#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF365	22891	hgsc.bcm.edu;ucsc.edu	37	10	64415147	64415147	+	Silent	SNP	A	A	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr10:64415147A>T	ENST00000395251.1	+	4	481	c.147A>T	c.(145-147)ccA>ccT	p.P49P	ZNF365_ENST00000395249.1_Intron|ZNF365_ENST00000410046.3_Intron|AC067751.1_ENST00000579246.1_RNA	NM_199452.3	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365	49										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					TAAAGAAGCCACTGATGAAAC	0.478																																						.											0													72.0	68.0	70.0					10																	64415147		2203	4300	6503	SO:0001819	synonymous_variant	22891			AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395251.1:c.147A>T	10.37:g.64415147A>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000395251.1	37	CCDS7265.1																																																																																				0.478	ZNF365-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277036.1	NM_014951	
PTEN	5728	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	89717769	89717769	+	Missense_Mutation	SNP	T	T	A	rs121913289		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr10:89717769T>A	ENST00000371953.3	+	7	2151	c.794T>A	c.(793-795)cTa>cAa	p.L265Q	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	265	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.M264fs*8(2)|p.G165_*404del(1)|p.?(1)|p.D268fs*30(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AACAAGATGCTAAAAAAGGTT	0.348		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	51	Whole gene deletion(37)|Deletion - Frameshift(11)|Deletion - In frame(1)|Insertion - Frameshift(1)|Unknown(1)	prostate(16)|central_nervous_system(10)|skin(6)|lung(4)|ovary(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|endometrium(2)|urinary_tract(2)|soft_tissue(1)											83.0	77.0	79.0					10																	89717769		2203	4300	6503	SO:0001583	missense	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.794T>A	10.37:g.89717769T>A	ENSP00000361021:p.Leu265Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.374547	0.61735	.	.	ENSG00000171862	ENST00000371953	D	0.85339	-1.97	5.15	5.15	0.70609	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.111163	0.64402	D	0.000012	D	0.82346	0.5017	L	0.34521	1.04	0.48040	D	0.999571	B	0.33826	0.427	B	0.42827	0.399	T	0.79605	-0.1734	9	.	.	.	-6.9851	14.9657	0.71193	0.0:0.0:0.0:1.0	.	265	P60484	PTEN_HUMAN	Q	265	ENSP00000361021:L265Q	.	L	+	2	0	PTEN	89707749	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.661000	0.83786	1.928000	0.55862	0.477000	0.44152	CTA		0.348	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
KIF1B	23095	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	10364647	10364647	+	Intron	SNP	G	G	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr1:10364647G>T	ENST00000377086.1	+	22	2317				RN7SL731P_ENST00000584329.1_RNA|KIF1B_ENST00000263934.6_Intron|KIF1B_ENST00000377083.1_Missense_Mutation_p.R1135L|KIF1B_ENST00000377093.4_Missense_Mutation_p.R1135L|KIF1B_ENST00000377081.1_Intron			O60333	KIF1B_HUMAN	kinesin family member 1B						anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		ACACCTCCGCGGATGAGGAGA	0.468																																						.											0													45.0	43.0	44.0					1																	10364647		2203	4300	6503	SO:0001627	intron_variant	23095			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2115+7343G>T	1.37:g.10364647G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	25.9	4.680881	0.88542	.	.	ENSG00000054523	ENST00000377093;ENST00000377083	T;T	0.77750	-1.12;-1.12	5.99	5.99	0.97316	.	.	.	.	.	D	0.89389	0.6701	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	D	0.89498	0.3762	8	0.87932	D	0	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	1135	O60333-3	.	L	1135	ENSP00000366297:R1135L;ENSP00000366287:R1135L	ENSP00000366287:R1135L	R	+	2	0	KIF1B	10287234	1.000000	0.71417	0.964000	0.40570	0.989000	0.77384	9.131000	0.94446	2.840000	0.97914	0.655000	0.94253	CGG		0.468	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
POLA2	23649	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	11	65048558	65048558	+	Silent	SNP	G	G	A	rs372693281		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr11:65048558G>A	ENST00000265465.3	+	8	1371	c.840G>A	c.(838-840)tcG>tcA	p.S280S	POLA2_ENST00000541089.1_Silent_p.S72S	NM_002689.2	NP_002680.2	Q14181	DPOA2_HUMAN	polymerase (DNA directed), alpha 2, accessory subunit	280					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein import into nucleus, translocation (GO:0000060)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|protein heterodimerization activity (GO:0046982)			endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	11					Dacarbazine(DB00851)	AACATTCCTCGGGTGCTCAAA	0.512																																						.											0								G		2,4400	4.2+/-10.8	0,2,2199	152.0	145.0	148.0		840	-10.2	0.2	11		148	0,8594		0,0,4297	no	coding-synonymous	POLA2	NM_002689.2		0,2,6496	AA,AG,GG		0.0,0.0454,0.0154		280/599	65048558	2,12994	2201	4297	6498	SO:0001819	synonymous_variant	23649			BC002990	CCDS8098.1	11q13	2012-05-18	2012-05-18		ENSG00000014138	ENSG00000014138		"""DNA polymerases"""	30073	protein-coding gene	gene with protein product	"""DNA polymerase alpha subunit B"", ""DNA polymerase alpha 70 kDa subunit"""		"""polymerase (DNA directed), alpha 2 (70kD subunit)"""			8223465, 11433027	Standard	NM_002689		Approved	FLJ21662	uc001odj.3	Q14181	OTTHUMG00000165951	ENST00000265465.3:c.840G>A	11.37:g.65048558G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DNB4|Q9BPV3	Silent	SNP	ENST00000265465.3	37	CCDS8098.1																																																																																				0.512	POLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387223.1	NM_002689	
B4GALNT1	2583	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	58022926	58022926	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr12:58022926C>T	ENST00000341156.4	-	7	1300	c.716G>A	c.(715-717)cGg>cAg	p.R239Q	B4GALNT1_ENST00000550943.1_5'Flank|B4GALNT1_ENST00000449184.3_Intron|B4GALNT1_ENST00000418555.2_Missense_Mutation_p.R184Q	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	239					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GGTGGAGAACCGGACTGGGAA	0.532																																						.											0													62.0	57.0	58.0					12																	58022926		2203	4300	6503	SO:0001583	missense	2583			M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.716G>A	12.37:g.58022926C>T	ENSP00000341562:p.Arg239Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B4DE26|Q8N636	Missense_Mutation	SNP	ENST00000341156.4	37	CCDS8950.1	.	.	.	.	.	.	.	.	.	.	.	11.97	1.797113	0.31777	.	.	ENSG00000135454	ENST00000341156;ENST00000418555	T;T	0.17528	2.27;2.29	5.34	5.34	0.76211	.	0.210000	0.41097	D	0.000952	T	0.07007	0.0178	N	0.10916	0.065	0.80722	D	1	B;B	0.30439	0.279;0.085	B;B	0.17979	0.02;0.007	T	0.25257	-1.0137	10	0.07482	T	0.82	-3.0107	10.1216	0.42623	0.0:0.9087:0.0:0.0913	.	184;239	B4DE26;Q00973	.;B4GN1_HUMAN	Q	239;184	ENSP00000341562:R239Q;ENSP00000401601:R184Q	ENSP00000341562:R239Q	R	-	2	0	B4GALNT1	56309193	0.945000	0.32115	1.000000	0.80357	0.992000	0.81027	1.769000	0.38522	2.522000	0.85027	0.655000	0.94253	CGG		0.532	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407853.1	NM_001478	
KIAA1033	23325	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	12	105504982	105504982	+	Silent	SNP	C	C	T	rs368178226		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr12:105504982C>T	ENST00000332180.5	+	2	228	c.141C>T	c.(139-141)gaC>gaT	p.D47D		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						GAATTGAGGACGCTCTGGATG	0.303																																						.											0								C		1,3617		0,1,1808	77.0	72.0	74.0		141	-10.7	0.4	12		74	0,8136		0,0,4068	no	coding-synonymous	KIAA1033	NM_015275.1		0,1,5876	TT,TC,CC		0.0,0.0276,0.0085		47/1174	105504982	1,11753	1809	4068	5877	SO:0001819	synonymous_variant	23325			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.141C>T	12.37:g.105504982C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000332180.5	37	CCDS41826.1																																																																																				0.303	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
MTMR10	54893	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	15	31234179	31234179	+	Missense_Mutation	SNP	A	A	T	rs377638176		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr15:31234179A>T	ENST00000435680.1	-	16	1925	c.1828T>A	c.(1828-1830)Tta>Ata	p.L610I	MTMR10_ENST00000425768.1_3'UTR|FAN1_ENST00000362065.4_3'UTR|MTMR10_ENST00000314404.8_Intron	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	610	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		TTTGGTTTTAATATCAATGAA	0.438																																						.											0													175.0	180.0	178.0					15																	31234179		1939	4133	6072	SO:0001583	missense	54893			AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.1828T>A	15.37:g.31234179A>T	ENSP00000402537:p.Leu610Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P4Q6	Missense_Mutation	SNP	ENST00000435680.1	37	CCDS45204.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.831740	0.50845	.	.	ENSG00000166912	ENST00000435680	T	0.50813	0.73	5.67	-11.3	0.00108	Myotubularin phosphatase domain (1);	.	.	.	.	T	0.52597	0.1744	M	0.67953	2.075	0.22719	N	0.998815	D	0.53312	0.959	P	0.53224	0.721	T	0.67507	-0.5653	9	0.33141	T	0.24	.	17.8796	0.88837	0.1273:0.1655:0.7071:0.0	.	610	Q9NXD2	MTMRA_HUMAN	I	610	ENSP00000402537:L610I	ENSP00000402537:L610I	L	-	1	2	MTMR10	29021471	0.000000	0.05858	0.000000	0.03702	0.806000	0.45545	-0.907000	0.04067	-2.442000	0.00549	0.533000	0.62120	TTA		0.438	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430747.1	NM_017762	
IQGAP1	8826	broad.mit.edu;hgsc.bcm.edu	37	15	91030265	91030277	+	Frame_Shift_Del	DEL	GTTCGACGTGCCT	GTTCGACGTGCCT	-	rs368968167|rs528193427|rs181919733|rs201241538		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	GTTCGACGTGCCT	GTTCGACGTGCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr15:91030265_91030277delGTTCGACGTGCCT	ENST00000268182.5	+	32	4228_4240	c.4104_4116delGTTCGACGTGCCT	c.(4102-4116)aagttcgacgtgcctfs	p.KFDVP1368fs	IQGAP1_ENST00000560738.1_Frame_Shift_Del_p.KFDVP796fs	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1368	C2.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)	p.D1370D(1)		breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TGACCAACAAGTTCGACGTGCCTGGAGATGAGA	0.451																																						.											1	Substitution - coding silent(1)	endometrium(1)																																								SO:0001589	frameshift_variant	8826			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.4104_4116delGTTCGACGTGCCT	15.37:g.91030265_91030277delGTTCGACGTGCCT	ENSP00000268182:p.Lys1368fs	Somatic		WXS	Illumina HiSeq	Phase_I	A7MBM3	Frame_Shift_Del	DEL	ENST00000268182.5	37	CCDS10362.1																																																																																				0.451	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
TP53	7157	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	7577594	7577594	+	Nonsense_Mutation	SNP	A	A	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:7577594A>T	ENST00000269305.4	-	7	876	c.687T>A	c.(685-687)tgT>tgA	p.C229*	TP53_ENST00000413465.2_Nonsense_Mutation_p.C229*|TP53_ENST00000359597.4_Nonsense_Mutation_p.C229*|TP53_ENST00000455263.2_Nonsense_Mutation_p.C229*|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Nonsense_Mutation_p.C229*|TP53_ENST00000420246.2_Nonsense_Mutation_p.C229*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	229	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> G (in a sporadic cancer; somatic mutation).|C -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C229fs*10(9)|p.0?(8)|p.?(5)|p.C229*(3)|p.C229_H233delCTTIH(2)|p.T230fs*9(1)|p.C229fs*1(1)|p.C229_T230insX(1)|p.C229C(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.C229_I232del(1)|p.S227_I232delSDCTTI(1)|p.C136fs*10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGATGGTGGTACAGTCAGAGC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	36	Deletion - Frameshift(13)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(4)|Substitution - Nonsense(3)|Insertion - In frame(1)|Complex - frameshift(1)|Substitution - coding silent(1)	ovary(7)|biliary_tract(6)|breast(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|oesophagus(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|stomach(1)|thymus(1)|large_intestine(1)|urinary_tract(1)|lung(1)|liver(1)	GRCh37	CD076915	TP53	D							104.0	85.0	91.0					17																	7577594		2203	4300	6503	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.687T>A	17.37:g.7577594A>T	ENSP00000269305:p.Cys229*	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.745334	0.89663	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	4.48	-0.453	0.12201	.	0.350628	0.33346	N	0.005002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-0.3974	8.2175	0.31521	0.612:0.0:0.388:0.0	.	.	.	.	X	229;229;229;229;229;229;218;136;97;136	.	ENSP00000269305:C229X	C	-	3	2	TP53	7518319	0.331000	0.24713	0.231000	0.23993	0.944000	0.59088	0.148000	0.16224	-0.212000	0.10109	0.379000	0.24179	TGT		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TP53	7157	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:7578235T>C	ENST00000269305.4	-	6	803	c.614A>G	c.(613-615)tAt>tGt	p.Y205C	TP53_ENST00000413465.2_Missense_Mutation_p.Y205C|TP53_ENST00000359597.4_Missense_Mutation_p.Y205C|TP53_ENST00000455263.2_Missense_Mutation_p.Y205C|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.Y205C|TP53_ENST00000420246.2_Missense_Mutation_p.Y205C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATCCAAATACTCCACACG	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	117	Substitution - Missense(102)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(1)|Deletion - Frameshift(1)	lung(20)|upper_aerodigestive_tract(19)|central_nervous_system(10)|large_intestine(9)|biliary_tract(8)|breast(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|urinary_tract(5)|bone(5)|soft_tissue(4)|oesophagus(4)|stomach(3)|liver(3)|pancreas(2)|vulva(1)|skin(1)|prostate(1)											136.0	121.0	126.0					17																	7578235		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.614A>G	17.37:g.7578235T>C	ENSP00000269305:p.Tyr205Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490024	0.64074	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88906	2.99	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.995;0.998;0.995;0.997;0.999;0.997;0.996	D	0.97320	0.9943	10	0.87932	D	0	-5.8058	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205C;ENSP00000352610:Y205C;ENSP00000269305:Y205C;ENSP00000398846:Y205C;ENSP00000391127:Y205C;ENSP00000391478:Y205C;ENSP00000425104:Y73C;ENSP00000423862:Y112C	ENSP00000269305:Y205C	Y	-	2	0	TP53	7518960	1.000000	0.71417	0.137000	0.22149	0.045000	0.14185	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	TAT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TP53	7157	hgsc.bcm.edu;mdanderson.org	37	17	7579312	7579312	+	Splice_Site	SNP	C	C	T	rs55863639		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:7579312C>T	ENST00000269305.4	-	4	564	c.375G>A	c.(373-375)acG>acA	p.T125T	TP53_ENST00000413465.2_Splice_Site_p.T125T|TP53_ENST00000359597.4_Splice_Site_p.T125T|TP53_ENST00000455263.2_Splice_Site_p.T125T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site_p.T125T|TP53_ENST00000420246.2_Splice_Site_p.T125T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	125	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125T(51)|p.0?(8)|p.?(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAACTGACCGTGCAAGTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	66	Substitution - coding silent(51)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Insertion - In frame(1)	lung(21)|haematopoietic_and_lymphoid_tissue(14)|large_intestine(8)|upper_aerodigestive_tract(7)|bone(4)|central_nervous_system(3)|biliary_tract(3)|stomach(1)|liver(1)|urinary_tract(1)|kidney(1)|ovary(1)|pancreas(1)	GRCh37	CS004351|CS011573|CS971913	TP53	S	rs55863639						66.0	61.0	63.0					17																	7579312		2203	4300	6503	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>A	17.37:g.7579312C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	ENST00000269305.4	37	CCDS11118.1																																																																																				0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Silent
ZNF225	7768	broad.mit.edu;hgsc.bcm.edu	37	19	44635141	44635142	+	Frame_Shift_Ins	INS	-	-	CAAA			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:44635141_44635142insCAAA	ENST00000262894.6	+	5	654_655	c.374_375insCAAA	c.(373-378)tccaaafs	p.-127fs	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Frame_Shift_Ins_p.-127fs	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				TTTCAGTTCTCCAAACAAGATG	0.421																																						.											0																																										SO:0001589	frameshift_variant	7768			AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.375_378dupCAAA	19.37:g.44635142_44635145dupCAAA	ENSP00000262894:p.Gln127fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8S2|Q53F12|Q9NS46|Q9UID8	Frame_Shift_Ins	INS	ENST00000262894.6	37	CCDS46100.1																																																																																				0.421	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
PAXBP1	94104	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	21	34134451	34134451	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr21:34134451G>T	ENST00000331923.4	-	4	1016	c.827C>A	c.(826-828)tCt>tAt	p.S276Y	PAXBP1_ENST00000472588.1_5'UTR|PAXBP1_ENST00000290178.4_Missense_Mutation_p.S276Y	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	276					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTCTTTCACAGAAAAAACTAT	0.368																																						.											0													119.0	121.0	120.0					21																	34134451		2203	4300	6503	SO:0001583	missense	94104			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.827C>A	21.37:g.34134451G>T	ENSP00000328992:p.Ser276Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DSE7|Q96DU8|Q9NYQ0	Missense_Mutation	SNP	ENST00000331923.4	37	CCDS13619.1	.	.	.	.	.	.	.	.	.	.	G	32	5.119781	0.94385	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	T;T	0.31510	1.92;1.49	5.98	5.98	0.97165	.	0.162808	0.56097	D	0.000027	T	0.55689	0.1936	M	0.70595	2.14	0.54753	D	0.999981	D;P	0.63880	0.993;0.956	D;P	0.63192	0.912;0.459	T	0.51795	-0.8660	10	0.52906	T	0.07	-16.743	20.0532	0.97636	0.0:0.0:1.0:0.0	.	276;276	Q9Y5B6-2;Q9Y5B6	.;GCFC1_HUMAN	Y	276	ENSP00000328992:S276Y;ENSP00000290178:S276Y	ENSP00000290178:S276Y	S	-	2	0	GCFC1	33056322	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.592000	0.82676	2.835000	0.97688	0.650000	0.86243	TCT		0.368	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139563.1	NM_013329	
MCM3AP	8888	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	21	47705096	47705096	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr21:47705096T>A	ENST00000397708.1	-	2	359	c.105A>T	c.(103-105)caA>caT	p.Q35H	YBEY_ENST00000397692.1_5'Flank|YBEY_ENST00000397691.1_5'Flank|YBEY_ENST00000329319.3_5'Flank|YBEY_ENST00000397694.1_5'Flank|MCM3AP_ENST00000291688.1_Missense_Mutation_p.Q35H|YBEY_ENST00000397701.4_5'Flank|YBEY_ENST00000339195.6_5'Flank			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	35	FG-repeats.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AAAGAGAAGGTTGACCAAATC	0.458																																						.											0													74.0	76.0	75.0					21																	47705096		2203	4300	6503	SO:0001583	missense	8888			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.105A>T	21.37:g.47705096T>A	ENSP00000380820:p.Gln35His	Somatic		WXS	Illumina HiSeq	Phase_I	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	T	18.44	3.624840	0.66901	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000426537	T;T	0.08984	3.03;3.03	5.04	1.0	0.19881	.	0.194568	0.45606	D	0.000358	T	0.10551	0.0258	L	0.29908	0.895	0.34028	D	0.653468	P	0.50710	0.938	P	0.54499	0.754	T	0.17868	-1.0355	10	0.87932	D	0	-14.0114	7.4203	0.27067	0.0:0.4632:0.0:0.5368	.	35	O60318	MCM3A_HUMAN	H	35	ENSP00000380820:Q35H;ENSP00000291688:Q35H	ENSP00000291688:Q35H	Q	-	3	2	MCM3AP	46529524	1.000000	0.71417	0.969000	0.41365	0.973000	0.67179	0.443000	0.21644	-0.005000	0.14395	0.459000	0.35465	CAA		0.458	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
OR5H15	403274	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	97888186	97888186	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr3:97888186C>G	ENST00000356526.2	+	1	643	c.643C>G	c.(643-645)Ctt>Gtt	p.L215V		NM_001005515.1	NP_001005515.1	A6NDH6	O5H15_HUMAN	olfactory receptor, family 5, subfamily H, member 15	215						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(2)|stomach(1)	35						TGTGACTATTCTTATATCTTA	0.343																																						.											0													58.0	65.0	62.0					3																	97888186		2203	4300	6503	SO:0001583	missense	403274				CCDS33799.1	3q11.2	2013-09-23			ENSG00000233412	ENSG00000233412		"""GPCR / Class A : Olfactory receptors"""	31287	protein-coding gene	gene with protein product							Standard	NM_001005515		Approved		uc011bgu.2	A6NDH6	OTTHUMG00000160076	ENST00000356526.2:c.643C>G	3.37:g.97888186C>G	ENSP00000373195:p.Leu215Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000356526.2	37	CCDS33799.1	.	.	.	.	.	.	.	.	.	.	-	4.264	0.048137	0.08243	.	.	ENSG00000233412	ENST00000356526;ENST00000454529	T	0.00051	8.81	2.48	0.494	0.16884	GPCR, rhodopsin-like superfamily (1);	0.171635	0.28026	N	0.016891	T	0.00144	0.0004	L	0.52759	1.655	0.09310	N	1	B	0.29671	0.254	B	0.37387	0.248	T	0.26360	-1.0105	10	0.59425	D	0.04	.	5.0095	0.14304	0.0:0.631:0.2238:0.1452	.	215	A6NDH6	O5H15_HUMAN	V	215	ENSP00000373195:L215V	ENSP00000373195:L215V	L	+	1	0	OR5H15	99370876	0.000000	0.05858	0.004000	0.12327	0.012000	0.07955	-1.111000	0.03303	0.344000	0.23847	0.184000	0.17185	CTT		0.343	OR5H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359109.1		
PCDHA8	56140	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	5	140221090	140221090	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr5:140221090C>T	ENST00000531613.1	+	1	184	c.184C>T	c.(184-186)Cgc>Tgc	p.R62C	PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.R62C|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	62	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGTGCCGCGCCTGTTCCG	0.637																																						.											0													38.0	52.0	47.0					5																	140221090		2203	4296	6499	SO:0001583	missense	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.184C>T	5.37:g.140221090C>T	ENSP00000434655:p.Arg62Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191550	0.58017	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.42131	0.98;0.98	3.95	3.0	0.34707	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.34411	U	0.003997	T	0.69097	0.3073	H	0.98965	4.385	0.24184	N	0.995573	D;D	0.65815	0.995;0.994	P;P	0.52454	0.699;0.574	T	0.69691	-0.5077	10	0.87932	D	0	.	11.4118	0.49929	0.3094:0.6906:0.0:0.0	.	62;62	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	C	62	ENSP00000434655:R62C;ENSP00000367363:R62C	ENSP00000367363:R62C	R	+	1	0	PCDHA8	140201274	0.010000	0.17322	1.000000	0.80357	0.983000	0.72400	0.201000	0.17276	1.905000	0.55150	0.557000	0.71058	CGC		0.637	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
CDKN1A	1026	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	36652171	36652171	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr6:36652171C>A	ENST00000405375.1	+	2	528	c.293C>A	c.(292-294)tCa>tAa	p.S98*	CDKN1A_ENST00000448526.2_Nonsense_Mutation_p.S132*|CDKN1A_ENST00000373711.2_Nonsense_Mutation_p.S98*|CDKN1A_ENST00000244741.5_Nonsense_Mutation_p.S98*|CDKN1A_ENST00000478800.1_3'UTR	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	98					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						CCTGGCACCTCACCTGCTCTG	0.672																																						.											0													32.0	32.0	32.0					6																	36652171		2203	4300	6503	SO:0001587	stop_gained	1026			U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.293C>A	6.37:g.36652171C>A	ENSP00000384849:p.Ser98*	Somatic		WXS	Illumina HiSeq	Phase_I	Q14010|Q6FI05|Q9BUT4	Nonsense_Mutation	SNP	ENST00000405375.1	37	CCDS4824.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.316242	0.40996	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	.	.	.	5.23	5.23	0.72850	.	0.000000	0.47852	D	0.000212	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-11.3875	14.1752	0.65537	0.0:1.0:0.0:0.0	.	.	.	.	X	132;98;98;98	.	ENSP00000244741:S98X	S	+	2	0	CDKN1A	36760149	0.052000	0.20516	0.063000	0.19743	0.107000	0.19398	2.394000	0.44450	2.724000	0.93272	0.561000	0.74099	TCA		0.672	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467	
AKAP12	9590	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	6	151671482	151671482	+	Silent	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr6:151671482A>G	ENST00000253332.1	+	3	2145	c.1956A>G	c.(1954-1956)gaA>gaG	p.E652E	AKAP12_ENST00000359755.5_Silent_p.E547E|AKAP12_ENST00000402676.2_Silent_p.E652E|AKAP12_ENST00000354675.6_Silent_p.E554E			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	652					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CAGCCTCTGAAATGCAAGAAG	0.493																																					Melanoma(141;1616 1805 10049 24534 51979)	.											0													73.0	71.0	72.0					6																	151671482		2203	4300	6503	SO:0001819	synonymous_variant	9590			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.1956A>G	6.37:g.151671482A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	37	CCDS5229.1																																																																																				0.493	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
KRIT1	889	hgsc.bcm.edu;ucsc.edu	37	7	91851360	91851360	+	Silent	SNP	T	T	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr7:91851360T>C	ENST00000340022.2	-	14	2437	c.1419A>G	c.(1417-1419)caA>caG	p.Q473Q	KRIT1_ENST00000394505.2_Silent_p.Q473Q|KRIT1_ENST00000394503.2_Silent_p.Q425Q|KRIT1_ENST00000394507.1_Silent_p.Q473Q|KRIT1_ENST00000412043.2_Silent_p.Q473Q	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	473	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATGGTTTGAGTTGAAGGCCTG	0.348																																						.											0													101.0	101.0	101.0					7																	91851360		2203	4300	6503	SO:0001819	synonymous_variant	889			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.1419A>G	7.37:g.91851360T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Silent	SNP	ENST00000340022.2	37	CCDS5624.1																																																																																				0.348	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253910.1		
CCDC180	100499483	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	100126382	100126382	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:100126382C>T	ENST00000357054.1	+	41	4854	c.3919C>T	c.(3919-3921)Ctt>Ttt	p.L1307F	CCDC180_ENST00000529487.1_Missense_Mutation_p.L1362F|MIR1302-8_ENST00000408342.1_RNA|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.L1362F|CCDC180_ENST00000395220.1_3'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1307						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GTACCGGGTGCTTGGGGACAA	0.557																																						.											0													58.0	51.0	54.0					9																	100126382		2203	4300	6503	SO:0001583	missense	100499483			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3919C>T	9.37:g.100126382C>T	ENSP00000349562:p.Leu1307Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	37		.	.	.	.	.	.	.	.	.	.	C	6.712	0.500137	0.12762	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000529487	T;T;T	0.05717	3.4;3.46;3.46	4.72	3.81	0.43845	.	0.225624	0.34362	N	0.004021	T	0.04407	0.0121	L	0.35288	1.05	0.80722	D	1	B;B	0.23854	0.043;0.092	B;B	0.20184	0.019;0.028	T	0.35351	-0.9792	10	0.10111	T	0.7	-12.1648	7.8778	0.29603	0.0:0.8917:0.0:0.1083	.	1501;1307	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	F	1307;1362;1362	ENSP00000349562:L1307F;ENSP00000364348:L1362F;ENSP00000434727:L1362F	ENSP00000349562:L1307F	L	+	1	0	C9orf174	99166203	0.981000	0.34729	0.992000	0.48379	0.518000	0.34316	1.281000	0.33214	2.560000	0.86352	0.655000	0.94253	CTT		0.557	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
OR1Q1	158131	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	125377830	125377830	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:125377830C>T	ENST00000297913.2	+	1	883	c.814C>T	c.(814-816)Cgc>Tgc	p.R272C	RP11-64P14.7_ENST00000431442.1_RNA	NM_012364.1	NP_036496.1	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q, member 1	272					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	17						GACCAAGGGTCGCATTATAAC	0.527																																						.											0													66.0	64.0	65.0					9																	125377830		2203	4300	6503	SO:0001583	missense	158131				CCDS35125.1	9q33.2	2013-09-20			ENSG00000165202	ENSG00000165202		"""GPCR / Class A : Olfactory receptors"""	8223	protein-coding gene	gene with protein product				OR1Q2, OR1Q3			Standard	NM_012364		Approved	OST226, OR9-A, HSTPCR106, OST226OR9-A, TPCR106	uc011lyy.2	Q15612	OTTHUMG00000020615	ENST00000297913.2:c.814C>T	9.37:g.125377830C>T	ENSP00000297913:p.Arg272Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFN4|Q8NGR7|Q96R82	Missense_Mutation	SNP	ENST00000297913.2	37	CCDS35125.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572804	0.28092	.	.	ENSG00000165202	ENST00000297913	T	0.00130	8.69	5.57	4.67	0.58626	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000117	T	0.00552	0.0018	M	0.88640	2.97	0.19300	N	0.99997	D	0.89917	1.0	D	0.78314	0.991	T	0.29397	-1.0013	10	0.66056	D	0.02	-7.5851	13.5884	0.61944	0.1563:0.8437:0.0:0.0	.	272	Q15612	OR1Q1_HUMAN	C	272	ENSP00000297913:R272C	ENSP00000297913:R272C	R	+	1	0	OR1Q1	124417651	0.000000	0.05858	0.103000	0.21229	0.226000	0.24999	0.473000	0.22132	1.569000	0.49696	0.650000	0.86243	CGC		0.527	OR1Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053946.1		
SPATA31E1	286234	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	9	90502738	90502738	+	Silent	SNP	G	G	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:90502738G>T	ENST00000325643.5	+	4	3402	c.3336G>T	c.(3334-3336)ctG>ctT	p.L1112L		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1112					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGGAGCAGCTGCCAGGCCGTG	0.637																																						.											0													36.0	39.0	38.0					9																	90502738		2203	4300	6503	SO:0001819	synonymous_variant	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.3336G>T	9.37:g.90502738G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	ENST00000325643.5	37	CCDS6676.1																																																																																				0.637	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
NR5A1	2516	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	9	127262905	127262905	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:127262905G>T	ENST00000373588.4	-	4	530	c.334C>A	c.(334-336)Cag>Aag	p.Q112K		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	112					adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						GCCCGAATCTGTGCCTTCTTC	0.677																																						.											0													38.0	41.0	40.0					9																	127262905		2138	4122	6260	SO:0001583	missense	2516			D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.334C>A	9.37:g.127262905G>T	ENSP00000362690:p.Gln112Lys	Somatic		WXS	Illumina HiSeq	Phase_I	O15196|Q5T6F5	Missense_Mutation	SNP	ENST00000373588.4	37	CCDS6856.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974805	0.34848	.	.	ENSG00000136931	ENST00000373588;ENST00000455734	D;D	0.93906	-3.31;-3.31	4.54	2.67	0.31697	Nuclear hormone receptor, ligand-binding (1);	0.218465	0.38778	N	0.001565	D	0.84151	0.5409	L	0.29908	0.895	0.28408	N	0.91831	B	0.06786	0.001	B	0.04013	0.001	T	0.67405	-0.5679	10	0.05525	T	0.97	.	7.0038	0.24826	0.2787:0.0:0.7213:0.0	.	112	Q13285	STF1_HUMAN	K	112	ENSP00000362690:Q112K;ENSP00000393245:Q112K	ENSP00000362690:Q112K	Q	-	1	0	NR5A1	126302726	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.343000	0.44001	0.897000	0.36392	0.561000	0.74099	CAG		0.677	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959	
FIGNL2	401720	hgsc.bcm.edu;mdanderson.org	37	12	52215205	52215205	+	lincRNA	SNP	C	C	T	rs116545797	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr12:52215205C>T	ENST00000562343.2	+	0	4188				RP11-923I11.4_ENST00000567167.1_lincRNA																							AGCCCAGGACCTTGAGGGGGA	0.731													C|||	398	0.0794728	0.1422	0.0331	5008	,	,		8514	0.0377		0.0358	False		,,,				2504	0.1155					.											0								C		210,2610		0,210,1200	2.0	3.0	3.0		993	-0.3	1.0	12	dbSNP_132	3	118,6564		0,118,3223	no	coding-synonymous	FIGNL2	NM_001013690.4		0,328,4423	TT,TC,CC		1.7659,7.4468,3.4519		331/654	52215205	328,9174	1410	3341	4751			401720																															12.37:g.52215205C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000562343.2	37																																																																																					0.731	RP11-923I11.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000430848.2		
LPIN1	23175	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	2	11955246	11955246	+	Missense_Mutation	SNP	G	G	A	rs398124543		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr2:11955246G>A	ENST00000256720.2	+	17	2267	c.2174G>A	c.(2173-2175)cGt>cAt	p.R725H	LPIN1_ENST00000404113.2_Missense_Mutation_p.R226H|LPIN1_ENST00000425416.2_Missense_Mutation_p.R731H|LPIN1_ENST00000396099.1_Missense_Mutation_p.R767H|LPIN1_ENST00000396097.1_Missense_Mutation_p.R455H|LPIN1_ENST00000449576.2_Missense_Mutation_p.R810H	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	725	C-LIP.				cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		TGTTCTGCCCGTGCCATCGGG	0.527																																						.											0													56.0	55.0	55.0					2																	11955246		2203	4300	6503	SO:0001583	missense	23175			D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.2174G>A	2.37:g.11955246G>A	ENSP00000256720:p.Arg725His	Somatic		WXS	Illumina HiSeq	Phase_I	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	37	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	G	32	5.149073	0.94645	.	.	ENSG00000134324	ENST00000449576;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097;ENST00000404113	D;D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05;-2.05	4.69	4.69	0.59074	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.000000	0.85682	D	0.000000	D	0.94611	0.8263	H	0.94847	3.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.96308	0.9226	10	0.87932	D	0	-14.9771	17.6508	0.88163	0.0:0.0:1.0:0.0	.	226;810;725	B4DET9;F5GY24;Q14693	.;.;LPIN1_HUMAN	H	810;767;731;725;455;226	ENSP00000397908:R810H;ENSP00000379406:R767H;ENSP00000401522:R731H;ENSP00000256720:R725H;ENSP00000379404:R455H;ENSP00000386120:R226H	ENSP00000256720:R725H	R	+	2	0	LPIN1	11872697	1.000000	0.71417	0.494000	0.27515	0.982000	0.71751	9.282000	0.95840	2.156000	0.67533	0.655000	0.94253	CGT		0.527	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
TIAM1	7074	broad.mit.edu;hgsc.bcm.edu	37	21	32624265	32624265	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr21:32624265C>T	ENST00000286827.3	-	6	1675	c.1204G>A	c.(1204-1206)Gag>Aag	p.E402K	TIAM1_ENST00000469412.1_5'UTR|TIAM1_ENST00000541036.1_Missense_Mutation_p.E402K	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	402					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CCGGCCTCCTCCAGGCTCTCG	0.697																																						.											0													34.0	40.0	38.0					21																	32624265		2203	4299	6502	SO:0001583	missense	7074				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1204G>A	21.37:g.32624265C>T	ENSP00000286827:p.Glu402Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.545166	0.86022	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.46451	0.87;0.88	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.46795	0.1411	M	0.62723	1.935	0.80722	D	1	P;P;P;P	0.42456	0.649;0.518;0.78;0.518	B;B;B;B	0.41510	0.359;0.197;0.265;0.197	T	0.54289	-0.8316	10	0.62326	D	0.03	.	18.1782	0.89768	0.0:1.0:0.0:0.0	.	402;402;243;402	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	K	402;243;402	ENSP00000286827:E402K;ENSP00000441570:E402K	ENSP00000286827:E402K	E	-	1	0	TIAM1	31546136	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.190000	0.77755	2.497000	0.84241	0.655000	0.94253	GAG		0.697	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
PRR23A	729627	hgsc.bcm.edu;mdanderson.org	37	3	138724463	138724463	+	Silent	SNP	G	G	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr3:138724463G>A	ENST00000383163.2	-	1	647	c.648C>T	c.(646-648)ttC>ttT	p.F216F	MRPS22_ENST00000495075.1_5'Flank	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	216	Pro-rich.									endometrium(3)|kidney(1)|lung(7)	11						ATTCCGGGTCGAAGAAGGGGC	0.662																																						.											0													32.0	39.0	37.0					3																	138724463		692	1591	2283	SO:0001819	synonymous_variant	729627				CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.648C>T	3.37:g.138724463G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000383163.2	37	CCDS46923.1																																																																																				0.662	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361503.1	NM_001134659	
FAM120B	84498	broad.mit.edu;hgsc.bcm.edu	37	6	170627576	170627576	+	Silent	SNP	C	C	T	rs542443578		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr6:170627576C>T	ENST00000476287.1	+	2	1206	c.1098C>T	c.(1096-1098)ccC>ccT	p.P366P	FAM120B_ENST00000252510.9_Intron|FAM120B_ENST00000537664.1_Silent_p.P389P|FAM120B_ENST00000540480.1_Silent_p.P378P	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	366					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		GAGAAGTTCCCGTGTATACAG	0.532																																						.											0													154.0	163.0	160.0					6																	170627576		2203	4300	6503	SO:0001819	synonymous_variant	84498			AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.1098C>T	6.37:g.170627576C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DL34|Q86V68|Q96JI9	Silent	SNP	ENST00000476287.1	37	CCDS5314.1																																																																																				0.532	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
COL27A1	85301	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	9	117052528	117052528	+	Missense_Mutation	SNP	C	C	T	rs200170613		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:117052528C>T	ENST00000356083.3	+	47	4676	c.4285C>T	c.(4285-4287)Cgg>Tgg	p.R1429W		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1429	Collagen-like 13.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GCCAGGGCCCCGGGGCGTGGT	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		12464	0.0		0.0	False		,,,				2504	0.001					.											0								C	TRP/ARG	0,4344		0,0,2172	11.0	11.0	11.0		4285	3.4	0.9	9		11	2,8506		0,2,4252	no	missense	COL27A1	NM_032888.2	101	0,2,6424	TT,TC,CC		0.0235,0.0,0.0156	probably-damaging	1429/1861	117052528	2,12850	2172	4254	6426	SO:0001583	missense	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4285C>T	9.37:g.117052528C>T	ENSP00000348385:p.Arg1429Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.357598	0.61293	0.0	2.35E-4	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.96200	-3.94	5.32	3.4	0.38934	.	.	.	.	.	D	0.97232	0.9095	M	0.92507	3.315	0.40675	D	0.982257	D	0.76494	0.999	P	0.54856	0.762	D	0.96917	0.9671	9	0.72032	D	0.01	.	11.5638	0.50794	0.5039:0.4961:0.0:0.0	.	1429	Q8IZC6	CORA1_HUMAN	W	1429	ENSP00000348385:R1429W	ENSP00000348385:R1429W	R	+	1	2	COL27A1	116092349	0.123000	0.22298	0.933000	0.37362	0.691000	0.40173	0.324000	0.19610	0.537000	0.28751	0.491000	0.48974	CGG		0.692	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
PRRC2C	23215	broad.mit.edu	37	1	171484936	171484936	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr1:171484936delA	ENST00000338920.4	+	5	695	c.458delA	c.(457-459)gaafs	p.E153fs	PRRC2C_ENST00000367742.3_Frame_Shift_Del_p.E155fs|PRRC2C_ENST00000392078.3_Frame_Shift_Del_p.E155fs|PRRC2C_ENST00000426496.2_Frame_Shift_Del_p.E153fs|PRRC2C_ENST00000476522.1_3'UTR	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	153					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GGGGATCAGGAAAAAAAAGAA	0.358																																						.											0													66.0	67.0	66.0					1																	171484936		2203	4300	6503	SO:0001589	frameshift_variant	23215			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.458delA	1.37:g.171484936delA	ENSP00000343629:p.Glu153fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Frame_Shift_Del	DEL	ENST00000338920.4	37	CCDS1296.2																																																																																				0.358	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
PIK3C2A	5286	broad.mit.edu	37	11	17121508	17121508	+	Silent	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr11:17121508A>G	ENST00000265970.7	-	25	4016	c.4017T>C	c.(4015-4017)ccT>ccC	p.P1339P	PIK3C2A_ENST00000540361.1_Silent_p.P959P|PIK3C2A_ENST00000531428.1_5'UTR	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1339	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						GTAACCCTGAAGGAATCATCT	0.358																																						.											0													80.0	81.0	81.0					11																	17121508		2200	4291	6491	SO:0001819	synonymous_variant	5286			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.4017T>C	11.37:g.17121508A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B0LPH2|B4E2G4|Q14CQ9	Silent	SNP	ENST00000265970.7	37	CCDS7824.1																																																																																				0.358	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
P2RX3	5024	broad.mit.edu;mdanderson.org	37	11	57137381	57137381	+	Missense_Mutation	SNP	G	G	A	rs201360035		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr11:57137381G>A	ENST00000263314.2	+	12	1139	c.1105G>A	c.(1105-1107)Gcg>Acg	p.A369T		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	369					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)			endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						GCTGAAAATCGCGGCTTTGAC	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		20104	0.0		0.0	False		,,,				2504	0.001					.											0								G	THR/ALA	0,4402		0,0,2201	109.0	90.0	96.0		1105	-5.1	0.0	11		96	1,8591	1.2+/-3.3	0,1,4295	no	missense	P2RX3	NM_002559.3	58	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign	369/398	57137381	1,12993	2201	4296	6497	SO:0001583	missense	5024			Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.1105G>A	11.37:g.57137381G>A	ENSP00000263314:p.Ala369Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6DK37|Q9UQB6	Missense_Mutation	SNP	ENST00000263314.2	37	CCDS7953.1	.	.	.	.	.	.	.	.	.	.	G	0.496	-0.873163	0.02570	0.0	1.16E-4	ENSG00000109991	ENST00000439993;ENST00000263314	T	0.04275	3.66	5.2	-5.1	0.02911	.	0.835048	0.10764	N	0.636768	T	0.01940	0.0061	N	0.04959	-0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48375	-0.9041	10	0.13853	T	0.58	-0.0127	8.327	0.32162	0.6906:0.1285:0.181:0.0	.	369	P56373	P2RX3_HUMAN	T	368;369	ENSP00000263314:A369T	ENSP00000263314:A369T	A	+	1	0	P2RX3	56893957	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.118000	0.15605	-1.177000	0.02744	-0.251000	0.11542	GCG		0.547	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392465.1	NM_002559	
DHCR7	1717	broad.mit.edu	37	11	71152273	71152273	+	Splice_Site	SNP	C	C	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr11:71152273C>T	ENST00000355527.3	-	6	902	c.626G>A	c.(625-627)tGc>tAc	p.C209Y	DHCR7_ENST00000407721.2_Splice_Site_p.C209Y	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	209					blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)			endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						AAGAACATACCAGTCTCTGGC	0.572									Smith-Lemli-Opitz syndrome																													.											0													88.0	76.0	80.0					11																	71152273		2200	4294	6494	SO:0001630	splice_region_variant	1717	Familial Cancer Database	SLOS type I & II	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.626+1G>A	11.37:g.71152273C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R6Z2|O60492|O60717	Missense_Mutation	SNP	ENST00000355527.3	37	CCDS8200.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.794386|5.794386	0.96952|0.96952	.|.	.|.	ENSG00000172893|ENSG00000172893	ENST00000407721;ENST00000355527;ENST00000527316|ENST00000524694	D;D;D|.	0.97870|.	-4.58;-4.58;-4.58|.	4.14|4.14	4.14|4.14	0.48551|0.48551	.|.	0.096169|.	0.64402|.	D|.	0.000001|.	T|.	0.72179|.	0.3428|.	M|M	0.70275|0.70275	2.135|2.135	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.40660|.	0.726|.	B|.	0.40410|.	0.328|.	T|.	0.73142|.	-0.4076|.	9|.	.|.	.|.	.|.	-30.5458|-30.5458	14.271|14.271	0.66152|0.66152	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	209|.	Q9UBM7|.	DHCR7_HUMAN|.	Y|X	209;209;177|221	ENSP00000384739:C209Y;ENSP00000347717:C209Y;ENSP00000435047:C177Y|.	.|.	C|W	-|-	2|2	0|0	DHCR7|DHCR7	70829921|70829921	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.639000|0.639000	0.38242|0.38242	6.765000|6.765000	0.74965|0.74965	2.035000|2.035000	0.60131|0.60131	0.313000|0.313000	0.20887|0.20887	TGC|TGG		0.572	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394243.1	NM_001360	Missense_Mutation
PMEL	6490	broad.mit.edu	37	12	56348043	56348043	+	Silent	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr12:56348043A>G	ENST00000548747.1	-	11	2603	c.1941T>C	c.(1939-1941)tgT>tgC	p.C647C	PMEL_ENST00000548493.1_Silent_p.C647C|PMEL_ENST00000536427.1_Silent_p.C612C|PMEL_ENST00000550447.1_Silent_p.C276C|PMEL_ENST00000360714.4_Silent_p.C654C|PMEL_ENST00000539511.1_Silent_p.C561C|PMEL_ENST00000552882.1_Silent_p.C647C|PMEL_ENST00000449260.2_Silent_p.C654C|PMEL_ENST00000550464.1_Silent_p.C561C			P40967	PMEL_HUMAN	premelanosome protein	647					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CACCAATGGGACAAGAGCAGA	0.512																																						.											0													126.0	111.0	116.0					12																	56348043		2203	4300	6503	SO:0001819	synonymous_variant	6490			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.1941T>C	12.37:g.56348043A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Silent	SNP	ENST00000548747.1	37	CCDS8897.1																																																																																				0.512	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409626.1	NM_006928	
UNC79	57578	broad.mit.edu	37	14	94156610	94156610	+	Silent	SNP	T	T	C	rs182301730	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr14:94156610T>C	ENST00000393151.2	+	46	7350	c.7350T>C	c.(7348-7350)caT>caC	p.H2450H	UNC79_ENST00000553484.1_Silent_p.H2472H|UNC79_ENST00000555664.1_Silent_p.H2411H|UNC79_ENST00000256339.4_Silent_p.H2273H			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2450					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TTGCAGACCATCTTATTGTTA	0.488													T|||	2	0.000399361	0.0	0.0	5008	,	,		20460	0.002		0.0	False		,,,				2504	0.0					.											0													142.0	122.0	129.0					14																	94156610		2203	4300	6503	SO:0001819	synonymous_variant	57578			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7350T>C	14.37:g.94156610T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	37																																																																																					0.488	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
ADCY9	115	broad.mit.edu	37	16	4016581	4016581	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr16:4016581T>A	ENST00000294016.3	-	11	3795	c.3257A>T	c.(3256-3258)aAc>aTc	p.N1086I		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1086	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GATGAGCTCGTTGAGGACCCG	0.582																																						.											0													124.0	120.0	121.0					16																	4016581		2197	4300	6497	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3257A>T	16.37:g.4016581T>A	ENSP00000294016:p.Asn1086Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.389093	0.82902	.	.	ENSG00000162104	ENST00000294016	T	0.40225	1.04	5.52	5.52	0.82312	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.75102	0.3804	H	0.95679	3.705	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.83486	0.0067	10	0.87932	D	0	.	15.9238	0.79597	0.0:0.0:0.0:1.0	.	1086	O60503	ADCY9_HUMAN	I	1086	ENSP00000294016:N1086I	ENSP00000294016:N1086I	N	-	2	0	ADCY9	3956582	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.997000	0.88414	2.221000	0.72209	0.533000	0.62120	AAC		0.582	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
CSNK2A2	1459	broad.mit.edu	37	16	58199559	58199559	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr16:58199559A>G	ENST00000262506.3	-	10	1064	c.881T>C	c.(880-882)gTc>gCc	p.V294A	CSNK2A2_ENST00000566813.1_5'UTR	NM_001896.2	NP_001887.1	P19784	CSK22_HUMAN	casein kinase 2, alpha prime polypeptide	294	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)	1						CTCAGGGCTGACAAGGTGTCT	0.453																																					Melanoma(54;119 1219 18349 35700 39738)	.											0													136.0	120.0	125.0					16																	58199559		2198	4300	6498	SO:0001583	missense	1459			M55268	CCDS10794.1	16q21	2013-01-17			ENSG00000070770	ENSG00000070770			2459	protein-coding gene	gene with protein product		115442				2174700, 1766873	Standard	NM_001896		Approved	CSNK2A1	uc002enc.3	P19784	OTTHUMG00000133488	ENST00000262506.3:c.881T>C	16.37:g.58199559A>G	ENSP00000262506:p.Val294Ala	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000262506.3	37	CCDS10794.1	.	.	.	.	.	.	.	.	.	.	A	16.41	3.115752	0.56505	.	.	ENSG00000070770	ENST00000262506	T	0.06849	3.25	5.75	5.75	0.90469	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.15176	0.0366	N	0.25825	0.765	0.80722	D	1	B	0.21452	0.056	P	0.48141	0.568	T	0.41233	-0.9520	10	0.17832	T	0.49	-14.6529	15.5278	0.75925	1.0:0.0:0.0:0.0	.	294	P19784	CSK22_HUMAN	A	294	ENSP00000262506:V294A	ENSP00000262506:V294A	V	-	2	0	CSNK2A2	56757060	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.287000	0.95975	2.320000	0.78422	0.528000	0.53228	GTC		0.453	CSNK2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257386.2	NM_001896	
LGALS9B	284194	broad.mit.edu	37	17	20363690	20363690	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:20363690C>T	ENST00000423676.3	-	2	169	c.106G>A	c.(106-108)Gcc>Acc	p.A36T	LGALS9B_ENST00000324290.5_Missense_Mutation_p.A36T			Q3B8N2	LEG9B_HUMAN	lectin, galactoside-binding, soluble, 9B	36	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	10						CTGAGAACGGCCCCATTGACA	0.562																																						.											0													189.0	157.0	168.0					17																	20363690		2202	4298	6500	SO:0001583	missense	284194				CCDS42283.1	17p11.2	2011-08-04			ENSG00000170298	ENSG00000170298		"""Lectins, galactoside-binding"""	24842	protein-coding gene	gene with protein product						11997339	Standard	NM_001042685		Approved		uc002gwz.1	Q3B8N2	OTTHUMG00000130730	ENST00000423676.3:c.106G>A	17.37:g.20363690C>T	ENSP00000388841:p.Ala36Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NLF8|A8K2J8	Missense_Mutation	SNP	ENST00000423676.3	37		.	.	.	.	.	.	.	.	.	.	C	0.008	-1.894362	0.00522	.	.	ENSG00000170298	ENST00000423676;ENST00000324290	T;T	0.04706	3.57;3.57	2.33	-4.66	0.03329	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	1.205440	0.05760	N	0.604671	T	0.01156	0.0038	N	0.00496	-1.435	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.42172	-0.9467	10	0.08381	T	0.77	.	4.3468	0.11136	0.162:0.4203:0.0:0.4177	.	36;36	Q3B8N2;Q3B8N2-2	LEG9B_HUMAN;.	T	36	ENSP00000388841:A36T;ENSP00000315564:A36T	ENSP00000315564:A36T	A	-	1	0	LGALS9B	20304282	0.000000	0.05858	0.001000	0.08648	0.069000	0.16628	-0.624000	0.05540	-1.862000	0.01151	-1.441000	0.01070	GCC		0.562	LGALS9B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000253230.2	NM_001042685	
FLJ36000	284124	broad.mit.edu	37	17	21904125	21904125	+	lincRNA	SNP	G	G	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:21904125G>A	ENST00000581223.2	+	0	0					NR_027084.1																						ggagtcgcaaggggccgagca	0.697																																						.											0																																												0																															17.37:g.21904125G>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000581223.2	37																																																																																					0.697	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000451067.1		
CASKIN2	57513	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	73502411	73502411	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:73502411G>A	ENST00000321617.3	-	8	1287	c.701C>T	c.(700-702)aCc>aTc	p.T234I	CASKIN2_ENST00000581870.1_Missense_Mutation_p.T234I|CASKIN2_ENST00000433559.2_Missense_Mutation_p.T152I	NM_020753.3	NP_065804.2	Q8WXE0	CSKI2_HUMAN	CASK interacting protein 2	234						cytoplasm (GO:0005737)				endometrium(1)|kidney(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CACCACCTCGGTCTTGCCATA	0.667																																						.											0													50.0	44.0	46.0					17																	73502411		2203	4299	6502	SO:0001583	missense	57513			AB032965	CCDS11723.1, CCDS45775.1	17q25.1	2014-09-04			ENSG00000177303	ENSG00000177303		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	18200	protein-coding gene	gene with protein product		612185				12040031	Standard	NM_020753		Approved	KIAA1139, FLJ21609, ANKS5B	uc002joc.4	Q8WXE0	OTTHUMG00000179683	ENST00000321617.3:c.701C>T	17.37:g.73502411G>A	ENSP00000325355:p.Thr234Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B4DTT3|B7Z9H1|Q7LG69|Q9ULT1	Missense_Mutation	SNP	ENST00000321617.3	37	CCDS11723.1	.	.	.	.	.	.	.	.	.	.	G	35	5.596620	0.96602	.	.	ENSG00000177303	ENST00000321617;ENST00000433559	T;T	0.52057	0.68;0.68	5.46	5.46	0.80206	Ankyrin repeat-containing domain (4);	0.000000	0.48286	D	0.000200	T	0.53626	0.1808	N	0.12637	0.245	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.988	T	0.61163	-0.7118	10	0.54805	T	0.06	.	19.3138	0.94204	0.0:0.0:1.0:0.0	.	152;234	Q8WXE0-2;Q8WXE0	.;CSKI2_HUMAN	I	234;152	ENSP00000325355:T234I;ENSP00000406963:T152I	ENSP00000325355:T234I	T	-	2	0	CASKIN2	71014006	1.000000	0.71417	0.985000	0.45067	0.982000	0.71751	9.807000	0.99171	2.561000	0.86390	0.655000	0.94253	ACC		0.667	CASKIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447609.1	NM_020753	
ANKRD27	84079	broad.mit.edu;mdanderson.org	37	19	33113410	33113410	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:33113410T>C	ENST00000306065.4	-	18	1903	c.1745A>G	c.(1744-1746)gAg>gGg	p.E582G		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	582					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CAGCAATGTCTCTATGACGCC	0.527																																						.											0													204.0	184.0	191.0					19																	33113410		2203	4300	6503	SO:0001583	missense	84079			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1745A>G	19.37:g.33113410T>C	ENSP00000304292:p.Glu582Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.984865	0.53934	.	.	ENSG00000105186	ENST00000306065	T	0.68025	-0.3	5.31	5.31	0.75309	Ankyrin repeat-containing domain (3);	0.098841	0.43919	D	0.000519	T	0.67069	0.2854	M	0.71206	2.165	0.80722	D	1	P	0.40332	0.713	B	0.37731	0.257	T	0.73183	-0.4063	10	0.72032	D	0.01	-27.6989	15.5369	0.76011	0.0:0.0:0.0:1.0	.	582	Q96NW4	ANR27_HUMAN	G	582	ENSP00000304292:E582G	ENSP00000304292:E582G	E	-	2	0	ANKRD27	37805250	1.000000	0.71417	1.000000	0.80357	0.639000	0.38242	4.630000	0.61297	2.135000	0.66039	0.533000	0.62120	GAG		0.527	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
CEACAM5	1048	broad.mit.edu;mdanderson.org;bcgsc.ca	37	19	42222091	42222091	+	Missense_Mutation	SNP	C	C	T	rs368617829		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:42222091C>T	ENST00000221992.6	+	6	1396	c.1282C>T	c.(1282-1284)Cgt>Tgt	p.R428C	CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000405816.1_Missense_Mutation_p.R428C|CEACAM5_ENST00000398599.4_Missense_Mutation_p.R427C	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	428	Ig-like 5.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CACCTATTACCGTCCAGGGGT	0.537																																						.											0								C	CYS/ARG	0,4406		0,0,2203	117.0	104.0	108.0		1282	-4.8	0.0	19		108	1,8599	1.2+/-3.3	0,1,4299	no	missense	CEACAM5	NM_004363.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	428/703	42222091	1,13005	2203	4300	6503	SO:0001583	missense	1048			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1282C>T	19.37:g.42222091C>T	ENSP00000221992:p.Arg428Cys	Somatic		WXS	Illumina HiSeq	Phase_I	H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	CCDS12584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.391|9.391	1.075422|1.075422	0.20227|0.20227	0.0|0.0	1.16E-4|1.16E-4	ENSG00000105388|ENSG00000105388	ENST00000398599|ENST00000221992;ENST00000405816;ENST00000378181	.|T;T	.|0.13901	.|2.55;2.55	2.39|2.39	-4.78|-4.78	0.03209|0.03209	.|Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.36496|0.36496	0.0969|0.0969	H|H	0.94847|0.94847	3.59|3.59	0.09310|0.09310	N|N	1|1	.|D;D	.|0.89917	.|1.0;0.994	.|D;P	.|0.74348	.|0.983;0.903	T|T	0.10706|0.10706	-1.0618|-1.0618	5|9	.|0.39692	.|T	.|0.17	.|.	3.1996|3.1996	0.06645|0.06645	0.4898:0.232:0.0:0.2782|0.4898:0.232:0.0:0.2782	.|.	.|428;428	.|P06731;Q53G30	.|CEAM5_HUMAN;.	L|C	423|428;428;146	.|ENSP00000221992:R428C;ENSP00000385072:R428C	.|ENSP00000221992:R428C	P|R	+|+	2|1	0|0	CEACAM5|CEACAM5	46913931|46913931	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-1.139000|-1.139000	0.03213|0.03213	-1.408000|-1.408000	0.02040|0.02040	-1.948000|-1.948000	0.00487|0.00487	CCG|CGT		0.537	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363	
KIAA1211L	343990	broad.mit.edu	37	2	99449445	99449445	+	Silent	SNP	C	C	T	rs373720213		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr2:99449445C>T	ENST00000397899.2	-	4	586	c.255G>A	c.(253-255)acG>acA	p.T85T	KIAA1211L_ENST00000462314.1_Intron	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	85																	GGCTGCCCAGCGTGCCCCTCG	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15890	0.0		0.0	False		,,,				2504	0.0					.											0								C		4,3854		0,4,1925	77.0	86.0	83.0		255	-9.9	0.0	2		83	0,8258		0,0,4129	no	coding-synonymous	C2orf55	NM_207362.2		0,4,6054	TT,TC,CC		0.0,0.1037,0.033		85/963	99449445	4,12112	1929	4129	6058	SO:0001819	synonymous_variant	343990			BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.255G>A	2.37:g.99449445C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000397899.2	37	CCDS42720.1																																																																																				0.562	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
CSRP2BP	57325	broad.mit.edu;mdanderson.org;bcgsc.ca	37	20	18162415	18162415	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr20:18162415T>C	ENST00000435364.3	+	7	2074	c.1733T>C	c.(1732-1734)gTa>gCa	p.V578A	CSRP2BP_ENST00000377681.3_Missense_Mutation_p.V577A|CSRP2BP_ENST00000489634.2_Missense_Mutation_p.V450A	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	578					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						TATCGCTTGGTAGGATCAGAA	0.418																																						.											0													144.0	137.0	139.0					20																	18162415		2203	4300	6503	SO:0001583	missense	57325			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.1733T>C	20.37:g.18162415T>C	ENSP00000392318:p.Val578Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	T	14.55	2.568250	0.45798	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.15139	2.45;2.45;2.45;2.45	5.49	5.49	0.81192	.	0.051941	0.85682	D	0.000000	T	0.13286	0.0322	L	0.28115	0.83	0.39638	D	0.970282	B;B	0.21821	0.061;0.036	B;B	0.23275	0.045;0.006	T	0.07635	-1.0762	10	0.42905	T	0.14	-19.0827	11.5629	0.50788	0.0:0.0:0.1492:0.8508	.	450;578	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	A	578;577;578;450	ENSP00000278816:V578A;ENSP00000366909:V577A;ENSP00000392318:V578A;ENSP00000425909:V450A	ENSP00000278816:V578A	V	+	2	0	CSRP2BP	18110415	1.000000	0.71417	0.998000	0.56505	0.909000	0.53808	4.268000	0.58883	2.088000	0.63022	0.460000	0.39030	GTA		0.418	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
FAM182A	284800	broad.mit.edu	37	20	26063982	26063982	+	RNA	DEL	C	C	-			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr20:26063982delC	ENST00000376398.2	+	0	1499					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						TGGGCATCCACCTGAGACTTG	0.547																																						.											0																																												284800			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26063982delC		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRD0|Q8N947	RNA	DEL	ENST00000376398.2	37																																																																																					0.547	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
EEF1A2	1917	broad.mit.edu;mdanderson.org	37	20	62127325	62127325	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr20:62127325C>T	ENST00000298049.7	-	2	278	c.208G>A	c.(208-210)Ggc>Agc	p.G70S	EEF1A2_ENST00000217182.3_Missense_Mutation_p.G70S			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	70	G2. {ECO:0000250}.|tr-type G.		G -> S (found in a patient with mental retardation, severe delay of psychomotor development, very limited speech, autistic features and aggressive behaviors). {ECO:0000269|PubMed:23033978}.		positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			ATGGTGATGCCGCGCTCACGC	0.597											OREG0026129	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													239.0	187.0	205.0					20																	62127325		2203	4299	6502	SO:0001583	missense	1917			AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.208G>A	20.37:g.62127325C>T	ENSP00000298049:p.Gly70Ser	Somatic	1058	WXS	Illumina HiSeq	Phase_I	B5BUF3|E1P5J1|P54266|Q0VGC7	Missense_Mutation	SNP	ENST00000298049.7	37	CCDS13522.1	.	.	.	.	.	.	.	.	.	.	C	34	5.304450	0.95601	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	T;T	0.77877	-1.13;-1.13	4.01	4.01	0.46588	Protein synthesis factor, GTP-binding (3);	0.057240	0.64402	D	0.000002	D	0.91673	0.7368	H	0.96301	3.8	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.98	D	0.94708	0.7889	10	0.87932	D	0	-3.5841	16.4593	0.84031	0.0:1.0:0.0:0.0	.	46;70	Q59GP5;Q05639	.;EF1A2_HUMAN	S	70	ENSP00000298049:G70S;ENSP00000217182:G70S	ENSP00000217182:G70S	G	-	1	0	EEF1A2	61597769	1.000000	0.71417	0.979000	0.43373	0.893000	0.52053	7.663000	0.83820	1.954000	0.56735	0.313000	0.20887	GGC		0.597	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080495.1	NM_001958	
RBMS3	27303	broad.mit.edu	37	3	29925685	29925685	+	Silent	SNP	T	T	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr3:29925685T>G	ENST00000383767.2	+	8	1113	c.777T>G	c.(775-777)gcT>gcG	p.A259A	RBMS3_ENST00000434693.2_Silent_p.A258A|RBMS3_ENST00000383766.2_Silent_p.A258A|RBMS3_ENST00000445033.1_Silent_p.A259A|RBMS3_ENST00000396583.3_Silent_p.A272A|RBMS3_ENST00000456853.1_Silent_p.A272A|RBMS3_ENST00000273139.9_Silent_p.A259A|RBMS3_ENST00000452462.1_Silent_p.A259A			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	259					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				ACCCCACAGCTGCCATACAGA	0.353																																						.											0													109.0	102.0	105.0					3																	29925685		2203	4300	6503	SO:0001819	synonymous_variant	27303			AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.777T>G	3.37:g.29925685T>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Silent	SNP	ENST00000383767.2	37	CCDS33724.1																																																																																				0.353	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
NOP14	8602	broad.mit.edu	37	4	2952919	2952919	+	Silent	SNP	T	T	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr4:2952919T>C	ENST00000314262.6	-	7	972	c.924A>G	c.(922-924)aaA>aaG	p.K308K	NOP14_ENST00000416614.2_Silent_p.K308K|NOP14-AS1_ENST00000515194.1_RNA|NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000398071.4_Silent_p.K308K|NOP14_ENST00000502735.1_Silent_p.K308K	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	308					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TATGTTTTGGTTTCTTAACAT	0.403																																						.											0													251.0	241.0	244.0					4																	2952919		2203	4300	6503	SO:0001819	synonymous_variant	8602			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.924A>G	4.37:g.2952919T>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Silent	SNP	ENST00000314262.6	37	CCDS33945.1																																																																																				0.403	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358135.2	NM_003703	
UGT2B28	54490	broad.mit.edu	37	4	70146674	70146674	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr4:70146674delT	ENST00000335568.5	+	1	458	c.456delT	c.(454-456)gctfs	p.A152fs	UGT2B28_ENST00000511240.1_Frame_Shift_Del_p.A152fs	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	152					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						TTGCAGATGCTTTTTTTCCTT	0.378																																						.											0													101.0	112.0	108.0					4																	70146674		2037	4235	6272	SO:0001589	frameshift_variant	54490			AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.456delT	4.37:g.70146674delT	ENSP00000334276:p.Ala152fs	Somatic		WXS	Illumina HiSeq	Phase_I	B5BUM0|Q9BY62|Q9BY63	Frame_Shift_Del	DEL	ENST00000335568.5	37	CCDS3528.1																																																																																				0.378	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
DCHS2	54798	broad.mit.edu;ucsc.edu	37	4	155219313	155219313	+	Silent	SNP	C	C	T	rs142512414		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr4:155219313C>T	ENST00000357232.4	-	18	4787	c.4788G>A	c.(4786-4788)tcG>tcA	p.S1596S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1596	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GGTTTGTAGGCGACTCGGGGG	0.423																																						.											0								C		1,4405	2.1+/-5.4	0,1,2202	87.0	89.0	88.0		4788	-8.5	0.0	4	dbSNP_134	88	0,8600		0,0,4300	no	coding-synonymous	DCHS2	NM_017639.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1596/2917	155219313	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4788G>A	4.37:g.155219313C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	CCDS3785.1																																																																																				0.423	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
BDP1	55814	broad.mit.edu	37	5	70766233	70766233	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr5:70766233delT	ENST00000358731.4	+	7	1194	c.931delT	c.(931-933)tttfs	p.F312fs	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	312	Myb-like.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AACAGATATGTTTTTTTTAGC	0.294																																						.											0													78.0	71.0	73.0					5																	70766233		1802	4061	5863	SO:0001589	frameshift_variant	55814			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.931delT	5.37:g.70766233delT	ENSP00000351575:p.Phe312fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Frame_Shift_Del	DEL	ENST00000358731.4	37	CCDS43328.1																																																																																				0.294	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
SCAMP1	9522	broad.mit.edu;mdanderson.org	37	5	77745782	77745782	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr5:77745782G>T	ENST00000538629.1	+	7	815	c.658G>T	c.(658-660)Gta>Tta	p.V220L	SCAMP1_ENST00000339292.4_3'UTR	NM_004866.4	NP_004857.4	O15126	SCAM1_HUMAN	secretory carrier membrane protein 1	220					endocytosis (GO:0006897)|exocytosis (GO:0006887)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	clathrin-coated vesicle (GO:0030136)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|synaptic vesicle membrane (GO:0030672)|trans-Golgi network (GO:0005802)|zymogen granule membrane (GO:0042589)							all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)		TAGATTCTTTGTATTCTTCTT	0.343																																						.											0													154.0	146.0	149.0					5																	77745782		1817	4070	5887	SO:0001583	missense	9522			AF038966	CCDS75264.1	5q14.1	2013-02-21			ENSG00000085365	ENSG00000085365		"""Secretory carrier membrane proteins"""	10563	protein-coding gene	gene with protein product		606911				9378760	Standard	NM_004866		Approved	SCAMP37	uc003kfl.3	O15126	OTTHUMG00000162479	ENST00000538629.1:c.658G>T	5.37:g.77745782G>T	ENSP00000475496:p.Val220Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O43587|Q6FG23|Q96BX1|Q96QK5	Missense_Mutation	SNP	ENST00000538629.1	37																																																																																					0.343	SCAMP1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_004866	
TTC37	9652	broad.mit.edu	37	5	94830430	94830430	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr5:94830430delT	ENST00000358746.2	-	36	4056	c.3758delA	c.(3757-3759)aatfs	p.N1253fs		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	1253						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						TAGTGCAGTATTTTTTTCATC	0.343																																						.											0													191.0	191.0	191.0					5																	94830430		2203	4300	6503	SO:0001589	frameshift_variant	9652			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.3758delA	5.37:g.94830430delT	ENSP00000351596:p.Asn1253fs	Somatic		WXS	Illumina HiSeq	Phase_I	O15077|Q6PJI3	Frame_Shift_Del	DEL	ENST00000358746.2	37	CCDS4072.1																																																																																				0.343	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241651.1	NM_014639	
FAM13B	51306	broad.mit.edu	37	5	137278834	137278834	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr5:137278834delA	ENST00000033079.3	-	20	2797	c.2346delT	c.(2344-2346)tttfs	p.F782fs	FAM13B_ENST00000420893.2_Frame_Shift_Del_p.F754fs|FAM13B_ENST00000425075.2_Frame_Shift_Del_p.F658fs	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	782					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						TGATTTCTTCAAAAAAATGTG	0.353																																						.											0													100.0	102.0	101.0					5																	137278834		2203	4300	6503	SO:0001589	frameshift_variant	51306			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.2346delT	5.37:g.137278834delA	ENSP00000033079:p.Phe782fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Frame_Shift_Del	DEL	ENST00000033079.3	37	CCDS4195.1																																																																																				0.353	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
HIBADH	11112	broad.mit.edu	37	7	27672041	27672041	+	Silent	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr7:27672041A>G	ENST00000265395.2	-	3	482	c.276T>C	c.(274-276)gtT>gtC	p.V92V		NM_152740.3	NP_689953.1	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase	92					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	3-hydroxyisobutyrate dehydrogenase activity (GO:0008442)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(4)|kidney(2)|lung(3)|ovary(2)|prostate(1)	12			GBM - Glioblastoma multiforme(3;0.0368)			CTTTTTCAGCAACATCTGCTG	0.353																																						.											0													127.0	121.0	123.0					7																	27672041		2203	4300	6503	SO:0001819	synonymous_variant	11112			AF529362	CCDS5414.1	7p15	2009-06-12			ENSG00000106049	ENSG00000106049	1.1.1.31		4907	protein-coding gene	gene with protein product		608475					Standard	NM_152740		Approved	NS5ATP1	uc003szf.3	P31937	OTTHUMG00000097035	ENST00000265395.2:c.276T>C	7.37:g.27672041A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q546Z2|Q9UDN3	Silent	SNP	ENST00000265395.2	37	CCDS5414.1	.	.	.	.	.	.	.	.	.	.	A	9.560	1.118239	0.20877	.	.	ENSG00000106049	ENST00000425715	.	.	.	5.8	3.36	0.38483	.	.	.	.	.	T	0.47002	0.1422	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32745	-0.9895	4	.	.	.	-15.8862	3.5762	0.07936	0.1389:0.07:0.1355:0.6556	.	.	.	.	S	35	.	.	L	-	2	0	HIBADH	27638566	0.885000	0.30320	1.000000	0.80357	0.995000	0.86356	-0.081000	0.11321	0.424000	0.26061	-0.347000	0.07816	TTG		0.353	HIBADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214132.1	NM_152740	
PLAA	9373	broad.mit.edu;mdanderson.org;bcgsc.ca	37	9	26905845	26905845	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:26905845C>T	ENST00000397292.3	-	14	2469	c.2052G>A	c.(2050-2052)atG>atA	p.M684I		NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	684	PUL. {ECO:0000255|PROSITE- ProRule:PRU00729}.				inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		TTGCATGGGACATCAGTGATT	0.433																																					Melanoma(175;2670 2735 14091 35526)	.											0													108.0	99.0	102.0					9																	26905845		2203	4300	6503	SO:0001583	missense	9373			AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.2052G>A	9.37:g.26905845C>T	ENSP00000380460:p.Met684Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Missense_Mutation	SNP	ENST00000397292.3	37	CCDS35000.1	.	.	.	.	.	.	.	.	.	.	C	11.37	1.618083	0.28801	.	.	ENSG00000137055	ENST00000397292	T	0.39997	1.05	6.07	2.18	0.27775	PUL (2);	0.415874	0.33419	N	0.004929	T	0.14570	0.0352	N	0.02011	-0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.04017	-1.0984	10	0.30854	T	0.27	-1.6509	5.2914	0.15729	0.1323:0.6012:0.0:0.2664	.	684	Q9Y263	PLAP_HUMAN	I	684	ENSP00000380460:M684I	ENSP00000380460:M684I	M	-	3	0	PLAA	26895845	0.996000	0.38824	0.994000	0.49952	0.995000	0.86356	0.479000	0.22228	0.435000	0.26365	-0.140000	0.14226	ATG		0.433	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051958.2	NM_001031689	
CNTNAP3	79937	broad.mit.edu	37	9	39178299	39178299	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:39178299delT	ENST00000297668.6	-	5	670	c.597delA	c.(595-597)aaafs	p.K199fs	CNTNAP3_ENST00000377653.2_5'UTR|CNTNAP3_ENST00000377656.2_Frame_Shift_Del_p.K199fs|CNTNAP3_ENST00000323947.7_Frame_Shift_Del_p.K199fs|CNTNAP3_ENST00000377659.1_Frame_Shift_Del_p.K199fs|CNTNAP3_ENST00000358144.2_Frame_Shift_Del_p.K111fs	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	199	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GTTTTAAAGGTTTTTTATCAA	0.313																																						.											0													83.0	92.0	89.0					9																	39178299		2202	4294	6496	SO:0001589	frameshift_variant	79937			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.597delA	9.37:g.39178299delT	ENSP00000297668:p.Lys199fs	Somatic		WXS	Illumina HiSeq	Phase_I	B1AMA0|Q9C0E9	Frame_Shift_Del	DEL	ENST00000297668.6	37	CCDS6616.1																																																																																				0.313	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655	
KDM5C	8242	broad.mit.edu	37	X	53222786	53222786	+	Silent	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chrX:53222786A>G	ENST00000375401.3	-	25	4682	c.4150T>C	c.(4150-4152)Ttg>Ctg	p.L1384L	KDM5C_ENST00000404049.3_Silent_p.L1383L|KDM5C_ENST00000375379.3_Silent_p.L1381L|KDM5C_ENST00000375383.3_Silent_p.L1340L|KDM5C_ENST00000452825.3_Silent_p.L1314L	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1384					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						GGGCCAGTCAACTGTGGCAAC	0.592			"""N, F, S"""		clear cell renal carcinoma																																	.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0													60.0	45.0	50.0					X																	53222786		2203	4300	6503	SO:0001819	synonymous_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.4150T>C	X.37:g.53222786A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	ENST00000375401.3	37	CCDS14351.1																																																																																				0.592	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
MUC5B	727897	broad.mit.edu	37	11	1264086	1264087	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr11:1264086_1264087insC	ENST00000529681.1	+	31	6034_6035	c.5976_5977insC	c.(5977-5979)accfs	p.T1993fs	MUC5B_ENST00000447027.1_Frame_Shift_Ins_p.T1996fs|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1993	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCACCACCTGGACCCGCCTATC	0.634																																						.											0																																										SO:0001589	frameshift_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		Exception_encountered	11.37:g.1264086_1264087insC	ENSP00000436812:p.Thr1993fs	Somatic		WXS	Illumina HiSeq	Phase_I	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Frame_Shift_Ins	INS	ENST00000529681.1	37	CCDS44515.2																																																																																				0.634	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OR5M8	219484	broad.mit.edu	37	11	56258238	56258239	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr11:56258238_56258239insC	ENST00000327216.2	-	1	632_633	c.608_609insG	c.(607-609)ggcfs	p.G203fs		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					AAAGGTTCCAGCCAGCCACAAT	0.411																																						.											0																																										SO:0001589	frameshift_variant	219484			AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.609dupG	11.37:g.56258240_56258240dupC	ENSP00000323354:p.Gly203fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNM5|Q6IEW3|Q96RB8	Frame_Shift_Ins	INS	ENST00000327216.2	37	CCDS31533.1																																																																																				0.411	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282	
TCTN2	79867	broad.mit.edu	37	12	124180975	124180976	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr12:124180975_124180976insA	ENST00000303372.5	+	12	1454_1455	c.1326_1327insA	c.(1327-1329)aagfs	p.K443fs	TCTN2_ENST00000426174.2_Frame_Shift_Ins_p.K442fs	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	443					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		ACCAACTTGGCAAGCCTGTCCG	0.431																																						.											0																																										SO:0001589	frameshift_variant	79867			AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.1328dupA	12.37:g.124180977_124180977dupA	ENSP00000304941:p.Lys443fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7Y8|B3KPW5|Q9H966	Frame_Shift_Ins	INS	ENST00000303372.5	37	CCDS9253.1																																																																																				0.431	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400652.1	NM_024809	
GGT8P	645367	broad.mit.edu	37	2	91968960	91968961	+	IGR	INS	-	-	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr2:91968960_91968961insA								AC027612.2 (16916 upstream) : SLC9B1P2 (111536 downstream)																							GGGCAGGTGTGGGGGTTGGTCT	0.644																																						.											0																																										SO:0001628	intergenic_variant	645367																															2.37:g.91968960_91968961insA		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	INS		37																																																																																				0	0.644								
KRTAP26-1	388818	broad.mit.edu	37	21	31692295	31692296	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr21:31692295_31692296insG	ENST00000360542.3	-	1	311_312	c.58_59insC	c.(58-60)cgcfs	p.R20fs		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	20						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						AGGAATATGGCGGGAGGTTCTG	0.53																																						.											0																																										SO:0001589	frameshift_variant	388818			AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.59dupC	21.37:g.31692298_31692298dupG	ENSP00000353742:p.Arg20fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0RZD3	Frame_Shift_Ins	INS	ENST00000360542.3	37	CCDS13588.1																																																																																				0.530	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128218.1	NM_203405	
SIK1	150094	broad.mit.edu	37	21	44837550	44837551	+	Frame_Shift_Ins	INS	-	-	G	rs430552	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr21:44837550_44837551insG	ENST00000270162.6	-	13	1980_1981	c.1848_1849insC	c.(1846-1851)cccgccfs	p.A617fs		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	617					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	GCCCGGCTGGCGGGGGCCTGGC	0.703																																						.											0																																										SO:0001589	frameshift_variant	150094			BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1849dupC	21.37:g.44837555_44837555dupG	ENSP00000270162:p.Ala617fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Frame_Shift_Ins	INS	ENST00000270162.6	37	CCDS33575.1																																																																																				0.703	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354	
SPATC1	375686	broad.mit.edu	37	8	145095684	145095685	+	Frame_Shift_Ins	INS	-	-	C	rs564781160	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr8:145095684_145095685insC	ENST00000377470.3	+	3	1084_1085	c.982_983insC	c.(982-984)accfs	p.T328fs	SPATC1_ENST00000447830.2_Frame_Shift_Ins_p.T328fs	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	328						centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ctcccccaccacctcccccacg	0.668																																						.											0																																										SO:0001589	frameshift_variant	375686			BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.984dupC	8.37:g.145095686_145095686dupC	ENSP00000366690:p.Thr328fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DWW9|Q5U5I8|Q7Z6L7	Frame_Shift_Ins	INS	ENST00000377470.3	37	CCDS6413.2																																																																																				0.668	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1	NM_198572	
ZNF462	58499	broad.mit.edu	37	9	109690574	109690575	+	Frame_Shift_Ins	INS	-	-	C	rs76760064		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:109690574_109690575insC	ENST00000277225.5	+	3	4670_4671	c.4381_4382insC	c.(4381-4383)gccfs	p.A1461fs	ZNF462_ENST00000441147.2_Frame_Shift_Ins_p.A306fs|ZNF462_ENST00000457913.1_Frame_Shift_Ins_p.A1461fs			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1461					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GCTAGCTTCAGCCAACCCCGCC	0.52																																						.											0																																										SO:0001589	frameshift_variant	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.4383dupC	9.37:g.109690576_109690576dupC	ENSP00000277225:p.Ala1461fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T0T4|Q8N408	Frame_Shift_Ins	INS	ENST00000277225.5	37	CCDS35096.1																																																																																				0.520	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
TNC	3371	broad.mit.edu	37	9	117838693	117838694	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:117838693_117838694insT	ENST00000350763.4	-	8	3246_3247	c.2835_2836insA	c.(2833-2838)caagccfs	p.A946fs	TNC_ENST00000346706.3_Frame_Shift_Ins_p.A946fs|TNC_ENST00000345230.3_Frame_Shift_Ins_p.A946fs|TNC_ENST00000535648.1_Frame_Shift_Ins_p.A946fs|TNC_ENST00000537320.1_Frame_Shift_Ins_p.A946fs|TNC_ENST00000423613.2_Frame_Shift_Ins_p.A946fs|TNC_ENST00000341037.4_Frame_Shift_Ins_p.A946fs|TNC_ENST00000340094.3_Frame_Shift_Ins_p.A946fs|TNC_ENST00000542877.1_Frame_Shift_Ins_p.A946fs	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	946	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TTGGTTGTGGCTTGTTGGCTCT	0.535																																						.											0																																										SO:0001589	frameshift_variant	3371				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.2836dupA	9.37:g.117838695_117838695dupT	ENSP00000265131:p.Ala946fs	Somatic		WXS	Illumina HiSeq	Phase_I	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Frame_Shift_Ins	INS	ENST00000350763.4	37	CCDS6811.1																																																																																				0.535	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
KIAA1614	57710	ucsc.edu	37	1	180905800	180905800	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr1:180905800A>G	ENST00000367588.4	+	5	2810	c.2755A>G	c.(2755-2757)Aga>Gga	p.R919G	KIAA1614_ENST00000367587.1_Missense_Mutation_p.R540G	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	919										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						GGAGAACAGCAGAGATGGTAA	0.677																																						.											0													3.0	4.0	4.0					1																	180905800		1708	3808	5516	SO:0001583	missense	57710			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.2755A>G	1.37:g.180905800A>G	ENSP00000356560:p.Arg919Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	A	10.96	1.499426	0.26861	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.27256	2.26;1.68	4.19	-0.27	0.12926	.	0.983219	0.08287	N	0.969066	T	0.12178	0.0296	N	0.19112	0.55	0.27723	N	0.945076	B	0.02656	0.0	B	0.04013	0.001	T	0.34551	-0.9824	9	0.21540	T	0.41	0.2422	0.4181	0.00452	0.3213:0.1535:0.2979:0.2274	.	919	Q5VZ46	K1614_HUMAN	G	919;540	ENSP00000356560:R919G;ENSP00000356559:R540G	ENSP00000356559:R540G	R	+	1	2	KIAA1614	179172423	0.000000	0.05858	0.000000	0.03702	0.708000	0.40852	-1.619000	0.02048	-0.279000	0.09167	0.459000	0.35465	AGA		0.677	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
MNT	4335	ucsc.edu	37	17	2290424	2290424	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:2290424T>C	ENST00000174618.4	-	6	1925	c.1520A>G	c.(1519-1521)cAg>cGg	p.Q507R	RP1-59D14.1_ENST00000571775.1_RNA|MNT_ENST00000575374.1_5'Flank	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	507					cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		CAAGGGCAGCTGGGAGCCCAG	0.701																																						.											0													28.0	28.0	28.0					17																	2290424		2198	4292	6490	SO:0001583	missense	4335			Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.1520A>G	17.37:g.2290424T>C	ENSP00000174618:p.Gln507Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6D1|D3DTI7|Q1ED38	Missense_Mutation	SNP	ENST00000174618.4	37	CCDS11018.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.561493	0.45590	.	.	ENSG00000070444	ENST00000174618;ENST00000404961	D	0.82984	-1.67	4.91	4.91	0.64330	.	0.111581	0.39909	N	0.001235	T	0.72211	0.3432	N	0.14661	0.345	0.45035	D	0.99805	P	0.42827	0.791	B	0.41236	0.351	T	0.76135	-0.3070	10	0.51188	T	0.08	-13.646	13.709	0.62656	0.0:0.0:0.0:1.0	.	507	Q99583	MNT_HUMAN	R	507	ENSP00000174618:Q507R	ENSP00000174618:Q507R	Q	-	2	0	MNT	2237174	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.652000	0.83633	1.844000	0.53588	0.482000	0.46254	CAG		0.701	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207158.1	NM_020310	
MTA1	9112	ucsc.edu	37	14	105931063	105931063	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr14:105931063A>G	ENST00000331320.7	+	15	1611	c.1397A>G	c.(1396-1398)aAg>aGg	p.K466R	MTA1_ENST00000435036.2_Missense_Mutation_p.K2R|MTA1_ENST00000405646.1_Missense_Mutation_p.K449R|MTA1_ENST00000406191.1_Missense_Mutation_p.K466R	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	466					circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		TTTGCCATGAAGACCAGGCAG	0.706																																						.											0													32.0	26.0	28.0					14																	105931063		2198	4293	6491	SO:0001583	missense	9112			U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.1397A>G	14.37:g.105931063A>G	ENSP00000333633:p.Lys466Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Missense_Mutation	SNP	ENST00000331320.7	37	CCDS32169.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.532901	0.85812	.	.	ENSG00000182979	ENST00000414153;ENST00000331320;ENST00000406191;ENST00000405646;ENST00000434050;ENST00000435036	T;T;T;T;T	0.75050	0.89;0.83;0.88;0.86;-0.9	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	D	0.86151	0.5864	M	0.82517	2.595	0.58432	D	0.999999	D;P	0.76494	0.999;0.949	D;P	0.85130	0.997;0.725	D	0.88270	0.2929	10	0.87932	D	0	-34.481	13.0096	0.58724	1.0:0.0:0.0:0.0	.	258;466	Q59FW1;Q13330	.;MTA1_HUMAN	R	375;466;466;449;258;2	ENSP00000333633:K466R;ENSP00000385702:K466R;ENSP00000384180:K449R;ENSP00000394106:K258R;ENSP00000389425:K2R	ENSP00000333633:K466R	K	+	2	0	MTA1	105002108	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.273000	0.78527	1.827000	0.53221	0.379000	0.24179	AAG		0.706	MTA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317849.15		
PDCD4	27250	ucsc.edu	37	10	112657808	112657808	+	Missense_Mutation	SNP	G	G	C	rs148548339		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr10:112657808G>C	ENST00000280154.7	+	12	1646	c.1372G>C	c.(1372-1374)Gaa>Caa	p.E458Q	BBIP1_ENST00000605265.1_5'Flank|PDCD4_ENST00000393104.2_Missense_Mutation_p.E447Q|MIR4680_ENST00000580906.1_RNA	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	458					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		TTTTGTAAGCGAAGGAGATGG	0.303																																					Ovarian(115;1498 1603 9363 40056 40885)	.											0													86.0	90.0	89.0					10																	112657808		2203	4300	6503	SO:0001583	missense	27250			U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.1372G>C	10.37:g.112657808G>C	ENSP00000280154:p.Glu458Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Missense_Mutation	SNP	ENST00000280154.7	37	CCDS7567.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.639851	0.87760	.	.	ENSG00000150593	ENST00000280154;ENST00000393104	T;T	0.58060	0.36;0.4	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.77253	0.4103	M	0.83384	2.64	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.78590	-0.2145	10	0.87932	D	0	-25.6209	20.5568	0.99304	0.0:0.0:1.0:0.0	.	444;458;447	B4DKX4;Q53EL6;B5ME91	.;PDCD4_HUMAN;.	Q	458;447	ENSP00000280154:E458Q;ENSP00000376816:E447Q	ENSP00000280154:E458Q	E	+	1	0	PDCD4	112647798	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.003000	0.93577	2.861000	0.98227	0.655000	0.94253	GAA		0.303	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050361.1	NM_014456	
PLIN5	440503	ucsc.edu;bcgsc.ca	37	19	4534034	4534034	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:4534034T>C	ENST00000381848.3	-	2	133	c.53A>G	c.(52-54)gAc>gGc	p.D18G	PLIN5_ENST00000592610.1_Missense_Mutation_p.D18G|PLIN5_ENST00000586133.1_Missense_Mutation_p.D18G|CTB-50L17.14_ENST00000586020.1_Missense_Mutation_p.T36A	NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	18	Essential for lipid droplet targeting. {ECO:0000250}.|Interaction with LIPE. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						CACCTGCTGGTCCTGCTCCCA	0.607																																						.											0													35.0	39.0	37.0					19																	4534034		2027	4181	6208	SO:0001583	missense	440503			DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.53A>G	19.37:g.4534034T>C	ENSP00000371272:p.Asp18Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRC1|Q6ZS68	Missense_Mutation	SNP	ENST00000381848.3	37	CCDS42473.1	.	.	.	.	.	.	.	.	.	.	.	2.952	-0.216591	0.06101	.	.	ENSG00000214456	ENST00000381848	T	0.05855	3.38	2.48	1.45	0.22620	.	0.840776	0.09839	U	0.749059	T	0.07279	0.0184	L	0.50333	1.59	0.09310	N	1	B;B	0.19200	0.034;0.017	B;B	0.19946	0.027;0.025	T	0.40213	-0.9575	10	0.32370	T	0.25	.	7.4427	0.27192	0.0:0.0:0.2189:0.7811	.	18;18	Q00G26-2;Q00G26	.;PLIN5_HUMAN	G	18	ENSP00000371272:D18G	ENSP00000371272:D18G	D	-	2	0	PLIN5	4485034	0.004000	0.15560	0.216000	0.23742	0.025000	0.11179	0.827000	0.27421	-0.006000	0.14370	-1.788000	0.00630	GAC		0.607	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706	
RAB11FIP4	84440	ucsc.edu	37	17	29844874	29844874	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:29844874G>T	ENST00000325874.8	+	4	771	c.542G>T	c.(541-543)gGc>gTc	p.G181V	RN7SL45P_ENST00000578050.1_RNA|RAB11FIP4_ENST00000394744.2_Missense_Mutation_p.G79V	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	181	Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				GGACTTGGGGGCCTGTTTCTG	0.567																																						.											0													13.0	16.0	15.0					17																	29844874		1993	3892	5885	SO:0001583	missense	84440			AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.542G>T	17.37:g.29844874G>T	ENSP00000312837:p.Gly181Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q52LI1|Q8N829|Q8NDT7|Q969D8	Missense_Mutation	SNP	ENST00000325874.8	37	CCDS11267.1	.	.	.	.	.	.	.	.	.	.	G	9.799	1.180141	0.21787	.	.	ENSG00000131242	ENST00000325874;ENST00000394744	.	.	.	5.55	2.41	0.29592	.	0.349613	0.32769	N	0.005677	T	0.43033	0.1229	L	0.29908	0.895	0.58432	D	0.999993	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.16482	-1.0401	8	.	.	.	-19.5212	13.7733	0.63038	0.0:0.4485:0.5515:0.0	.	79;181	Q86YS3-2;Q86YS3	.;RFIP4_HUMAN	V	181	.	.	G	+	2	0	RAB11FIP4	26868994	1.000000	0.71417	0.722000	0.30670	0.925000	0.55904	2.658000	0.46733	0.290000	0.22444	-0.438000	0.05819	GGC		0.567	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256195.2	NM_032932	
A4GNT	51146	mdanderson.org	37	3	137850003	137850003	+	Silent	SNP	A	A	G	rs2724691	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr3:137850003A>G	ENST00000236709.3	-	2	297	c.96T>C	c.(94-96)tgT>tgC	p.C32C		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	32					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						AAGAAGGCAAACAGAAGAGGC	0.557													G|||	3075	0.614018	0.5946	0.719	5008	,	,		16574	0.5476		0.662	False		,,,				2504	0.5849					.											0								G		2648,1758	521.2+/-370.5	794,1060,349	85.0	84.0	84.0		96	3.6	0.0	3	dbSNP_100	84	5754,2846	447.4+/-361.5	1918,1918,464	no	coding-synonymous	A4GNT	NM_016161.2		2712,2978,813	GG,GA,AA		33.093,39.9001,35.399		32/341	137850003	8402,4604	2203	4300	6503	SO:0001819	synonymous_variant	51146			AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.96T>C	3.37:g.137850003A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q0VDK1|Q0VDK2	Silent	SNP	ENST00000236709.3	37	CCDS3097.1																																																																																				0.557	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	NM_016161	
AHNAK2	113146	mdanderson.org	37	14	105416872	105416872	+	Missense_Mutation	SNP	T	T	C	rs148787429	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr14:105416872T>C	ENST00000333244.5	-	7	5035	c.4916A>G	c.(4915-4917)cAg>cGg	p.Q1639R	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1639						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCCTCCAGCTGCGCACCATC	0.592													.|||	704	0.140575	0.1566	0.0778	5008	,	,		17132	0.2401		0.0358	False		,,,				2504	0.1687					.											0								C	ARG/GLN	378,3456		58,262,1597	148.0	168.0	162.0		4916	-1.8	0.0	14	dbSNP_134	162	270,7886		40,190,3848	no	missense	AHNAK2	NM_138420.2	43	98,452,5445	CC,CT,TT		3.3104,9.8592,5.4045	benign	1639/5796	105416872	648,11342	1917	4078	5995	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4916A>G	14.37:g.105416872T>C	ENSP00000353114:p.Gln1639Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	214	0.09798534798534798	54	0.10975609756097561	36	0.09944751381215469	106	0.1853146853146853	18	0.023746701846965697	N	0.418	-0.909540	0.02434	0.098592	0.033104	ENSG00000185567	ENST00000333244	T	0.00659	5.94	3.11	-1.82	0.07857	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.08055	0.003	T	0.37619	-0.9698	8	0.24483	T	0.36	.	5.9125	0.19037	0.0:0.2565:0.1368:0.6067	.	1639	Q8IVF2	AHNK2_HUMAN	R	1639	ENSP00000353114:Q1639R	ENSP00000353114:Q1639R	Q	-	2	0	AHNAK2	104487917	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.109000	0.10840	-2.238000	0.00712	-3.443000	0.00036	CAG		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ANKRD20A5P	440482	mdanderson.org	37	18	14184023	14184023	+	RNA	SNP	T	T	G	rs62085009		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr18:14184023T>G	ENST00000581935.1	+	0	712							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						CTGCTCTCCATTATGCTGTGT	0.448																																						.											0													97.0	101.0	100.0					18																	14184023		2200	4292	6492			440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14184023T>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																					0.448	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
ANKRD30BL	554226	mdanderson.org	37	2	132912312	132912312	+	Missense_Mutation	SNP	T	T	C	rs199906464	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr2:132912312T>C	ENST00000409867.1	-	4	786	c.537A>G	c.(535-537)atA>atG	p.I179M	ANKRD30BL_ENST00000470729.1_5'UTR|RNU6-1132P_ENST00000459214.1_RNA			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	179										endometrium(1)|kidney(3)	4						TTCTTTTCCTTATGGCCAGTA	0.294																																						.											0																																										SO:0001583	missense	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.537A>G	2.37:g.132912312T>C	ENSP00000386398:p.Ile179Met	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	11.67	1.708267	0.30322	.	.	ENSG00000163046	ENST00000409867	T	0.68025	-0.3	0.569	0.569	0.17340	.	.	.	.	.	T	0.63768	0.2539	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.57906	-0.7730	5	0.72032	D	0.01	.	.	.	.	.	.	.	.	M	179	ENSP00000386398:I179M	ENSP00000295181:I179M	I	-	3	3	ANKRD30BL	132628782	0.000000	0.05858	0.157000	0.22605	0.428000	0.31595	-0.675000	0.05227	0.477000	0.27464	0.155000	0.16302	ATA		0.294	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ANKRD30BL	554226	mdanderson.org	37	2	132912316	132912316	+	Missense_Mutation	SNP	G	G	A	rs200558206		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr2:132912316G>A	ENST00000409867.1	-	4	782	c.533C>T	c.(532-534)gCc>gTc	p.A178V	ANKRD30BL_ENST00000470729.1_5'UTR|RNU6-1132P_ENST00000459214.1_RNA			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	178								p.A178V(2)		endometrium(1)|kidney(3)	4						TTTCCTTATGGCCAGTAAAAG	0.294																																						.											2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.533C>T	2.37:g.132912316G>A	ENSP00000386398:p.Ala178Val	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	14.64	2.594656	0.46214	.	.	ENSG00000163046	ENST00000409867	T	0.61627	0.09	0.569	0.569	0.17340	.	.	.	.	.	T	0.54046	0.1834	.	.	.	0.23581	N	0.997362	.	.	.	.	.	.	T	0.51228	-0.8732	5	0.66056	D	0.02	.	.	.	.	.	.	.	.	V	178	ENSP00000386398:A178V	ENSP00000295181:A178V	A	-	2	0	ANKRD30BL	132628786	0.014000	0.17966	0.261000	0.24466	0.477000	0.33069	0.281000	0.18810	0.567000	0.29293	0.184000	0.17185	GCC		0.294	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ANKRD30BL	554226	mdanderson.org	37	2	132912327	132912327	+	Silent	SNP	T	T	C	rs201025942		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr2:132912327T>C	ENST00000409867.1	-	4	771	c.522A>G	c.(520-522)ccA>ccG	p.P174P	ANKRD30BL_ENST00000470729.1_5'UTR|RNU6-1132P_ENST00000459214.1_RNA			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	174										endometrium(1)|kidney(3)	4						CCAGTAAAAGTGGTGTGTGGC	0.308																																						.											0																																										SO:0001819	synonymous_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.522A>G	2.37:g.132912327T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																					0.308	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ANKRD30BL	554226	mdanderson.org	37	2	132912341	132912341	+	Splice_Site	SNP	C	C	T	rs201696527		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr2:132912341C>T	ENST00000409867.1	-	4	757	c.508G>A	c.(508-510)Gct>Act	p.A170T	ANKRD30BL_ENST00000470729.1_5'UTR|RNU6-1132P_ENST00000459214.1_RNA			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	170								p.A170T(2)		endometrium(1)|kidney(3)	4						GTGTGGCCAGCCTGTAAAACA	0.313																																						.											2	Substitution - Missense(2)	kidney(2)																																								SO:0001630	splice_region_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.508-1G>A	2.37:g.132912341C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	9.294	1.051484	0.19827	.	.	ENSG00000163046	ENST00000409867	T	0.64438	-0.1	0.569	-0.552	0.11818	.	.	.	.	.	T	0.49847	0.1581	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.42716	-0.9435	5	0.38643	T	0.18	.	.	.	.	.	.	.	.	T	170	ENSP00000386398:A170T	ENSP00000295181:A170T	A	-	1	0	ANKRD30BL	132628811	0.467000	0.25831	0.261000	0.24466	0.505000	0.33919	0.179000	0.16840	-0.292000	0.08999	0.184000	0.17185	GCT		0.313	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	Missense_Mutation
CFHR1	3078	mdanderson.org	37	1	196797357	196797357	+	Silent	SNP	A	A	G	rs3201739	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr1:196797357A>G	ENST00000320493.5	+	4	676	c.588A>G	c.(586-588)acA>acG	p.T196T	CFHR1_ENST00000367424.4_Intron|CFHR2_ENST00000367421.3_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	196	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						GAAACTGGACAGAACCACCTC	0.348																																						.											0								A		1322,2228		545,232,998	66.0	100.0	90.0		588	0.6	1.0	1	dbSNP_105	90	1631,6527		669,293,3117	no	coding-synonymous	CFHR1	NM_002113.2		1214,525,4115	GG,GA,AA		19.9926,37.2394,25.2221		196/331	196797357	2953,8755	1775	4079	5854	SO:0001819	synonymous_variant	3078			M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.588A>G	1.37:g.196797357A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8K465|Q3B774|Q9UJ17	Silent	SNP	ENST00000320493.5	37	CCDS1386.1																																																																																				0.348	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2	NM_002113	
CNOT6L	246175	mdanderson.org	37	4	78650048	78650048	+	Silent	SNP	C	C	T	rs199946358	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr4:78650048C>T	ENST00000504123.1	-	10	1342	c.1212G>A	c.(1210-1212)ccG>ccA	p.P404P	CNOT6L_ENST00000264903.4_Silent_p.P404P			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	404	Nuclease domain.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						ATAGCACCAGCGGGATGGAAT	0.423													C|||	3	0.000599042	0.0023	0.0	5008	,	,		19748	0.0		0.0	False		,,,				2504	0.0					.											0								C		8,3758		0,8,1875	122.0	120.0	121.0		1212	4.7	1.0	4		121	0,8220		0,0,4110	no	coding-synonymous	CNOT6L	NM_144571.2		0,8,5985	TT,TC,CC		0.0,0.2124,0.0667		404/556	78650048	8,11978	1883	4110	5993	SO:0001819	synonymous_variant	246175			AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.1212G>A	4.37:g.78650048C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9UF92	Silent	SNP	ENST00000504123.1	37		3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	8.699	0.909296	0.17833	0.002124	0.0	ENSG00000138767	ENST00000515506	.	.	.	5.56	4.71	0.59529	.	.	.	.	.	T	0.41073	0.1143	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43278	-0.9401	4	.	.	.	-2.3006	4.5793	0.12252	0.192:0.5099:0.2233:0.0748	.	.	.	.	T	433	.	.	A	-	1	0	CNOT6L	78869072	0.930000	0.31532	1.000000	0.80357	0.998000	0.95712	0.063000	0.14410	2.627000	0.88993	0.563000	0.77884	GCT		0.423	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362515.1		
CSGALNACT2	55454	mdanderson.org	37	10	43659338	43659339	+	Missense_Mutation	DNP	CT	CT	TG	rs114078794|rs78146682	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr10:43659338_43659339CT>TG	ENST00000374466.3	+	5	1340_1341	c.1005_1006CT>TG	c.(1003-1008)acCTtg>acTGtg	p.L336V		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	336					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.T335T(3)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						ACAATTACACCTTGGTCTCATT	0.401																																						.											3	Substitution - coding silent(3)	endometrium(3)																																								SO:0001583	missense	55454			AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	Exception_encountered	10.37:g.43659338_43659339delinsTG	ENSP00000363590:p.Leu336Val	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	DNP	ENST00000374466.3	37	CCDS7201.1																																																																																				0.401	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
CSGALNACT2	55454	mdanderson.org	37	10	43659372	43659372	+	Nonsense_Mutation	SNP	C	C	T	rs76607193	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr10:43659372C>T	ENST00000374466.3	+	5	1374	c.1039C>T	c.(1039-1041)Cga>Tga	p.R347*		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	347					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.R347*(1)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TAATCGTGGACGAGGACTAAA	0.408																																						.											1	Substitution - Nonsense(1)	skin(1)											191.0	181.0	184.0					10																	43659372		2203	4300	6503	SO:0001587	stop_gained	55454			AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1039C>T	10.37:g.43659372C>T	ENSP00000363590:p.Arg347*	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Nonsense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	C	41	8.712957	0.98925	.	.	ENSG00000169826	ENST00000374466	.	.	.	6.08	4.19	0.49359	.	0.110120	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-3.2438	15.5126	0.75795	0.253:0.747:0.0:0.0	.	.	.	.	X	347	.	ENSP00000363590:R347X	R	+	1	2	CSGALNACT2	42979378	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	1.226000	0.32563	0.852000	0.35287	0.591000	0.81541	CGA		0.408	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
EMR2	30817	mdanderson.org	37	19	14877799	14877799	+	Missense_Mutation	SNP	G	G	C	rs12976472	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:14877799G>C	ENST00000315576.3	-	6	929	c.478C>G	c.(478-480)Ctc>Gtc	p.L160V	EMR2_ENST00000392967.2_Missense_Mutation_p.L160V|EMR2_ENST00000392964.3_5'UTR|EMR2_ENST00000594294.1_Missense_Mutation_p.L160V|EMR2_ENST00000599423.1_5'Flank|EMR2_ENST00000346057.1_Missense_Mutation_p.L160V|EMR2_ENST00000353005.1_Intron|EMR2_ENST00000595839.1_Intron|EMR2_ENST00000596991.2_Missense_Mutation_p.L160V|EMR2_ENST00000353876.1_Intron|EMR2_ENST00000392965.3_Missense_Mutation_p.L160V|EMR2_ENST00000594076.1_Intron|EMR2_ENST00000601345.1_Missense_Mutation_p.L160V	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	160	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						CCTGTGCAGAGCTTCGGGTCC	0.617																																						.											0								G	VAL/LEU,VAL/LEU,,,VAL/LEU,VAL/LEU,	1741,2609		740,261,1174	36.0	42.0	40.0		478,478,,,478,478,	-1.3	0.0	19	dbSNP_121	40	2362,6160		964,434,2863	yes	missense,missense,intron,intron,missense,missense,intron	EMR2	NM_013447.2,NM_152916.1,NM_152917.1,NM_152918.1,NM_152919.1,NM_152920.1,NM_152921.1	32,32,,,32,32,	1704,695,4037	CC,CG,GG		27.7165,40.023,31.8754	benign,benign,,,benign,benign,	160/824,160/775,,,160/813,160/764,	14877799	4103,8769	2175	4261	6436	SO:0001583	missense	30817			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.478C>G	19.37:g.14877799G>C	ENSP00000319883:p.Leu160Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	ENST00000315576.3	37	CCDS32935.1	839	0.3841575091575092	243	0.49390243902439024	152	0.4198895027624309	169	0.29545454545454547	275	0.3627968337730871	G	0.563	-0.844360	0.02671	0.40023	0.277165	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000360222;ENST00000392965;ENST00000392962	T;T;T;T;T	0.78364	-0.86;-0.99;-1.17;-1.15;-1.04	3.06	-1.28	0.09318	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	P;B;B;B	0.42757	0.789;0.008;0.097;0.019	B;B;B;B	0.40940	0.344;0.019;0.046;0.015	T	0.30297	-0.9983	8	0.09590	T	0.72	.	4.8562	0.13561	0.0:0.2107:0.3614:0.4279	rs12976472	160;160;160;160	E7ESD7;Q9UHX3-3;Q9UHX3;Q9UHX3-2	.;.;EMR2_HUMAN;.	V	160	ENSP00000319883:L160V;ENSP00000376694:L160V;ENSP00000263380:L160V;ENSP00000376692:L160V;ENSP00000376689:L160V	ENSP00000319883:L160V	L	-	1	0	EMR2	14738799	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.286000	0.08399	0.069000	0.16605	0.508000	0.49915	CTC		0.617	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2		
EP400	57634	mdanderson.org	37	12	132547093	132547093	+	Silent	SNP	A	A	G	rs10902490|rs528214697	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr12:132547093A>G	ENST00000333577.4	+	48	8398	c.8289A>G	c.(8287-8289)caA>caG	p.Q2763Q	EP400_ENST00000389562.2_Silent_p.Q2726Q|EP400_ENST00000332482.4_Silent_p.Q2690Q|EP400_ENST00000330386.6_Silent_p.Q2646Q|EP400_ENST00000389561.2_Silent_p.Q2727Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.567																																						.											9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)											25.0	29.0	28.0					12																	132547093		2173	4217	6390	SO:0001819	synonymous_variant	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8289A>G	12.37:g.132547093A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																					0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
FAM182A	284800	mdanderson.org	37	20	26063577	26063577	+	RNA	SNP	C	C	T	rs201158839		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr20:26063577C>T	ENST00000376398.2	+	0	1094					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						ATAAAATATCCACGCATCCTT	0.448													.|||	1	0.000199681	0.0	0.0	5008	,	,		13425	0.0		0.0	False		,,,				2504	0.001					.											0													67.0	51.0	56.0					20																	26063577		685	1502	2187			284800			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26063577C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37																																																																																					0.448	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
HERC5	51191	mdanderson.org	37	4	89380519	89380519	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr4:89380519A>G	ENST00000264350.3	+	2	440	c.287A>G	c.(286-288)aAc>aGc	p.N96S	HERC5_ENST00000508695.1_3'UTR	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	96					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TTAGGAAAAAACATGAAGATA	0.353																																					Esophageal Squamous(39;887 1012 34045 50514)	.											0													122.0	120.0	121.0					4																	89380519		2203	4300	6503	SO:0001583	missense	51191			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.287A>G	4.37:g.89380519A>G	ENSP00000264350:p.Asn96Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTQ1|Q69G20	Missense_Mutation	SNP	ENST00000264350.3	37	CCDS3630.1	.	.	.	.	.	.	.	.	.	.	a	9.031	0.987277	0.18889	.	.	ENSG00000138646	ENST00000264350	T	0.80824	-1.42	3.62	3.62	0.41486	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.233755	0.27595	N	0.018671	T	0.67268	0.2875	L	0.31371	0.925	0.80722	D	1	B	0.10296	0.003	B	0.04013	0.001	T	0.60835	-0.7184	10	0.19147	T	0.46	.	10.6203	0.45476	1.0:0.0:0.0:0.0	.	96	Q9UII4	HERC5_HUMAN	S	96	ENSP00000264350:N96S	ENSP00000264350:N96S	N	+	2	0	HERC5	89599542	0.786000	0.28738	0.999000	0.59377	0.700000	0.40528	2.129000	0.42055	1.894000	0.54839	0.529000	0.55759	AAC		0.353	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323	
HLA-B	3106	mdanderson.org	37	6	31324911	31324911	+	Missense_Mutation	SNP	C	C	G	rs1050462	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr6:31324911C>G	ENST00000412585.2	-	1	53	c.25G>C	c.(25-27)Gtc>Ctc	p.V9L		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	9			V -> L (in dbSNP:rs1050462).		antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						AGCAGGAGGACGGTTCGGGGC	0.692									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				.|||	1155	0.230631	0.1233	0.245	5008	,	,		8959	0.25		0.3062	False		,,,				2504	0.2679					.											0								C	LEU/VAL	238,3960		11,216,1872	13.0	12.0	12.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	25	2.5	0.1	6	dbSNP_86	12	981,7141		59,863,3139	yes	missense	HLA-B	NM_005514.6	32	70,1079,5011	GG,GC,CC		12.0783,5.6694,9.8945		9/363	31324911	1219,11101	2099	4061	6160	SO:0001583	missense	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.25G>C	6.37:g.31324911C>G	ENSP00000399168:p.Val9Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	494	0.2261904761904762	61	0.12398373983739837	84	0.23204419889502761	135	0.23601398601398602	214	0.28232189973614774	N	8.101	0.776701	0.16120	0.056694	0.120783	ENSG00000234745	ENST00000412585	T	0.00597	6.31	3.34	2.47	0.30058	.	0.330918	0.16642	N	0.205609	T	0.00109	0.0003	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.06405	0.002	T	0.12400	-1.0549	8	0.02654	T	1	.	8.6444	0.33996	0.0:0.237:0.763:0.0	rs1050462;rs2308334;rs3177903;rs3190781;rs9266204;rs17416898;rs17840061	9	P01889	1B07_HUMAN	L	9	ENSP00000399168:V9L	ENSP00000399168:V9L	V	-	1	0	HLA-B	31432890	0.007000	0.16637	0.054000	0.19295	0.040000	0.13550	0.447000	0.21710	0.756000	0.33013	-0.435000	0.05868	GTC		0.692	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
HLA-DRB5	3127	mdanderson.org	37	6	32497931	32497931	+	Missense_Mutation	SNP	G	G	A	rs147565130	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr6:32497931G>A	ENST00000374975.3	-	1	133	c.71C>T	c.(70-72)tCc>tTc	p.S24F		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						AGCCAGTGGGGAGCTCAGCAC	0.557																																						.											0													96.0	100.0	99.0					6																	32497931		2203	4300	6503	SO:0001583	missense	3127				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.71C>T	6.37:g.32497931G>A	ENSP00000364114:p.Ser24Phe	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000374975.3	37	CCDS4751.1	.	.	.	.	.	.	.	.	.	.	.	11.29	1.594048	0.28445	.	.	ENSG00000198502	ENST00000374975	T	0.00267	8.38	4.32	1.46	0.22682	MHC classes I/II-like antigen recognition protein (1);	.	.	.	.	T	0.00073	0.0002	L	0.52905	1.665	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.37454	-0.9705	9	0.62326	D	0.03	.	6.5543	0.22452	0.3227:0.0:0.6773:0.0	.	24	Q30154	DRB5_HUMAN	F	24	ENSP00000364114:S24F	ENSP00000364114:S24F	S	-	2	0	HLA-DRB5	32605909	0.001000	0.12720	0.035000	0.18076	0.177000	0.22998	1.003000	0.29809	0.461000	0.27071	0.485000	0.47835	TCC		0.557	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076022.2	NM_002125	
KIAA1551	55196	mdanderson.org	37	12	32138691	32138691	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr12:32138691A>G	ENST00000312561.4	+	4	5216	c.4802A>G	c.(4801-4803)gAa>gGa	p.E1601G	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1601																	ACCAAATTAGAAAGTTCACCC	0.368																																						.											0													67.0	73.0	71.0					12																	32138691		2202	4300	6502	SO:0001583	missense	55196			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.4802A>G	12.37:g.32138691A>G	ENSP00000310338:p.Glu1601Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	A	10.82	1.459493	0.26248	.	.	ENSG00000174718	ENST00000312561	T	0.15017	2.46	5.44	4.27	0.50696	.	0.695490	0.13932	N	0.352814	T	0.12987	0.0315	N	0.19112	0.55	0.22330	N	0.999195	P	0.39480	0.675	B	0.40940	0.344	T	0.15983	-1.0418	9	.	.	.	.	10.8893	0.46986	0.8422:0.1578:0.0:0.0	.	1601	Q9HCM1	CL035_HUMAN	G	1601	ENSP00000310338:E1601G	.	E	+	2	0	C12orf35	32029958	0.990000	0.36364	0.056000	0.19401	0.258000	0.26162	3.724000	0.54962	0.855000	0.35359	0.455000	0.32223	GAA		0.368	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
KIF24	347240	mdanderson.org	37	9	34310782	34310782	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:34310782A>G	ENST00000402558.2	-	1	587	c.563T>C	c.(562-564)aTt>aCt	p.I188T	KIF24_ENST00000345050.2_Missense_Mutation_p.I188T|KIF24_ENST00000379166.2_Missense_Mutation_p.I188T|KIF24_ENST00000379174.3_Missense_Mutation_p.I188T			Q5T7B8	KIF24_HUMAN	kinesin family member 24	188					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			TCTTTGAATAATGGGAATATC	0.368																																						.											0													140.0	134.0	136.0					9																	34310782		1844	4097	5941	SO:0001583	missense	347240			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.563T>C	9.37:g.34310782A>G	ENSP00000384433:p.Ile188Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845864	0.32606	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.72394	-0.41;-0.65;-0.41;-0.65	5.48	1.37	0.22104	.	0.756495	0.11337	N	0.574500	T	0.61261	0.2333	L	0.50333	1.59	0.21841	N	0.999512	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.52961	-0.8505	10	0.49607	T	0.09	.	6.6848	0.23138	0.7316:0.0:0.1496:0.1188	.	188;188	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	T	188	ENSP00000384433:I188T;ENSP00000368472:I188T;ENSP00000368464:I188T;ENSP00000340179:I188T	ENSP00000340179:I188T	I	-	2	0	KIF24	34300782	0.691000	0.27709	0.986000	0.45419	0.971000	0.66376	1.175000	0.31944	0.368000	0.24481	-0.280000	0.10049	ATT		0.368	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5		
LILRA4	23547	mdanderson.org	37	19	54845018	54845018	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:54845018T>C	ENST00000291759.4	-	8	1381	c.1325A>G	c.(1324-1326)tAc>tGc	p.Y442C	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	442					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		CTCCACTGTGTAATCCTGGAG	0.562																																						.											0													104.0	94.0	97.0					19																	54845018		2203	4300	6503	SO:0001583	missense	23547			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.1325A>G	19.37:g.54845018T>C	ENSP00000291759:p.Tyr442Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MC4	Missense_Mutation	SNP	ENST00000291759.4	37	CCDS12890.1	.	.	.	.	.	.	.	.	.	.	.	12.61	1.990687	0.35131	.	.	ENSG00000239961	ENST00000291759	T	0.00644	6.01	3.08	2.05	0.26809	.	4.632680	0.00961	N	0.003108	T	0.03520	0.0101	M	0.80616	2.505	0.09310	N	1	D	0.76494	0.999	D	0.70487	0.969	T	0.30446	-0.9978	10	0.66056	D	0.02	.	4.8432	0.13501	0.0:0.1453:0.0:0.8547	.	442	P59901	LIRA4_HUMAN	C	442	ENSP00000291759:Y442C	ENSP00000291759:Y442C	Y	-	2	0	LILRA4	59536830	0.515000	0.26210	0.046000	0.18839	0.038000	0.13279	0.744000	0.26245	0.581000	0.29539	0.460000	0.39030	TAC		0.562	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276	
LILRB5	10990	mdanderson.org	37	19	54758897	54758897	+	Missense_Mutation	SNP	A	A	T	rs201754865		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:54758897A>T	ENST00000316219.5	-	6	1063	c.956T>A	c.(955-957)cTg>cAg	p.L319Q	LILRB5_ENST00000345866.6_Missense_Mutation_p.L219Q|LILRB5_ENST00000449561.2_Missense_Mutation_p.L319Q|LILRB5_ENST00000450632.1_Missense_Mutation_p.L310Q	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	319					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTCAGGGATCAGTCCTGGAGA	0.597																																						.											0													21.0	21.0	21.0					19																	54758897		2202	4300	6502	SO:0001583	missense	10990			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.956T>A	19.37:g.54758897A>T	ENSP00000320390:p.Leu319Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.693568	0.00731	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00476	7.2;7.15;7.19;7.18	3.32	-4.58	0.03410	.	1.425370	0.05061	N	0.479896	T	0.00109	0.0003	N	0.00277	-1.72	0.09310	N	1	B;B;B;B;B	0.12630	0.001;0.006;0.003;0.001;0.0	B;B;B;B;B	0.12837	0.004;0.008;0.007;0.002;0.002	T	0.43458	-0.9390	10	0.02654	T	1	.	0.9412	0.01355	0.3013:0.1143:0.3475:0.2369	.	310;210;219;319;319	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	Q	319;310;319;219	ENSP00000320390:L319Q;ENSP00000414225:L310Q;ENSP00000406478:L319Q;ENSP00000263430:L219Q	ENSP00000320390:L319Q	L	-	2	0	LILRB5	59450709	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.550000	0.00434	-0.714000	0.04975	-0.460000	0.05396	CTG		0.597	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
LILRB5	10990	mdanderson.org	37	19	54759241	54759241	+	Missense_Mutation	SNP	C	C	G	rs146167320		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:54759241C>G	ENST00000316219.5	-	5	967	c.860G>C	c.(859-861)cGc>cCc	p.R287P	LILRB5_ENST00000345866.6_Missense_Mutation_p.R187P|LILRB5_ENST00000449561.2_Missense_Mutation_p.R287P|LILRB5_ENST00000450632.1_Missense_Mutation_p.R278P	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	287	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCCGTGGGAGCGGCTCACAGG	0.662																																						.											0													42.0	43.0	42.0					19																	54759241		2203	4299	6502	SO:0001583	missense	10990			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.860G>C	19.37:g.54759241C>G	ENSP00000320390:p.Arg287Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	C	0.152	-1.090490	0.01873	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.11277	2.79;2.79;2.79;2.79	2.35	-4.71	0.03279	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	3.187420	0.01181	N	0.007095	T	0.04272	0.0118	N	0.03294	-0.36	0.09310	N	1	B;B;B;B;B	0.23185	0.012;0.081;0.034;0.066;0.003	B;B;B;B;B	0.27500	0.036;0.033;0.045;0.08;0.018	T	0.27226	-1.0080	10	0.23302	T	0.38	.	0.448	0.00497	0.3596:0.2013:0.2366:0.2026	.	278;178;187;287;287	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	P	287;278;287;187	ENSP00000320390:R287P;ENSP00000414225:R278P;ENSP00000406478:R287P;ENSP00000263430:R187P	ENSP00000320390:R287P	R	-	2	0	LILRB5	59451053	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.171000	0.00281	-3.550000	0.00142	-0.827000	0.03088	CGC		0.662	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
LILRB5	10990	mdanderson.org	37	19	54759290	54759290	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:54759290G>A	ENST00000316219.5	-	5	918	c.811C>T	c.(811-813)Ccc>Tcc	p.P271S	LILRB5_ENST00000345866.6_Missense_Mutation_p.P171S|LILRB5_ENST00000449561.2_Missense_Mutation_p.P271S|LILRB5_ENST00000450632.1_Missense_Mutation_p.P262S	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	271	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCAGCCTGGGGCTGCTGGCCA	0.627																																						.											0													45.0	46.0	46.0					19																	54759290		2203	4300	6503	SO:0001583	missense	10990			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.811C>T	19.37:g.54759290G>A	ENSP00000320390:p.Pro271Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	G	8.086	0.773447	0.16051	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00675	5.88;5.88;5.88;5.88	2.19	-4.38	0.03622	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.405960	0.04922	N	0.455206	T	0.01156	0.0038	L	0.29908	0.895	0.09310	N	1	B;P;P;P;P	0.47302	0.437;0.586;0.544;0.88;0.893	B;B;B;P;P	0.53689	0.349;0.389;0.353;0.583;0.732	T	0.36480	-0.9746	10	0.36615	T	0.2	.	4.0167	0.09647	0.1434:0.0:0.2763:0.5803	.	262;162;171;271;271	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	S	271;262;271;171	ENSP00000320390:P271S;ENSP00000414225:P262S;ENSP00000406478:P271S;ENSP00000263430:P171S	ENSP00000320390:P271S	P	-	1	0	LILRB5	59451102	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.421000	0.07053	-0.890000	0.03945	-0.493000	0.04662	CCC		0.627	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
LILRA4	23547	mdanderson.org	37	19	54845027	54845027	+	Missense_Mutation	SNP	A	A	T	rs534532199	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:54845027A>T	ENST00000291759.4	-	8	1372	c.1316T>A	c.(1315-1317)cTc>cAc	p.L439H	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	439					immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		GTAATCCTGGAGGTGTGGGGC	0.562													A|||	38	0.00758786	0.0	0.0	5008	,	,		20088	0.002		0.004	False		,,,				2504	0.0327					.											0													106.0	95.0	99.0					19																	54845027		2203	4300	6503	SO:0001583	missense	23547			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.1316T>A	19.37:g.54845027A>T	ENSP00000291759:p.Leu439His	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MC4	Missense_Mutation	SNP	ENST00000291759.4	37	CCDS12890.1	.	.	.	.	.	.	.	.	.	.	.	0.637	-0.815062	0.02776	.	.	ENSG00000239961	ENST00000291759	T	0.00514	6.88	2.96	-5.63	0.02474	.	.	.	.	.	T	0.00328	0.0010	L	0.31578	0.945	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35400	-0.9790	9	0.45353	T	0.12	.	4.9614	0.14068	0.3711:0.0:0.4882:0.1407	.	439	P59901	LIRA4_HUMAN	H	439	ENSP00000291759:L439H	ENSP00000291759:L439H	L	-	2	0	LILRA4	59536839	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.301000	0.00257	-1.097000	0.03042	-2.427000	0.00216	CTC		0.562	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276	
MLLT3	4300	mdanderson.org	37	9	20414343	20414343	+	Silent	SNP	A	A	G	rs372894655	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:20414343A>G	ENST00000380338.4	-	5	787	c.501T>C	c.(499-501)agT>agC	p.S167S	MLLT3_ENST00000429426.2_Silent_p.S164S|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	167	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S167S(19)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.532			T	MLL	ALL								A|||	612	0.122204	0.1505	0.1066	5008	,	,		12422	0.0833		0.0716	False		,,,				2504	0.1871					.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	19	Substitution - coding silent(19)	lung(8)|kidney(5)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|prostate(1)											8.0	15.0	13.0					9																	20414343		1537	3257	4794	SO:0001819	synonymous_variant	4300			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.501T>C	9.37:g.20414343A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																				0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
RNF123	63891	mdanderson.org	37	3	49725021	49725021	+	5'Flank	SNP	C	C	T	rs114429531		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr3:49725021C>T	ENST00000327697.6	+	0	0				RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000383728.3_Missense_Mutation_p.R33H|MST1_ENST00000545762.1_Missense_Mutation_p.R94H|MST1_ENST00000494828.2_5'UTR|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000449682.2_Missense_Mutation_p.R108H	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GCGCCCAGAACGCCGCAGCCT	0.602																																						.											0													57.0	52.0	54.0					3																	49725021		2203	4300	6503	SO:0001631	upstream_gene_variant	4485			AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725021C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	C	6.297	0.422849	0.11928	.	.	ENSG00000173531	ENST00000449682;ENST00000383728;ENST00000545762	D;D;D	0.89617	-2.54;-2.54;-2.54	5.13	-2.2	0.06994	.	1.343830	0.05227	N	0.509632	T	0.81777	0.4894	L	0.31065	0.9	0.25358	N	0.98881	B;B	0.23058	0.079;0.013	B;B	0.17979	0.02;0.02	T	0.64997	-0.6275	10	0.33940	T	0.23	.	9.7461	0.40448	0.0:0.4826:0.0918:0.4256	.	94;108	B7Z538;G3XAK1	.;.	H	108;33;94	ENSP00000414287:R108H;ENSP00000373234:R33H;ENSP00000437535:R94H	ENSP00000373234:R33H	R	-	2	0	MST1	49700025	0.007000	0.16637	0.005000	0.12908	0.310000	0.27922	0.043000	0.13971	-0.712000	0.04988	-1.936000	0.00505	CGT		0.602	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
MUC17	140453	mdanderson.org	37	7	100684573	100684573	+	Silent	SNP	G	G	A	rs144023476	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr7:100684573G>A	ENST00000306151.4	+	3	9940	c.9876G>A	c.(9874-9876)acG>acA	p.T3292T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3292	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCACCACAACGGTGGCCAGTT	0.512													G|||	172	0.034345	0.0688	0.0072	5008	,	,		27204	0.0298		0.0149	False		,,,				2504	0.0317					.											0								G		35,4371	28.1+/-56.4	2,31,2170	331.0	330.0	330.0		9876	-2.6	0.0	7	dbSNP_134	330	5,8595	2.2+/-6.3	0,5,4295	no	coding-synonymous	MUC17	NM_001040105.1		2,36,6465	AA,AG,GG		0.0581,0.7944,0.3076		3292/4494	100684573	40,12966	2203	4300	6503	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9876G>A	7.37:g.100684573G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																				0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC4	4585	mdanderson.org	37	3	195506530	195506530	+	Missense_Mutation	SNP	C	C	G	rs201186756	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr3:195506530C>G	ENST00000463781.3	-	2	12380	c.11921G>C	c.(11920-11922)cGt>cCt	p.R3974P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.R3974P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCTGAGGAACGGCTGGTGAC	0.592													.|||	839	0.167532	0.1959	0.1225	5008	,	,		7943	0.0794		0.2555	False		,,,				2504	0.1616					.											0													10.0	7.0	8.0					3																	195506530		529	1169	1698	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11921G>C	3.37:g.195506530C>G	ENSP00000417498:p.Arg3974Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.027	-1.362500	0.01235	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.51817	1.18;0.69	.	.	.	.	.	.	.	.	T	0.22627	0.0546	N	0.14661	0.345	0.80722	P	0.0	B	0.13145	0.007	B	0.01281	0.0	T	0.17806	-1.0357	6	.	.	.	.	6.1553	0.20334	0.0:0.3911:0.6089:0.0	.	3846	E7ESK3	.	P	3974	ENSP00000417498:R3974P;ENSP00000420243:R3974P	.	R	-	2	0	MUC4	196991309	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-4.899000	0.00172	-2.030000	0.00929	-2.332000	0.00249	CGT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195510900	195510900	+	Missense_Mutation	SNP	G	G	T	rs201192572	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr3:195510900G>T	ENST00000463781.3	-	2	8010	c.7551C>A	c.(7549-7551)gaC>gaA	p.D2517E	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2517E|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGAGGGAGTGTCGGTGACAG	0.572													.|||	363	0.072484	0.1157	0.0663	5008	,	,		15268	0.0		0.1252	False		,,,				2504	0.0389					.											0								G	,GLU/ASP,	134,1188		11,112,538	92.0	75.0	80.0		,7551,		0.0	3	dbSNP_132	80	338,2844		10,318,1263	no	intron,missense,intron	MUC4	NM_004532.5,NM_018406.6,NM_138297.4	,45,	21,430,1801	TT,TG,GG		10.6223,10.1362,10.4796	,possibly-damaging,	,2517/5413,	195510900	472,4032	661	1591	2252	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7551C>A	3.37:g.195510900G>T	ENSP00000417498:p.Asp2517Glu	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.741	0.505442	0.12822	0.101362	0.106223	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28895	1.59;1.59	.	.	.	.	.	.	.	.	T	0.00241	0.0007	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.04013	0.001	T	0.29882	-0.9997	7	.	.	.	.	2.6652	0.05046	0.5:0.0:0.5:0.0	.	2517	E7ESK3	.	E	2517	ENSP00000417498:D2517E;ENSP00000420243:D2517E	.	D	-	3	2	MUC4	196995295	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	-0.189000	0.09629	-0.000000	0.14550	0.000000	0.15137	GAC		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1017966	1017966	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr11:1017966A>G	ENST00000421673.2	-	31	4885	c.4835T>C	c.(4834-4836)cTt>cCt	p.L1612P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1612	Approximate repeats.|Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGAGTGGGAAGTGTGGTCTG	0.547																																						.											0													475.0	445.0	455.0					11																	1017966		2191	4283	6474	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4835T>C	11.37:g.1017966A>G	ENSP00000406861:p.Leu1612Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	A	5.280	0.237104	0.10023	.	.	ENSG00000184956	ENST00000421673	T	0.20738	2.05	2.39	-4.77	0.03219	.	.	.	.	.	T	0.15003	0.0362	L	0.49126	1.545	0.09310	N	1	B	0.26081	0.141	B	0.28305	0.088	T	0.34750	-0.9816	9	0.30078	T	0.28	.	4.2322	0.10608	0.4312:0.3355:0.2332:0.0	.	1612	Q6W4X9	MUC6_HUMAN	P	1612	ENSP00000406861:L1612P	ENSP00000406861:L1612P	L	-	2	0	MUC6	1007966	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-1.263000	0.02850	-0.760000	0.04677	0.247000	0.18012	CTT		0.547	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
NBPF3	84224	mdanderson.org	37	1	21806667	21806667	+	Missense_Mutation	SNP	C	C	G	rs12043777	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr1:21806667C>G	ENST00000318249.5	+	11	1682	c.1332C>G	c.(1330-1332)gaC>gaG	p.D444E	NBPF3_ENST00000318220.6_Missense_Mutation_p.D388E|NBPF3_ENST00000454000.2_Missense_Mutation_p.D374E|NBPF3_ENST00000342104.5_Missense_Mutation_p.D432E	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	444	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.		D -> E (in dbSNP:rs12043777). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.			cytoplasm (GO:0005737)		p.D444E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		ACAGAAGTGACTTTTACTCAT	0.453																																						.											1	Substitution - Missense(1)	prostate(1)						C	GLU/ASP	128,4248		35,58,2095	87.0	47.0	61.0		1332	-1.3	0.0	1	dbSNP_120	61	1540,6608		435,670,2969	no	missense	NBPF3	NM_032264.2	45	470,728,5064	GG,GC,CC		18.9003,2.925,13.3184	benign	444/634	21806667	1668,10856	2188	4074	6262	SO:0001583	missense	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1332C>G	1.37:g.21806667C>G	ENSP00000316782:p.Asp444Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Silent	SNP	ENST00000318249.5	37	CCDS216.1	705	0.3228021978021978	55	0.11178861788617886	140	0.3867403314917127	235	0.41083916083916083	275	0.3627968337730871	.	1.891	-0.455414	0.04540	0.02925	0.189003	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32	0.658	-1.32	0.09201	DUF1220 (2);	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.24823	0.0;0.112	B;B	0.25140	0.001;0.058	T	0.45279	-0.9272	7	0.52906	T	0.07	.	.	.	.	rs56119644	432;444	Q9H094-3;Q9H094	.;NBPF3_HUMAN	E	374;388;444;432;388	ENSP00000415711:D374E;ENSP00000316739:D388E;ENSP00000316782:D444E;ENSP00000340336:D432E;ENSP00000391865:D388E	ENSP00000316739:D388E	D	+	3	2	NBPF3	21679254	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	0.088000	0.14979	-0.800000	0.04433	0.121000	0.15741	GAC		0.453	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264	
NBPF10	100132406	mdanderson.org	37	1	145302745	145302745	+	Missense_Mutation	SNP	A	A	T	rs376449217		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr1:145302745A>T	ENST00000369339.3	+	5	623	c.370A>T	c.(370-372)Aat>Tat	p.N124Y	NBPF10_ENST00000342960.5_Missense_Mutation_p.N395Y|NBPF10_ENST00000369338.1_Missense_Mutation_p.N124Y|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	395						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCGCTCATTGAATGAGCATCT	0.557																																						.											0																																										SO:0001583	missense	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.370A>T	1.37:g.145302745A>T	ENSP00000358345:p.Asn124Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.	.	.	.	.	.	.	.	.	.	.	10.64	1.406203	0.25378	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.41065	1.01;4.01	0.712	-0.618	0.11576	.	.	.	.	.	T	0.19366	0.0465	M	0.62723	1.935	0.09310	N	1	B	0.18461	0.028	B	0.29077	0.098	T	0.43507	-0.9387	8	0.62326	D	0.03	.	.	.	.	.	124	A8MQ30	.	Y	320;124;124;395	ENSP00000358344:N124Y;ENSP00000345684:N395Y	ENSP00000345684:N395Y	N	+	1	0	NBPF10	144014102	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.371000	0.34250	-0.245000	0.09625	-0.537000	0.04273	AAT		0.557	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703	
OR13C5	138799	mdanderson.org	37	9	107361111	107361111	+	Missense_Mutation	SNP	T	T	C	rs6479259	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:107361111T>C	ENST00000374779.2	-	1	677	c.584A>G	c.(583-585)aAt>aGt	p.N195S		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	195			N -> S (in dbSNP:rs6479259).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						GATGAACTCATTGCCTGAGAT	0.373													T|||	669	0.133586	0.3676	0.0504	5008	,	,		24620	0.0704		0.007	False		,,,				2504	0.0716					.											0								T	SER/ASN	1329,3077	446.5+/-348.0	197,935,1071	191.0	175.0	180.0		584	-4.1	0.0	9	dbSNP_116	180	35,8565	24.0+/-70.4	0,35,4265	yes	missense	OR13C5	NM_001004482.1	46	197,970,5336	CC,CT,TT		0.407,30.1634,10.4875	probably-damaging	195/319	107361111	1364,11642	2203	4300	6503	SO:0001583	missense	138799				CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.584A>G	9.37:g.107361111T>C	ENSP00000363911:p.Asn195Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	ENST00000374779.2	37	CCDS35091.1	202	0.0924908424908425	155	0.3150406504065041	8	0.022099447513812154	35	0.06118881118881119	4	0.005277044854881266	T	15.48	2.846604	0.51164	0.301634	0.00407	ENSG00000255800	ENST00000374779	T	0.00211	8.54	4.17	-4.11	0.03928	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39407	U	0.001380	T	0.00012	0.0000	L	0.58101	1.795	0.80722	P	0.0	D	0.59357	0.985	D	0.63283	0.913	T	0.43442	-0.9391	9	0.62326	D	0.03	.	10.4853	0.44717	0.6686:0.0:0.0:0.3314	rs6479259;rs52801984;rs6479259	195	Q8NGS8	O13C5_HUMAN	S	195	ENSP00000363911:N195S	ENSP00000363911:N195S	N	-	2	0	OR13C5	106400932	0.000000	0.05858	0.000000	0.03702	0.315000	0.28087	-0.658000	0.05329	-1.031000	0.03308	0.433000	0.28618	AAT		0.373	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053479.2	NM_001004482	
OBP2B	29989	mdanderson.org	37	9	136083528	136083528	+	Missense_Mutation	SNP	T	T	A	rs3192921	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr9:136083528T>A	ENST00000372034.3	-	3	310	c.269A>T	c.(268-270)tAc>tTc	p.Y90F	OBP2B_ENST00000461961.1_5'UTR|OBP2B_ENST00000372032.2_Silent_p.I45I	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	90					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)			central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		ACAGGCGCTGTATTTGCCAGG	0.642																																						.											0													60.0	58.0	59.0					9																	136083528		2203	4300	6503	SO:0001583	missense	29989			AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.269A>T	9.37:g.136083528T>A	ENSP00000361104:p.Tyr90Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	37	CCDS6961.1	.	.	.	.	.	.	.	.	.	.	A	0.025	-1.376984	0.01214	.	.	ENSG00000171102	ENST00000372034	T	0.06849	3.25	1.91	0.679	0.17975	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.188123	0.26062	N	0.026576	T	0.04543	0.0124	N	0.24115	0.695	0.19945	N	0.999945	B	0.33000	0.393	B	0.37731	0.257	T	0.39881	-0.9592	10	0.02654	T	1	-47.8449	5.6514	0.17618	0.2549:0.0:0.0:0.7451	rs3192921;rs17417803	90	Q9NPH6	OBP2B_HUMAN	F	90	ENSP00000361104:Y90F	ENSP00000361104:Y90F	Y	-	2	0	OBP2B	135073349	0.001000	0.12720	0.123000	0.21794	0.003000	0.03518	-0.353000	0.07691	-0.219000	0.10003	-1.992000	0.00449	TAC		0.642	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
OR51A4	401666	mdanderson.org	37	11	4968155	4968155	+	Missense_Mutation	SNP	T	T	C	rs1817206		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr11:4968155T>C	ENST00000380373.2	-	1	201	c.176A>G	c.(175-177)gAg>gGg	p.E59G	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTACATGGGCTCATGCAAGGA	0.428																																						.											0													187.0	169.0	175.0					11																	4968155		2198	4298	6496	SO:0001583	missense	401666			AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.176A>G	11.37:g.4968155T>C	ENSP00000369731:p.Glu59Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000380373.2	37	CCDS31367.1	27	0.012362637362637362	18	0.036585365853658534	1	0.0027624309392265192	2	0.0034965034965034965	6	0.0079155672823219	T	18.26	3.583935	0.65992	.	.	ENSG00000205497	ENST00000380373	T	0.00360	7.86	3.56	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00271	0.0008	M	0.93150	3.385	0.26475	N	0.975206	D	0.63046	0.992	D	0.65773	0.938	T	0.35992	-0.9766	9	0.72032	D	0.01	.	6.3245	0.21237	0.2208:0.0:0.0:0.7792	.	59	Q8NGJ6	O51A4_HUMAN	G	59	ENSP00000369731:E59G	ENSP00000369731:E59G	E	-	2	0	OR51A4	4924731	0.004000	0.15560	0.912000	0.35992	0.945000	0.59286	1.544000	0.36158	1.620000	0.50308	0.462000	0.41574	GAG		0.428	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
OTUD7A	161725	mdanderson.org;bcgsc.ca	37	15	31779425	31779425	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr15:31779425G>A	ENST00000307050.4	-	10	1414	c.1322C>T	c.(1321-1323)aCg>aTg	p.T441M	OTUD7A_ENST00000382902.1_Missense_Mutation_p.T448M	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	441	Catalytic. {ECO:0000250}.				protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		CCGGATCCACGTCACGTTCAT	0.582																																						.											0													123.0	96.0	105.0					15																	31779425		2202	4300	6502	SO:0001583	missense	161725			AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.1322C>T	15.37:g.31779425G>A	ENSP00000305926:p.Thr441Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IWK5	Missense_Mutation	SNP	ENST00000307050.4	37	CCDS10026.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429639	0.83776	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.32988	1.43;1.43	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.51244	0.1663	L	0.51422	1.61	0.50467	D	0.999874	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.54200	-0.8329	10	0.62326	D	0.03	-25.3487	17.7878	0.88543	0.0:0.0:1.0:0.0	.	448;441	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	M	441;448	ENSP00000305926:T441M;ENSP00000372358:T448M	ENSP00000305926:T441M	T	-	2	0	OTUD7A	29566717	1.000000	0.71417	0.950000	0.38849	0.888000	0.51559	8.825000	0.92029	2.234000	0.73211	0.561000	0.74099	ACG		0.582	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251393.2	NM_130901	
PABPC1	26986	mdanderson.org	37	8	101724606	101724606	+	Missense_Mutation	SNP	G	G	A	rs202060459		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr8:101724606G>A	ENST00000318607.5	-	7	2084	c.956C>T	c.(955-957)aCa>aTa	p.T319I	PABPC1_ENST00000522387.1_Missense_Mutation_p.T287I|PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000519004.1_Missense_Mutation_p.T274I	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	319	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.T319I(2)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ACTAGTGATTGTACCAAATGG	0.284																																						.											2	Substitution - Missense(2)	kidney(1)|endometrium(1)											154.0	166.0	162.0					8																	101724606		2203	4298	6501	SO:0001583	missense	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.956C>T	8.37:g.101724606G>A	ENSP00000313007:p.Thr319Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.768189|4.768189	0.90020|0.90020	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000519100|ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387	.|T;T;T	.|0.16196	.|2.36;2.36;2.36	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.64402	.|D	.|0.000009	.|T	.|0.37652	.|0.1011	M|M	0.62154|0.62154	1.92|1.92	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.54964	.|0.917;0.784;0.969	.|P;B;P	.|0.56916	.|0.747;0.442;0.809	.|T	.|0.03784	.|-1.1004	.|10	.|0.87932	.|D	.|0	.|.	20.0919|20.0919	0.97823|0.97823	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|287;319;319	.|E7ERJ7;B3KT93;P11940	.|.;.;PABP1_HUMAN	X|I	188|319;319;274;287	.|ENSP00000313007:T319I;ENSP00000429594:T274I;ENSP00000429395:T287I	.|ENSP00000313007:T319I	Q|T	-|-	1|2	0|0	PABPC1|PABPC1	101793782|101793782	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.776000|9.776000	0.99001|0.99001	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CAA|ACA		0.284	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
PAK2	5062	mdanderson.org	37	3	196529926	196529926	+	Silent	SNP	C	C	A	rs77470308		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr3:196529926C>A	ENST00000327134.3	+	4	649	c.327C>A	c.(325-327)tcC>tcA	p.S109S		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	109	Autoregulatory region. {ECO:0000250}.|GTPase-binding. {ECO:0000250}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		TACAGACCTCCAATATCACCA	0.383																																						.											0													94.0	83.0	87.0					3																	196529926		2203	4300	6503	SO:0001819	synonymous_variant	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.327C>A	3.37:g.196529926C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																				0.383	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
PAK2	5062	mdanderson.org	37	3	196529978	196529978	+	Silent	SNP	C	C	T	rs79726945		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr3:196529978C>T	ENST00000327134.3	+	4	701	c.379C>T	c.(379-381)Cta>Tta	p.L127L		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	127	Autoregulatory region. {ECO:0000250}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		GCTGGATGTCCTAAAGTTCTA	0.453																																						.											0													106.0	93.0	98.0					3																	196529978		2203	4300	6503	SO:0001819	synonymous_variant	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.379C>T	3.37:g.196529978C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																				0.453	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
POTEG	404785	mdanderson.org	37	14	19553760	19553760	+	Missense_Mutation	SNP	G	G	A	rs375902660		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr14:19553760G>A	ENST00000409832.3	+	1	396	c.344G>A	c.(343-345)aGc>aAc	p.S115N		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	115										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						AGCGGCAAGAGCAAAGTGGGC	0.597																																						.											0													391.0	424.0	413.0					14																	19553760		2201	4298	6499	SO:0001583	missense	404785				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.344G>A	14.37:g.19553760G>A	ENSP00000386971:p.Ser115Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	0.049	-1.256079	0.01457	.	.	ENSG00000222036	ENST00000409832	T	0.27256	1.68	.	.	.	.	.	.	.	.	T	0.12263	0.0298	L	0.37630	1.12	0.09310	N	1	B	0.21147	0.052	B	0.21708	0.036	T	0.41805	-0.9488	7	0.02654	T	1	.	.	.	.	.	115	Q6S5H5	POTEG_HUMAN	N	115	ENSP00000386971:S115N	ENSP00000386971:S115N	S	+	2	0	POTEG	18623760	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-2.058000	0.01394	-1.485000	0.01854	-1.526000	0.00926	AGC		0.597	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356	
PRSS1	5644	mdanderson.org	37	7	142458542	142458542	+	Silent	SNP	A	A	G			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr7:142458542A>G	ENST00000311737.7	+	2	183	c.177A>G	c.(175-177)gtA>gtG	p.V59V	PRSS1_ENST00000486171.1_Silent_p.V59V	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	59	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	AGTGGGTGGTATCAGCAGGCC	0.582																																						.											0													83.0	86.0	85.0					7																	142458542		2203	4300	6503	SO:0001819	synonymous_variant	5644			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.177A>G	7.37:g.142458542A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	ENST00000311737.7	37	CCDS5872.1																																																																																				0.582	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
PRSS1	5644	mdanderson.org	37	7	142458551	142458551	+	Silent	SNP	C	C	T	rs199713773		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr7:142458551C>T	ENST00000311737.7	+	2	192	c.186C>T	c.(184-186)ggC>ggT	p.G62G	PRSS1_ENST00000486171.1_Silent_p.G62G	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	62	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TATCAGCAGGCCACTGCTACA	0.582																																						.											0																																										SO:0001819	synonymous_variant	5644			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.186C>T	7.37:g.142458551C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	ENST00000311737.7	37	CCDS5872.1																																																																																				0.582	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
SDHA	6389	mdanderson.org	37	5	236628	236628	+	Missense_Mutation	SNP	C	C	T	rs201139275	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr5:236628C>T	ENST00000264932.6	+	10	1461	c.1346C>T	c.(1345-1347)gCc>gTc	p.A449V	SDHA_ENST00000510361.1_Missense_Mutation_p.A401V|SDHA_ENST00000504309.1_Missense_Mutation_p.A449V	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	449					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GTACATGGTGCCAACCGCCTC	0.592									Familial Paragangliomas				C|||	9	0.00179712	0.003	0.0014	5008	,	,		17830	0.002		0.001	False		,,,				2504	0.001					.											0													81.0	74.0	77.0					5																	236628		2203	4300	6503	SO:0001583	missense	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1346C>T	5.37:g.236628C>T	ENSP00000264932:p.Ala449Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	21.6|21.6	4.176378|4.176378	0.78564|0.78564	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361|ENST00000515815	T;T;T|.	0.70986|.	-0.53;-0.53;-0.53|.	4.9|4.9	4.9|4.9	0.64082|0.64082	Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);|.	0.142014|.	0.46758|.	U|.	0.000265|.	D|D	0.92519|0.92519	0.7624|0.7624	H|H	0.99971|0.99971	5.125|5.125	0.80722|0.80722	D|D	1|1	D;D;P;P;D|.	0.63046|.	0.96;0.992;0.881;0.955;0.99|.	P;P;P;P;P|.	0.54924|.	0.764;0.675;0.448;0.548;0.585|.	D|D	0.96100|0.96100	0.9068|0.9068	10|5	0.87932|.	D|.	0|.	.|.	15.9089|15.9089	0.79456|0.79456	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	401;449;43;449;449|.	E9PBJ5;B4DYN5;B3KYA5;D6RFM5;P31040|.	.;.;.;.;DHSA_HUMAN|.	V|S	449;304;449;401|1	ENSP00000264932:A449V;ENSP00000426514:A449V;ENSP00000427703:A401V|.	ENSP00000264932:A449V|.	A|P	+|+	2|1	0|0	SDHA|SDHA	289628|289628	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.230000|0.230000	0.25150|0.25150	5.793000|5.793000	0.69060|0.69060	2.411000|2.411000	0.81874|0.81874	0.650000|0.650000	0.86243|0.86243	GCC|CCA		0.592	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
SERPINB5	5268	mdanderson.org	37	18	61170782	61170782	+	Missense_Mutation	SNP	A	A	G	rs1455555	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr18:61170782A>G	ENST00000382771.4	+	7	1247	c.955A>G	c.(955-957)Atc>Gtc	p.I319V		NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	319			I -> V (in dbSNP:rs1455555). {ECO:0000269|PubMed:17974005}.		cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						ATCAAATGTTATCCACAAAGT	0.458													A|||	1827	0.364816	0.1884	0.4092	5008	,	,		19831	0.4871		0.4662	False		,,,				2504	0.3415					.											0								A	VAL/ILE	1023,3383	378.5+/-322.9	133,757,1313	92.0	76.0	81.0		955	0.5	0.4	18	dbSNP_88	81	4244,4356	573.4+/-389.9	1069,2106,1125	yes	missense	SERPINB5	NM_002639.4	29	1202,2863,2438	GG,GA,AA		49.3488,23.2183,40.4967	benign	319/376	61170782	5267,7739	2203	4300	6503	SO:0001583	missense	5268			U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.955A>G	18.37:g.61170782A>G	ENSP00000372221:p.Ile319Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	ENST00000382771.4	37	CCDS32839.1	872	0.3992673992673993	82	0.16666666666666666	155	0.4281767955801105	263	0.4597902097902098	372	0.49076517150395776	A	0.603	-0.828305	0.02734	0.232183	0.493488	ENSG00000206075	ENST00000382771	D	0.83075	-1.68	5.95	0.527	0.17084	Serpin domain (3);	0.270437	0.36409	N	0.002601	T	0.00012	0.0000	N	0.20357	0.565	0.23271	P	0.99800098	B	0.02656	0.0	B	0.06405	0.002	T	0.24728	-1.0152	9	0.02654	T	1	.	9.8568	0.41090	0.723:0.0:0.277:0.0	rs1455555;rs3744947;rs52802635;rs60882957;rs1455555	319	P36952	SPB5_HUMAN	V	319	ENSP00000372221:I319V	ENSP00000372221:I319V	I	+	1	0	SERPINB5	59321762	0.957000	0.32711	0.446000	0.26920	0.819000	0.46315	1.402000	0.34600	0.088000	0.17205	-0.290000	0.09829	ATC		0.458	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280629.1	NM_002639	
SSX6	280657	mdanderson.org	37	X	47979011	47979011	+	RNA	SNP	A	A	G	rs111780663	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chrX:47979011A>G	ENST00000509958.1	+	0	160							Q7RTT6	SSX6_HUMAN	synovial sarcoma, X breakpoint 6 (pseudogene)						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			large_intestine(6)|lung(4)|skin(2)|stomach(1)	13						GGAAGATGACAAGTAACTCCA	0.493													.|||	355	0.0940397	0.1543	0.0663	3775	,	,		15863	0.0942		0.0	False		,,,				2504	0.0102					.											0								G		742,3087		74,490,104,1067,463	241.0	221.0	228.0			-0.5	0.0	X	dbSNP_132	228	17,6704		0,12,5,2416,1860	no	intergenic				74,502,109,3483,2323	GG,GA,G,AA,A		0.2529,19.3784,7.1943			47979011	759,9791	2198	4293	6491			280657			BK000686		Xp11.23	2009-09-11	2009-08-26		ENSG00000171483	ENSG00000171483			19652	pseudogene	pseudogene		300541	"""SSX family pseudogene 2"", ""synovial sarcoma, X breakpoint 6"""	SSXP2		12216073	Standard	NR_028366		Approved	psiSSX2	uc011mlv.2	Q7RTT6	OTTHUMG00000021464		X.37:g.47979011A>G		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000509958.1	37		126	0.0759493670886076	46	0.1031390134529148	17	0.049132947976878616	23	0.04212454212454213	0	0.0	.	0.003	-2.445876	0.00178	0.193784	0.002529	ENSG00000171483	ENST00000376932;ENST00000319275	T;T	0.46819	3.08;0.86	0.626	-0.47	0.12131	.	1.283650	0.06090	N	0.663453	T	0.00039	0.0001	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.04976	-1.0914	7	0.02654	T	1	.	.	.	.	.	188	Q7RTT6	SSX6_HUMAN	E	188;90	ENSP00000366131:K188E;ENSP00000325176:K90E	ENSP00000325176:K90E	K	+	1	0	SSX6	47863955	0.069000	0.21087	0.001000	0.08648	0.025000	0.11179	-0.358000	0.07641	-1.050000	0.03230	-0.765000	0.03448	AAG		0.493	SSX6-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000362117.1	NR_028366	
TLK2	11011	mdanderson.org	37	17	60637441	60637441	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:60637441G>A	ENST00000326270.9	+	10	1053	c.785G>A	c.(784-786)cGa>cAa	p.R262Q	TLK2_ENST00000542523.1_Missense_Mutation_p.R230Q|TLK2_ENST00000343388.7_Missense_Mutation_p.R230Q|TLK2_ENST00000346027.5_Missense_Mutation_p.R262Q|TLK2_ENST00000582809.1_Missense_Mutation_p.R113Q	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	262			R -> Q. {ECO:0000269|PubMed:17344846}.		cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R262Q(17)|p.R261Q(9)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TACAAGGAACGATTAAATAGA	0.358																																						.											26	Substitution - Missense(26)	endometrium(15)|kidney(9)|central_nervous_system(2)											72.0	74.0	73.0					17																	60637441		2203	4298	6501	SO:0001583	missense	11011			AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.785G>A	17.37:g.60637441G>A	ENSP00000316512:p.Arg262Gln	Somatic		WXS	Illumina HiSeq	Phase_I	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37		.	.	.	.	.	.	.	.	.	.	G	17.31	3.356600	0.61293	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.66460	-0.16;-0.21;-0.13;-0.21	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.70474	0.3228	N	0.26092	0.79	0.80722	D	1	D;B;B;B	0.89917	1.0;0.369;0.031;0.135	D;B;B;B	0.85130	0.997;0.074;0.016;0.012	T	0.64896	-0.6299	10	0.17369	T	0.5	.	16.8221	0.85835	0.0:0.0:1.0:0.0	.	262;230;262;262	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	Q	262;230;262;230	ENSP00000275780:R262Q;ENSP00000340800:R230Q;ENSP00000316512:R262Q;ENSP00000442311:R230Q	ENSP00000316512:R262Q	R	+	2	0	TLK2	57991173	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.504000	0.97986	2.516000	0.84829	0.655000	0.94253	CGA		0.358	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
TPSD1	23430	mdanderson.org	37	16	1306355	1306355	+	Missense_Mutation	SNP	T	T	C	rs1800984	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr16:1306355T>C	ENST00000211076.3	+	1	222	c.74T>C	c.(73-75)gTg>gCg	p.V25A	TPSD1_ENST00000397534.2_Missense_Mutation_p.V18A|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	25			V -> A (in dbSNP:rs1800984).	V -> G (in Ref. 1; AAD17861). {ECO:0000305}.		extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				CCGGCCTACGTGGCCCCTGGT	0.721													-|||	3599	0.71865	0.7564	0.6542	5008	,	,		14753	0.9484		0.5577	False		,,,				2504	0.6421					.											0								T	ALA/VAL	3121,1271		1094,933,169	29.0	37.0	34.0		74	-3.1	0.0	16	dbSNP_89	34	4690,3906		1125,2440,733	no	missense	TPSD1	NM_012217.2	64	2219,3373,902	CC,CT,TT		45.4397,28.939,39.8599	benign	25/243	1306355	7811,5177	2196	4298	6494	SO:0001583	missense	23430			AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.74T>C	16.37:g.1306355T>C	ENSP00000211076:p.Val25Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	SNP	ENST00000211076.3	37	CCDS10432.1	1558	0.7133699633699634	388	0.7886178861788617	208	0.574585635359116	556	0.972027972027972	406	0.5356200527704486	-	0.855	-0.737258	0.03111	0.71061	0.545603	ENSG00000095917	ENST00000397534;ENST00000211076	T;T	0.81247	-1.47;-1.47	2.55	-3.13	0.05266	.	0.813971	0.10635	N	0.651704	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35076	-0.9803	9	0.02654	T	1	.	3.4489	0.07491	0.0:0.375:0.2043:0.4206	rs1800984;rs3865206;rs4083416	25	Q9BZJ3	TRYD_HUMAN	A	18;25	ENSP00000380668:V18A;ENSP00000211076:V25A	ENSP00000211076:V25A	V	+	2	0	TPSD1	1246356	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.814000	0.01723	-0.826000	0.04284	-1.137000	0.01932	GTG		0.721	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2		
TRIOBP	11078	mdanderson.org	37	22	38120095	38120095	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr22:38120095G>A	ENST00000406386.3	+	7	1787	c.1532G>A	c.(1531-1533)aGa>aAa	p.R511K		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	511					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.R511K(2)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GACAATCCCAGAGCCTCCAGA	0.592																																						.											2	Substitution - Missense(2)	kidney(1)|skin(1)											16.0	27.0	24.0					22																	38120095		1746	3975	5721	SO:0001583	missense	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1532G>A	22.37:g.38120095G>A	ENSP00000384312:p.Arg511Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	-	12.91	2.079188	0.36662	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.20200	2.09	0.725	0.725	0.18242	.	.	.	.	.	T	0.14442	0.0349	L	0.44542	1.39	0.80722	D	1	.	.	.	.	.	.	T	0.10894	-1.0610	7	0.05620	T	0.96	.	4.9132	0.13833	0.0:0.0:1.0:0.0	.	511	Q9H2D6	TARA_HUMAN	K	511	ENSP00000384312:R511K	ENSP00000384312:R511K	R	+	2	0	TRIOBP	36450041	0.001000	0.12720	0.176000	0.23000	0.248000	0.25809	0.139000	0.16036	0.721000	0.32231	0.289000	0.19496	AGA		0.592	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
VPS53	55275	mdanderson.org	37	17	465775	465775	+	Silent	SNP	G	G	A	rs2075443	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr17:465775G>A	ENST00000571805.1	-	14	1660	c.1524C>T	c.(1522-1524)taC>taT	p.Y508Y	VPS53_ENST00000291074.5_Silent_p.Y479Y|VPS53_ENST00000437048.2_Silent_p.Y508Y|VPS53_ENST00000401468.3_Silent_p.Y231Y|VPS53_ENST00000446250.2_Silent_p.Y310Y|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000576149.1_5'UTR			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	508					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		TTTTCCAGGCGTATTCTCGGA	0.483													g|||	1746	0.348642	0.6021	0.4207	5008	,	,		19160	0.2163		0.2247	False		,,,				2504	0.2188					.											0								A	,	2369,2037	611.2+/-391.7	669,1031,503	83.0	79.0	81.0		1524,1437	-12.1	0.3	17	dbSNP_96	81	1978,6622	347.3+/-326.5	239,1500,2561	no	coding-synonymous,coding-synonymous	VPS53	NM_001128159.2,NM_018289.3	,	908,2531,3064	AA,AG,GG		23.0,46.2324,33.423	,	508/833,479/671	465775	4347,8659	2203	4300	6503	SO:0001819	synonymous_variant	55275				CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.1524C>T	17.37:g.465775G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Silent	SNP	ENST00000571805.1	37																																																																																					0.483	VPS53-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000436940.2	NM_018289	
ZNF676	163223	mdanderson.org	37	19	22363737	22363737	+	Missense_Mutation	SNP	C	C	G	rs572031376	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:22363737C>G	ENST00000397121.2	-	3	1099	c.782G>C	c.(781-783)gGa>gCa	p.G261A		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GCTACTAAATCCTTTGCCACA	0.393													G|||	17	0.00339457	0.0015	0.0029	5008	,	,		24868	0.0089		0.003	False		,,,				2504	0.001					.											0													89.0	96.0	93.0					19																	22363737		2158	4274	6432	SO:0001583	missense	163223			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.782G>C	19.37:g.22363737C>G	ENSP00000380310:p.Gly261Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.455683	0.00012	.	.	ENSG00000196109	ENST00000397121	T	0.35236	1.32	0.81	-1.62	0.08372	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09247	0.0228	N	0.00788	-1.185	0.09310	N	1	B	0.11235	0.004	B	0.14023	0.01	T	0.28996	-1.0026	9	0.02654	T	1	.	8.4431	0.32826	0.0:0.685:0.315:0.0	.	261	Q8N7Q3	ZN676_HUMAN	A	261	ENSP00000380310:G261A	ENSP00000380310:G261A	G	-	2	0	ZNF676	22155577	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.024000	0.12435	-1.409000	0.02038	-1.398000	0.01145	GGA		0.393	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
ZNF285	26974	mdanderson.org	37	19	44890685	44890685	+	Silent	SNP	T	T	G	rs73039936	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:44890685T>G	ENST00000330997.4	-	4	1786	c.1722A>C	c.(1720-1722)ggA>ggC	p.G574G	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Silent_p.G574G|ZNF285_ENST00000591679.1_Silent_p.G581G	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	574					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GAAGGTCCTTTCCACGCTCAC	0.418													T|||	491	0.0980431	0.0446	0.0821	5008	,	,		24509	0.1696		0.0646	False		,,,				2504	0.1421					.											0													161.0	129.0	140.0					19																	44890685		2203	4300	6503	SO:0001819	synonymous_variant	26974			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1722A>C	19.37:g.44890685T>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	ENST00000330997.4	37	CCDS12638.1																																																																																				0.418	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
IQGAP1	8826	bcgsc.ca	37	15	91030266	91030278	+	Frame_Shift_Del	DEL	GTTCGACGTGCCT	GTTCGACGTGCCT	-	rs368968167|rs528193427|rs181919733|rs201241538		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	GTTCGACGTGCCT	GTTCGACGTGCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr15:91030266_91030278delGTTCGACGTGCCT	ENST00000268182.5	+	32	4229_4241	c.4105_4117delGTTCGACGTGCCT	c.(4105-4119)gttcgacgtgcctgafs	p.VRRA*1369fs	IQGAP1_ENST00000560738.1_Frame_Shift_Del_p.VRRA*797fs	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1369	C2.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)	p.D1370D(1)		breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			GACCAACAAGTTCGACGTGCCTGGAGATGAGAA	0.451																																						.											1	Substitution - coding silent(1)	endometrium(1)																																								SO:0001589	frameshift_variant	8826			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.4105_4117delGTTCGACGTGCCT	15.37:g.91030266_91030278delGTTCGACGTGCCT	ENSP00000268182:p.Val1369fs	Somatic		WXS	Illumina HiSeq	Phase_I	A7MBM3	Frame_Shift_Del	DEL	ENST00000268182.5	37	CCDS10362.1																																																																																				0.451	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
ZNF814	730051	bcgsc.ca	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	G	A	rs145250945		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:58385748G>A	ENST00000435989.2	-	3	1244	c.1010C>T	c.(1009-1011)gCt>gTt	p.A337V	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A337V(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACTGAAGCTAGCATATTTGCT	0.353																																						.											2	Substitution - Missense(2)	prostate(2)											58.0	51.0	53.0					19																	58385748		692	1591	2283	SO:0001583	missense	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1010C>T	19.37:g.58385748G>A	ENSP00000410545:p.Ala337Val	Somatic		WXS	Illumina HiSeq	Phase_I	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	3.777	-0.046344	0.07407	.	.	ENSG00000204514	ENST00000435989	T	0.15372	2.43	2.11	-4.21	0.03812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07728	0.0194	N	0.21142	0.635	0.09310	N	1	B	0.32781	0.384	B	0.18561	0.022	T	0.05649	-1.0872	9	0.66056	D	0.02	.	3.5015	0.07674	0.0936:0.1206:0.3016:0.4843	.	337	B7Z6K7	ZN814_HUMAN	V	337	ENSP00000410545:A337V	ENSP00000410545:A337V	A	-	2	0	ZNF814	63077560	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.230000	0.01207	-3.525000	0.00147	-3.867000	0.00017	GCT		0.353	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
LARP1	23367	bcgsc.ca	37	5	154173805	154173820	+	Frame_Shift_Del	DEL	ACTACATCAAGCGCCA	ACTACATCAAGCGCCA	-	rs144538564		TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	ACTACATCAAGCGCCA	ACTACATCAAGCGCCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr5:154173805_154173820delACTACATCAAGCGCCA	ENST00000336314.4	+	7	1008_1023	c.984_999delACTACATCAAGCGCCA	c.(982-999)gaactacatcaagcgccafs	p.ELHQAP328fs		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	405					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGCTCAAAGACTACATCAAGCGCCAGATGTGAGTGT	0.519																																						.											0																																										SO:0001589	frameshift_variant	23367			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.984_999delACTACATCAAGCGCCA	5.37:g.154173805_154173820delACTACATCAAGCGCCA	ENSP00000336721:p.Glu328fs	Somatic		WXS	Illumina HiSeq	Phase_I	O94836|Q8N4M2|Q8NB73|Q9UFD7	Frame_Shift_Del	DEL	ENST00000336314.4	37	CCDS4328.1																																																																																				0.519	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	
HLA-B	3106	bcgsc.ca	37	6	31324931	31324931	+	Missense_Mutation	SNP	A	A	C	rs151341074|rs9266206	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr6:31324931A>C	ENST00000412585.2	-	1	33	c.5T>G	c.(4-6)cTg>cGg	p.L2R		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	2					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CGCCATGACCAGCATCTCGGC	0.647									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				.|||	3976	0.79393	0.7958	0.732	5008	,	,		9657	0.8462		0.7197	False		,,,				2504	0.8579					.											0													14.0	12.0	13.0					6																	31324931		2093	4077	6170	SO:0001583	missense	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.5T>G	6.37:g.31324931A>C	ENSP00000399168:p.Leu2Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	1641	0.7513736263736264	370	0.7520325203252033	254	0.7016574585635359	484	0.8461538461538461	533	0.7031662269129287	N	5.499	0.276991	0.10403	.	.	ENSG00000234745	ENST00000412585	T	0.00612	6.22	3.34	-2.25	0.06888	.	.	.	.	.	T	0.00109	0.0003	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.14727	-1.0462	7	0.16896	T	0.51	.	3.3191	0.07044	0.4438:0.2616:0.0:0.2946	rs9266206	2	P01889	1B07_HUMAN	R	2	ENSP00000399168:L2R	ENSP00000399168:L2R	L	-	2	0	HLA-B	31432910	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.210000	0.02999	-1.187000	0.02709	-1.627000	0.00785	CTG		0.647	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
MT-ND1	4535	bcgsc.ca	37	M	3814	3814	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chrM:3814G>A	ENST00000361390.2	+	1	508	c.508G>A	c.(508-510)Gaa>Aaa	p.E170K	MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND2_ENST00000361453.3_5'Flank			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	170					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCACAACACAAGAACACCTCT	0.448																																						.											0																																										SO:0001583	missense	10625					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.508G>A	M.37:g.3814G>A	ENSP00000354687:p.Glu170Lys	Somatic		WXS	Illumina HiSeq	Phase_I	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	37																																																																																					0.448	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MT-ND4	4538	bcgsc.ca	37	M	11004	11004	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chrM:11004G>A	ENST00000361381.2	+	1	245	c.245G>A	c.(244-246)cGc>cAc	p.R82H	MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	82					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						GGCAAGCCAACGCCACTTATC	0.453																																						.											0																																										SO:0001583	missense	0					mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.245G>A	M.37:g.11004G>A	ENSP00000354961:p.Arg82His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	37																																																																																					0.453	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
ZNF225	7768	bcgsc.ca	37	19	44635142	44635143	+	Frame_Shift_Ins	INS	-	-	CAAA	rs184915163	byFrequency	TCGA-KL-8329-01A-11D-2310-10	TCGA-KL-8329-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9453974-c7a0-4ace-8a46-2047f3328711	fe78c18d-8b68-4d67-bdae-07e288693c0f	g.chr19:44635142_44635143insCAAA	ENST00000262894.6	+	5	655_656	c.375_376insCAAA	c.(376-378)aaafs	p.-125fs	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Frame_Shift_Ins_p.-125fs	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				TTCAGTTCTCCAAACAAGATGA	0.421																																						.											0																																										SO:0001589	frameshift_variant	7768			AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		Exception_encountered	19.37:g.44635142_44635143insCAAA	ENSP00000262894:p.Ser125fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8S2|Q53F12|Q9NS46|Q9UID8	Frame_Shift_Ins	INS	ENST00000262894.6	37	CCDS46100.1																																																																																				0.421	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
