#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RSC1A1	6248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	15987648	15987648	+	Silent	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:15987648T>C	ENST00000345034.1	+	1	1285	c.1285T>C	c.(1285-1287)Tta>Cta	p.L429L	DDI2_ENST00000480945.1_3'UTR	NM_006511.1	NP_006502.1	Q92681	RSCA1_HUMAN	regulatory solute carrier protein, family 1, member 1	429					intestinal absorption (GO:0050892)|negative regulation of transport (GO:0051051)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	brush border (GO:0005903)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel inhibitor activity (GO:0008200)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)	11		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GACAGAAAAATTAACAGGTAC	0.433																																					p.L429L		.											.	RSC1A1-91	0			c.T1285C						.						51.0	51.0	51.0					1																	15987648		2203	4300	6503	SO:0001819	synonymous_variant	6248	exon1			GAAAAATTAACAG	BN000122, X82877	CCDS161.1	1p36.1	1998-08-25			ENSG00000215695	ENSG00000215695			10458	protein-coding gene	gene with protein product		601966					Standard	NM_006511		Approved	RS1	uc010obn.2	Q92681	OTTHUMG00000067830	ENST00000345034.1:c.1285T>C	1.37:g.15987648T>C		Somatic	87	1		WXS	Illumina HiSeq	Phase_I	74	34	NM_006511	0	0	1	3	2	B2RBP5	Silent	SNP	ENST00000345034.1	37	CCDS161.1																																																																																			.		0.433	RSC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145500.1	NM_006511	
PGM1	5236	hgsc.bcm.edu;broad.mit.edu	37	1	64117371	64117371	+	Missense_Mutation	SNP	G	G	A	rs201303497		TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:64117371G>A	ENST00000371084.3	+	9	1525	c.1312G>A	c.(1312-1314)Gca>Aca	p.A438T	PGM1_ENST00000371083.4_Missense_Mutation_p.A456T|PGM1_ENST00000483707.1_3'UTR|PGM1_ENST00000540265.1_Missense_Mutation_p.A241T	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1	438					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						AGCTGAGGGCGCAAACAAAAT	0.512													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17958	0.0		0.0	False		,,,				2504	0.0				p.A456T		.											.	PGM1-228	0			c.G1366A						.						136.0	130.0	132.0					1																	64117371		2203	4300	6503	SO:0001583	missense	5236	exon9			GAGGGCGCAAACA	BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.1312G>A	1.37:g.64117371G>A	ENSP00000360125:p.Ala438Thr	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	42	3	NM_001172818	0	0	139	139	0	B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	Missense_Mutation	SNP	ENST00000371084.3	37	CCDS625.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	27.4	4.830886	0.91036	.	.	ENSG00000079739	ENST00000538673;ENST00000371084;ENST00000540265;ENST00000371083	T;T;T	0.49139	0.79;0.79;0.79	5.69	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.64768	0.2628	M	0.92555	3.32	0.47037	D	0.999295	D;P	0.76494	0.999;0.94	P;B	0.57776	0.827;0.306	T	0.75422	-0.3323	10	0.56958	D	0.05	-42.0023	15.1823	0.72968	0.0679:0.0:0.9321:0.0	.	456;438	P36871-2;P36871	.;PGM1_HUMAN	T	414;438;241;456	ENSP00000360125:A438T;ENSP00000443449:A241T;ENSP00000360124:A456T	ENSP00000360124:A456T	A	+	1	0	PGM1	63889959	1.000000	0.71417	0.265000	0.24526	0.910000	0.53928	9.813000	0.99286	1.540000	0.49301	0.655000	0.94253	GCA	G|0.999;A|0.000		0.512	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024868.1	NM_002633	
AMY1A	276	hgsc.bcm.edu	37	1	104203011	104203011	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:104203011C>T	ENST00000370083.4	+	7	1128	c.908C>T	c.(907-909)cCt>cTt	p.P303L		NM_001008221.1|NM_004038.3	NP_001008222.1|NP_004029.2	P04745	AMY1_HUMAN	amylase, alpha 1A (salivary)	303					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)						all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		GGTTTCATGCCTTCTGACAGA	0.423																																					p.P303L	Pancreas(131;743 2392 43382 44986)	.											.	.	0			c.C908T						.						13.0	14.0	13.0					1																	104203011		1525	3443	4968	SO:0001583	missense	276	exon7			TCATGCCTTCTGA		CCDS30782.1	1p21	2012-10-02	2007-05-03		ENSG00000237763	ENSG00000237763	3.2.1.1		474	protein-coding gene	gene with protein product		104700	"""amylase, alpha 1A; salivary"""	AMY1			Standard	XM_005270755		Approved		uc001duv.3	P04745	OTTHUMG00000011020	ENST00000370083.4:c.908C>T	1.37:g.104203011C>T	ENSP00000359100:p.Pro303Leu	Somatic	667	1		WXS	Illumina HiSeq	Phase_I	547	106	NM_001008221	0	0	0	0	0	A6NJS5|A8K8H6|Q13763|Q5T083	Missense_Mutation	SNP	ENST00000370083.4	37	CCDS30782.1	.	.	.	.	.	.	.	.	.	.	c	16.08	3.022827	0.54683	.	.	ENSG00000237763	ENST00000370083	D	0.98012	-4.66	2.38	2.38	0.29361	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.177118	0.51477	D	0.000100	D	0.97461	0.9169	.	.	.	0.80722	D	1	D	0.54772	0.968	P	0.56648	0.803	D	0.97391	0.9989	9	0.87932	D	0	.	12.3897	0.55352	0.0:1.0:0.0:0.0	.	303	P04745	AMY1_HUMAN	L	303	ENSP00000359100:P303L	ENSP00000359100:P303L	P	+	2	0	AMY1A	104004534	1.000000	0.71417	0.993000	0.49108	0.426000	0.31534	5.529000	0.67135	1.150000	0.42419	0.184000	0.17185	CCT	.		0.423	AMY1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030304.2	NM_001008221	
CELSR2	1952	hgsc.bcm.edu	37	1	109792762	109792762	+	Silent	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:109792762T>C	ENST00000271332.3	+	1	122	c.61T>C	c.(61-63)Ttg>Ctg	p.L21L		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	21					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		gctgctgctgttgctgctgct	0.746																																					p.L21L	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.T61C						.						9.0	11.0	11.0					1																	109792762		1973	3925	5898	SO:0001819	synonymous_variant	1952	exon1			CTGCTGTTGCTGC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.61T>C	1.37:g.109792762T>C		Somatic	49	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_001408	0	0	0	12	12	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																			.		0.746	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CAPZA1	829	hgsc.bcm.edu	37	1	113202331	113202331	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:113202331G>A	ENST00000263168.3	+	7	1187	c.515G>A	c.(514-516)cGt>cAt	p.R172H	CAPZA1_ENST00000476936.1_3'UTR	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1	172					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGAATGGTCGTTGGAGATCA	0.438																																					p.R172H		.											.	CAPZA1-514	0			c.G515A						.						95.0	88.0	91.0					1																	113202331		2203	4300	6503	SO:0001583	missense	829	exon7			ATGGTCGTTGGAG	U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.515G>A	1.37:g.113202331G>A	ENSP00000263168:p.Arg172His	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	37	3	NM_006135	0	0	0	0	0	Q53FQ6|Q6FHD5	Missense_Mutation	SNP	ENST00000263168.3	37	CCDS30805.1	.	.	.	.	.	.	.	.	.	.	G	36	5.611435	0.96637	.	.	ENSG00000116489	ENST00000263168	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.73908	0.3647	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.72600	-0.4244	9	0.48119	T	0.1	-28.1951	19.3394	0.94335	0.0:0.0:1.0:0.0	.	172	P52907	CAZA1_HUMAN	H	172	.	ENSP00000263168:R172H	R	+	2	0	CAPZA1	113003854	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.776000	0.99001	2.739000	0.93911	0.655000	0.94253	CGT	.		0.438	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032567.2	NM_006135	
KIAA1614	57710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	180885553	180885553	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:180885553C>T	ENST00000367588.4	+	2	369	c.314C>T	c.(313-315)tCt>tTt	p.S105F		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	105										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						AGTCCCTGCTCTGCTTCCCAA	0.587																																					p.S105F		.											.	KIAA1614-26	0			c.C314T						.						80.0	89.0	86.0					1																	180885553		2038	4181	6219	SO:0001583	missense	57710	exon2			CCTGCTCTGCTTC	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.314C>T	1.37:g.180885553C>T	ENSP00000356560:p.Ser105Phe	Somatic	162	0		WXS	Illumina HiSeq	Phase_I	108	44	NM_020950	0	0	1	3	2	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	C	9.289	1.050241	0.19827	.	.	ENSG00000135835	ENST00000367588	T	0.05580	3.42	4.87	1.69	0.24217	.	1.482150	0.04336	N	0.353230	T	0.03695	0.0105	N	0.08118	0	0.29690	N	0.841037	B	0.23735	0.09	B	0.20955	0.032	T	0.40905	-0.9538	9	0.37606	T	0.19	-0.5476	3.0596	0.06195	0.2088:0.5355:0.0:0.2557	.	105	Q5VZ46	K1614_HUMAN	F	105	ENSP00000356560:S105F	ENSP00000356560:S105F	S	+	2	0	KIAA1614	179152176	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.043000	0.13971	0.143000	0.18926	0.655000	0.94253	TCT	.		0.587	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
TRMT1L	81627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	185094118	185094118	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:185094118T>A	ENST00000367506.5	-	12	1985	c.1717A>T	c.(1717-1719)Agt>Tgt	p.S573C	TRMT1L_ENST00000367504.3_3'UTR	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	573	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.				adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						GAAAACTGACTTTGAGGCGTA	0.358																																					p.S573C		.											.	TRMT1L-92	0			c.A1717T						.						143.0	134.0	137.0					1																	185094118		2203	4300	6503	SO:0001583	missense	81627	exon12			ACTGACTTTGAGG	AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.1717A>T	1.37:g.185094118T>A	ENSP00000356476:p.Ser573Cys	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	112	42	NM_030934	0	0	12	17	5	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Missense_Mutation	SNP	ENST00000367506.5	37	CCDS1366.1	.	.	.	.	.	.	.	.	.	.	T	18.22	3.575763	0.65878	.	.	ENSG00000121486	ENST00000367506;ENST00000458395	.	.	.	4.79	4.79	0.61399	.	0.178960	0.64402	D	0.000016	T	0.44829	0.1312	N	0.08118	0	0.80722	D	1	D	0.56287	0.975	P	0.53689	0.732	T	0.49818	-0.8899	9	0.38643	T	0.18	-18.1595	14.6174	0.68558	0.0:0.0:0.0:1.0	.	573	Q7Z2T5	TRM1L_HUMAN	C	573;197	.	ENSP00000356476:S573C	S	-	1	0	TRMT1L	183360741	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.348000	0.73009	1.935000	0.56089	0.477000	0.44152	AGT	.		0.358	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085787.1	NM_030934	
ADCK3	56997	hgsc.bcm.edu	37	1	227169815	227169815	+	Missense_Mutation	SNP	C	C	T	rs368872986		TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:227169815C>T	ENST00000366779.1	+	11	3589	c.818C>T	c.(817-819)gCg>gTg	p.A273V	ADCK3_ENST00000478406.1_3'UTR|ADCK3_ENST00000366777.3_Missense_Mutation_p.A273V|ADCK3_ENST00000433743.2_5'UTR|ADCK3_ENST00000458507.2_5'UTR|ADCK3_ENST00000366778.1_Missense_Mutation_p.A221V			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	273					cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						GTGCGTGGTGCGGCACTCAAG	0.682																																					p.A273V		.											.	ADCK3-361	0			c.C818T						.	C	VAL/ALA	0,4400		0,0,2200	25.0	23.0	24.0		818	5.1	0.9	1		24	1,8591		0,1,4295	no	missense	ADCK3	NM_020247.4	64	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	273/648	227169815	1,12991	2200	4296	6496	SO:0001583	missense	56997	exon6			GTGGTGCGGCACT	AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.818C>T	1.37:g.227169815C>T	ENSP00000355741:p.Ala273Val	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	25	2	NM_020247	0	0	26	26	0	Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Missense_Mutation	SNP	ENST00000366779.1	37	CCDS1557.1	.	.	.	.	.	.	.	.	.	.	C	33	5.203948	0.95033	0.0	1.16E-4	ENSG00000163050	ENST00000366779;ENST00000366778;ENST00000366777;ENST00000366776;ENST00000366775;ENST00000405743	T;T;T;T;T	0.76316	-0.88;-0.86;-0.88;-1.01;-1.0	5.1	5.1	0.69264	.	0.052474	0.85682	D	0.000000	D	0.89480	0.6727	M	0.89968	3.075	0.80722	D	1	D	0.76494	0.999	P	0.62184	0.899	D	0.91390	0.5134	10	0.59425	D	0.04	-27.9144	18.4947	0.90861	0.0:1.0:0.0:0.0	.	273	Q8NI60	ADCK3_HUMAN	V	273;221;273;198;118;224	ENSP00000355741:A273V;ENSP00000355740:A221V;ENSP00000355739:A273V;ENSP00000355738:A198V;ENSP00000355737:A118V	ENSP00000355737:A118V	A	+	2	0	ADCK3	225236438	1.000000	0.71417	0.941000	0.38009	0.495000	0.33615	7.705000	0.84606	2.378000	0.81104	0.491000	0.48974	GCG	.		0.682	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091712.1	NM_020247	
OBSCN	84033	hgsc.bcm.edu	37	1	228539078	228539078	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:228539078A>G	ENST00000422127.1	+	78	18520	c.18476A>G	c.(18475-18477)gAg>gGg	p.E6159G	OBSCN_ENST00000570156.2_Missense_Mutation_p.E7116G|OBSCN_ENST00000366709.4_Missense_Mutation_p.E3278G|OBSCN_ENST00000284548.11_Missense_Mutation_p.E6159G|OBSCN_ENST00000366707.4_Missense_Mutation_p.E3793G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6159	Ig-like 53.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACACTGAGTGAGCCTCGCAGC	0.652																																					p.E7116G		.											.	OBSCN-403	0			c.A21347G						.						30.0	37.0	35.0					1																	228539078		2092	4188	6280	SO:0001583	missense	84033	exon89			TGAGTGAGCCTCG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18476A>G	1.37:g.228539078A>G	ENSP00000409493:p.Glu6159Gly	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	9	2	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.86|19.86	3.904910|3.904910	0.72868|0.72868	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709|ENST00000441106	T;T;T;T|.	0.69306|.	-0.39;-0.39;-0.39;-0.39|.	5.34|5.34	5.34|5.34	0.76211|0.76211	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.227351|.	0.34628|.	N|.	0.003818|.	T|.	0.59432|.	0.2193|.	L|L	0.39147|0.39147	1.195|1.195	0.53005|0.53005	D|D	0.999969|0.999969	D;D|.	0.56968|.	0.978;0.973|.	P;P|.	0.51974|.	0.686;0.559|.	T|.	0.56463|.	-0.7975|.	10|.	0.54805|.	T|.	0.06|.	.|.	15.305|15.305	0.73985|0.73985	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	6159;6159|.	Q5VST9;Q5VST9-3|.	OBSCN_HUMAN;.|.	G|W	6159;6159;3793;3278|775	ENSP00000284548:E6159G;ENSP00000409493:E6159G;ENSP00000355668:E3793G;ENSP00000355670:E3278G|.	ENSP00000284548:E6159G|.	E|X	+|+	2|3	0|0	OBSCN|OBSCN	226605701|226605701	1.000000|1.000000	0.71417|0.71417	0.912000|0.912000	0.35992|0.35992	0.006000|0.006000	0.05464|0.05464	8.760000|8.760000	0.91671|0.91671	2.040000|2.040000	0.60383|0.60383	0.402000|0.402000	0.26972|0.26972	GAG|TGA	.		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
GCSAML	148823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247737622	247737622	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:247737622T>C	ENST00000366488.4	+	5	450	c.346T>C	c.(346-348)Tct>Cct	p.S116P	GCSAML_ENST00000366491.2_Missense_Mutation_p.S96P|GCSAML_ENST00000366489.1_Missense_Mutation_p.S96P|GCSAML_ENST00000536561.1_Missense_Mutation_p.S96P|GCSAML_ENST00000527541.1_Missense_Mutation_p.S84P|RP11-978I15.10_ENST00000446347.1_RNA|GCSAML_ENST00000527084.1_Missense_Mutation_p.S84P|RP11-978I15.10_ENST00000435333.1_RNA|GCSAML_ENST00000463359.1_Missense_Mutation_p.S84P	NM_001281836.1|NM_001281837.1|NM_001281853.1|NM_145278.3	NP_001268765.1|NP_001268766.1|NP_001268782.1|NP_660321.1	Q5JQS6	GSAML_HUMAN	germinal center-associated, signaling and motility-like	116																	TCTTAGGACTTCTGTTAGTAG	0.433																																					p.S116P		.											.	.	0			c.T346C						.						154.0	129.0	137.0					1																	247737622		2203	4300	6503	SO:0001583	missense	148823	exon5			AGGACTTCTGTTA	AK126682	CCDS1635.1, CCDS60470.1, CCDS73058.1	1q44	2012-08-23	2012-08-23	2012-08-23	ENSG00000169224	ENSG00000169224			29583	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 150"""	C1orf150			Standard	NM_001281834		Approved	FLJ44728	uc001idf.3	Q5JQS6	OTTHUMG00000040648	ENST00000366488.4:c.346T>C	1.37:g.247737622T>C	ENSP00000355444:p.Ser116Pro	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	89	36	NM_145278	0	0	0	0	0	B2R4Y5|B3KX46|Q5JQT3	Missense_Mutation	SNP	ENST00000366488.4	37	CCDS1635.1	.	.	.	.	.	.	.	.	.	.	T	10.44	1.350166	0.24512	.	.	ENSG00000169224	ENST00000527084;ENST00000527541;ENST00000366491;ENST00000366489;ENST00000463359;ENST00000366488;ENST00000536561	.	.	.	3.91	2.73	0.32206	.	1.484660	0.04639	N	0.405118	T	0.28830	0.0715	L	0.34521	1.04	0.09310	N	1	P	0.47677	0.899	P	0.45099	0.469	T	0.12091	-1.0561	9	0.02654	T	1	-1.0246	7.2357	0.26067	0.0:0.0:0.2272:0.7728	.	116	Q5JQS6	CA150_HUMAN	P	84;84;96;96;84;116;96	.	ENSP00000355444:S116P	S	+	1	0	C1orf150	245804245	0.001000	0.12720	0.001000	0.08648	0.338000	0.28826	0.818000	0.27295	0.638000	0.30545	0.482000	0.46254	TCT	.		0.433	GCSAML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097745.4	NM_145278	
GTPBP4	23560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	1061760	1061760	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr10:1061760C>A	ENST00000360803.4	+	16	1758	c.1676C>A	c.(1675-1677)gCt>gAt	p.A559D	GTPBP4_ENST00000545048.1_Missense_Mutation_p.A512D|GTPBP4_ENST00000538293.1_Missense_Mutation_p.A443D	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	559					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		GAAGACTCTGCTCCCCCGTCC	0.552																																					p.A559D		.											.	GTPBP4-92	0			c.C1676A						.						137.0	124.0	128.0					10																	1061760		2203	4300	6503	SO:0001583	missense	23560	exon16			ACTCTGCTCCCCC	AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.1676C>A	10.37:g.1061760C>A	ENSP00000354040:p.Ala559Asp	Somatic	198	0		WXS	Illumina HiSeq	Phase_I	166	55	NM_012341	0	0	6	13	7	B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Missense_Mutation	SNP	ENST00000360803.4	37	CCDS31132.1	.	.	.	.	.	.	.	.	.	.	C	4.232	0.041906	0.08196	.	.	ENSG00000107937	ENST00000360803;ENST00000538293;ENST00000545048	T;T;T	0.32753	1.44;1.45;1.44	5.67	2.86	0.33363	.	0.344788	0.32868	N	0.005550	T	0.13628	0.0330	N	0.14661	0.345	0.34292	D	0.683401	B	0.10296	0.003	B	0.17098	0.017	T	0.20638	-1.0269	10	0.12103	T	0.63	-11.4058	4.131	0.10149	0.2318:0.1869:0.0:0.5813	.	559	Q9BZE4	NOG1_HUMAN	D	559;443;512	ENSP00000354040:A559D;ENSP00000444277:A443D;ENSP00000445473:A512D	ENSP00000354040:A559D	A	+	2	0	GTPBP4	1051760	0.537000	0.26386	0.749000	0.31150	0.005000	0.04900	0.845000	0.27668	0.256000	0.21614	-0.218000	0.12543	GCT	.		0.552	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046412.1	NM_012341	
KLF6	1316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	3822362	3822362	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr10:3822362C>T	ENST00000497571.1	-	3	996	c.736G>A	c.(736-738)Gag>Aag	p.E246K	KLF6_ENST00000173785.4_5'UTR|KLF6_ENST00000542957.1_Intron	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	246					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		CTGGTTAACTCATCACTTCTT	0.542																																					p.E246K		.											.	KLF6-1134	0			c.G736A						.						222.0	168.0	186.0					10																	3822362		2203	4300	6503	SO:0001583	missense	1316	exon3			TTAACTCATCACT	U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.736G>A	10.37:g.3822362C>T	ENSP00000419923:p.Glu246Lys	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	77	23	NM_001300	0	0	43	90	47	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Missense_Mutation	SNP	ENST00000497571.1	37	CCDS7060.1	.	.	.	.	.	.	.	.	.	.	C	36	5.975022	0.97162	.	.	ENSG00000067082	ENST00000497571	T	0.51071	0.72	5.67	5.67	0.87782	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.053414	0.85682	D	0.000000	T	0.56156	0.1966	N	0.17379	0.485	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.995;0.998	T	0.62234	-0.6897	10	0.87932	D	0	.	18.7705	0.91890	0.0:1.0:0.0:0.0	.	204;246	D3GC14;Q99612	.;KLF6_HUMAN	K	246	ENSP00000419923:E246K	ENSP00000419923:E246K	E	-	1	0	KLF6	3812362	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.702000	0.84576	2.677000	0.91161	0.561000	0.74099	GAG	.		0.542	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046495.1		
ATP5C1	509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	7829859	7829859	+	5'Flank	SNP	G	G	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr10:7829859G>C	ENST00000356708.7	+	0	0				ATP5C1_ENST00000541227.1_5'Flank|KIN_ENST00000379562.4_Missense_Mutation_p.A13G|KIN_ENST00000543003.1_5'UTR|KIN_ENST00000535925.1_Missense_Mutation_p.A13G|ATP5C1_ENST00000335698.4_5'Flank	NM_001001973.1	NP_001001973.1	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1						ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	16						GATCCTGTTGGCGATAGCCTT	0.612																																					p.A13G	Melanoma(143;1012 1820 16249 30920 33158)	.											.	KIN-230	0			c.C38G						.						108.0	107.0	108.0					10																	7829859		2203	4300	6503	SO:0001631	upstream_gene_variant	22944	exon1			CTGTTGGCGATAG	D16561	CCDS7081.1, CCDS31142.1	10p14	2012-10-12			ENSG00000165629	ENSG00000165629		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	833	protein-coding gene	gene with protein product		108729		ATP5CL1, ATP5C		8168843, 8227057	Standard	NM_005174		Approved		uc001iju.3	P36542	OTTHUMG00000017639		10.37:g.7829859G>C	Exception_encountered	Somatic	203	0		WXS	Illumina HiSeq	Phase_I	145	67	NM_012311	0	0	1	1	0	A8KA31|Q5VYP3|Q6I9V2|Q96AS8	Missense_Mutation	SNP	ENST00000356708.7	37	CCDS31142.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942900	0.73672	.	.	ENSG00000151657	ENST00000535925;ENST00000379562	.	.	.	5.97	5.97	0.96955	.	0.224004	0.45606	D	0.000341	T	0.48714	0.1515	L	0.41236	1.265	0.80722	D	1	P;P	0.40970	0.734;0.734	B;B	0.28991	0.097;0.097	T	0.53387	-0.8446	9	0.52906	T	0.07	-11.2701	20.4301	0.99081	0.0:0.0:1.0:0.0	.	13;13	B4DX32;O60870	.;KIN17_HUMAN	G	13	.	ENSP00000368881:A13G	A	-	2	0	KIN	7869865	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.909000	0.48758	2.834000	0.97654	0.557000	0.71058	GCC	.		0.612	ATP5C1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046708.1	NM_005174	
MGEA5	10724	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	103563517	103563517	+	Silent	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr10:103563517A>G	ENST00000361464.3	-	7	1406	c.1011T>C	c.(1009-1011)aaT>aaC	p.N337N	MGEA5_ENST00000370094.3_Silent_p.N337N|MGEA5_ENST00000357797.5_Silent_p.N337N|MGEA5_ENST00000439817.1_Silent_p.N337N	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	337					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		TTCTCACTCCATTCATGTTTG	0.438																																					p.N337N		.											.	MGEA5-93	0			c.T1011C						.						113.0	107.0	109.0					10																	103563517		2203	4300	6503	SO:0001819	synonymous_variant	10724	exon7			CACTCCATTCATG	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.1011T>C	10.37:g.103563517A>G		Somatic	148	0		WXS	Illumina HiSeq	Phase_I	116	9	NM_001142434	0	0	9	9	0	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Silent	SNP	ENST00000361464.3	37	CCDS7520.1																																																																																			.		0.438	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215	
NPS	594857	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	129347639	129347639	+	Splice_Site	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr10:129347639A>G	ENST00000398023.1	+	1	27	c.7A>G	c.(7-9)Agc>Ggc	p.S3G		NM_001030013.1	NP_001025184.1	P0C0P6	NPS_HUMAN	neuropeptide S	3					neuropeptide signaling pathway (GO:0007218)|positive regulation of action potential (GO:0045760)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|visual learning (GO:0008542)	extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|lung(4)	5						CAAAATGATTAGGTAAAAGGC	0.348																																					p.S3G		.											.	NPS-22	0			c.A7G						.						120.0	114.0	116.0					10																	129347639		1824	4084	5908	SO:0001630	splice_region_variant	594857	exon1			ATGATTAGGTAAA	BC148465	CCDS41577.1	10q26.2	2013-02-26			ENSG00000214285	ENSG00000214285		"""Endogenous ligands"""	33940	protein-coding gene	gene with protein product	"""prepro-neuropeptide S"""	609513				18181564, 15312648	Standard	NM_001030013		Approved		uc001ljx.1	P0C0P6		ENST00000398023.1:c.8+1A>G	10.37:g.129347639A>G		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	37	4	NM_001030013	0	0	0	0	0		Missense_Mutation	SNP	ENST00000398023.1	37	CCDS41577.1	.	.	.	.	.	.	.	.	.	.	A	1.347	-0.592491	0.03799	.	.	ENSG00000214285	ENST00000398023	T	0.33216	1.42	5.72	0.828	0.18841	.	0.509696	0.13562	N	0.378760	T	0.14056	0.0340	.	.	.	0.21861	N	0.999501	B	0.14805	0.011	B	0.14578	0.011	T	0.34875	-0.9811	9	0.08599	T	0.76	2.0E-4	9.0261	0.36230	0.7136:0.0:0.2864:0.0	.	3	P0C0P6	NPS_HUMAN	G	3	ENSP00000381105:S3G	ENSP00000381105:S3G	S	+	1	0	NPS	129237629	0.925000	0.31364	0.777000	0.31699	0.054000	0.15201	1.856000	0.39389	-0.032000	0.13758	-0.899000	0.02877	AGC	.		0.348	NPS-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001030013	Missense_Mutation
DCHS1	8642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6662595	6662595	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr11:6662595C>G	ENST00000299441.3	-	2	661	c.250G>C	c.(250-252)Gag>Cag	p.E84Q		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	84	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCGCTGCCCTCTTGGGCAGAG	0.627																																					p.E84Q		.											.	DCHS1-73	0			c.G250C						.						35.0	35.0	35.0					11																	6662595		2201	4296	6497	SO:0001583	missense	8642	exon2			TGCCCTCTTGGGC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.250G>C	11.37:g.6662595C>G	ENSP00000299441:p.Glu84Gln	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	49	20	NM_003737	0	0	2	4	2	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.772553	0.69992	.	.	ENSG00000166341	ENST00000299441	T	0.38401	1.14	5.41	5.41	0.78517	Cadherin (3);Cadherin-like (1);	0.000000	0.47093	D	0.000243	T	0.50103	0.1596	L	0.33245	0.995	0.54753	D	0.999986	D	0.69078	0.997	D	0.75020	0.985	T	0.42344	-0.9457	10	0.40728	T	0.16	.	18.1884	0.89799	0.0:1.0:0.0:0.0	.	84	Q96JQ0	PCD16_HUMAN	Q	84	ENSP00000299441:E84Q	ENSP00000299441:E84Q	E	-	1	0	DCHS1	6619171	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.783000	0.85696	2.536000	0.85505	0.643000	0.83706	GAG	.		0.627	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
OR5F1	338674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55761615	55761615	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr11:55761615C>T	ENST00000278409.1	-	1	486	c.487G>A	c.(487-489)Gtc>Atc	p.V163I		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	163					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					AAGCTGCTGACATGGCTTGTG	0.483																																					p.V163I		.											.	OR5F1-70	0			c.G487A						.						73.0	69.0	71.0					11																	55761615		2201	4296	6497	SO:0001583	missense	338674	exon1			TGCTGACATGGCT	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.487G>A	11.37:g.55761615C>T	ENSP00000278409:p.Val163Ile	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	108	48	NM_003697	0	0	0	0	0	Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	C	1.364	-0.588052	0.03799	.	.	ENSG00000149133	ENST00000278409	T	0.00099	8.73	2.8	-5.6	0.02497	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.02111	-0.68	0.09310	N	1	B	0.14012	0.009	B	0.15870	0.014	T	0.02975	-1.1087	9	0.33141	T	0.24	.	7.0422	0.25027	0.1404:0.1464:0.0:0.7132	.	163	O95221	OR5F1_HUMAN	I	163	ENSP00000278409:V163I	ENSP00000278409:V163I	V	-	1	0	OR5F1	55518191	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-2.797000	0.00763	-0.940000	0.03705	0.297000	0.19635	GTC	.		0.483	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
OR5F1	338674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55761636	55761636	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr11:55761636A>C	ENST00000278409.1	-	1	465	c.466T>G	c.(466-468)Ttc>Gtc	p.F156V		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	156					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					TTGACCATGAAGTTCAGCAAC	0.507																																					p.F156V		.											.	OR5F1-70	0			c.T466G						.						56.0	55.0	55.0					11																	55761636		2201	4296	6497	SO:0001583	missense	338674	exon1			CCATGAAGTTCAG	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.466T>G	11.37:g.55761636A>C	ENSP00000278409:p.Phe156Val	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	95	31	NM_003697	0	0	0	0	0	Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	37	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	A	4.403	0.074536	0.08485	.	.	ENSG00000149133	ENST00000278409	T	0.36157	1.27	2.96	1.42	0.22433	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.15089	0.0364	N	0.02286	-0.61	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19095	-1.0316	9	0.87932	D	0	.	7.3055	0.26445	0.7399:0.0:0.0:0.2601	.	156	O95221	OR5F1_HUMAN	V	156	ENSP00000278409:F156V	ENSP00000278409:F156V	F	-	1	0	OR5F1	55518212	0.000000	0.05858	0.976000	0.42696	0.068000	0.16541	-0.848000	0.04326	1.136000	0.42199	0.155000	0.16302	TTC	.		0.507	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751585	76751585	+	Splice_Site	SNP	T	T	G	rs11292199		TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr11:76751585T>G	ENST00000354301.5	+	4	1076	c.988T>G	c.(988-990)Tgg>Ggg	p.W330G	B3GNT6_ENST00000421061.1_Splice_Site|B3GNT6_ENST00000533140.1_Silent_p.P330P	NM_138706.3	NP_619651.3	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GAGGGCATCCTGGCCCTTCGG	0.697																																					.		.											.	.	0			c.988+1T>G						.						6.0	5.0	6.0					11																	76751585		1175	2610	3785	SO:0001630	splice_region_variant	192134	exon3			GCATCCTGGCCCT	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000354301.5:c.988-1T>G	11.37:g.76751585T>G		Somatic	1	0		WXS	Illumina HiSeq	Phase_I	5	4	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	SNP	ENST00000354301.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	7.627|7.627	0.677983|0.677983	0.14841|0.14841	.|.	.|.	ENSG00000198488|ENSG00000198488	ENST00000354301;ENST00000421061|ENST00000354301	.|T	.|0.27104	.|1.69	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.34308	.|0.0893	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.12142	.|-1.0559	.|4	.|0.54805	.|T	.|0.06	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|G	-1|330	.|ENSP00000346256:W330G	.|ENSP00000346256:W330G	.|W	+|+	.|1	.|0	B3GNT6|B3GNT6	76429233|76429233	0.988000|0.988000	0.35896|0.35896	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	0.000000|0.000000	0.12993|0.12993	0.000000|0.000000	0.14550|0.14550	0.000000|0.000000	0.15137|0.15137	.|TGG	.		0.697	B3GNT6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_138706	Missense_Mutation
MYO7A	4647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	76903188	76903188	+	Silent	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr11:76903188C>T	ENST00000409709.3	+	31	4289	c.4017C>T	c.(4015-4017)aaC>aaT	p.N1339N	MYO7A_ENST00000458637.2_Silent_p.N1339N|MYO7A_ENST00000409619.2_Silent_p.N1328N	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1339	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AGGAGCGCAACGCCCCCTGGA	0.662											OREG0021258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N1339N		.											.	MYO7A-138	0			c.C4017T						.						59.0	69.0	66.0					11																	76903188		2114	4216	6330	SO:0001819	synonymous_variant	4647	exon31			GCGCAACGCCCCC	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.4017C>T	11.37:g.76903188C>T		Somatic	106	0	1171	WXS	Illumina HiSeq	Phase_I	77	35	NM_000260	0	0	0	0	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																			.		0.662	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
PRDM10	56980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	129817185	129817185	+	Silent	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr11:129817185G>A	ENST00000360871.3	-	5	606	c.375C>T	c.(373-375)acC>acT	p.T125T	PRDM10_ENST00000304538.6_Silent_p.T39T|PRDM10_ENST00000423662.2_Silent_p.T39T|PRDM10_ENST00000358825.5_Silent_p.T125T|PRDM10_ENST00000526082.1_Silent_p.T39T|PRDM10_ENST00000528746.1_Silent_p.T99T	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	125					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TGCCTAGAGGGGTCTGCAGAG	0.547																																					p.T125T		.											.	PRDM10-91	0			c.C375T						.						202.0	123.0	150.0					11																	129817185		2201	4297	6498	SO:0001819	synonymous_variant	56980	exon5			TAGAGGGGTCTGC	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.375C>T	11.37:g.129817185G>A		Somatic	93	1		WXS	Illumina HiSeq	Phase_I	79	28	NM_020228	0	0	2	2	0	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Silent	SNP	ENST00000360871.3	37	CCDS8484.1																																																																																			.		0.547	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57573720	57573720	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr12:57573720G>A	ENST00000243077.3	+	30	5588	c.5122G>A	c.(5122-5124)Gtc>Atc	p.V1708I		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1708					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCATGGCCTTGTCGTCCACCC	0.622																																					p.V1708I		.											.	LRP1-596	0			c.G5122A						.						80.0	84.0	82.0					12																	57573720		2203	4300	6503	SO:0001583	missense	4035	exon30			GGCCTTGTCGTCC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5122G>A	12.37:g.57573720G>A	ENSP00000243077:p.Val1708Ile	Somatic	200	0		WXS	Illumina HiSeq	Phase_I	127	54	NM_002332	0	0	9	17	8	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135943	0.77662	.	.	ENSG00000123384	ENST00000243077	D	0.91792	-2.91	5.01	5.01	0.66863	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000008	D	0.94814	0.8325	L	0.58669	1.825	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	D	0.94336	0.7566	10	0.46703	T	0.11	.	17.2551	0.87053	0.0:0.0:1.0:0.0	.	1708	Q07954	LRP1_HUMAN	I	1708	ENSP00000243077:V1708I	ENSP00000243077:V1708I	V	+	1	0	LRP1	55859987	1.000000	0.71417	0.994000	0.49952	0.978000	0.69477	9.622000	0.98378	2.606000	0.88127	0.655000	0.94253	GTC	.		0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
HECTD4	283450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	112668608	112668608	+	Silent	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr12:112668608G>A	ENST00000430131.2	-	39	6098	c.4953C>T	c.(4951-4953)ccC>ccT	p.P1651P	HECTD4_ENST00000550722.1_Silent_p.P1927P|HECTD4_ENST00000377560.5_Silent_p.P1901P			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1651					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CACTGATGAAGGGACGCACAG	0.498																																					p.P1939P		.											.	.	0			c.C5817T						.						84.0	76.0	79.0					12																	112668608		2068	4230	6298	SO:0001819	synonymous_variant	283450	exon40			GATGAAGGGACGC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4953C>T	12.37:g.112668608G>A		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	15	5	NM_001109662	0	0	1	4	3	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37																																																																																				.		0.498	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
ZMYM5	9205	hgsc.bcm.edu	37	13	20398977	20398977	+	Silent	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr13:20398977A>G	ENST00000337963.4	-	8	1914	c.1650T>C	c.(1648-1650)ttT>ttC	p.F550F		NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	550						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		tatcttttggaaagttaaaat	0.378																																					p.F550F		.											.	ZMYM5-90	0			c.T1650C						.						23.0	21.0	22.0					13																	20398977		1568	3582	5150	SO:0001819	synonymous_variant	9205	exon8			TTTTGGAAAGTTA	AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.1650T>C	13.37:g.20398977A>G		Somatic	13	0		WXS	Illumina HiSeq	Phase_I	14	2	NM_001142684	0	0	5	5	0	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Silent	SNP	ENST00000337963.4	37																																																																																				.		0.378	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242	
MTMR6	9107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	25823587	25823587	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr13:25823587G>C	ENST00000381801.5	-	14	2410	c.1649C>G	c.(1648-1650)aCc>aGc	p.T550S	MTMR6_ENST00000540661.1_Intron|AL590787.1_ENST00000408397.1_RNA	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	550					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		CAATTCCTTGGTGAGGATGCC	0.353																																					p.T550S		.											.	MTMR6-94	0			c.C1649G						.						145.0	137.0	139.0					13																	25823587		2203	4300	6503	SO:0001583	missense	9107	exon14			TCCTTGGTGAGGA	AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1649C>G	13.37:g.25823587G>C	ENSP00000371221:p.Thr550Ser	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	58	24	NM_004685	0	0	6	14	8	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	ENST00000381801.5	37	CCDS9313.1	.	.	.	.	.	.	.	.	.	.	G	10.08	1.252375	0.22880	.	.	ENSG00000139505	ENST00000381801;ENST00000319298	D	0.94092	-3.35	5.65	4.76	0.60689	.	0.280543	0.39210	N	0.001422	D	0.82701	0.5094	N	0.12182	0.205	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.74551	-0.3628	10	0.15066	T	0.55	.	6.229	0.20724	0.0787:0.1336:0.6502:0.1375	.	550	Q9Y217	MTMR6_HUMAN	S	550;118	ENSP00000371221:T550S	ENSP00000317987:T118S	T	-	2	0	MTMR6	24721587	0.998000	0.40836	0.987000	0.45799	0.992000	0.81027	0.947000	0.29082	2.833000	0.97629	0.655000	0.94253	ACC	.		0.353	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044225.1	NM_004685	
PROSER1	80209	hgsc.bcm.edu	37	13	39588610	39588610	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr13:39588610A>C	ENST00000352251.3	-	11	1612	c.779T>G	c.(778-780)tTt>tGt	p.F260C	PROSER1_ENST00000350125.3_Missense_Mutation_p.F238C|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	260	Pro-rich.																TGGGGTGGAAAATGCTATATG	0.378																																					p.F260C		.											.	.	0			c.T779G						.						57.0	54.0	55.0					13																	39588610		2203	4300	6503	SO:0001583	missense	80209	exon11			GTGGAAAATGCTA	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.779T>G	13.37:g.39588610A>C	ENSP00000332034:p.Phe260Cys	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_025138	0	0	0	0	0	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	37	CCDS9368.2	.	.	.	.	.	.	.	.	.	.	A	17.32	3.359517	0.61403	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.34472	1.37;1.36	5.09	5.09	0.68999	.	.	.	.	.	T	0.52435	0.1734	L	0.59436	1.845	0.38844	D	0.956135	D;D	0.69078	0.997;0.997	D;D	0.63192	0.912;0.912	T	0.55049	-0.8201	8	.	.	.	-18.4404	14.0355	0.64642	1.0:0.0:0.0:0.0	.	238;260	A6NJ97;Q86XN7	.;PRSR1_HUMAN	C	260;238	ENSP00000332034:F260C;ENSP00000339123:F238C	.	F	-	2	0	PROSER1	38486610	1.000000	0.71417	0.263000	0.24496	0.887000	0.51463	6.071000	0.71229	1.912000	0.55364	0.528000	0.53228	TTT	.		0.378	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
IPO5	3843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	98652854	98652854	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr13:98652854G>A	ENST00000490680.1	+	10	1128	c.1063G>A	c.(1063-1065)Gtt>Att	p.V355I	IPO5_ENST00000539640.1_Missense_Mutation_p.V230I|IPO5_ENST00000261574.5_Missense_Mutation_p.V373I			O00410	IPO5_HUMAN	importin 5	355	Ran-GTP binding. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						TGGAAAGCTCGTTCTGCCGAT	0.418																																					p.V373I		.											.	IPO5-228	0			c.G1117A						.						138.0	119.0	125.0					13																	98652854		2203	4300	6503	SO:0001583	missense	3843	exon13			AAGCTCGTTCTGC	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.1063G>A	13.37:g.98652854G>A	ENSP00000418393:p.Val355Ile	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	67	33	NM_002271	0	0	11	20	9	B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	ENST00000490680.1	37		.	.	.	.	.	.	.	.	.	.	G	14.28	2.486959	0.44249	.	.	ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.99	5.99	0.97316	Armadillo-like helical (1);Armadillo-type fold (1);	0.052583	0.85682	D	0.000000	T	0.10465	0.0256	N	0.05280	-0.08	0.58432	D	0.999996	B;B;B	0.17852	0.024;0.013;0.023	B;B;B	0.23716	0.021;0.013;0.048	T	0.21177	-1.0253	10	0.07644	T	0.81	-0.6551	20.4756	0.99175	0.0:0.0:1.0:0.0	.	230;355;373	B4E0R6;O00410;O00410-3	.;IPO5_HUMAN;.	I	373;355;355;230	ENSP00000261574:V373I;ENSP00000350219:V355I;ENSP00000418393:V355I;ENSP00000445126:V230I	ENSP00000261574:V373I	V	+	1	0	IPO5	97450855	1.000000	0.71417	0.795000	0.32087	0.974000	0.67602	6.319000	0.72871	2.847000	0.97988	0.655000	0.94253	GTT	.		0.418	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	NM_002271	
FARP1	10160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	99037979	99037979	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr13:99037979A>C	ENST00000319562.6	+	8	935	c.670A>C	c.(670-672)Atg>Ctg	p.M224L	FARP1_ENST00000376586.2_Missense_Mutation_p.M224L|FARP1_ENST00000595437.1_Missense_Mutation_p.M224L	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	224	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TCGGCTAGAGATGTATGGAAT	0.488																																					p.M224L		.											.	FARP1-290	0			c.A670C						.						102.0	98.0	99.0					13																	99037979		2203	4300	6503	SO:0001583	missense	10160	exon8			CTAGAGATGTATG	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.670A>C	13.37:g.99037979A>C	ENSP00000322926:p.Met224Leu	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	110	39	NM_005766	0	0	34	68	34	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	A	15.46	2.839552	0.51057	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	D;D	0.82619	-1.63;-1.63	5.85	4.63	0.57726	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);	0.075237	0.85682	D	0.000000	D	0.88555	0.6468	M	0.63428	1.95	0.58432	D	0.999996	B;D	0.60575	0.019;0.988	B;D	0.77557	0.026;0.99	D	0.86464	0.1781	10	0.32370	T	0.25	.	12.9994	0.58666	0.8652:0.1348:0.0:0.0	.	224;224	Q9Y4F1;C9JME2	FARP1_HUMAN;.	L	224	ENSP00000365771:M224L;ENSP00000322926:M224L	ENSP00000322926:M224L	M	+	1	0	FARP1	97835980	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.144000	0.71762	0.994000	0.38892	0.533000	0.62120	ATG	.		0.488	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
MYO16	23026	hgsc.bcm.edu	37	13	109793009	109793009	+	Silent	SNP	C	C	T	rs141423536	byFrequency	TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr13:109793009C>T	ENST00000357550.2	+	31	4424	c.4383C>T	c.(4381-4383)caC>caT	p.H1461H	MYO16_ENST00000356711.2_Silent_p.H1461H	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCCTGCTCCACCGCGCGCCGG	0.761													C|||	89	0.0177716	0.0023	0.0317	5008	,	,		6208	0.0		0.0527	False		,,,				2504	0.0112				p.H1483H		.											.	MYO16-142	0			c.C4449T						.						1.0	2.0	2.0					13																	109793009		1243	2621	3864	SO:0001819	synonymous_variant	23026	exon32			GCTCCACCGCGCG		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.4383C>T	13.37:g.109793009C>T		Somatic	1	1		WXS	Illumina HiSeq	Phase_I	3	3	NM_001198950	0	0	0	0	0		Silent	SNP	ENST00000357550.2	37	CCDS32008.1																																																																																			C|0.974;T|0.026		0.761	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
EXOC3L4	91828	hgsc.bcm.edu	37	14	103569068	103569068	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr14:103569068G>C	ENST00000380069.3	+	2	1084	c.1008G>C	c.(1006-1008)caG>caC	p.Q336H		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	336					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						GCTGCGAGCAGCTCTATATCC	0.711																																					p.Q336H		.											.	EXOC3L4-23	0			c.G1008C						.						3.0	5.0	4.0					14																	103569068		1976	3896	5872	SO:0001583	missense	91828	exon2			CGAGCAGCTCTAT	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.1008G>C	14.37:g.103569068G>C	ENSP00000369409:p.Gln336His	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	4	2	NM_001077594	0	0	0	0	0	Q14CR2	Missense_Mutation	SNP	ENST00000380069.3	37	CCDS32163.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.766182	0.49574	.	.	ENSG00000205436	ENST00000380069	T	0.06449	3.3	4.09	3.1	0.35709	.	0.178569	0.34853	N	0.003631	T	0.16514	0.0397	M	0.65975	2.015	0.35903	D	0.830539	D	0.89917	1.0	D	0.79108	0.992	T	0.05257	-1.0896	10	0.72032	D	0.01	-32.8675	3.7055	0.08398	0.1324:0.0:0.6206:0.247	.	336	Q17RC7	EX3L4_HUMAN	H	336	ENSP00000369409:Q336H	ENSP00000369409:Q336H	Q	+	3	2	EXOC3L4	102638821	0.999000	0.42202	1.000000	0.80357	0.611000	0.37282	0.218000	0.17622	2.124000	0.65301	0.491000	0.48974	CAG	.		0.711	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	33961646	33961646	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr15:33961646T>C	ENST00000389232.4	+	37	5781	c.5711T>C	c.(5710-5712)cTc>cCc	p.L1904P	RYR3_ENST00000415757.3_Missense_Mutation_p.L1904P	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1904	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAGGACCTTCTCCTTCACTGT	0.463																																					p.L1904P		.											.	RYR3-520	0			c.T5711C						.						86.0	83.0	84.0					15																	33961646		1868	4102	5970	SO:0001583	missense	6263	exon37			ACCTTCTCCTTCA		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5711T>C	15.37:g.33961646T>C	ENSP00000373884:p.Leu1904Pro	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	53	21	NM_001243996	0	0	0	0	0	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	T	15.50	2.851326	0.51270	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.71341	-0.54;-0.56	5.65	4.53	0.55603	.	0.156082	0.44097	D	0.000496	T	0.69771	0.3148	M	0.61703	1.905	0.54753	D	0.999987	P;P	0.44195	0.787;0.828	B;B	0.43413	0.419;0.296	T	0.72821	-0.4177	10	0.87932	D	0	.	11.6133	0.51074	0.0:0.0688:0.0:0.9312	.	1904;1904	Q15413-2;Q15413	.;RYR3_HUMAN	P	1904	ENSP00000373884:L1904P;ENSP00000399610:L1904P	ENSP00000354735:L1904P	L	+	2	0	RYR3	31748938	1.000000	0.71417	0.639000	0.29394	0.964000	0.63967	3.815000	0.55651	1.158000	0.42547	0.533000	0.62120	CTC	.		0.463	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
ACTC1	70	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	35085735	35085735	+	Silent	SNP	G	G	A	rs149432225		TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr15:35085735G>A	ENST00000290378.4	-	3	820	c.165C>T	c.(163-165)taC>taT	p.Y55Y	ACTC1_ENST00000557860.1_5'Flank|RP11-814P5.1_ENST00000503496.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	55					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		CATCACCTACGTAGGAGTCCT	0.473																																					p.Y55Y		.											.	ACTC1-92	0			c.C165T						.	G		3,4399	6.2+/-15.9	0,3,2198	64.0	53.0	57.0		165	-10.9	0.4	15	dbSNP_134	57	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	ACTC1	NM_005159.4		0,4,6495	AA,AG,GG		0.0116,0.0682,0.0308		55/378	35085735	4,12994	2201	4298	6499	SO:0001819	synonymous_variant	70	exon3			ACCTACGTAGGAG	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.165C>T	15.37:g.35085735G>A		Somatic	94	1		WXS	Illumina HiSeq	Phase_I	74	34	NM_005159	0	0	0	0	0	P04270	Silent	SNP	ENST00000290378.4	37	CCDS10041.1																																																																																			G|1.000;A|0.000		0.473	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159	
THBS1	7057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	39885784	39885784	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr15:39885784T>C	ENST00000260356.5	+	19	3347	c.3182T>C	c.(3181-3183)cTt>cCt	p.L1061P	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	1061	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		TACTCGGGCCTTTCTGTGAAA	0.582																																					p.L1061P		.											.	THBS1-653	0			c.T3182C						.						107.0	105.0	106.0					15																	39885784		2200	4297	6497	SO:0001583	missense	7057	exon19			CGGGCCTTTCTGT		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.3182T>C	15.37:g.39885784T>C	ENSP00000260356:p.Leu1061Pro	Somatic	257	0		WXS	Illumina HiSeq	Phase_I	179	67	NM_003246	0	0	9	11	2	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.514534	0.85389	.	.	ENSG00000137801	ENST00000260356	D	0.95853	-3.83	5.77	5.77	0.91146	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.32357	N	0.006219	D	0.97049	0.9036	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.989;1.0	D	0.97737	1.0206	10	0.87932	D	0	-8.1512	16.0747	0.80960	0.0:0.0:0.0:1.0	.	976;1061	B4E3J7;P07996	.;TSP1_HUMAN	P	1061	ENSP00000260356:L1061P	ENSP00000260356:L1061P	L	+	2	0	THBS1	37673076	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	8.036000	0.88901	2.190000	0.69967	0.533000	0.62120	CTT	.		0.582	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
CGNL1	84952	hgsc.bcm.edu	37	15	57808995	57808995	+	Silent	SNP	G	G	T	rs76645518		TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr15:57808995G>T	ENST00000281282.5	+	9	2499	c.2421G>T	c.(2419-2421)gcG>gcT	p.A807A		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	807						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AGGTCTTGGCGAGCAGGAGCA	0.512																																					p.A807A		.											.	CGNL1-100	0			c.G2421T						.						50.0	48.0	49.0					15																	57808995		2192	4292	6484	SO:0001819	synonymous_variant	84952	exon10			CTTGGCGAGCAGG	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.2421G>T	15.37:g.57808995G>T		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	32	3	NM_001252335	0	0	1	1	0	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Silent	SNP	ENST00000281282.5	37	CCDS10161.1																																																																																			G|0.999;A|0.001		0.512	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
HMG20A	10363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	77759508	77759508	+	Silent	SNP	C	C	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr15:77759508C>A	ENST00000381714.3	+	5	737	c.309C>A	c.(307-309)ccC>ccA	p.P103P	HMG20A_ENST00000336216.4_Silent_p.P103P	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	103					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						GCAATGCACCCAAATCCCCCC	0.428																																					p.P103P		.											.	HMG20A-228	0			c.C309A						.						92.0	88.0	90.0					15																	77759508		2196	4294	6490	SO:0001819	synonymous_variant	10363	exon5			TGCACCCAAATCC	AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.309C>A	15.37:g.77759508C>A		Somatic	116	0		WXS	Illumina HiSeq	Phase_I	75	28	NM_018200	0	0	11	20	9	A6NHY3|D3DW78|Q53G31|Q9NSF6	Silent	SNP	ENST00000381714.3	37	CCDS10295.1																																																																																			.		0.428	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200	
TICRR	90381	broad.mit.edu	37	15	90118913	90118913	+	Silent	SNP	C	C	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr15:90118913C>A	ENST00000268138.7	+	1	201	c.96C>A	c.(94-96)acC>acA	p.T32T	RP11-429B14.1_ENST00000559041.1_RNA|TICRR_ENST00000560985.1_Silent_p.T32T			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	32					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										GCCTCCTCACCTATCTGAGTT	0.687																																					p.T32T													.	.	0			c.C96A						.						6.0	7.0	6.0					15																	90118913		1706	3871	5577	SO:0001819	synonymous_variant	90381	exon1			CCTCACCTATCTG	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.96C>A	15.37:g.90118913C>A		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	13	4	NM_152259	0	0	0	0	0	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	ENST00000268138.7	37	CCDS10352.2																																																																																			.		0.687	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
MLST8	64223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2258565	2258565	+	Silent	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr16:2258565C>T	ENST00000569417.1	+	8	1167	c.813C>T	c.(811-813)ggC>ggT	p.G271G	MLST8_ENST00000564088.1_Silent_p.G271G|MLST8_ENST00000301724.10_Silent_p.G271G|MLST8_ENST00000301725.7_3'UTR|MLST8_ENST00000565250.1_Silent_p.G271G|MLST8_ENST00000382450.4_Silent_p.G270G|MLST8_ENST00000397124.1_Silent_p.G271G	NM_022372.4	NP_071767.3	Q9BVC4	LST8_HUMAN	MTOR associated protein, LST8 homolog (S. cerevisiae)	271					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of TOR signaling (GO:0032008)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac GTPase activity (GO:0032314)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				large_intestine(3)|lung(2)|skin(1)	6						CCTCCCGCGGCTGGATGTGGG	0.677																																					p.G271G		.											.	MLST8-392	0			c.C813T						.						61.0	74.0	70.0					16																	2258565		2030	4167	6197	SO:0001819	synonymous_variant	64223	exon8			CCGCGGCTGGATG		CCDS10462.2, CCDS58409.1	16p13.3	2013-01-09			ENSG00000167965	ENSG00000167965		"""WD repeat domain containing"""	24825	protein-coding gene	gene with protein product	"""G protein beta subunit like"""	612190				12477932	Standard	NM_022372		Approved	Lst8, Pop3, GBL, GbetaL	uc002cpc.3	Q9BVC4	OTTHUMG00000128827	ENST00000569417.1:c.813C>T	16.37:g.2258565C>T		Somatic	276	0		WXS	Illumina HiSeq	Phase_I	198	45	NM_001199174	0	0	104	158	54	B3KMM4|B4DY00|D3DU88|Q5M800|Q86Y18|Q8WUI5|Q9HA66|Q9UJV6	Silent	SNP	ENST00000569417.1	37	CCDS10462.2																																																																																			.		0.677	MLST8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250763.2	NM_022372	
PPP4C	5531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30094761	30094761	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr16:30094761G>A	ENST00000279387.7	+	6	518	c.350G>A	c.(349-351)aGt>aAt	p.S117N	PPP4C_ENST00000561610.1_Missense_Mutation_p.S117N	NM_002720.1	NP_002711.1	P60510	PP4C_HUMAN	protein phosphatase 4, catalytic subunit	117					dephosphorylation (GO:0016311)|NIK/NF-kappaB signaling (GO:0038061)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase 4 complex (GO:0030289)	metal ion binding (GO:0046872)|NF-kappaB-inducing kinase activity (GO:0004704)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(2)|pancreas(1)|skin(1)|urinary_tract(1)	9						AACCATGAGAGTCGCCAGATC	0.592																																					p.S117N		.											.	PPP4C-226	0			c.G350A						.						101.0	92.0	95.0					16																	30094761		2197	4300	6497	SO:0001583	missense	5531	exon6			ATGAGAGTCGCCA		CCDS10669.1	16p11.2	2010-03-17	2010-03-05		ENSG00000149923	ENSG00000149923	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9319	protein-coding gene	gene with protein product	"""protein phosphatase X, catalytic subunit"""	602035	"""protein phosphatase 4 (formerly X), catalytic subunit"""			9177794	Standard	NM_002720		Approved	PP4, PPX	uc002dwf.3	P60510	OTTHUMG00000132113	ENST00000279387.7:c.350G>A	16.37:g.30094761G>A	ENSP00000279387:p.Ser117Asn	Somatic	156	0		WXS	Illumina HiSeq	Phase_I	165	102	NM_002720	0	0	25	65	40	P33172	Missense_Mutation	SNP	ENST00000279387.7	37	CCDS10669.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.690325	0.88735	.	.	ENSG00000149923	ENST00000279387	D	0.85861	-2.04	5.83	5.83	0.93111	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.136138	0.64402	D	0.000003	D	0.94751	0.8306	H	0.97315	3.98	0.80722	D	1	P	0.44380	0.834	P	0.55785	0.784	D	0.95816	0.8845	10	0.87932	D	0	1.9966	18.8865	0.92379	0.0:0.0:1.0:0.0	.	117	P60510	PP4C_HUMAN	N	117	ENSP00000279387:S117N	ENSP00000279387:S117N	S	+	2	0	PPP4C	30002262	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	2.862000	0.48388	2.761000	0.94854	0.650000	0.86243	AGT	.		0.592	PPP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255155.2	NM_002720	
MARVELD3	91862	broad.mit.edu;bcgsc.ca	37	16	71663293	71663293	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr16:71663293T>A	ENST00000268485.3	+	2	535	c.491T>A	c.(490-492)cTg>cAg	p.L164Q	MARVELD3_ENST00000567501.1_5'UTR|MARVELD3_ENST00000299952.4_Missense_Mutation_p.L164Q|MARVELD3_ENST00000565261.1_Missense_Mutation_p.C110S|RP11-432I5.2_ENST00000562763.1_RNA|MARVELD3_ENST00000567566.1_Missense_Mutation_p.L164Q	NM_052858.4	NP_443090.4	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	164	Pro-rich.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				GAGAGATATCTGCCCTCGACC	0.502																																					p.L164Q													.	MARVELD3-91	0			c.T491A						.						97.0	90.0	92.0					16																	71663293		2198	4300	6498	SO:0001583	missense	91862	exon2			GATATCTGCCCTC	BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000268485.3:c.491T>A	16.37:g.71663293T>A	ENSP00000268485:p.Leu164Gln	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	118	5	NM_001017967	0	0	9	9	0	A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	ENST00000268485.3	37	CCDS10904.1	.	.	.	.	.	.	.	.	.	.	T	9.698	1.153699	0.21371	.	.	ENSG00000140832	ENST00000268485;ENST00000299952	T;T	0.49139	0.79;0.84	5.57	3.3	0.37823	.	0.821835	0.11320	N	0.576170	T	0.48857	0.1523	L	0.34521	1.04	0.09310	N	0.999993	D;D;D	0.71674	0.958;0.958;0.998	P;P;P	0.62560	0.66;0.66;0.904	T	0.28776	-1.0033	10	0.18276	T	0.48	-13.3398	6.9002	0.24279	0.0:0.1987:0.0:0.8013	.	164;164;187	Q96A59-2;Q96A59;Q9BSH2	.;MALD3_HUMAN;.	Q	164	ENSP00000268485:L164Q;ENSP00000299952:L164Q	ENSP00000268485:L164Q	L	+	2	0	MARVELD3	70220794	0.001000	0.12720	0.001000	0.08648	0.051000	0.14879	0.598000	0.24074	0.958000	0.37956	0.459000	0.35465	CTG	.		0.502	MARVELD3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268991.2	NM_052858	
ABR	29	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	916353	916353	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr17:916353T>C	ENST00000302538.5	-	17	1989	c.1843A>G	c.(1843-1845)Atg>Gtg	p.M615V	ABR_ENST00000574437.1_Missense_Mutation_p.M569V|ABR_ENST00000572441.1_Missense_Mutation_p.M66V|ABR_ENST00000543210.2_Missense_Mutation_p.M66V|ABR_ENST00000291107.2_Missense_Mutation_p.M578V|ABR_ENST00000536794.2_Missense_Mutation_p.M397V|ABR_ENST00000544583.2_Missense_Mutation_p.M569V	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	615					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		ACCCCGTTCATCTCAATCACG	0.632																																					p.M615V	Esophageal Squamous(197;2016 2115 4129 29033 46447)	.											.	ABR-91	0			c.A1843G						.						232.0	177.0	196.0					17																	916353		2203	4300	6503	SO:0001583	missense	29	exon17			CGTTCATCTCAAT	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1843A>G	17.37:g.916353T>C	ENSP00000303909:p.Met615Val	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	129	39	NM_021962	0	0	1	1	0	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	ENST00000302538.5	37	CCDS10999.1	.	.	.	.	.	.	.	.	.	.	T	16.54	3.152234	0.57259	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794;ENST00000543210	T;T;T;T;T	0.19532	2.17;2.18;2.14;3.39;3.13	5.77	5.77	0.91146	C2 calcium/lipid-binding domain, CaLB (1);	0.046264	0.85682	D	0.000000	T	0.39733	0.1089	M	0.65975	2.015	0.41941	D	0.990616	B;B;P;B	0.43578	0.128;0.452;0.811;0.129	B;P;P;B	0.60789	0.101;0.455;0.879;0.045	T	0.15037	-1.0451	10	0.16896	T	0.51	.	12.5258	0.56085	0.0:0.0:0.0:1.0	.	397;66;578;615	B7Z683;F5H3S2;Q12979-2;Q12979	.;.;.;ABR_HUMAN	V	615;569;578;397;66	ENSP00000303909:M615V;ENSP00000442048:M569V;ENSP00000291107:M578V;ENSP00000437429:M397V;ENSP00000445198:M66V	ENSP00000291107:M578V	M	-	1	0	ABR	863103	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.919000	0.56439	2.220000	0.72140	0.529000	0.55759	ATG	.		0.632	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
CTNS	1497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	3550808	3550808	+	Silent	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr17:3550808C>T	ENST00000046640.3	+	4	725	c.132C>T	c.(130-132)ctC>ctT	p.L44L	CTNS_ENST00000441220.2_Intron|CTNS_ENST00000381870.3_Silent_p.L44L|CTNS_ENST00000414524.2_Intron|CTNS_ENST00000399306.2_Silent_p.L44L|CTNS_ENST00000488623.1_3'UTR	NM_004937.2	NP_004928.2	O60931	CTNS_HUMAN	cystinosin, lysosomal cystine transporter	44					adult walking behavior (GO:0007628)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|cellular amino acid metabolic process (GO:0006520)|cognition (GO:0050890)|glutathione metabolic process (GO:0006749)|grooming behavior (GO:0007625)|L-cystine transport (GO:0015811)|lens development in camera-type eye (GO:0002088)|long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	L-cystine transmembrane transporter activity (GO:0015184)			NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)	10				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)	ACGTCAGCCTCACCCTGCGGT	0.602																																					p.L44L		.											.	CTNS-90	0			c.C132T						.						135.0	100.0	112.0					17																	3550808		2203	4300	6503	SO:0001819	synonymous_variant	1497	exon4			CAGCCTCACCCTG	AJ222967	CCDS11031.1, CCDS32530.1	17p13	2011-06-07	2011-06-07		ENSG00000040531	ENSG00000040531			2518	protein-coding gene	gene with protein product		606272	"""cystinosis, nephropathic"""			9537412, 15128704	Standard	NM_004937		Approved	CTNS-LSB, PQLC4	uc002fwa.3	O60931	OTTHUMG00000090693	ENST00000046640.3:c.132C>T	17.37:g.3550808C>T		Somatic	68	0		WXS	Illumina HiSeq	Phase_I	94	13	NM_001031681	0	0	0	0	0	D3DTJ5|Q8IZ01|Q9UNK6	Silent	SNP	ENST00000046640.3	37	CCDS11031.1																																																																																			.		0.602	CTNS-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317696.1	NM_004937	
GPR179	440435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	36486249	36486249	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr17:36486249A>C	ENST00000342292.4	-	11	3223	c.3203T>G	c.(3202-3204)aTc>aGc	p.I1068S	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1068					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TTTAGGGAAGATCTTGGGCCT	0.562																																					p.I1068S		.											.	GPR179-93	0			c.T3203G						.						70.0	76.0	74.0					17																	36486249		2078	4209	6287	SO:0001583	missense	440435	exon11			GGGAAGATCTTGG		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.3203T>G	17.37:g.36486249A>C	ENSP00000345060:p.Ile1068Ser	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	113	28	NM_001004334	0	0	0	0	0		Missense_Mutation	SNP	ENST00000342292.4	37	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	A	0.624	-0.819832	0.02776	.	.	ENSG00000188888	ENST00000342292	T	0.52295	0.67	5.14	2.9	0.33743	.	0.633204	0.14796	N	0.297947	T	0.28200	0.0696	N	0.24115	0.695	0.18873	N	0.999981	B	0.15473	0.013	B	0.14023	0.01	T	0.17592	-1.0364	10	0.25106	T	0.35	-0.9541	3.9932	0.09546	0.6254:0.1793:0.1953:0.0	.	1068	Q6PRD1	GP179_HUMAN	S	1068	ENSP00000345060:I1068S	ENSP00000345060:I1068S	I	-	2	0	GPR179	33739775	0.000000	0.05858	0.494000	0.27515	0.138000	0.21146	-0.354000	0.07681	0.427000	0.26145	0.379000	0.24179	ATC	.		0.562	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
IFNL1	282618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	39787490	39787490	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr19:39787490T>G	ENST00000333625.2	+	2	314	c.217T>G	c.(217-219)Ttc>Gtc	p.F73V		NM_172140.1	NP_742152.1	Q8IU54	IFNL1_HUMAN	interferon, lambda 1	73					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of cell proliferation (GO:0008285)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of memory T cell differentiation (GO:0043381)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of immune response (GO:0050778)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-28 receptor complex (GO:0032002)	interleukin-28 receptor binding (GO:0032003)|receptor binding (GO:0005102)										CTCTCCTGTCTTCCCCGGGAA	0.572																																					p.F73V		.											.	.	0			c.T217G						.						91.0	86.0	88.0					19																	39787490		2203	4300	6503	SO:0001583	missense	282618	exon2			CCTGTCTTCCCCG	AY129150	CCDS12531.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000182393	ENSG00000182393		"""Interferons"""	18363	protein-coding gene	gene with protein product		607403	"""interleukin 29"", ""interleukin 29 (interferon, lambda 1)"""	IL29			Standard	NM_172140		Approved	IL-29	uc002okv.3	Q8IU54		ENST00000333625.2:c.217T>G	19.37:g.39787490T>G	ENSP00000329991:p.Phe73Val	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	55	23	NM_172140	0	0	0	0	0	A0AV25|Q17R34	Missense_Mutation	SNP	ENST00000333625.2	37	CCDS12531.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470360	0.63625	.	.	ENSG00000182393	ENST00000333625	T	0.35421	1.31	3.69	3.69	0.42338	.	0.094954	0.46758	D	0.000269	T	0.59770	0.2218	M	0.84846	2.72	0.25011	N	0.991407	D	0.71674	0.998	D	0.71870	0.975	T	0.54098	-0.8344	10	0.66056	D	0.02	-28.5284	10.3642	0.44012	0.0:0.0:0.0:1.0	.	73	Q8IU54	IL29_HUMAN	V	73	ENSP00000329991:F73V	ENSP00000329991:F73V	F	+	1	0	IL29	44479330	0.956000	0.32656	0.939000	0.37840	0.068000	0.16541	1.113000	0.31184	1.553000	0.49476	0.374000	0.22700	TTC	.		0.572	IFNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463834.1	NM_172140	
PRR19	284338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42814766	42814766	+	Silent	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr19:42814766C>T	ENST00000499536.2	+	2	1756	c.945C>T	c.(943-945)ccC>ccT	p.P315P	PRR19_ENST00000598490.1_3'UTR|TMEM145_ENST00000301204.3_5'Flank|PRR19_ENST00000341747.3_Silent_p.P315P|TMEM145_ENST00000598766.1_5'Flank			A6NJB7	PRR19_HUMAN	proline rich 19	315	Pro-rich.									NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)				CTTCATCACCCCTGTTGCCCC	0.652																																					p.P315P		.											.	PRR19-68	0			c.C945T						.						71.0	82.0	78.0					19																	42814766		2203	4300	6503	SO:0001819	synonymous_variant	284338	exon3			ATCACCCCTGTTG	AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368			33728	protein-coding gene	gene with protein product							Standard	NM_199285		Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.945C>T	19.37:g.42814766C>T		Somatic	300	0		WXS	Illumina HiSeq	Phase_I	218	83	NM_199285	0	0	0	0	0	A8K663|B3KW48|Q6P584	Silent	SNP	ENST00000499536.2	37	CCDS33036.1																																																																																			.		0.652	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463735.1	NM_199285	
RSPH6A	81492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	46317875	46317875	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr19:46317875G>C	ENST00000221538.3	-	1	702	c.560C>G	c.(559-561)gCc>gGc	p.A187G	RSPH6A_ENST00000597055.1_Missense_Mutation_p.A187G|SYMPK_ENST00000598155.1_5'Flank	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	187						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						AGGCACCTGGGCACTGTAGTG	0.612																																					p.A187G		.											.	RSPH6A-91	0			c.C560G						.						41.0	42.0	42.0					19																	46317875		2203	4300	6503	SO:0001583	missense	81492	exon1			ACCTGGGCACTGT	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.560C>G	19.37:g.46317875G>C	ENSP00000221538:p.Ala187Gly	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	67	24	NM_030785	0	0	0	0	0	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	ENST00000221538.3	37	CCDS12675.1	.	.	.	.	.	.	.	.	.	.	G	7.970	0.748802	0.15710	.	.	ENSG00000104941	ENST00000221538	T	0.14022	2.54	4.76	-7.87	0.01183	.	1.573020	0.03646	N	0.240221	T	0.05273	0.0140	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35822	-0.9773	10	0.12766	T	0.61	-6.7105	6.8603	0.24064	0.3005:0.342:0.3575:0.0	.	187	Q9H0K4	RSH6A_HUMAN	G	187	ENSP00000221538:A187G	ENSP00000221538:A187G	A	-	2	0	RSPH6A	51009715	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.503000	0.06383	-1.022000	0.03346	-0.274000	0.10170	GCC	.		0.612	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		
MYPOP	339344	hgsc.bcm.edu	37	19	46394100	46394100	+	Silent	SNP	C	C	T	rs142323830	byFrequency	TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr19:46394100C>T	ENST00000322217.5	-	3	1067	c.981G>A	c.(979-981)ccG>ccA	p.P327P		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	327	Pro-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			large_intestine(2)|lung(1)|skin(1)	4						CCTTGGGGGCCGGTGGGGGCA	0.697													T|||	49	0.00978435	0.003	0.0159	5008	,	,		4018	0.0		0.0278	False		,,,				2504	0.0061				p.P327P		.											.	MYPOP-90	0			c.G981A						.	T		20,3674		0,20,1827	3.0	3.0	3.0		981	-5.3	0.0	19	dbSNP_134	3	242,7102		1,240,3431	no	coding-synonymous	MYPOP	NM_001012643.2		1,260,5258	TT,TC,CC		3.2952,0.5414,2.3736		327/400	46394100	262,10776	1847	3672	5519	SO:0001819	synonymous_variant	339344	exon3			GGGGGCCGGTGGG	BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.981G>A	19.37:g.46394100C>T		Somatic	2	0		WXS	Illumina HiSeq	Phase_I	7	6	NM_001012643	0	0	2	3	1		Silent	SNP	ENST00000322217.5	37	CCDS33055.1																																																																																			C|0.989;T|0.011		0.697	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461684.1	NM_001012643	
PEG3	5178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57325186	57325186	+	Missense_Mutation	SNP	A	A	G	rs530969342		TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr19:57325186A>G	ENST00000326441.9	-	10	4987	c.4624T>C	c.(4624-4626)Tgc>Cgc	p.C1542R	PEG3_ENST00000598410.1_Missense_Mutation_p.C1418R|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.C1542R|PEG3_ENST00000593695.1_Missense_Mutation_p.C1416R|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000593711.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1542					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TAGCCTGAGCACTCCCCAAAG	0.488													A|||	0	0.0	0.0	0.0	5008	,	,		21323	0.0		0.0	False		,,,				2504	0.0				p.C1542R		.											.	PEG3-164	0			c.T4624C						.						158.0	137.0	144.0					19																	57325186		2203	4300	6503	SO:0001583	missense	5178	exon9			CTGAGCACTCCCC	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4624T>C	19.37:g.57325186A>G	ENSP00000326581:p.Cys1542Arg	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	114	35	NM_001146184	0	0	0	0	0	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	A	10.68	1.417219	0.25552	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.03330	3.97;3.97	3.95	-1.91	0.07641	.	0.139082	0.33712	N	0.004636	T	0.01800	0.0057	N	0.19112	0.55	.	.	.	B;B;B	0.29432	0.159;0.244;0.244	B;B;B	0.29176	0.031;0.047;0.099	T	0.41324	-0.9515	9	0.23302	T	0.38	-3.4232	0.998	0.01471	0.2243:0.3544:0.1312:0.2901	.	1418;1542;1477	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	R	1542	ENSP00000326581:C1542R;ENSP00000403051:C1542R	ENSP00000326581:C1542R	C	-	1	0	ZIM2	62016998	0.001000	0.12720	0.008000	0.14137	0.951000	0.60555	0.315000	0.19451	-0.525000	0.06391	0.482000	0.46254	TGC	.		0.488	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
ASAP2	8853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	9528579	9528579	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr2:9528579T>C	ENST00000281419.3	+	22	2627	c.2287T>C	c.(2287-2289)Tac>Cac	p.Y763H	ASAP2_ENST00000315273.4_Missense_Mutation_p.Y763H|ASAP2_ENST00000491413.1_3'UTR	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	763					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						GAATGAGACTTACGGAGCCCT	0.597																																					p.Y763H		.											.	ASAP2-90	0			c.T2287C						.						45.0	50.0	48.0					2																	9528579		2203	4300	6503	SO:0001583	missense	8853	exon22			GAGACTTACGGAG	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2287T>C	2.37:g.9528579T>C	ENSP00000281419:p.Tyr763His	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	49	22	NM_001135191	0	0	0	0	0	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.806023	0.70682	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.57436	0.41;0.4	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.66137	0.2759	L	0.49778	1.585	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.915	T	0.61724	-0.7004	10	0.23891	T	0.37	.	15.7424	0.77910	0.0:0.0:0.0:1.0	.	763;763	O43150-2;O43150	.;ASAP2_HUMAN	H	763	ENSP00000281419:Y763H;ENSP00000316404:Y763H	ENSP00000281419:Y763H	Y	+	1	0	ASAP2	9446030	1.000000	0.71417	0.081000	0.20488	0.971000	0.66376	7.614000	0.82996	2.118000	0.64928	0.459000	0.35465	TAC	.		0.597	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
SLC4A1AP	22950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27888159	27888159	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr2:27888159A>G	ENST00000326019.6	+	2	1300	c.1018A>G	c.(1018-1020)Atg>Gtg	p.M340V	SUPT7L_ENST00000337768.5_5'Flank|SUPT7L_ENST00000406540.1_5'Flank|SUPT7L_ENST00000404798.2_5'Flank|SUPT7L_ENST00000464789.2_5'Flank|SUPT7L_ENST00000405491.1_5'Flank	NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	340						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					CACCTGGGGAATGGGTAAGAA	0.388																																					p.M340V		.											.	SLC4A1AP-90	0			c.A1018G						.						133.0	138.0	136.0					2																	27888159		2203	4300	6503	SO:0001583	missense	22950	exon2			TGGGGAATGGGTA		CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.1018A>G	2.37:g.27888159A>G	ENSP00000323837:p.Met340Val	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	120	56	NM_018158	0	0	0	0	0	A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Missense_Mutation	SNP	ENST00000326019.6	37	CCDS33166.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.135945	0.77662	.	.	ENSG00000163798	ENST00000326019	T	0.51574	0.7	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.58921	0.2156	M	0.84948	2.725	0.80722	D	1	P	0.42010	0.768	B	0.43386	0.418	T	0.67821	-0.5571	10	0.72032	D	0.01	-17.2495	15.2303	0.73383	1.0:0.0:0.0:0.0	.	340	Q9BWU0	NADAP_HUMAN	V	340	ENSP00000323837:M340V	ENSP00000323837:M340V	M	+	1	0	SLC4A1AP	27741663	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.617000	0.74210	1.995000	0.58328	0.379000	0.24179	ATG	.		0.388	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324550.1	NM_018158	
GPR75	10936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	54080607	54080607	+	Silent	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr2:54080607A>G	ENST00000394705.2	-	2	1557	c.1287T>C	c.(1285-1287)tcT>tcC	p.S429S	GPR75-ASB3_ENST00000352846.3_Intron|ASB3_ENST00000406625.2_Intron|ASB3_ENST00000498475.2_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	429					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			ACATGTAGGCAGAGTTTGTTT	0.448																																					p.S429S		.											.	GPR75-92	0			c.T1287C						.						122.0	122.0	122.0					2																	54080607		2203	4300	6503	SO:0001819	synonymous_variant	10936	exon2			GTAGGCAGAGTTT	AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.1287T>C	2.37:g.54080607A>G		Somatic	303	0		WXS	Illumina HiSeq	Phase_I	190	49	NM_006794	0	0	0	0	0	B2RC02|Q6NWR2	Silent	SNP	ENST00000394705.2	37	CCDS1849.1																																																																																			.		0.448	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251403.2		
USP39	10713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	85875075	85875075	+	Nonsense_Mutation	SNP	T	T	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr2:85875075T>G	ENST00000323701.6	+	12	1596	c.1586T>G	c.(1585-1587)tTa>tGa	p.L529*	USP39_ENST00000459775.1_3'UTR|USP39_ENST00000409766.3_Missense_Mutation_p.Y484D|USP39_ENST00000409470.1_Nonsense_Mutation_p.L529*|USP39_ENST00000450066.2_Nonsense_Mutation_p.L426*|USP39_ENST00000409025.1_Intron	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	529	USP.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						TGGTATGAATTACAAGACCTC	0.478																																					p.L529X		.											.	USP39-658	0			c.T1586G						.						98.0	91.0	93.0					2																	85875075		2203	4300	6503	SO:0001587	stop_gained	10713	exon12			ATGAATTACAAGA	AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.1586T>G	2.37:g.85875075T>G	ENSP00000312981:p.Leu529*	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	102	44	NM_001256725	0	0	18	19	1	A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Nonsense_Mutation	SNP	ENST00000323701.6	37	CCDS33234.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	37|37	6.533352|6.533352	0.97641|0.97641	.|.	.|.	ENSG00000168883|ENSG00000168883	ENST00000450066;ENST00000409268;ENST00000409470;ENST00000323701|ENST00000409766	.|T	.|0.19105	.|2.17	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	0.065227|.	0.56097|.	D|.	0.000040|.	.|T	.|0.21145	.|0.0509	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|B	.|0.21905	.|0.062	.|B	.|0.21360	.|0.034	.|T	.|0.16129	.|-1.0413	.|7	0.14252|0.87932	T|D	0.57|0	-7.4979|-7.4979	14.3391|14.3391	0.66614|0.66614	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|484	.|G5E9H0	.|.	X|D	426;466;529;529|484	.|ENSP00000386803:Y484D	ENSP00000312981:L529X|ENSP00000386803:Y484D	L|Y	+|+	2|1	0|0	USP39|USP39	85728586|85728586	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.995000|0.995000	0.86356|0.86356	7.252000|7.252000	0.78309|0.78309	2.265000|2.265000	0.75225|0.75225	0.533000|0.533000	0.62120|0.62120	TTA|TAC	.		0.478	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329892.1	NM_006590	
MBD5	55777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	149248040	149248040	+	Silent	SNP	A	A	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr2:149248040A>C	ENST00000407073.1	+	12	5137	c.4140A>C	c.(4138-4140)ccA>ccC	p.P1380P	MBD5_ENST00000404807.1_Silent_p.P1613P	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1380					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		ATTATAGACCAAGGACGTTCA	0.453																																					p.P1380P		.											.	MBD5-95	0			c.A4140C						.						77.0	78.0	78.0					2																	149248040		2203	4300	6503	SO:0001819	synonymous_variant	55777	exon12			TAGACCAAGGACG	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.4140A>C	2.37:g.149248040A>C		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	109	51	NM_018328	0	0	2	7	5	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Silent	SNP	ENST00000407073.1	37	CCDS33302.1																																																																																			.		0.453	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
PAX3	5077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	223066673	223066673	+	Silent	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr2:223066673C>T	ENST00000350526.4	-	8	1546	c.1410G>A	c.(1408-1410)caG>caA	p.Q470Q	PAX3_ENST00000409551.3_Silent_p.Q469Q|PAX3_ENST00000464706.1_5'Flank|PAX3_ENST00000392069.2_Silent_p.Q470Q|PAX3_ENST00000344493.4_Intron|PAX3_ENST00000336840.6_Intron|PAX3_ENST00000392070.2_Silent_p.Q470Q	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	470					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTTGTCCATACTGCCCATATT	0.468			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.Q470Q		.		Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	PAX3-1821	0			c.G1410A						.						99.0	93.0	95.0					2																	223066673		2203	4300	6503	SO:0001819	synonymous_variant	5077	exon8			TCCATACTGCCCA		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.1410G>A	2.37:g.223066673C>T		Somatic	123	0		WXS	Illumina HiSeq	Phase_I	82	8	NM_181457	0	0	0	0	0	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Silent	SNP	ENST00000350526.4	37	CCDS42826.1																																																																																			.		0.468	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
DOCK10	55619	hgsc.bcm.edu	37	2	225630473	225630473	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr2:225630473G>C	ENST00000258390.7	-	56	6593	c.6526C>G	c.(6526-6528)Ccc>Gcc	p.P2176A	DOCK10_ENST00000409592.3_Missense_Mutation_p.P2170A	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	2176					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GAGACCGTGGGTAGGGCCGGA	0.512																																					p.P2176A		.											.	DOCK10-92	0			c.C6526G						.						143.0	143.0	143.0					2																	225630473		1919	4127	6046	SO:0001583	missense	55619	exon56			CCGTGGGTAGGGC	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.6526C>G	2.37:g.225630473G>C	ENSP00000258390:p.Pro2176Ala	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_014689	0	0	2	2	0	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	G	4.364	0.067136	0.08388	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.18338	2.22;2.23	5.12	4.24	0.50183	.	1.033560	0.07661	N	0.933647	T	0.11196	0.0273	N	0.08118	0	0.09310	N	1	B;B	0.16603	0.018;0.003	B;B	0.14023	0.01;0.007	T	0.31971	-0.9924	10	0.37606	T	0.19	.	12.029	0.53388	0.0809:0.0:0.9191:0.0	.	2176;2170	Q96BY6;B3FL70	DOC10_HUMAN;.	A	2170;2176	ENSP00000386694:P2170A;ENSP00000258390:P2176A	ENSP00000258390:P2176A	P	-	1	0	DOCK10	225338717	0.970000	0.33590	0.027000	0.17364	0.009000	0.06853	3.388000	0.52509	1.162000	0.42619	0.561000	0.74099	CCC	.		0.512	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
FRG1B	284802	bcgsc.ca	37	20	29625885	29625885	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr20:29625885A>T	ENST00000278882.3	+	5	509	c.129A>T	c.(127-129)aaA>aaT	p.K43N	FRG1B_ENST00000439954.2_Missense_Mutation_p.K48N|FRG1B_ENST00000358464.4_Missense_Mutation_p.K43N			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	43								p.K43N(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCGCCCTGAAATCTGGCTATG	0.353																																					.													.	FRG1B-22	2	Substitution - Missense(2)	prostate(2)	.						.																																			SO:0001583	missense	284802	.			CCTGAAATCTGGC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.129A>T	20.37:g.29625885A>T	ENSP00000278882:p.Lys43Asn	Somatic	187	1		WXS	Illumina HiSeq	Phase_1	190	11	.	0	6	1	7	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	10.23	1.292024	0.23564	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.62364	0.03	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.74145	0.3678	.	.	.	0.48762	D	0.999701	D	0.71674	0.998	D	0.79784	0.993	T	0.74598	-0.3612	9	0.87932	D	0	.	7.3757	0.26827	1.0:0.0:0.0:0.0	.	48	F5H5R5	.	N	43;48;43	ENSP00000408863:K48N	ENSP00000278882:K43N	K	+	3	2	FRG1B	28239546	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	0.595000	0.24029	1.028000	0.39785	0.155000	0.16302	AAA	.		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
SAMHD1	25939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	35532631	35532631	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr20:35532631T>C	ENST00000262878.4	-	13	1631	c.1432A>G	c.(1432-1434)Aaa>Gaa	p.K478E		NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	478					dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				GCAACCTCTTTTGGAAGAGAT	0.388																																					p.K478E		.											.	SAMHD1-90	0			c.A1432G						.						167.0	160.0	163.0					20																	35532631		2203	4300	6503	SO:0001583	missense	25939	exon13			CCTCTTTTGGAAG	AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.1432A>G	20.37:g.35532631T>C	ENSP00000262878:p.Lys478Glu	Somatic	209	0		WXS	Illumina HiSeq	Phase_I	210	124	NM_015474	0	0	6	7	1	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	ENST00000262878.4	37	CCDS13288.1	.	.	.	.	.	.	.	.	.	.	T	3.335	-0.135924	0.06711	.	.	ENSG00000101347	ENST00000262878	D	0.95035	-3.59	5.58	-1.17	0.09648	.	0.908554	0.09627	N	0.776782	T	0.81880	0.4916	N	0.05012	-0.13	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.70040	-0.4981	10	0.12103	T	0.63	-4.9058	2.7471	0.05270	0.1081:0.3573:0.2665:0.2681	.	478	Q9Y3Z3	SAMH1_HUMAN	E	478	ENSP00000262878:K478E	ENSP00000262878:K478E	K	-	1	0	SAMHD1	34966045	0.001000	0.12720	0.005000	0.12908	0.362000	0.29581	-0.100000	0.10990	-0.173000	0.10761	0.460000	0.39030	AAA	.		0.388	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474	
FITM2	128486	hgsc.bcm.edu	37	20	42939740	42939740	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr20:42939740G>A	ENST00000396825.3	-	1	69	c.49C>T	c.(49-51)Cgg>Tgg	p.R17W		NM_001080472.1	NP_001073941.1	Q8N6M3	FITM2_HUMAN	fat storage-inducing transmembrane protein 2	17					cellular triglyceride homeostasis (GO:0035356)|cytoskeleton organization (GO:0007010)|lipid particle organization (GO:0034389)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of cell morphogenesis (GO:0022604)|regulation of triglyceride biosynthetic process (GO:0010866)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)				endometrium(2)|lung(2)|skin(2)	6						ACGGCCGCCCGCACCAGCGTT	0.692											OREG0025965	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R17W		.											.	FITM2-24	0			c.C49T						.						44.0	41.0	42.0					20																	42939740		2197	4298	6495	SO:0001583	missense	128486	exon1			CCGCCCGCACCAG	BC029662	CCDS33473.1	20q13.12	2009-04-29	2009-04-29	2009-04-29	ENSG00000197296	ENSG00000197296			16135	protein-coding gene	gene with protein product	"""fat inducing transcript 2"""	612029	"""chromosome 20 open reading frame 142"""	C20orf142		18160536	Standard	NM_001080472		Approved	dJ881L22.2, FIT2	uc002xlr.1	Q8N6M3	OTTHUMG00000032522	ENST00000396825.3:c.49C>T	20.37:g.42939740G>A	ENSP00000380037:p.Arg17Trp	Somatic	40	0	912	WXS	Illumina HiSeq	Phase_I	39	2	NM_001080472	0	0	0	0	0	A1L492|B9EGQ4|Q5TE59|Q9H3Y1	Missense_Mutation	SNP	ENST00000396825.3	37	CCDS33473.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987782	0.74589	.	.	ENSG00000197296	ENST00000396825	.	.	.	5.21	4.17	0.49024	.	0.606331	0.16941	N	0.193271	T	0.46737	0.1408	N	0.24115	0.695	0.32924	D	0.516204	D	0.76494	0.999	P	0.57620	0.824	T	0.58098	-0.7696	9	0.66056	D	0.02	.	8.8643	0.35276	0.0:0.1241:0.3961:0.4799	.	17	Q8N6M3	FITM2_HUMAN	W	17	.	ENSP00000380037:R17W	R	-	1	2	FITM2	42373154	0.867000	0.29959	0.999000	0.59377	0.698000	0.40448	1.213000	0.32407	0.962000	0.38057	0.484000	0.47621	CGG	G|1.000;A|0.000		0.692	FITM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079342.2	XM_371399	
SCAF4	57466	hgsc.bcm.edu	37	21	33057763	33057763	+	Silent	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr21:33057763A>G	ENST00000286835.7	-	18	2626	c.2244T>C	c.(2242-2244)acT>acC	p.T748T	SCAF4_ENST00000399804.1_Silent_p.T748T|SCAF4_ENST00000434667.3_Silent_p.T733T	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	748						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						ATACTGGTGGAGTTATAGGAG	0.433																																					p.T748T		.											.	SCAF4-90	0			c.T2244C						.						92.0	94.0	93.0					21																	33057763		2203	4300	6503	SO:0001819	synonymous_variant	57466	exon18			TGGTGGAGTTATA	AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.2244T>C	21.37:g.33057763A>G		Somatic	139	0		WXS	Illumina HiSeq	Phase_I	96	5	NM_020706	0	0	10	10	0	C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Silent	SNP	ENST00000286835.7	37	CCDS33537.1																																																																																			.		0.433	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000192659.1	XM_047889	
CACNA1I	8911	hgsc.bcm.edu	37	22	40080409	40080409	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr22:40080409A>G	ENST00000402142.3	+	36	5933	c.5933A>G	c.(5932-5934)aAg>aGg	p.K1978R	CACNA1I_ENST00000400164.3_Missense_Mutation_p.K1943R|CACNA1I_ENST00000404898.1_Missense_Mutation_p.K1943R|CACNA1I_ENST00000336649.4_Missense_Mutation_p.K1984R|CACNA1I_ENST00000407673.1_Missense_Mutation_p.K1943R|CACNA1I_ENST00000401624.1_Missense_Mutation_p.K1978R	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1978					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GGCCCAGAAAAGGGCACTGGC	0.642																																					p.K1978R		.											.	CACNA1I-135	0			c.A5933G						.						41.0	46.0	44.0					22																	40080409		2027	4190	6217	SO:0001583	missense	8911	exon36			CAGAAAAGGGCAC	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.5933A>G	22.37:g.40080409A>G	ENSP00000385019:p.Lys1978Arg	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_021096	0	0	0	0	0	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	37	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	A	6.096	0.385972	0.11524	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.96967	-4.17;-4.13;-4.16;-4.12;-4.19;-4.1	5.05	2.86	0.33363	.	2.583880	0.02234	U	0.065144	D	0.91523	0.7323	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.20459	0.045;0.0;0.0;0.0	B;B;B;B	0.18561	0.022;0.001;0.001;0.0	T	0.81258	-0.1014	10	0.19147	T	0.46	.	2.9533	0.05868	0.6285:0.1545:0.0779:0.139	.	1943;1978;1943;1978	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	R	1978;1943;1978;1943;1984;1943	ENSP00000385019:K1978R;ENSP00000384093:K1943R;ENSP00000383887:K1978R;ENSP00000385680:K1943R;ENSP00000337829:K1984R;ENSP00000383028:K1943R	ENSP00000337829:K1984R	K	+	2	0	CACNA1I	38410355	0.997000	0.39634	0.308000	0.25141	0.069000	0.16628	1.737000	0.38197	0.255000	0.21593	0.459000	0.35465	AAG	.		0.642	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
ACAA1	30	hgsc.bcm.edu	37	3	38180515	38180515	+	5'Flank	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr3:38180515C>T	ENST00000333167.8	-	0	0				ACAA1_ENST00000544624.1_5'Flank|MYD88_ENST00000424893.1_Silent_p.S121S|MYD88_ENST00000443433.2_Silent_p.S121S|MYD88_ENST00000396334.3_Silent_p.S121S|ACAA1_ENST00000450296.1_5'Flank|ACAA1_ENST00000301810.7_5'Flank|MYD88_ENST00000495303.1_Silent_p.S121S|ACAA1_ENST00000444607.2_5'Flank|MYD88_ENST00000417037.2_Silent_p.S121S	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		TGGGACCCAGCATTGGTGAGG	0.662																																					p.S121S		.											.	MYD88-901	0			c.C363T						.						27.0	30.0	29.0					3																	38180515		2203	4300	6503	SO:0001631	upstream_gene_variant	4615	exon1			ACCCAGCATTGGT	X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087		3.37:g.38180515C>T	Exception_encountered	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_002468	0	0	0	0	0	G5E935|Q96CA6	Silent	SNP	ENST00000333167.8	37	CCDS2673.1																																																																																			.		0.662	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342980.1	NM_001607	
CELSR3	1951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	48690562	48690562	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr3:48690562A>C	ENST00000164024.4	-	10	5787	c.5507T>G	c.(5506-5508)cTc>cGc	p.L1836R	CELSR3_ENST00000544264.1_Missense_Mutation_p.L1836R	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1836	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTCCAGAAGGAGATGGGAAGC	0.622																																					p.L1836R		.											.	CELSR3-523	0			c.T5507G						.						69.0	59.0	62.0					3																	48690562		2203	4300	6503	SO:0001583	missense	1951	exon10			AGAAGGAGATGGG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.5507T>G	3.37:g.48690562A>C	ENSP00000164024:p.Leu1836Arg	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	65	28	NM_001407	0	0	0	0	0	O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.699442	0.88830	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	D;D	0.81821	-1.54;-1.54	5.33	5.33	0.75918	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.88584	0.6476	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.97110	0.988;1.0	D	0.88600	0.3149	9	0.45353	T	0.12	.	15.3149	0.74065	1.0:0.0:0.0:0.0	.	1836;1906	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	R	1836	ENSP00000164024:L1836R;ENSP00000445694:L1836R	ENSP00000164024:L1836R	L	-	2	0	CELSR3	48665566	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	8.549000	0.90672	2.026000	0.59711	0.460000	0.39030	CTC	.		0.622	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
COL6A6	131873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	130292932	130292932	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr3:130292932T>A	ENST00000358511.6	+	7	3141	c.3110T>A	c.(3109-3111)gTg>gAg	p.V1037E	COL6A6_ENST00000453409.2_Missense_Mutation_p.V1037E	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1037	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CTCAACAGAGTGCGAATAGGA	0.418																																					p.V1037E		.											.	COL6A6-76	0			c.T3110A						.						67.0	62.0	64.0					3																	130292932		1868	4100	5968	SO:0001583	missense	131873	exon7			ACAGAGTGCGAAT	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.3110T>A	3.37:g.130292932T>A	ENSP00000351310:p.Val1037Glu	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	41	20	NM_001102608	0	0	0	0	0	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.993314	0.54041	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.85171	-1.95;-1.95	5.15	3.99	0.46301	von Willebrand factor, type A (3);	0.000000	0.52532	D	0.000074	D	0.92596	0.7648	M	0.92784	3.345	0.38839	D	0.956029	D	0.58268	0.982	P	0.62740	0.906	D	0.93390	0.6751	10	0.66056	D	0.02	.	10.6799	0.45809	0.0:0.0762:0.0:0.9238	.	1037	A6NMZ7	CO6A6_HUMAN	E	1037	ENSP00000351310:V1037E;ENSP00000399236:V1037E	ENSP00000351310:V1037E	V	+	2	0	COL6A6	131775622	0.928000	0.31464	0.677000	0.29947	0.260000	0.26232	3.286000	0.51724	0.919000	0.36945	0.459000	0.35465	GTG	.		0.418	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
LRPAP1	4043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	3519768	3519768	+	Silent	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr4:3519768A>G	ENST00000500728.2	-	5	890	c.744T>C	c.(742-744)acT>acC	p.T248T	LRPAP1_ENST00000296325.5_5'UTR	NM_002337.3	NP_002328.1	P30533	AMRP_HUMAN	low density lipoprotein receptor-related protein associated protein 1	248	LDL receptor binding. {ECO:0000255}.				extracellular negative regulation of signal transduction (GO:1900116)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of protein binding (GO:0032091)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|protein folding (GO:0006457)|receptor-mediated endocytosis (GO:0006898)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum lumen (GO:0048237)|vesicle (GO:0031982)	asialoglycoprotein receptor activity (GO:0004873)|heparin binding (GO:0008201)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|unfolded protein binding (GO:0051082)|very-low-density lipoprotein particle receptor binding (GO:0070326)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)		CACCAGCCTCAGTGCTGTAGC	0.657																																					p.T248T		.											.	LRPAP1-92	0			c.T744C						.						40.0	37.0	38.0					4																	3519768		2203	4300	6503	SO:0001819	synonymous_variant	4043	exon5			AGCCTCAGTGCTG		CCDS3371.1	4p16.3	2008-05-02	2003-03-17		ENSG00000163956	ENSG00000163956			6701	protein-coding gene	gene with protein product		104225	"""low density lipoprotein-related protein-associated protein 1 (alpha-2-macroglobulin receptor-associated protein 1)"""	A2MRAP		1712782	Standard	NM_002337		Approved	HBP44	uc003ghh.4	P30533	OTTHUMG00000090299	ENST00000500728.2:c.744T>C	4.37:g.3519768A>G		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	41	13	NM_002337	0	0	0	0	0	D3DVR9|Q2M310|Q53HQ3|Q53HS6	Silent	SNP	ENST00000500728.2	37	CCDS3371.1																																																																																			.		0.657	LRPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206659.4		
TBC1D19	55296	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	26737100	26737100	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr4:26737100T>A	ENST00000264866.4	+	16	1386	c.1108T>A	c.(1108-1110)Tca>Aca	p.S370T	TBC1D19_ENST00000511789.1_Missense_Mutation_p.S305T	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	370	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				TCATGGATTTTCAATGTATGG	0.264																																					p.S370T		.											.	TBC1D19-153	0			c.T1108A						.						40.0	36.0	38.0					4																	26737100		2186	4257	6443	SO:0001583	missense	55296	exon16			GGATTTTCAATGT	AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.1108T>A	4.37:g.26737100T>A	ENSP00000264866:p.Ser370Thr	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	22	7	NM_018317	0	0	0	0	0	B9A6M0|Q9NUX1	Missense_Mutation	SNP	ENST00000264866.4	37	CCDS3439.1	.	.	.	.	.	.	.	.	.	.	T	7.982	0.751339	0.15778	.	.	ENSG00000109680	ENST00000264866;ENST00000511789	T;T	0.12361	2.69;2.69	5.7	5.7	0.88788	Rab-GAP/TBC domain (3);	0.000000	0.85682	D	0.000000	T	0.21801	0.0525	L	0.31065	0.9	0.80722	D	1	B;D;D	0.53885	0.013;0.963;0.963	B;D;D	0.69824	0.02;0.966;0.966	T	0.01879	-1.1255	10	0.02654	T	1	-10.0854	15.9517	0.79843	0.0:0.0:0.0:1.0	.	305;370;370	B9A6M0;A8K0R6;Q8N5T2	.;.;TBC19_HUMAN	T	370;305	ENSP00000264866:S370T;ENSP00000425569:S305T	ENSP00000264866:S370T	S	+	1	0	TBC1D19	26346198	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.742000	0.74843	2.172000	0.68678	0.519000	0.50382	TCA	.		0.264	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	NM_018317	
AFF1	4299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	88029381	88029381	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr4:88029381G>T	ENST00000307808.6	+	10	1846	c.1426G>T	c.(1426-1428)Gac>Tac	p.D476Y	AFF1_ENST00000395146.4_Missense_Mutation_p.D483Y|AFF1_ENST00000544085.1_Missense_Mutation_p.D114Y	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	476					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AAGCACCAGTGACTCAGACAG	0.512																																					p.D483Y		.											.	AFF1-289	0			c.G1447T						.						114.0	104.0	108.0					4																	88029381		2203	4300	6503	SO:0001583	missense	4299	exon11			ACCAGTGACTCAG	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1426G>T	4.37:g.88029381G>T	ENSP00000305689:p.Asp476Tyr	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	64	24	NM_001166693	0	0	4	7	3	B4DTU1|E9PBM3	Missense_Mutation	SNP	ENST00000307808.6	37	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164359	0.78339	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000511722;ENST00000544085;ENST00000514970	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	5.5	5.5	0.81552	.	0.131246	0.52532	D	0.000065	T	0.80319	0.4601	L	0.59436	1.845	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.977;0.977;0.977	T	0.80761	-0.1238	10	0.66056	D	0.02	-14.424	19.7664	0.96346	0.0:0.0:1.0:0.0	.	483;476;476	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	Y	483;476;114;114;167	ENSP00000378578:D483Y;ENSP00000305689:D476Y;ENSP00000424766:D114Y;ENSP00000440843:D114Y;ENSP00000424881:D167Y	ENSP00000305689:D476Y	D	+	1	0	AFF1	88248405	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.723000	0.91458	2.735000	0.93741	0.655000	0.94253	GAC	.		0.512	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	
SEC24B	10427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	110415933	110415933	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr4:110415933A>G	ENST00000265175.5	+	6	1464	c.1409A>G	c.(1408-1410)tAt>tGt	p.Y470C	SEC24B_ENST00000504968.2_Missense_Mutation_p.Y501C|SEC24B_ENST00000399100.2_Missense_Mutation_p.Y435C	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	470					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		CAGCCTGGTTATCAGAATGCT	0.473																																					p.Y470C		.											.	SEC24B-137	0			c.A1409G						.						116.0	117.0	117.0					4																	110415933		2080	4262	6342	SO:0001583	missense	10427	exon6			CTGGTTATCAGAA	AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.1409A>G	4.37:g.110415933A>G	ENSP00000265175:p.Tyr470Cys	Somatic	188	0		WXS	Illumina HiSeq	Phase_I	144	59	NM_006323	0	0	2	5	3	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	37	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	A	19.06	3.754236	0.69648	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.23754	1.89;1.89;1.89	5.47	5.47	0.80525	.	.	.	.	.	T	0.48943	0.1528	M	0.65975	2.015	0.54753	D	0.999987	D;P;D;D;D	0.89917	0.997;0.951;1.0;0.998;1.0	D;P;D;D;D	0.81914	0.926;0.759;0.995;0.947;0.995	T	0.50849	-0.8779	9	0.72032	D	0.01	2.3658	13.7816	0.63085	1.0:0.0:0.0:0.0	.	385;69;501;435;470	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	C	501;435;470	ENSP00000428564:Y501C;ENSP00000382051:Y435C;ENSP00000265175:Y470C	ENSP00000265175:Y470C	Y	+	2	0	SEC24B	110635382	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	6.401000	0.73256	2.064000	0.61679	0.533000	0.62120	TAT	.		0.473	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2		
SPATA5	166378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	123848831	123848831	+	Missense_Mutation	SNP	A	A	G	rs201699296		TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr4:123848831A>G	ENST00000274008.4	+	2	275	c.206A>G	c.(205-207)cAt>cGt	p.H69R	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	69					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						TCCCTTATTCATCTTGGACTC	0.338													A|||	1	0.000199681	0.0	0.0014	5008	,	,		18755	0.0		0.0	False		,,,				2504	0.0				p.H69R		.											.	SPATA5-90	0			c.A206G						.						116.0	116.0	116.0					4																	123848831		2203	4300	6503	SO:0001583	missense	166378	exon2			TTATTCATCTTGG	AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.206A>G	4.37:g.123848831A>G	ENSP00000274008:p.His69Arg	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	116	53	NM_145207	0	0	0	0	0	C9JT97|Q86XW1|Q8NI20|Q8TDL7	Missense_Mutation	SNP	ENST00000274008.4	37	CCDS3730.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	14.82	2.648636	0.47258	.	.	ENSG00000145375	ENST00000274008	T	0.80480	-1.38	4.38	4.38	0.52667	Aspartate decarboxylase-like fold (1);	0.066103	0.64402	D	0.000008	T	0.64994	0.2649	N	0.11427	0.14	0.38412	D	0.945945	B;B	0.23249	0.049;0.082	B;B	0.25140	0.016;0.058	T	0.65084	-0.6254	10	0.38643	T	0.18	-13.2842	12.66	0.56809	1.0:0.0:0.0:0.0	.	69;69	Q8NB90;Q8NB90-3	SPAT5_HUMAN;.	R	69	ENSP00000274008:H69R	ENSP00000274008:H69R	H	+	2	0	SPATA5	124068281	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.210000	0.77924	1.992000	0.58205	0.533000	0.62120	CAT	A|0.999;G|0.000		0.338	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256714.2	NM_145207	
MAML3	55534	hgsc.bcm.edu	37	4	140811108	140811108	+	Silent	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr4:140811108C>T	ENST00000509479.2	-	2	2338	c.1482G>A	c.(1480-1482)caG>caA	p.Q494Q	MAML3_ENST00000398940.1_Silent_p.Q33Q|MAML3_ENST00000327122.5_Silent_p.Q338Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.537																																					p.Q494Q		.											.	MAML3-455	0			c.G1482A						.						14.0	19.0	17.0					4																	140811108		2165	4272	6437	SO:0001819	synonymous_variant	55534	exon2			CTGCTGCTGCTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1482G>A	4.37:g.140811108C>T		Somatic	71	1		WXS	Illumina HiSeq	Phase_I	63	4	NM_018717	0	0	488	488	0		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																			.		0.537	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
TRIM2	23321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	154215496	154215496	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr4:154215496A>T	ENST00000437508.2	+	5	765	c.564A>T	c.(562-564)gaA>gaT	p.E188D	TRIM2_ENST00000494872.1_3'UTR|TRIM2_ENST00000338700.5_Missense_Mutation_p.E215D	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	188					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		TCATCTCTGAAATCATTCATC	0.413																																					p.E215D		.											.	TRIM2-650	0			c.A645T						.						108.0	103.0	104.0					4																	154215496		2203	4300	6503	SO:0001583	missense	23321	exon5			CTCTGAAATCATT	AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.564A>T	4.37:g.154215496A>T	ENSP00000415812:p.Glu188Asp	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	83	33	NM_015271	0	0	8	15	7	D3DP09|O60272|Q9BSI9|Q9UFZ1	Missense_Mutation	SNP	ENST00000437508.2	37	CCDS47147.1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.411858	0.42817	.	.	ENSG00000109654	ENST00000437508;ENST00000338700;ENST00000433687	T;T;T	0.71222	-0.54;-0.55;-0.23	6.17	5.0	0.66597	B-box, C-terminal (1);	0.041315	0.85682	D	0.000000	T	0.57829	0.2080	L	0.34521	1.04	0.54753	D	0.999982	B;B	0.12013	0.005;0.005	B;B	0.10450	0.005;0.005	T	0.50693	-0.8798	10	0.17369	T	0.5	-3.329	12.1877	0.54250	0.9342:0.0:0.0658:0.0	.	215;188	D3DP09;Q9C040	.;TRIM2_HUMAN	D	188;215;102	ENSP00000415812:E188D;ENSP00000339659:E215D;ENSP00000400375:E102D	ENSP00000339659:E215D	E	+	3	2	TRIM2	154434946	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.959000	0.56744	1.166000	0.42689	0.533000	0.62120	GAA	.		0.413	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1		
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	155225827	155225827	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr4:155225827T>C	ENST00000357232.4	-	17	4233	c.4234A>G	c.(4234-4236)Ata>Gta	p.I1412V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1412	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTACCAATTATGTGATATTCA	0.418																																					p.I1412V		.											.	DCHS2-94	0			c.A4234G						.						59.0	58.0	59.0					4																	155225827		2203	4300	6503	SO:0001583	missense	54798	exon17			CAATTATGTGATA	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4234A>G	4.37:g.155225827T>C	ENSP00000349768:p.Ile1412Val	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	48	23	NM_017639	0	0	0	0	0	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	T	7.389	0.630312	0.14257	.	.	ENSG00000197410	ENST00000357232	T	0.58797	0.31	5.09	3.91	0.45181	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.69160	0.3080	M	0.74258	2.255	0.80722	D	1	D	0.57899	0.981	P	0.58077	0.832	T	0.70784	-0.4778	10	0.56958	D	0.05	.	10.979	0.47483	0.0:0.074:0.0:0.926	.	1412	Q6V1P9	PCD23_HUMAN	V	1412	ENSP00000349768:I1412V	ENSP00000349768:I1412V	I	-	1	0	DCHS2	155445277	0.984000	0.35163	0.546000	0.28166	0.036000	0.12997	2.011000	0.40922	0.883000	0.36040	0.460000	0.39030	ATA	.		0.418	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
FAT1	2195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	187539116	187539116	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr4:187539116A>G	ENST00000441802.2	-	10	8833	c.8624T>C	c.(8623-8625)cTt>cCt	p.L2875P		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2875	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTCATGGTCAAGTTCCTTTAA	0.418										HNSCC(5;0.00058)																											p.L2875P	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.T8624C						.						175.0	154.0	161.0					4																	187539116		1930	4152	6082	SO:0001583	missense	2195	exon10			TGGTCAAGTTCCT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8624T>C	4.37:g.187539116A>G	ENSP00000406229:p.Leu2875Pro	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	67	26	NM_005245	0	0	20	36	16		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	A	18.14	3.557734	0.65425	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.75154	-0.91	4.86	4.86	0.63082	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.90256	0.6953	H	0.96269	3.795	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93285	0.6663	10	0.87932	D	0	.	14.9179	0.70812	1.0:0.0:0.0:0.0	.	2875	Q14517	FAT1_HUMAN	P	2875;2877	ENSP00000406229:L2875P	ENSP00000260147:L2877P	L	-	2	0	FAT1	187776110	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	9.139000	0.94554	2.167000	0.68274	0.528000	0.53228	CTT	.		0.418	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
SLC6A19	340024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1219640	1219640	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:1219640T>C	ENST00000304460.10	+	10	1455	c.1399T>C	c.(1399-1401)Ttc>Ctc	p.F467L		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	467					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCTGGGGACATTCCTCATTGG	0.627																																					p.F467L		.											.	SLC6A19-90	0			c.T1399C						.						140.0	118.0	125.0					5																	1219640		2203	4300	6503	SO:0001583	missense	340024	exon10			GGGACATTCCTCA	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1399T>C	5.37:g.1219640T>C	ENSP00000305302:p.Phe467Leu	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	51	20	NM_001003841	0	0	0	0	0	A8K446	Missense_Mutation	SNP	ENST00000304460.10	37	CCDS34130.1	.	.	.	.	.	.	.	.	.	.	T	8.371	0.835267	0.16820	.	.	ENSG00000174358	ENST00000304460	T	0.76316	-1.01	4.83	4.83	0.62350	.	0.341281	0.33691	N	0.004644	T	0.79311	0.4424	M	0.83603	2.65	0.09310	N	1	B	0.12630	0.006	B	0.17722	0.019	T	0.70128	-0.4957	10	0.41790	T	0.15	.	14.3784	0.66895	0.0:0.0:0.0:1.0	.	467	Q695T7	S6A19_HUMAN	L	467	ENSP00000305302:F467L	ENSP00000305302:F467L	F	+	1	0	SLC6A19	1272640	0.950000	0.32346	0.052000	0.19188	0.038000	0.13279	3.934000	0.56553	1.801000	0.52704	0.391000	0.25812	TTC	.		0.627	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
TRIO	7204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	14497016	14497016	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:14497016C>A	ENST00000344204.4	+	50	7933	c.7909C>A	c.(7909-7911)Cgt>Agt	p.R2637S	TRIO_ENST00000344135.5_Missense_Mutation_p.R136S|TRIO_ENST00000537187.1_Missense_Mutation_p.R2461S	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2637					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CACAGCACTCCGTTTAAGGAA	0.448																																					p.R2637S		.											.	TRIO-562	0			c.C7909A						.						121.0	112.0	115.0					5																	14497016		2203	4300	6503	SO:0001583	missense	7204	exon50			GCACTCCGTTTAA	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.7909C>A	5.37:g.14497016C>A	ENSP00000339299:p.Arg2637Ser	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	80	35	NM_007118	0	0	4	9	5	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915239	0.92178	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206;ENST00000344135	T;T;T	0.71341	-0.56;-0.36;-0.53	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.82282	0.5003	M	0.65498	2.005	0.36519	D	0.87004	D	0.89917	1.0	D	0.79784	0.993	D	0.84372	0.0544	10	0.37606	T	0.19	.	16.8938	0.86094	0.0:1.0:0.0:0.0	.	2637	O75962	TRIO_HUMAN	S	2637;2461;2324;136	ENSP00000339299:R2637S;ENSP00000446348:R2461S;ENSP00000339291:R136S	ENSP00000339291:R136S	R	+	1	0	TRIO	14550016	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.596000	0.67570	2.414000	0.81942	0.655000	0.94253	CGT	.		0.448	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
POLK	51426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	74892358	74892358	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:74892358G>C	ENST00000241436.4	+	13	2012	c.1840G>C	c.(1840-1842)Gag>Cag	p.E614Q	CTC-366B18.2_ENST00000511329.1_RNA|POLK_ENST00000352007.5_Missense_Mutation_p.E416Q|POLK_ENST00000508526.1_Missense_Mutation_p.E416Q|POLK_ENST00000380481.3_Missense_Mutation_p.E524Q|POLK_ENST00000504026.1_Intron|POLK_ENST00000506928.1_3'UTR	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	614					DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		GGAAATATCAGAGAATTCAGA	0.368								DNA polymerases (catalytic subunits)																													p.E614Q		.											.	POLK-229	0			c.G1840C						.						106.0	108.0	107.0					5																	74892358		2203	4300	6503	SO:0001583	missense	51426	exon13			ATATCAGAGAATT	AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.1840G>C	5.37:g.74892358G>C	ENSP00000241436:p.Glu614Gln	Somatic	215	0		WXS	Illumina HiSeq	Phase_I	171	76	NM_016218	0	0	4	7	3	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Missense_Mutation	SNP	ENST00000241436.4	37	CCDS4030.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027552	0.54683	.	.	ENSG00000122008	ENST00000241436;ENST00000352007;ENST00000508526;ENST00000380481	T;T;T;T	0.58358	1.15;0.34;0.34;1.13	5.15	4.28	0.50868	.	0.893154	0.09986	N	0.730347	T	0.50480	0.1618	M	0.65498	2.005	0.22888	N	0.998601	B;B	0.28419	0.211;0.098	B;B	0.23275	0.045;0.021	T	0.43909	-0.9362	10	0.48119	T	0.1	-2.8619	9.5091	0.39065	0.0815:0.1534:0.7651:0.0	.	416;614	Q9UBT6-3;Q9UBT6	.;POLK_HUMAN	Q	614;416;416;524	ENSP00000241436:E614Q;ENSP00000342256:E416Q;ENSP00000426853:E416Q;ENSP00000369848:E524Q	ENSP00000241436:E614Q	E	+	1	0	POLK	74928114	0.025000	0.19082	0.097000	0.21041	0.978000	0.69477	0.423000	0.21313	1.148000	0.42385	0.655000	0.94253	GAG	.		0.368	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218	
BHMT	635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	78426847	78426847	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:78426847A>G	ENST00000274353.5	+	8	1236	c.1129A>G	c.(1129-1131)Aaa>Gaa	p.K377E	BHMT_ENST00000524080.1_Missense_Mutation_p.K224E|DMGDH_ENST00000520388.1_Intron	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	377					amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	GGGAGTGACCAAAGGAACAGC	0.493																																					p.K377E		.											.	BHMT-91	0			c.A1129G						.						113.0	126.0	121.0					5																	78426847		2203	4300	6503	SO:0001583	missense	635	exon8			GTGACCAAAGGAA	BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.1129A>G	5.37:g.78426847A>G	ENSP00000274353:p.Lys377Glu	Somatic	247	1		WXS	Illumina HiSeq	Phase_I	164	53	NM_001713	0	0	0	2	2	Q9UNI9	Missense_Mutation	SNP	ENST00000274353.5	37	CCDS4046.1	.	.	.	.	.	.	.	.	.	.	A	18.22	3.574689	0.65878	.	.	ENSG00000145692	ENST00000274353;ENST00000524080	T;T	0.33865	1.42;1.39	5.55	4.38	0.52667	.	0.086125	0.85682	D	0.000000	T	0.28532	0.0706	M	0.70595	2.14	0.58432	D	0.999998	P;B	0.36599	0.56;0.182	B;B	0.24006	0.05;0.029	T	0.21621	-1.0240	10	0.02654	T	1	-19.2971	12.7653	0.57388	0.8628:0.1372:0.0:0.0	.	224;377	E5RJH0;Q93088	.;BHMT1_HUMAN	E	377;224	ENSP00000274353:K377E;ENSP00000428240:K224E	ENSP00000274353:K377E	K	+	1	0	BHMT	78462603	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.446000	0.80609	0.929000	0.37192	0.533000	0.62120	AAA	.		0.493	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226961.1	NM_001713	
MSH3	4437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	80040402	80040402	+	Silent	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:80040402G>A	ENST00000265081.6	+	12	1811	c.1731G>A	c.(1729-1731)aaG>aaA	p.K577K	MSH3_ENST00000512258.1_3'UTR	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	577					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		GGAAGTTAAAGAAGTGGGTGA	0.338								Mismatch excision repair (MMR)																													p.K577K	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.G1731A						.						22.0	25.0	24.0					5																	80040402		2200	4295	6495	SO:0001819	synonymous_variant	4437	exon12			GTTAAAGAAGTGG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.1731G>A	5.37:g.80040402G>A		Somatic	53	0		WXS	Illumina HiSeq	Phase_I	52	20	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	ENST00000265081.6	37	CCDS34195.1																																																																																			.		0.338	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
SOX30	11063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	157075894	157075894	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:157075894A>T	ENST00000265007.6	-	2	1319	c.978T>A	c.(976-978)gaT>gaA	p.D326E	SOX30_ENST00000311371.5_Missense_Mutation_p.D326E|SOX30_ENST00000519442.1_Missense_Mutation_p.D21E	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	326					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGAAGGGAGTATCTGGTATGC	0.428																																					p.D326E	Esophageal Squamous(31;525 799 19355 21125 41744)	.											.	SOX30-91	0			c.T978A						.						126.0	111.0	116.0					5																	157075894		2203	4300	6503	SO:0001583	missense	11063	exon2			GGGAGTATCTGGT	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.978T>A	5.37:g.157075894A>T	ENSP00000265007:p.Asp326Glu	Somatic	126	0		WXS	Illumina HiSeq	Phase_I	106	41	NM_178424	0	0	0	0	0	O94995|Q8IYX6	Missense_Mutation	SNP	ENST00000265007.6	37	CCDS4339.1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.588194	0.66105	.	.	ENSG00000039600	ENST00000311371;ENST00000265007;ENST00000519442	D;D;D	0.97976	-4.64;-4.3;-4.57	5.72	-2.31	0.06765	High mobility group, superfamily (1);	0.152930	0.45867	D	0.000328	D	0.95793	0.8631	N	0.08118	0	0.30089	N	0.808462	D;D;D	0.76494	0.999;0.99;0.983	D;D;P	0.78314	0.991;0.933;0.858	D	0.92745	0.6211	10	0.66056	D	0.02	.	14.1885	0.65623	0.5913:0.0:0.4087:0.0	.	21;326;326	B4DXW7;O94993-2;O94993	.;.;SOX30_HUMAN	E	326;326;21	ENSP00000309343:D326E;ENSP00000265007:D326E;ENSP00000427984:D21E	ENSP00000265007:D326E	D	-	3	2	SOX30	157008472	0.992000	0.36948	0.971000	0.41717	0.971000	0.66376	0.280000	0.18790	-0.732000	0.04856	-1.477000	0.00996	GAT	.		0.428	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017	
NHP2	55651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	177580732	177580732	+	Silent	SNP	G	G	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:177580732G>T	ENST00000274606.3	-	1	236	c.87C>A	c.(85-87)gtC>gtA	p.V29V	NHP2_ENST00000314397.4_Silent_p.V29V	NM_017838.3	NP_060308.1	Q9NX24	NHP2_HUMAN	NHP2 ribonucleoprotein	29					rRNA pseudouridine synthesis (GO:0031118)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|kidney(1)|ovary(2)	4						GGTTCTGGTTGACCAGCAGCT	0.662																																					p.V29V		.											.	NHP2-90	0			c.C87A						.						22.0	26.0	25.0					5																	177580732		2202	4299	6501	SO:0001819	synonymous_variant	55651	exon1			CTGGTTGACCAGC	AF161404	CCDS4432.1, CCDS34308.1	5q35.3	2014-09-17	2012-12-10	2008-10-13	ENSG00000145912	ENSG00000145912			14377	protein-coding gene	gene with protein product		606470	"""nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)"", ""NHP2 ribonucleoprotein homolog (yeast)"""	NOLA2		11074001	Standard	NM_017838		Approved	FLJ20479	uc003mir.2	Q9NX24	OTTHUMG00000130886	ENST00000274606.3:c.87C>A	5.37:g.177580732G>T		Somatic	70	1		WXS	Illumina HiSeq	Phase_I	39	20	NM_017838	0	0	70	128	58	A6NKY8|Q9P095	Silent	SNP	ENST00000274606.3	37	CCDS4432.1																																																																																			.		0.662	NHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253471.1	NM_017838	
MAML1	9794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	179193185	179193185	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:179193185G>T	ENST00000292599.3	+	2	1437	c.1174G>T	c.(1174-1176)Gag>Tag	p.E392*	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGGGCCTCAGAGCTGTCCTC	0.657																																					p.E392X		.											.	MAML1-848	0			c.G1174T						.						42.0	46.0	45.0					5																	179193185		2203	4300	6503	SO:0001587	stop_gained	9794	exon2			GCCTCAGAGCTGT	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1174G>T	5.37:g.179193185G>T	ENSP00000292599:p.Glu392*	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	104	28	NM_014757	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000292599.3	37	CCDS34315.1	.	.	.	.	.	.	.	.	.	.	G	39	7.386389	0.98252	.	.	ENSG00000161021	ENST00000292599;ENST00000376951	.	.	.	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-25.6288	18.0213	0.89255	0.0:0.0:1.0:0.0	.	.	.	.	X	392;429	.	ENSP00000292599:E392X	E	+	1	0	MAML1	179125791	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.169000	0.94788	2.250000	0.74265	0.305000	0.20034	GAG	.		0.657	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
TBC1D9B	23061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	179320371	179320371	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:179320371T>A	ENST00000356834.3	-	5	711	c.674A>T	c.(673-675)gAg>gTg	p.E225V	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.E225V	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	225						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAGAAGAGCTCCTGGTCGCG	0.607																																					p.E225V		.											.	TBC1D9B-154	0			c.A674T						.						86.0	76.0	79.0					5																	179320371		2203	4300	6503	SO:0001583	missense	23061	exon5			AAGAGCTCCTGGT	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.674A>T	5.37:g.179320371T>A	ENSP00000349291:p.Glu225Val	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	69	24	NM_198868	0	0	20	40	20	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	ENST00000356834.3	37	CCDS43408.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.196607	0.79015	.	.	ENSG00000197226	ENST00000356834;ENST00000355235	T;T	0.11712	2.75;2.84	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.26304	0.0642	L	0.58810	1.83	0.80722	D	1	D;D;P	0.69078	0.997;0.995;0.79	P;P;B	0.62649	0.87;0.905;0.441	T	0.01087	-1.1456	10	0.59425	D	0.04	-27.504	14.075	0.64885	0.0:0.0:0.0:1.0	.	225;225;225	A1L3A9;Q66K14-2;Q66K14	.;.;TBC9B_HUMAN	V	225	ENSP00000349291:E225V;ENSP00000347375:E225V	ENSP00000347375:E225V	E	-	2	0	TBC1D9B	179252977	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	7.791000	0.85805	1.929000	0.55896	0.260000	0.18958	GAG	.		0.607	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
TBC1D7	51256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	13307966	13307966	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr6:13307966A>C	ENST00000379300.3	-	6	774	c.531T>G	c.(529-531)ttT>ttG	p.F177L	TBC1D7_ENST00000607532.1_5'UTR|TBC1D7_ENST00000356436.4_Missense_Mutation_p.F177L|TBC1D7_ENST00000379307.2_Missense_Mutation_p.F150L|TBC1D7_ENST00000343141.4_Missense_Mutation_p.F131L|TBC1D7_ENST00000607658.1_Missense_Mutation_p.F150L	NM_001143964.2|NM_016495.4	NP_001137436.1|NP_057579.1	Q9P0N9	TBCD7_HUMAN	TBC1 domain family, member 7	177	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				activation of Rho GTPase activity (GO:0032862)|negative regulation of cilium assembly (GO:1902018)|negative regulation of TOR signaling (GO:0032007)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of Rab GTPase activity (GO:0032851)|response to growth factor (GO:0070848)	ciliary basal body (GO:0036064)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)	22	Breast(50;0.0296)|Ovarian(93;0.0339)	all_hematologic(90;0.135)	Epithelial(50;0.0784)|BRCA - Breast invasive adenocarcinoma(129;0.13)|all cancers(50;0.21)			AGTATTGTTCAAACGCTTTTG	0.398																																					p.F177L		.											.	TBC1D7-91	0			c.T531G						.						74.0	70.0	71.0					6																	13307966		2203	4300	6503	SO:0001583	missense	51256	exon6			TTGTTCAAACGCT	AF151073	CCDS4523.1, CCDS47376.1, CCDS58995.1	6p23	2013-07-10			ENSG00000145979	ENSG00000145979			21066	protein-coding gene	gene with protein product		612655				11042152, 17646400	Standard	XM_005249163		Approved	dJ257A7.3, FLJ32666	uc003nan.3	Q9P0N9	OTTHUMG00000014272	ENST00000379300.3:c.531T>G	6.37:g.13307966A>C	ENSP00000368602:p.Phe177Leu	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	85	26	NM_001143965	0	0	0	0	0	E7EV96|Q2TU37|Q53F44|Q5SZL7|Q86VM8|Q96MB8	Missense_Mutation	SNP	ENST00000379300.3	37	CCDS4523.1	.	.	.	.	.	.	.	.	.	.	A	6.453	0.451648	0.12223	.	.	ENSG00000145979	ENST00000334971;ENST00000356436;ENST00000379300;ENST00000379307;ENST00000343141;ENST00000452989;ENST00000450347;ENST00000422136;ENST00000446018;ENST00000420456	T;T;T;T;T;T;T;T;T	0.26660	2.42;2.42;2.42;2.42;2.42;2.42;2.42;2.42;1.72	6.17	1.03	0.20045	Rab-GAP/TBC domain (3);	0.105355	0.64402	D	0.000003	T	0.02970	0.0088	N	0.11154	0.105	0.48236	D	0.999617	B;B;B;B	0.09022	0.0;0.0;0.0;0.002	B;B;B;B	0.08055	0.0;0.003;0.001;0.002	T	0.35450	-0.9788	10	0.08837	T	0.75	-16.1625	5.7639	0.18215	0.5313:0.2616:0.2071:0.0	.	131;150;150;177	Q2TU37;Q5SZL5;Q9P0N9-2;Q9P0N9	.;.;.;TBCD7_HUMAN	L	118;177;177;150;131;150;150;177;150;150	ENSP00000348813:F177L;ENSP00000368602:F177L;ENSP00000368609:F150L;ENSP00000343100:F131L;ENSP00000414292:F150L;ENSP00000404680:F150L;ENSP00000394425:F177L;ENSP00000417005:F150L;ENSP00000412102:F150L	ENSP00000334212:F118L	F	-	3	2	TBC1D7	13415945	0.997000	0.39634	1.000000	0.80357	0.901000	0.52897	0.600000	0.24104	0.165000	0.19558	0.533000	0.62120	TTT	.		0.398	TBC1D7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039896.2	NM_016495	
AHI1	54806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	135644423	135644423	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr6:135644423C>A	ENST00000367800.4	-	23	3421	c.3205G>T	c.(3205-3207)Gaa>Taa	p.E1069*	AHI1_ENST00000417892.2_Nonsense_Mutation_p.E423*|AHI1_ENST00000457866.2_Nonsense_Mutation_p.E1069*	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	1069	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		ATGGTTAGTTCATCTGATCGA	0.438																																					p.E1069X		.											.	AHI1-227	0			c.G3205T						.						99.0	91.0	93.0					6																	135644423		1940	4132	6072	SO:0001587	stop_gained	54806	exon24			TTAGTTCATCTGA	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.3205G>T	6.37:g.135644423C>A	ENSP00000356774:p.Glu1069*	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	27	13	NM_017651	0	0	2	2	0	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Nonsense_Mutation	SNP	ENST00000367800.4	37	CCDS47483.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.418512|7.418512	0.98272|0.98272	.|.	.|.	ENSG00000135541|ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000417892;ENST00000265602|ENST00000367799	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.72606	.|0.3481	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68503	.|-0.5391	.|4	0.52906|.	T|.	0.07|.	-28.0524|-28.0524	20.6208|20.6208	0.99490|0.99490	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	1069;1069;423;1069|568	.|.	ENSP00000265602:E1069X|.	E|M	-|-	1|3	0|0	AHI1|AHI1	135686116|135686116	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.487000|7.487000	0.81328|0.81328	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GAA|ATG	.		0.438	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	
REPS1	85021	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	139251190	139251190	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr6:139251190G>C	ENST00000450536.2	-	9	1755	c.1181C>G	c.(1180-1182)gCt>gGt	p.A394G	REPS1_ENST00000415951.2_Missense_Mutation_p.A394G|REPS1_ENST00000367663.4_Missense_Mutation_p.A394G|REPS1_ENST00000409812.2_Missense_Mutation_p.A394G|REPS1_ENST00000258062.5_Missense_Mutation_p.A394G			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	394					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		AGGAGCTTCAGCAGGAGAGCC	0.418																																					p.A394G		.											.	REPS1-522	0			c.C1181G						.						146.0	123.0	131.0					6																	139251190		2203	4300	6503	SO:0001583	missense	85021	exon9			GCTTCAGCAGGAG		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1181C>G	6.37:g.139251190G>C	ENSP00000392065:p.Ala394Gly	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	107	49	NM_001128617	0	0	9	20	11	B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Missense_Mutation	SNP	ENST00000450536.2	37		.	.	.	.	.	.	.	.	.	.	G	14.17	2.454329	0.43634	.	.	ENSG00000135597	ENST00000450536;ENST00000367663;ENST00000529597;ENST00000409812;ENST00000258062;ENST00000415951;ENST00000367668	T;T;T;T;T;T	0.34667	1.37;1.35;1.37;1.37;1.37;1.36	5.72	5.72	0.89469	.	0.168464	0.53938	D	0.000060	T	0.17534	0.0421	L	0.36672	1.1	0.46749	D	0.999188	B;B;P;B;B	0.38504	0.005;0.007;0.634;0.002;0.361	B;B;B;B;B	0.33620	0.009;0.006;0.167;0.002;0.081	T	0.02691	-1.1123	10	0.24483	T	0.36	-10.4052	18.069	0.89399	0.0:0.0:1.0:0.0	.	394;342;394;394;394	Q96D71-3;B2R7D3;Q96D71-2;Q96D71;E9PMG1	.;.;.;REPS1_HUMAN;.	G	394;394;380;394;394;394;342	ENSP00000392065:A394G;ENSP00000356635:A394G;ENSP00000434251:A380G;ENSP00000386699:A394G;ENSP00000258062:A394G;ENSP00000397941:A394G	ENSP00000258062:A394G	A	-	2	0	REPS1	139292883	1.000000	0.71417	0.986000	0.45419	0.985000	0.73830	7.353000	0.79414	2.700000	0.92200	0.563000	0.77884	GCT	.		0.418	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3		
UST	10090	hgsc.bcm.edu	37	6	149068615	149068615	+	Missense_Mutation	SNP	C	C	T	rs559911654		TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr6:149068615C>T	ENST00000367463.4	+	1	152	c.49C>T	c.(49-51)Cat>Tat	p.H17Y		NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	17					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		TCCCTGGCCCCATGGGGCCCC	0.706													C|||	1	0.000199681	0.0	0.0	5008	,	,		9452	0.001		0.0	False		,,,				2504	0.0				p.H17Y		.											.	UST-92	0			c.C49T						.						5.0	7.0	7.0					6																	149068615		2063	4069	6132	SO:0001583	missense	10090	exon1			TGGCCCCATGGGG	AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.49C>T	6.37:g.149068615C>T	ENSP00000356433:p.His17Tyr	Somatic	7	2		WXS	Illumina HiSeq	Phase_I	7	5	NM_005715	0	0	0	1	1	B2RCX6	Missense_Mutation	SNP	ENST00000367463.4	37	CCDS5213.1	.	.	.	.	.	.	.	.	.	.	c	4.610	0.113276	0.08831	.	.	ENSG00000111962	ENST00000367463	T	0.47177	0.85	3.58	2.71	0.32032	.	0.732533	0.12547	N	0.459427	T	0.10551	0.0258	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24657	-1.0154	10	0.87932	D	0	-3.7085	5.6822	0.17782	0.0:0.75:0.0:0.2499	.	17	Q9Y2C2	UST_HUMAN	Y	17	ENSP00000356433:H17Y	ENSP00000356433:H17Y	H	+	1	0	UST	149110308	1.000000	0.71417	0.941000	0.38009	0.005000	0.04900	3.877000	0.56123	0.694000	0.31654	-0.157000	0.13467	CAT	.		0.706	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715	
HOXA3	3200	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	27147884	27147884	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr7:27147884G>A	ENST00000396352.4	-	3	1181	c.982C>T	c.(982-984)Cgc>Tgc	p.R328C	HOXA3_ENST00000521401.1_5'Flank|HOXA3_ENST00000317201.2_Missense_Mutation_p.R328C|HOXA-AS2_ENST00000518088.1_RNA	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	328					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						GCCGTGTAGCGCTTCTGTGGG	0.726																																					p.R328C	Esophageal Squamous(136;1368 1743 5685 7935 50360)	.											.	HOXA3-153	0			c.C982T						.						6.0	8.0	7.0					7																	27147884		2050	4012	6062	SO:0001583	missense	3200	exon3			TGTAGCGCTTCTG		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.982C>T	7.37:g.27147884G>A	ENSP00000379640:p.Arg328Cys	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	19	5	NM_030661	0	0	2	5	3	A4D181	Missense_Mutation	SNP	ENST00000396352.4	37	CCDS5404.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.104964	0.37145	.	.	ENSG00000105997	ENST00000396352;ENST00000317201;ENST00000396350	D;D	0.86769	-2.17;-2.17	5.68	4.8	0.61643	.	0.046305	0.85682	D	0.000000	D	0.89842	0.6832	M	0.79123	2.44	0.80722	D	1	D	0.62365	0.991	P	0.50231	0.635	D	0.90827	0.4713	10	0.87932	D	0	.	13.1397	0.59428	0.0:0.0:0.5656:0.4344	.	328	O43365	HXA3_HUMAN	C	328;328;170	ENSP00000379640:R328C;ENSP00000324884:R328C	ENSP00000324884:R328C	R	-	1	0	HOXA3	27114409	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	3.812000	0.55628	1.395000	0.46643	0.655000	0.94253	CGC	.		0.726	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2		
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	48411809	48411809	+	Silent	SNP	C	C	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr7:48411809C>A	ENST00000435803.1	+	33	10872	c.10848C>A	c.(10846-10848)gcC>gcA	p.A3616A		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3616					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATTTCCTGGCCTGGTTCCTGG	0.463																																					p.A3616A		.											.	ABCA13-521	0			c.C10848A						.						178.0	170.0	173.0					7																	48411809		2026	4187	6213	SO:0001819	synonymous_variant	154664	exon33			CCTGGCCTGGTTC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.10848C>A	7.37:g.48411809C>A		Somatic	98	0		WXS	Illumina HiSeq	Phase_I	84	32	NM_152701	0	0	0	0	0	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.463	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
TMEM139	135932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	142983611	142983611	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr7:142983611T>C	ENST00000359333.3	+	3	853	c.340T>C	c.(340-342)Tac>Cac	p.Y114H	CASP2_ENST00000392925.2_5'Flank|TMEM139_ENST00000409541.1_Missense_Mutation_p.Y114H|TMEM139_ENST00000409244.1_Missense_Mutation_p.Y114H|AC073342.12_ENST00000446192.1_RNA|TMEM139_ENST00000410004.1_Missense_Mutation_p.Y114H|AC073342.12_ENST00000427392.1_RNA|TMEM139_ENST00000409102.1_Missense_Mutation_p.Y114H|CASP2_ENST00000310447.5_5'Flank|TMEM139_ENST00000471161.1_3'UTR	NM_001242775.2|NM_001282876.1|NM_001282877.1	NP_001229704.1|NP_001269805.1|NP_001269806.1	Q8IV31	TM139_HUMAN	transmembrane protein 139	114						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(1)|prostate(1)	7	Melanoma(164;0.059)					ACCACCCCCCTACAGCACTGT	0.577																																					p.Y114H		.											.	TMEM139-90	0			c.T340C						.						72.0	77.0	75.0					7																	142983611		2203	4300	6503	SO:0001583	missense	135932	exon4			CCCCCCTACAGCA	AK075067	CCDS5878.1	7q34	2006-03-17			ENSG00000178826	ENSG00000178826			22058	protein-coding gene	gene with protein product							Standard	NM_153345		Approved	FLJ90586	uc003wck.4	Q8IV31	OTTHUMG00000152652	ENST00000359333.3:c.340T>C	7.37:g.142983611T>C	ENSP00000352284:p.Tyr114His	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	148	46	NM_001242773	0	0	34	73	39	B2RCL5|D3DXD4|Q6ZME2|Q8NC22|Q96AU8	Missense_Mutation	SNP	ENST00000359333.3	37	CCDS5878.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.391665	0.62066	.	.	ENSG00000178826	ENST00000409102;ENST00000359333;ENST00000409244;ENST00000409541;ENST00000410004	.	.	.	5.1	5.1	0.69264	.	0.000000	0.56097	D	0.000028	T	0.72423	0.3458	M	0.65498	2.005	0.36979	D	0.894208	D	0.89917	1.0	D	0.91635	0.999	T	0.79264	-0.1875	9	0.87932	D	0	-14.1344	11.6253	0.51142	0.0:0.0:0.0:1.0	.	114	Q8IV31	TM139_HUMAN	H	114	.	ENSP00000352284:Y114H	Y	+	1	0	TMEM139	142693733	0.999000	0.42202	0.998000	0.56505	0.511000	0.34104	3.868000	0.56055	2.076000	0.62316	0.456000	0.33151	TAC	.		0.577	TMEM139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327145.1	NM_153345	
CA8	767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	61192348	61192348	+	Silent	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr8:61192348C>T	ENST00000317995.4	-	2	456	c.192G>A	c.(190-192)tcG>tcA	p.S64S		NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	64					one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	CATCCAACAGCGAGGGGTCAT	0.473																																					p.S64S		.											.	CA8-90	0			c.G192A						.						92.0	86.0	88.0					8																	61192348		2203	4300	6503	SO:0001819	synonymous_variant	767	exon2			CAACAGCGAGGGG	L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.192G>A	8.37:g.61192348C>T		Somatic	104	0		WXS	Illumina HiSeq	Phase_I	103	66	NM_004056	0	0	0	0	0	A8K0A5|B3KQZ7|Q32MY2	Silent	SNP	ENST00000317995.4	37	CCDS6174.1																																																																																			.		0.473	CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383445.1		
ZC3H3	23144	hgsc.bcm.edu	37	8	144550696	144550696	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr8:144550696C>T	ENST00000262577.5	-	7	1992	c.1961G>A	c.(1960-1962)cGc>cAc	p.R654H		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	654					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			GGCCAGGCTGCGCTGCACTGC	0.677																																					p.R654H		.											.	ZC3H3-91	0			c.G1961A						.						24.0	30.0	28.0					8																	144550696		2191	4297	6488	SO:0001583	missense	23144	exon7			AGGCTGCGCTGCA	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.1961G>A	8.37:g.144550696C>T	ENSP00000262577:p.Arg654His	Somatic	17	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_015117	0	0	15	15	0	Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864699	0.91511	.	.	ENSG00000014164	ENST00000262577	T	0.04049	3.72	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000001	T	0.21267	0.0512	M	0.68952	2.095	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.00382	-1.1775	10	0.72032	D	0.01	-20.1301	18.3055	0.90179	0.0:1.0:0.0:0.0	.	654	Q8IXZ2	ZC3H3_HUMAN	H	654	ENSP00000262577:R654H	ENSP00000262577:R654H	R	-	2	0	ZC3H3	144621839	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	7.212000	0.77941	2.348000	0.79779	0.561000	0.74099	CGC	.		0.677	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117	
MAPK15	225689	hgsc.bcm.edu	37	8	144802400	144802400	+	Splice_Site	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr8:144802400A>G	ENST00000338033.4	+	8	841	c.722A>G	c.(721-723)gAc>gGc	p.D241G	RP11-429J17.5_ENST00000527908.1_RNA|MAPK15_ENST00000395108.2_Intron|MAPK15_ENST00000395107.4_Splice_Site_p.D258G	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	241	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCTGCCCCAGACCTCCTGGCT	0.682																																					p.D241G		.											.	MAPK15-1378	0			c.A722G						.						25.0	24.0	24.0					8																	144802400		2195	4292	6487	SO:0001630	splice_region_variant	225689	exon8			CCCCAGACCTCCT	AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.722-1A>G	8.37:g.144802400A>G		Somatic	12	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_139021	0	0	0	0	0	Q2TCF9|Q8N362	Missense_Mutation	SNP	ENST00000338033.4	37	CCDS6409.2	.	.	.	.	.	.	.	.	.	.	a	18.12	3.553270	0.65425	.	.	ENSG00000181085	ENST00000338033;ENST00000395107	T;T	0.67698	-0.28;-0.28	3.64	3.64	0.41730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.053347	0.64402	D	0.000001	T	0.76730	0.4028	M	0.63428	1.95	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.78455	-0.2197	10	0.87932	D	0	.	10.1299	0.42672	1.0:0.0:0.0:0.0	.	241	Q8TD08	MK15_HUMAN	G	241;258	ENSP00000337691:D241G;ENSP00000378539:D258G	ENSP00000337691:D241G	D	+	2	0	MAPK15	144874388	0.998000	0.40836	0.996000	0.52242	0.669000	0.39330	1.934000	0.40163	1.521000	0.48983	0.397000	0.26171	GAC	.		0.682	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000300348.1	NM_139021	Missense_Mutation
FBXO10	26267	hgsc.bcm.edu	37	9	37537315	37537315	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr9:37537315C>A	ENST00000432825.2	-	3	1259	c.1211G>T	c.(1210-1212)tGc>tTc	p.C404F	FBXO10_ENST00000541829.1_Intron|FBXO10_ENST00000543968.1_5'Flank|RP11-613M10.8_ENST00000544475.1_5'UTR	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	404					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		CAGCACTAGGCAGCTGGGCAG	0.592																																					p.C404F		.											.	FBXO10-637	0			c.G1211T						.						20.0	23.0	22.0					9																	37537315		2001	4173	6174	SO:0001583	missense	26267	exon3			ACTAGGCAGCTGG	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.1211G>T	9.37:g.37537315C>A	ENSP00000403802:p.Cys404Phe	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	26	2	NM_012166	0	0	0	0	0	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Missense_Mutation	SNP	ENST00000432825.2	37	CCDS47966.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.876989	0.33162	.	.	ENSG00000147912	ENST00000432825	T	0.43294	0.95	5.46	3.59	0.41128	Carbohydrate-binding/sugar hydrolysis domain (1);	0.267734	0.36134	N	0.002765	T	0.21103	0.0508	N	0.14661	0.345	0.80722	D	1	B	0.26775	0.159	B	0.20955	0.032	T	0.10154	-1.0642	10	0.52906	T	0.07	-29.5035	4.512	0.11915	0.1905:0.6273:0.0:0.1822	.	404	Q9UK96	FBX10_HUMAN	F	404	ENSP00000403802:C404F	ENSP00000276960:C404F	C	-	2	0	FBXO10	37527315	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	1.381000	0.34362	2.543000	0.85770	0.655000	0.94253	TGC	.		0.592	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3		
CBWD5	220869	hgsc.bcm.edu	37	9	70490003	70490003	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr9:70490003C>A	ENST00000382405.3	-	1	243	c.66G>T	c.(64-66)ttG>ttT	p.L22F	CBWD5_ENST00000429800.2_Missense_Mutation_p.L22F|CBWD5_ENST00000377384.1_Missense_Mutation_p.L22F|CBWD5_ENST00000377392.5_5'Flank|CBWD5_ENST00000377395.4_Missense_Mutation_p.L22F|CBWD5_ENST00000430059.2_Missense_Mutation_p.L22F			Q5RIA9	CBWD5_HUMAN	COBW domain containing 5	22							ATP binding (GO:0005524)								all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		CAATGGGAACCAATTCAGGAC	0.537																																					p.L22F		.											.	CBWD5-22	0			c.G66T						.						5.0	4.0	4.0					9																	70490003		1428	2636	4064	SO:0001583	missense	220869	exon1			GGGAACCAATTCA	BC067803, BC082271	CCDS75841.1, CCDS75843.1, CCDS75844.1	9q13	2005-08-23			ENSG00000147996	ENSG00000147996			24584	protein-coding gene	gene with protein product	"""dopamine responsive protein"""						Standard	XM_005272748		Approved		uc004ack.3	Q5RIA9	OTTHUMG00000013336	ENST00000382405.3:c.66G>T	9.37:g.70490003C>A	ENSP00000371842:p.Leu22Phe	Somatic	528	0		WXS	Illumina HiSeq	Phase_I	380	46	NM_001024916	0	0	32	33	1	Q8N7U8	Missense_Mutation	SNP	ENST00000382405.3	37		.	.	.	.	.	.	.	.	.	.	.	17.81	3.480990	0.63849	.	.	ENSG00000147996	ENST00000382405;ENST00000377395;ENST00000430059;ENST00000429800;ENST00000377384	T;T;T;T;T	0.53206	2.83;2.76;2.82;2.79;0.63	3.14	3.14	0.36123	.	0.000000	0.64402	D	0.000001	T	0.63331	0.2502	M	0.75884	2.315	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.65166	-0.6234	10	0.62326	D	0.03	-15.2117	7.7474	0.28877	0.2503:0.7497:0.0:0.0	.	22;22;22	B4DNG9;Q5RIA9-3;Q5RIA9	.;.;CBWD5_HUMAN	F	22	ENSP00000371842:L22F;ENSP00000366612:L22F;ENSP00000397999:L22F;ENSP00000405076:L22F;ENSP00000366601:L22F	ENSP00000366601:L22F	L	-	3	2	CBWD5	69729823	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.362000	0.52314	1.738000	0.51689	0.393000	0.25936	TTG	.		0.537	CBWD5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000037131.2		
TMEM245	23731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	111853340	111853340	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr9:111853340G>A	ENST00000374586.3	-	5	1043	c.1012C>T	c.(1012-1014)Cga>Tga	p.R338*		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	338						integral component of membrane (GO:0016021)											TCAGGCCTTCGTCTGCCCAGA	0.502																																					p.R338X		.											.	.	0			c.C1012T						.						102.0	105.0	104.0					9																	111853340		1918	4124	6042	SO:0001587	stop_gained	23731	exon5			GCCTTCGTCTGCC	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1012C>T	9.37:g.111853340G>A	ENSP00000363714:p.Arg338*	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	85	15	NM_032012	0	0	25	25	0	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Nonsense_Mutation	SNP	ENST00000374586.3	37	CCDS43858.1	.	.	.	.	.	.	.	.	.	.	G	36	5.709073	0.96821	.	.	ENSG00000106771	ENST00000374587;ENST00000374586;ENST00000223608	.	.	.	5.68	3.78	0.43462	.	0.612323	0.16965	N	0.192324	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.7849	16.3662	0.83325	0.0:0.2216:0.7784:0.0	.	.	.	.	X	338	.	ENSP00000223608:R338X	R	-	1	2	C9orf5	110893161	1.000000	0.71417	0.646000	0.29493	0.959000	0.62525	3.441000	0.52893	0.708000	0.31955	0.563000	0.77884	CGA	.		0.502	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053587.2	NM_032012	
C9orf171	389799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	135447853	135447853	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr9:135447853G>A	ENST00000343036.2	+	7	967	c.919G>A	c.(919-921)Gtg>Atg	p.V307M	C9orf171_ENST00000393216.2_Missense_Mutation_p.V271M	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	307										large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						AGAGTGTGCCGTGCGCCAGGG	0.602																																					p.V307M		.											.	C9orf171-157	0			c.G919A						.						54.0	52.0	53.0					9																	135447853		2203	4300	6503	SO:0001583	missense	389799	exon7			TGTGCCGTGCGCC	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.919G>A	9.37:g.135447853G>A	ENSP00000343290:p.Val307Met	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	62	32	NM_207417	0	0	0	0	0	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648988	0.67358	.	.	ENSG00000188523	ENST00000343036;ENST00000393216	T;T	0.24350	1.87;1.86	5.53	4.62	0.57501	.	0.411149	0.21865	N	0.067979	T	0.34193	0.0889	L	0.36672	1.1	0.21897	N	0.999488	D;D	0.76494	0.995;0.999	P;P	0.60117	0.578;0.869	T	0.07195	-1.0785	10	0.56958	D	0.05	.	10.6586	0.45690	0.0906:0.0:0.9094:0.0	.	271;307	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	M	307;271	ENSP00000343290:V307M;ENSP00000376909:V271M	ENSP00000343290:V307M	V	+	1	0	C9orf171	134437674	0.997000	0.39634	0.952000	0.39060	0.875000	0.50365	3.331000	0.52075	2.617000	0.88574	0.542000	0.68232	GTG	.		0.602	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417	
SNAPC4	6621	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139273027	139273027	+	Silent	SNP	C	C	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr9:139273027C>G	ENST00000298532.2	-	21	3620	c.3252G>C	c.(3250-3252)ggG>ggC	p.G1084G		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CAGGGAGAAGCCCCTGGGCTG	0.687																																					p.G1084G													.	SNAPC4-90	0			c.G3252C						.						6.0	7.0	7.0					9																	139273027		2086	4149	6235	SO:0001819	synonymous_variant	6621	exon21			GAGAAGCCCCTGG	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.3252G>C	9.37:g.139273027C>G		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	16	4	NM_003086	0	0	1	2	1		Silent	SNP	ENST00000298532.2	37	CCDS6998.1																																																																																			.		0.687	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055071.1	NM_003086	
CHDC2	286464	hgsc.bcm.edu	37	X	36103603	36103603	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chrX:36103603A>G	ENST00000313548.4	+	5	775	c.589A>G	c.(589-591)Aaa>Gaa	p.K197E		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	197						integral component of membrane (GO:0016021)											TAACCATGAAAAAAGGGTAAT	0.368																																					p.K197E		.											.	.	0			c.A589G						.						77.0	71.0	73.0					X																	36103603		2202	4300	6502	SO:0001583	missense	286464	exon5			CATGAAAAAAGGG	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.589A>G	X.37:g.36103603A>G	ENSP00000324767:p.Lys197Glu	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_173695	0	0	0	0	0		Missense_Mutation	SNP	ENST00000313548.4	37	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.721792	0.00092	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	0.158	0.158	0.14942	.	0.426104	0.20758	N	0.086213	T	0.16685	0.0401	N	0.14661	0.345	0.09310	N	1	P	0.34587	0.458	B	0.39152	0.292	T	0.31861	-0.9928	8	0.02654	T	1	.	.	.	.	.	197	Q8N9S7	CX059_HUMAN	E	197	.	ENSP00000324767:K197E	K	+	1	0	CXorf59	36013524	0.994000	0.37717	0.097000	0.21041	0.017000	0.09413	0.241000	0.18065	0.160000	0.19432	0.158000	0.16466	AAA	.		0.368	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695	
ZFY	7544	broad.mit.edu	37	Y	2843189	2843189	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chrY:2843189G>C	ENST00000155093.3	+	4	1009	c.688G>C	c.(688-690)Gca>Cca	p.A230P	ZFY-AS1_ENST00000417305.1_RNA|ZFY_ENST00000383052.1_Missense_Mutation_p.A230P|ZFY_ENST00000449237.1_Missense_Mutation_p.A204P|ZFY_ENST00000431102.1_Missense_Mutation_p.A39P	NM_003411.3	NP_003402.2	P08048	ZFY_HUMAN	zinc finger protein, Y-linked	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			biliary_tract(1)|kidney(3)|large_intestine(1)|lung(3)	8						GACCATCGATGCAGAATCAGA	0.398																																					p.A230P													.	.	0			c.G688C						.						103.0	103.0	103.0					Y																	2843189		614	1956	2570	SO:0001583	missense	7544	exon4			ATCGATGCAGAAT	L10393	CCDS14774.1, CCDS48200.1, CCDS48201.1	Yp11.3	2013-01-08			ENSG00000067646	ENSG00000067646		"""Zinc fingers, C2H2-type"""	12870	protein-coding gene	gene with protein product		490000				2497060	Standard	NM_001145275		Approved	ZNF911	uc004fqj.3	P08048	OTTHUMG00000036159	ENST00000155093.3:c.688G>C	Y.37:g.2843189G>C	ENSP00000155093:p.Ala230Pro	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	11	2	NM_003411	0	0	0	0	0	B4DVF7|Q14021|Q15558|Q1RME9|Q24JR0|Q96TF3	Missense_Mutation	SNP	ENST00000155093.3	37	CCDS14774.1																																																																																			.		0.398	ZFY-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088063.1	NM_003411	
NCDN	23154	hgsc.bcm.edu	37	1	36026434	36026444	+	Frame_Shift_Del	DEL	GATTTCCAGAA	GATTTCCAGAA	-			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	GATTTCCAGAA	GATTTCCAGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:36026434_36026444delGATTTCCAGAA	ENST00000373243.2	+	3	1065_1075	c.682_692delGATTTCCAGAA	c.(682-693)gatttccagaaafs	p.DFQK228fs	NCDN_ENST00000373253.3_Frame_Shift_Del_p.DFQK211fs|NCDN_ENST00000356090.4_Frame_Shift_Del_p.DFQK228fs|NCDN_ENST00000459931.1_3'UTR	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	228					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CCTCAGTGAGGATTTCCAGAAAGCTGAGGAT	0.654																																					p.228_231del		.											.	NCDN-155	0			c.682_692del						.																																			SO:0001589	frameshift_variant	23154	exon3			.	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.682_692delGATTTCCAGAA	1.37:g.36026434_36026444delGATTTCCAGAA	ENSP00000362340:p.Asp228fs	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	60	20	NM_014284	0	0	0	0	0	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Frame_Shift_Del	DEL	ENST00000373243.2	37	CCDS392.1																																																																																			.		0.654	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
OR2M2	391194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	248344277	248344277	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr1:248344277delA	ENST00000359682.2	+	1	990	c.990delA	c.(988-990)atafs	p.I330fs		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	330						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCTTTCTAATATCCATCTTTT	0.318																																					p.I330fs		.											.	OR2M2-72	0			c.990delA						.						164.0	175.0	171.0					1																	248344277		2203	4300	6503	SO:0001589	frameshift_variant	391194	exon1			.	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.990delA	1.37:g.248344277delA	ENSP00000352710:p.Ile330fs	Somatic	201	0		WXS	Illumina HiSeq	Phase_I	166	49	NM_001004688	0	0	0	0	0	A3KFT4	Frame_Shift_Del	DEL	ENST00000359682.2	37	CCDS31106.1																																																																																			.		0.318	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
ITFG1	81533	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	47189669	47189669	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr16:47189669delT	ENST00000320640.6	-	18	2028	c.1800delA	c.(1798-1800)aaafs	p.K600fs	RP11-329J18.2_ENST00000565694.1_RNA|ITFG1_ENST00000568047.1_5'UTR|ITFG1_ENST00000544001.2_3'UTR|RP11-329J18.2_ENST00000564705.1_RNA	NM_030790.3	NP_110417.2	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1	600						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	19		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				CTTCTTGTCGTTTTTCTCTAT	0.328																																					p.K600fs		.											.	ITFG1-91	0			c.1800delA						.						158.0	171.0	167.0					16																	47189669		2202	4300	6502	SO:0001589	frameshift_variant	81533	exon18			.	AF503339	CCDS10728.1	16q12.1	2008-02-05			ENSG00000129636	ENSG00000129636			30697	protein-coding gene	gene with protein product	"""T cell immunomodulatory protein"""	611803				12598909	Standard	NM_030790		Approved	CDA08, TIP	uc002eet.3	Q8TB96	OTTHUMG00000133103	ENST00000320640.6:c.1800delA	16.37:g.47189669delT	ENSP00000319918:p.Lys600fs	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	239	77	NM_030790	0	0	0	0	0	Q96SR4|Q9BRE2|Q9H2V9	Frame_Shift_Del	DEL	ENST00000320640.6	37	CCDS10728.1																																																																																			.		0.328	ITFG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256768.3	NM_030790	
FOXK2	3607	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	80543893	80543893	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr17:80543893delC	ENST00000335255.5	+	7	1567	c.1393delC	c.(1393-1395)ccafs	p.P466fs	RP13-638C3.3_ENST00000575085.1_RNA	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	466					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			GACCTCCCAGCCACCCGTCGT	0.632																																					p.P465fs		.											.	FOXK2-226	0			c.1393delC						.						69.0	56.0	60.0					17																	80543893		2200	4294	6494	SO:0001589	frameshift_variant	3607	exon7			.	U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.1393delC	17.37:g.80543893delC	ENSP00000335677:p.Pro466fs	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	70	22	NM_004514	0	0	0	0	0	A6NEP5|Q13622|Q13623|Q13624	Frame_Shift_Del	DEL	ENST00000335255.5	37	CCDS11813.1																																																																																			.		0.632	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277099.2	NM_181430	
ZNF814	730051	broad.mit.edu	37	19	58384658	58384660	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr19:58384658_58384660delCTT	ENST00000435989.2	-	3	2332_2334	c.2098_2100delAAG	c.(2098-2100)aagdel	p.K700del	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	700					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						GGAGGTGAGACTTCTTCTTAAAT	0.384																																					p.700_700del													.	.	0			c.2098_2100del						.																																			SO:0001651	inframe_deletion	730051	exon3			GTGAGACTTCTTC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2098_2100delAAG	19.37:g.58384664_58384666delCTT	ENSP00000410545:p.Lys700del	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	17	7	NM_001144989	0	0	0	0	0	A6NF35	In_Frame_Del	DEL	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.384	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ASTE1	28990	hgsc.bcm.edu	37	3	130743293	130743300	+	Frame_Shift_Del	DEL	TTCTCGAT	TTCTCGAT	-			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	TTCTCGAT	TTCTCGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr3:130743293_130743300delTTCTCGAT	ENST00000264992.3	-	3	1292_1299	c.851_858delATCGAGAA	c.(850-858)gatcgagaafs	p.DRE284fs	NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000356918.4_5'Flank|ASTE1_ENST00000514044.1_Frame_Shift_Del_p.DRE284fs|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000510688.1_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	284					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.R285*(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						CCTTAACATTTTCTCGATCCTTTTTTGG	0.447																																					p.284_286del		.											.	ASTE1-90	1	Substitution - Nonsense(1)	large_intestine(1)	c.851_858del						.																																			SO:0001589	frameshift_variant	28990	exon3			.	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.851_858delATCGAGAA	3.37:g.130743293_130743300delTTCTCGAT	ENSP00000264992:p.Asp284fs	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	66	20	NM_014065	0	0	0	0	0	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Frame_Shift_Del	DEL	ENST00000264992.3	37	CCDS3068.1																																																																																			.		0.447	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065	
ZNF292	23036	broad.mit.edu	37	6	87928395	87928395	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr6:87928395delA	ENST00000369577.3	+	4	527	c.484delA	c.(484-486)aaafs	p.K162fs	ZNF292_ENST00000339907.4_Frame_Shift_Del_p.K162fs|ZNF292_ENST00000369578.2_3'UTR	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	162						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TGGGGTGTGGAAAAACCCGGT	0.368																																					p.K162fs													.	ZNF292-72	0			c.484delA						.						42.0	41.0	42.0					6																	87928395		1826	4076	5902	SO:0001589	frameshift_variant	23036	exon4			GTGTGGAAAAACC	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.484delA	6.37:g.87928395delA	ENSP00000358590:p.Lys162fs	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	14	7	NM_015021	0	0	0	0	0	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Frame_Shift_Del	DEL	ENST00000369577.3	37	CCDS47457.1																																																																																			.		0.368	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
AIM1	202	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	106968989	106968991	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr6:106968989_106968991delTCT	ENST00000369066.3	+	2	3169_3171	c.2682_2684delTCT	c.(2680-2685)aatctt>aat	p.L896del		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AACAGTCAAATCTTCTGCCCGAC	0.463																																					p.894_895del		.											.	AIM1-139	0			c.2682_2684del						.																																			SO:0001651	inframe_deletion	202	exon2			.	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.2682_2684delTCT	6.37:g.106968992_106968994delTCT	ENSP00000358062:p.Leu896del	Somatic	196	0		WXS	Illumina HiSeq	Phase_I	148	55	NM_001624	0	0	0	0	0	Q6P2P0|Q9BTM3	In_Frame_Del	DEL	ENST00000369066.3	37	CCDS34506.1																																																																																			.		0.463	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
DMXL1	1657	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	118500212	118500213	+	Frame_Shift_Ins	INS	-	-	AGTCATTT			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr5:118500212_118500213insAGTCATTT	ENST00000311085.8	+	20	4793_4794	c.4713_4714insAGTCATTT	c.(4714-4716)agtfs	p.-1572fs	DMXL1_ENST00000539542.1_Frame_Shift_Ins_p.-1572fs	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1											breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GCCTGTCTACAAGTCATTTTGC	0.342																																					p.T1571fs		.											.	DMXL1-92	0			c.4713_4714insAGTCATTT						.																																			SO:0001589	frameshift_variant	1657	exon20			.	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.4714_4721dupAGTCATTT	5.37:g.118500213_118500220dupAGTCATTT	ENSP00000309690:p.Ser1572fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	62	20	NM_005509	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000311085.8	37	CCDS4125.1																																																																																			.		0.342	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
GPT	2875	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	145732311	145732312	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IZ-8195-01A-31D-2396-08	TCGA-IZ-8195-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcdb724c-08ad-42b7-9fef-e4d84edaf2fe	5d320b5a-a67a-4a11-908d-9c5e8c70e16a	g.chr8:145732311_145732312insA	ENST00000528431.1	+	12	1576_1577	c.1419_1420insA	c.(1420-1422)ttgfs	p.L474fs	MFSD3_ENST00000301327.4_5'Flank|GPT_ENST00000394955.2_Frame_Shift_Ins_p.L474fs			P24298	ALAT1_HUMAN	glutamic-pyruvate transaminase (alanine aminotransferase)	474					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|Phenelzine(DB00780)	TTCTGCCCCCCTTGGAGAAACT	0.629																																					p.P473fs		.											.	GPT-91	0			c.1419_1420insA						.																																			SO:0001589	frameshift_variant	2875	exon11			.		CCDS6430.1	8q24.3	2013-09-19			ENSG00000167701	ENSG00000167701	2.6.1.2		4552	protein-coding gene	gene with protein product		138200					Standard	NM_005309		Approved	ALT1, GPT1	uc003zdh.4	P24298	OTTHUMG00000165176	Exception_encountered	8.37:g.145732311_145732312insA	ENSP00000433586:p.Leu474fs	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	109	36	NM_005309	0	0	0	0	0	B0YJ18|D3DWM7|P78398|Q93076	Frame_Shift_Ins	INS	ENST00000528431.1	37	CCDS6430.1																																																																																			.		0.629	GPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382471.1		
