SI	6476	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	164767590	164767590	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr3:164767590G>A	ENST00000264382.3	-	14	1648	c.1586C>T	c.(1585-1587)cCg>cTg	p.P529L		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	529	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AGGAGTAAACGGTGGATAATT	0.279										HNSCC(35;0.089)																											p.P529L		.											.	SI-104	0			c.C1586T						.						90.0	100.0	97.0					3																	164767590		2203	4289	6492	SO:0001583	missense	6476	exon14			GTAAACGGTGGAT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1586C>T	3.37:g.164767590G>A	ENSP00000264382:p.Pro529Leu	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	131	9	NM_001041	0	0	0	0	0	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778691	0.70107	.	.	ENSG00000090402	ENST00000264382	D	0.91686	-2.89	5.58	5.58	0.84498	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97188	0.9081	M	0.93375	3.41	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.97952	1.0332	10	0.87932	D	0	.	18.5615	0.91101	0.0:0.0:1.0:0.0	.	529	P14410	SUIS_HUMAN	L	529	ENSP00000264382:P529L	ENSP00000264382:P529L	P	-	2	0	SI	166250284	1.000000	0.71417	1.000000	0.80357	0.394000	0.30568	9.114000	0.94329	2.622000	0.88805	0.585000	0.79938	CCG	.		0.279	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
KLB	152831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	39439409	39439409	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr4:39439409G>C	ENST00000257408.4	+	3	1496	c.1399G>C	c.(1399-1401)Gaa>Caa	p.E467Q		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	467	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						GGATGGCTTTGAATGGCAGGA	0.428																																					p.E467Q		.											.	KLB-69	0			c.G1399C						.						189.0	178.0	182.0					4																	39439409		2203	4300	6503	SO:0001583	missense	152831	exon3			GGCTTTGAATGGC	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1399G>C	4.37:g.39439409G>C	ENSP00000257408:p.Glu467Gln	Somatic	178	0		WXS	Illumina HiSeq	Phase_I	112	15	NM_175737	0	0	0	0	0	Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	37	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956339	0.92726	.	.	ENSG00000134962	ENST00000257408	T	0.41065	1.01	6.03	5.19	0.71726	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.095361	0.64402	D	0.000001	T	0.77239	0.4101	H	0.98446	4.235	0.51767	D	0.999938	D;D	0.76494	0.999;0.999	D;D	0.66716	0.946;0.946	D	0.86716	0.1939	10	0.87932	D	0	-28.1831	15.0523	0.71885	0.0674:0.0:0.9326:0.0	.	467;467	B7ZL50;Q86Z14	.;KLOTB_HUMAN	Q	467	ENSP00000257408:E467Q	ENSP00000257408:E467Q	E	+	1	0	KLB	39115804	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	1.562000	0.49601	0.655000	0.94253	GAA	.		0.428	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
FIP1L1	81608	broad.mit.edu	37	4	54244014	54244014	+	Silent	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr4:54244014C>T	ENST00000337488.6	+	1	203	c.9C>T	c.(7-9)gcC>gcT	p.A3A	FIP1L1_ENST00000358575.5_Silent_p.A3A|FIP1L1_ENST00000306932.6_Silent_p.A3A|FIP1L1_ENST00000507922.1_Silent_p.A3A|FIP1L1_ENST00000507166.1_Silent_p.A3A	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	3	Necessary for stimulating PAPOLA activity.|Sufficient for interaction with PAPOLA.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CCATGTCGGCCGGCGAGGTCG	0.672			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.A3A				Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	FIP1L1-1083	0			c.C9T						.						39.0	55.0	50.0					4																	54244014		2191	4292	6483	SO:0001819	synonymous_variant	81608	exon1			GTCGGCCGGCGAG	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.9C>T	4.37:g.54244014C>T		Somatic	44	1		WXS	Illumina HiSeq	Phase_I	22	9	NM_030917	0	0	3	7	4	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Silent	SNP	ENST00000337488.6	37	CCDS3491.1																																																																																			.		0.672	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
POLR2B	5431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	57889646	57889646	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr4:57889646A>T	ENST00000381227.1	+	20	3079	c.2666A>T	c.(2665-2667)aAg>aTg	p.K889M	POLR2B_ENST00000431623.2_Missense_Mutation_p.K814M|POLR2B_ENST00000314595.5_Missense_Mutation_p.K889M|POLR2B_ENST00000441246.2_Missense_Mutation_p.K882M			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	889					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					CGCTATACCAAGAGAGACTGT	0.413																																					p.K889M		.											.	POLR2B-92	0			c.A2666T						.						108.0	104.0	105.0					4																	57889646		2203	4300	6503	SO:0001583	missense	5431	exon19			ATACCAAGAGAGA		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2666A>T	4.37:g.57889646A>T	ENSP00000370625:p.Lys889Met	Somatic	167	0		WXS	Illumina HiSeq	Phase_I	92	7	NM_000938	0	0	28	30	2	A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	37	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.834179	0.91036	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6	6.04	6.04	0.98038	RNA polymerase Rpb2, OB-fold (1);DNA-directed RNA polymerase, subunit 2, domain 6 (1);	0.000000	0.85682	D	0.000000	D	0.88066	0.6337	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90731	0.4642	10	0.87932	D	0	.	16.5885	0.84745	1.0:0.0:0.0:0.0	.	814;889	C9J4M6;P30876	.;RPB2_HUMAN	M	889;814;882;889	ENSP00000370625:K889M;ENSP00000391096:K814M;ENSP00000391452:K882M;ENSP00000312735:K889M	ENSP00000312735:K889M	K	+	2	0	POLR2B	57584403	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.317000	0.78254	0.460000	0.39030	AAG	.		0.413	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
SMARCAD1	56916	broad.mit.edu	37	4	95174021	95174021	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr4:95174021G>A	ENST00000354268.4	+	9	1217	c.1144G>A	c.(1144-1146)Gag>Aag	p.E382K	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.E382K|SMARCAD1_ENST00000509418.1_5'Flank			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	382					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		AGAAGTGATGGAGGATGGCTA	0.378																																					p.E382K													.	SMARCAD1-229	0			c.G1144A						.						97.0	94.0	95.0					4																	95174021		2203	4300	6503	SO:0001583	missense	56916	exon9			GTGATGGAGGATG	AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.1144G>A	4.37:g.95174021G>A	ENSP00000346217:p.Glu382Lys	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	61	4	NM_001128429	0	0	4	4	0	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	37	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759725	0.49468	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268	D;D;D	0.88277	-2.36;-2.36;-2.35	5.58	5.58	0.84498	.	0.000000	0.50627	D	0.000119	D	0.85936	0.5813	L	0.54323	1.7	0.80722	D	1	P;B	0.41910	0.764;0.157	B;B	0.32762	0.152;0.077	D	0.86276	0.1664	10	0.42905	T	0.14	-9.6286	19.5837	0.95482	0.0:0.0:1.0:0.0	.	382;382	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	K	382	ENSP00000351947:E382K;ENSP00000415576:E382K;ENSP00000346217:E382K	ENSP00000346217:E382K	E	+	1	0	SMARCAD1	95393044	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.116000	0.77119	2.630000	0.89119	0.655000	0.94253	GAG	.		0.378	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
GUCY1B3	2983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	156724870	156724870	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr4:156724870T>G	ENST00000264424.8	+	11	1590	c.1508T>G	c.(1507-1509)aTg>aGg	p.M503R	GUCY1B3_ENST00000505764.1_Missense_Mutation_p.M483R|GUCY1B3_ENST00000503520.1_Missense_Mutation_p.M470R|GUCY1B3_ENST00000505154.1_Missense_Mutation_p.M435R|GUCY1B3_ENST00000513437.1_Missense_Mutation_p.M435R|GUCY1B3_ENST00000507146.1_Missense_Mutation_p.M478R|GUCY1B3_ENST00000502959.1_Missense_Mutation_p.M525R	NM_000857.2	NP_000848.1	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	503	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)	cytoplasm (GO:0005737)|guanylate cyclase complex, soluble (GO:0008074)|intracellular membrane-bounded organelle (GO:0043231)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		GCCTTGGACATGATGGAAATT	0.423																																					p.M503R		.											.	.	0			c.T1508G						.						76.0	79.0	78.0					4																	156724870		1960	4160	6120	SO:0001583	missense	2983	exon11			TGGACATGATGGA	AF020340	CCDS47154.1, CCDS75203.1	4q31.3-q33	2008-03-18			ENSG00000061918	ENSG00000061918	4.6.1.2		4687	protein-coding gene	gene with protein product		139397		GUC1B3		1352257	Standard	XM_005262959		Approved	GC-SB3, GC-S-beta-1	uc003ipc.3	Q02153	OTTHUMG00000161698	ENST00000264424.8:c.1508T>G	4.37:g.156724870T>G	ENSP00000264424:p.Met503Arg	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	39	4	NM_000857	0	0	16	21	5	B7Z426|Q86WY5	Missense_Mutation	SNP	ENST00000264424.8	37	CCDS47154.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.327658	0.81690	.	.	ENSG00000061918	ENST00000505154;ENST00000502959;ENST00000505764;ENST00000507146;ENST00000264424;ENST00000503520;ENST00000513437	D;D;D;D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71;-1.71;-1.71;-1.71	5.61	5.61	0.85477	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.93848	0.8032	H	0.96576	3.845	0.80722	D	1	P;P;D;P;P	0.58970	0.94;0.941;0.984;0.875;0.867	P;P;D;P;P	0.65010	0.735;0.86;0.931;0.517;0.735	D	0.95757	0.8797	10	0.87932	D	0	.	16.1025	0.81194	0.0:0.0:0.0:1.0	.	483;525;478;470;503	B7Z426;E9PCN2;D6RC99;Q02153-2;Q02153	.;.;.;.;GCYB1_HUMAN	R	435;525;483;478;503;470;435	ENSP00000427226:M435R;ENSP00000426786:M525R;ENSP00000426319:M483R;ENSP00000422313:M478R;ENSP00000264424:M503R;ENSP00000420842:M470R;ENSP00000425065:M435R	ENSP00000264424:M503R	M	+	2	0	GUCY1B3	156944320	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.990000	0.88215	2.254000	0.74563	0.533000	0.62120	ATG	.		0.423	GUCY1B3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365770.2		
SDHA	6389	ucsc.edu;bcgsc.ca	37	5	235358	235358	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr5:235358G>A	ENST00000264932.6	+	9	1279	c.1164G>A	c.(1162-1164)atG>atA	p.M388I	SDHA_ENST00000504309.1_Missense_Mutation_p.M388I|SDHA_ENST00000510361.1_Missense_Mutation_p.M340I	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	388					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	AGACAGCCATGATCTTCGCTG	0.602									Familial Paragangliomas																												p.M388I													.	SDHA-226	0			c.G1164A						.						68.0	61.0	63.0					5																	235358		2203	4300	6503	SO:0001583	missense	6389	exon9	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	AGCCATGATCTTC	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1164G>A	5.37:g.235358G>A	ENSP00000264932:p.Met388Ile	Somatic	444	4		WXS	Illumina HiSeq		569	92	NM_004168	0	0	78	89	11	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	N	18.72	3.683429	0.68157	.	.	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	T;T;T	0.68331	-0.32;-0.32;-0.32	5.12	5.12	0.69794	Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);	0.000000	0.85682	U	0.000000	T	0.60353	0.2262	L	0.35542	1.07	0.80722	D	1	P;B;B;B;B	0.37276	0.589;0.005;0.121;0.024;0.024	B;B;B;B;B	0.39299	0.296;0.01;0.097;0.017;0.017	T	0.64605	-0.6368	10	0.56958	D	0.05	.	16.4201	0.83755	0.0:0.0:1.0:0.0	.	340;388;388;388;394	E9PBJ5;B4DYN5;D6RFM5;P31040;Q59GW8	.;.;.;DHSA_HUMAN;.	I	388;243;388;340	ENSP00000264932:M388I;ENSP00000426514:M388I;ENSP00000427703:M340I	ENSP00000264932:M388I	M	+	3	0	SDHA	288358	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	8.994000	0.93529	2.541000	0.85698	0.557000	0.71058	ATG	.		0.602	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	13771076	13771076	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr5:13771076G>T	ENST00000265104.4	-	56	9491	c.9387C>A	c.(9385-9387)ttC>ttA	p.F3129L	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3129	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGGAAGTGAGGAAGTGTTCAG	0.388									Kartagener syndrome																												p.F3129L		.											.	DNAH5-182	0			c.C9387A						.						63.0	60.0	61.0					5																	13771076		2203	4300	6503	SO:0001583	missense	1767	exon56	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AGTGAGGAAGTGT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9387C>A	5.37:g.13771076G>T	ENSP00000265104:p.Phe3129Leu	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	104	7	NM_001369	0	0	0	0	0	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521574	0.44866	.	.	ENSG00000039139	ENST00000265104	T	0.54071	0.59	5.71	2.58	0.30949	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.85682	D	0.000000	T	0.67268	0.2875	M	0.89601	3.045	0.80722	D	1	B	0.31989	0.35	P	0.46585	0.521	T	0.68792	-0.5315	10	0.72032	D	0.01	.	7.8099	0.29226	0.1782:0.0:0.6883:0.1335	.	3129	Q8TE73	DYH5_HUMAN	L	3129	ENSP00000265104:F3129L	ENSP00000265104:F3129L	F	-	3	2	DNAH5	13824076	1.000000	0.71417	1.000000	0.80357	0.201000	0.24016	2.368000	0.44222	0.759000	0.33084	-0.152000	0.13540	TTC	.		0.388	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
NNT	23530	broad.mit.edu	37	5	43677873	43677873	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr5:43677873G>T	ENST00000264663.5	+	19	3062	c.2841G>T	c.(2839-2841)ttG>ttT	p.L947F	NNT_ENST00000512996.2_Missense_Mutation_p.L816F|NNT_ENST00000344920.4_Missense_Mutation_p.L947F	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	947					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					TTGCTGATTTGGTAAAGATGC	0.403																																					p.L947F													.	NNT-92	0			c.G2841T						.						158.0	153.0	155.0					5																	43677873		2203	4300	6503	SO:0001583	missense	23530	exon19			TGATTTGGTAAAG	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2841G>T	5.37:g.43677873G>T	ENSP00000264663:p.Leu947Phe	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	110	4	NM_182977	0	0	31	31	0	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	37	CCDS3949.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620944	0.66787	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.90955	-2.76;-2.76;-2.76	5.19	4.32	0.51571	.	0.196995	0.43579	D	0.000550	D	0.90810	0.7114	M	0.65320	2	0.54753	D	0.999983	P	0.45634	0.863	P	0.49332	0.607	D	0.90075	0.4166	10	0.51188	T	0.08	-2.1643	10.6804	0.45811	0.2048:0.0:0.7952:0.0	.	947	Q13423	NNTM_HUMAN	F	462;947;947;816	ENSP00000264663:L947F;ENSP00000343873:L947F;ENSP00000426343:L816F	ENSP00000264663:L947F	L	+	3	2	NNT	43713630	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.031000	0.49728	1.311000	0.45024	0.558000	0.71614	TTG	.		0.403	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977	
DDX4	54514	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	55110902	55110902	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr5:55110902G>A	ENST00000505374.1	+	20	1981	c.1889G>A	c.(1888-1890)cGt>cAt	p.R630H	DDX4_ENST00000511853.1_Missense_Mutation_p.R481H|DDX4_ENST00000354991.5_Missense_Mutation_p.R596H|DDX4_ENST00000514278.2_Missense_Mutation_p.R610H|DDX4_ENST00000353507.5_Missense_Mutation_p.R596H	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	630	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				CGAATTGGGCGTACTGGTCGT	0.393																																					p.R630H		.											.	DDX4-227	0			c.G1889A						.						183.0	179.0	180.0					5																	55110902		2203	4300	6503	SO:0001583	missense	54514	exon20			TTGGGCGTACTGG	AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.1889G>A	5.37:g.55110902G>A	ENSP00000424838:p.Arg630His	Somatic	244	0		WXS	Illumina HiSeq	Phase_I	287	16	NM_024415	0	0	0	0	0	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	37	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106807	0.56291	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000354991;ENST00000511853	D;D;D;D;D	0.99143	-5.48;-5.48;-5.48;-5.48;-5.48	5.69	3.83	0.44106	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99576	0.9847	H	0.99042	4.41	0.47737	D	0.999505	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97744	1.0210	10	0.87932	D	0	-18.9385	12.9225	0.58241	0.0:0.1242:0.7465:0.1293	.	610;481;596;630	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	H	596;610;630;596;481	ENSP00000334167:R596H;ENSP00000425359:R610H;ENSP00000424838:R630H;ENSP00000347087:R596H;ENSP00000423123:R481H	ENSP00000334167:R596H	R	+	2	0	DDX4	55146659	1.000000	0.71417	0.997000	0.53966	0.125000	0.20455	7.630000	0.83225	1.390000	0.46547	-0.305000	0.09177	CGT	.		0.393	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415	
RASA1	5921	bcgsc.ca	37	5	86645138	86645138	+	Missense_Mutation	SNP	A	A	T	rs560064316		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr5:86645138A>T	ENST00000274376.6	+	8	1774	c.1210A>T	c.(1210-1212)Acg>Tcg	p.T404S	RASA1_ENST00000506290.1_Missense_Mutation_p.T238S|RASA1_ENST00000456692.2_Missense_Mutation_p.T227S|RASA1_ENST00000512763.1_Missense_Mutation_p.T237S	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	404	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		AATATGTCCAACGCCAAACAA	0.348																																					p.T404S													.	RASA1-661	0			c.A1210T						.						75.0	79.0	78.0					5																	86645138		2201	4298	6499	SO:0001583	missense	5921	exon8			TGTCCAACGCCAA		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1210A>T	5.37:g.86645138A>T	ENSP00000274376:p.Thr404Ser	Somatic	103	2		WXS	Illumina HiSeq	Phase_1	89	32	NM_002890	0	0	4	7	3	B2R6W3|Q9UDI1	Missense_Mutation	SNP	ENST00000274376.6	37	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	A	19.80	3.894664	0.72639	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45	5.78	5.78	0.91487	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	N	0.16656	0.425	0.58432	D	0.999999	P;B;P;B;P	0.39094	0.488;0.196;0.488;0.305;0.659	B;B;B;B;B	0.43889	0.357;0.254;0.357;0.298;0.435	D	0.83771	0.0220	10	0.32370	T	0.25	.	16.1143	0.81295	1.0:0.0:0.0:0.0	.	238;237;238;227;404	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	S	404;437;227;237;238	ENSP00000274376:T404S;ENSP00000411221:T227S;ENSP00000422008:T237S;ENSP00000420905:T238S	ENSP00000274376:T404S	T	+	1	0	RASA1	86680894	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.294000	0.78760	2.198000	0.70561	0.477000	0.44152	ACG	.		0.348	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
SLCO6A1	133482	broad.mit.edu	37	5	101811427	101811427	+	Silent	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr5:101811427G>A	ENST00000506729.1	-	4	1044	c.873C>T	c.(871-873)gtC>gtT	p.V291V	SLCO6A1_ENST00000513675.1_Silent_p.V229V|SLCO6A1_ENST00000514551.1_5'UTR|SLCO6A1_ENST00000379810.1_Silent_p.V229V|SLCO6A1_ENST00000379807.3_Silent_p.V291V|SLCO6A1_ENST00000389019.3_Silent_p.V229V			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	291						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TATTCTCAGGGACTTTAACTA	0.333																																					p.V291V													.	SLCO6A1-96	0			c.C873T						.						114.0	109.0	111.0					5																	101811427		2203	4300	6503	SO:0001819	synonymous_variant	133482	exon4			CTCAGGGACTTTA	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.873C>T	5.37:g.101811427G>A		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	84	4	NM_173488	0	0	0	0	0	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	ENST00000506729.1	37	CCDS34206.1																																																																																			.		0.333	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
PCDHGA1	56114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140711698	140711698	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr5:140711698G>A	ENST00000517417.1	+	1	1447	c.1447G>A	c.(1447-1449)Gag>Aag	p.E483K	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.E483K	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	483	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACAGCAATGAGAATGCACA	0.537																																					p.E483K		.											.	PCDHGA1-137	0			c.G1447A						.						113.0	121.0	119.0					5																	140711698		2203	4300	6503	SO:0001583	missense	56114	exon1			AGCAATGAGAATG	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1447G>A	5.37:g.140711698G>A	ENSP00000431083:p.Glu483Lys	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	75	15	NM_018912	0	0	0	0	0	Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	G	6.770	0.511030	0.12883	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.51574	4.68;0.7	3.82	2.91	0.33838	Cadherin (4);Cadherin-like (1);	0.321295	0.22123	N	0.064320	T	0.43523	0.1251	L	0.52266	1.64	0.09310	N	0.999999	B;B	0.14805	0.011;0.009	B;B	0.24701	0.049;0.055	T	0.42430	-0.9452	10	0.46703	T	0.11	.	12.8583	0.57899	0.0:0.3118:0.6881:0.0	.	483;483	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	K	483	ENSP00000431083:E483K;ENSP00000367345:E483K	ENSP00000367345:E483K	E	+	1	0	PCDHGA1	140691882	0.000000	0.05858	0.121000	0.21740	0.494000	0.33585	0.184000	0.16939	0.905000	0.36596	0.557000	0.71058	GAG	.		0.537	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
CLINT1	9685	broad.mit.edu	37	5	157285975	157285975	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr5:157285975A>T	ENST00000411809.2	-	1	208	c.4T>A	c.(4-6)Ttg>Atg	p.L2M	CLINT1_ENST00000296951.5_De_novo_Start_InFrame|CLINT1_ENST00000530742.1_Intron|CLINT1_ENST00000523908.1_Missense_Mutation_p.L2M|CLINT1_ENST00000523094.1_De_novo_Start_OutOfFrame	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	2					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CACATGTTCAACATCGTGCCC	0.701																																					p.L2M	Colon(22;427 587 2170 6147 14291)												.	CLINT1-48	0			c.T4A						.						34.0	41.0	39.0					5																	157285975		2024	4177	6201	SO:0001583	missense	9685	exon1			TGTTCAACATCGT	AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.4T>A	5.37:g.157285975A>T	ENSP00000388340:p.Leu2Met	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	87	3	NM_014666	0	0	25	27	2	B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Missense_Mutation	SNP	ENST00000411809.2	37	CCDS47330.1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.694344	0.48202	.	.	ENSG00000113282	ENST00000411809;ENST00000523908	T;T	0.48836	0.8;0.8	5.11	3.95	0.45737	ENTH/VHS (1);	.	.	.	.	T	0.37237	0.0996	L	0.43152	1.355	0.80722	D	1	B;B	0.25105	0.118;0.118	B;B	0.25884	0.064;0.064	T	0.21245	-1.0251	9	0.54805	T	0.06	.	6.1994	0.20567	0.7953:0.0:0.2047:0.0	.	2;2	B7Z6F8;Q14677	.;EPN4_HUMAN	M	2	ENSP00000388340:L2M;ENSP00000429824:L2M	ENSP00000388340:L2M	L	-	1	2	CLINT1	157218553	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.819000	0.39022	0.789000	0.33779	0.533000	0.62120	TTG	.		0.701	CLINT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374001.1	NM_014666	
FLT4	2324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	180050943	180050943	+	Nonsense_Mutation	SNP	T	T	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr5:180050943T>A	ENST00000261937.6	-	11	1618	c.1540A>T	c.(1540-1542)Aag>Tag	p.K514*	FLT4_ENST00000502649.1_Nonsense_Mutation_p.K514*|FLT4_ENST00000393347.3_Nonsense_Mutation_p.K514*|FLT4_ENST00000424276.2_5'UTR	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	514	Ig-like C2-type 5.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACCTTATTCTTTCCCTCCACA	0.602																																					p.K514X	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4-1490	0			c.A1540T						.						95.0	82.0	87.0					5																	180050943		2203	4300	6503	SO:0001587	stop_gained	2324	exon11			TATTCTTTCCCTC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1540A>T	5.37:g.180050943T>A	ENSP00000261937:p.Lys514*	Somatic	203	0		WXS	Illumina HiSeq	Phase_I	197	21	NM_182925	0	0	0	0	0	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Nonsense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	T	39	7.440611	0.98286	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.8621	0.46833	0.0:0.0:0.2833:0.7166	.	.	.	.	X	514;514;514;324	.	ENSP00000261937:K514X	K	-	1	0	FLT4	179983549	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	3.078000	0.50096	1.906000	0.55180	0.459000	0.35465	AAG	.		0.602	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
HIST1H2AE	3012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	26217223	26217223	+	Missense_Mutation	SNP	A	A	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr6:26217223A>T	ENST00000303910.2	+	1	59	c.21A>T	c.(19-21)caA>caT	p.Q7H	HIST1H2BG_ENST00000244601.3_5'Flank	NM_021052.2	NP_066390.1	P04908	H2A1B_HUMAN	histone cluster 1, H2ae	7						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	10		all_hematologic(11;0.196)				GTGGAAAGCAAGGCGGCAAAG	0.502																																					p.Q7H		.											.	HIST1H2AE-92	0			c.A21T						.						62.0	55.0	57.0					6																	26217223		2203	4300	6503	SO:0001583	missense	3012	exon1			AAAGCAAGGCGGC	M60752	CCDS4595.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000168274	ENSG00000277075		"""Histones / Replication-dependent"""	4724	protein-coding gene	gene with protein product		602786	"""H2A histone family, member A"", ""histone 1, H2ae"""	H2AFA		9119399, 1916825, 12408966	Standard	NM_021052		Approved	H2A/a, H2A.1	uc003nha.1	P04908	OTTHUMG00000014440	ENST00000303910.2:c.21A>T	6.37:g.26217223A>T	ENSP00000303373:p.Gln7His	Somatic	193	0		WXS	Illumina HiSeq	Phase_I	131	68	NM_021052	0	0	3	4	1	P28001|Q76P63	Missense_Mutation	SNP	ENST00000303910.2	37	CCDS4595.1	.	.	.	.	.	.	.	.	.	.	.	11.14	1.551016	0.27739	.	.	ENSG00000168274	ENST00000303910	T	0.42900	0.96	4.08	-4.32	0.03688	.	0.000000	0.32640	U	0.005837	T	0.14830	0.0358	N	0.17474	0.49	0.34285	D	0.682566	.	.	.	.	.	.	T	0.14811	-1.0459	8	0.66056	D	0.02	.	10.9427	0.47283	0.6741:0.0:0.3259:0.0	.	.	.	.	H	7	ENSP00000303373:Q7H	ENSP00000303373:Q7H	Q	+	3	2	HIST1H2AE	26325202	0.014000	0.17966	0.774000	0.31636	0.857000	0.48899	-1.328000	0.02680	-1.206000	0.02641	0.533000	0.62120	CAA	.		0.502	HIST1H2AE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040103.1	NM_021052	
PKHD1	5314	broad.mit.edu;bcgsc.ca	37	6	51889790	51889790	+	Silent	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr6:51889790G>A	ENST00000371117.3	-	32	5093	c.4818C>T	c.(4816-4818)gtC>gtT	p.V1606V	PKHD1_ENST00000340994.4_Silent_p.V1606V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1606	IPT/TIG 11.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGTCAATATAGACTGACGTGG	0.507																																					p.V1606V													.	PKHD1-603	0			c.C4818T						.						148.0	133.0	138.0					6																	51889790		2203	4300	6503	SO:0001819	synonymous_variant	5314	exon32			AATATAGACTGAC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4818C>T	6.37:g.51889790G>A		Somatic	209	0		WXS	Illumina HiSeq	Phase_I	209	9	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	CCDS4935.1																																																																																			.		0.507	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
CEP162	22832	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	84911470	84911470	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr6:84911470C>T	ENST00000403245.3	-	8	817	c.703G>A	c.(703-705)Ggc>Agc	p.G235S	KIAA1009_ENST00000257766.4_Missense_Mutation_p.G159S	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		GCAAGCATGCCAGTTTTTTCT	0.264																																					p.G235S													.	KIAA1009-91	0			c.G703A						.						14.0	15.0	15.0					6																	84911470		2167	4247	6414	SO:0001583	missense	22832	exon8			GCATGCCAGTTTT																												ENST00000403245.3:c.703G>A	6.37:g.84911470C>T	ENSP00000385215:p.Gly235Ser	Somatic	82	1		WXS	Illumina HiSeq	Phase_I	90	46	NM_014895	0	0	4	6	2		Missense_Mutation	SNP	ENST00000403245.3	37	CCDS34494.2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111524	0.77210	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.13538	2.58;2.58	5.26	4.38	0.52667	.	0.088446	0.49305	D	0.000147	T	0.20495	0.0493	M	0.78637	2.42	0.34708	D	0.72746	D;D	0.69078	0.994;0.997	P;P	0.60682	0.83;0.878	T	0.06180	-1.0841	10	0.40728	T	0.16	-2.3175	11.4271	0.50018	0.1804:0.8196:0.0:0.0	.	235;235	Q5TB80;C9JFM9	QN1_HUMAN;.	S	159;235	ENSP00000257766:G159S;ENSP00000385215:G235S	ENSP00000257766:G159S	G	-	1	0	KIAA1009	84968189	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	1.971000	0.40530	1.304000	0.44892	0.563000	0.77884	GGC	.		0.264	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
PM20D2	135293	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	89859124	89859124	+	Silent	SNP	T	T	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr6:89859124T>A	ENST00000275072.4	+	2	701	c.606T>A	c.(604-606)gcT>gcA	p.A202A		NM_001010853.1	NP_001010853.1	Q8IYS1	P20D2_HUMAN	peptidase M20 domain containing 2	202						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|skin(1)	12		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)		CAGATATGGCTGAACATGAGT	0.373																																					p.A202A		.											.	PM20D2-68	0			c.T606A						.						135.0	136.0	135.0					6																	89859124		2203	4300	6503	SO:0001819	synonymous_variant	135293	exon2			TATGGCTGAACAT	BC035036	CCDS34499.1	6q15	2014-07-14	2007-11-14	2007-11-14	ENSG00000146281	ENSG00000146281			21408	protein-coding gene	gene with protein product	"""&#946;-alanyl-lysine dipeptidase"""	615913	"""aminoacylase 1-like 2"""	ACY1L2		24891507	Standard	NM_001010853		Approved	bA63L7.3	uc003pmz.4	Q8IYS1	OTTHUMG00000015193	ENST00000275072.4:c.606T>A	6.37:g.89859124T>A		Somatic	98	0		WXS	Illumina HiSeq	Phase_I	79	6	NM_001010853	0	0	0	0	0	B4DYJ2|Q5T7J9|Q6MZV2|Q86XD9	Silent	SNP	ENST00000275072.4	37	CCDS34499.1																																																																																			.		0.373	PM20D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041477.1	NM_001010853	
HDDC2	51020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	125619919	125619919	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr6:125619919C>T	ENST00000398153.2	-	3	292	c.250G>A	c.(250-252)Gtt>Att	p.V84I	HDDC2_ENST00000368377.4_Intron|HDDC2_ENST00000608295.1_Missense_Mutation_p.V84I|HDDC2_ENST00000608284.1_Missense_Mutation_p.V84I	NM_016063.2	NP_057147.2	Q7Z4H3	HDDC2_HUMAN	HD domain containing 2	84	HD.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(4)	6			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0186)		ATGTCCCCAACGATGCATTCT	0.413																																					p.V84I		.											.	HDDC2-90	0			c.G250A						.						190.0	168.0	175.0					6																	125619919		1925	4164	6089	SO:0001583	missense	51020	exon3			CCCCAACGATGCA	AF151888	CCDS43503.1	6q13-q24.3	2008-02-05	2005-08-22	2005-08-22	ENSG00000111906	ENSG00000111906			21078	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 74"""	C6orf74		10810093	Standard	NM_016063		Approved	CGI-130, dJ167O5.2	uc003qaa.1	Q7Z4H3	OTTHUMG00000015506	ENST00000398153.2:c.250G>A	6.37:g.125619919C>T	ENSP00000381220:p.Val84Ile	Somatic	179	0		WXS	Illumina HiSeq	Phase_I	185	85	NM_016063	0	0	44	51	7	Q5TDQ4|Q6NZ49|Q9BTT2|Q9BV31|Q9Y3D1	Missense_Mutation	SNP	ENST00000398153.2	37	CCDS43503.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039411	0.93630	.	.	ENSG00000111906	ENST00000398153	T	0.43688	0.94	5.62	4.76	0.60689	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.000000	0.64402	U	0.000001	T	0.35770	0.0943	L	0.48877	1.53	0.80722	D	1	D	0.60575	0.988	P	0.51895	0.683	T	0.28004	-1.0057	10	0.59425	D	0.04	.	13.6517	0.62314	0.0:0.9242:0.0:0.0758	.	84	Q7Z4H3	HDDC2_HUMAN	I	84	ENSP00000381220:V84I	ENSP00000381220:V84I	V	-	1	0	HDDC2	125661618	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.426000	0.80270	1.527000	0.49086	0.655000	0.94253	GTT	.		0.413	HDDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472493.1	NM_016063	
SNX10	29887	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	26404687	26404687	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr7:26404687C>G	ENST00000338523.4	+	5	420	c.233C>G	c.(232-234)tCt>tGt	p.S78C	SNX10_ENST00000446848.2_Missense_Mutation_p.S104C|SNX10_ENST00000409838.1_5'UTR|SNX10_ENST00000396376.1_Missense_Mutation_p.S78C|SNX10_ENST00000409367.1_Missense_Mutation_p.S38C	NM_001199835.1|NM_013322.2	NP_001186764.1|NP_037454.2	Q9Y5X0	SNX10_HUMAN	sorting nexin 10	78	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.|Required for the interaction with ATP6V1D.				cilium assembly (GO:0042384)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|osteoclast differentiation (GO:0030316)|protein localization to centrosome (GO:0071539)|protein localization to cilium (GO:0061512)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extrinsic component of endosome membrane (GO:0031313)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|ATPase binding (GO:0051117)			endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	6						GAACTTCCATCTAAAAACCTG	0.408											OREG0017908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S78C		.											.	SNX10-226	0			c.C233G						.						58.0	61.0	60.0					7																	26404687		2203	4300	6503	SO:0001583	missense	29887	exon5			TTCCATCTAAAAA	AF121860	CCDS5399.1, CCDS56470.1	7p15.2	2008-05-22			ENSG00000086300	ENSG00000086300		"""Sorting nexins"""	14974	protein-coding gene	gene with protein product		614780				17012226	Standard	NM_013322		Approved		uc010kuu.3	Q9Y5X0	OTTHUMG00000023650	ENST00000338523.4:c.233C>G	7.37:g.26404687C>G	ENSP00000343709:p.Ser78Cys	Somatic	81	0	786	WXS	Illumina HiSeq	Phase_I	109	6	NM_001199835	0	0	33	34	1	E9PFH5|Q8IYT5	Missense_Mutation	SNP	ENST00000338523.4	37	CCDS5399.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333040	0.81801	.	.	ENSG00000086300	ENST00000416246;ENST00000338523;ENST00000446848;ENST00000396376;ENST00000409367	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	6.17	6.17	0.99709	Phox homologous domain (5);	0.052852	0.85682	D	0.000000	T	0.61540	0.2355	M	0.68952	2.095	0.47659	D	0.999481	D;D	0.76494	0.999;0.999	D;D	0.70487	0.969;0.917	T	0.57711	-0.7764	10	0.56958	D	0.05	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	104;78	B4DJM0;Q9Y5X0	.;SNX10_HUMAN	C	104;78;104;78;38	ENSP00000408164:S104C;ENSP00000343709:S78C;ENSP00000395474:S104C;ENSP00000379661:S78C;ENSP00000387274:S38C	ENSP00000343709:S78C	S	+	2	0	SNX10	26371212	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	6.525000	0.73795	2.941000	0.99782	0.655000	0.94253	TCT	.		0.408	SNX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214120.1		
CCDC129	223075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	31609394	31609394	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr7:31609394G>T	ENST00000407970.3	+	5	317	c.279G>T	c.(277-279)atG>atT	p.M93I	CCDC129_ENST00000409210.1_Start_Codon_SNP_p.M1I|CCDC129_ENST00000319386.3_Missense_Mutation_p.M93I|CCDC129_ENST00000451887.2_Missense_Mutation_p.M119I|CCDC129_ENST00000482748.1_3'UTR	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	93										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AACAAGGGATGGTTCAAATGA	0.373																																					p.M119I		.											.	.	0			c.G357T						.						119.0	101.0	107.0					7																	31609394		2203	4300	6503	SO:0001583	missense	223075	exon5			AGGGATGGTTCAA	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.279G>T	7.37:g.31609394G>T	ENSP00000384416:p.Met93Ile	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	147	24	NM_001257968	0	0	0	0	0	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	37	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116871	0.37339	.	.	ENSG00000180347	ENST00000409717;ENST00000456011;ENST00000319386;ENST00000407970;ENST00000454513;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T;T;T;T	0.39997	1.05;1.07;2.39;2.66;1.06;2.63;2.3	5.49	0.437	0.16555	.	0.576671	0.16859	N	0.196589	T	0.20373	0.0490	N	0.21448	0.665	0.20563	N	0.999888	B;B;B;B	0.20887	0.049;0.049;0.049;0.049	B;B;B;B	0.17433	0.008;0.018;0.018;0.018	T	0.18777	-1.0326	10	0.12766	T	0.61	-0.3883	3.0709	0.06230	0.1436:0.2578:0.4642:0.1344	.	119;103;93;93	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	I	93;93;93;93;93;119;103;1	ENSP00000387220:M93I;ENSP00000390544:M93I;ENSP00000313062:M93I;ENSP00000384416:M93I;ENSP00000413233:M93I;ENSP00000395835:M119I;ENSP00000387214:M1I	ENSP00000313062:M93I	M	+	3	0	CCDC129	31575919	0.999000	0.42202	0.971000	0.41717	0.937000	0.57800	0.316000	0.19469	-0.088000	0.12506	0.655000	0.94253	ATG	.		0.373	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
CFTR	1080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	117267708	117267708	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr7:117267708G>T	ENST00000003084.6	+	22	3733	c.3601G>T	c.(3601-3603)Gat>Tat	p.D1201Y	CFTR_ENST00000454343.1_Missense_Mutation_p.D1140Y|AC000111.6_ENST00000456270.1_RNA	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1201					cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	CGTGAAGAAAGATGACATCTG	0.413									Cystic Fibrosis																												p.D1201Y		.											.	CFTR-518	0			c.G3601T						.						86.0	78.0	81.0					7																	117267708		2203	4300	6503	SO:0001583	missense	1080	exon22	Familial Cancer Database	CF	AAGAAAGATGACA	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.3601G>T	7.37:g.117267708G>T	ENSP00000003084:p.Asp1201Tyr	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	103	24	NM_000492	0	0	0	0	0	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.99|13.99	2.402264|2.402264	0.42613|0.42613	.|.	.|.	ENSG00000001626|ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809|ENST00000468795	D;D;D|D	0.93366|0.93366	-3.15;-2.96;-3.21|-3.21	5.86|5.86	2.07|2.07	0.26955|0.26955	.|.	0.549977|.	0.20348|.	N|.	0.094112|.	D|D	0.91140|0.91140	0.7210|0.7210	L|L	0.45581|0.45581	1.43|1.43	0.34472|0.34472	D|D	0.702874|0.702874	P|.	0.47409|.	0.895|.	B|.	0.43536|.	0.423|.	D|D	0.89511|0.89511	0.3771|0.3771	10|7	0.72032|0.66056	D|D	0.01|0.02	-3.7623|-3.7623	5.6055|5.6055	0.17377|0.17377	0.261:0.0:0.6124:0.1266|0.261:0.0:0.6124:0.1266	.|.	1201|.	P13569|.	CFTR_HUMAN|.	Y|N	1201;1140;1171|142	ENSP00000003084:D1201Y;ENSP00000403677:D1140Y;ENSP00000389119:D1171Y|ENSP00000419254:K142N	ENSP00000003084:D1201Y|ENSP00000419254:K142N	D|K	+|+	1|3	0|2	CFTR|CFTR	117054944|117054944	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.591000|0.591000	0.36615|0.36615	2.668000|2.668000	0.46816|0.46816	0.177000|0.177000	0.19895|0.19895	-0.142000|-0.142000	0.14014|0.14014	GAT|AAG	.		0.413	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
RNF133	168433	broad.mit.edu	37	7	122338189	122338189	+	Missense_Mutation	SNP	G	G	A	rs137950690		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr7:122338189G>A	ENST00000340112.2	-	1	1021	c.784C>T	c.(784-786)Cgc>Tgc	p.R262C	CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000449022.2_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	262					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						GGCTTATAGCGTTCAAAGCAA	0.403																																					p.R262C	Colon(198;1778 2057 7449 19869 45985)												.	RNF133-227	0			c.C784T						.	G	,,,CYS/ARG	0,4406		0,0,2203	159.0	148.0	152.0		,,,784	2.6	0.3	7	dbSNP_134	152	2,8598	2.2+/-6.3	0,2,4298	no	intron,intron,intron,missense	CADPS2,RNF133	NM_001009571.3,NM_001167940.1,NM_017954.10,NM_139175.1	,,,180	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,,benign	,,,262/377	122338189	2,13004	2203	4300	6503	SO:0001583	missense	168433	exon1			TATAGCGTTCAAA	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.784C>T	7.37:g.122338189G>A	ENSP00000344489:p.Arg262Cys	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	191	7	NM_139175	0	0	0	0	0	A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	37	CCDS5784.1	.	.	.	.	.	.	.	.	.	.	G	0.871	-0.731875	0.03135	0.0	2.33E-4	ENSG00000188050	ENST00000340112	T	0.43294	0.95	5.53	2.62	0.31277	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.713262	0.12945	U	0.426283	T	0.26011	0.0634	N	0.21282	0.65	0.09310	N	0.999999	B	0.23891	0.093	B	0.20767	0.031	T	0.20306	-1.0279	10	0.62326	D	0.03	.	4.5179	0.11945	0.091:0.4253:0.36:0.1236	.	262	Q8WVZ7	RN133_HUMAN	C	262	ENSP00000344489:R262C	ENSP00000344489:R262C	R	-	1	0	RNF133	122125425	0.051000	0.20477	0.293000	0.24932	0.004000	0.04260	0.822000	0.27352	0.672000	0.31204	-0.424000	0.05967	CGC	G|1.000;A|0.000		0.403	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175	
CCNE2	9134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	95906316	95906316	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr8:95906316G>A	ENST00000520509.1	-	3	298	c.46C>T	c.(46-48)Ccc>Tcc	p.P16S	NDUFAF6_ENST00000396113.1_5'Flank|CCNE2_ENST00000523476.1_5'Flank|CCNE2_ENST00000308108.4_Missense_Mutation_p.P16S|CCNE2_ENST00000396133.3_Missense_Mutation_p.P16S			O96020	CCNE2_HUMAN	cyclin E2	16					cell cycle checkpoint (GO:0000075)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|prostate(1)	11	Breast(36;8.75e-07)					GTCTGGCTGGGCTGGGGCTGC	0.443																																					p.P16S		.											.	CCNE2-414	0			c.C46T						.						141.0	161.0	154.0					8																	95906316		2203	4300	6503	SO:0001583	missense	9134	exon3			GGCTGGGCTGGGG	AF091433	CCDS6264.1	8q22.1	2005-10-18			ENSG00000175305	ENSG00000175305			1590	protein-coding gene	gene with protein product		603775				9840927, 9840943	Standard	NM_057749		Approved	CYCE2	uc003yhc.3	O96020	OTTHUMG00000164696	ENST00000520509.1:c.46C>T	8.37:g.95906316G>A	ENSP00000429089:p.Pro16Ser	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	89	19	NM_057749	0	0	2	2	0	O95439	Missense_Mutation	SNP	ENST00000520509.1	37	CCDS6264.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072843	0.36566	.	.	ENSG00000175305	ENST00000520509;ENST00000308108;ENST00000396133	T;T;T	0.30981	1.94;1.94;1.51	5.29	2.11	0.27256	.	0.268590	0.33980	N	0.004370	T	0.24470	0.0593	L	0.50333	1.59	0.30643	N	0.7563	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.24977	-1.0145	10	0.13853	T	0.58	.	11.6218	0.51121	0.0:0.1897:0.6789:0.1315	.	16;16	Q8WUE3;O96020	.;CCNE2_HUMAN	S	16	ENSP00000429089:P16S;ENSP00000309181:P16S;ENSP00000379437:P16S	ENSP00000309181:P16S	P	-	1	0	CCNE2	95975492	0.949000	0.32298	1.000000	0.80357	0.956000	0.61745	0.420000	0.21263	0.601000	0.29879	0.561000	0.74099	CCC	.		0.443	CCNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379808.1	NM_057749, NM_004702	
PARP10	84875	broad.mit.edu;bcgsc.ca	37	8	145059064	145059064	+	Missense_Mutation	SNP	C	C	G			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr8:145059064C>G	ENST00000313028.7	-	5	1200	c.1106G>C	c.(1105-1107)gGg>gCg	p.G369A	PARP10_ENST00000524918.1_Missense_Mutation_p.G369A|PARP10_ENST00000525773.1_Missense_Mutation_p.G381A|PARP10_ENST00000533665.1_5'Flank	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	369					negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TTCCTGCAACCCCACAGGCCT	0.647																																					p.G369A													.	PARP10-526	0			c.G1106C						.						73.0	81.0	78.0					8																	145059064		2203	4300	6503	SO:0001583	missense	84875	exon5			TGCAACCCCACAG	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.1106G>C	8.37:g.145059064C>G	ENSP00000325618:p.Gly369Ala	Somatic	70	1		WXS	Illumina HiSeq	Phase_I	102	20	NM_032789	0	0	29	39	10	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	37	CCDS34960.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627392	0.28978	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773;ENST00000313059	T;T;T;T	0.75938	2.51;2.48;2.47;-0.98	3.68	-1.16	0.09678	.	1.065050	0.07452	U	0.899186	T	0.57301	0.2044	L	0.39898	1.24	0.09310	N	1	P;P;P	0.52842	0.884;0.956;0.884	B;B;B	0.38985	0.14;0.287;0.14	T	0.48514	-0.9029	10	0.08837	T	0.75	.	7.4919	0.27466	0.0:0.4833:0.0:0.5167	.	381;369;369	E9PNI7;E9PK67;Q53GL7	.;.;PAR10_HUMAN	A	369;75;369;381;284	ENSP00000431620:G369A;ENSP00000325618:G369A;ENSP00000434776:G381A;ENSP00000314320:G284A	ENSP00000325618:G369A	G	-	2	0	PARP10	145131052	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-0.791000	0.04599	-0.164000	0.10927	-0.269000	0.10298	GGG	.		0.647	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789	
ALAD	210	broad.mit.edu;bcgsc.ca	37	9	116153879	116153879	+	Silent	SNP	C	C	T			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr9:116153879C>T	ENST00000409155.3	-	4	385	c.189G>A	c.(187-189)gaG>gaA	p.E63E	ALAD_ENST00000482001.1_5'UTR|ALAD_ENST00000277315.5_Silent_p.E46E	NM_000031.5	NP_000022.3	P13716	HEM2_HUMAN	aminolevulinate dehydratase	63					cellular response to interleukin-4 (GO:0071353)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protein homooligomerization (GO:0051260)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|identical protein binding (GO:0042802)|lead ion binding (GO:0032791)|porphobilinogen synthase activity (GO:0004655)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|stomach(1)	9					Aminolevulinic acid(DB00855)	GCCTCAGCATCTCTTCCAGCC	0.577																																					p.E63E													.	ALAD-90	0			c.G189A						.						82.0	75.0	77.0					9																	116153879		2203	4300	6503	SO:0001819	synonymous_variant	210	exon4			CAGCATCTCTTCC	M13928	CCDS6794.2	9q32	2010-04-29	2010-04-29		ENSG00000148218	ENSG00000148218	4.2.1.24		395	protein-coding gene	gene with protein product	"""porphobilinogen synthase"""	125270	"""aminolevulinate, delta-, dehydratase"""			6839527, 6378062	Standard	NM_000031		Approved	ALADH, PBGS	uc011lxf.2	P13716	OTTHUMG00000020522	ENST00000409155.3:c.189G>A	9.37:g.116153879C>T		Somatic	189	0		WXS	Illumina HiSeq	Phase_I	116	5	NM_000031	0	0	4	4	0	A8K375|B2R6F2|Q16870|Q16871|Q9BVQ9	Silent	SNP	ENST00000409155.3	37	CCDS6794.2																																																																																			.		0.577	ALAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053724.3	NM_001003945	
PHF19	26147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	123620475	123620475	+	Missense_Mutation	SNP	C	C	T	rs144405933		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr9:123620475C>T	ENST00000373896.3	-	15	1742	c.1490G>A	c.(1489-1491)cGc>cAc	p.R497H	PHF19_ENST00000419155.1_Missense_Mutation_p.R288H|PHF19_ENST00000487555.1_5'UTR	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19	497					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CGAGGGGCAGCGTCCATCCAG	0.597																																					p.R497H		.											.	PHF19-136	0			c.G1490A						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	79.0	71.0	74.0		1490	3.0	0.6	9	dbSNP_134	74	0,8600		0,0,4300	no	missense	PHF19	NM_015651.1	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	497/581	123620475	1,13005	2203	4300	6503	SO:0001583	missense	26147	exon15			GGGCAGCGTCCAT	BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.1490G>A	9.37:g.123620475C>T	ENSP00000363003:p.Arg497His	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	45	21	NM_015651	0	0	1	5	4	Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Missense_Mutation	SNP	ENST00000373896.3	37	CCDS35116.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059942	0.76074	2.27E-4	0.0	ENSG00000119403	ENST00000544082;ENST00000373896;ENST00000419155	T;T	0.49432	1.79;0.78	4.97	3.03	0.35002	.	0.659654	0.15009	N	0.285669	T	0.39627	0.1085	N	0.24115	0.695	0.36632	D	0.876372	D	0.67145	0.996	P	0.49502	0.613	T	0.36841	-0.9731	10	0.45353	T	0.12	-8.0699	9.2722	0.37679	0.0:0.8127:0.0:0.1873	.	497	Q5T6S3	PHF19_HUMAN	H	497;497;288	ENSP00000363003:R497H;ENSP00000407433:R288H	ENSP00000363003:R497H	R	-	2	0	PHF19	122660296	0.728000	0.28080	0.574000	0.28523	0.897000	0.52465	0.193000	0.17116	0.449000	0.26747	-0.367000	0.07326	CGC	C|1.000;T|0.000		0.597	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053838.3	XM_045308	
SEPT6	23157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	118797595	118797595	+	Missense_Mutation	SNP	T	T	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chrX:118797595T>A	ENST00000343984.5	-	3	455	c.191A>T	c.(190-192)aAc>aTc	p.N64I	SEPT6_ENST00000360156.7_Missense_Mutation_p.N64I|SEPT6_ENST00000394610.1_Missense_Mutation_p.N64I|SEPT6_ENST00000394616.4_Missense_Mutation_p.N6I|SEPT6_ENST00000354228.4_Missense_Mutation_p.N64I|SEPT6_ENST00000394617.2_Missense_Mutation_p.N94I|SEPT6_ENST00000489216.1_Missense_Mutation_p.N64I|SEPT6_ENST00000354416.3_Missense_Mutation_p.N64I	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6	64	Septin-type G.				cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						GAATTTGGTGTTGAACAGGGT	0.502			T	MLL	AML																																p.N64I		.		Dom	yes		X	Xq24	23157	septin 6		L	.	SEPT6-969	0			c.A191T						.						213.0	198.0	203.0					X																	118797595		2203	4300	6503	SO:0001583	missense	23157	exon3			TTGGTGTTGAACA	D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.191A>T	X.37:g.118797595T>A	ENSP00000341524:p.Asn64Ile	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	87	9	NM_145802	0	0	2	4	2	Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	Missense_Mutation	SNP	ENST00000343984.5	37	CCDS14584.1	.	.	.	.	.	.	.	.	.	.	t	21.9	4.214865	0.79352	.	.	ENSG00000125354	ENST00000360156;ENST00000354228;ENST00000489216;ENST00000354416;ENST00000394610;ENST00000343984;ENST00000394616;ENST00000394617;ENST00000520510	T;T;T;T;T;T;D;T	0.81739	1.28;1.28;1.28;1.28;1.28;1.28;-1.53;1.28	4.47	4.47	0.54385	.	0.081767	0.85682	D	0.000000	D	0.91415	0.7291	H	0.94925	3.6	0.80722	D	1	D;P;D;D	0.60575	0.973;0.922;0.961;0.988	P;P;P;D	0.67548	0.894;0.908;0.864;0.952	D	0.93282	0.6661	10	0.72032	D	0.01	.	12.648	0.56746	0.0:0.0:0.0:1.0	.	94;6;64;64	F5H1J5;B4E049;Q14141;Q548C9	.;.;SEPT6_HUMAN;.	I	64;64;64;64;64;64;6;94;64	ENSP00000353278:N64I;ENSP00000346169:N64I;ENSP00000418715:N64I;ENSP00000346397:N64I;ENSP00000378108:N64I;ENSP00000341524:N64I;ENSP00000378114:N6I;ENSP00000378115:N94I	ENSP00000341524:N64I	N	-	2	0	SEPT6	118681623	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.649000	0.83500	1.736000	0.51660	0.483000	0.47432	AAC	.		0.502	SEPT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058059.1	NM_145802	
FATE1	89885	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	150889896	150889896	+	Silent	SNP	G	G	A			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chrX:150889896G>A	ENST00000370350.3	+	3	349	c.264G>A	c.(262-264)ctG>ctA	p.L88L		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	88						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGAATGCTGAGAGAATCAG	0.542																																					p.L88L													.	FATE1-131	0			c.G264A						.						94.0	79.0	84.0					X																	150889896		2203	4300	6503	SO:0001819	synonymous_variant	89885	exon3			AATGCTGAGAGAA	AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.264G>A	X.37:g.150889896G>A		Somatic	391	1		WXS	Illumina HiSeq	Phase_I	270	39	NM_033085	0	0	0	0	0		Silent	SNP	ENST00000370350.3	37	CCDS14700.1																																																																																			.		0.542	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060885.1	NM_033085	
DPYS	1807	broad.mit.edu	37	8	105478888	105478888	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr8:105478888delG	ENST00000351513.2	-	1	393	c.261delC	c.(259-261)accfs	p.T87fs		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	87					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			cgggTACCTTGGTGCCCTGGT	0.736																																					p.T87fs													.	DPYS-229	0			c.261delC						.						16.0	9.0	11.0					8																	105478888		1505	2849	4354	SO:0001589	frameshift_variant	1807	exon1			TACCTTGGTGCCC	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.261delC	8.37:g.105478888delG	ENSP00000276651:p.Thr87fs	Somatic	4	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_001385	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000351513.2	37	CCDS6302.1																																																																																			.		0.736	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385	
IFT74	80173	hgsc.bcm.edu;bcgsc.ca	37	9	26962063	26962075	+	Frame_Shift_Del	DEL	GAAATATTCGAGT	GAAATATTCGAGT	-	rs200556379|rs542289534		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	GAAATATTCGAGT	GAAATATTCGAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr9:26962063_26962075delGAAATATTCGAGT	ENST00000443698.1	+	2	269_281	c.98_110delGAAATATTCGAGT	c.(97-111)ggaaatattcgagtgfs	p.GNIRV33fs	IFT74_ENST00000433700.1_Frame_Shift_Del_p.GNIRV33fs|IFT74_ENST00000429045.2_Frame_Shift_Del_p.GNIRV33fs|IFT74_ENST00000380062.5_Frame_Shift_Del_p.GNIRV33fs	NM_001099222.1	NP_001092692.1	Q96LB3	IFT74_HUMAN	intraflagellar transport 74	33	Basic region.				cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|keratinocyte development (GO:0003334)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|nucleus (GO:0005634)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)			endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	6		all_neural(11;2.36e-10)		Lung(218;1.4e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		CCCCTATCAGGAAATATTCGAGTGGCAACTGCA	0.493																																					p.33_37del		.											.	IFT74-515	0			c.98_110del						.																																			SO:0001589	frameshift_variant	80173	exon2			.	AK023707	CCDS43793.1, CCDS47955.1	9p21.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000096872	ENSG00000096872		"""Intraflagellar transport homologs"""	21424	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 1"""	608040	"""coiled-coil domain containing 2"", ""intraflagellar transport 74 homolog (Chlamydomonas)"""	CCDC2		11683410	Standard	NM_001099223		Approved	CMG1, CMG-1, FLJ22621	uc003zqg.4	Q96LB3	OTTHUMG00000021028	ENST00000443698.1:c.98_110delGAAATATTCGAGT	9.37:g.26962063_26962075delGAAATATTCGAGT	ENSP00000404122:p.Gly33fs	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	27	10	NM_001099222	0	0	0	0	0	Q3B789|Q5VY34|Q6PGQ8|Q9H643|Q9H8G7	Frame_Shift_Del	DEL	ENST00000443698.1	37	CCDS43793.1																																																																																			.		0.493	IFT74-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055476.2	NM_025103	
CLCC1	23155	broad.mit.edu	37	1	109477463	109477464	+	Frame_Shift_Ins	INS	-	-	T	rs371820348		TCGA-IA-A40Y-01A-11D-A25F-10	TCGA-IA-A40Y-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ad9455e9-7147-489e-9b1f-3540c457c260	aab4115c-fdfe-45ae-9a51-91ee50250623	g.chr1:109477463_109477464insT	ENST00000369971.2	-	11	1613_1614	c.1484_1485insA	c.(1483-1485)aagfs	p.K495fs	CLCC1_ENST00000302500.4_Frame_Shift_Ins_p.K374fs|CLCC1_ENST00000356970.2_Frame_Shift_Ins_p.K495fs|CLCC1_ENST00000415331.1_Frame_Shift_Ins_p.K445fs|CLCC1_ENST00000369976.1_Intron|CLCC1_ENST00000482889.1_Intron|CLCC1_ENST00000369968.2_Frame_Shift_Ins_p.K310fs|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000348264.2_Frame_Shift_Ins_p.K310fs|CLCC1_ENST00000369970.3_Frame_Shift_Ins_p.K445fs|CLCC1_ENST00000369969.2_Frame_Shift_Ins_p.K374fs	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	495						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		CAGAGACAGGCTTGGCCGACTG	0.55																																					p.K495fs													.	CLCC1-91	0			c.1485_1486insA						.																																			SO:0001589	frameshift_variant	23155	exon11			GACAGGCTTGGCC	AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.1485dupA	1.37:g.109477465_109477465dupT	ENSP00000358988:p.Lys495fs	Somatic	311	0		WXS	Illumina HiSeq	Phase_I	212	11	NM_001048210	0	0	0	0	0	O94861|Q8WYP8|Q8WYP9|Q9BU25	Frame_Shift_Ins	INS	ENST00000369971.2	37	CCDS41362.1																																																																																			.		0.550	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032405.1	NM_015127	
